Experimental Waterflow Determination of the Dynamic Hydraulic Transfer Function for the J-2X Oxidizer Turbopump. Part Two; Results and Interpretation

NASA Technical Reports Server (NTRS)

Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave

2011-01-01

Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

A review of the matrix-exponential formalism in radiative transfer

NASA Astrophysics Data System (ADS)

Efremenko, Dmitry S.; Molina García, Víctor; Gimeno García, Sebastián; Doicu, Adrian

2017-07-01

This paper outlines the matrix exponential description of radiative transfer. The eigendecomposition method which serves as a basis for computing the matrix exponential and for representing the solution in a discrete ordinate setting is considered. The mathematical equivalence of the discrete ordinate method, the matrix operator method, and the matrix Riccati equations method is proved rigorously by means of the matrix exponential formalism. For optically thin layers, approximate solution methods relying on the Padé and Taylor series approximations to the matrix exponential, as well as on the matrix Riccati equations, are presented. For optically thick layers, the asymptotic theory with higher-order corrections is derived, and parameterizations of the asymptotic functions and constants for a water-cloud model with a Gamma size distribution are obtained.

Diagonalization of transfer matrix of supersymmetry U{sub q}(sl-caret(M+1|N+1)) chain with a boundary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kojima, Takeo

2013-04-15

We study the supersymmetry U{sub q}(sl-caret(M+1|N+1)) analogue of the supersymmetric t-J model with a boundary. Our approach is based on the algebraic analysis method of solvable lattice models. We diagonalize the commuting transfer matrix by using the bosonizations of the vertex operators associated with the quantum affine supersymmetry U{sub q}(sl-caret(M+1|N+1)).

Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

2001-04-01

Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

Experimental estimation of migration and transfer of organic substances from consumer articles to cotton wipes: Evaluation of underlying mechanisms.

PubMed

Clausen, Per Axel; Spaan, Suzanne; Brouwer, Derk H; Marquart, Hans; le Feber, Maaike; Engel, Roel; Geerts, Lieve; Jensen, Keld Alstrup; Kofoed-Sørensen, Vivi; Hansen, Brian; De Brouwere, Katleen

2016-01-01

The aim of this work was to identify the key mechanisms governing transport of organic chemical substances from consumer articles to cotton wipes. The results were used to establish a mechanistic model to improve assessment of dermal contact exposure. Four types of PVC flooring, 10 types of textiles and one type of inkjet printed paper were used to establish the mechanisms and model. Kinetic extraction studies in methanol demonstrated existence of matrix diffusion and indicated the presence of a substance surface layer on some articles. Consequently, the proposed substance transfer model considers mechanical transport from a surface film and matrix diffusion in an article with a known initial total substance concentration. The estimated chemical substance transfer values to cotton wipes were comparable to the literature data (relative transfer ∼ 2%), whereas relative transfer efficiencies from spiked substrates were high (∼ 50%). For consumer articles, high correlation (r(2)=0.92) was observed between predicted and measured transfer efficiencies, but concentrations were overpredicted by a factor of 10. Adjusting the relative transfer from about 50% used in the model to about 2.5% removed overprediction. Further studies are required to confirm the model for generic use.

Frequency domain system identification methods - Matrix fraction description approach

NASA Technical Reports Server (NTRS)

Horta, Luca G.; Juang, Jer-Nan

1993-01-01

This paper presents the use of matrix fraction descriptions for least-squares curve fitting of the frequency spectra to compute two matrix polynomials. The matrix polynomials are intermediate step to obtain a linearized representation of the experimental transfer function. Two approaches are presented: first, the matrix polynomials are identified using an estimated transfer function; second, the matrix polynomials are identified directly from the cross/auto spectra of the input and output signals. A set of Markov parameters are computed from the polynomials and subsequently realization theory is used to recover a minimum order state space model. Unevenly spaced frequency response functions may be used. Results from a simple numerical example and an experiment are discussed to highlight some of the important aspect of the algorithm.

Fast mean and variance computation of the diffuse sound transmission through finite-sized thick and layered wall and floor systems

NASA Astrophysics Data System (ADS)

Decraene, Carolina; Dijckmans, Arne; Reynders, Edwin P. B.

2018-05-01

A method is developed for computing the mean and variance of the diffuse field sound transmission loss of finite-sized layered wall and floor systems that consist of solid, fluid and/or poroelastic layers. This is achieved by coupling a transfer matrix model of the wall or floor to statistical energy analysis subsystem models of the adjacent room volumes. The modal behavior of the wall is approximately accounted for by projecting the wall displacement onto a set of sinusoidal lateral basis functions. This hybrid modal transfer matrix-statistical energy analysis method is validated on multiple wall systems: a thin steel plate, a polymethyl methacrylate panel, a thick brick wall, a sandwich panel, a double-leaf wall with poro-elastic material in the cavity, and a double glazing. The predictions are compared with experimental data and with results obtained using alternative prediction methods such as the transfer matrix method with spatial windowing, the hybrid wave based-transfer matrix method, and the hybrid finite element-statistical energy analysis method. These comparisons confirm the prediction accuracy of the proposed method and the computational efficiency against the conventional hybrid finite element-statistical energy analysis method.

On the formulation of a minimal uncertainty model for robust control with structured uncertainty

NASA Technical Reports Server (NTRS)

Belcastro, Christine M.; Chang, B.-C.; Fischl, Robert

1991-01-01

In the design and analysis of robust control systems for uncertain plants, representing the system transfer matrix in the form of what has come to be termed an M-delta model has become widely accepted and applied in the robust control literature. The M represents a transfer function matrix M(s) of the nominal closed loop system, and the delta represents an uncertainty matrix acting on M(s). The nominal closed loop system M(s) results from closing the feedback control system, K(s), around a nominal plant interconnection structure P(s). The uncertainty can arise from various sources, such as structured uncertainty from parameter variations or multiple unsaturated uncertainties from unmodeled dynamics and other neglected phenomena. In general, delta is a block diagonal matrix, but for real parameter variations delta is a diagonal matrix of real elements. Conceptually, the M-delta structure can always be formed for any linear interconnection of inputs, outputs, transfer functions, parameter variations, and perturbations. However, very little of the currently available literature addresses computational methods for obtaining this structure, and none of this literature addresses a general methodology for obtaining a minimal M-delta model for a wide class of uncertainty, where the term minimal refers to the dimension of the delta matrix. Since having a minimally dimensioned delta matrix would improve the efficiency of structured singular value (or multivariable stability margin) computations, a method of obtaining a minimal M-delta would be useful. Hence, a method of obtaining the interconnection system P(s) is required. A generalized procedure for obtaining a minimal P-delta structure for systems with real parameter variations is presented. Using this model, the minimal M-delta model can then be easily obtained by closing the feedback loop. The procedure involves representing the system in a cascade-form state-space realization, determining the minimal uncertainty matrix, delta, and constructing the state-space representation of P(s). Three examples are presented to illustrate the procedure.

Deformed quantum double realization of the toric code and beyond

NASA Astrophysics Data System (ADS)

Padmanabhan, Pramod; Ibieta-Jimenez, Juan Pablo; Bernabe Ferreira, Miguel Jorge; Teotonio-Sobrinho, Paulo

2016-09-01

Quantum double models, such as the toric code, can be constructed from transfer matrices of lattice gauge theories with discrete gauge groups and parametrized by the center of the gauge group algebra and its dual. For general choices of these parameters the transfer matrix contains operators acting on links which can also be thought of as perturbations to the quantum double model driving it out of its topological phase and destroying the exact solvability of the quantum double model. We modify these transfer matrices with perturbations and extract exactly solvable models which remain in a quantum phase, thus nullifying the effect of the perturbation. The algebra of the modified vertex and plaquette operators now obey a deformed version of the quantum double algebra. The Abelian cases are shown to be in the quantum double phase whereas the non-Abelian phases are shown to be in a modified phase of the corresponding quantum double phase. These are illustrated with the groups Zn and S3. The quantum phases are determined by studying the excitations of these systems namely their fusion rules and the statistics. We then go further to construct a transfer matrix which contains the other Z2 phase namely the double semion phase. More generally for other discrete groups these transfer matrices contain the twisted quantum double models. These transfer matrices can be thought of as being obtained by introducing extra parameters into the transfer matrix of lattice gauge theories. These parameters are central elements belonging to the tensor products of the algebra and its dual and are associated to vertices and volumes of the three dimensional lattice. As in the case of the lattice gauge theories we construct the operators creating the excitations in this case and study their braiding and fusion properties.

The analytical transfer matrix method for PT-symmetric complex potential

NASA Astrophysics Data System (ADS)

Naceri, Leila; Hammou, Amine B.

2017-07-01

We have extended the analytical transfer matrix (ATM) method to solve quantum mechanical bound state problems with complex PT-symmetric potentials. Our work focuses on a class of models studied by Bender and Jones, we calculate the energy eigenvalues, discuss the critical values of g and compare the results with those obtained from other methods such as exact numerical computation and WKB approximation method.

Heat Transfer and Fluid Transport of Supercritical CO 2 in Enhanced Geothermal System with Local Thermal Non-equilibrium Model

DOE PAGES

Zhang, Le; Luo, Feng; Xu, Ruina; ...

2014-12-31

The heat transfer and fluid transport of supercritical CO 2 in enhanced geothermal system (EGS) is studied numerically with local thermal non-equilibrium model, which accounts for the temperature difference between solid matrix and fluid components in porous media and uses two energy equations to describe heat transfer in the solid matrix and in the fluid, respectively. As compared with the previous results of our research group, the effect of local thermal non-equilibrium mainly depends on the volumetric heat transfer coefficient ah, which has a significant effect on the production temperature at reservoir outlet and thermal breakthrough time. The uniformity ofmore » volumetric heat transfer coefficient ah has little influence on the thermal breakthrough time, but the temperature difference become more obvious with time after thermal breakthrough with this simulation model. The thermal breakthrough time reduces and the effect of local thermal non-equilibrium becomes significant with decreasing ah.« less

Theoretical models for supercritical fluid extraction.

PubMed

Huang, Zhen; Shi, Xiao-Han; Jiang, Wei-Juan

2012-08-10

For the proper design of supercritical fluid extraction processes, it is essential to have a sound knowledge of the mass transfer mechanism of the extraction process and the appropriate mathematical representation. In this paper, the advances and applications of kinetic models for describing supercritical fluid extraction from various solid matrices have been presented. The theoretical models overviewed here include the hot ball diffusion, broken and intact cell, shrinking core and some relatively simple models. Mathematical representations of these models have been in detail interpreted as well as their assumptions, parameter identifications and application examples. Extraction process of the analyte solute from the solid matrix by means of supercritical fluid includes the dissolution of the analyte from the solid, the analyte diffusion in the matrix and its transport to the bulk supercritical fluid. Mechanisms involved in a mass transfer model are discussed in terms of external mass transfer resistance, internal mass transfer resistance, solute-solid interactions and axial dispersion. The correlations of the external mass transfer coefficient and axial dispersion coefficient with certain dimensionless numbers are also discussed. Among these models, the broken and intact cell model seems to be the most relevant mathematical model as it is able to provide realistic description of the plant material structure for better understanding the mass-transfer kinetics and thus it has been widely employed for modeling supercritical fluid extraction of natural matters. Copyright © 2012 Elsevier B.V. All rights reserved.

Transfer matrix method for dynamics modeling and independent modal space vibration control design of linear hybrid multibody system

NASA Astrophysics Data System (ADS)

Rong, Bao; Rui, Xiaoting; Lu, Kun; Tao, Ling; Wang, Guoping; Ni, Xiaojun

2018-05-01

In this paper, an efficient method of dynamics modeling and vibration control design of a linear hybrid multibody system (MS) is studied based on the transfer matrix method. The natural vibration characteristics of a linear hybrid MS are solved by using low-order transfer equations. Then, by constructing the brand-new body dynamics equation, augmented operator and augmented eigenvector, the orthogonality of augmented eigenvector of a linear hybrid MS is satisfied, and its state space model expressed in each independent model space is obtained easily. According to this dynamics model, a robust independent modal space-fuzzy controller is designed for vibration control of a general MS, and the genetic optimization of some critical control parameters of fuzzy tuners is also presented. Two illustrative examples are performed, which results show that this method is computationally efficient and with perfect control performance.

Effects of multiple scattering and surface albedo on the photochemistry of the troposphere

NASA Technical Reports Server (NTRS)

Augustsson, T. R.; Tiwari, S. N.

1981-01-01

The effect of treatment of incoming solar radiation on the photochemistry of the troposphere is discussed. A one dimensional photochemical model of the troposphere containing the species of the nitrogen, oxygen, carbon, hydrogen, and sulfur families was developed. The vertical flux is simulated by use of the parameterized eddy diffusion coefficients. The photochemical model is coupled to a radiative transfer model that calculates the radiation field due to the incoming solar radiation which initiates much of the photochemistry of the troposphere. Vertical profiles of tropospheric species were compared with the Leighton approximation, radiative transfer, matrix inversion model. The radiative transfer code includes the effects of multiple scattering due to molecules and aerosols, pure absorption, and surface albedo on the transfer of incoming solar radiation. It is indicated that significant differences exist for several key photolysis frequencies and species number density profiles between the Leighton approximation and the profiles generated with, radiative transfer, matrix inversion technique. Most species show enhanced vertical profiles when the more realistic treatment of the incoming solar radiation field is included

Centralized PI control for high dimensional multivariable systems based on equivalent transfer function.

PubMed

Luan, Xiaoli; Chen, Qiang; Liu, Fei

2014-09-01

This article presents a new scheme to design full matrix controller for high dimensional multivariable processes based on equivalent transfer function (ETF). Differing from existing ETF method, the proposed ETF is derived directly by exploiting the relationship between the equivalent closed-loop transfer function and the inverse of open-loop transfer function. Based on the obtained ETF, the full matrix controller is designed utilizing the existing PI tuning rules. The new proposed ETF model can more accurately represent the original processes. Furthermore, the full matrix centralized controller design method proposed in this paper is applicable to high dimensional multivariable systems with satisfactory performance. Comparison with other multivariable controllers shows that the designed ETF based controller is superior with respect to design-complexity and obtained performance. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Assessment of CO2 Storage Potential in Naturally Fractured Reservoirs With Dual-Porosity Models

NASA Astrophysics Data System (ADS)

March, Rafael; Doster, Florian; Geiger, Sebastian

2018-03-01

Naturally Fractured Reservoirs (NFR's) have received little attention as potential CO2 storage sites. Two main facts deter from storage projects in fractured reservoirs: (1) CO2 tends to be nonwetting in target formations and capillary forces will keep CO2 in the fractures, which typically have low pore volume; and (2) the high conductivity of the fractures may lead to increased spatial spreading of the CO2 plume. Numerical simulations are a powerful tool to understand the physics behind brine-CO2 flow in NFR's. Dual-porosity models are typically used to simulate multiphase flow in fractured formations. However, existing dual-porosity models are based on crude approximations of the matrix-fracture fluid transfer processes and often fail to capture the dynamics of fluid exchange accurately. Therefore, more accurate transfer functions are needed in order to evaluate the CO2 transfer to the matrix. This work presents an assessment of CO2 storage potential in NFR's using dual-porosity models. We investigate the impact of a system of fractures on storage in a saline aquifer, by analyzing the time scales of brine drainage by CO2 in the matrix blocks and the maximum CO2 that can be stored in the rock matrix. A new model to estimate drainage time scales is developed and used in a transfer function for dual-porosity simulations. We then analyze how injection rates should be limited in order to avoid early spill of CO2 (lost control of the plume) on a conceptual anticline model. Numerical simulations on the anticline show that naturally fractured reservoirs may be used to store CO2.

An improved ray theory and transfer matrix method-based model for lightning electromagnetic pulses propagating in Earth-ionosphere waveguide and its applications

NASA Astrophysics Data System (ADS)

Qin, Zilong; Chen, Mingli; Zhu, Baoyou; Du, Ya-ping

2017-01-01

An improved ray theory and transfer matrix method-based model for a lightning electromagnetic pulse (LEMP) propagating in Earth-ionosphere waveguide (EIWG) is proposed and tested. The model involves the presentation of a lightning source, parameterization of the lower ionosphere, derivation of a transfer function representing all effects of EIWG on LEMP sky wave, and determination of attenuation mode of the LEMP ground wave. The lightning source is simplified as an electric point dipole standing on Earth surface with finite conductance. The transfer function for the sky wave is derived based on ray theory and transfer matrix method. The attenuation mode for the ground wave is solved from Fock's diffraction equations. The model is then applied to several lightning sferics observed in central China during day and night times within 1000 km. The results show that the model can precisely predict the time domain sky wave for all these observed lightning sferics. Both simulations and observations show that the lightning sferics in nighttime has a more complicated waveform than in daytime. Particularly, when a LEMP propagates from east to west (Φ = 270°) and in nighttime, its sky wave tends to be a double-peak waveform (dispersed sky wave) rather than a single peak one. Such a dispersed sky wave in nighttime may be attributed to the magneto-ionic splitting phenomenon in the lower ionosphere. The model provides us an efficient way for retrieving the electron density profile of the lower ionosphere and hence to monitor its spatial and temporal variations via lightning sferics.

A Two-Time Scale Decentralized Model Predictive Controller Based on Input and Output Model

PubMed Central

Niu, Jian; Zhao, Jun; Xu, Zuhua; Qian, Jixin

2009-01-01

A decentralized model predictive controller applicable for some systems which exhibit different dynamic characteristics in different channels was presented in this paper. These systems can be regarded as combinations of a fast model and a slow model, the response speeds of which are in two-time scale. Because most practical models used for control are obtained in the form of transfer function matrix by plant tests, a singular perturbation method was firstly used to separate the original transfer function matrix into two models in two-time scale. Then a decentralized model predictive controller was designed based on the two models derived from the original system. And the stability of the control method was proved. Simulations showed that the method was effective. PMID:19834542

Modeling of trim panels in the energy finite element analysis

NASA Astrophysics Data System (ADS)

Moravaeji, Seyed-Javid

Modeling a trim panel is divided into finding the power exchange through two different paths: (i) the connection of the outer and inner panels (ii) through the layers directly. The vibrational power exchanged through the mounts is modeled as the connection of two parallel plates connected via a beam. Wave matrices representing plates and beams are derived separately; then a matrix method is proposed to solve for the wave amplitudes and hence the vibrational power exchange between the plates accordingly. A closed form formula for the case of connection of two identical plates is derived. For the power transmission loss directly through the layers, first transfer matrices representing layers made of different materials is considered. New matrices for a porous layer are derived. A method of finding the layered structure transfer matrix is proposed. It is concluded that in general a single isotropic layer cannot replace a structure accurately. Finally, on the basis of an equivalent transfer matrix, an optimization process for is proposed to replace the panel by a suitable set of layers.

Parallel family trees for transfer matrices in the Potts model

NASA Astrophysics Data System (ADS)

Navarro, Cristobal A.; Canfora, Fabrizio; Hitschfeld, Nancy; Navarro, Gonzalo

2015-02-01

The computational cost of transfer matrix methods for the Potts model is related to the question in how many ways can two layers of a lattice be connected? Answering the question leads to the generation of a combinatorial set of lattice configurations. This set defines the configuration space of the problem, and the smaller it is, the faster the transfer matrix can be computed. The configuration space of generic (q , v) transfer matrix methods for strips is in the order of the Catalan numbers, which grows asymptotically as O(4m) where m is the width of the strip. Other transfer matrix methods with a smaller configuration space indeed exist but they make assumptions on the temperature, number of spin states, or restrict the structure of the lattice. In this paper we propose a parallel algorithm that uses a sub-Catalan configuration space of O(3m) to build the generic (q , v) transfer matrix in a compressed form. The improvement is achieved by grouping the original set of Catalan configurations into a forest of family trees, in such a way that the solution to the problem is now computed by solving the root node of each family. As a result, the algorithm becomes exponentially faster than the Catalan approach while still highly parallel. The resulting matrix is stored in a compressed form using O(3m ×4m) of space, making numerical evaluation and decompression to be faster than evaluating the matrix in its O(4m ×4m) uncompressed form. Experimental results for different sizes of strip lattices show that the parallel family trees (PFT) strategy indeed runs exponentially faster than the Catalan Parallel Method (CPM), especially when dealing with dense transfer matrices. In terms of parallel performance, we report strong-scaling speedups of up to 5.7 × when running on an 8-core shared memory machine and 28 × for a 32-core cluster. The best balance of speedup and efficiency for the multi-core machine was achieved when using p = 4 processors, while for the cluster scenario it was in the range p ∈ [ 8 , 10 ] . Because of the parallel capabilities of the algorithm, a large-scale execution of the parallel family trees strategy in a supercomputer could contribute to the study of wider strip lattices.

Multi-spectrometer calibration transfer based on independent component analysis.

PubMed

Liu, Yan; Xu, Hao; Xia, Zhenzhen; Gong, Zhiyong

2018-02-26

Calibration transfer is indispensable for practical applications of near infrared (NIR) spectroscopy due to the need for precise and consistent measurements across different spectrometers. In this work, a method for multi-spectrometer calibration transfer is described based on independent component analysis (ICA). A spectral matrix is first obtained by aligning the spectra measured on different spectrometers. Then, by using independent component analysis, the aligned spectral matrix is decomposed into the mixing matrix and the independent components of different spectrometers. These differing measurements between spectrometers can then be standardized by correcting the coefficients within the independent components. Two NIR datasets of corn and edible oil samples measured with three and four spectrometers, respectively, were used to test the reliability of this method. The results of both datasets reveal that spectra measurements across different spectrometers can be transferred simultaneously and that the partial least squares (PLS) models built with the measurements on one spectrometer can predict that the spectra can be transferred correctly on another.

A hybrid finite element-transfer matrix model for vibroacoustic systems with flat and homogeneous acoustic treatments.

PubMed

Alimonti, Luca; Atalla, Noureddine; Berry, Alain; Sgard, Franck

2015-02-01

Practical vibroacoustic systems involve passive acoustic treatments consisting of highly dissipative media such as poroelastic materials. The numerical modeling of such systems at low to mid frequencies typically relies on substructuring methodologies based on finite element models. Namely, the master subsystems (i.e., structural and acoustic domains) are described by a finite set of uncoupled modes, whereas condensation procedures are typically preferred for the acoustic treatments. However, although accurate, such methodology is computationally expensive when real life applications are considered. A potential reduction of the computational burden could be obtained by approximating the effect of the acoustic treatment on the master subsystems without introducing physical degrees of freedom. To do that, the treatment has to be assumed homogeneous, flat, and of infinite lateral extent. Under these hypotheses, simple analytical tools like the transfer matrix method can be employed. In this paper, a hybrid finite element-transfer matrix methodology is proposed. The impact of the limiting assumptions inherent within the analytical framework are assessed for the case of plate-cavity systems involving flat and homogeneous acoustic treatments. The results prove that the hybrid model can capture the qualitative behavior of the vibroacoustic system while reducing the computational effort.

Linearized radiative transfer models for retrieval of cloud parameters from EPIC/DSCOVR measurements

NASA Astrophysics Data System (ADS)

Molina García, Víctor; Sasi, Sruthy; Efremenko, Dmitry S.; Doicu, Adrian; Loyola, Diego

2018-07-01

In this paper, we describe several linearized radiative transfer models which can be used for the retrieval of cloud parameters from EPIC (Earth Polychromatic Imaging Camera) measurements. The approaches under examination are (1) the linearized forward approach, represented in this paper by the linearized discrete ordinate and matrix operator methods with matrix exponential, and (2) the forward-adjoint approach based on the discrete ordinate method with matrix exponential. To enhance the performance of the radiative transfer computations, the correlated k-distribution method and the Principal Component Analysis (PCA) technique are used. We provide a compact description of the proposed methods, as well as a numerical analysis of their accuracy and efficiency when simulating EPIC measurements in the oxygen A-band channel at 764 nm. We found that the computation time of the forward-adjoint approach using the correlated k-distribution method in conjunction with PCA is approximately 13 s for simultaneously computing the derivatives with respect to cloud optical thickness and cloud top height.

First-order transitions and thermodynamic properties in the 2D Blume-Capel model: the transfer-matrix method revisited

NASA Astrophysics Data System (ADS)

Jung, Moonjung; Kim, Dong-Hee

2017-12-01

We investigate the first-order transition in the spin-1 two-dimensional Blume-Capel model in square lattices by revisiting the transfer-matrix method. With large strip widths increased up to the size of 18 sites, we construct the detailed phase coexistence curve which shows excellent quantitative agreement with the recent advanced Monte Carlo results. In the deep first-order area, we observe the exponential system-size scaling of the spectral gap of the transfer matrix from which linearly increasing interfacial tension is deduced with decreasing temperature. We find that the first-order signature at low temperatures is strongly pronounced with much suppressed finite-size influence in the examined thermodynamic properties of entropy, non-zero spin population, and specific heat. It turns out that the jump at the transition becomes increasingly sharp as it goes deep into the first-order area, which is in contrast to the Wang-Landau results where finite-size smoothing gets more severe at lower temperatures.

Heat transfer and flow friction correlations for perforated plate matrix heat exchangers

NASA Astrophysics Data System (ADS)

Ratna Raju, L.; Kumar, S. Sunil; Chowdhury, K.; Nandi, T. K.

2017-02-01

Perforated plate matrix heat exchangers (MHE) are constructed of high conductivity perforated plates stacked alternately with low conductivity spacers. They are being increasingly used in many cryogenic applications including Claude cycle or Reversed Brayton cycle cryo-refrigerators and liquefiers. Design of high NTU (number of (heat) transfer unit) cryogenic MHEs requires accurate heat transfer coefficient and flow friction factor. Thermo-hydraulic behaviour of perforated plates strongly depends on the geometrical parameters. Existing correlations, however, are mostly expressed as functions of Reynolds number only. This causes, for a given configuration, significant variations in coefficients from one correlation to the other. In this paper we present heat transfer and flow friction correlations as functions of all geometrical and other controlling variables. A FluentTM based numerical model has been developed for heat transfer and pressure drop studies over a stack of alternately arranged perforated plates and spacers. The model is validated with the data from literature. Generalized correlations are obtained through regression analysis over a large number of computed data.

Rotordynamic analysis using the Complex Transfer Matrix: An application to elastomer supports using the viscoelastic correspondence principle

NASA Astrophysics Data System (ADS)

Varney, Philip; Green, Itzhak

2014-11-01

Numerous methods are available to calculate rotordynamic whirl frequencies, including analytic methods, finite element analysis, and the transfer matrix method. The typical real-valued transfer matrix (RTM) suffers from several deficiencies, including lengthy computation times and the inability to distinguish forward and backward whirl. Though application of complex coordinates in rotordynamic analysis is not novel per se, specific advantages gained from using such coordinates in a transfer matrix analysis have yet to be elucidated. The present work employs a complex coordinate redefinition of the transfer matrix to obtain reduced forms of the elemental transfer matrices in inertial and rotating reference frames, including external stiffness and damping. Application of the complex-valued state variable redefinition results in a reduction of the 8×8 RTM to the 4×4 Complex Transfer Matrix (CTM). The CTM is advantageous in that it intrinsically separates forward and backward whirl, eases symbolic manipulation by halving the transfer matrices’ dimension, and provides significant improvement in computation time. A symbolic analysis is performed on a simple overhung rotor to demonstrate the mathematical motivation for whirl frequency separation. The CTM's utility is further shown by analyzing a rotordynamic system supported by viscoelastic elastomer rings. Viscoelastic elastomer ring supports can provide significant damping while reducing the cost and complexity associated with conventional components such as squeeze film dampers. The stiffness and damping of a viscoelastic damper ring are determined herein as a function of whirl frequency using the viscoelastic correspondence principle and a constitutive fractional calculus viscoelasticity model. The CTM is then employed to obtain the characteristic equation, where the whirl frequency dependent stiffness and damping of the elastomer supports are included. The Campbell diagram is shown, demonstrating the CTM's ability to intrinsically separate synchronous whirl direction for a non-trivial rotordynamic system. Good agreement is found between the CTM results and previously obtained analytic and experimental results for the elastomer ring supported rotordynamic system.

Effects of multiple scattering and surface albedo on the photochemistry of the troposphere. Final report, period ending 30 Nov 1981

DOE Office of Scientific and Technical Information (OSTI.GOV)

Augustsson, T.R.; Tiwari, S.N.

The effect of treatment of incoming solar radiation on the photochemistry of the troposphere is discussed. A one dimensional photochemical model of the troposphere containing the species of the nitrogen, oxygen, carbon, hydrogen, and sulfur families was developed. The vertical flux is simulated by use of the parameterized eddy diffusion coefficients. The photochemical model is coupled to a radiative transfer model that calculates the radiation field due to the incoming solar radiation which initiates much of the photochemistry of the troposphere. Vertical profiles of tropospheric species were compared with the Leighton approximation, radiative transfer, matrix inversion model. The radiative transfermore » code includes the effects of multiple scattering due to molecules and aerosols, pure absorption, and surface albedo on the transfer of incoming solar radiation. It is indicated that significant differences exist for several key photolysis frequencies and species number density profiles between the Leighton approximation and the profiles generated with, radiative transfer, matrix inversion technique. Most species show enhanced vertical profiles when the more realistic treatment of the incoming solar radiation field is included« less

Discriminative Transfer Subspace Learning via Low-Rank and Sparse Representation.

PubMed

Xu, Yong; Fang, Xiaozhao; Wu, Jian; Li, Xuelong; Zhang, David

2016-02-01

In this paper, we address the problem of unsupervised domain transfer learning in which no labels are available in the target domain. We use a transformation matrix to transfer both the source and target data to a common subspace, where each target sample can be represented by a combination of source samples such that the samples from different domains can be well interlaced. In this way, the discrepancy of the source and target domains is reduced. By imposing joint low-rank and sparse constraints on the reconstruction coefficient matrix, the global and local structures of data can be preserved. To enlarge the margins between different classes as much as possible and provide more freedom to diminish the discrepancy, a flexible linear classifier (projection) is obtained by learning a non-negative label relaxation matrix that allows the strict binary label matrix to relax into a slack variable matrix. Our method can avoid a potentially negative transfer by using a sparse matrix to model the noise and, thus, is more robust to different types of noise. We formulate our problem as a constrained low-rankness and sparsity minimization problem and solve it by the inexact augmented Lagrange multiplier method. Extensive experiments on various visual domain adaptation tasks show the superiority of the proposed method over the state-of-the art methods. The MATLAB code of our method will be publicly available at http://www.yongxu.org/lunwen.html.

Stress transfer around a broken fiber in unidirectional fiber-reinforced composites considering matrix damage evolution and interface slipping

NASA Astrophysics Data System (ADS)

Yang, Zhong; Zhang, BoMing; Zhao, Lin; Sun, XinYang

2011-02-01

A shear-lag model is applied to study the stress transfer around a broken fiber within unidirectional fiber-reinforced composites (FRC) subjected to uniaxial tensile loading along the fiber direction. The matrix damage and interfacial debonding, which are the main failure modes, are considered in the model. The maximum stress criterion with the linear damage evolution theory is used for the matrix. The slipping friction stress is considered in the interfacial debonding region using Coulomb friction theory, in which interfacial clamping stress comes from radial residual stress and mismatch of Poisson's ratios of constituents (fiber and matrix). The stress distributions in the fiber and matrix are obtained by the shear-lag theory added with boundary conditions, which includes force continuity and displacement compatibility constraints in the broken and neighboring intact fibers. The result gives axial stress distribution in fibers and shear stress in the interface and compares the theory reasonably well with the measurement by a polarized light microscope. The relation curves between damage, debonding and ineffective region lengths with external strain loading are obtained.

Contaminant sequestration in karstic aquifers: Experiments and quantification

NASA Astrophysics Data System (ADS)

Li, Guangquan; Loper, David E.; Kung, Robin

2008-02-01

A karstic aquifer typically has significant secondary porosity consisting of an interconnected system of caves or conduits. Conduit-borne contaminants can enter the contiguous limestone matrix, remain inside for a longer time than in the conduit, and subsequently be flushed out. This retention or sequestration can significantly influence the fate of contaminants within the aquifer and alter the shape of the breakthrough curve. The mechanisms involved in sequestration have been identified and quantified by analysis of the breakthrough curves generated by a set of laboratory experiments in which a conduit, porous limestone matrix, and conservative contaminant were simulated by a porous-walled pipe, chamber of closely packed glass beads, and salt, respectively. Experiments were conducted with both active and passive transfer of water between conduit and matrix, simulating differing hydrogeologic regimes. In active transfer the primary control parameter is the volume of water transferred; sequestration is primarily due to advection with the effects of diffusion and dispersion being minimal. In passive transfer the control parameters are the conduit Reynolds number and the duration that contaminant resides in the conduit; sequestration is caused by the combined effects of the conduit pressure drop, pressure variation due to bedform, and diffusion. Active and passive transfer can be unified by analyzing the ratio of the scale of pressure variation to the conduit length. In accordance with the resolved mechanisms a variety of models have been constructed to recover solute distributions in the matrix and to regenerate breakthrough curves. These analyses and models provide a potential approach to investigate contaminant migration in karstic aquifers.

Radiative-Transfer Modeling of Spectra of Densely Packed Particulate Media

NASA Astrophysics Data System (ADS)

Ito, G.; Mishchenko, M. I.; Glotch, T. D.

2017-12-01

Remote sensing measurements over a wide range of wavelengths from both ground- and space-based platforms have provided a wealth of data regarding the surfaces and atmospheres of various solar system bodies. With proper interpretations, important properties, such as composition and particle size, can be inferred. However, proper interpretation of such datasets can often be difficult, especially for densely packed particulate media with particle sizes on the order of wavelength of light being used for remote sensing. Radiative transfer theory has often been applied to the study of densely packed particulate media like planetary regoliths and snow, but with difficulty, and here we continue to investigate radiative transfer modeling of spectra of densely packed media. We use the superposition T-matrix method to compute scattering properties of clusters of particles and capture the near-field effects important for dense packing. Then, the scattering parameters from the T-matrix computations are modified with the static structure factor correction, accounting for the dense packing of the clusters themselves. Using these corrected scattering parameters, reflectance (or emissivity via Kirchhoff's Law) is computed with the method of invariance imbedding solution to the radiative transfer equation. For this work we modeled the emissivity spectrum of the 3.3 µm particle size fraction of enstatite, representing some common mineralogical and particle size components of regoliths, in the mid-infrared wavelengths (5 - 50 µm). The modeled spectrum from the T-matrix method with static structure factor correction using moderate packing densities (filling factors of 0.1 - 0.2) produced better fits to the laboratory measurement of corresponding spectrum than the spectrum modeled by the equivalent method without static structure factor correction. Future work will test the method of the superposition T-matrix and static structure factor correction combination for larger particles sizes and polydispersed clusters in search for the most effective modeling of spectra of densely packed particulate media.

Critical speeds and forced response solutions for active magnetic bearing turbomachinery, part 2

NASA Technical Reports Server (NTRS)

Rawal, D.; Keesee, J.; Kirk, R. Gordon

1991-01-01

The need for better performance of turbomachinery with active magnetic bearings has necessitated a study of such systems for accurate prediction of their vibrational characteristics. A modification of existing transfer matrix methods for rotor analysis is presented to predict the response of rotor systems with active magnetic bearings. The position of the magnetic bearing sensors is taken into account and the effect of changing sensor position on the vibrational characteristics of the rotor system is studied. The modified algorithm is validated using a simpler Jeffcott model described previously. The effect of changing from a rotating unbalance excitation to a constant excitation in a single plane is also studied. A typical eight stage centrifugal compressor rotor is analyzed using the modified transfer matrix code. The results for a two mass Jeffcott model were presented previously. The results obtained by running this model with the transfer matrix method were compared with the results of the Jeffcott analysis for the purposes of verification. Also included are plots of amplitude versus frequency for the eight stage centrifugal compressor rotor. These plots demonstrate the significant influence that sensor location has on the amplitude and critical frequencies of the rotor system.

The spectrum of a vertex model and related spin one chain sitting in a genus five curve

NASA Astrophysics Data System (ADS)

Martins, M. J.

2017-11-01

We derive the transfer matrix eigenvalues of a three-state vertex model whose weights are based on a R-matrix not of difference form with spectral parameters lying on a genus five curve. We have shown that the basic building blocks for both the transfer matrix eigenvalues and Bethe equations can be expressed in terms of meromorphic functions on an elliptic curve. We discuss the properties of an underlying spin one chain originated from a particular choice of the R-matrix second spectral parameter. We present numerical and analytical evidences that the respective low-energy excitations can be gapped or massless depending on the strength of the interaction coupling. In the massive phase we provide analytical and numerical evidences in favor of an exact expression for the lowest energy gap. We point out that the critical point separating these two distinct physical regimes coincides with the one in which the weights geometry degenerate into union of genus one curves.

Vertically-Integrated Dual-Continuum Models for CO2 Injection in Fractured Aquifers

NASA Astrophysics Data System (ADS)

Tao, Y.; Guo, B.; Bandilla, K.; Celia, M. A.

2017-12-01

Injection of CO2 into a saline aquifer leads to a two-phase flow system, with supercritical CO2 and brine being the two fluid phases. Various modeling approaches, including fully three-dimensional (3D) models and vertical-equilibrium (VE) models, have been used to study the system. Almost all of that work has focused on unfractured formations. 3D models solve the governing equations in three dimensions and are applicable to generic geological formations. VE models assume rapid and complete buoyant segregation of the two fluid phases, resulting in vertical pressure equilibrium and allowing integration of the governing equations in the vertical dimension. This reduction in dimensionality makes VE models computationally more efficient, but the associated assumptions restrict the applicability of VE model to formations with moderate to high permeability. In this presentation, we extend the VE and 3D models for CO2 injection in fractured aquifers. This is done in the context of dual-continuum modeling, where the fractured formation is modeled as an overlap of two continuous domains, one representing the fractures and the other representing the rock matrix. Both domains are treated as porous media continua and can be modeled by either a VE or a 3D formulation. The transfer of fluid mass between rock matrix and fractures is represented by a mass transfer function connecting the two domains. We have developed a computational model that combines the VE and 3D models, where we use the VE model in the fractures, which typically have high permeability, and the 3D model in the less permeable rock matrix. A new mass transfer function is derived, which couples the VE and 3D models. The coupled VE-3D model can simulate CO2 injection and migration in fractured aquifers. Results from this model compare well with a full-3D model in which both the fractures and rock matrix are modeled with 3D models, with the hybrid VE-3D model having significantly reduced computational cost. In addition to the VE-3D model, we explore simplifications of the rock matrix domain by using sugar-cube and matchstick conceptualizations and develop VE-dual porosity and VE-matchstick models. These vertically-integrated dual-permeability and dual-porosity models provide a range of computationally efficient tools to model CO2 storage in fractured saline aquifers.

Finite element analysis of stress transfer mechanism from matrix to the fiber in SWCN reinforced nanocomposites

NASA Astrophysics Data System (ADS)

Günay, E.

2017-02-01

This study defined as micromechanical finite element (FE) approach examining the stress transfer mechanism in single-walled carbon nanotube (SWCN) reinforced composites. In the modeling, 3D unit-cell method was evaluated. Carbon nanotube reinforced composites were modeled as three layers which comprises CNT, interface and matrix material. Firstly; matrix, fiber and interfacial materials all together considered as three layered cylindrical nanocomposite. Secondly, the cylindrical matrix material was assumed to be isotropic and also considered as a continuous medium. Then, fiber material was represented with zigzag type SWCNs. Finally, SWCN was combined with the elastic medium by using springs with different constants. In the FE modeling of SWCN reinforced composite model springs were modeled by using ANSYS spring damper element COMBIN14. The developed interfacial van der Waals interaction effects between the continuous matrix layer and the carbon nanotube fiber layer were simulated by applying these various spring stiffness values. In this study, the layered composite cylindrical FE model was presented as the equivalent mechanical properties of SWCN structures in terms of Young's modulus. The obtained results and literature values were presented and discussed. Figures, 16, 17, and 18 of the original article PDF file, as supplied to AIP Publishing, were affected by a PDF-processing error. Consequently, a solid diamond symbol appeared instead of a Greek tau on the y axis labels for these three figures. This article was updated on 17 March 2017 to correct the PDF-processing error, with the scientific content remaining unchanged.

Applying transfer matrix method to the estimation of the modal characteristics of the NASA Mini-Mass Truss

NASA Technical Reports Server (NTRS)

Shen, Ji-Yao; Taylor, Lawrence W., Jr.

1994-01-01

It is beneficial to use a distributed parameter model for large space structures because the approach minimizes the number of model parameters. Holzer's transfer matrix method provides a useful means to simplify and standardize the procedure for solving the system of partial differential equations. Any large space structures can be broken down into sub-structures with simple elastic and dynamical properties. For each single element, such as beam, tether, or rigid body, we can derive the corresponding transfer matrix. Combining these elements' matrices enables the solution of the global system equations. The characteristics equation can then be formed by satisfying the appropriate boundary conditions. Then natural frequencies and mode shapes can be determined by searching the roots of the characteristic equation at frequencies within the range of interest. This paper applies this methodology, and the maximum likelihood estimation method, to refine the modal characteristics of the NASA Mini-Mast Truss by successively matching the theoretical response to the test data of the truss. The method is being applied to more complex configurations.

Water exchange and pressure transfer between conduits and matrix and their influence on hydrodynamics of two karst aquifers with sinking streams

NASA Astrophysics Data System (ADS)

Bailly-Comte, Vincent; Martin, Jonathan B.; Jourde, Hervé; Screaton, Elizabeth J.; Pistre, Séverin; Langston, Abigail

2010-05-01

SummaryKarst aquifers are heterogeneous media where conduits usually drain water from lower permeability volumes (matrix and fractures). For more than a century, various approaches have used flood recession curves, which integrate all hydrodynamic processes in a karst aquifer, to infer physical properties of the movement and storage of groundwater. These investigations typically only consider flow to the conduits and thus have lacked quantitative observations of how pressure transfer and water exchange between matrix and conduit during flooding could influence recession curves. We present analyses of simultaneous discharge and water level time series of two distinctly different karst systems, one with low porosity and permeability matrix rocks in southern France, and one with high porosity and permeability matrix rocks in north-central Florida (USA). We apply simple mathematical models of flood recession using time series representations of recharge, storage, and discharge processes in the karst aquifer. We show that karst spring hydrographs can be interpreted according to pressure transfer between two distinct components of the aquifer, conduit and matrix porosity, which induce two distinct responses at the spring. Water exchange between conduits and matrix porosity successively control the flow regime at the spring. This exchange is governed by hydraulic head differences between conduits and matrix, head gradients within conduits, and the contrast of permeability between conduits and matrix. These observations have consequences for physical interpretations of recession curves and modeling of karst spring flows, particularly for the relative magnitudes of base flow and quick flow from karst springs. Finally, these results suggest that similar analyses of recession curves can be applied to karst aquifers with distinct physical characteristics utilizing well and spring hydrograph data, but information must be known about the hydrodynamics and physical properties of the aquifer before the results can be correctly interpreted.

Transport Phenomena in Fluid Dynamics: Matrix Heat Exchangers and Their Applications in Energy Systems

DTIC Science & Technology

2009-07-01

presented a summary of recent research on boiling in microchannels . He addressed the topics of macro scale versus micro scale heat transfer , two phase...flow regime, flow boiling 14 heat transfer results for microchannels , heat transfer mechanisms in microchannels , and flow boiling models for... Heat Transfer Boiling In Minichannel And Microchannel Flow Passages Of Compact Evaporators, Keynote Lecture Presented at the Engineering Foundation

Charge-transfer contributions to the excitonic coupling matrix element in BODIPY-based energy transfer cassettes

NASA Astrophysics Data System (ADS)

Spiegel, J. Dominik; Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M.

2017-01-01

BODIPY-based dyads serve as model systems for the investigation of excitation energy transfer (EET). Through-space EET is brought about by direct and exchange interactions between the transition densities of donor and acceptor localized states. The presence of a molecular linker gives rise to additional charge transfer (CT) contributions. Here, we present a novel approach for the calculation of the excitonic coupling matrix element (ECME) including CT contributions which is based on supermolecular one-electron transition density matrices (STD). The validity of the approach is assessed for a model system of two π -stacked ethylene molecules at varying intermolecular separation. Wave functions and electronic excitation energies of five EET cassettes comprising anthracene as exciton donor and BODIPY as exciton acceptor are obtained by the redesigned combined density functional theory and multireference configuration interaction (DFT/MRCI-R) method. CT contributions to the ECME are shown to be important in the covalently linked EET cassettes.

A revised version of the transfer matrix method to analyze one-dimensional structures

NASA Technical Reports Server (NTRS)

Nitzsche, F.

1983-01-01

A new and general method to analyze both free and forced vibration characteristics of one-dimensional structures is discussed in this paper. This scheme links for the first time the classical transfer matrix method with the recently developed integrating matrix technique to integrate systems of differential equations. Two alternative approaches to the problem are presented. The first is based upon the lumped parameter model to account for the inertia properties of the structure. The second releases that constraint allowing a more precise description of the physical system. The free vibration of a straight uniform beam under different support conditions is analyzed to test the accuracy of the two models. Finally some results for the free vibration of a 12th order system representing a curved, rotating beam prove that the present method is conveniently extended to more complicated structural dynamics problems.

A methodology for formulating a minimal uncertainty model for robust control system design and analysis

NASA Technical Reports Server (NTRS)

Belcastro, Christine M.; Chang, B.-C.; Fischl, Robert

1989-01-01

In the design and analysis of robust control systems for uncertain plants, the technique of formulating what is termed an M-delta model has become widely accepted and applied in the robust control literature. The M represents the transfer function matrix M(s) of the nominal system, and delta represents an uncertainty matrix acting on M(s). The uncertainty can arise from various sources, such as structured uncertainty from parameter variations or multiple unstructured uncertainties from unmodeled dynamics and other neglected phenomena. In general, delta is a block diagonal matrix, and for real parameter variations the diagonal elements are real. As stated in the literature, this structure can always be formed for any linear interconnection of inputs, outputs, transfer functions, parameter variations, and perturbations. However, very little of the literature addresses methods for obtaining this structure, and none of this literature addresses a general methodology for obtaining a minimal M-delta model for a wide class of uncertainty. Since have a delta matrix of minimum order would improve the efficiency of structured singular value (or multivariable stability margin) computations, a method of obtaining a minimal M-delta model would be useful. A generalized method of obtaining a minimal M-delta structure for systems with real parameter variations is given.

Assessment of the antireflection property of moth wings by three-dimensional transfer-matrix optical simulations

NASA Astrophysics Data System (ADS)

Deparis, Olivier; Khuzayim, Nadia; Parker, Andrew; Vigneron, Jean Pol

2009-04-01

The wings of the moth Cacostatia ossa (Ctenuchinae) are covered on both sides by non-close-packed nipple arrays which are known to act as broadband antireflection coatings. Experimental evaluation of the antireflection property of these biological structures is problematic because of the lack of a proper reference for reflectance measurements, i.e., a smooth surface made of the same material as the wing. Theoretical evaluation, on the other hand, is much more reliable provided that optical simulations are carried out on a realistic structural model of the wing. Based on detailed morphological characterizations, we established a three-dimensional (3D) model of the wing and used 3D transfer-matrix optical simulations in order to demonstrate the broadband antireflection property of the wings of Cacostatia ossa. Differences between hemispherical and specular reflectance spectra revealed that diffraction effects were not negligible for this structure although they did not jeopardize the antireflection efficiency. The influences of the backside corrugation and of the material’s absorption on the reflectance spectrum were also studied. In addition, simulations based on an effective-medium model of the wing were carried out using a multilayer thin-film code. In comparison with the latter simulations, the 3D transfer-matrix simulations were found to be more accurate for evaluating the antireflection property.

Application of Transfer Matrix Approach to Modeling and Decentralized Control of Lattice-Based Structures

NASA Technical Reports Server (NTRS)

Cramer, Nick; Swei, Sean Shan-Min; Cheung, Kenny; Teodorescu, Mircea

2015-01-01

This paper presents a modeling and control of aerostructure developed by lattice-based cellular materials/components. The proposed aerostructure concept leverages a building block strategy for lattice-based components which provide great adaptability to varying ight scenarios, the needs of which are essential for in- ight wing shaping control. A decentralized structural control design is proposed that utilizes discrete-time lumped mass transfer matrix method (DT-LM-TMM). The objective is to develop an e ective reduced order model through DT-LM-TMM that can be used to design a decentralized controller for the structural control of a wing. The proposed approach developed in this paper shows that, as far as the performance of overall structural system is concerned, the reduced order model can be as e ective as the full order model in designing an optimal stabilizing controller.

Transfer matrix calculation for ion optical elements using real fields

NASA Astrophysics Data System (ADS)

Mishra, P. M.; Blaum, K.; George, S.; Grieser, M.; Wolf, A.

2018-03-01

With the increasing importance of ion storage rings and traps in low energy physics experiments, an efficient transport of ion species from the ion source area to the experimental setup becomes essential. Some available, powerful software packages rely on transfer matrix calculations in order to compute the ion trajectory through the ion-optical beamline systems of high complexity. With analytical approaches, so far the transfer matrices are documented only for a few ideal ion optical elements. Here we describe an approach (using beam tracking calculations) to determine the transfer matrix for any individual electrostatic or magnetostatic ion optical element. We verify the procedure by considering the well-known cases and then apply it to derive the transfer matrix of a 90-degree electrostatic quadrupole deflector including its realistic geometry and fringe fields. A transfer line consisting of a quadrupole deflector and a quadrupole doublet is considered, where the results from the standard first order transfer matrix based ion optical simulation program implementing the derived transfer matrix is compared with the real field beam tracking simulations.

Minimal Model of Quantum Kinetic Clusters for the Energy-Transfer Network of a Light-Harvesting Protein Complex.

PubMed

Wu, Jianlan; Tang, Zhoufei; Gong, Zhihao; Cao, Jianshu; Mukamel, Shaul

2015-04-02

The energy absorbed in a light-harvesting protein complex is often transferred collectively through aggregated chromophore clusters. For population evolution of chromophores, the time-integrated effective rate matrix allows us to construct quantum kinetic clusters quantitatively and determine the reduced cluster-cluster transfer rates systematically, thus defining a minimal model of energy-transfer kinetics. For Fenna-Matthews-Olson (FMO) and light-havrvesting complex II (LCHII) monomers, quantum Markovian kinetics of clusters can accurately reproduce the overall energy-transfer process in the long-time scale. The dominant energy-transfer pathways are identified in the picture of aggregated clusters. The chromophores distributed extensively in various clusters can assist a fast and long-range energy transfer.

A quasi steady state method for solving transient Darcy flow in complex 3D fractured networks accounting for matrix to fracture flow

NASA Astrophysics Data System (ADS)

Nœtinger, B.

2015-02-01

Modeling natural Discrete Fracture Networks (DFN) receives more and more attention in applied geosciences, from oil and gas industry, to geothermal recovery and aquifer management. The fractures may be either natural, or artificial in case of well stimulation. Accounting for the flow inside the fracture network, and accounting for the transfers between the matrix and the fractures, with the same level of accuracy is an important issue for calibrating the well architecture and for setting up optimal resources recovery strategies. Recently, we proposed an original method allowing to model transient pressure diffusion in the fracture network only [1]. The matrix was assumed to be impervious. A systematic approximation scheme was built, allowing to model the initial DFN by a set of N unknowns located at each identified intersection between fractures. The higher N, the higher the accuracy of the model. The main assumption was using a quasi steady state hypothesis, that states that the characteristic diffusion time over one single fracture is negligible compared with the characteristic time of the macroscopic problem, e.g. change of boundary conditions. In that context, the lowest order approximation N = 1 has the form of solving a transient problem in a resistor/capacitor network, a so-called pipe network. Its topology is the same as the network of geometrical intersections between fractures. In this paper, we generalize this approach in order to account for fluxes from matrix to fractures. The quasi steady state hypothesis at the fracture level is still kept. Then, we show that in the case of well separated time scales between matrix and fractures, the preceding model needs only to be slightly modified in order to incorporate these fluxes. The additional knowledge of the so-called matrix to fracture transfer function allows to modify the mass matrix that becomes a time convolution operator. This is reminiscent of existing space averaged transient dual porosity models.

Analysis of the performance of a wireless optical multi-input to multi-output communication system.

PubMed

Bushuev, Denis; Arnon, Shlomi

2006-07-01

We investigate robust optical wireless communication in a highly scattering propagation medium using multielement optical detector arrays. The communication setup consists of synchronized multiple transmitters that send information to a receiver array and an atmospheric propagation channel. The mathematical model that best describes this scenario is multi-input to multi-output communication through stochastic slow changing channels. In this model, signals from m transmitters are received by n receiver-detectors. The channel transfer function matrix is G, and its size is n x m. G(i,j) is the transfer function from transmitter i to detector j, and m > or = n. We adopt a quasi-stationary approach in which the channel time variation has a negligible effect on communication performance over a burst. The G matrix is calculated on the basis of the optical transfer function of the atmospheric channel (composed of aerosol and turbulence elements) and the receiver's optics. In this work we derive a performance model using environmental data, such as documented turbulence and aerosol models and noise statistics. We also present the results of simulations conducted for the proposed detection algorithm.

General transfer matrix formalism to calculate DNA-protein-drug binding in gene regulation: application to OR operator of phage lambda.

PubMed

Teif, Vladimir B

2007-01-01

The transfer matrix methodology is proposed as a systematic tool for the statistical-mechanical description of DNA-protein-drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the O(R) operator of phage lambda. The transfer matrix formalism allowed the description of the lambda-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI-Cro-RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the O(R) and O(L) operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters P(R) and P(RM) becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed.

General transfer matrix formalism to calculate DNA–protein–drug binding in gene regulation: application to OR operator of phage λ

PubMed Central

Teif, Vladimir B.

2007-01-01

The transfer matrix methodology is proposed as a systematic tool for the statistical–mechanical description of DNA–protein–drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the OR operator of phage λ. The transfer matrix formalism allowed the description of the λ-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI–Cro–RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the OR and OL operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters PR and PRM becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed. PMID:17526526

Determination of poles and zeros of transfer functions for flexible spacecraft attitude control

NASA Technical Reports Server (NTRS)

Ohkami, Y.; Likins, P. W.

1976-01-01

The transfer function matrix is obtained for a three-input and three-output model of minimum sensors and actuators for the attitude control system of flexible spacecraft, and a method is described for determining the poles and zeros of this transfer function. Three cases are considered: (1) the actuators and the sensors are all attached to the primary body, (2) the actuators are on the primary body and the sensors are on the sub-body, and (3) the actuators are on the sub-body and the sensors are on the primary body. The zero-determination problem is shown to reduce to eigenvalue calculations of a matrix which is constructed from the inertial and modal matrices in a simple fashion.

Transfer matrix approach for the Kerr and Faraday rotation in layered nanostructures.

PubMed

Széchenyi, Gábor; Vigh, Máté; Kormányos, Andor; Cserti, József

2016-09-21

To study the optical rotation of the polarization of light incident on multilayer systems consisting of atomically thin conductors and dielectric multilayers we present a general method based on transfer matrices. The transfer matrix of the atomically thin conducting layer is obtained using the Maxwell equations. We derive expressions for the Kerr (Faraday) rotation angle and for the ellipticity of the reflected (transmitted) light as a function of the incident angle and polarization of the light. The method is demonstrated by calculating the Kerr (Faraday) angle for bilayer graphene in the quantum anomalous Hall state placed on the top of dielectric multilayers. The optical conductivity of the bilayer graphene is calculated in the framework of a four-band model.

Simulating the volatilization of solvents in unsaturated soils during laboratory and field infiltration experiments

USGS Publications Warehouse

Cho, H. Jean; Jaffe, Peter R.; Smith, James A.

1993-01-01

This paper describes laboratory and field experiments which were conducted to study the dynamics of trichloroethylene (TCE) as it volatilized from contaminated groundwater and diffused in the presence of infiltrating water through the unsaturated soil zone to the land surface. The field experiments were conducted at the Picatinny Arsenal, which is part of the United States Geological Survey Toxic Substances Hydrology Program. In both laboratory and field settings the gas and water phase concentrations of TCE were not in equilibrium during infiltration. Gas-water mass transfer rate constants were calibrated to the experimental data using a model in which the water phase was treated as two phases: a mobile water phase and an immobile water phase. The mass transfer limitations of a volatile organic compound between the gas and liquid phases were described explicitly in the model. In the laboratory experiment the porous medium was nonsorbing, and water infiltration rates ranged from 0.076 to 0.28 cm h−1. In the field experiment the water infiltration rate was 0.34 cm h−1, and sorption onto the soil matrix was significant. The laboratory-calibrated gas-water mass transfer rate constant is 3.3×10−4 h−1 for an infiltration rate of 0.076 cm h−1 and 1.4×10−3 h−1 for an infiltration rate of 0.28 cm h−1. The overall mass transfer rate coefficients, incorporating the contribution of mass transfer between mobile and immobile water phases and the variation of interfacial area with moisture content, range from 3×10−4 h−1 to 1×10−2 h−1. A power law model relates the gas-water mass transfer rate constant to the infiltration rate and the fraction of the water phase which is mobile. It was found that the results from the laboratory experiments could not be extrapolated to the field. In order to simulate the field experiment the very slow desorption of TCE from the soil matrix was incorporated into the mathematical model. When desorption from the soil matrix was added to the model, the calibrated gas-water mass transfer rate constant is 2 orders of magnitude lower than that predicted using the power law model developed for the nonsorbing laboratory soil.

Tests of conformal field theory at the Yang-Lee singularity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wydro, Tomasz; McCabe, John F.

2009-12-14

This paper studies the Yang-Lee edge singularity of 2-dimensional (2D) Ising model based on a quantum spin chain and transfer matrix measurements on the cylinder. Based on finite-size scaling, the low-lying excitation spectrum is found at the Yang-Lee edge singularity. Based on transfer matrix techniques, the single structure constant is evaluated at the Yang-Lee edge singularity. The results of both types of measurements are found to be fully consistent with the predictions for the (A{sub 4}, A{sub 1}) minimal conformal field theory, which was previously identified with this critical point.

Dynamical simulation of electron transfer processes in self-assembled monolayers at metal surfaces using a density matrix approach.

PubMed

Prucker, V; Bockstedte, M; Thoss, M; Coto, P B

2018-03-28

A single-particle density matrix approach is introduced to simulate the dynamics of heterogeneous electron transfer (ET) processes at interfaces. The characterization of the systems is based on a model Hamiltonian parametrized by electronic structure calculations and a partitioning method. The method is applied to investigate ET in a series of nitrile-substituted (poly)(p-phenylene)thiolate self-assembled monolayers adsorbed at the Au(111) surface. The results show a significant dependence of the ET on the orbital symmetry of the donor state and on the molecular and electronic structure of the spacer.

An Embedded 3D Fracture Modeling Approach for Simulating Fracture-Dominated Fluid Flow and Heat Transfer in Geothermal Reservoirs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnston, Henry; Wang, Cong; Winterfeld, Philip

An efficient modeling approach is described for incorporating arbitrary 3D, discrete fractures, such as hydraulic fractures or faults, into modeling fracture-dominated fluid flow and heat transfer in fractured geothermal reservoirs. This technique allows 3D discrete fractures to be discretized independently from surrounding rock volume and inserted explicitly into a primary fracture/matrix grid, generated without including 3D discrete fractures in prior. An effective computational algorithm is developed to discretize these 3D discrete fractures and construct local connections between 3D fractures and fracture/matrix grid blocks of representing the surrounding rock volume. The constructed gridding information on 3D fractures is then added tomore » the primary grid. This embedded fracture modeling approach can be directly implemented into a developed geothermal reservoir simulator via the integral finite difference (IFD) method or with TOUGH2 technology This embedded fracture modeling approach is very promising and computationally efficient to handle realistic 3D discrete fractures with complicated geometries, connections, and spatial distributions. Compared with other fracture modeling approaches, it avoids cumbersome 3D unstructured, local refining procedures, and increases computational efficiency by simplifying Jacobian matrix size and sparsity, while keeps sufficient accuracy. Several numeral simulations are present to demonstrate the utility and robustness of the proposed technique. Our numerical experiments show that this approach captures all the key patterns about fluid flow and heat transfer dominated by fractures in these cases. Thus, this approach is readily available to simulation of fractured geothermal reservoirs with both artificial and natural fractures.« less

Real-Time Parameter Estimation Method Applied to a MIMO Process and its Comparison with an Offline Identification Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaplanoglu, Erkan; Safak, Koray K.; Varol, H. Selcuk

2009-01-12

An experiment based method is proposed for parameter estimation of a class of linear multivariable systems. The method was applied to a pressure-level control process. Experimental time domain input/output data was utilized in a gray-box modeling approach. Prior knowledge of the form of the system transfer function matrix elements is assumed to be known. Continuous-time system transfer function matrix parameters were estimated in real-time by the least-squares method. Simulation results of experimentally determined system transfer function matrix compare very well with the experimental results. For comparison and as an alternative to the proposed real-time estimation method, we also implemented anmore » offline identification method using artificial neural networks and obtained fairly good results. The proposed methods can be implemented conveniently on a desktop PC equipped with a data acquisition board for parameter estimation of moderately complex linear multivariable systems.« less

Scale-Dependent Fracture-Matrix Interactions And Their Impact on Radionuclide Transport - Final Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Detwiler, Russell

Matrix diffusion and adsorption within a rock matrix are widely regarded as important mechanisms for retarding the transport of radionuclides and other solutes in fractured rock (e.g., Neretnieks, 1980; Tang et al., 1981; Maloszewski and Zuber, 1985; Novakowski and Lapcevic, 1994; Jardine et al., 1999; Zhou and Xie, 2003; Reimus et al., 2003a,b). When remediation options are being evaluated for old sources of contamination, where a large fraction of contaminants reside within the rock matrix, slow diffusion out of the matrix greatly increases the difficulty and timeframe of remediation. Estimating the rates of solute exchange between fractures and the adjacentmore » rock matrix is a critical factor in quantifying immobilization and/or remobilization of DOE-relevant contaminants within the subsurface. In principle, the most rigorous approach to modeling solute transport with fracture-matrix interaction would be based on local-scale coupled advection-diffusion/dispersion equations for the rock matrix and in discrete fractures that comprise the fracture network (Discrete Fracture Network and Matrix approach, hereinafter referred to as DFNM approach), fully resolving aperture variability in fractures and matrix property heterogeneity. However, such approaches are computationally demanding, and thus, many predictive models rely upon simplified models. These models typically idealize fracture rock masses as a single fracture or system of parallel fractures interacting with slabs of porous matrix or as a mobile-immobile or multi-rate mass transfer system. These idealizations provide tractable approaches for interpreting tracer tests and predicting contaminant mobility, but rely upon a fitted effective matrix diffusivity or mass-transfer coefficients. However, because these fitted parameters are based upon simplified conceptual models, their effectiveness at predicting long-term transport processes remains uncertain. Evidence of scale dependence of effective matrix diffusion coefficients obtained from tracer tests highlights this point and suggests that the underlying mechanisms and relationship between rock and fracture properties are not fully understood in large complex fracture networks. In this project, we developed a high-resolution DFN model of solute transport in fracture networks to explore and quantify the mechanisms that control transport in complex fracture networks and how these may give rise to observed scale-dependent matrix diffusion coefficients. Results demonstrate that small scale heterogeneity in the flow field caused by local aperture variability within individual fractures can lead to long-tailed breakthrough curves indicative of matrix diffusion, even in the absence of interactions with the fracture matrix. Furthermore, the temporal and spatial scale dependence of these processes highlights the inability of short-term tracer tests to estimate transport parameters that will control long-term fate and transport of contaminants in fractured aquifers.« less

Quantum simulation of an ultrathin body field-effect transistor with channel imperfections

NASA Astrophysics Data System (ADS)

Vyurkov, V.; Semenikhin, I.; Filippov, S.; Orlikovsky, A.

2012-04-01

An efficient program for the all-quantum simulation of nanometer field-effect transistors is elaborated. The model is based on the Landauer-Buttiker approach. Our calculation of transmission coefficients employs a transfer-matrix technique involving the arbitrary precision (multiprecision) arithmetic to cope with evanescent modes. Modified in such way, the transfer-matrix technique turns out to be much faster in practical simulations than that of scattering-matrix. Results of the simulation demonstrate the impact of realistic channel imperfections (random charged centers and wall roughness) on transistor characteristics. The Landauer-Buttiker approach is developed to incorporate calculation of the noise at an arbitrary temperature. We also validate the ballistic Landauer-Buttiker approach for the usual situation when heavily doped contacts are indispensably included into the simulation region.

A transfer matrix approach to vibration localization in mistuned blade assemblies

NASA Technical Reports Server (NTRS)

Ottarson, Gisli; Pierre, Chritophe

1993-01-01

A study of mode localization in mistuned bladed disks is performed using transfer matrices. The transfer matrix approach yields the free response of a general, mono-coupled, perfectly cyclic assembly in closed form. A mistuned structure is represented by random transfer matrices, and the expansion of these matrices in terms of the small mistuning parameter leads to the definition of a measure of sensitivity to mistuning. An approximation of the localization factor, the spatially averaged rate of exponential attenuation per blade-disk sector, is obtained through perturbation techniques in the limits of high and low sensitivity. The methodology is applied to a common model of a bladed disk and the results verified by Monte Carlo simulations. The easily calculated sensitivity measure may prove to be a valuable design tool due to its system-independent quantification of mistuning effects such as mode localization.

Hybrid-dual-fourier tomographic algorithm for a fast three-dimensionial optical image reconstruction in turbid media

NASA Technical Reports Server (NTRS)

Alfano, Robert R. (Inventor); Cai, Wei (Inventor)

2007-01-01

A reconstruction technique for reducing computation burden in the 3D image processes, wherein the reconstruction procedure comprises an inverse and a forward model. The inverse model uses a hybrid dual Fourier algorithm that combines a 2D Fourier inversion with a 1D matrix inversion to thereby provide high-speed inverse computations. The inverse algorithm uses a hybrid transfer to provide fast Fourier inversion for data of multiple sources and multiple detectors. The forward model is based on an analytical cumulant solution of a radiative transfer equation. The accurate analytical form of the solution to the radiative transfer equation provides an efficient formalism for fast computation of the forward model.

Active and Passive 3D Vector Radiative Transfer with Preferentially-Aligned Ice Particles

NASA Astrophysics Data System (ADS)

Adams, I. S.; Munchak, S. J.; Pelissier, C.; Kuo, K. S.; Heymsfield, G. M.

2017-12-01

To support the observation of clouds and precipitation using combinations of radars and radiometers, a forward model capable of representing diverse sensing geometries for active and passive instruments is necessary for correctly interpreting and consistently combining multi-sensor measurements from ground-based, airborne, and spaceborne platforms. As such, the Atmospheric Radiative Transfer Simulator (ARTS) uses Monte Carlo integration to produce radar reflectivities and radiometric brightness temperatures for three-dimensional cloud and precipitation input fields. This radiative transfer framework is capable of efficiently sampling Gaussian antenna beams and fully accounting for multiple scattering. By relying on common ray-tracing tools, gaseous absorption models, and scattering properties, the model reproduces accurate and consistent radar and radiometer observables. While such a framework is an important component for simulating remote sensing observables, the key driver for self-consistent radiative transfer calculations of clouds and precipitation is scattering data. Research over the past decade has demonstrated that spheroidal models of frozen hydrometeors cannot accurately reproduce all necessary scattering properties at all desired frequencies. The discrete dipole approximation offers flexibility in calculating scattering for arbitrary particle geometries, but at great computational expense. When considering scattering for certain pristine ice particles, the Extended Boundary Condition Method, or T-Matrix, is much more computationally efficient; however, convergence for T-Matrix calculations fails at large size parameters and high aspect ratios. To address these deficiencies, we implemented the Invariant Imbedding T-Matrix Method (IITM). A brief overview of ARTS and IITM will be given, including details for handling preferentially-aligned hydrometeors. Examples highlighting the performance of the model for simulating space-based and airborne measurements will be offered, and some case studies showing the response to particle type and orientation will be presented. Simulations of polarized radar (Z, LDR, ZDR) and radiometer (Stokes I and Q) quantities will be used to demonstrate the capabilities of the model.

Performance analysis of cross-seeding WDM-PON system using transfer matrix method

NASA Astrophysics Data System (ADS)

Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

2016-12-01

In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

Ion-to-Neutral Ratios and Thermal Proton Transfer in Matrix-Assisted Laser Desorption/Ionization

NASA Astrophysics Data System (ADS)

Lu, I.-Chung; Chu, Kuan Yu; Lin, Chih-Yuan; Wu, Shang-Yun; Dyakov, Yuri A.; Chen, Jien-Lian; Gray-Weale, Angus; Lee, Yuan-Tseh; Ni, Chi-Kung

2015-07-01

The ion-to-neutral ratios of four commonly used solid matrices, α-cyano-4-hydroxycinnamic acid (CHCA), 2,5-dihydroxybenzoic acid (2,5-DHB), sinapinic acid (SA), and ferulic acid (FA) in matrix-assisted laser desorption/ionization (MALDI) at 355 nm are reported. Ions are measured using a time-of-flight mass spectrometer combined with a time-sliced ion imaging detector. Neutrals are measured using a rotatable quadrupole mass spectrometer. The ion-to-neutral ratios of CHCA are three orders of magnitude larger than those of the other matrices at the same laser fluence. The ion-to-neutral ratios predicted using the thermal proton transfer model are similar to the experimental measurements, indicating that thermal proton transfer reactions play a major role in generating ions in ultraviolet-MALDI.

Practical robustness measures in multivariable control system analysis. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Lehtomaki, N. A.

1981-01-01

The robustness of the stability of multivariable linear time invariant feedback control systems with respect to model uncertainty is considered using frequency domain criteria. Available robustness tests are unified under a common framework based on the nature and structure of model errors. These results are derived using a multivariable version of Nyquist's stability theorem in which the minimum singular value of the return difference transfer matrix is shown to be the multivariable generalization of the distance to the critical point on a single input, single output Nyquist diagram. Using the return difference transfer matrix, a very general robustness theorem is presented from which all of the robustness tests dealing with specific model errors may be derived. The robustness tests that explicitly utilized model error structure are able to guarantee feedback system stability in the face of model errors of larger magnitude than those robustness tests that do not. The robustness of linear quadratic Gaussian control systems are analyzed.

A modified Finite Element-Transfer Matrix for control design of space structures

NASA Technical Reports Server (NTRS)

Tan, T.-M.; Yousuff, A.; Bahar, L. Y.; Konstandinidis, M.

1990-01-01

The Finite Element-Transfer Matrix (FETM) method was developed for reducing the computational efforts involved in structural analysis. While being widely used by structural analysts, this method does, however, have certain limitations, particularly when used for the control design of large flexible structures. In this paper, a new formulation based on the FETM method is presented. The new method effectively overcomes the limitations in the original FETM method, and also allows an easy construction of reduced models that are tailored for the control design. Other advantages of this new method include the ability to extract open loop frequencies and mode shapes with less computation, and simplification of the design procedures for output feedback, constrained compensation, and decentralized control. The development of this new method and the procedures for generating reduced models using this method are described in detail and the role of the reduced models in control design is discussed through an illustrative example.

Interdisciplinary matrix in economics: two applications to the transition from socialism to capitalism.

PubMed

Jakimowicz, Aleksander

2009-10-01

The 7-fold interdisciplinary matrix is introduced. This integrated methodological point of view is original, although it is based on ideas of others in various ways. The name for this new approach draws on the Kuhnian notion of a disciplinary matrix. There are four components of the Kuhnian matrix on which the existence of scientific communities hinges: symbolic generalizations, models, values, and exemplars. In this context the term "paradigm" should refer to exemplars. The interdisciplinary matrix is composed of seven elements: cybernetics, catastrophe theory, fractal geometry, deterministic chaos, artificial intelligence, theory of complexity, and humanistic values. Scientific developments have recently brought substantial changes in the structure of scientific communities. Transferability of ideas and thoughts contributed to the creation of scientific communities, which unite representatives of various professions. When researching into certain phenomena we no longer need to develop theories for them from scratch, as we can draw on the achievements in other disciplines. Two examples of the employment of the interdisciplinary matrix in macroeconomics are elaborated here: the investment cycle model in socialist economy, and the model of economic transformation based on chaotic hysteresis.

A multi-layer discrete-ordinate method for vector radiative transfer in a vertically-inhomogeneous, emitting and scattering atmosphere. I - Theory. II - Application

NASA Technical Reports Server (NTRS)

Weng, Fuzhong

1992-01-01

A theory is developed for discretizing the vector integro-differential radiative transfer equation including both solar and thermal radiation. A complete solution and boundary equations are obtained using the discrete-ordinate method. An efficient numerical procedure is presented for calculating the phase matrix and achieving computational stability. With natural light used as a beam source, the Stokes parameters from the model proposed here are compared with the analytical solutions of Chandrasekhar (1960) for a Rayleigh scattering atmosphere. The model is then applied to microwave frequencies with a thermal source, and the brightness temperatures are compared with those from Stamnes'(1988) radiative transfer model.

Factorized three-body S-matrix restrained by the Yang–Baxter equation and quantum entanglements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Li-Wei, E-mail: NKyulw@gmail.com; Zhao, Qing, E-mail: qzhaoyuping@bit.edu.cn; Ge, Mo-Lin, E-mail: geml@nankai.edu.cn

2014-09-15

This paper investigates the physical effects of the Yang–Baxter equation (YBE) to quantum entanglements through the 3-body S-matrix in entangling parameter space. The explicit form of 3-body S-matrix Ř{sub 123}(θ,φ) based on the 2-body S-matrices is given due to the factorization condition of YBE. The corresponding chain Hamiltonian has been obtained and diagonalized, also the Berry phase for 3-body system is given. It turns out that by choosing different spectral parameters the Ř(θ,φ)-matrix gives GHZ and W states respectively. The extended 1-D Kitaev toy model has been derived. Examples of the role of the model in entanglement transfer are discussed.more » - Highlights: • We give the relation between 3-body S-matrix and 3-qubit entanglement. • The relation between 3-qubit and 2-qubit entanglements is investigated via YBE. • 1D Kitaev toy model is derived by the Type-II solution of YBE. • The condition of YBE kills the “Zero boundary mode” in our chain model.« less

La structure de Jordan des matrices de transfert des modeles de boucles et la relation avec les hamiltoniens XXZ

NASA Astrophysics Data System (ADS)

Morin-Duchesne, Alexi

Lattice models such as percolation, the Ising model and the Potts model are useful for the description of phase transitions in two dimensions. Finding analytical solutions is done by calculating the partition function, which in turn requires finding eigenvalues of transfer matrices. At the critical point, the two dimensional statistical models are invariant under conformal transformations and the construction of rational conformal field theories, as the continuum limit of these lattice models, allows one to compute the partition function at the critical point. Many researchers think however that the paradigm of rational conformal conformal field theories can be extended to include models with non diagonalizable transfer matrices. These models would then be described, in the scaling limit, by logarithmic conformal field theories and the representations of the Virasoro algebra coming into play would be indecomposable. We recall the construction of the double-row transfer matrix DN (λ, u) of the Fortuin-Kasteleyn model, seen as an element of the Temperley-Lieb algebra. This transfer matrix comes into play in physical theories through its representation in link modules (or standard modules). The vector space on which this representation acts decomposes into sectors labelled by a physical parameter d, the number of defects, which remains constant or decreases in the link representations. This thesis is devoted to the identification of the Jordan structure of DN(λ, u) in the link representations. The parameter β = 2 cos λ = -(q + q-1) fixes the theory : for instance β = 1 for percolation and 2 for the Ising model. On the geometry of the strip with open boundary conditions, we show that DN(λ, u) has the same Jordan blocks as its highest Fourier coefficient, FN. We study the non-diagonalizability of FN through the divergences of some of the eigenstates of ρ(F N) that appear at the critical values of λ. The Jordan cells we find in ρ(DN(λ, u)) have rank 2 and couple sectors d and d' when specific constraints on λ, d, d' and N are satisfied. For the model of critical dense polymers (β = 0) on the strip, the eigenvalues of ρ(DN(λ, u)) were known, but their degeneracies only conjectured. By constructing an isomorphism between the link modules on the strip and a subspace of spin modules of the XXZ model at q = i, we prove this conjecture. We also show that the restriction of the Hamiltonian to any sector d is diagonalizable, and that the XX Hamiltonian has rank 2 Jordan cells when N is even. Finally, we study the Jordan structure of the transfer matrix T N(λ, ν) for periodic boundary conditions. When λ = πa/b and a, b ∈ Z× , the matrix TN(λ, ν) has Jordan blocks between sectors, but also within sectors. The approach using FN admits a generalization to the present case and allows us to probe the Jordan cells that tie different sectors. The rank of these cells exceeds 2 in some cases and can grow indefinitely with N. For the Jordan blocks within a sector, we show that the link modules on the cylinder and the XXZ spin modules are isomorphic except for specific curves in the (q, ν) plane. By using the behavior of the transformation ĩd N in a neighborhood of the critical values (qc, ν c), we explicitly build Jordan partners of rank 2 and discuss the existence of Jordan cells with higher rank. Keywords : phase transitions, Ising model, Potts model, Fortuin-Kasteleyn model, transfer matrix method, XXZ Hamiltonian, logarithmic conformal field theory, Jordan structure.

A Framework for Integrated Component and System Analyses of Instabilities

NASA Technical Reports Server (NTRS)

Ahuja, Vineet; Erwin, James; Arunajatesan, Srinivasan; Cattafesta, Lou; Liu, Fei

2010-01-01

Instabilities associated with fluid handling and operation in liquid rocket propulsion systems and test facilities usually manifest themselves as structural vibrations or some form of structural damage. While the source of the instability is directly related to the performance of a component such as a turbopump, valve or a flow control element, the associated pressure fluctuations as they propagate through the system have the potential to amplify and resonate with natural modes of the structural elements and components of the system. In this paper, the authors have developed an innovative multi-level approach that involves analysis at the component and systems level. The primary source of the unsteadiness is modeled with a high-fidelity hybrid RANS/LES based CFD methodology that has been previously used to study instabilities in feed systems. This high fidelity approach is used to quantify the instability and understand the physics associated with the instability. System response to the driving instability is determined through a transfer matrix approach wherein the incoming and outgoing pressure and velocity fluctuations are related through a transfer (or transmission) matrix. The coefficients of the transfer matrix for each component (i.e. valve, pipe, orifice etc.) are individually derived from the flow physics associated with the component. A demonstration case representing a test loop/test facility comprised of a network of elements is constructed with the transfer matrix approach and the amplification of modes analyzed as the instability propagates through the test loop.

Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

NASA Technical Reports Server (NTRS)

Murthy, V. R.; Shultz, Louis A.

1994-01-01

The goal of this research is to develop the transfer matrix method to treat nonlinear autonomous boundary value problems with multiple branches. The application is the complete nonlinear aeroelastic analysis of multiple-branched rotor blades. Once the development is complete, it can be incorporated into the existing transfer matrix analyses. There are several difficulties to be overcome in reaching this objective. The conventional transfer matrix method is limited in that it is applicable only to linear branch chain-like structures, but consideration of multiple branch modeling is important for bearingless rotors. Also, hingeless and bearingless rotor blade dynamic characteristics (particularly their aeroelasticity problems) are inherently nonlinear. The nonlinear equations of motion and the multiple-branched boundary value problem are treated together using a direct transfer matrix method. First, the formulation is applied to a nonlinear single-branch blade to validate the nonlinear portion of the formulation. The nonlinear system of equations is iteratively solved using a form of Newton-Raphson iteration scheme developed for differential equations of continuous systems. The formulation is then applied to determine the nonlinear steady state trim and aeroelastic stability of a rotor blade in hover with two branches at the root. A comprehensive computer program is developed and is used to obtain numerical results for the (1) free vibration, (2) nonlinearly deformed steady state, (3) free vibration about the nonlinearly deformed steady state, and (4) aeroelastic stability tasks. The numerical results obtained by the present method agree with results from other methods.

Extending radiative transfer models by use of Bayes rule. [in atmospheric science

NASA Technical Reports Server (NTRS)

Whitney, C.

1977-01-01

This paper presents a procedure that extends some existing radiative transfer modeling techniques to problems in atmospheric science where curvature and layering of the medium and dynamic range and angular resolution of the signal are important. Example problems include twilight and limb scan simulations. Techniques that are extended include successive orders of scattering, matrix operator, doubling, Gauss-Seidel iteration, discrete ordinates and spherical harmonics. The procedure for extending them is based on Bayes' rule from probability theory.

Thermal form-factor approach to dynamical correlation functions of integrable lattice models

NASA Astrophysics Data System (ADS)

Göhmann, Frank; Karbach, Michael; Klümper, Andreas; Kozlowski, Karol K.; Suzuki, Junji

2017-11-01

We propose a method for calculating dynamical correlation functions at finite temperature in integrable lattice models of Yang-Baxter type. The method is based on an expansion of the correlation functions as a series over matrix elements of a time-dependent quantum transfer matrix rather than the Hamiltonian. In the infinite Trotter-number limit the matrix elements become time independent and turn into the thermal form factors studied previously in the context of static correlation functions. We make this explicit with the example of the XXZ model. We show how the form factors can be summed utilizing certain auxiliary functions solving finite sets of nonlinear integral equations. The case of the XX model is worked out in more detail leading to a novel form-factor series representation of the dynamical transverse two-point function.

Systems identification technology development for large space systems

NASA Technical Reports Server (NTRS)

Armstrong, E. S.

1982-01-01

A methodology for synthesizinng systems identification, both parameter and state, estimation and related control schemes for flexible aerospace structures is developed with emphasis on the Maypole hoop column antenna as a real world application. Modeling studies of the Maypole cable hoop membrane type antenna are conducted using a transfer matrix numerical analysis approach. This methodology was chosen as particularly well suited for handling a large number of antenna configurations of a generic type. A dedicated transfer matrix analysis, both by virtue of its specialization and the inherently easy compartmentalization of the formulation and numerical procedures, is significantly more efficient not only in computer time required but, more importantly, in the time needed to review and interpret the results.

Cortical dipole imaging using truncated total least squares considering transfer matrix error.

PubMed

Hori, Junichi; Takeuchi, Kosuke

2013-01-01

Cortical dipole imaging has been proposed as a method to visualize electroencephalogram in high spatial resolution. We investigated the inverse technique of cortical dipole imaging using a truncated total least squares (TTLS). The TTLS is a regularization technique to reduce the influence from both the measurement noise and the transfer matrix error caused by the head model distortion. The estimation of the regularization parameter was also investigated based on L-curve. The computer simulation suggested that the estimation accuracy was improved by the TTLS compared with Tikhonov regularization. The proposed method was applied to human experimental data of visual evoked potentials. We confirmed the TTLS provided the high spatial resolution of cortical dipole imaging.

Coherent Microwave Scattering Model of Marsh Grass

NASA Astrophysics Data System (ADS)

Duan, Xueyang; Jones, Cathleen E.

2017-12-01

In this work, we developed an electromagnetic scattering model to analyze radar scattering from tall-grass-covered lands such as wetlands and marshes. The model adopts the generalized iterative extended boundary condition method (GIEBCM) algorithm, previously developed for buried cylindrical media such as vegetation roots, to simulate the scattering from the grass layer. The major challenge of applying GIEBCM to tall grass is the extremely time-consuming iteration among the large number of short subcylinders building up the grass. To overcome this issue, we extended the GIEBCM to multilevel GIEBCM, or M-GIEBCM, in which we first use GIEBCM to calculate a T matrix (transition matrix) database of "straws" with various lengths, thicknesses, orientations, curvatures, and dielectric properties; we then construct the grass with a group of straws from the database and apply GIEBCM again to calculate the T matrix of the overall grass scene. The grass T matrix is transferred to S matrix (scattering matrix) and combined with the ground S matrix, which is computed using the stabilized extended boundary condition method, to obtain the total scattering. In this article, we will demonstrate the capability of the model by simulating scattering from scenes with different grass densities, different grass structures, different grass water contents, and different ground moisture contents. This model will help with radar experiment design and image interpretation for marshland and wetland observations.

An Algebraic Construction of Duality Functions for the Stochastic {U_q( A_n^{(1)})} Vertex Model and Its Degenerations

NASA Astrophysics Data System (ADS)

Kuan, Jeffrey

2018-03-01

A recent paper (Kuniba in Nucl Phys B 913:248-277, 2016) introduced the stochastic U}_q(A_n^{(1)})} vertex model. The stochastic S-matrix is related to the R-matrix of the quantum group {U_q(A_n^{(1)})} by a gauge transformation. We will show that a certain function {D^+_{m intertwines with the transfer matrix and its space reversal. When interpreting the transfer matrix as the transition matrix of a discrete-time totally asymmetric particle system on the one-dimensional lattice Z , the function {D^+m} becomes a Markov duality function {Dm} which only depends on q and the vertical spin parameters μ_x. By considering degenerations in the spectral parameter, the duality results also hold on a finite lattice with closed boundary conditions, and for a continuous-time degeneration. This duality function had previously appeared in a multi-species ASEP(q, j) process (Kuan in A multi-species ASEP(q, j) and q-TAZRP with stochastic duality, 2017). The proof here uses that the R-matrix intertwines with the co-product, but does not explicitly use the Yang-Baxter equation. It will also be shown that the stochastic U}_q(A_n^{(1)})} is a multi-species version of a stochastic vertex model studied in Borodin and Petrov (Higher spin six vertex model and symmetric rational functions, 2016) and Corwin and Petrov (Commun Math Phys 343:651-700, 2016). This will be done by generalizing the fusion process of Corwin and Petrov (2016) and showing that it matches the fusion of Kulish and yu (Lett Math Phys 5:393-403, 1981) up to the gauge transformation. We also show, by direct computation, that the multi-species q-Hahn Boson process (which arises at a special value of the spectral parameter) also satisfies duality with respect to D_∞, generalizing the single-species result of Corwin (Int Math Res Not 2015:5577-5603, 2015).

Comparison of Five System Identification Algorithms for Rotorcraft Higher Harmonic Control

NASA Technical Reports Server (NTRS)

Jacklin, Stephen A.

1998-01-01

This report presents an analysis and performance comparison of five system identification algorithms. The methods are presented in the context of identifying a frequency-domain transfer matrix for the higher harmonic control (HHC) of helicopter vibration. The five system identification algorithms include three previously proposed methods: (1) the weighted-least- squares-error approach (in moving-block format), (2) the Kalman filter method, and (3) the least-mean-squares (LMS) filter method. In addition there are two new ones: (4) a generalized Kalman filter method and (5) a generalized LMS filter method. The generalized Kalman filter method and the generalized LMS filter method were derived as extensions of the classic methods to permit identification by using more than one measurement per identification cycle. Simulation results are presented for conditions ranging from the ideal case of a stationary transfer matrix and no measurement noise to the more complex cases involving both measurement noise and transfer-matrix variation. Both open-loop identification and closed- loop identification were simulated. Closed-loop mode identification was more challenging than open-loop identification because of the decreasing signal-to-noise ratio as the vibration became reduced. The closed-loop simulation considered both local-model identification, with measured vibration feedback and global-model identification with feedback of the identified uncontrolled vibration. The algorithms were evaluated in terms of their accuracy, stability, convergence properties, computation speeds, and relative ease of implementation.

Diffuse charge and Faradaic reactions in porous electrodes

NASA Astrophysics Data System (ADS)

Biesheuvel, P. M.; Fu, Yeqing; Bazant, Martin Z.

2011-06-01

Porous electrodes instead of flat electrodes are widely used in electrochemical systems to boost storage capacities for ions and electrons, to improve the transport of mass and charge, and to enhance reaction rates. Existing porous electrode theories make a number of simplifying assumptions: (i) The charge-transfer rate is assumed to depend only on the local electrostatic potential difference between the electrode matrix and the pore solution, without considering the structure of the double layer (DL) formed in between; (ii) the charge-transfer rate is generally equated with the salt-transfer rate not only at the nanoscale of the matrix-pore interface, but also at the macroscopic scale of transport through the electrode pores. In this paper, we extend porous electrode theory by including the generalized Frumkin-Butler-Volmer model of Faradaic reaction kinetics, which postulates charge transfer across the molecular Stern layer located in between the electron-conducting matrix phase and the plane of closest approach for the ions in the diffuse part of the DL. This is an elegant and purely local description of the charge-transfer rate, which self-consistently determines the surface charge and does not require consideration of reference electrodes or comparison with a global equilibrium. For the description of the DLs, we consider the two natural limits: (i) the classical Gouy-Chapman-Stern model for thin DLs compared to the macroscopic pore dimensions, e.g., for high-porosity metallic foams (macropores >50 nm) and (ii) a modified Donnan model for strongly overlapping DLs, e.g., for porous activated carbon particles (micropores <2 nm). Our theory is valid for electrolytes where both ions are mobile, and it accounts for voltage and concentration differences not only on the macroscopic scale of the full electrode, but also on the local scale of the DL. The model is simple enough to allow us to derive analytical approximations for the steady-state and early transients. We also present numerical solutions to validate the analysis and to illustrate the evolution of ion densities, pore potential, surface charge, and reaction rates in response to an applied voltage.

Integrable Floquet dynamics, generalized exclusion processes and "fused" matrix ansatz

NASA Astrophysics Data System (ADS)

Vanicat, Matthieu

2018-04-01

We present a general method for constructing integrable stochastic processes, with two-step discrete time Floquet dynamics, from the transfer matrix formalism. The models can be interpreted as a discrete time parallel update. The method can be applied for both periodic and open boundary conditions. We also show how the stationary distribution can be built as a matrix product state. As an illustration we construct parallel discrete time dynamics associated with the R-matrix of the SSEP and of the ASEP, and provide the associated stationary distributions in a matrix product form. We use this general framework to introduce new integrable generalized exclusion processes, where a fixed number of particles is allowed on each lattice site in opposition to the (single particle) exclusion process models. They are constructed using the fusion procedure of R-matrices (and K-matrices for open boundary conditions) for the SSEP and ASEP. We develop a new method, that we named "fused" matrix ansatz, to build explicitly the stationary distribution in a matrix product form. We use this algebraic structure to compute physical observables such as the correlation functions and the mean particle current.

Electrical transport engineering of semiconductor superlattice structures

NASA Astrophysics Data System (ADS)

Shokri, Aliasghar

2014-04-01

We investigate the influence of doping concentration on band structures of electrons and electrical transmission in a typical aperiodic semiconductor superlattice consisting of quantum well and barrier layers, theoretically. For this purpose, we assume that each unit cell of the superlattice contains alternately two types of material GaAs (as a well) and GaAlAs (as a barrier) with six sublayers of two materials. Our calculations are based on the generalized Kronig-Penny (KP) model and the transfer matrix method within the framework of the parabolic conductance band effective mass approximation in the coherent regime. This model reduces the numerical calculation time and enables us to use the transfer matrix method to investigate transport in the superlattices. We show that by varying the doping concentration and geometrical parameters, one can easily block the transmission of the electrons. The numerical results may be useful in designing of nanoenergy filter devices.

Mechanical Properties of Nanostructured Materials Determined Through Molecular Modeling Techniques

NASA Technical Reports Server (NTRS)

Clancy, Thomas C.; Gates, Thomas S.

2005-01-01

The potential for gains in material properties over conventional materials has motivated an effort to develop novel nanostructured materials for aerospace applications. These novel materials typically consist of a polymer matrix reinforced with particles on the nanometer length scale. In this study, molecular modeling is used to construct fully atomistic models of a carbon nanotube embedded in an epoxy polymer matrix. Functionalization of the nanotube which consists of the introduction of direct chemical bonding between the polymer matrix and the nanotube, hence providing a load transfer mechanism, is systematically varied. The relative effectiveness of functionalization in a nanostructured material may depend on a variety of factors related to the details of the chemical bonding and the polymer structure at the nanotube-polymer interface. The objective of this modeling is to determine what influence the details of functionalization of the carbon nanotube with the polymer matrix has on the resulting mechanical properties. By considering a range of degree of functionalization, the structure-property relationships of these materials is examined and mechanical properties of these models are calculated using standard techniques.

Force-Induced Unfolding of Fibronectin in the Extracellular Matrix of Living Cells

PubMed Central

Smith, Michael L; Gourdon, Delphine; Little, William C; Kubow, Kristopher E; Eguiluz, R. Andresen; Luna-Morris, Sheila; Vogel, Viola

2007-01-01

Whether mechanically unfolded fibronectin (Fn) is present within native extracellular matrix fibrils is controversial. Fn extensibility under the influence of cell traction forces has been proposed to originate either from the force-induced lengthening of an initially compact, folded quaternary structure as is found in solution (quaternary structure model, where the dimeric arms of Fn cross each other), or from the force-induced unfolding of type III modules (unfolding model). Clarification of this issue is central to our understanding of the structural arrangement of Fn within fibrils, the mechanism of fibrillogenesis, and whether cryptic sites, which are exposed by partial protein unfolding, can be exposed by cell-derived force. In order to differentiate between these two models, two fluorescence resonance energy transfer schemes to label plasma Fn were applied, with sensitivity to either compact-to-extended conformation (arm separation) without loss of secondary structure or compact-to-unfolded conformation. Fluorescence resonance energy transfer studies revealed that a significant fraction of fibrillar Fn within a three-dimensional human fibroblast matrix is partially unfolded. Complete relaxation of Fn fibrils led to a refolding of Fn. The compactly folded quaternary structure with crossed Fn arms, however, was never detected within extracellular matrix fibrils. We conclude that the resting state of Fn fibrils does not contain Fn molecules with crossed-over arms, and that the several-fold extensibility of Fn fibrils involves the unfolding of type III modules. This could imply that Fn might play a significant role in mechanotransduction processes. PMID:17914904

Fragment charge difference method for estimating donor-acceptor electronic coupling: Application to DNA π-stacks

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Rösch, Notker

2002-09-01

The purpose of this communication is two-fold. We introduce the fragment charge difference (FCD) method to estimate the electron transfer matrix element HDA between a donor D and an acceptor A, and we apply this method to several aspects of hole transfer electronic couplings in π-stacks of DNA, including systems with several donor-acceptor sites. Within the two-state model, our scheme can be simplified to recover a convenient estimate of the electron transfer matrix element HDA=(1-Δq2)1/2(E2-E1)/2 based on the vertical excitation energy E2-E1 and the charge difference Δq between donor and acceptor. For systems with strong charge separation, Δq≳0.95, one should resort to the FCD method. As favorable feature, we demonstrate the stability of the FCD approach for systems which require an approach beyond the two-state model. On the basis of ab initio calculations of various DNA related systems, we compared three approaches for estimating the electronic coupling: the minimum splitting method, the generalized Mulliken-Hush (GMH) scheme, and the FCD approach. We studied the sensitivity of FCD and GMH couplings to the donor-acceptor energy gap and found both schemes to be quite robust; they are applicable also in cases where donor and acceptor states are off resonance. In the application to π-stacks of DNA, we demonstrated for the Watson-Crick pair dimer [(GC),(GC)] how structural changes considerably affect the coupling strength of electron hole transfer. For models of three Watson-Crick pairs, we showed that the two-state model significantly overestimates the hole transfer coupling whereas simultaneous treatment of several states leads to satisfactory results.

Lattice Virasoro algebra and corner transfer matrices in the Baxter eight-vertex model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Itoyama, H.; Thacker, H.B.

1987-04-06

A lattice Virasoro algebra is constructed for the Baxter eight-vertex model. The operator L/sub 0/ is obtained from the logarithm of the corner transfer matrix and is given by the first moment of the XYZ spin-chain Hamiltonian. The algebra is valid even when the Hamiltonian includes a mass term, in which case it represents lattice coordinate transformations which distinguish between even and odd sublattices. We apply the quantum inverse scattering method to demonstrate that the Virasoro algebra follows from the Yang-Baxter relations.

Murt user`s guide: A hybrid Lagrangian-Eulerian finite element model of multiple-pore-region solute transport through subsurface media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gwo, J.P.; Jardine, P.M.; Yeh, G.T.

Matrix diffusion, a diffusive mass transfer process,in the structured soils and geologic units at ORNL, is believe to be an important subsurface mass transfer mechanism; it may affect off-site movement of radioactive wastes and remediation of waste disposal sites by locally exchanging wastes between soil/rock matrix and macropores/fractures. Advective mass transfer also contributes to waste movement but is largely neglected by researchers. This report presents the first documented 2-D multiregion solute transport code (MURT) that incorporates not only diffusive but also advective mass transfer and can be applied to heterogeneous porous media under transient flow conditions. In this report, theoreticalmore » background is reviewed and the derivation of multiregion solute transport equations is presented. Similar to MURF (Gwo et al. 1994), a multiregion subsurface flow code, multiplepore domains as suggested by previous investigators (eg, Wilson and Luxmoore 1988) can be implemented in MURT. Transient or steady-state flow fields of the pore domains can be either calculated by MURF or by modelers. The mass transfer process is briefly discussed through a three-pore-region multiregion solute transport mechanism. Mass transfer equations that describe mass flux across pore region interfaces are also presented and parameters needed to calculate mass transfer coefficients detailed. Three applications of MURT (tracer injection problem, sensitivity analysis of advective and diffusive mass transfer, hillslope ponding infiltration and secondary source problem) were simulated and results discussed. Program structure of MURT and functions of MURT subroutiness are discussed so that users can adapt the code; guides for input data preparation are provided in appendices.« less

Growth and substrate consumption of Nitrobacter agilis cells immobilized in carrageenan: part 1. Dynamic modeling.

PubMed

de Gooijer, C D; Wijffels, R H; Tramper, J

1991-07-01

The modeling of the growth of Nitrobacter agilis cell immobilized in kappa-carrageenan is presented. A detailed description is given of the modeling of internal diffusion and growth of cells in the support matrix in addition to external mass transfer resistance. The model predicts the substrate and biomass profiles in the support as well as the macroscopic oxygen consumption rate of the immobilized biocatalyst in time. The model is tested by experiments with continuously operated airlift loop reactors containing cells immobilized in kappa-carrageenan. The model describes experimental data very well. It is clearly shown that external mass transfer may not be neglected. Furthermore, a sensitivity analysis of the parameters at their values during the experiments revealed that apart from the radius of the spheres and the substrate bulk concentration, the external mass transfer resistance coefficient is the most sensitive parameter for our case.

Matrix heat exchanger including a liquid, thermal couplant

DOEpatents

Fewell, Thomas E.; Ward, Charles T.

1976-01-01

A tube-to-tube heat exchanger is disclosed with a thermally conductive matrix between and around the tubes to define annuli between the tubes and matrix. The annuli are filled to a level with a molten metal or alloy to provide a conductive heat transfer path from one tube through the matrix to the second tube. A matrix heat exchanger of this type is particularly useful for heat transfer between fluids which would react should one leak into the second.

A Transfer Hamiltonian Model for Devices Based on Quantum Dot Arrays

PubMed Central

Illera, S.; Prades, J. D.; Cirera, A.; Cornet, A.

2015-01-01

We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide. PMID:25879055

Matrix-algebra-based calculations of the time evolution of the binary spin-bath model for magnetization transfer.

PubMed

Müller, Dirk K; Pampel, André; Möller, Harald E

2013-05-01

Quantification of magnetization-transfer (MT) experiments are typically based on the assumption of the binary spin-bath model. This model allows for the extraction of up to six parameters (relative pool sizes, relaxation times, and exchange rate constants) for the characterization of macromolecules, which are coupled via exchange processes to the water in tissues. Here, an approach is presented for estimating MT parameters acquired with arbitrary saturation schemes and imaging pulse sequences. It uses matrix algebra to solve the Bloch-McConnell equations without unwarranted simplifications, such as assuming steady-state conditions for pulsed saturation schemes or neglecting imaging pulses. The algorithm achieves sufficient efficiency for voxel-by-voxel MT parameter estimations by using a polynomial interpolation technique. Simulations, as well as experiments in agar gels with continuous-wave and pulsed MT preparation, were performed for validation and for assessing approximations in previous modeling approaches. In vivo experiments in the normal human brain yielded results that were consistent with published data. Copyright © 2013 Elsevier Inc. All rights reserved.

A transfer hamiltonian model for devices based on quantum dot arrays.

PubMed

Illera, S; Prades, J D; Cirera, A; Cornet, A

2015-01-01

We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide.

Matrix Characterization and Development for the Vacuum Assisted Resin Transfer Molding Process

NASA Technical Reports Server (NTRS)

Grimsley, B. W.; Hubert, P.; Hou, T. H.; Cano, R. J.; Loos, A. C.; Pipes, R. B.

2001-01-01

The curing kinetics and viscosity of an epoxy resin system, SI-ZG-5A, have been characterized for application in the vacuum assisted resin transfer molding (VARTM) process. Impregnation of a typical carbon fiber perform provided the test bed for the characterization. Process simulations were carried out using the process model, COMPRO, to examine heat transfer and curing kinetics for a fully impregnated panel, neglecting resin flow. The predicted viscosity profile and final degree of cure were found to be in good agreement with experimental observations.

Development of a poly(dimethylacrylamide) based matrix material for solid phase high density peptide array synthesis employing a laser based material transfer

NASA Astrophysics Data System (ADS)

Ridder, Barbara; Foertsch, Tobias C.; Welle, Alexander; Mattes, Daniela S.; von Bojnicic-Kninski, Clemens M.; Loeffler, Felix F.; Nesterov-Mueller, Alexander; Meier, Michael A. R.; Breitling, Frank

2016-12-01

Poly(dimethylacrylamide) (PDMA) based matrix materials were developed for laser-based in situ solid phase peptide synthesis to produce high density arrays. In this specific array synthesis approach, amino acid derivatives are embedded into a matrix material, serving as a ;solid; solvent material at room temperature. Then, a laser pulse transfers this mixture to the target position on a synthesis slide, where the peptide array is synthesized. Upon heating above the glass transition temperature of the matrix material, it softens, allowing diffusion of the amino acid derivatives to the synthesis surface and serving as a solvent for peptide bond formation. Here, we synthesized PDMA six-arm star polymers, offering the desired matrix material properties, using atom transfer radical polymerization. With the synthesized polymers as matrix material, we structured and synthesized arrays with combinatorial laser transfer. With densities of up to 20,000 peptide spots per cm2, the resolution could be increased compared to the commercially available standard matrix material. Time-of-Flight Secondary Ion Mass Spectrometry experiments revealed the penetration behavior of an amino acid derivative into the prepared acceptor synthesis surface and the effectiveness of the washing protocols.

Resonant electronic excitation energy transfer by exchange mechanism in the quantum dot system

NASA Astrophysics Data System (ADS)

Chikalova-Luzina, O. P.; Samosvat, D. M.; Vyatkin, V. M.; Zegrya, G. G.

2017-11-01

A microscopic theory of nonradiative resonance energy transfer between spherical A3B5 semiconductor quantum dots by the exchange mechanism is suggested. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same A3B5 compound and are embedded in the matrix of another material that produces potential barriers for electrons and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found in the frame of the Kane model that provides the most adequate description of the real spectra of A3B5 semiconductors. The analytical treatment is carried out with using the density matrix method, which enabled us to perform an energy transfer analysis both in the weak-interaction approximation and in the strong-interaction approximation. The numerical calculations showed the saturation of the energy transfer rate at the distances between the donor and the acceptor approaching the contact one. The contributions of the exchange and direct Coulomb intractions can be of the same order at the small distances and can have the same value in the saturation range.

A micromechanical model to explain the mechanical properties of bovine cortical bone in tension: In vitro fluoride ion effects

NASA Astrophysics Data System (ADS)

Kotha, Shiva Prasad

Bone mineral and bone organic are assumed to be a linearly elastic, brittle material. A simple micromechanical model based on the shear lag theory is developed to model the stress transfer between the mineral platelets of bone. The bone mineral platelets carry most of the applied load while the organic primarily serves to transfer load between the overlapped mineral platelets by shear. Experiments were done to elucidate the mechanism of failure in bovine cortical bone and to decrease the mineral content of control bone with in-vitro fluoride ion treatments. It was suggested that the failure at the ultrastructural level is due to the transverse failure of bonds between the collagen microfibrils in the organic matrix. However, the shear stress transfer and the axial load bearing capacity of the organic is not impaired. Hence, it is assumed that the shear strain in the matrix increases while the shear stress remains constant at the shear yield stress once the matrix starts yielding at the ends of the bone mineral. When the shear stress over the length of the mineral platelet reaches the shear yield stress, no more applied stress is carried by the bone mineral platelets while the organic matrix carries the increased axial load. The bone fails when the axial stress in the organic reaches its ultimate stress. The bone mineral is assumed to dissolve due to in-vitro fluoride ion treatments and precipitate calcium fluoride or fluoroapatite like material. The amount of dissolution is estimated based on 19F Nuclear Magnetic Resonance or a decrease in the carbonate content of bone. The dissolution of bone mineral is assumed to increase the porosity in the organic. We assume that the elastic modulus and the ultimate strength of the organic decrease due to the increased porosity. A simple empirical model is used to model the decrease in the elastic modulus. The strength is modeled to decrease based on an increase in the cross-sectional area occupied by the porosity. The precipitate is assumed to contribute to the mechanical properties of bone due to friction generated by the poisson's contraction of the organic as it carries axial loads. The resulting stress-strain curve predicted by the model resembles the stress-strain curves obtained in the experiments.

Review of Recent Developments on Using an Off-Lattice Monte Carlo Approach to Predict the Effective Thermal Conductivity of Composite Systems with Complex Structures

PubMed Central

Gong, Feng; Duong, Hai M.; Papavassiliou, Dimitrios V.

2016-01-01

Here, we present a review of recent developments for an off-lattice Monte Carlo approach used to investigate the thermal transport properties of multiphase composites with complex structure. The thermal energy was quantified by a large number of randomly moving thermal walkers. Different modes of heat conduction were modeled in appropriate ways. The diffusive heat conduction in the polymer matrix was modeled with random Brownian motion of thermal walkers within the polymer, and the ballistic heat transfer within the carbon nanotubes (CNTs) was modeled by assigning infinite speed of thermal walkers in the CNTs. Three case studies were conducted to validate the developed approach, including three-phase single-walled CNTs/tungsten disulfide (WS2)/(poly(ether ether ketone) (PEEK) composites, single-walled CNT/WS2/PEEK composites with the CNTs clustered in bundles, and complex graphene/poly(methyl methacrylate) (PMMA) composites. In all cases, resistance to heat transfer due to nanoscale phenomena was also modeled. By quantitatively studying the influencing factors on the thermal transport properties of the multiphase composites, it was found that the orientation, aggregation and morphology of fillers, as well as the interfacial thermal resistance at filler-matrix interfaces would limit the transfer of heat in the composites. These quantitative findings may be applied in the design and synthesis of multiphase composites with specific thermal transport properties. PMID:28335270

Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

NASA Technical Reports Server (NTRS)

Murthy, V. R.

1985-01-01

The bearingless rotorcraft offers reduced weight, less complexity and superior flying qualities. Almost all the current industrial structural dynamic programs of conventional rotors which consist of single load path rotor blades employ the transfer matrix method to determine natural vibration characteristics because this method is ideally suited for one dimensional chain like structures. This method is extended to multiple load path rotor blades without resorting to an equivalent single load path approximation. Unlike the conventional blades, it isk necessary to introduce the axial-degree-of-freedom into the solution process to account for the differential axial displacements in the different load paths. With the present extension, the current rotor dynamic programs can be modified with relative ease to account for the multiple load paths without resorting to the equivalent single load path modeling. The results obtained by the transfer matrix method are validated by comparing with the finite element solutions. A differential stiffness matrix due to blade rotation is derived to facilitate the finite element solutions.

The critical boundary RSOS M(3,5) model

NASA Astrophysics Data System (ADS)

El Deeb, O.

2017-12-01

We consider the critical nonunitary minimal model M(3, 5) with integrable boundaries and analyze the patterns of zeros of the eigenvalues of the transfer matrix and then determine the spectrum of the critical theory using the thermodynamic Bethe ansatz ( TBA) equations. Solving the TBA functional equation satisfied by the transfer matrices of the associated A 4 restricted solid-on-solid Forrester-Baxter lattice model in regime III in the continuum scaling limit, we derive the integral TBA equations for all excitations in the ( r, s) = (1, 1) sector and then determine their corresponding energies. We classify the excitations in terms of ( m, n) systems.

Momentum loss in proton-nucleus and nucleus-nucleus collisions

NASA Technical Reports Server (NTRS)

Khan, Ferdous; Townsend, Lawrence W.

1993-01-01

An optical model description, based on multiple scattering theory, of longitudinal momentum loss in proton-nucleus and nucleus-nucleus collisions is presented. The crucial role of the imaginary component of the nucleon-nucleon transition matrix in accounting for longitudinal momentum transfer is demonstrated. Results obtained with this model are compared with Intranuclear Cascade (INC) calculations, as well as with predictions from Vlasov-Uehling-Uhlenbeck (VUU) and quantum molecular dynamics (QMD) simulations. Comparisons are also made with experimental data where available. These indicate that the present model is adequate to account for longitudinal momentum transfer in both proton-nucleus and nucleus-nucleus collisions over a wide range of energies.

Tensile failure criteria for fiber composite materials

NASA Technical Reports Server (NTRS)

Rosen, B. W.; Zweben, C. H.

1972-01-01

The analysis provides insight into the failure mechanics of these materials and defines criteria which serve as tools for preliminary design material selection and for material reliability assessment. The model incorporates both dispersed and propagation type failures and includes the influence of material heterogeneity. The important effects of localized matrix damage and post-failure matrix shear stress transfer are included in the treatment. The model is used to evaluate the influence of key parameters on the failure of several commonly used fiber-matrix systems. Analyses of three possible failure modes were developed. These modes are the fiber break propagation mode, the cumulative group fracture mode, and the weakest link mode. Application of the new model to composite material systems has indicated several results which require attention in the development of reliable structural composites. Prominent among these are the size effect and the influence of fiber strength variability.

Estimates of electronic coupling for excess electron transfer in DNA

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.

2005-07-01

Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.

Combined heat and mass transfer device for improving separation process

DOEpatents

Tran, Thanh Nhon

1999-01-01

A two-phase small channel heat exchange matrix simultaneously provides for heat transfer and mass transfer between the liquid and vapor phases of a multi-component mixture at a single, predetermined location within a separation column, significantly improving the thermodynamic efficiency of the separation process. The small channel heat exchange matrix is composed of a series of channels having a hydraulic diameter no greater than 5.0 millimeters for conducting a two-phase coolant. In operation, the matrix provides the liquid-vapor contacting surfaces within the separation column, such that heat and mass are transferred simultaneously between the liquid and vapor phases. The two-phase coolant allows for a uniform heat transfer coefficient to be maintained along the length of the channels and across the surface of the matrix. Preferably, a perforated, concave sheet connects each channel to an adjacent channel to facilitate the flow of the liquid and vapor phases within the column and to increase the liquid-vapor contacting surface area.

Combined heat and mass transfer device for improving separation process

DOEpatents

Tran, T.N.

1999-08-24

A two-phase small channel heat exchange matrix simultaneously provides for heat transfer and mass transfer between the liquid and vapor phases of a multi-component mixture at a single, predetermined location within a separation column, significantly improving the thermodynamic efficiency of the separation process. The small channel heat exchange matrix is composed of a series of channels having a hydraulic diameter no greater than 5.0 millimeters for conducting a two-phase coolant. In operation, the matrix provides the liquid-vapor contacting surfaces within the separation column, such that heat and mass are transferred simultaneously between the liquid and vapor phases. The two-phase coolant allows for a uniform heat transfer coefficient to be maintained along the length of the channels and across the surface of the matrix. Preferably, a perforated, concave sheet connects each channel to an adjacent channel to facilitate the flow of the liquid and vapor phases within the column and to increase the liquid-vapor contacting surface area. 12 figs.

Laser Pulse Width Dependence and Ionization Mechanism of Matrix-Assisted Laser Desorption/Ionization

NASA Astrophysics Data System (ADS)

Liang, Sheng-Ping; Lu, I.-Chung; Tsai, Shang-Ting; Chen, Jien-Lian; Lee, Yuan Tseh; Ni, Chi-Kung

2017-10-01

Ultraviolet laser pulses at 355 nm with variable pulse widths in the region from 170 ps to 1.5 ns were used to investigate the ionization mechanism of matrix-assisted laser desorption/ionization (MALDI) for matrices 2,5-dihydroxybenzoic acid (DHB), α-cyano-4-hydroxycinnamic acid (CHCA), and sinapinic acid (SA). The mass spectra of desorbed ions and the intensity and velocity distribution of desorbed neutrals were measured simultaneously for each laser shot. These quantities were found to be independent of the laser pulse width. A comparison of the experimental measurements and numerical simulations according to the multiphoton ionization, coupled photophysical and chemical dynamics (CPCD), and thermally induced proton transfer models showed that the predictions of thermally induced proton transfer model were in agreement with the experimental data, but those of the multiphoton ionization model were not. Moreover, the predictions of the CPCD model based on singlet-singlet energy pooling were inconsistent with the experimental data of CHCA and SA, but were consistent with the experimental data of DHB only when some parameters used in the model were adjusted to extreme values. [Figure not available: see fulltext.

Predicting plant protein subcellular multi-localization by Chou's PseAAC formulation based multi-label homolog knowledge transfer learning.

PubMed

Mei, Suyu

2012-10-07

Recent years have witnessed much progress in computational modeling for protein subcellular localization. However, there are far few computational models for predicting plant protein subcellular multi-localization. In this paper, we propose a multi-label multi-kernel transfer learning model for predicting multiple subcellular locations of plant proteins (MLMK-TLM). The method proposes a multi-label confusion matrix and adapts one-against-all multi-class probabilistic outputs to multi-label learning scenario, based on which we further extend our published work MK-TLM (multi-kernel transfer learning based on Chou's PseAAC formulation for protein submitochondria localization) for plant protein subcellular multi-localization. By proper homolog knowledge transfer, MLMK-TLM is applicable to novel plant protein subcellular localization in multi-label learning scenario. The experiments on plant protein benchmark dataset show that MLMK-TLM outperforms the baseline model. Unlike the existing models, MLMK-TLM also reports its misleading tendency, which is important for comprehensive survey of model's multi-labeling performance. Copyright © 2012 Elsevier Ltd. All rights reserved.

Validation of a numerical method for interface-resolving simulation of multicomponent gas-liquid mass transfer and evaluation of multicomponent diffusion models

NASA Astrophysics Data System (ADS)

Woo, Mino; Wörner, Martin; Tischer, Steffen; Deutschmann, Olaf

2018-03-01

The multicomponent model and the effective diffusivity model are well established diffusion models for numerical simulation of single-phase flows consisting of several components but are seldom used for two-phase flows so far. In this paper, a specific numerical model for interfacial mass transfer by means of a continuous single-field concentration formulation is combined with the multicomponent model and effective diffusivity model and is validated for multicomponent mass transfer. For this purpose, several test cases for one-dimensional physical or reactive mass transfer of ternary mixtures are considered. The numerical results are compared with analytical or numerical solutions of the Maxell-Stefan equations and/or experimental data. The composition-dependent elements of the diffusivity matrix of the multicomponent and effective diffusivity model are found to substantially differ for non-dilute conditions. The species mole fraction or concentration profiles computed with both diffusion models are, however, for all test cases very similar and in good agreement with the analytical/numerical solutions or measurements. For practical computations, the effective diffusivity model is recommended due to its simplicity and lower computational costs.

Transient radiative transfer in a scattering slab considering polarization.

PubMed

Yi, Hongliang; Ben, Xun; Tan, Heping

2013-11-04

The characteristics of the transient and polarization must be considered for a complete and correct description of short-pulse laser transfer in a scattering medium. A Monte Carlo (MC) method combined with a time shift and superposition principle is developed to simulate transient vector (polarized) radiative transfer in a scattering medium. The transient vector radiative transfer matrix (TVRTM) is defined to describe the transient polarization behavior of short-pulse laser propagating in the scattering medium. According to the definition of reflectivity, a new criterion of reflection at Fresnel surface is presented. In order to improve the computational efficiency and accuracy, a time shift and superposition principle is applied to the MC model for transient vector radiative transfer. The results for transient scalar radiative transfer and steady-state vector radiative transfer are compared with those in published literatures, respectively, and an excellent agreement between them is observed, which validates the correctness of the present model. Finally, transient radiative transfer is simulated considering the polarization effect of short-pulse laser in a scattering medium, and the distributions of Stokes vector in angular and temporal space are presented.

Algebraic Bethe ansatz for the XXZ Heisenberg spin chain with triangular boundaries and the corresponding Gaudin model

NASA Astrophysics Data System (ADS)

Manojlović, N.; Salom, I.

2017-10-01

The implementation of the algebraic Bethe ansatz for the XXZ Heisenberg spin chain in the case, when both reflection matrices have the upper-triangular form is analyzed. The general form of the Bethe vectors is studied. In the particular form, Bethe vectors admit the recurrent procedure, with an appropriate modification, used previously in the case of the XXX Heisenberg chain. As expected, these Bethe vectors yield the strikingly simple expression for the off-shell action of the transfer matrix of the chain as well as the spectrum of the transfer matrix and the corresponding Bethe equations. As in the XXX case, the so-called quasi-classical limit gives the off-shell action of the generating function of the corresponding trigonometric Gaudin Hamiltonians with boundary terms.

Transferring elements of a density matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allahverdyan, Armen E.; Hovhannisyan, Karen V.; Yerevan State University, A. Manoogian Street 1, Yerevan

2010-01-15

We study restrictions imposed by quantum mechanics on the process of matrix-element transfer. This problem is at the core of quantum measurements and state transfer. Given two systems A and B with initial density matrices lambda and r, respectively, we consider interactions that lead to transferring certain matrix elements of unknown lambda into those of the final state r-tilde of B. We find that this process eliminates the memory on the transferred (or certain other) matrix elements from the final state of A. If one diagonal matrix element is transferred, r(tilde sign){sub aa}=lambda{sub aa}, the memory on each nondiagonal elementmore » lambda{sub an}ot ={sub b} is completely eliminated from the final density operator of A. Consider the following three quantities, Relambda{sub an}ot ={sub b}, Imlambda{sub an}ot ={sub b}, and lambda{sub aa}-lambda{sub bb} (the real and imaginary part of a nondiagonal element and the corresponding difference between diagonal elements). Transferring one of them, e.g., Rer(tilde sign){sub an}ot ={sub b}=Relambda{sub an}ot ={sub b}, erases the memory on two others from the final state of A. Generalization of these setups to a finite-accuracy transfer brings in a trade-off between the accuracy and the amount of preserved memory. This trade-off is expressed via system-independent uncertainty relations that account for local aspects of the accuracy-disturbance trade-off in quantum measurements. Thus, the general aspect of state disturbance in quantum measurements is elimination of memory on non-diagonal elements, rather than diagonalization.« less

Creep-induced residual stress strengthening in a Nicalon-fiber-reinforced BMAS-glass-ceramic-matrix composite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Widjaja, S.; Jakus, K.; Ritter, J.E.

The feasibility of inducing a compressive residual stress in the matrix of a Nicalon-fiber-reinforced BMAS-glass-ceramic-matrix composite through a creep-load transfer treatment was studied. Specimens were crept at 1100 C under constant tensile load to cause load transfer from the matrix to the fibers, then cooled under load. Upon removal of the load at room temperature, the matrix was put into compression by the elastic recovery of the fibers. This compressive residual stress in the matrix increased the room-temperature proportional limit stress of the composite. The increase in the proportional limit stress was found to be dependent upon the applied creepmore » stress, with an increase in creep stress resulting in an increase in the proportional limit stress. Acoustic emission results showed that the onset of significant matrix cracking correlated closely to the proportional limit stress. Changes in the state of residual stress in the matrix were supported by X-ray diffraction results. Fracture surfaces of all specimens exhibited fiber pullout behavior, indicating that the creep-load transfer process did not embrittle the fiber/matrix interface.« less

In vitro model to study the effects of matrix stiffening on Ca2+ handling and myofilament function in isolated adult rat cardiomyocytes

PubMed Central

Najafi, Aref; Fontoura, Dulce; Valent, Erik; Goebel, Max; Kardux, Kim; Falcão‐Pires, Inês; van der Velden, Jolanda

2017-01-01

Key points This paper describes a novel model that allows exploration of matrix‐induced cardiomyocyte adaptations independent of the passive effect of matrix rigidity on cardiomyocyte function.Detachment of adult cardiomyocytes from the matrix enables the study of matrix effects on cell shortening, Ca2+ handling and myofilament function.Cell shortening and Ca2+ handling are altered in cardiomyocytes cultured for 24 h on a stiff matrix.Matrix stiffness‐impaired cardiomyocyte contractility is reversed upon normalization of extracellular stiffness.Matrix stiffness‐induced reduction in unloaded shortening is more pronounced in cardiomyocytes isolated from obese ZSF1 rats with heart failure with preserved ejection fraction compared to lean ZSF1 rats. Abstract Extracellular matrix (ECM) stiffening is a key element of cardiac disease. Increased rigidity of the ECM passively inhibits cardiac contraction, but if and how matrix stiffening also actively alters cardiomyocyte contractility is incompletely understood. In vitro models designed to study cardiomyocyte–matrix interaction lack the possibility to separate passive inhibition by a stiff matrix from active matrix‐induced alterations of cardiomyocyte properties. Here we introduce a novel experimental model that allows exploration of cardiomyocyte functional alterations in response to matrix stiffening. Adult rat cardiomyocytes were cultured for 24 h on matrices of tuneable stiffness representing the healthy and the diseased heart and detached from their matrix before functional measurements. We demonstrate that matrix stiffening, independent of passive inhibition, reduces cell shortening and Ca2+ handling but does not alter myofilament‐generated force. Additionally, detachment of adult cultured cardiomyocytes allowed the transfer of cells from one matrix to another. This revealed that stiffness‐induced cardiomyocyte changes are reversed when matrix stiffness is normalized. These matrix stiffness‐induced changes in cardiomyocyte function could not be explained by adaptation in the microtubules. Additionally, cardiomyocytes isolated from stiff hearts of the obese ZSF1 rat model of heart failure with preserved ejection fraction show more pronounced reduction in unloaded shortening in response to matrix stiffening. Taken together, we introduce a method that allows evaluation of the influence of ECM properties on cardiomyocyte function separate from the passive inhibitory component of a stiff matrix. As such, it adds an important and physiologically relevant tool to investigate the functional consequences of cardiomyocyte–matrix interactions. PMID:28485491

Analysis of Yb3+/Er3+-codoped microring resonator cross-grid matrices

NASA Astrophysics Data System (ADS)

Vallés, Juan A.; Gǎlǎtuş, Ramona

2014-09-01

An analytic model of the scattering response of a highly Yb3+/Er3+-codoped phosphate glass microring resonator matrix is considered to obtain the transfer functions of an M x N cross-grid microring resonator structure. Then a detailed model is used to calculate the pump and signal propagation, including a microscopic statistical formalism to describe the high-concentration induced energy-transfer mechanisms and passive and active features are combined to realistically simulate the performance as a wavelength-selective amplifier or laser. This analysis allows the optimization of these structures for telecom or sensing applications.

The Linear Parameters and the Decoupling Matrix for Linearly Coupled Motion in 6 Dimensional Phase Space

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parzen, George

It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 x 6 matrix, R. R will be called the decoupling matrix. It will be shown that of the 36 elements of the 6 x 6 decoupling matrix R, only 12 elements are independent. This may be contrasted with the results for motion in 4- dimensional phase space, wheremore » R has 4 independent elements. A set of equations is given from which the 12 elements of R can be computed from the one period transfer matrix. This set of equations also allows the linear parameters, the β i,α i, i = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix. An alternative procedure for computing the linear parameters,β i,α i, i = 1, 3, and the 12 independent elements of the decoupling matrix R is also given which depends on computing the eigenvectors of the one period transfer matrix. These results can be used in a tracking program, where the one period transfer matrix can be computed by multiplying the transfer matrices of all the elements in a period, to compute the linear parameters α i and β i, i = 1, 3, and the elements of the decoupling matrix R. The procedure presented here for studying coupled motion in 6-dimensional phase space can also be applied to coupled motion in 4-dimensional phase space, where it may be a useful alternative procedure to the procedure presented by Edwards and Teng. In particular, it gives a simpler programing procedure for computing the beta functions and the emittances for coupled motion in 4-dimensional phase space.« less

The linear parameters and the decoupling matrix for linearly coupled motion in 6 dimensional phase space. Informal report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parzen, G.

It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 {times} 6 matrix, R. R will be called the decoupling matrix. It will be shown that of the 36 elements of the 6 {times} 6 decoupling matrix R, only 12 elements are independent. This may be contrasted with the results for motion in 4-dimensional phase space, where Rmore » has 4 independent elements. A set of equations is given from which the 12 elements of R can be computed from the one period transfer matrix. This set of equations also allows the linear parameters, {beta}{sub i}, {alpha}{sub i} = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix. An alternative procedure for computing the linear parameters, the {beta}{sub i}, {alpha}{sub i} i = 1, 3, and the 12 independent elements of the decoupling matrix R is also given which depends on computing the eigenvectors of the one period transfer matrix. These results can be used in a tracking program, where the one period transfer matrix can be computed by multiplying the transfer matrices of all the elements in a period, to compute the linear parameters {alpha}{sub i} and {beta}{sub i}, i = 1, 3, and the elements of the decoupling matrix R. The procedure presented here for studying coupled motion in 6-dimensional phase space can also be applied to coupled motion in 4-dimensional phase space, where it may be a useful alternative procedure to the procedure presented by Edwards and Teng. In particular, it gives a simpler programming procedure for computing the beta functions and the emittances for coupled motion in 4-dimensional phase space.« less

Theoretical and material studies on thin-film electroluminescent devices

NASA Technical Reports Server (NTRS)

Summers, C. J.; Brennan, K. F.

1986-01-01

A theoretical study of resonant tunneling in multilayered heterostructures is presented based on an exact solution of the Schroedinger equation under the application of a constant electric field. By use of the transfer matrix approach, the transmissivity of the structure is determined as a function of the incident electron energy. The approach presented is easily extended to many layer structures where it is more accurate than other existing transfer matrix or WKB models. The transmission resonances are compared to the bound state energies calculated for a finite square well under bias using either an asymmetric square well model or the exact solution of an infinite square well under the application of an electric field. The results show good agreement with other existing models as well as with the bound state energies. The calculations were then applied to a new superlattice structure, the variablly spaced superlattice energy filter, (VSSEP) which is designed such that under bias the spatial quantization levels fully align. Based on these calculations, a new class of resonant tunneling superlattice devices can be designed.

Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del

2006-01-20

Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 ({alpha}3{beta}3{gamma}2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the {alpha}3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretionmore » of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials.« less

Rotordynamic Analysis with Shell Elements for the Transfer Matrix Method

DTIC Science & Technology

1989-08-01

consistent kindness and extraordinarily good direction in the completion of this work. I am very pleased to acknowledge my brothers in Christ. Vinai ...modelling used in the transfer ma- trix approach. Rouch et al., (1979), Nelson (1980), To (1981), Greenhill et al., (1985), and Gupta (1986) have all...Reliability in Design, Vol. 107, pp. 4 2 1-4 3 0 . Gupta , A.K., 1986, --Finite Element Analysis of Vibration of Tapered Beams," Shock and Vibration

Interactive Computer Graphics for System Analysis.

DTIC Science & Technology

1983-12-01

seven matrices have a maximum size of 10xlO and are named: AMAT BMAT CMAT DMAT KMAT FMAT GMAT ICECAP-II has available four transfer functions which B-1...is: COPY (source) (destination) The valid source and destination variables are: AMAT CMAT PMAT GTF KMAT BMAT DMAT GMAT HTF OLTF CLTF Transfer functions...Function: gtf, htf, oltf, cltf Enter choice of Matrix: AMAT, BMAT , CMAT, DMAT, FMAT, GMAT, KMAT Enter SETUP in order to set up State Space Model Enter

Evaluation of light extraction efficiency for the light-emitting diodes based on the transfer matrix formalism and ray-tracing method

NASA Astrophysics Data System (ADS)

Pingbo, An; Li, Wang; Hongxi, Lu; Zhiguo, Yu; Lei, Liu; Xin, Xi; Lixia, Zhao; Junxi, Wang; Jinmin, Li

2016-06-01

The internal quantum efficiency (IQE) of the light-emitting diodes can be calculated by the ratio of the external quantum efficiency (EQE) and the light extraction efficiency (LEE). The EQE can be measured experimentally, but the LEE is difficult to calculate due to the complicated LED structures. In this work, a model was established to calculate the LEE by combining the transfer matrix formalism and an in-plane ray tracing method. With the calculated LEE, the IQE was determined and made a good agreement with that obtained by the ABC model and temperature-dependent photoluminescence method. The proposed method makes the determination of the IQE more practical and conventional. Project supported by the National Natural Science Foundation of China (Nos.11574306, 61334009), the China International Science and Technology Cooperation Program (No. 2014DFG62280), and the National High Technology Program of China (No. 2015AA03A101).

Processing of a fiber-reinforced transparent glass matrix composite and study of micromechanics of load transfer from matrix to fiber using micro-fluorescence spectroscopy

NASA Astrophysics Data System (ADS)

Banerjee, Debangshu

The brittleness of monolithic ceramic materials can be overcome by reinforcing them with high strength, high modulus ceramic fibers. These ceramic matrix composites exhibit improved strength, toughness, and work of fracture. Successful design of a ceramic matrix composite (CMC) depends on two factors: proper choice of fiber, matrix, and interface material, and understanding the mechanics of fracture. The conventional techniques for measuring stress and strain at a local level in CMCs are based on indirect experiments and analytical models. In recent years a couple of optical techniques have been explored for non- contact and direct evaluation of the stress and strain in materials, such as laser Raman spectroscopy and fluorescence spectroscopy. In order to employ spectroscopy to study stress in a composite, a transparent matrix was needed. In this study a SiC fiber reinforced transparent glass matrix composite was developed. A tape casting, binder burnout, and sintering route was adopted to achieve the optimum transparency with proper fiber alignment and interfacial properties. Sapphire fibers were used to act as probe to generate fluorescence signals for measuring stress. A fugitive carbon coating was developed to act as a weak interface for the sapphire fiber, which otherwise, forms a strong bond with the matrix. A fixture was designed to apply stress on the composite specimen, in situ, under the microscope of the spectrometer. Using fluorescence spectroscopy, the micromechanics of load transfer from matrix to fibers were studied. Studies were conducted on both strongly and weakly bonded fibers, as well as on single fiber, and multi fiber situations. Residual stresses arising from thermal expansion mismatch have been mapped along the fiber length with resolution in microns. Residual axial stress was found to follow a shear lag profile along the fiber length. A finite residual axial stress was detected at the fiber ends. Correction of the measured stress for sample probe interaction could not eliminate this finite stress completely. Residual axial stress was also found to vary across the fiber cross section. Analytical models predicting the stress variation along the fiber length and across fiber cross section were developed. (Abstract shortened by UMI.)

The Relationship between N-Back Performance and Matrix Reasoning--Implications for Training and Transfer

ERIC Educational Resources Information Center

Jaeggi, Susanne M.; Studer-Luethi, Barbara; Buschkuehl, Martin; Su, Yi-Fen; Jonides, John; Perrig, Walter J.

2010-01-01

We have previously demonstrated that training on a dual n-back task results in improvements in fluid intelligence ("Gf") as measured by matrix reasoning tasks. Here, we explored the underlying mechanisms of this transfer effect in two studies, and we evaluated the transfer potential of a single n-back task. In the first study, we demonstrated that…

Polarimetric signatures of a canopy of dielectric cylinders based on first and second order vector radiative transfer theory

NASA Technical Reports Server (NTRS)

Tsang, Leung; Chan, Chi Hou; Kong, Jin AU; Joseph, James

1992-01-01

Complete polarimetric signatures of a canopy of dielectric cylinders overlying a homogeneous half space are studied with the first and second order solutions of the vector radiative transfer theory. The vector radiative transfer equations contain a general nondiagonal extinction matrix and a phase matrix. The energy conservation issue is addressed by calculating the elements of the extinction matrix and the elements of the phase matrix in a manner that is consistent with energy conservation. Two methods are used. In the first method, the surface fields and the internal fields of the dielectric cylinder are calculated by using the fields of an infinite cylinder. The phase matrix is calculated and the extinction matrix is calculated by summing the absorption and scattering to ensure energy conservation. In the second method, the method of moments is used to calculate the elements of the extinction and phase matrices. The Mueller matrix based on the first order and second order multiple scattering solutions of the vector radiative transfer equation are calculated. Results from the two methods are compared. The vector radiative transfer equations, combined with the solution based on method of moments, obey both energy conservation and reciprocity. The polarimetric signatures, copolarized and depolarized return, degree of polarization, and phase differences are studied as a function of the orientation, sizes, and dielectric properties of the cylinders. It is shown that second order scattering is generally important for vegetation canopy at C band and can be important at L band for some cases.

Modeling of the heat transfer performance of plate-type dispersion nuclear fuel elements

NASA Astrophysics Data System (ADS)

Ding, Shurong; Huo, Yongzhong; Yan, XiaoQing

2009-08-01

Considering the mutual actions between fuel particles and the metal matrix, the three-dimensional finite element models are developed to simulate the heat transfer behaviors of dispersion nuclear fuel plates. The research results indicate that the temperatures of the fuel plate might rise more distinctly with considering the particle swelling and the degraded surface heat transfer coefficients with increasing burnup; the local heating phenomenon within the particles appears when their thermal conductivities are too low. With rise of the surface heat transfer coefficients, the temperatures within the fuel plate decrease; the temperatures of the fuel plate are sensitive to the variations of the heat transfer coefficients whose values are lower, but their effects are weakened and slight when the heat transfer coefficients increase and reach a certain extent. Increasing the heat generation rate leads to elevating the internal temperatures. The temperatures and the maximum temperature differences within the plate increase along with the particle volume fractions. The surface thermal flux goes up along with particle volume fractions and heat generation rates, but the effects of surface heat transfer coefficients are not evident.

Load partitioning between the bcc-iron matrix and NiAl-type precipitates in a ferritic alloy on multiple length scales

PubMed Central

Sun, Zhiqian; Song, Gian; Sisneros, Thomas A.; Clausen, Bjørn; Pu, Chao; Li, Lin; Gao, Yanfei; Liaw, Peter K.

2016-01-01

An understanding of load sharing among constituent phases aids in designing mechanical properties of multiphase materials. Here we investigate load partitioning between the body-centered-cubic iron matrix and NiAl-type precipitates in a ferritic alloy during uniaxial tensile tests at 364 and 506 °C on multiple length scales by in situ neutron diffraction and crystal plasticity finite element modeling. Our findings show that the macroscopic load-transfer efficiency is not as high as that predicted by the Eshelby model; moreover, it depends on the matrix strain-hardening behavior. We explain the grain-level anisotropic load-partitioning behavior by considering the plastic anisotropy of the matrix and elastic anisotropy of precipitates. We further demonstrate that the partitioned load on NiAl-type precipitates relaxes at 506 °C, most likely through thermally-activated dislocation rearrangement on the microscopic scale. The study contributes to further understanding of load-partitioning characteristics in multiphase materials. PMID:26979660

Load partitioning between the bcc-iron matrix and NiAl-type precipitates in a ferritic alloy on multiple length scales

DOE PAGES

Sun, Zhiqian; Song, Gian; Sisneros, Thomas A.; ...

2016-03-16

An understanding of load sharing among constituent phases aids in designing mechanical properties of multiphase materials. Here we investigate load partitioning between the body-centered-cubic iron matrix and NiAl-type precipitates in a ferritic alloy during uniaxial tensile tests at 364 and 506 C on multiple length scales by in situ neutron diffraction and crystal plasticity finite element modeling. Our findings show that the macroscopic load-transfer efficiency is not as high as that predicted by the Eshelby model; moreover, it depends on the matrix strain-hardening behavior. We explain the grain-level anisotropic load-partitioning behavior by considering the plastic anisotropy of the matrix andmore » elastic anisotropy of precipitates. We further demonstrate that the partitioned load on NiAl-type precipitates relaxes at 506 C, most likely through thermally-activated dislocation rearrangement on the microscopic scale. Furthermore, the study contributes to further understanding of load-partitioning characteristics in multiphase materials.« less

Optimal Substrate Preheating Model for Thermal Spray Deposition of Thermosets onto Polymer Matrix Composites

NASA Technical Reports Server (NTRS)

Ivosevic, M.; Knight, R.; Kalidindi, S. R.; Palmese, G. R.; Tsurikov, A.; Sutter, J. K.

2003-01-01

High velocity oxy-fuel (HVOF) sprayed, functionally graded polyimide/WC-Co composite coatings on polymer matrix composites (PMC's) are being investigated for applications in turbine engine technologies. This requires that the polyimide, used as the matrix material, be fully crosslinked during deposition in order to maximize its engineering properties. The rapid heating and cooling nature of the HVOF spray process and the high heat flux through the coating into the substrate typically do not allow sufficient time at temperature for curing of the thermoset. It was hypothesized that external substrate preheating might enhance the deposition behavior and curing reaction during the thermal spraying of polyimide thermosets. A simple analytical process model for the deposition of thermosetting polyimide onto polymer matrix composites by HVOF thermal spray technology has been developed. The model incorporates various heat transfer mechanisms and enables surface temperature profiles of the coating to be simulated, primarily as a function of substrate preheating temperature. Four cases were modeled: (i) no substrate preheating; (ii) substrates electrically preheated from the rear; (iii) substrates preheated by hot air from the front face; and (iv) substrates electrically preheated from the rear and by hot air from the front.

Design of a Matrix Transducer for Three-Dimensional Second Harmonic Transesophageal Echocardiography

NASA Astrophysics Data System (ADS)

Blaak, Sandra; van Neer, Paul L. M. J.; Prins, Christian; Bosch, Johan G.; Lancée, Charles T.; van der Steen, Antonius F. W.; de Jong, Nico

Three-dimensional (3D) echocardiography visualizes the 3D anatomy and function of the heart. For 3D imaging an ultrasound matrix of several thousands of elements is required. To connect the matrix to an external imaging system, smart signal processing with integrated circuitry in the tip of the TEE probe is required for channel reduction. To separate the low voltage integrated receive circuitry from the high voltages required for transmission, our design features a separate transmit and receive subarray. In this study we focus on the transmit subarray. A 3D model of an individual element was developed using the finite element method (FEM). The model was validated by laser interferometer and acoustic measurements. Measurement and simulations matched well. The maximum transmit transfer was 3 nm/V at 2.4 MHz for both the FEM simulation of an element in air and the laser interferometer measurement. The FEM simulation of an element in water resulted in a maximum transfer of 43 kPa/V at 2.3 MHz and the acoustic measurement in 55 kPa/V at 2.5 MHz. The maximum pressure is ~1 MPa/120Vpp, which is sufficient pressure for second harmonic imaging. The proposed design of the transmit subarray is suitable for its role in a 3D 2H TEE probe.

Combined effects of slip and convective boundary condition on MHD 3D stretched flow of nanofluid through porous media inspired by non-linear thermal radiation

NASA Astrophysics Data System (ADS)

Nayak, M. K.; Shaw, Sachin; Pandey, V. S.; Chamkha, Ali J.

2018-02-01

In the present study, the main concern is to investigate the magnetohydrodynamic nanofluid flow subject to porous matrix and convective heating past a permeable linear stretching sheet. In addition, the influence of velocity slip, viscous dissipation, Joule heating and non-linear thermal radiation are considered. A new micro-convection model known as the Patel model is implemented for considerable enhancement of the thermal conductivity and hence, the heat transfer capability of nanofluids. Moreover, a convective heat transfer model is introduced where the bottom surface of the sheet gets heated due to a convection mechanism from a hot fluid of particular temperature. The numerical results of the transformed governing differential equations have been obtained by using fourth-order Runge-Kutta method along with shooting approach and secant method is used for better approximation. In the present analysis, base fluids such as water and Ethylene glycol and Copper, Silver and Aluminum oxide nanoparticles are considered. Results of the present investigation show that inclusion of porous matrix contributes to slow down the fluid velocity and diminution of wall shear stress (axial as well as transverse). Drag force due to magnetic field strength, velocity slip and imposed fluid suction impede the fluid motion and upsurge the heat transfer rate from the surface. In addition, rise in viscous dissipation widens the thermal boundary layer.

Role of protein fluctuation correlations in electron transfer in photosynthetic complexes.

PubMed

Nesterov, Alexander I; Berman, Gennady P

2015-04-01

We consider the dependence of the electron transfer in photosynthetic complexes on correlation properties of random fluctuations of the protein environment. The electron subsystem is modeled by a finite network of connected electron (exciton) sites. The fluctuations of the protein environment are modeled by random telegraph processes, which act either collectively (correlated) or independently (uncorrelated) on the electron sites. We derived an exact closed system of first-order linear differential equations with constant coefficients, for the average density matrix elements and for their first moments. Under some conditions, we obtained analytic expressions for the electron transfer rates and found the range of parameters for their applicability by comparing with the exact numerical simulations. We also compared the correlated and uncorrelated regimes and demonstrated numerically that the uncorrelated fluctuations of the protein environment can, under some conditions, either increase or decrease the electron transfer rates.

In vitro model to study the effects of matrix stiffening on Ca2+ handling and myofilament function in isolated adult rat cardiomyocytes.

PubMed

van Deel, Elza D; Najafi, Aref; Fontoura, Dulce; Valent, Erik; Goebel, Max; Kardux, Kim; Falcão-Pires, Inês; van der Velden, Jolanda

2017-07-15

This paper describes a novel model that allows exploration of matrix-induced cardiomyocyte adaptations independent of the passive effect of matrix rigidity on cardiomyocyte function. Detachment of adult cardiomyocytes from the matrix enables the study of matrix effects on cell shortening, Ca 2+ handling and myofilament function. Cell shortening and Ca 2+ handling are altered in cardiomyocytes cultured for 24 h on a stiff matrix. Matrix stiffness-impaired cardiomyocyte contractility is reversed upon normalization of extracellular stiffness. Matrix stiffness-induced reduction in unloaded shortening is more pronounced in cardiomyocytes isolated from obese ZSF1 rats with heart failure with preserved ejection fraction compared to lean ZSF1 rats. Extracellular matrix (ECM) stiffening is a key element of cardiac disease. Increased rigidity of the ECM passively inhibits cardiac contraction, but if and how matrix stiffening also actively alters cardiomyocyte contractility is incompletely understood. In vitro models designed to study cardiomyocyte-matrix interaction lack the possibility to separate passive inhibition by a stiff matrix from active matrix-induced alterations of cardiomyocyte properties. Here we introduce a novel experimental model that allows exploration of cardiomyocyte functional alterations in response to matrix stiffening. Adult rat cardiomyocytes were cultured for 24 h on matrices of tuneable stiffness representing the healthy and the diseased heart and detached from their matrix before functional measurements. We demonstrate that matrix stiffening, independent of passive inhibition, reduces cell shortening and Ca 2+ handling but does not alter myofilament-generated force. Additionally, detachment of adult cultured cardiomyocytes allowed the transfer of cells from one matrix to another. This revealed that stiffness-induced cardiomyocyte changes are reversed when matrix stiffness is normalized. These matrix stiffness-induced changes in cardiomyocyte function could not be explained by adaptation in the microtubules. Additionally, cardiomyocytes isolated from stiff hearts of the obese ZSF1 rat model of heart failure with preserved ejection fraction show more pronounced reduction in unloaded shortening in response to matrix stiffening. Taken together, we introduce a method that allows evaluation of the influence of ECM properties on cardiomyocyte function separate from the passive inhibitory component of a stiff matrix. As such, it adds an important and physiologically relevant tool to investigate the functional consequences of cardiomyocyte-matrix interactions. © 2017 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

Modelling heat and mass transfer in bread baking with mechanical deformation

NASA Astrophysics Data System (ADS)

Nicolas, V.; Salagnac, P.; Glouannec, P.; Ploteau, J.-P.; Jury, V.; Boillereaux, L.

2012-11-01

In this paper, the thermo-hydric behaviour of bread during baking is studied. A numerical model has been developed with Comsol Multiphysics© software. The model takes into account the heat and mass transfers in the bread and the phenomenon of swelling. This model predicts the evolution of temperature, moisture, gas pressure and deformation in French "baguette" during baking. Local deformation is included in equations using solid phase conservation and, global deformation is calculated using a viscous mechanic model. Boundary conditions are specified with the sole temperature model and vapour pressure estimation of the oven during baking. The model results are compared with experimental data for a classic baking. Then, the model is analysed according to physical properties of bread and solicitations for a better understanding of the interactions between different mechanisms within the porous matrix.

Point interactions, metamaterials, and PT-symmetry

NASA Astrophysics Data System (ADS)

Mostafazadeh, Ali

2016-05-01

We express the boundary conditions for TE and TM waves at the interfaces of an infinite planar slab of homogeneous metamaterial as certain point interactions and use them to compute the transfer matrix of the system. This allows us to demonstrate the omnidirectional reflectionlessness of Veselago's slab for waves of arbitrary wavelength, reveal the translational and reflection symmetry of this slab, explore the laser threshold condition and coherent perfect absorption for active negative-index metamaterials, introduce a point interaction modeling phase-conjugation, determine the corresponding antilinear transfer matrix, and offer a simple proof of the equivalence of Veselago's slab with a pair of parallel phase-conjugating plates. We also study the connection between certain optical setups involving metamaterials and a class of PT-symmetric quantum systems defined on wedge-shape contours in the complex plane. This provides a physical interpretation for the latter.

Coherent-Anomaly Method in Critical Phenomena. III. Mean-Field Transfer-Matrix Method in the 2D Ising Model

NASA Astrophysics Data System (ADS)

Hu, Xiao; Katori, Makoto; Suzuki, Masuo

1987-11-01

Two kinds of systematic mean-field transfer-matrix methods are formulated in the 2-dimensional Ising spin system, by introducing Weiss-like and Bethe-like approximations. All the critical exponents as well as the true critical point can be estimated in these methods following the CAM procedure. The numerical results of the above system are Tc*≃2.271 (J/kB), γ{=}γ'≃1.749, β≃0.131 and δ≃15.1. The specific heat is confirmd to be continuous and to have a logarithmic divergence at the true critical point, i.e., α{=}α'{=}0. Thus, the finite-degree-of-approximation scaling ansatz is shown to be correct and very powerful in practical estimations of the critical exponents as well as the true critical point.

Förster-type energy transfer as a probe for changes in local fluctuations of the protein matrix.

PubMed

Somogyi, B; Matkó, J; Papp, S; Hevessy, J; Welch, G R; Damjanovich, S

1984-07-17

Much evidence, on both theoretical and experimental sides, indicates the importance of local fluctuations (in energy levels, conformational substates, etc.) of the macromolecular matrix in the biological activity of proteins. We describe here a novel application of the Förster-type energy-transfer process capable of monitoring changes both in local fluctuations and in conformational states of macromolecules. A new energy-transfer parameter, f, is defined as an average transfer efficiency, [E], normalized by the actual average quantum efficiency of the donor fluorescence, [phi D]. A simple oscillator model (for a one donor-one acceptor system) is presented to show the sensitivity of this parameter to changes in amplitudes of local fluctuations. The different modes of averaging (static, dynamic, and intermediate cases) occurring for a given value of the average transfer rate, [kt], and the experimental requirements as well as limitations of the method are also discussed. The experimental tests were performed on the ribonuclease T1-pyridoxamine 5'-phosphate conjugate (a one donor-one acceptor system) by studying the change of the f parameter with temperature, an environmental parameter expectedly perturbing local fluctuations of proteins. The parameter f increased with increasing temperature as expected on the basis of the oscillator model, suggesting that it really reflects changes of fluctuation amplitudes (significant changes in the orientation factor, k2, as well as in the spectral properties of the fluorophores can be excluded by anisotropy measurements and spectral investigations). Possibilities of the general applicability of the method are also discussed.

Numerical simulations of electromagnetic scattering by Solar system objects

NASA Astrophysics Data System (ADS)

Dlugach, Janna M.

2016-11-01

Having been profoundly stimulated by the seminal work of Viktor V. Sobolev, I have been involved in multi-decadal research in the fields of radiative transfer, electromagnetic scattering by morphologically complex particles and particulate media, and planetary remote sensing. Much of this research has been done in close collaboration with other "descendants" of Academician Sobolev. This tutorial paper gives a representative overview of the results of extensive numerical simulations (in the vast majority carried out in collaboration with Michael Mishchenko) used to analyze remote-sensing observations of Solar system objects and based on highly accurate methods of the radiative transfer theory and direct computer solvers of the Maxwell equations. Using the atmosphere of Jupiter as a proving ground and performing T-matrix and radiative-transfer calculations helps demonstrate the strong effect of aerosol-particle shapes on the accuracy of remote-sensing retrievals. I then discuss the application of the T-matrix method, a numerically exact solution of the vector radiative transfer equation, and the theory of coherent backscattering to an analysis of polarimetric radar observations of Saturn's rings. Numerical modeling performed by using the superposition T-matrix method in application to cometary dust in the form of aggregates serves to reproduce the results of polarimetric observations of the distant comet C/2010 S1. On the basis of direct computer solutions of the Maxwell equations, it is demonstrated that all backscattering effects predicted by the low-density theories of radiative transfer and coherent backscattering can also be identified for media with volume packing densities typically encountered in natural and artificial environments. This result implies that spectacular opposition effects observed for some high-albedo atmoshereless Solar system bodies can be attributed to coherent backscattering of sunlight by regolith layers composed of microscopic particles.

Robustness results in LQG based multivariable control designs

NASA Technical Reports Server (NTRS)

Lehtomaki, N. A.; Sandell, N. R., Jr.; Athans, M.

1980-01-01

The robustness of control systems with respect to model uncertainty is considered using simple frequency domain criteria. Results are derived under a common framework in which the minimum singular value of the return difference transfer matrix is the key quantity. In particular, the LQ and LQG robustness results are discussed.

Resonant electronic excitation energy transfer by Dexter mechanism in the quantum dot system

NASA Astrophysics Data System (ADS)

Samosvat, D. M.; Chikalova-Luzina, O. P.; Vyatkin, V. M.; Zegrya, G. G.

2016-11-01

In present work the energy transfer between quantum dots by the exchange (Dexter) mechanism is analysed. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same compound A3B5 and embedded in the matrix of other material creating potential barriers for electron and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found using the Kane model that provides the most adequate description spectra of semiconductors A3B5. Numerical calculations show that the rate of the energy transfer by Dexter mechanism is comparable to the rate of the energy transfer by electrostatic mechanism at the distances approaching to the contact ones.

Ab initio quantum chemical study of electron transfer in carboranes

NASA Astrophysics Data System (ADS)

Pati, Ranjit; Pineda, Andrew C.; Pandey, Ravindra; Karna, Shashi P.

2005-05-01

The electron transfer (ET) properties of 10- and 12-vertex carboranes are investigated by the ab initio Hartree-Fock method within the Marcus-Hush (MH) two-state model and the Koopman theorem (KT) approach. The calculated value of the ET coupling matrix element, VAB, is consistently higher in the KT approach than in the MH two-state model. For the carborane molecules functionalized by -CH 2 groups at C-vertices, VAB strongly depends on the relative orientation of the planes containing the terminal -CH 2 groups. The predicted conformation dependence of VAB offers a molecular mechanism to control ET between two active centers in molecular systems.

Computational Analyses of Complex Flows with Chemical Reactions

NASA Astrophysics Data System (ADS)

Bae, Kang-Sik

The heat and mass transfer phenomena in micro-scale for the mass transfer phenomena on drug in cylindrical matrix system, the simulation of oxygen/drug diffusion in a three dimensional capillary network, and a reduced chemical kinetic modeling of gas turbine combustion for Jet propellant-10 have been studied numerically. For the numerical analysis of the mass transfer phenomena on drug in cylindrical matrix system, the governing equations are derived from the cylindrical matrix systems, Krogh cylinder model, which modeling system is comprised of a capillary to a surrounding cylinder tissue along with the arterial distance to veins. ADI (Alternative Direction Implicit) scheme and Thomas algorithm are applied to solve the nonlinear partial differential equations (PDEs). This study shows that the important factors which have an effect on the drug penetration depth to the tissue are the mass diffusivity and the consumption of relevant species during the time allowed for diffusion to the brain tissue. Also, a computational fluid dynamics (CFD) model has been developed to simulate the blood flow and oxygen/drug diffusion in a three dimensional capillary network, which are satisfied in the physiological range of a typical capillary. A three dimensional geometry has been constructed to replicate the one studied by Secomb et al. (2000), and the computational framework features a non-Newtonian viscosity model for blood, the oxygen transport model including in oxygen-hemoglobin dissociation and wall flux due to tissue absorption, as well as an ability to study the diffusion of drugs and other materials in the capillary streams. Finally, a chemical kinetic mechanism of JP-10 has been compiled and validated for a wide range of combustion regimes, covering pressures of 1atm to 40atm with temperature ranges of 1,200 K--1,700 K, which is being studied as a possible Jet propellant for the Pulse Detonation Engine (PDE) and other high-speed flight applications such as hypersonic missiles. The comprehensive skeletal mechanism consists of 58 species and 315 reactions including in CPD, Benzene formation process by the theory for polycyclic aromatic hydrocarbons (PAH) and soot formation process on the constant volume combustor, premixed flame characteristics.

Matrix method for two-dimensional waveguide mode solution

NASA Astrophysics Data System (ADS)

Sun, Baoguang; Cai, Congzhong; Venkatesh, Balajee Seshasayee

2018-05-01

In this paper, we show that the transfer matrix theory of multilayer optics can be used to solve the modes of any two-dimensional (2D) waveguide for their effective indices and field distributions. A 2D waveguide, even composed of numerous layers, is essentially a multilayer stack and the transmission through the stack can be analysed using the transfer matrix theory. The result is a transfer matrix with four complex value elements, namely A, B, C and D. The effective index of a guided mode satisfies two conditions: (1) evanescent waves exist simultaneously in the first (cladding) layer and last (substrate) layer, and (2) the complex element D vanishes. For a given mode, the field distribution in the waveguide is the result of a 'folded' plane wave. In each layer, there is only propagation and absorption; at each boundary, only reflection and refraction occur, which can be calculated according to the Fresnel equations. As examples, we show that this method can be used to solve modes supported by the multilayer step-index dielectric waveguide, slot waveguide, gradient-index waveguide and various plasmonic waveguides. The results indicate the transfer matrix method is effective for 2D waveguide mode solution in general.

Moment inference from tomograms

USGS Publications Warehouse

Day-Lewis, F. D.; Chen, Y.; Singha, K.

2007-01-01

Time-lapse geophysical tomography can provide valuable qualitative insights into hydrologic transport phenomena associated with aquifer dynamics, tracer experiments, and engineered remediation. Increasingly, tomograms are used to infer the spatial and/or temporal moments of solute plumes; these moments provide quantitative information about transport processes (e.g., advection, dispersion, and rate-limited mass transfer) and controlling parameters (e.g., permeability, dispersivity, and rate coefficients). The reliability of moments calculated from tomograms is, however, poorly understood because classic approaches to image appraisal (e.g., the model resolution matrix) are not directly applicable to moment inference. Here, we present a semi-analytical approach to construct a moment resolution matrix based on (1) the classic model resolution matrix and (2) image reconstruction from orthogonal moments. Numerical results for radar and electrical-resistivity imaging of solute plumes demonstrate that moment values calculated from tomograms depend strongly on plume location within the tomogram, survey geometry, regularization criteria, and measurement error. Copyright 2007 by the American Geophysical Union.

Moment inference from tomograms

USGS Publications Warehouse

Day-Lewis, Frederick D.; Chen, Yongping; Singha, Kamini

2007-01-01

Time-lapse geophysical tomography can provide valuable qualitative insights into hydrologic transport phenomena associated with aquifer dynamics, tracer experiments, and engineered remediation. Increasingly, tomograms are used to infer the spatial and/or temporal moments of solute plumes; these moments provide quantitative information about transport processes (e.g., advection, dispersion, and rate-limited mass transfer) and controlling parameters (e.g., permeability, dispersivity, and rate coefficients). The reliability of moments calculated from tomograms is, however, poorly understood because classic approaches to image appraisal (e.g., the model resolution matrix) are not directly applicable to moment inference. Here, we present a semi-analytical approach to construct a moment resolution matrix based on (1) the classic model resolution matrix and (2) image reconstruction from orthogonal moments. Numerical results for radar and electrical-resistivity imaging of solute plumes demonstrate that moment values calculated from tomograms depend strongly on plume location within the tomogram, survey geometry, regularization criteria, and measurement error.

Formation of Metal-Related Ions in Matrix-Assisted Laser Desorption Ionization.

PubMed

Lee, Chuping; Lu, I-Chung; Hsu, Hsu Chen; Lin, Hou-Yu; Liang, Sheng-Ping; Lee, Yuan-Tseh; Ni, Chi-Kung

2016-09-01

In a study of the metal-related ion generation mechanism in matrix-assisted laser desorption ionization (MALDI), crystals of matrix used in MALDI were grown from matrix- and salt-containing solutions. The intensities of metal ion and metal adducts of the matrix ion obtained from unwashed crystals were higher than those from crystals washed with deionized water, indicating that metal ions and metal adducts of the matrix ions are mainly generated from the surface of crystals. The contributions of preformed metal ions and metal adducts of the matrix ions inside the matrix crystals were minor. Metal adducts of the matrix and analyte ion intensities generated from a mixture of dried matrix, salt, and analyte powders were similar to or higher than those generated from the powder of dried droplet crystals, indicating that the contributions of the preformed metal adducts of the matrix and analyte ions were insignificant. Correlation between metal-related ion intensity fluctuation and protonated ion intensity fluctuation was observed, indicating that the generation mechanism of the metal-related ions is similar to that of the protonated ions. Because the thermally induced proton transfer model effectively describes the generation of the protonated ions, we suggest that metal-related ions are mainly generated from the salt dissolution in the matrix melted by the laser. Graphical Abstract ᅟ.

A test for interfacial effects and stress transfer in ceramic matrix composites

NASA Technical Reports Server (NTRS)

1988-01-01

A test specimen was devised for measuring stress transfer between a high modulus fiber and a ceramic matrix. Single filaments of SiC were embedded in chemically vapor deposited SiC on a thin plate of molybdenum. The CVD overcoating which encapsulated the fiber was continuous with a coating of SiC on the molybdenum. When placed in a microtensile test device and loaded in the fiber direction, the fiber fracture characteristics provide information on the fiber/matrix adhesion and stress transfer. Problems were encountered due to the formation of a weak boundary between the SiC and the molybdenum which obviated any meaningful tensile tests. Also, the high CVD temperature used in fabricating these specimens restrict the fiber, matrix (and substrate) to materials having similar thermal coefficients of expansion in order to minimize thermal stresses.

Three-Dimensional High Fidelity Progressive Failure Damage Modeling of NCF Composites

NASA Technical Reports Server (NTRS)

Aitharaju, Venkat; Aashat, Satvir; Kia, Hamid G.; Satyanarayana, Arunkumar; Bogert, Philip B.

2017-01-01

Performance prediction of off-axis laminates is of significant interest in designing composite structures for energy absorption. Phenomenological models available in most of the commercial programs, where the fiber and resin properties are smeared, are very efficient for large scale structural analysis, but lack the ability to model the complex nonlinear behavior of the resin and fail to capture the complex load transfer mechanisms between the fiber and the resin matrix. On the other hand, high fidelity mesoscale models, where the fiber tows and matrix regions are explicitly modeled, have the ability to account for the complex behavior in each of the constituents of the composite. However, creating a finite element model of a larger scale composite component could be very time consuming and computationally very expensive. In the present study, a three-dimensional mesoscale model of non-crimp composite laminates was developed for various laminate schemes. The resin material was modeled as an elastic-plastic material with nonlinear hardening. The fiber tows were modeled with an orthotropic material model with brittle failure. In parallel, new stress based failure criteria combined with several damage evolution laws for matrix stresses were proposed for a phenomenological model. The results from both the mesoscale and phenomenological models were compared with the experiments for a variety of off-axis laminates.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Modeling donor/acceptor interactions: Combined roles of theory and computation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newton, M.D.

2000-03-05

An extended superexchange model for electron transfer (ET) matrix elements (H{sub DA}) has been formulated as a superposition of McConnell-type pathways and implemented by combined use of configuration interaction wave functions (obtained using the INDO/s model of Zerner and co-workers) and the generalized Muliken-Hush formulation of charge-localized diabatic states. Applications are made for et (and hold transfer) in several donor/bridge/acceptor radical anion (and cation) systems, (DBA){sup {+-}}, allowing detailed comparison with experimental H{sub DA} estimates. For the case of oligo phenylene ethynylene (OPE) bridges, the role of {pi} and {sigma} electronic manifolds for different distributions of phenylene torsion angles ismore » analyzed in detail.« less

A new state space model for the NASA/JPL 70-meter antenna servo controls

NASA Technical Reports Server (NTRS)

Hill, R. E.

1987-01-01

A control axis referenced model of the NASA/JPL 70-m antenna structure is combined with the dynamic equations of servo components to produce a comprehansive state variable (matrix) model of the coupled system. An interactive Fortran program for generating the linear system model and computing its salient parameters is described. Results are produced in a state variable, block diagram, and in factored transfer function forms to facilitate design and analysis by classical as well as modern control methods.

Analysis of simplified heat transfer models for thermal property determination of nano-film by TDTR method

NASA Astrophysics Data System (ADS)

Wang, Xinwei; Chen, Zhe; Sun, Fangyuan; Zhang, Hang; Jiang, Yuyan; Tang, Dawei

2018-03-01

Heat transfer in nanostructures is of critical importance for a wide range of applications such as functional materials and thermal management of electronics. Time-domain thermoreflectance (TDTR) has been proved to be a reliable measurement technique for the thermal property determinations of nanoscale structures. However, it is difficult to determine more than three thermal properties at the same time. Heat transfer model simplifications can reduce the fitting variables and provide an alternative way for thermal property determination. In this paper, two simplified models are investigated and analyzed by the transform matrix method and simulations. TDTR measurements are performed on Al-SiO2-Si samples with different SiO2 thickness. Both theoretical and experimental results show that the simplified tri-layer model (STM) is reliable and suitable for thin film samples with a wide range of thickness. Furthermore, the STM can also extract the intrinsic thermal conductivity and interfacial thermal resistance from serial samples with different thickness.

Simulation of radioelement volatility during the vitrification of radioactive wastes by arc plasma.

PubMed

Ghiloufi, Imed

2009-04-15

A computer model is used to simulate the volatility of some radioelements cesium ((137)Cs), cobalt ((60)Co), and ruthenium ((106)Ru) during the radioactive wastes vitrification by thermal plasma. This model is based on the calculation of system composition using the free enthalpy minimization method, coupled with the equation of mass transfer at the reactional interface. The model enables the determination of the effects of various parameters (e.g., temperature, plasma current, and matrix composition) on the radioelement volatility. The obtained results indicate that any increase in molten bath temperature causes an increase in the cobalt volatility; while ruthenium has a less obvious behavior. It is also found that the oxygen flux in the carrier gas supports the radioelement incorporations in the containment matrix, except in the case of the ruthenium which is more volatile under an oxidizing atmosphere. For electrolyses effects, an increase in the plasma current considerably increases both the vaporization speed and the vaporized quantities of (137)Cs and (60)Co. The increase of silicon percentage in the containment matrix supports the incorporation of (60)Co and (137)Cs in the matrix. The simulation results are compared favorably to the experimental measurements obtained by emission spectroscopy.

A study of pilot modeling in multi-controller tasks

NASA Technical Reports Server (NTRS)

Whitbeck, R. F.; Knight, J. R.

1972-01-01

A modeling approach, which utilizes a matrix of transfer functions to describe the human pilot in multiple input, multiple output control situations, is studied. The approach used was to extend a well established scalar Wiener-Hopf minimization technique to the matrix case and then study, via a series of experiments, the data requirements when only finite record lengths are available. One of these experiments was a two-controller roll tracking experiment designed to force the pilot to use rudder in order to coordinate and reduce the effects of aileron yaw. One model was computed for the case where the signals used to generate the spectral matrix are error and bank angle while another model was computed for the case where error and yaw angle are the inputs. Several anomalies were observed to be present in the experimental data. These are defined by the descriptive terms roll up, break up, and roll down. Due to these algorithm induced anomalies, the frequency band over which reliable estimates of power spectra can be achieved is considerably less than predicted by the sampling theorem.

An Initial Non-Equilibrium Porous-Media Model for CFD Simulation of Stirling Regenerators

NASA Technical Reports Server (NTRS)

Tew, Roy C.; Simon, Terry; Gedeon, David; Ibrahim, Mounir; Rong, Wei

2006-01-01

The objective of this paper is to define empirical parameters for an initial thermal non-equilibrium porous-media model for use in Computational Fluid Dynamics (CFD) codes for simulation of Stirling regenerators. The two codes currently used at Glenn Research Center for Stirling modeling are Fluent and CFD-ACE. The codes porous-media models are equilibrium models, which assume solid matrix and fluid are in thermal equilibrium. This is believed to be a poor assumption for Stirling regenerators; Stirling 1-D regenerator models, used in Stirling design, use non-equilibrium regenerator models and suggest regenerator matrix and gas average temperatures can differ by several degrees at a given axial location and time during the cycle. Experimentally based information was used to define: hydrodynamic dispersion, permeability, inertial coefficient, fluid effective thermal conductivity, and fluid-solid heat transfer coefficient. Solid effective thermal conductivity was also estimated. Determination of model parameters was based on planned use in a CFD model of Infinia's Stirling Technology Demonstration Converter (TDC), which uses a random-fiber regenerator matrix. Emphasis is on use of available data to define empirical parameters needed in a thermal non-equilibrium porous media model for Stirling regenerator simulation. Such a model has not yet been implemented by the authors or their associates.

A subsystem identification method based on the path concept with coupling strength estimation

NASA Astrophysics Data System (ADS)

Magrans, Francesc Xavier; Poblet-Puig, Jordi; Rodríguez-Ferran, Antonio

2018-02-01

For complex geometries, the definition of the subsystems is not a straightforward task. We present here a subsystem identification method based on the direct transfer matrix, which represents the first-order paths. The key ingredient is a cluster analysis of the rows of the powers of the transfer matrix. These powers represent high-order paths in the system and are more affected than low-order paths by damping. Once subsystems are identified, the proposed approach also provides a quantification of the degree of coupling between subsystems. This information is relevant to decide whether a subsystem may be analysed in a computer model or measured in the laboratory independently of the rest or subsystems or not. The two features (subsystem identification and quantification of the degree of coupling) are illustrated by means of numerical examples: plates coupled by means of springs and rooms connected by means of a cavity.

Matrix operator theory of radiative transfer. I - Rayleigh scattering.

NASA Technical Reports Server (NTRS)

Plass, G. N.; Kattawar, G. W.; Catchings, F. E.

1973-01-01

An entirely rigorous method for the solution of the equations for radiative transfer based on the matrix operator theory is reviewed. The advantages of the present method are: (1) all orders of the reflection and transmission matrices are calculated at once; (2) layers of any thickness may be combined, so that a realistic model of the atmosphere can be developed from any arbitrary number of layers, each with different properties and thicknesses; (3) calculations can readily be made for large optical depths and with highly anisotropic phase functions; (4) results are obtained for any desired value of the surface albedo including the value unity and for a large number of polar and azimuthal angles; (5) all fundamental equations can be interpreted immediately in terms of the physical interactions appropriate to the problem; and (6) both upward and downward radiance can be calculated at interior points from relatively simple expressions.

Unravelling radiative energy transfer in solid-state lighting

NASA Astrophysics Data System (ADS)

Melikov, Rustamzhon; Press, Daniel Aaron; Ganesh Kumar, Baskaran; Sadeghi, Sadra; Nizamoglu, Sedat

2018-01-01

Today, a wide variety of organic and inorganic luminescent materials (e.g., phosphors, quantum dots, etc.) are being used for lighting and new materials (e.g., graphene, perovskite, etc.) are currently under investigation. However, the understanding of radiative energy transfer is limited, even though it is critical to understand and improve the performance levels of solid-state lighting devices. In this study, we derived a matrix approach that includes absorption, reabsorption, inter-absorption and their iterative and combinatorial interactions for one and multiple types of fluorophores, which is simplified to an analytical matrix. This mathematical approach gives results that agree well with the measured spectral and efficiency characteristics of color-conversion light-emitting diodes. Moreover, it also provides a deep physical insight by uncovering the entire radiative interactions and their contribution to the output optical spectrum. The model is universal and applicable for all kinds of fluorophores.

Dis-aggregation of an insoluble porphyrin in a calixarene matrix: characterization of aggregate modes by extended dipole model.

PubMed

de Miguel, Gustavo; Martín-Romero, María T; Pedrosa, José M; Muñoz, Eulogia; Pérez-Morales, Marta; Richardson, Tim H; Camacho, Luis

2008-03-21

In this paper, the different aggregation modes of a water-insoluble porphyrin (EHO) mixed with an amphiphilic calix[8]arene (C8A), at the air-water interface and in Langmuir-Blodgett (LB) film form, are analyzed as a function of the mixed composition. The strategy used to control the EHO aggregation has consisted of preparing mixed thin films containing EHO and C8A, in different ratios, at the air-water interface. Therefore, the increase of the C8A molar ratio in the mixed film diminishes the aggregation of the EHO molecules, although such an effect must be exclusively related to the dilution of the porphyrin. The reflection spectra of the mixed C8A-EHO films registered at the air-water interface, show a complex Soret band exhibiting splitting, hypochromicity and broadening features. Also, during the transfer process at high surface pressure, it has been shown that the EHO molecules are ejected from the C8A monolayer and only a fraction of porphyrin is transferred to the solid support, in spite of a complete transfer for the C8A matrix. The complex structure of the reflection spectra at the air-water interface, as well as the polarization dependence of the absorption spectra for the mixed LB films, indicate the existence of four different arrangements for the EHO hosted in the C8A matrix. The aggregate formation is governed by two factors: the attraction between the porphyrin rings which minimizes their separation, and the alkyl chain interactions, that is, hydrophobic effect and/or steric hindrance which determine and restrict the possible aggregation structures. By using the extended dipole model, the assignment of the spectral peaks observed to different EHO aggregates is shown.

Quantum Engineering of Dynamical Gauge Fields on Optical Lattices

DTIC Science & Technology

2016-07-08

opens the door for exciting new research directions, such as quantum simulation of the Schwinger model and of non-Abelian models. (a) Papers...exact blocking formulas from the TRG formulation of the transfer matrix. The second is a worm algorithm. The particle number distributions obtained...a fact that can be explained by an approximate particle- hole symmetry. We have also developed a computer code suite for simulating the Abelian

Money creation process in a random redistribution model

NASA Astrophysics Data System (ADS)

Chen, Siyan; Wang, Yougui; Li, Keqiang; Wu, Jinshan

2014-01-01

In this paper, the dynamical process of money creation in a random exchange model with debt is investigated. The money creation kinetics are analyzed by both the money-transfer matrix method and the diffusion method. From both approaches, we attain the same conclusion: the source of money creation in the case of random exchange is the agents with neither money nor debt. These analytical results are demonstrated by computer simulations.

Finitized conformal spectrum of the Ising model on the cylinder and torus

NASA Astrophysics Data System (ADS)

O'Brien, David L.; Pearce, Paul A.; Ole Warnaar, S.

1996-02-01

The spectrum of the critical Ising model on a lattice with cylindrical and toroidal boundary conditions is calculated by commuting transfer matrix methods. Using a simple truncation procedure, we obtain the natural finitizations of the conformal spectra recently proposed by Melzer. These finitizations imply polynomial identities which in the large lattice limit give rise to the Rogers-Ramanujan identities for the c = {1}/{2} Virasoro characters.

Transfer matrix modeling and experimental validation of cellular porous material with resonant inclusions.

PubMed

Doutres, Olivier; Atalla, Noureddine; Osman, Haisam

2015-06-01

Porous materials are widely used for improving sound absorption and sound transmission loss of vibrating structures. However, their efficiency is limited to medium and high frequencies of sound. A solution for improving their low frequency behavior while keeping an acceptable thickness is to embed resonant structures such as Helmholtz resonators (HRs). This work investigates the absorption and transmission acoustic performances of a cellular porous material with a two-dimensional periodic arrangement of HR inclusions. A low frequency model of a resonant periodic unit cell based on the parallel transfer matrix method is presented. The model is validated by comparison with impedance tube measurements and simulations based on both the finite element method and a homogenization based model. At the HR resonance frequency (i) the transmission loss is greatly improved and (ii) the sound absorption of the foam can be either decreased or improved depending on the HR tuning frequency and on the thickness and properties of the host foam. Finally, the diffuse field sound absorption and diffuse field sound transmission loss performance of a 2.6 m(2) resonant cellular material are measured. It is shown that the improvements observed at the Helmholtz resonant frequency on a single cell are confirmed at a larger scale.

Viscoelastic shear lag model to predict the micromechanical behavior of tendon under dynamic tensile loading.

PubMed

Wu, Jiayu; Yuan, Hong; Li, Longyuan; Fan, Kunjie; Qian, Shanguang; Li, Bing

2018-01-21

Owing to its viscoelastic nature, tendon exhibits stress rate-dependent breaking and stiffness function. A Kelvin-Voigt viscoelastic shear lag model is proposed to illustrate the micromechanical behavior of the tendon under dynamic tensile conditions. Theoretical closed-form expressions are derived to predict the deformation and stress transfer between fibrils and interfibrillar matrix while tendon is dynamically stretched. The results from the analytical solutions demonstrate that how the fibril overlap length and fibril volume fraction affect the stress transfer and mechanical properties of tendon. We find that the viscoelastic property of interfibrillar matrix mainly results in collagen fibril failure under fast loading rate or creep rupture of tendon. However, discontinuous fibril model and hierarchical structure of tendon ensure relative sliding under slow loading rate, helping dissipate energy and protecting fibril from damage, which may be a key reason why regularly staggering alignment microstructure is widely selected in nature. According to the growth, injury, healing and healed process of tendon observed by many researchers, the conclusions presented in this paper agrees well with the experimental findings. Additionally, the emphasis of this paper is on micromechanical behavior of tendon, whereas this analytical viscoelastic shear lag model can be equally applicable to other soft or hard tissues, owning the similar microstructure. Copyright © 2017 Elsevier Ltd. All rights reserved.

Multilayer-MCTDH approach to the energy transfer dynamics in the LH2 antenna complex

NASA Astrophysics Data System (ADS)

Shibl, Mohamed F.; Schulze, Jan; Al-Marri, Mohammed J.; Kühn, Oliver

2017-09-01

The multilayer multiconfiguration time-dependent Hartree method is used to study the coupled exciton-vibrational dynamics in a high-dimensional nonameric model of the LH2 antenna complex of purple bacteria. The exciton-vibrational coupling is parametrized within the Huang-Rhys model according to phonon and intramolecular vibrational modes derived from an experimental bacteriochlorophyll spectral density. In contrast to reduced density matrix approaches, the Schrödinger equation is solved explicitly, giving access to the full wave function. This facilitates an unbiased analysis in terms of the coupled dynamics of excitonic and vibrational degrees of freedom. For the present system, we identify spectator modes for the B800 to B800 transfer and we find a non-additive effect of phonon and intramolecular vibrational modes on the B800 to B850 exciton transfer.

Third generation biosensing matrix based on Fe-implanted ZnO thin film

NASA Astrophysics Data System (ADS)

Saha, Shibu; Gupta, Vinay; Sreenivas, K.; Tan, H. H.; Jagadish, C.

2010-09-01

Third generation biosensor based on Fe-implanted ZnO (Fe-ZnO) thin film has been demonstrated. Implantation of Fe in rf-sputtered ZnO thin film introduces redox center along with shallow donor level and thereby enhance its electron transfer property. Glucose oxidase (GOx), chosen as model enzyme, has been immobilized on the surface of the matrix. Cyclic voltammetry and photometric assay show that the prepared bioelectrode, GOx/Fe-ZnO/ITO/Glass is sensitive to the glucose concentration with enhanced response of 0.326 μA mM-1 cm-2 and low Km of 2.76 mM. The results show promising application of Fe-implanted ZnO thin film as an attractive matrix for third generation biosensing.

Generalization of the Mulliken-Hush treatment for the calculation of electron transfer matrix elements

NASA Astrophysics Data System (ADS)

Cave, Robert J.; Newton, Marshall D.

1996-01-01

A new method for the calculation of the electronic coupling matrix element for electron transfer processes is introduced and results for several systems are presented. The method can be applied to ground and excited state systems and can be used in cases where several states interact strongly. Within the set of states chosen it is a non-perturbative treatment, and can be implemented using quantities obtained solely in terms of the adiabatic states. Several applications based on quantum chemical calculations are briefly presented. Finally, since quantities for adiabatic states are the only input to the method, it can also be used with purely experimental data to estimate electron transfer matrix elements.

Development of RWHet to Simulate Contaminant Transport in Fractured Porous Media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yong; LaBolle, Eric; Reeves, Donald M

2012-07-01

Accurate simulation of matrix diffusion in regional-scale dual-porosity and dual-permeability media is a critical issue for the DOE Underground Test Area (UGTA) program, given the prevalence of fractured geologic media on the Nevada National Security Site (NNSS). Contaminant transport through regional-scale fractured media is typically quantified by particle-tracking based Lagrangian solvers through the inclusion of dual-domain mass transfer algorithms that probabilistically determine particle transfer between fractures and unfractured matrix blocks. UGTA applications include a wide variety of fracture aperture and spacing, effective diffusion coefficients ranging four orders of magnitude, and extreme end member retardation values. This report incorporates the currentmore » dual-domain mass transfer algorithms into the well-known particle tracking code RWHet [LaBolle, 2006], and then tests and evaluates the updated code. We also develop and test a direct numerical simulation (DNS) approach to replace the classical transfer probability method in characterizing particle dynamics across the fracture/matrix interface. The final goal of this work is to implement the algorithm identified as most efficient and effective into RWHet, so that an accurate and computationally efficient software suite can be built for dual-porosity/dual-permeability applications. RWHet is a mature Lagrangian transport simulator with a substantial user-base that has undergone significant development and model validation. In this report, we also substantially tested the capability of RWHet in simulating passive and reactive tracer transport through regional-scale, heterogeneous media. Four dual-domain mass transfer methodologies were considered in this work. We first developed the empirical transfer probability approach proposed by Liu et al. [2000], and coded it into RWHet. The particle transfer probability from one continuum to the other is proportional to the ratio of the mass entering the other continuum to the mass in the current continuum. Numerical examples show that this method is limited to certain ranges of parameters, due to an intrinsic assumption of an equilibrium concentration profile in the matrix blocks in building the transfer probability. Subsequently, this method fails in describing mass transfer for parameter combinations that violate this assumption, including small diffusion coefficients (i.e., the free-water molecular diffusion coefficient 1×10-11 meter2/second), relatively large fracture spacings (such as meter), and/or relatively large matrix retardation coefficients (i.e., ). These “outliers” in parameter range are common in UGTA applications. To address the above limitations, we then developed a Direct Numerical Simulation (DNS)-Reflective method. The novel DNS-Reflective method can directly track the particle dynamics across the fracture/matrix interface using a random walk, without any empirical assumptions. This advantage should make the DNS-Reflective method feasible for a wide range of parameters. Numerical tests of the DNS-Reflective, however, show that the method is computationally very demanding, since the time step must be very small to resolve particle transfer between fractures and matrix blocks. To improve the computational efficiency of the DNS approach, we then adopted Roubinet et al.’s method [2009], which uses first passage time distributions to simulate dual-domain mass transfer. The DNS-Roubinet method was found to be computationally more efficient than the DNS-Reflective method. It matches the analytical solution for the whole range of major parameters (including diffusion coefficient and fracture aperture values that are considered “outliers” for Liu et al.’s transfer probability method [2000]) for a single fracture system. The DNS-Roubinet method, however, has its own disadvantage: for a parallel fracture system, the truncation of the first passage time distribution creates apparent errors when the fracture spacing is small, and thus it tends to erroneously predict breakthrough curves (BTCs) for the parallel fracture system. Finally, we adopted the transient range approach proposed by Pan and Bodvarsson [2002] in RWHet. In this method, particle transfer between fractures and matrix blocks can be resolved without using very small time steps. It does not use any truncation of the first passage time distribution for particles. Hence it does not have the limitation identified above for the DNS-Reflective method and the DNS-Roubinet method. Numerical results were checked against analytical solutions, and also compared to DCPTV2.0 [Pan, 2002]. This version of RWHet (called RWHet-Pan&Bodvarsson in this report) can accurately capture contaminant transport in fractured porous media for a full range of parameters without any practical or theoretical limitations.« less

Matrix Formalism of Synchrobetatron Coupling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Xiaobiao; /SLAC

In this paper we present a complete linear synchrobetatron coupling formalism by studying the transfer matrix which describes linear horizontal and longitudinal motions. With the technique established in the linear horizontal-vertical coupling study [D. Sagan and D. Rubin, Phys. Rev. ST Accel. Beams 2, 074001 (1999)], we found a transformation to block diagonalize the transfer matrix and decouple the betatron motion and the synchrotron motion. By separating the usual dispersion term from the horizontal coordinate first, we were able to obtain analytic expressions of the transformation under reasonable approximations. We also obtained the perturbations to the betatron tune and themore » Courant-Snyder functions. The closed orbit changes due to finite energy gains at rf cavities and radiation energy losses were also studied by the 5 x 5 extended transfer matrix with the fifth column describing kicks in the 4-dimension phase space.« less

Sparse matrix-vector multiplication on network-on-chip

NASA Astrophysics Data System (ADS)

Sun, C.-C.; Götze, J.; Jheng, H.-Y.; Ruan, S.-J.

2010-12-01

In this paper, we present an idea for performing matrix-vector multiplication by using Network-on-Chip (NoC) architecture. In traditional IC design on-chip communications have been designed with dedicated point-to-point interconnections. Therefore, regular local data transfer is the major concept of many parallel implementations. However, when dealing with the parallel implementation of sparse matrix-vector multiplication (SMVM), which is the main step of all iterative algorithms for solving systems of linear equation, the required data transfers depend on the sparsity structure of the matrix and can be extremely irregular. Using the NoC architecture makes it possible to deal with arbitrary structure of the data transfers; i.e. with the irregular structure of the sparse matrices. So far, we have already implemented the proposed SMVM-NoC architecture with the size 4×4 and 5×5 in IEEE 754 single float point precision using FPGA.

Artificial Neural Network and application in calibration transfer of AOTF-based NIR spectrometer

NASA Astrophysics Data System (ADS)

Wang, Wenbo; Jiang, Chengzhi; Xu, Kexin; Wang, Bin

2002-09-01

Chemometrics is widely applied to develop models for quantitative prediction of unknown samples in Near-infrared (NIR) spectroscopy. However, calibrated models generally fail when new instruments are introduced or replacement of the instrument parts occurs. Therefore, calibration transfer becomes necessary to avoid the costly, time-consuming recalibration of models. Piecewise Direct Standardization (PDS) has been proven to be a reference method for standardization. In this paper, Artificial Neural Network (ANN) is employed as an alternative to transfer spectra between instruments. Two Acousto-optic Tunable Filter NIR spectrometers are employed in the experiment. Spectra of glucose solution are collected on the spectrometers through transflectance mode. A Back propagation Network with two layers is employed to simulate the function between instruments piecewisely. Standardization subset is selected by Kennard and Stone (K-S) algorithm in the first two score space of Principal Component Analysis (PCA) of spectra matrix. In current experiment, it is noted that obvious nonlinearity exists between instruments and attempts are made to correct such nonlinear effect. Prediction results before and after successful calibration transfer are compared. Successful transfer can be achieved by adapting window size and training parameters. Final results reveal that ANN is effective in correcting the nonlinear instrumental difference and a only 1.5~2 times larger prediction error is expected after successful transfer.

Kinetic modelling of a diesel-polluted clayey soil bioremediation process.

PubMed

Fernández, Engracia Lacasa; Merlo, Elena Moliterni; Mayor, Lourdes Rodríguez; Camacho, José Villaseñor

2016-07-01

A mathematical model is proposed to describe a diesel-polluted clayey soil bioremediation process. The reaction system under study was considered a completely mixed closed batch reactor, which initially contacted a soil matrix polluted with diesel hydrocarbons, an aqueous liquid-specific culture medium and a microbial inoculation. The model coupled the mass transfer phenomena and the distribution of hydrocarbons among four phases (solid, S; water, A; non-aqueous liquid, NAPL; and air, V) with Monod kinetics. In the first step, the model simulating abiotic conditions was used to estimate only the mass transfer coefficients. In the second step, the model including both mass transfer and biodegradation phenomena was used to estimate the biological kinetic and stoichiometric parameters. In both situations, the model predictions were validated with experimental data that corresponded to previous research by the same authors. A correct fit between the model predictions and the experimental data was observed because the modelling curves captured the major trends for the diesel distribution in each phase. The model parameters were compared to different previously reported values found in the literature. Pearson correlation coefficients were used to show the reproducibility level of the model. Copyright © 2016. Published by Elsevier B.V.

Models of the thermal effects of melt migration at continental interiors, with applications to the Colorado Plateau

NASA Astrophysics Data System (ADS)

Roy, M.; Rios, D.; Cosburn, K.

2017-12-01

Shear between the moving lithosphere and the underlying asthenospheric mantle can produce dynamic pressure gradients that control patterns of melt migration by percolative flow. Within continental interiors these pressure gradients may be large enough to focus melt migration into zones of low dynamic pressure and thus influence the surface distribution of magmatism. We build upon previous work to show that for a lithospheric keel that protrudes into the "mantle wind," spatially-variable melt migration can lead to spatially-variable thermal weakening of the lithosphere. Our models treat advective heat transfer in porous flow in the limit that heat transfer between the melt and surrounding matrix dominates over conductive heat transfer within either the melt or the solid alone. The models are parameterized by a heat transfer coefficient that we interpret to be related to the efficiency of heat transfer across the fluid-rock interface, related to the geometry and distribution of porosity. Our models quantitatively assess the viability of spatially variable thermal-weakening caused by melt-migration through continental regions that are characterized by variations in lithospheric thickness. We speculate upon the relevance of this process in producing surface patterns of Cenozoic magmatism and heatflow at the Colorado Plateau in the western US.

Scattering and Emission from Inhomogeneous Vegetation Canopy and Alien Target by Using Three-Dimensional Vector Radiative Transfer (3D-VRT) Equation

NASA Astrophysics Data System (ADS)

Jin, Ya-Qiu; Liang, Zichang

2005-01-01

To solve 3D-VRT equation for the model of spatially inhomogeneous scatter media, the finite enclosure of the scatter media is geometrically divided, in both the vertical z and horizontal (x,y) directions, to form very thin multi-boxes. The zero-th order emission, first-order Mueller matrix of each thin box and an iterative approach of high-order radiative transfer are applied to deriving high-order scattering and emission of whole inhomogeneous scatter media. Numerical results of polarized brightness temperature at microwave frequency and under different radiometer's resolutions from inhomogeneous scatter model such as vegetation canopy and embedded alien target are simulated and discussed.

Electronic coupling matrix elements from charge constrained density functional theory calculations using a plane wave basis set

NASA Astrophysics Data System (ADS)

Oberhofer, Harald; Blumberger, Jochen

2010-12-01

We present a plane wave basis set implementation for the calculation of electronic coupling matrix elements of electron transfer reactions within the framework of constrained density functional theory (CDFT). Following the work of Wu and Van Voorhis [J. Chem. Phys. 125, 164105 (2006)], the diabatic wavefunctions are approximated by the Kohn-Sham determinants obtained from CDFT calculations, and the coupling matrix element calculated by an efficient integration scheme. Our results for intermolecular electron transfer in small systems agree very well with high-level ab initio calculations based on generalized Mulliken-Hush theory, and with previous local basis set CDFT calculations. The effect of thermal fluctuations on the coupling matrix element is demonstrated for intramolecular electron transfer in the tetrathiafulvalene-diquinone (Q-TTF-Q-) anion. Sampling the electronic coupling along density functional based molecular dynamics trajectories, we find that thermal fluctuations, in particular the slow bending motion of the molecule, can lead to changes in the instantaneous electron transfer rate by more than an order of magnitude. The thermal average, ( {< {| {H_ab } |^2 } > } )^{1/2} = 6.7 {mH}, is significantly higher than the value obtained for the minimum energy structure, | {H_ab } | = 3.8 {mH}. While CDFT in combination with generalized gradient approximation (GGA) functionals describes the intermolecular electron transfer in the studied systems well, exact exchange is required for Q-TTF-Q- in order to obtain coupling matrix elements in agreement with experiment (3.9 mH). The implementation presented opens up the possibility to compute electronic coupling matrix elements for extended systems where donor, acceptor, and the environment are treated at the quantum mechanical (QM) level.

Development of Matrix Microstructures in UHTC Composites

NASA Technical Reports Server (NTRS)

Johnson, Sylvia; Stackpoole, Margaret; Gusman, Michael

2012-01-01

One of the major issues hindering the use of ultra high temperature ceramics for aerospace applications is low fracture toughness. There is considerable interest in developing fiber-reinforced composites to improve fracture toughness. Considerable knowledge has been gained in controlling and improving the microstructure of monolithic UHTCs, and this paper addresses the question of transferring that knowledge to composites. Some model composites have been made and the microstructures of the matrix developed has been explored and compared to the microstructure of monolithic materials in the hafnium diboride/silicon carbide family. Both 2D and 3D weaves have been impregnated and processed.

Strong coupling between surface plasmon polariton and laser dye rhodamine 800

NASA Astrophysics Data System (ADS)

Valmorra, Federico; Bröll, Markus; Schwaiger, Stephan; Welzel, Nadine; Heitmann, Detlef; Mendach, Stefan

2011-08-01

We report on strong coupling between surface plasmon polaritons on a thin silver film and laser dye Rhodamine 800. Attenuated total reflection measurements reveal that the pure surface plasmon polaritons interact with the Rhodamine 800 absorption lines exhibiting pronounced anticrossings in the dispersion relation. We show that the corresponding energy gap can be tailored by the concentration of dye molecules in the dielectric matrix between 50 meV and 70 meV. We can well model our data by a classical transfer matrix approach as well as by a quantum mechanical coupled oscillator ansatz.

7Li(d,p)8Li transfer reaction in the NCSM/RGM approach

NASA Astrophysics Data System (ADS)

Raimondi, F.; Hupin, G.; Navrátil, P.; Quaglioni, S.

2018-03-01

Recently, we applied an ab initio method, the no-core shell model combined with the resonating group method, to the transfer reactions with light p-shell nuclei as targets and deuteron as the projectile. In particular, we studied the elastic scattering of deuterium on 7Li and the 7Li(d,p)8Li transfer reaction starting from a realistic two-nucleon interaction. In this contribution, we review of our main results on the 7Li(d,p)8Li transfer reaction, and we extend the study of the relevant reaction channels, by showing the dominant resonant phase shifts of the scattering matrix. We assess also the impact of the polarization effects of the deuteron below the breakup on the positive-parity resonant states in the reaction. For this purpose, we perform an analysis of the convergence trend of the phase and eigenphase shifts, with respect to the number of deuteron pseudostates included in the model space.

A direct approach to the design of linear multivariable systems

NASA Technical Reports Server (NTRS)

Agrawal, B. L.

1974-01-01

Design of multivariable systems is considered and design procedures are formulated in the light of the most recent work on model matching. The word model matching is used exclusively to mean matching the input-output behavior of two systems. The term is used in the frequency domain to indicate the comparison of two transfer matrices containing transfer functions as elements. Design methods where non-interaction is not used as a criteria were studied. Two design methods are considered. The first method of design is based solely upon the specification of generalized error coefficients for each individual transfer function of the overall system transfer matrix. The second design method is called the pole fixing method because all the system poles are fixed at preassigned positions. The zeros of terms either above or below the diagonal are partially fixed via steady state error coefficients. The advantages and disadvantages of each method are discussed and an example is worked to demonstrate their uses. The special cases of triangular decoupling and minimum constraints are discussed.

A complete two-phase model of a porous cathode of a PEM fuel cell

NASA Astrophysics Data System (ADS)

Hwang, J. J.

This paper has developed a complete two-phase model of a proton exchange membrane (PEM) fuel cell by considering fluid flow, heat transfer and current simultaneously. In fluid flow, two momentum equations governing separately the gaseous-mixture velocity (u g) and the liquid-water velocity (u w) illustrate the behaviors of the two-phase flow in a porous electrode. Correlations for the capillary pressure and the saturation level connect the above two-fluid transports. In heat transfer, a local thermal non-equilibrium (LTNE) model accounting for intrinsic heat transfer between the reactant fluids and the solid matrices depicts the interactions between the reactant-fluid temperature (T f) and the solid-matrix temperature (T s). The irreversibility heating due to electrochemical reactions, Joule heating arising from Ohmic resistance, and latent heat of water condensation/evaporation are considered in the present non-isothermal model. In current, Ohm's law is applied to yield the conservations in ionic current (i m) and electronic current (i s) in the catalyst layer. The Butler-Volmer correlation describes the relation of the potential difference (overpotential) and the transfer current between the electrolyte (such as Nafion™) and the catalyst (such as Pt/C).

An improved biomechanical model for simulating the strain of the hand-arm system under vibration stress.

PubMed

Fritz, M

1991-01-01

In order to define relationships between the vibration stress and the strain of the human hand-arm system a biomechanical model was developed. The four masses of the model representing the hand, the forearm and the upper arm were connected by dampers and springs in two perpendicular directions. Simulating muscle activity, damped torsion springs were included additionally. The motions of the model were described by a differential matrix equation which was solved by using a 'transfer matrix routine' as well as by numerical integration. Thus, functions with harmonic or transient time courses could be selected as an excitation. The simulated vibrations were compared with those of other hand-arm models. The forces and torques transmitted between the masses, and the energy dissipated by the dampers were computed for several combinations of exciter frequencies and accelerations. The dependence of torques upon excitation agreed fairly well with the behaviour of the arm muscles under vibration as described by various investigators. At frequencies above 100 Hz the energy was dissipated mainly by the dampers between the masses near to the exciter. Transferring this result to the hand-arm system it shows that at high frequencies energy is dissipated by the hand and its palmar tissues and this might be one cause for the incidence of vibration-induced white finger disease.

Solute Migration from the Aquifer Matrix into a Solution Conduit and the Reverse.

PubMed

Li, Guangquan; Field, Malcolm S

2016-09-01

A solution conduit has a permeable wall allowing for water exchange and solute transfer between the conduit and its surrounding aquifer matrix. In this paper, we use Laplace Transform to solve a one-dimensional equation constructed using the Euler approach to describe advective transport of solute in a conduit, a production-value problem. Both nonuniform cross-section of the conduit and nonuniform seepage at the conduit wall are considered in the solution. Physical analysis using the Lagrangian approach and a lumping method is performed to verify the solution. Two-way transfer between conduit water and matrix water is also investigated by using the solution for the production-value problem as a first-order approximation. The approximate solution agrees well with the exact solution if dimensionless travel time in the conduit is an order of magnitude smaller than unity. Our analytical solution is based on the assumption that the spatial and/or temporal heterogeneity in the wall solute flux is the dominant factor in the spreading of spring-breakthrough curves, and conduit dispersion is only a secondary mechanism. Such an approach can lead to the better understanding of water exchange and solute transfer between conduits and aquifer matrix. Euler and Lagrangian approaches are used to solve transport in conduit. Two-way transfer between conduit and matrix is investigated. The solution is applicable to transport in conduit of persisting solute from matrix. © 2016, National Ground Water Association.

Heat Transfer Characteristics of Regenerator Matrix (Case of Packed Wire Gauzes)

NASA Technical Reports Server (NTRS)

Hamaguchi, K.; Takahashi, S.; Miyabe, H.

1984-01-01

The average heat transfer coefficient in the matrix of laminated wire screens (10 to 250 mesh) for a Stirling engine heat exchanger was studied experimentally. The data are correlated by N sub ud = 0.42 R sub ed 0.56 (3 or = R sub ed or = 400), and R sub ed are the Nusselt and Reynolds nubmers based on the wire diameter. The pressure drop decreased and the heat transfer increased as the wire diameter was decreased.

Reduced modeling of flexible structures for decentralized control

NASA Technical Reports Server (NTRS)

Yousuff, A.; Tan, T. M.; Bahar, L. Y.; Konstantinidis, M. F.

1986-01-01

Based upon the modified finite element-transfer matrix method, this paper presents a technique for reduced modeling of flexible structures for decentralized control. The modeling decisions are carried out at (finite-) element level, and are dictated by control objectives. A simply supported beam with two sets of actuators and sensors (linear force actuator and linear position and velocity sensors) is considered for illustration. In this case, it is conjectured that the decentrally controlled closed loop system is guaranteed to be at least marginally stable.

Modelling of intermittent microwave convective drying: parameter sensitivity

NASA Astrophysics Data System (ADS)

Zhang, Zhijun; Qin, Wenchao; Shi, Bin; Gao, Jingxin; Zhang, Shiwei

2017-06-01

The reliability of the predictions of a mathematical model is a prerequisite to its utilization. A multiphase porous media model of intermittent microwave convective drying is developed based on the literature. The model considers the liquid water, gas and solid matrix inside of food. The model is simulated by COMSOL software. Its sensitivity parameter is analysed by changing the parameter values by ±20%, with the exception of several parameters. The sensitivity analysis of the process of the microwave power level shows that each parameter: ambient temperature, effective gas diffusivity, and evaporation rate constant, has significant effects on the process. However, the surface mass, heat transfer coefficient, relative and intrinsic permeability of the gas, and capillary diffusivity of water do not have a considerable effect. The evaporation rate constant has minimal parameter sensitivity with a ±20% value change, until it is changed 10-fold. In all results, the temperature and vapour pressure curves show the same trends as the moisture content curve. However, the water saturation at the medium surface and in the centre show different results. Vapour transfer is the major mass transfer phenomenon that affects the drying process.

A Transfer Learning Approach for Applying Matrix Factorization to Small ITS Datasets

ERIC Educational Resources Information Center

Voß, Lydia; Schatten, Carlotta; Mazziotti, Claudia; Schmidt-Thieme, Lars

2015-01-01

Machine Learning methods for Performance Prediction in Intelligent Tutoring Systems (ITS) have proven their efficacy; specific methods, e.g. Matrix Factorization (MF), however suffer from the lack of available information about new tasks or new students. In this paper we show how this problem could be solved by applying Transfer Learning (TL),…

Toda theories as contractions of affine Toda theories

NASA Astrophysics Data System (ADS)

Aghamohammadi, A.; Khorrami, M.; Shariati, A.

1996-02-01

Using a contraction procedure, we obtain Toda theories and their structures, from affine Toda theories and their corresponding structures. By structures, we mean the equation of motion, the classical Lax pair, the boundary term for half line theories, and the quantum transfer matrix. The Lax pair and the transfer matrix so obtained, depend nontrivially on the spectral parameter.

A Synthetic Approach to the Transfer Matrix Method in Classical and Quantum Physics

ERIC Educational Resources Information Center

Pujol, O.; Perez, J. P.

2007-01-01

The aim of this paper is to propose a synthetic approach to the transfer matrix method in classical and quantum physics. This method is an efficient tool to deal with complicated physical systems of practical importance in geometrical light or charged particle optics, classical electronics, mechanics, electromagnetics and quantum physics. Teaching…

A simple transferable adaptive potential to study phase separation in large-scale xMgO-(1-x)SiO2 binary glasses.

PubMed

Bidault, Xavier; Chaussedent, Stéphane; Blanc, Wilfried

2015-10-21

A simple transferable adaptive model is developed and it allows for the first time to simulate by molecular dynamics the separation of large phases in the MgO-SiO2 binary system, as experimentally observed and as predicted by the phase diagram, meaning that separated phases have various compositions. This is a real improvement over fixed-charge models, which are often limited to an interpretation involving the formation of pure clusters, or involving the modified random network model. Our adaptive model, efficient to reproduce known crystalline and glassy structures, allows us to track the formation of large amorphous Mg-rich Si-poor nanoparticles in an Mg-poor Si-rich matrix from a 0.1MgO-0.9SiO2 melt.

MS-CASPT2 study of hole transfer in guanine-indole complexes using the generalized Mulliken-Hush method: effective two-state treatment.

PubMed

Butchosa, C; Simon, S; Blancafort, L; Voityuk, A

2012-07-12

Because hole transfer from nucleobases to amino acid residues in DNA-protein complexes can prevent oxidative damage of DNA in living cells, computational modeling of the process is of high interest. We performed MS-CASPT2 calculations of several model structures of π-stacked guanine and indole and derived electron-transfer (ET) parameters for these systems using the generalized Mulliken-Hush (GMH) method. We show that the two-state model commonly applied to treat thermal ET between adjacent donor and acceptor is of limited use for the considered systems because of the small gap between the ground and first excited states in the indole radical cation. The ET parameters obtained within the two-state GMH scheme can deviate significantly from the corresponding matrix elements of the two-state effective Hamiltonian based on the GMH treatment of three adiabatic states. The computed values of diabatic energies and electronic couplings provide benchmarks to assess the performance of less sophisticated computational methods.

Gamow-Teller transitions and neutron-proton-pair transfer reactions

NASA Astrophysics Data System (ADS)

Van Isacker, P.; Macchiavelli, A. O.

2018-05-01

We propose a schematic model of nucleons moving in spin-orbit partner levels, j = l ± 1/2, to explain Gamow-Teller and two-nucleon transfer data in N = Z nuclei above 40Ca. Use of the LS coupling scheme provides a more transparent approach to interpret the structure and reaction data. We apply the model to the analysis of charge-exchange, 42Ca(3He,t)42Sc, and np-transfer, 40Ca(3He,p)42Sc, reactions data to define the elementary modes of excitation in terms of both isovector and isoscalar pairs, whose properties can be determined by adjusting the parameters of the model (spin-orbit splitting, isovector pairing strength and quadrupole matrix element) to the available data. The overall agreement with experiment suggests that the approach captures the main physics ingredients and provides the basis for a boson approximation that can be extended to heavier nuclei. Our analysis also reveals that the SU(4)-symmetry limit is not realized in 42Sc.

Imaging and modeling of collagen architecture in living tissue with polarized light transfer (Conference Presentation)

NASA Astrophysics Data System (ADS)

Ramella-Roman, Jessica C.; Stoff, Susan; Chue-Sang, Joseph; Bai, Yuqiang

2016-03-01

The extra-cellular space in connective tissue of animals and humans alike is comprised in large part of collagen. Monitoring of collagen arrangement and cross-linking has been utilized to diagnose a variety of medical conditions and guide surgical intervention. For example, collagen monitoring is useful in the assessment and treatment of cervical cancer, skin cancer, myocardial infarction, and non-arteritic anterior ischemic optic neuropathy. We have developed a suite of tools and models based on polarized light transfer for the assessment of collagen presence, cross-linking, and orientation in living tissue. Here we will present some example of such approach applied to the human cervix. We will illustrate a novel Mueller Matrix (MM) imaging system for the study of cervical tissue; furthermore we will show how our model of polarized light transfer through cervical tissue compares to the experimental findings. Finally we will show validation of the methodology through histological results and Second Harmonic imaging microscopy.

Polarimetric signatures of a coniferous forest canopy based on vector radiative transfer theory

NASA Technical Reports Server (NTRS)

Karam, M. A.; Fung, A. K.; Amar, F.; Mougin, E.; Lopes, A.; Beaudoin, A.

1992-01-01

Complete polarization signatures of a coniferous forest canopy are studied by the iterative solution of the vector radiative transfer equations up to the second order. The forest canopy constituents (leaves, branches, stems, and trunk) are embedded in a multi-layered medium over a rough interface. The branches, stems and trunk scatterers are modeled as finite randomly oriented cylinders. The leaves are modeled as randomly oriented needles. For a plane wave exciting the canopy, the average Mueller matrix is formulated in terms of the iterative solution of the radiative transfer solution and used to determine the linearly polarized backscattering coefficients, the co-polarized and cross-polarized power returns, and the phase difference statistics. Numerical results are presented to investigate the effect of transmitting and receiving antenna configurations on the polarimetric signature of a pine forest. Comparison is made with measurements.

Mass balance modelling of contaminants in river basins: a flexible matrix approach.

PubMed

Warren, Christopher; Mackay, Don; Whelan, Mick; Fox, Kay

2005-12-01

A novel and flexible approach is described for simulating the behaviour of chemicals in river basins. A number (n) of river reaches are defined and their connectivity is described by entries in an n x n matrix. Changes in segmentation can be readily accommodated by altering the matrix entries, without the need for model revision. Two models are described. The simpler QMX-R model only considers advection and an overall loss due to the combined processes of volatilization, net transfer to sediment and degradation. The rate constant for the overall loss is derived from fugacity calculations for a single segment system. The more rigorous QMX-F model performs fugacity calculations for each segment and explicitly includes the processes of advection, evaporation, water-sediment exchange and degradation in both water and sediment. In this way chemical exposure in all compartments (including equilibrium concentrations in biota) can be estimated. Both models are designed to serve as intermediate-complexity exposure assessment tools for river basins with relatively low data requirements. By considering the spatially explicit nature of emission sources and the changes in concentration which occur with transport in the channel system, the approach offers significant advantages over simple one-segment simulations while being more readily applicable than more sophisticated, highly segmented, GIS-based models.

Detection of no-model input-output pairs in closed-loop systems.

PubMed

Potts, Alain Segundo; Alvarado, Christiam Segundo Morales; Garcia, Claudio

2017-11-01

The detection of no-model input-output (IO) pairs is important because it can speed up the multivariable system identification process, since all the pairs with null transfer functions are previously discarded and it can also improve the identified model quality, thus improving the performance of model based controllers. In the available literature, the methods focus just on the open-loop case, since in this case there is not the effect of the controller forcing the main diagonal in the transfer matrix to one and all the other terms to zero. In this paper, a modification of a previous method able to detect no-model IO pairs in open-loop systems is presented, but adapted to perform this duty in closed-loop systems. Tests are performed by using the traditional methods and the proposed one to show its effectiveness. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Flat (0 0 1) surfaces of II-VI semiconductors: a lattice gas model

NASA Astrophysics Data System (ADS)

Ahr, Martin; Biehl, Michael

2002-05-01

We present a two-dimensional lattice gas with anisotropic interactions which model the known properties of the surface reconstructions of CdTe and ZnSe. In contrast to an earlier publication [M. Biehl, M. Ahr, W. Kinzel, M. Sokolowski, T. Volkmann, Europhys. Lett. 53 (2001) 169] the formation of anion dimers is considered. This alters the behaviour of the model considerably. We determine the phase diagram of this model by means of transfer matrix calculations and Monte Carlo simulations. We find qualitative agreement with the results of various experimental investigations.

Quantum kinetic expansion in the spin-boson model: Matrix formulation and system-bath factorized initial state.

PubMed

Gong, Zhihao; Tang, Zhoufei; Wang, Haobin; Wu, Jianlan

2017-12-28

Within the framework of the hierarchy equation of motion (HEOM), the quantum kinetic expansion (QKE) method of the spin-boson model is reformulated in the matrix representation. The equivalence between the two formulations (HEOM matrices and quantum operators) is numerically verified from the calculation of the time-integrated QKE rates. The matrix formulation of the QKE is extended to the system-bath factorized initial state. Following a one-to-one mapping between HEOM matrices and quantum operators, a quantum kinetic equation is rederived. The rate kernel is modified by an extra term following a systematic expansion over the site-site coupling. This modified QKE is numerically tested for its reliability by calculating the time-integrated rate and non-Markovian population kinetics. For an intermediate-to-strong dissipation strength and a large site-site coupling, the population transfer is found to be significantly different when the initial condition is changed from the local equilibrium to system-bath factorized state.

MALDI In-Source Decay of Protein: The Mechanism of c-Ion Formation

PubMed Central

Takayama, Mitsuo

2016-01-01

The in-source decay (ISD) phenomenon, the fragmentation at an N–Cα bond of a peptide backbone that occurs within several tens of nanoseconds in the ion-source in matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS), is discussed from the standpoints of the discovery and early publications dealing with MALDI-ISD, the formation of c-ions in energy-sudden desorption/ionization methods, the formation of radical species in a MALDI, model construction for ISD, and matrix materials that are suitable for use in MALDI-ISD. The formation of c-ions derived from peptides and proteins in MALDI-ISD can be rationalized by a mechanism involving intermolecular hydrogen transfer, denoted as the “Takayama’s model” by De Pauw’s group (Anal. Chem. 79: 8678–8685, 2007). It should be emphasized that the model for MALDI-ISD was constructed on the basis of X-ray crystallography and scanning probe microscopy (SPM) analyses of matrix crystals, as well as the use of isotopically-labelled peptides. PMID:27162707

Application of unsteady flow rate evaluations to identify the dynamic transfer function of a cavitatingVenturi

NASA Astrophysics Data System (ADS)

Marie-Magdeleine, A.; Fortes-Patella, R.; Lemoine, N.; Marchand, N.

2012-11-01

This study concerns the simulation of the implementation of the Kinetic Differential Pressure (KDP) method used for the unsteady mass flow rate evaluation in order to identify the dynamic transfer matrix of a cavitatingVenturi. Firstly, the equations of the IZ code used for this simulation are introduced. Next, the methodology for evaluating unsteady pressures and mass flow rates at the inlet and the outlet of the cavitatingVenturi and for identifying the dynamic transfer matrix is presented. Later, the robustness of the method towards measurement uncertainties implemented as a Gaussian white noise is studied. The results of the numerical simulations let us estimate the system linearity domain and to perform the Empirical Transfer Function Evaluation on the inlet frequency per frequency signal and on the chirp signal tests. Then the pressure data obtained with the KDP method is taken and the identification procedure by ETFE and by the user-made Auto-Recursive Moving-Average eXogenous algorithms is performed and the obtained transfer matrix coefficients are compared with those obtained from the simulated input and output data.

Dispersion relations of elastic waves in one-dimensional piezoelectric/piezomagnetic phononic crystal with functionally graded interlayers.

PubMed

Guo, Xiao; Wei, Peijun; Lan, Man; Li, Li

2016-08-01

The effects of functionally graded interlayers on dispersion relations of elastic waves in a one-dimensional piezoelectric/piezomagnetic phononic crystal are studied in this paper. First, the state transfer equation of the functionally graded interlayer is derived from the motion equation by the reduction of order (from second order to first order). The transfer matrix of the functionally graded interlayer is obtained by solving the state transfer equation with the spatial-varying coefficient. Based on the transfer matrixes of the piezoelectric slab, the piezomagnetic slab and the functionally graded interlayers, the total transfer matrix of a single cell is obtained. Further, the Bloch theorem is used to obtain the resultant dispersion equations of in-plane and anti-plane Bloch waves. The dispersion equations are solved numerically and the numerical results are shown graphically. Five kinds of profiles of functionally graded interlayers between a piezoelectric slab and a piezomagnetic slab are considered. It is shown that the functionally graded interlayers have evident influences on the dispersion curves and the band gaps. Copyright © 2016 Elsevier B.V. All rights reserved.

Superconducting coil and method of stress management in a superconducting coil

DOEpatents

McIntyre, Peter M.; Shen, Weijun; Diaczenko, Nick; Gross, Dan A.

1999-01-01

A superconducting coil (12) having a plurality of superconducting layers (18) is provided. Each superconducting layer (18) may have at least one superconducting element (20) which produces an operational load. An outer support structure (24) may be disposed outwardly from the plurality of layers (18). A load transfer system (22) may be coupled between at least one of the superconducting elements (20) and the outer support structure (24). The load transfer system (22) may include a support matrix structure (30) operable to transfer the operational load from the superconducting element (20) directly to the outer support structure (24). A shear release layer (40) may be disposed, in part, between the superconducting element (20) and the support matrix structure (30) for relieving a shear stress between the superconducting element (20) and the support matrix structure (30). A compliant layer (42) may also be disposed, in part, between the superconducting element (20) and the support matrix structure (30) for relieving a compressive stress on the superconducting element (20).

One-Shot Decoupling and Page Curves from a Dynamical Model for Black Hole Evaporation.

PubMed

Brádler, Kamil; Adami, Christoph

2016-03-11

One-shot decoupling is a powerful primitive in quantum information theory and was hypothesized to play a role in the black hole information paradox. We study black hole dynamics modeled by a trilinear Hamiltonian whose semiclassical limit gives rise to Hawking radiation. An explicit numerical calculation of the discretized path integral of the S matrix shows that decoupling is exact in the continuous limit, implying that quantum information is perfectly transferred from the black hole to radiation. A striking consequence of decoupling is the emergence of an output radiation entropy profile that follows Page's prediction. We argue that information transfer and the emergence of Page curves is a robust feature of any multilinear interaction Hamiltonian with a bounded spectrum.

A method to model latent heat for transient analysis using NASTRAN

NASA Technical Reports Server (NTRS)

Harder, R. L.

1982-01-01

A sample heat transfer analysis is demonstrated which includes the heat of fusion. The method can be used to analyze a system with nonconstant specific heat. The enthalpy is introduced as an independent degree of freedom at each node. The user input consists of a curve of temperature as a function of enthalpy, which may include a constant temperature phase change. The basic NASTRAN heat transfer capability is used to model the effects of latent heat with existing direct matrix output and nonlinear load data cards. Although some user care is required, the numerical stability of the integration is quite good when the given recommendations are followed. The theoretical equations used and the NASTRAN techniques are shown.

Scattering and emission from inhomogeneous vegetation canopy and alien target beneath by using three-dimensional vector radiative transfer (3D-VRT) equation

NASA Astrophysics Data System (ADS)

Jin, Ya-Qiu; Liang, Zichang

2005-05-01

To solve the 3D-VRT equation for the model of spatially inhomogeneous scatter media, the finite enclosure of the scatter media is geometrically divided, in both vertical z and transversal (x,y) directions, to form very thin multi-boxes. The zeroth order emission, first-order Mueller matrix of each thin box and an iterative approach of high-order radiative transfer are applied to derive high-order scattering and emission of whole inhomogeneous scatter media. Numerical results of polarized brightness temperature at microwave frequency and under different radiometer resolutions from inhomogeneous scatter model such as vegetation canopy and alien target beneath canopy are simulated and discussed.

Experiences on p-Version Time-Discontinuous Galerkin's Method for Nonlinear Heat Transfer Analysis and Sensitivity Analysis

NASA Technical Reports Server (NTRS)

Hou, Gene

2004-01-01

The focus of this research is on the development of analysis and sensitivity analysis equations for nonlinear, transient heat transfer problems modeled by p-version, time discontinuous finite element approximation. The resulting matrix equation of the state equation is simply in the form ofA(x)x = c, representing a single step, time marching scheme. The Newton-Raphson's method is used to solve the nonlinear equation. Examples are first provided to demonstrate the accuracy characteristics of the resultant finite element approximation. A direct differentiation approach is then used to compute the thermal sensitivities of a nonlinear heat transfer problem. The report shows that only minimal coding effort is required to enhance the analysis code with the sensitivity analysis capability.

Vector meson photoproduction with a linearly polarized beam

NASA Astrophysics Data System (ADS)

Mathieu, V.; Nys, J.; Fernández-Ramírez, C.; Jackura, A.; Pilloni, A.; Sherrill, N.; Szczepaniak, A. P.; Fox, G.; Joint Physics Analysis Center

2018-05-01

We propose a model based on Regge theory to describe photoproduction of light vector mesons. We fit the SLAC data and make predictions for the energy and momentum-transfer dependence of the spin-density matrix elements in photoproduction of ω , ρ0 and ϕ mesons at Eγ˜8.5 GeV , which are soon to be measured at Jefferson Lab.

Advanced Physical Models and Numerical Methods for High Enthalpy and Plasma Flows Applied to Hypersonics

DTIC Science & Technology

2011-07-28

4874–48??, 1970. [16] R. O. Jung , J. B. Boffard, L. W. Anderson, and C. C. Lin. Electron-impact excitation cross sections from the xenon j = 2...Journal of Quantitative Spectroscopy and Radiative Transfer, 5(2):503– 510, 1965. [35] O. Zatsarinny and K. Bartschat. B -spline Breit- Pauli R-matrix

Torsional vibration measurements on rotating shaft system using laser doppler vibrometer

NASA Astrophysics Data System (ADS)

Xiang, Ling; Yang, Shixi; Gan, Chunbiao

2012-11-01

In this work, a laser torsional vibrameter was used to measure the torsion vibration of a rotating shaft system under electrical network impact. Based on the principles of laser Doppler velocimetry, the laser torsional vibrometer (LTV) are non-contact measurement of torsional oscillation of rotating shafts, offering significant advantages over conventional techniques. Furthermore, a highly complex shafting system is analyzed by a modified Riccati torsional transfer matrix. The system is modeled as a chain consisting of an elastic spring with concentrated mass points, and the multi-segments lumped mass model is established for this shafting system. By the modified Riccati torsional transfer matrix method, an accumulated calculation is effectively eliminated to obtain the natural frequencies. The electrical network impacts can activize the torsional vibration of shaft system, and the activized torsion vibration frequencies contained the natural frequencies of shaft system. The torsional vibrations of the shaft system were measured under electrical network impacts in laser Doppler torsional vibrometer. By comparisons, the natural frequencies by measurement were consistent with the values by calculation. The results verify the instrument is robust, user friendly and can be calibrated in situ. The laser torsional vibrometer represents a significant step forward in rotating machinery diagnostics.

Electrodialytic matrix isolation for metal cations.

PubMed

Ohira, Shin-Ichi; Hiroyama, Yuri; Nakamura, Koretaka; Koda, Takumi; Dasgupta, Purnendu K; Toda, Kei

2015-01-01

Electrodialytic ion transfer was studied as a matrix isolation tool for heavy metal determinations. An ion transfer device (ITD) was used for the transfer of heavy metal cations. Under optimized flow rates applied voltage and receptor composition, heavy metal ions were quantitatively transferred at concentrations spanning µg L(-1) to mg L(-1). As long as the sample pH was acidic, there was no significant sample pH effect on the transfer efficiencies. Significant salt concentrations (>1 mM NaCl), however, decreased the transfer efficiency. This could be ameliorated (up to 5 mM NaCl) by transient instead of continuous sample introduction. The device was applied to the determination of Fe, Cu and Zn in equine and bovine serum; the reproducibility was better than conventional digestion method. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of flank wear model of cutting tool by using adaptive feedback linear control system on machining AISI D2 steel and AISI 4340 steel

NASA Astrophysics Data System (ADS)

Orra, Kashfull; Choudhury, Sounak K.

2016-12-01

The purpose of this paper is to build an adaptive feedback linear control system to check the variation of cutting force signal to improve the tool life. The paper discusses the use of transfer function approach in improving the mathematical modelling and adaptively controlling the process dynamics of the turning operation. The experimental results shows to be in agreement with the simulation model and error obtained is less than 3%. The state space approach model used in this paper successfully check the adequacy of the control system through controllability and observability test matrix and can be transferred from one state to another by appropriate input control in a finite time. The proposed system can be implemented to other machining process under varying range of cutting conditions to improve the efficiency and observability of the system.

A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

NASA Astrophysics Data System (ADS)

Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; Lambrakos, Samuel G.; Moody, Nathan A.; Petillo, John J.; Yamaguchi, Hisato; Liu, Fangze

2018-01-01

Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al. [Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated by an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quantum yield, emittance, and emission models needed by beam optics codes are discussed.

Dynamic modeling and parameter estimation of a radial and loop type distribution system network

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jun Qui; Heng Chen; Girgis, A.A.

1993-05-01

This paper presents a new identification approach to three-phase power system modeling and model reduction taking power system network as multi-input, multi-output (MIMO) processes. The model estimate can be obtained in discrete-time input-output form, discrete- or continuous-time state-space variable form, or frequency-domain impedance transfer function matrix form. An algorithm for determining the model structure of this MIMO process is described. The effect of measurement noise on the approach is also discussed. This approach has been applied on a sample system and simulation results are also presented in this paper.

Semi-analytical model for a slab one-dimensional photonic crystal

NASA Astrophysics Data System (ADS)

Libman, M.; Kondratyev, N. M.; Gorodetsky, M. L.

2018-02-01

In our work we justify the applicability of a dielectric mirror model to the description of a real photonic crystal. We demonstrate that a simple one-dimensional model of a multilayer mirror can be employed for modeling of a slab waveguide with periodically changing width. It is shown that this width change can be recalculated to the effective refraction index modulation. The applicability of transfer matrix method of reflection properties calculation was demonstrated. Finally, our 1-D model was employed to analyze reflection properties of a 2-D structure - a slab photonic crystal with a number of elliptic holes.

Complete spatiotemporal characterization and optical transfer matrix inversion of a 420 mode fiber.

PubMed

Carpenter, Joel; Eggleton, Benjamin J; Schröder, Jochen

2016-12-01

The ability to measure a scattering medium's optical transfer matrix, the mapping between any spatial input and output, has enabled applications such as imaging to be performed through media which would otherwise be opaque due to scattering. However, the scattering of light occurs not just in space, but also in time. We complete the characterization of scatter by extending optical transfer matrix methods into the time domain, allowing any spatiotemporal input state at one end to be mapped directly to its corresponding spatiotemporal output state. We have measured the optical transfer function of a multimode fiber in its entirety; it consists of 420 modes in/out at 32768 wavelengths, the most detailed complete characterization of multimode waveguide light propagation to date, to the best of our knowledge. We then demonstrate the ability to generate any spatial/polarization state at the output of the fiber at any wavelength, as well as predict the temporal response of any spatial/polarization input state.

Exact solution of a one-dimensional model of strained epitaxy on a periodically modulated substrate

NASA Astrophysics Data System (ADS)

Tokar, V. I.; Dreyssé, H.

2005-03-01

We consider a one-dimensional lattice gas model of strained epitaxy with the elastic strain accounted for through a finite number of cluster interactions comprising contiguous atomic chains. Interactions of this type arise in the models of strained epitaxy based on the Frenkel-Kontorova model. Furthermore, the deposited atoms interact with the substrate via an arbitrary periodic potential of period L . This model is solved exactly with the use of an appropriately adopted technique developed recently in the theory of protein folding. The advantage of the proposed approach over the standard transfer-matrix method is that it reduces the problem to finding the largest eigenvalue of a matrix of size L instead of 2L-1 , which is vital in the case of nanostructures where L may measure in hundreds of interatomic distances. Our major conclusion is that the substrate modulation always facilitates the size calibration of self-assembled nanoparticles in one- and two-dimensional systems.

Topology-driven phase transitions in the classical monomer-dimer-loop model.

PubMed

Li, Sazi; Li, Wei; Chen, Ziyu

2015-06-01

In this work, we investigate the classical loop models doped with monomers and dimers on a square lattice, whose partition function can be expressed as a tensor network (TN). In the thermodynamic limit, we use the boundary matrix product state technique to contract the partition function TN, and determine the thermodynamic properties with high accuracy. In this monomer-dimer-loop model, we find a second-order phase transition between a trivial monomer-condensation and a loop-condensation (LC) phase, which cannot be distinguished by any local order parameter, while nevertheless the two phases have distinct topological properties. In the LC phase, we find two degenerate dominating eigenvalues in the transfer-matrix spectrum, as well as a nonvanishing (nonlocal) string order parameter, both of which identify the topological ergodicity breaking in the LC phase and can serve as the order parameter for detecting the phase transitions.

Exactly solved mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy

NASA Astrophysics Data System (ADS)

Lisnyi, Bohdan; Strečka, Jozef

2015-03-01

The mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy is exactly solved through the generalized decoration-iteration transformation and the transfer-matrix method. The decoration-iteration transformation is first used for establishing a rigorous mapping equivalence with the corresponding spin-1 Blume-Emery-Griffiths chain, which is subsequently exactly treated within the transfer-matrix technique. Apart from three classical ground states the model exhibits three striking quantum ground states in which a singlet-dimer state of the interstitial Heisenberg spins is accompanied either with a frustrated state or a polarized state or a non-magnetic state of the nodal Ising spins. It is evidenced that two magnetization plateaus at zero and/or one-half of the saturation magnetization may appear in low-temperature magnetization curves. The specific heat may display remarkable temperature dependences with up to three and four distinct round maxima in a zero and non-zero magnetic field, respectively.

Knowledge-transfer learning for prediction of matrix metalloprotease substrate-cleavage sites.

PubMed

Wang, Yanan; Song, Jiangning; Marquez-Lago, Tatiana T; Leier, André; Li, Chen; Lithgow, Trevor; Webb, Geoffrey I; Shen, Hong-Bin

2017-07-18

Matrix Metalloproteases (MMPs) are an important family of proteases that play crucial roles in key cellular and disease processes. Therefore, MMPs constitute important targets for drug design, development and delivery. Advanced proteomic technologies have identified type-specific target substrates; however, the complete repertoire of MMP substrates remains uncharacterized. Indeed, computational prediction of substrate-cleavage sites associated with MMPs is a challenging problem. This holds especially true when considering MMPs with few experimentally verified cleavage sites, such as for MMP-2, -3, -7, and -8. To fill this gap, we propose a new knowledge-transfer computational framework which effectively utilizes the hidden shared knowledge from some MMP types to enhance predictions of other, distinct target substrate-cleavage sites. Our computational framework uses support vector machines combined with transfer machine learning and feature selection. To demonstrate the value of the model, we extracted a variety of substrate sequence-derived features and compared the performance of our method using both 5-fold cross-validation and independent tests. The results show that our transfer-learning-based method provides a robust performance, which is at least comparable to traditional feature-selection methods for prediction of MMP-2, -3, -7, -8, -9 and -12 substrate-cleavage sites on independent tests. The results also demonstrate that our proposed computational framework provides a useful alternative for the characterization of sequence-level determinants of MMP-substrate specificity.

Theorems on symmetries and flux conservation in radiative transfer using the matrix operator theory.

NASA Technical Reports Server (NTRS)

Kattawar, G. W.

1973-01-01

The matrix operator approach to radiative transfer is shown to be a very powerful technique in establishing symmetry relations for multiple scattering in inhomogeneous atmospheres. Symmetries are derived for the reflection and transmission operators using only the symmetry of the phase function. These results will mean large savings in computer time and storage for performing calculations for realistic planetary atmospheres using this method. The results have also been extended to establish a condition on the reflection matrix of a boundary in order to preserve reciprocity. Finally energy conservation is rigorously proven for conservative scattering in inhomogeneous atmospheres.

Macro- to microscale strain transfer in fibrous tissues is heterogeneous and tissue-specific.

PubMed

Han, Woojin M; Heo, Su-Jin; Driscoll, Tristan P; Smith, Lachlan J; Mauck, Robert L; Elliott, Dawn M

2013-08-06

Mechanical deformation applied at the joint or tissue level is transmitted through the macroscale extracellular matrix to the microscale local matrix, where it is transduced to cells within these tissues and modulates tissue growth, maintenance, and repair. The objective of this study was to investigate how applied tissue strain is transferred through the local matrix to the cell and nucleus in meniscus, tendon, and the annulus fibrosus, as well as in stem cell-seeded scaffolds engineered to reproduce the organized microstructure of these native tissues. To carry out this study, we developed a custom confocal microscope-mounted tensile testing device and simultaneously monitored strain across multiple length scales. Results showed that mean strain was heterogeneous and significantly attenuated, but coordinated, at the local matrix level in native tissues (35-70% strain attenuation). Conversely, freshly seeded scaffolds exhibited very direct and uniform strain transfer from the tissue to the local matrix level (15-25% strain attenuation). In addition, strain transfer from local matrix to cells and nuclei was dependent on fiber orientation and tissue type. Histological analysis suggested that different domains exist within these fibrous tissues, with most of the tissue being fibrous, characterized by an aligned collagen structure and elongated cells, and other regions being proteoglycan (PG)-rich, characterized by a dense accumulation of PGs and rounder cells. In meniscus, the observed heterogeneity in strain transfer correlated strongly with cellular morphology, where rounder cells located in PG-rich microdomains were shielded from deformation, while elongated cells in fibrous microdomains deformed readily. Collectively, these findings suggest that different tissues utilize distinct strain-attenuating mechanisms according to their unique structure and cellular phenotype, and these differences likely alter the local biologic response of such tissues and constructs in response to mechanical perturbation. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Modelling of Tc migration in an un-oxidized fractured drill core from Äspö, Sweden

NASA Astrophysics Data System (ADS)

Huber, F. M.; Totskiy, Y.; Montoya Garcia, V.; Enzmann, F.; Trumm, M.; Wenka, A.; Geckeis, H.; Schaefer, T.

2015-12-01

The radionuclide retention of redox sensitive radionuclides (e.g. Pu, Np, U, Tc) in crystalline host rock greatly depends on the rock matrix and the rock redox capacity. Preservation of drill cores concerning oxidation is therefore of paramount importance to reliably predict the near-natural radionuclide retention properties. Here, experimental results of HTO and Tc laboratory migration experiments in a naturally single fractured Äspö un-oxidized drill core are modelled using two different 2D models. Both models employ geometrical information obtained by μ-computed tomography (μCT) scanning of the drill core. The models differ in geometrical complexity meaning the first model (PPM-MD) consists of a simple parallel plate with a porous matrix adjacent to the fracture whereas the second model (MPM) uses the mid-plane of the 3D fracture only (no porous matrix). Simulation results show that for higher flow rates (Peclet number > 1), the MPM satisfactorily describes the HTO breakthrough curves (BTC) whereas the PPM-MD model nicely reproduces the HTO BTC for small Pe numbers (<1). These findings clearly highlight the influence of fracture geometry/flow field complexity on solute transport for Pe numbers > 1 and the dominating effect of matrix diffusion for Peclet numbers < 1. Retention of Tc is modelled using a simple Kd-approach in case of the PPM-MD and including 1st order sorptive reduction/desorption kinetics in case of the MPM. Batch determined sorptive reduction/desorption kinetic rates and Kd values for Tc on non-oxidized Äspö diorite are used in the model and compared to best fit values. By this approach, the transferability of kinetic data concerning sorptive reduction determined in static batch experiments to dynamic transport experiments is examined.

Direct computational approach to lattice supersymmetric quantum mechanics

NASA Astrophysics Data System (ADS)

Kadoh, Daisuke; Nakayama, Katsumasa

2018-07-01

We study the lattice supersymmetric models numerically using the transfer matrix approach. This method consists only of deterministic processes and has no statistical uncertainties. We improve it by performing a scale transformation of variables such that the Witten index is correctly reproduced from the lattice model, and the other prescriptions are shown in detail. Compared to the precious Monte-Carlo results, we can estimate the effective masses, SUSY Ward identity and the cut-off dependence of the results in high precision. Those kinds of information are useful in improving lattice formulation of supersymmetric models.

MRI-based, wireless determination of the transfer function of a linear implant: Introduction of the transfer matrix.

PubMed

Tokaya, Janot P; Raaijmakers, Alexander J E; Luijten, Peter R; van den Berg, Cornelis A T

2018-04-24

We introduce the transfer matrix (TM) that makes MR-based wireless determination of transfer functions (TFs) possible. TFs are implant specific measures for RF-safety assessment of linear implants. The TF relates an incident tangential electric field on an implant to a scattered electric field at its tip that generally governs local heating. The TM extends this concept and relates an incident tangential electric field to a current distribution in the implant therewith characterizing the RF response along the entire implant. The TM is exploited to measure TFs with MRI without hardware alterations. A model of rightward and leftward propagating attenuated waves undergoing multiple reflections is used to derive an analytical expression for the TM. This allows parameterization of the TM of generic implants, e.g., (partially) insulated single wires, in a homogeneous medium in a few unknowns that simultaneously describe the TF. These unknowns can be determined with MRI making it possible to measure the TM and, therefore, also the TF. The TM is able to predict an induced current due to an incident electric field and can be accurately parameterized with a limited number of unknowns. Using this description the TF is determined accurately (with a Pearson correlation coefficient R ≥ 0.9 between measurements and simulations) from MRI acquisitions. The TM enables measuring of TFs with MRI of the tested generic implant models. The MR-based method does not need hardware alterations and is wireless hence making TF determination in more realistic scenarios conceivable. © 2018 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine.

Neutrinoless ββ decay mediated by the exchange of light and heavy neutrinos: the role of nuclear structure correlations

NASA Astrophysics Data System (ADS)

Menéndez, J.

2018-01-01

Neutrinoless β β decay nuclear matrix elements calculated with the shell model and energy-density functional theory typically disagree by more than a factor of two in the standard scenario of light-neutrino exchange. In contrast, for a decay mediated by sterile heavy neutrinos the deviations are reduced to about 50%, an uncertainty similar to the one due to short-range effects. We compare matrix elements in the light- and heavy-neutrino-exchange channels, exploring the radial, momentum transfer and angular momentum-parity matrix element distributions, and considering transitions that involve correlated and uncorrelated nuclear states. We argue that the shorter-range heavy-neutrino exchange is less sensitive to collective nuclear correlations, and that discrepancies in matrix elements are mostly due to the treatment of long-range correlations in many-body calculations. Our analysis supports previous studies suggesting that isoscalar pairing correlations, which affect mostly the longer-range part of the neutrinoless β β decay operator, are partially responsible for the differences between nuclear matrix elements in the standard light-neutrino-exchange mechanism.

Extension of modified power method to two-dimensional problems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Peng; Ulsan National Institute of Science and Technology, 50 UNIST-gil, Ulsan 44919; Lee, Hyunsuk

2016-09-01

In this study, the generalized modified power method was extended to two-dimensional problems. A direct application of the method to two-dimensional problems was shown to be unstable when the number of requested eigenmodes is larger than a certain problem dependent number. The root cause of this instability has been identified as the degeneracy of the transfer matrix. In order to resolve this instability, the number of sub-regions for the transfer matrix was increased to be larger than the number of requested eigenmodes; and a new transfer matrix was introduced accordingly which can be calculated by the least square method. Themore » stability of the new method has been successfully demonstrated with a neutron diffusion eigenvalue problem and the 2D C5G7 benchmark problem. - Graphical abstract:.« less

Effects of nuclear structure in the spin-dependent scattering of weakly interacting massive particles

NASA Astrophysics Data System (ADS)

Nikolaev, M. A.; Klapdor-Kleingrothaus, H. V.

1993-06-01

We present calculations of the nuclear from factors for spin-dependent elastic scattering of dark matter WIMPs from123Te and131Xe isotopes, proposed to be used for dark matter detection. A method based on the theory of finite Fermi systems was used to describe the reduction of the single-particle spin-dependent matrix elements in the nuclear medium. Nucleon single-particle states were calculated in a realistic shell model potential; pairing effects were treated within the BCS model. The coupling of the lowest single-particle levels in123Te to collective 2+ excitations of the core was taken into account phenomenologically. The calculated nuclear form factors are considerably less then the single-particle ones for low momentum transfer. At high momentum transfer some dynamical amplification takes place due to the pion exchange term in the effective nuclear interaction. But as the momentum transfer increases, the difference disappears, the momentum transfer increases and the quenching effect disappears. The shape of the nuclear form factor for the131Xe isotope differs from the one obtained using an oscillator basis.

Bethe states of the trigonometric SU(3) spin chain with generic open boundaries

NASA Astrophysics Data System (ADS)

Sun, Pei; Xin, Zhirong; Qiao, Yi; Wen, Fakai; Hao, Kun; Cao, Junpeng; Li, Guang-Liang; Yang, Tao; Yang, Wen-Li; Shi, Kangjie

2018-06-01

By combining the algebraic Bethe ansatz and the off-diagonal Bethe ansatz, we investigate the trigonometric SU (3) model with generic open boundaries. The eigenvalues of the transfer matrix are given in terms of an inhomogeneous T - Q relation, and the corresponding eigenstates are expressed in terms of nested Bethe-type eigenstates which have well-defined homogeneous limit. This exact solution provides a basis for further analyzing the thermodynamic properties and correlation functions of the anisotropic models associated with higher rank algebras.

A unified model for transfer alignment at random misalignment angles based on second-order EKF

NASA Astrophysics Data System (ADS)

Cui, Xiao; Mei, Chunbo; Qin, Yongyuan; Yan, Gongmin; Liu, Zhenbo

2017-04-01

In the transfer alignment process of inertial navigation systems (INSs), the conventional linear error model based on the small misalignment angle assumption cannot be applied to large misalignment situations. Furthermore, the nonlinear model based on the large misalignment angle suffers from redundant computation with nonlinear filters. This paper presents a unified model for transfer alignment suitable for arbitrary misalignment angles. The alignment problem is transformed into an estimation of the relative attitude between the master INS (MINS) and the slave INS (SINS), by decomposing the attitude matrix of the latter. Based on the Rodriguez parameters, a unified alignment model in the inertial frame with the linear state-space equation and a second order nonlinear measurement equation are established, without making any assumptions about the misalignment angles. Furthermore, we employ the Taylor series expansions on the second-order nonlinear measurement equation to implement the second-order extended Kalman filter (EKF2). Monte-Carlo simulations demonstrate that the initial alignment can be fulfilled within 10 s, with higher accuracy and much smaller computational cost compared with the traditional unscented Kalman filter (UKF) at large misalignment angles.

Electromagnetic scattering calculations on the Intel Touchstone Delta

NASA Technical Reports Server (NTRS)

Cwik, Tom; Patterson, Jean; Scott, David

1992-01-01

During the first year's operation of the Intel Touchstone Delta system, software which solves the electric field integral equations for fields scattered from arbitrarily shaped objects has been transferred to the Delta. To fully realize the Delta's resources, an out-of-core dense matrix solution algorithm that utilizes some or all of the 90 Gbyte of concurrent file system (CFS) has been used. The largest calculation completed to date computes the fields scattered from a perfectly conducting sphere modeled by 48,672 unknown functions, resulting in a complex valued dense matrix needing 37.9 Gbyte of storage. The out-of-core LU matrix factorization algorithm was executed in 8.25 h at a rate of 10.35 Gflops. Total time to complete the calculation was 19.7 h-the additional time was used to compute the 48,672 x 48,672 matrix entries, solve the system for a given excitation, and compute observable quantities. The calculation was performed in 64-b precision.

Sensitivity Equation Derivation for Transient Heat Transfer Problems

NASA Technical Reports Server (NTRS)

Hou, Gene; Chien, Ta-Cheng; Sheen, Jeenson

2004-01-01

The focus of the paper is on the derivation of sensitivity equations for transient heat transfer problems modeled by different discretization processes. Two examples will be used in this study to facilitate the discussion. The first example is a coupled, transient heat transfer problem that simulates the press molding process in fabrication of composite laminates. These state equations are discretized into standard h-version finite elements and solved by a multiple step, predictor-corrector scheme. The sensitivity analysis results based upon the direct and adjoint variable approaches will be presented. The second example is a nonlinear transient heat transfer problem solved by a p-version time-discontinuous Galerkin's Method. The resulting matrix equation of the state equation is simply in the form of Ax = b, representing a single step, time marching scheme. A direct differentiation approach will be used to compute the thermal sensitivities of a sample 2D problem.

Rapid electron transfer by the carbon matrix in natural pyrogenic carbon

PubMed Central

Sun, Tianran; Levin, Barnaby D. A.; Guzman, Juan J. L.; Enders, Akio; Muller, David A.; Angenent, Largus T.; Lehmann, Johannes

2017-01-01

Surface functional groups constitute major electroactive components in pyrogenic carbon. However, the electrochemical properties of pyrogenic carbon matrices and the kinetic preference of functional groups or carbon matrices for electron transfer remain unknown. Here we show that environmentally relevant pyrogenic carbon with average H/C and O/C ratios of less than 0.35 and 0.09 can directly transfer electrons more than three times faster than the charging and discharging cycles of surface functional groups and have a 1.5 V potential range for biogeochemical reactions that invoke electron transfer processes. Surface functional groups contribute to the overall electron flux of pyrogenic carbon to a lesser extent with greater pyrolysis temperature due to lower charging and discharging capacities, although the charging and discharging kinetics remain unchanged. This study could spur the development of a new generation of biogeochemical electron flux models that focus on the bacteria–carbon–mineral conductive network. PMID:28361882

Gaussian-Beam Laser-Resonator Program

NASA Technical Reports Server (NTRS)

Cross, Patricia L.; Bair, Clayton H.; Barnes, Norman

1989-01-01

Gaussian Beam Laser Resonator Program models laser resonators by use of Gaussian-beam-propagation techniques. Used to determine radii of beams as functions of position in laser resonators. Algorithm used in program has three major components. First, ray-transfer matrix for laser resonator must be calculated. Next, initial parameters of beam calculated. Finally, propagation of beam through optical elements computed. Written in Microsoft FORTRAN (Version 4.01).

Tunable Ionization Modes of a Flowing Atmospheric-Pressure Afterglow (FAPA) Ambient Ionization Source.

PubMed

Badal, Sunil P; Michalak, Shawn D; Chan, George C-Y; You, Yi; Shelley, Jacob T

2016-04-05

Plasma-based ambient desorption/ionization sources are versatile in that they enable direct ionization of gaseous samples as well as desorption/ionization of analytes from liquid and solid samples. However, ionization matrix effects, caused by competitive ionization processes, can worsen sensitivity or even inhibit detection all together. The present study is focused on expanding the analytical capabilities of the flowing atmospheric-pressure afterglow (FAPA) source by exploring additional types of ionization chemistry. Specifically, it was found that the abundance and type of reagent ions produced by the FAPA source and, thus, the corresponding ionization pathways of analytes, can be altered by changing the source working conditions. High abundance of proton-transfer reagent ions was observed with relatively high gas flow rates and low discharge currents. Conversely, charge-transfer reagent species were most abundant at low gas flows and high discharge currents. A rather nonpolar model analyte, biphenyl, was found to significantly change ionization pathway based on source operating parameters. Different analyte ions (e.g., MH(+) via proton-transfer and M(+.) via charge-transfer) were formed under unique operating parameters demonstrating two different operating regimes. These tunable ionization modes of the FAPA were used to enable or enhance detection of analytes which traditionally exhibit low-sensitivity in plasma-based ADI-MS analyses. In one example, 2,2'-dichloroquaterphenyl was detected under charge-transfer FAPA conditions, which were difficult or impossible to detect with proton-transfer FAPA or direct analysis in real-time (DART). Overall, this unique mode of operation increases the number and range of detectable analytes and has the potential to lessen ionization matrix effects in ADI-MS analyses.

Ionoluminescence properties of polystyrene-hosted fluorophore films induced by helium ions of energy 50-350 keV

NASA Astrophysics Data System (ADS)

Chakraborty, Subha; Huang, Mengbing

2017-10-01

We report on measurements and analysis of ionoluminescence properties of pure polystyrene films and polystyrene films doped with four types of fluorophores in low kinetic energies (50-350 keV) of ion irradiation. We have developed a theoretical model to understand the experimentally observed ionoluminescence behaviors in terms of scintillation yield from individual ion tracks, photophysical energy transfer mechanisms, and irradiation-induced defects. A comparison of the model and experimental results suggests that singlet up-conversion resulting from triplet-triplet annihilation processes may be responsible for enhanced singlet emission of the fluorophores at high ion beam flux densities. Energy transfer from the polystyrene matrix to the fluorophore molecules has been identified as an effective pathway to increasing the fluorescence efficiency in the doped scintillator films.

Effect of partial heating at mid of vertical plate adjacent to porous medium

NASA Astrophysics Data System (ADS)

Mulla, Mohammed Fahimuddin; Pallan, Khalid. M.; Al-Rashed, A. A. A. A.

2018-05-01

Heat and mass transfer in porous medium due to heating of vertical plate at mid-section is analyzed for various physical parameters. The heat and mass transfer in porous medium is modeled with the help of momentum, energy and concentration equations in terms of non-dimensional partial differential equations. The partial differential equations are converted into simpler form of algebraic equations with the help of finite element method. A computer code is developed to assemble the matrix form of algebraic equations into global matrices and then to solve them in an iterative manner to obtain the temperature, concentration and streamline distribution inside the porous medium. It is found that the heat transfer behavior of porous medium heated at middle section is considerably different from other cases.

Line-Mixing Relaxation Matrix model for spectroscopic and radiative transfer studies

NASA Astrophysics Data System (ADS)

Mendaza, Teresa; Martin-Torres, Javier

2016-04-01

We present a generic model to compute the Relaxation Matrix easily adaptable to any molecule and type of spectroscopic lines or bands in non-reactive molecule collisions regimes. It also provides the dipole moment of every transition and level population of the selected molecule. The model is based on the Energy-Corrected Sudden (ECS) approximation/theory introduced by DePristo (1980), and on previous Relaxation Matrix studies for the interaction between molecular ro-vibrational levels (Ben-Rueven, 1966), atoms (Rosenkranz, 1975), linear molecules (Strow and Reuter, 1994; Niro, Boulet and Hartmann, 2004), and symmetric but not linear molecules (Tran et al., 2006). The model is open source, and it is user-friendly. To the point that the user only has to select the wished molecule and vibrational band to perform the calculations. It reads the needed spectroscopic data from the HIgh-resolution TRANsmission molecular absorption (HITRAN) (Rothman et al., 2013) and ExoMol (Tennyson and Yurchenko, 2012). In this work we present an example of the calculations with our model for the case of the 2ν3 band of methane (CH4), and a comparison with a previous work (Tran et al., 2010). The data produced by our model can be used to characterise the line-mixing effects on ro-vibrational lines of the infrared emitters of any atmosphere, to calculate accurate absorption spectra, that are needed in the interpretation of atmospheric spectra, radiative transfer modelling and General Circulation Models (GCM). References [1] A.E. DePristo, Collisional influence on vibration-rotation spectral line shapes: A scaling theoretical analysis and simplification, J. Chem. Phys. 73(5), 1980. [2] A. Ben-Reuven, Impact broadening of microwave spectra, Phys. Rev. 145(1), 7-22, 1966. [3] P.W. Rosenkranz, Shape of the 5 mm Oxygen Band in the Atmosphere, IEEE Transactions on Antennas and Propagation, vol. AP-23, no. 4, pp. 498-506, 1975. [4] Strow, L.L., D.D. Tobin, and S.E. Hannon, A compilation of first-order line mixing coefficients for CO2-Q branches, Journal of Quantitative Spectroscopy and Radiative Transfer, vol. 52, pp. 281-294, 1994. [5] Niro, Boulet and Hartmann, Spectra calculations in central and wing regions of CO2 IR bands between 10 and 20 μm, J. Quant. Spectr. Rad. Transf., 88 (4) : 483-498, 2004. [6] H. Tran, P.M. Flaud, T. Fouchet, T. Gabard and J.M. Hartmann (2006); Model, software and database for line-mixing effects in the ν3 and ν4 bands of CH4 and tests using laboratory and planetary measurements - II: H2 Bibliography 181(and He) broadening and the atmospheres of Jupiter and Saturn. J. Quant. Spectr. Rad. Transf., 101 (2), 306 - 324, doi:10.1016/j.jqsrt.2005.11.033. [7] Rothman et al., The HITRAN2012 molecular spectroscopic database, Journal of Quantitative Spectroscopy and Radiative Transfer, vol. 130, 2013. [8] J. Tennyson, S. N. Yurchenko, "ExoMol: molecular line lists for exoplanet and other atmospheres", Monthly Notices of the Royal Astronomical Society 425, 21-33 (2012). [9] H. Tran et al., The 2ν3 band of CH4 revisited with line mixing: Consequences for spectroscopy and atmospheric retrievals at 1.67μm, Journal of Quantitative Spectroscopy and Radiative Transfer, vol. 111, no 10, 2010.

Optical implementation of systolic array processing

NASA Technical Reports Server (NTRS)

Caulfield, H. J.; Rhodes, W. T.; Foster, M. J.; Horvitz, S.

1981-01-01

Algorithms for matrix vector multiplication are implemented using acousto-optic cells for multiplication and input data transfer and using charge coupled devices detector arrays for accumulation and output of the results. No two dimensional matrix mask is required; matrix changes are implemented electronically. A system for multiplying a 50 component nonnegative real vector by a 50 by 50 nonnegative real matrix is described. Modifications for bipolar real and complex valued processing are possible, as are extensions to matrix-matrix multiplication and multiplication of a vector by multiple matrices.

Increasing the thermal conductivity of silicone based fluids using carbon nanofibers

NASA Astrophysics Data System (ADS)

Vales-Pinzon, C.; Vega-Flick, A.; Pech-May, N. W.; Alvarado-Gil, J. J.; Medina-Esquivel, R. A.; Zambrano-Arjona, M. A.; Mendez-Gamboa, J. A.

2016-11-01

Heat transfer in silicone fluids loaded with high thermal conductivity carbon nanofibers was studied using photoacoustics and thermal wave resonator cavity. It is shown that heat transport depends strongly on volume fraction of carbon nanofibers; in particular, a low loading percentage is enough to obtain significant changes in thermal conductivity. Theoretical models were used to determine how heat transfer is affected by structural formations in the composite, such as packing fraction and aspect ratio (form factor) of carbon nanofiber agglomerates in the high viscosity fluid matrix. Our results may find practical applications in systems, in which the carbon nanofibers can facilitate heat dissipation in the electronic devices.

Effective Methods for Solving Band SLEs after Parabolic Nonlinear PDEs

NASA Astrophysics Data System (ADS)

Veneva, Milena; Ayriyan, Alexander

2018-04-01

A class of models of heat transfer processes in a multilayer domain is considered. The governing equation is a nonlinear heat-transfer equation with different temperature-dependent densities and thermal coefficients in each layer. Homogeneous Neumann boundary conditions and ideal contact ones are applied. A finite difference scheme on a special uneven mesh with a second-order approximation in the case of a piecewise constant spatial step is built. This discretization leads to a pentadiagonal system of linear equations (SLEs) with a matrix which is neither diagonally dominant, nor positive definite. Two different methods for solving such a SLE are developed - diagonal dominantization and symbolic algorithms.

A discrete fracture model for two-phase flow in fractured porous media

NASA Astrophysics Data System (ADS)

Gläser, Dennis; Helmig, Rainer; Flemisch, Bernd; Class, Holger

2017-12-01

A discrete fracture model on the basis of a cell-centered finite volume scheme with multi-point flux approximation (MPFA) is presented. The fractures are included in a d-dimensional computational domain as (d - 1)-dimensional entities living on the element facets, which requires the grid to have the element facets aligned with the fracture geometries. However, the approach overcomes the problem of small cells inside the fractures when compared to equi-dimensional models. The system of equations considered is solved on both the matrix and the fracture domain, where on the prior the fractures are treated as interior boundaries and on the latter the exchange term between fracture and matrix appears as an additional source/sink. This exchange term is represented by the matrix-fracture fluxes, computed as functions of the unknowns in both domains by applying adequate modifications to the MPFA scheme. The method is applicable to both low-permeable as well as highly conductive fractures. The quality of the results obtained by the discrete fracture model is studied by comparison to an equi-dimensional discretization on a simple geometry for both single- and two-phase flow. For the case of two-phase flow in a highly conductive fracture, good agreement in the solution and in the matrix-fracture transfer fluxes could be observed, while for a low-permeable fracture the discrepancies were more pronounced. The method is then applied two-phase flow through a realistic fracture network in two and three dimensions.

Acoustic response of a rectangular levitator with orifices

NASA Technical Reports Server (NTRS)

El-Raheb, Michael; Wagner, Paul

1990-01-01

The acoustic response of a rectangular cavity to speaker-generated excitation through waveguides terminating at orifices in the cavity walls is analyzed. To find the effects of orifices, acoustic pressure is expressed by eigenfunctions satisfying Neumann boundary conditions as well as by those satisfying Dirichlet ones. Some of the excess unknowns can be eliminated by point constraints set over the boundary, by appeal to Lagrange undetermined multipliers. The resulting transfer matrix must be further reduced by partial condensation to the order of a matrix describing unmixed boundary conditions. If the cavity is subjected to an axial temperature dependence, the transfer matrix is determined numerically.

Energy transfer and reaction dynamics of matrix-isolated 1,2-difluoroethane-d4

NASA Astrophysics Data System (ADS)

Raff, Lionel M.

1990-09-01

The molecular dynamics of vibrationally excited 1,2-difluoroethane-d4 isolated in Ar, Kr, and Xe matrices at 12 K are investigated using trajectory methods. The matrix model is an fcc crystal containing 125 unit cells with 666 atoms in a cubic (5×5×5) arrangement. It is assumed that 1,2-difluoroethane-d4 is held interstitially within the volume bounded by the innermost unit cell of the crystal. The transport effects of the bulk are simulated using the velocity reset method introduced by Riley, Coltrin, and Diestler [J. Chem. Phys. 88, 5934 (1988)]. The system potential is written as the separable sum of a lattice potential, a lattice-molecule interaction and a gas-phase potential for 1,2-difluoroethane. The first two of these are assumed to have pairwise form while the molecular potential is a modified form of the global potential previously developed for 1,2-difluoroethane [J. Phys. Chem. 91, 3266 (1987)]. Calculated sublimation energies for the pure crystals are in good accord with the experimental data. The distribution of metastable-state energies for matrix-isolated 1,2-difluoroethane-d4 is Gaussian in form. In krypton, the full width at half maximum for the distribution is 0.37 eV. For a total excitation energy of 6.314 eV, the observed dynamic processes are vibrational relaxation, orientational exchange, and four-center DF elimination reactions. The first of these processes is characterized by a near linear, first-order decay curve with rate coefficients in the range 1.30-1.48×1011 s-1. The average rates in krypton and xenon are nearly equal. The process is slightly slower in argon. The decay curves exhibit characteristic high-frequency oscillations that are generally seen in energy transfer studies. It is demonstrated that these oscillations are associated with the frequencies for intramolecular energy transfer so that the entire frequency spectrum for such transfer processes can be obtained from the Fourier transform of the decay curve. Orientational exchange is shown to occur with much greater frequency as the unit cell spacing decreases. The occurrence of orientational exchange generally results in a very rapid dissipation of molecular rotational energy to the lattice which causes a characteristic break to occur in the decay curve. It is shown that 16% of the total energy transfer to the lattice in argon is a result of such rotational energy transfer. The propensity for four-center DF elimination is found to be greater in argon than in either krypton or xenon. The relaxation data show that this effect is not the result of different energy transfer rates but is probably associated with steric effects resulting from the smaller lattice dimensions in argon. Isotope effects upon the energy partitioning in unimolecular reactions of 1,2-difluoroethane and upon the energy transfer dynamics under matrix-isolation conditions are also reported.

Biaxial (Tension-Torsion) Testing of an Oxide/Oxide Ceramic Matrix Composite

DTIC Science & Technology

2013-03-01

estimation algorithms and constants . . . . . . . . . . . . . 61 4.27 Biaxial (tension-torsion) load spreadsheet with independent axial load and torsion...through the composite and provides the main load - bearing capability. The interaction of the two (or more) phases takes place in the interface. The...transfer loads between fibers[15]. The fiber-to-fiber load transfer mechanism provided by the matrix plays a major role in the load - bearing properties of the

Solid-perforated panel layout optimization by topology optimization based on unified transfer matrix.

PubMed

Kim, Yoon Jae; Kim, Yoon Young

2010-10-01

This paper presents a numerical method for the optimization of the sequencing of solid panels, perforated panels and air gaps and their respective thickness for maximizing sound transmission loss and/or absorption. For the optimization, a method based on the topology optimization formulation is proposed. It is difficult to employ only the commonly-used material interpolation technique because the involved layers exhibit fundamentally different acoustic behavior. Thus, an optimization method formulation using a so-called unified transfer matrix is newly proposed. The key idea is to form elements of the transfer matrix such that interpolated elements by the layer design variables can be those of air, perforated and solid panel layers. The problem related to the interpolation is addressed and bench mark-type problems such as sound transmission or absorption maximization problems are solved to check the efficiency of the developed method.

Diagonalizing controller for a superconducting six-axis accelerometer

NASA Astrophysics Data System (ADS)

Bachrach, B.; Canavan, E. R.; Levine, W. S.

A relatively simple MIMO (multiple input, multiple output) controller which converts an instrument with a nondiagonally dominant transfer function matrix into a strongly diagonally dominant device is developed. The instrument, which uses inductance bridges to sense the position of a magnetically levitated superconducting mass, has very lightly damped resonances and fairly strong cross coupling. By taking advantage of the particular structure of the instrument's transfer function matrix, it is possible to develop a relatively simple controller which achieves the desired decoupling. This controller consists of two parts. The first part cancels the nondiagonal terms of the open-loop transfer function matrix, while the second part is simply a set of SISO (single input, single output) controllers. The stability of the closed-loop system is studied using Rosenbrock's INA (inverse Nyguist array) technique, which produces a simple set of conditions guaranteeing stability. Simulation of the closed-loop system indicates that it should easily achieve its performance goals.

The numerical approach adopted in toba computer code for mass and heat transfer dynamic analysis of metal hydride hydrogen storage beds

DOE Office of Scientific and Technical Information (OSTI.GOV)

El Osery, I.A.

1983-12-01

Modelling studies of metal hydride hydrogen storage beds is a part of an extensive R and D program conducted in Egypt on hydrogen energy. In this context two computer programs; namely RET and RET1; have been developed. In RET computer program, a cylindrical conduction bed model is considered and an approximate analytical solution is used for solution of the associated mass and heat transfer problem. This problem is solved in RET1 computer program numerically allowing more flexibility in operating conditions but still limited to cylindrical configuration with only two alternatives for heat exchange; either fluid is passing through tubes imbeddedmore » in the solid alloy matrix or solid rods are surrounded by annular fluid tubes. The present computer code TOBA is more flexible and realistic. It performs the mass and heat transfer dynamic analysis of metal hydride storage beds using a variety of geometrical and operating alternatives.« less

Ballistic-diffusive approximation for the thermal dynamics of metallic nanoparticles in nanocomposite materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shirdel-Havar, A. H., E-mail: Amir.hushang.shirdel@gmail.com; Masoudian Saadabad, R.

2015-03-21

Based on ballistic-diffusive approximation, a method is presented to model heat transfer in nanocomposites containing metal nanoparticles. This method provides analytical expression for the temperature dynamics of metallic nanoparticles embedded in a dielectric medium. In this study, nanoparticles are considered as spherical shells, so that Boltzmann equation is solved using ballistic-diffusive approximation to calculate the electron and lattice thermal dynamics in gold nanoparticles, while thermal exchange between the particles is taken into account. The model was used to investigate the influence of particle size and metal concentration of the medium on the electron and lattice thermal dynamics. It is shownmore » that these two parameters are crucial in determining the nanocomposite thermal behavior. Our results showed that the heat transfer rate from nanoparticles to the matrix decreases as the nanoparticle size increases. On the other hand, increasing the metal concentration of the medium can also decrease the heat transfer rate.« less

Multiscale strain analysis of tissue equivalents using a custom-designed biaxial testing device.

PubMed

Bell, B J; Nauman, E; Voytik-Harbin, S L

2012-03-21

Mechanical signals transferred between a cell and its extracellular matrix play an important role in regulating fundamental cell behavior. To further define the complex mechanical interactions between cells and matrix from a multiscale perspective, a biaxial testing device was designed and built. Finite element analysis was used to optimize the cruciform specimen geometry so that stresses within the central region were concentrated and homogenous while minimizing shear and grip effects. This system was used to apply an equibiaxial loading and unloading regimen to fibroblast-seeded tissue equivalents. Digital image correlation and spot tracking were used to calculate three-dimensional strains and associated strain transfer ratios at macro (construct), meso, matrix (collagen fibril), cell (mitochondria), and nuclear levels. At meso and matrix levels, strains in the 1- and 2-direction were statistically similar throughout the loading-unloading cycle. Interestingly, a significant amplification of cellular and nuclear strains was observed in the direction perpendicular to the cell axis. Findings indicate that strain transfer is dependent upon local anisotropies generated by the cell-matrix force balance. Such multiscale approaches to tissue mechanics will assist in advancement of modern biomechanical theories as well as development and optimization of preconditioning regimens for functional engineered tissue constructs. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Inorganic Polymer Matrix Composite Strength Related to Interface Condition

PubMed Central

Radford, Donald W.; Grabher, Andrew; Bridge, John

2009-01-01

Resin transfer molding of an inorganic polymer binder was successfully demonstrated in the preparation of ceramic fiber reinforced engine exhaust valves. Unfortunately, in the preliminary processing trials, the resulting composite valves were too brittle for in-engine evaluation. To address this limited toughness, the effectiveness of a modified fiber-matrix interface is investigated through the use of carbon as a model material fiber coating. After sequential heat treatments composites molded from uncoated and carbon-coated fibers are compared using room temperature 3-point bend testing. Carbon-coated Nextel fiber reinforced geopolymer composites demonstrated a 50% improvement in strength, versus that of the uncoated fiber reinforced composites, after the 250 °C postcure.

MODELING FUNCTIONALLY GRADED INTERPHASE REGIONS IN CARBON NANOTUBE REINFORCED COMPOSITES

NASA Technical Reports Server (NTRS)

Seidel, G. D.; Lagoudas, D. C.; Frankland, S. J. V.; Gates, T. S.

2006-01-01

A combination of micromechanics methods and molecular dynamics simulations are used to obtain the effective properties of the carbon nanotube reinforced composites with functionally graded interphase regions. The multilayer composite cylinders method accounts for the effects of non-perfect load transfer in carbon nanotube reinforced polymer matrix composites using a piecewise functionally graded interphase. The functional form of the properties in the interphase region, as well as the interphase thickness, is derived from molecular dynamics simulations of carbon nanotubes in a polymer matrix. Results indicate that the functional form of the interphase can have a significant effect on all the effective elastic constants except for the effective axial modulus for which no noticeable effects are evident.

An R-matrix study of electron induced processes in BF3 plasma

NASA Astrophysics Data System (ADS)

Gupta, Dhanoj; Chakrabarti, Kalyan; Yoon, Jung-Sik; Song, Mi-Young

2017-12-01

An R-matrix formalism is used to study electron collision with the BF3 molecule using Quantemol-N, a computational system for electron molecule collisions which uses the molecular R-matrix method. Several target models are tested for BF3 in its equilibrium geometry, and the results are presented for the best model. Scattering calculations are then performed to yield resonance parameters, elastic, differential, excitation, and momentum transfer cross sections. The results for all the cross sections are compared with the experimental and theoretical data, and a good agreement is obtained. The resonances have been detected at 3.79 and 13.58 eV, with the ionization threshold being 15.7 eV. We have also estimated the absolute dissociative electron attachment (DEA) cross section for the F- ion production from BF3, which is a maiden attempt. The peak of the DEA is at around 13.5 eV, which is well supported by the resonance detected at 13.58 eV. The cross sections reported here find a variety of applications in the plasma technology.

A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew

Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less

A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

DOE PAGES

Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; ...

2018-01-28

Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less

3-D Inhomogeous Radiative Transfer Model using a Planar-stratified Forward RT Model and Horizontal Perturbation Series

NASA Astrophysics Data System (ADS)

Zhang, K.; Gasiewski, A. J.

2017-12-01

A horizontally inhomogeneous unified microwave radiative transfer (HI-UMRT) model based upon a nonspherical hydrometeor scattering model is being developed at the University of Colorado at Boulder to facilitate forward radiative simulations for 3-dimensionally inhomogeneous clouds in severe weather. The HI-UMRT 3-D analytical solution is based on incorporating a planar-stratified 1-D UMRT algorithm within a horizontally inhomogeneous iterative perturbation scheme. Single-scattering parameters are computed using the Discrete Dipole Scattering (DDSCAT v7.3) program for hundreds of carefully selected nonspherical complex frozen hydrometeors from the NASA/GSFC DDSCAT database. The required analytic factorization symmetry of transition matrix in a normalized RT equation was analytically proved and validated numerically using the DDSCAT-based full Stokes matrix of randomly oriented hydrometeors. The HI-UMRT model thus inherits the properties of unconditional numerical stability, efficiency, and accuracy from the UMRT algorithm and provides a practical 3-D two-Stokes parameter radiance solution with Jacobian to be used within microwave retrievals and data assimilation schemes. In addition, a fast forward radar reflectivity operator with Jacobian based on DDSCAT backscatter efficiency computed for large hydrometeors is incorporated into the HI-UMRT model to provide applicability to active radar sensors. The HI-UMRT will be validated strategically at two levels: 1) intercomparison of brightness temperature (Tb) results with those of several 1-D and 3-D RT models, including UMRT, CRTM and Monte Carlo models, 2) intercomparison of Tb with observed data from combined passive and active spaceborne sensors (e.g. GPM GMI and DPR). The precise expression for determining the required number of 3-D iterations to achieve an error bound on the perturbation solution will be developed to facilitate the numerical verification of the HI-UMRT code complexity and computation performance.

Adsorption behavior of plasmid DNA onto perfusion chromatographic matrix.

PubMed

Limonta, Miladys; Zumalacárregui, Lourdes; Soler, Dayana

2012-05-01

Anion exchange chromatography is the most popular chromatographic method for plasmid separation. POROS RI 50 is a perfusion chromatographic support which is a reversed phase matrix and is an alternative to conventional ones due to its mass transfer properties. The adsorption and elution of the pIDKE2 plasmid onto reversed phase POROS R1 50 was studied. Langmuir isotherm model was adjusted in order to get the maximum adsorption capacity and the dissociation constant for POROS R1 50-plasmid DNA (pDNA) system. Breakthrough curves were obtained for volumetric flows between 0.69-3.33 mL/min, given dynamic capacity up to 2.3 times higher than those reported for ionic exchange matrix used during the purification process of plasmids with similar size to that of pIDKE2. The efficiency was less than 45% for the flow conditions and initial concentration studied, which means that the support will not be operated under saturation circumstances.

Experimental Determination of the Dynamic Hydraulic Transfer Function for the J-2X Oxidizer Turbopump. Part One; Methodology

NASA Technical Reports Server (NTRS)

Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave

2011-01-01

An advanced methodology for extracting the hydraulic dynamic pump transfer matrix (Yp) for a cavitating liquid rocket engine turbopump inducer+impeller has been developed. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Laboratory pulsed subscale waterflow test of the J-2X oxygen turbo pump is introduced and our new extraction method applied to the data collected. From accurate measures of pump inlet and discharge perturbational mass flows and pressures, and one-dimensional flow models that represents complete waterflow loop physics, we are able to derive Yp and hence extract the characteristic pump parameters: compliance, pump gain, impedance, mass flow gain. Detailed modeling is necessary to accurately translate instrument plane measurements to the pump inlet and discharge and extract Yp. We present the MSFC Dynamic Lump Parameter Fluid Model Framework and describe critical dynamic component details. We report on fit minimization techniques, cost (fitness) function derivation, and resulting model fits to our experimental data are presented. Comparisons are made to alternate techniques for spatially translating measurement stations to actual pump inlet and discharge.

Surface Composition and Physical Mixture State of the Regoliths of Outer Solar System Satellites: The Role of Scattering and Absorption by the non-Ice Components and Implications for Rayleigh Absorption and Rayleigh Scattering

NASA Astrophysics Data System (ADS)

Clark, R. N.; Perlman, Z. S.; Pearson, N.; Hendrix, A. R.; Cuzzi, J. N.; Cruikshank, D. P.; Bradley, E. T.; Filacchione, G.; Nicholson, P. D.; Hedman, M. M.; Brown, R. H.; Buratti, B. J.; Baines, K. H.; Sotin, C.; Nelson, R. M.

2014-12-01

Many outer Solar System satellites have surfaces dominated by water ice and a mysterious material(s) causing strong visible to ultraviolet absorption along with trace other compounds with infrared absorptions, including CO2 and organics. Various mechanisms have been proposed for the UV absorber, including tholins, iron oxides, and nano-sized metallic iron particles (e.g. see Clark et al., 2012, Icarus v218 p831, and references therein). We have constructed extensive laboratory analog measurements and radiative transfer modeling of the materials and scattering conditions that can contribute to the optical properties seen on outer Solar System satellites. We have successfully modeled Rayleigh absorption and Rayleigh scattering to produce spectral shapes typical of those seen in spectra of icy Solar System satellites, including those in the Saturn system observed with the Cassini UVIS and VIMS instruments. While it is easy to create these absorptions with radiative transfer modeling, it has been more difficult to do with laboratory analogs. We are finding that laboratory analogs refine and restricts the possible mixing states of the UV absorber in icy satellite surfaces. We have found that just because a particle is highly absorbing, as in metallic iron, if the particle is not embedded in another matrix, scattering will dominate over absorption and Rayleigh absorption will not be observed. Further, the closer the indices of refraction match between the absorbing particle and the matrix, there will be less scattering and more absorption will occur. But we have also found this to be true with other absorbing material, like Tholins. It is very difficult to obtain the very low reflectances observed in the UV in icy satellite spectra using traditional intimate mixtures, as scattering and first surface reflections contribute significantly to the reflectance. The solution, both from radiative transfer modeling and laboratory analogs point to embedded absorbing materials. For example, nano-phase metallic iron embedded in a less absorbing silicate matrix as meteoritic dust infall onto satellitesurfaces is one explanation. An alternative would be tholins embedded in the ice. Spectral features should be able to distinguish between these and other possibilities and will be explored.

Adaptive Inverse Control for Rotorcraft Vibration Reduction

NASA Technical Reports Server (NTRS)

Jacklin, Stephen A.

1985-01-01

This thesis extends the Least Mean Square (LMS) algorithm to solve the mult!ple-input, multiple-output problem of alleviating N/Rev (revolutions per minute by number of blades) helicopter fuselage vibration by means of adaptive inverse control. A frequency domain locally linear model is used to represent the transfer matrix relating the higher harmonic pitch control inputs to the harmonic vibration outputs to be controlled. By using the inverse matrix as the controller gain matrix, an adaptive inverse regulator is formed to alleviate the N/Rev vibration. The stability and rate of convergence properties of the extended LMS algorithm are discussed. It is shown that the stability ranges for the elements of the stability gain matrix are directly related to the eigenvalues of the vibration signal information matrix for the learning phase, but not for the control phase. The overall conclusion is that the LMS adaptive inverse control method can form a robust vibration control system, but will require some tuning of the input sensor gains, the stability gain matrix, and the amount of control relaxation to be used. The learning curve of the controller during the learning phase is shown to be quantitatively close to that predicted by averaging the learning curves of the normal modes. For higher order transfer matrices, a rough estimate of the inverse is needed to start the algorithm efficiently. The simulation results indicate that the factor which most influences LMS adaptive inverse control is the product of the control relaxation and the the stability gain matrix. A small stability gain matrix makes the controller less sensitive to relaxation selection, and permits faster and more stable vibration reduction, than by choosing the stability gain matrix large and the control relaxation term small. It is shown that the best selections of the stability gain matrix elements and the amount of control relaxation is basically a compromise between slow, stable convergence and fast convergence with increased possibility of unstable identification. In the simulation studies, the LMS adaptive inverse control algorithm is shown to be capable of adapting the inverse (controller) matrix to track changes in the flight conditions. The algorithm converges quickly for moderate disturbances, while taking longer for larger disturbances. Perfect knowledge of the inverse matrix is not required for good control of the N/Rev vibration. However it is shown that measurement noise will prevent the LMS adaptive inverse control technique from controlling the vibration, unless the signal averaging method presented is incorporated into the algorithm.

Vector meson photoproduction with a linearly polarized beam

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mathieu, V.; Nys, J.; Fernendez-Ramirez, C.

Here, we propose a model based on Regge theory to describe photoproduction of light vector mesons. We fit the SLAC data and make predictions for the energy and momentum transfer dependence of the spin-density matrix elements in photoproduction of ω,more » $$\\rho^0$$ and $$\\sigma$$ mesons at Ε γ ~ 8.5 GeV, which are soon to be measured at Jefferson Lab.« less

The NASTRAN theoretical manual

NASA Technical Reports Server (NTRS)

1981-01-01

Designed to accommodate additions and modifications, this commentary on NASTRAN describes the problem solving capabilities of the program in a narrative fashion and presents developments of the analytical and numerical procedures that underlie the program. Seventeen major sections and numerous subsections cover; the organizational aspects of the program, utility matrix routines, static structural analysis, heat transfer, dynamic structural analysis, computer graphics, special structural modeling techniques, error analysis, interaction between structures and fluids, and aeroelastic analysis.

Vector meson photoproduction with a linearly polarized beam

DOE PAGES

Mathieu, V.; Nys, J.; Fernendez-Ramirez, C.; ...

2018-05-09

Here, we propose a model based on Regge theory to describe photoproduction of light vector mesons. We fit the SLAC data and make predictions for the energy and momentum transfer dependence of the spin-density matrix elements in photoproduction of ω,more » $$\\rho^0$$ and $$\\sigma$$ mesons at Ε γ ~ 8.5 GeV, which are soon to be measured at Jefferson Lab.« less

Corrigendum to "Matrix-algebra-based calculations of the time evolution of the binary spin-bath model for magnetization transfer" [J. Magn. Reson. 230 (2013) 88-97

NASA Astrophysics Data System (ADS)

Müller, Dirk K.; Pampel, André; Möller, Harald E.

2015-12-01

In the print version of this article initially published, reference to a funding source was missing. The following information should be added to the Acknowledgements section: This work was funded (in part) by the Helmholtz Alliance ICEMED-Imaging and Curing Environmental Metabolic Diseases, through the Initiative and Networking Fund of the Helmholtz Association.

Nuclear waste storage container with metal matrix

DOEpatents

Sump, Kenneth R.

1978-01-01

The invention relates to a storage container for high-level waste having a metal matrix for the high-level waste, thereby providing greater impact strength for the waste container and increasing heat transfer properties.

Jet Penetration into a Scaled Microfabricated Stirling Cycle Regenerator

NASA Technical Reports Server (NTRS)

Sun, Liyong; Simon, Terrence W.; Mantell, Susan; Ibrahim, Mournir; Gedeon, David; Tew, Roy

2008-01-01

The cooler and heater adjacent to the regenerator of a Stirling cycle engine have tubes or channels which form jets that pass into the regenerator while diffusing within the matrix. An inactive part of the matrix, beyond the cores of these jets, does not participate fully in the heat transfer between the flow of working fluid and the regenerator matrix material, weakening the regenerator s ability to exchange heat with the working fluid. The objective of the present program is to document this effect on the performance of the regenerator and to develop a model for generalizing the results. However, the small scales of actual Stirling regenerator matrices (on the order of tens of microns) make direct measurements of this effect very difficult. As a result, jet spreading within a regenerator matrix has not been characterized well and is poorly understood. Also, modeling is lacking experimental verification. To address this, a large-scale mockup of thirty times actual scale was constructed and operated under conditions that are dynamically similar to the engine operation. Jet penetration with round jets and slot jets into the microfabricated regenerator geometry are then measured by conventional means. The results are compared with those from a study of spreading of round jets within woven screen regenerator for further documentation of the comparative performance of the microfabricated regenerator geometry.

Comment on ``Multicritical behavior of a square-lattice-gas model with anisotropic repulsive interactions: A transfer-matrix scaling study''

NASA Astrophysics Data System (ADS)

Caflisch, Robert G.

1988-09-01

An argument is given that the model of Buda, Florio, and Giaquinta (BFG)[Phys. Rev. B 35, 2021 (1987)] for anisotropic molecules on a square lattice is inappropriate in that context, because it confuses anisotropy of the lattice with the anisotropy of the molecule. The importance of this is made clear by noting the absence (in BFG) of a dilute isotropic phase. Such a phase is unavoidable on very general grounds. Comments are made about an alternative realization of their results and an alternative class of models for anisotropic molecules.

A scattering model for defoliated vegetation

NASA Technical Reports Server (NTRS)

Karam, M. A.; Fung, A. K.

1986-01-01

A scattering model for defoliated vegetation is conceived as a layer of dielectric, finite-length cylinders with specified size and orientation distributions above an irregular ground surface. The scattering phase matrix of a single cylinder is computed, then the radiative transfer technique is applied to link volume scattering from vegetation to surface scattering from the soil surface. Polarized and depolarized scattering are computed and the effects of the cylinder size and orientation distributions are illustrated. It is found that size and orientation distributions have significant effects on the backscattered signal. The model is compared with scattering from defoliated trees and agricultural crops.

Regenerator filled with a matrix of polycrystalline iron whiskers

NASA Astrophysics Data System (ADS)

Eder, F. X.; Appel, H.

1982-08-01

In thermal regenerators, parameters were optimized: convection coefficient, surface of heat accumulating matrix, matrix density and heat capacity, and frequency of cycle inversions. The variation of heat capacity with working temperature was also computed. Polycrystalline iron whiskers prove a good compromise as matrix for heat regenerators at working temperatures ranging from 300 to 80 K. They were compared with wire mesh screens and microspheres of bronze and stainless steel. For theses structures and materials, thermal conductivity, pressure drop, heat transfer and yield were calculated and related to the experimental values. As transport heat gas, helium, argon, and dry nitrogen were applied at pressures up to 20 bar. Experimental and theoretical studies result in a set of formulas for calculating pressure drop, heat capacity, and heat transfer rate for a given thermal regenerator in function of mass flow. It is proved that a whisker matrix has an efficiency that depends strongly on gas pressure and composition. Iron whiskers make a good matrix with heat capacities of kW/cu cm per K, but their relative high pressure drop may, at low pressures, be a limitation. A regenerator expansion machine is described.

Influences of system uncertainties on the numerical transfer path analysis of engine systems

NASA Astrophysics Data System (ADS)

Acri, A.; Nijman, E.; Acri, A.; Offner, G.

2017-10-01

Practical mechanical systems operate with some degree of uncertainty. In numerical models uncertainties can result from poorly known or variable parameters, from geometrical approximation, from discretization or numerical errors, from uncertain inputs or from rapidly changing forcing that can be best described in a stochastic framework. Recently, random matrix theory was introduced to take parameter uncertainties into account in numerical modeling problems. In particular in this paper, Wishart random matrix theory is applied on a multi-body dynamic system to generate random variations of the properties of system components. Multi-body dynamics is a powerful numerical tool largely implemented during the design of new engines. In this paper the influence of model parameter variability on the results obtained from the multi-body simulation of engine dynamics is investigated. The aim is to define a methodology to properly assess and rank system sources when dealing with uncertainties. Particular attention is paid to the influence of these uncertainties on the analysis and the assessment of the different engine vibration sources. Examples of the effects of different levels of uncertainties are illustrated by means of examples using a representative numerical powertrain model. A numerical transfer path analysis, based on system dynamic substructuring, is used to derive and assess the internal engine vibration sources. The results obtained from this analysis are used to derive correlations between parameter uncertainties and statistical distribution of results. The derived statistical information can be used to advance the knowledge of the multi-body analysis and the assessment of system sources when uncertainties in model parameters are considered.

Representing Matrix Cracks Through Decomposition of the Deformation Gradient Tensor in Continuum Damage Mechanics Methods

NASA Technical Reports Server (NTRS)

Leone, Frank A., Jr.

2015-01-01

A method is presented to represent the large-deformation kinematics of intraply matrix cracks and delaminations in continuum damage mechanics (CDM) constitutive material models. The method involves the additive decomposition of the deformation gradient tensor into 'crack' and 'bulk material' components. The response of the intact bulk material is represented by a reduced deformation gradient tensor, and the opening of an embedded cohesive interface is represented by a normalized cohesive displacement-jump vector. The rotation of the embedded interface is tracked as the material deforms and as the crack opens. The distribution of the total local deformation between the bulk material and the cohesive interface components is determined by minimizing the difference between the cohesive stress and the bulk material stress projected onto the cohesive interface. The improvements to the accuracy of CDM models that incorporate the presented method over existing approaches are demonstrated for a single element subjected to simple shear deformation and for a finite element model of a unidirectional open-hole tension specimen. The material model is implemented as a VUMAT user subroutine for the Abaqus/Explicit finite element software. The presented deformation gradient decomposition method reduces the artificial load transfer across matrix cracks subjected to large shearing deformations, and avoids the spurious secondary failure modes that often occur in analyses based on conventional progressive damage models.

Steady State Transportation Cooling in Porous Media Under Local, Non-Thermal Equilibrium Fluid Flow

NASA Technical Reports Server (NTRS)

Rodriquez, Alvaro Che

2002-01-01

An analytical solution to the steady-state fluid temperature for 1-D (one dimensional) transpiration cooling has been derived. Transpiration cooling has potential use in the aerospace industry for protection against high heating environments for re-entry vehicles. Literature for analytical treatments of transpiration cooling has been largely confined to the assumption of thermal equilibrium between the porous matrix and fluid. In the present analysis, the fundamental fluid and matrix equations are coupled through a volumetric heat transfer coefficient and investigated in non-thermal equilibrium. The effects of varying the thermal conductivity of the solid matrix and the heat transfer coefficient are investigated. The results are also compared to existing experimental data.

Addressable inverter matrix for process and device characterization

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Sayah, H. R.

1985-01-01

The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold vltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

Addressable inverter matrix for process and device characterization

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Sayah, H. R.

1985-01-01

The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

Quantum phase transitions in the S=(1)/(2) distorted diamond chain

NASA Astrophysics Data System (ADS)

Li, Yan-Chao; Li, Shu-Shen

2008-11-01

By means of the second derivative of the ground-state and first-excited energy, the quantum phase transitions (QPTs) for the distorted diamond chain (DDC) with ferromagnetic and antiferromagnetic frustrated interactions and the trimerized case are investigated, respectively. Our results show the plentiful quantum phases owing to the spin interaction competitions in the model. Meanwhile, by using the transfer-matrix renormalization-group technique, we study the two-site thermal entanglement of the DDC model in the thermodynamic limit for a further understanding of the QPTs.

A TBA approach to thermal transport in the XXZ Heisenberg model

NASA Astrophysics Data System (ADS)

Zotos, X.

2017-10-01

We show that the thermal Drude weight and magnetothermal coefficient of the 1D easy-plane Heisenberg model can be evaluated by an extension of the Bethe ansatz thermodynamics formulation by Takahashi and Suzuki (1972 Prog. Theor. Phys. 48 2187). They have earlier been obtained by the quantum transfer matrix method (Klümper 1999 Z. Phys. B 91 507). Furthermore, this approach can be applied to the study of the far-out of equilibrium energy current generated at the interface between two semi-infinite chains held at different temperatures.

Transfer-matrix study of a hard-square lattice gas with two kinds of particles and density anomaly

NASA Astrophysics Data System (ADS)

Oliveira, Tiago J.; Stilck, Jürgen F.

2015-09-01

Using transfer matrix and finite-size scaling methods, we study the thermodynamic behavior of a lattice gas with two kinds of particles on the square lattice. Only excluded volume interactions are considered, so that the model is athermal. Large particles exclude the site they occupy and its four first neighbors, while small particles exclude only their site. Two thermodynamic phases are found: a disordered phase where large particles occupy both sublattices with the same probability and an ordered phase where one of the two sublattices is preferentially occupied by them. The transition between these phases is continuous at small concentrations of the small particles and discontinuous at larger concentrations, both transitions are separated by a tricritical point. Estimates of the central charge suggest that the critical line is in the Ising universality class, while the tricritical point has tricritical Ising (Blume-Emery-Griffiths) exponents. The isobaric curves of the total density as functions of the fugacity of small or large particles display a minimum in the disordered phase.

Plasmon enhanced heterogeneous electron transfer with continuous band energy model

NASA Astrophysics Data System (ADS)

Zhao, Dandan; Niu, Lu; Wang, Luxia

2017-08-01

Photoinduced charge injection from a perylene dye molecule into the conduction band of a TiO2 system decorated by a metal nanoparticles (MNP) is studied theoretically. Utilizing the density matrix theory the charge transfer dynamics is analyzed. The continuous behavior of the TiO2 conduction band is accounted for by a Legendre polynomials expansion. The simulations consider optical excitation of the dye molecule coupled to the MNP and the subsequent electron injection into the TiO2 semiconductor. Due to the energy transfer coupling between the molecule and the MNP optical excitation and subsequent charge injection into semiconductor is strongly enhanced. The respective enhancement factor can reach values larger than 103. Effects of pulse duration, coupling strength and energetic resonances are also analyzed. The whole approach offers an efficient way to increase charge injection in dye-sensitized solar cells.

Quantum State Transfer via Noisy Photonic and Phononic Waveguides

NASA Astrophysics Data System (ADS)

Vermersch, B.; Guimond, P.-O.; Pichler, H.; Zoller, P.

2017-03-01

We describe a quantum state transfer protocol, where a quantum state of photons stored in a first cavity can be faithfully transferred to a second distant cavity via an infinite 1D waveguide, while being immune to arbitrary noise (e.g., thermal noise) injected into the waveguide. We extend the model and protocol to a cavity QED setup, where atomic ensembles, or single atoms representing quantum memory, are coupled to a cavity mode. We present a detailed study of sensitivity to imperfections, and apply a quantum error correction protocol to account for random losses (or additions) of photons in the waveguide. Our numerical analysis is enabled by matrix product state techniques to simulate the complete quantum circuit, which we generalize to include thermal input fields. Our discussion applies both to photonic and phononic quantum networks.

Ultrashort hybrid metal-insulator plasmonic directional coupler.

PubMed

Noghani, Mahmoud Talafi; Samiei, Mohammad Hashem Vadjed

2013-11-01

An ultrashort plasmonic directional coupler based on the hybrid metal-insulator slab waveguide is proposed and analyzed at the telecommunication wavelength of 1550 nm. It is first analyzed using the supermode theory based on mode analysis via the transfer matrix method in the interaction region. Then the 2D model of the coupler, including transition arms, is analyzed using a commercial finite-element method simulator. The hybrid slab waveguide is composed of a metallic layer of silver and two dielectric layers of silica (SiO2) and silicon (Si). The coupler is optimized to have a minimum coupling length and to transfer maximum power considering the layer thicknesses as optimization variables. The resulting coupling length in the submicrometer region along with a noticeable power transfer efficiency are advantages of the proposed coupler compared to previously reported plasmonic couplers.

Modeling reactive transport processes in fractured rock using the time domain random walk approach within a dual-porosity framework

NASA Astrophysics Data System (ADS)

Roubinet, D.; Russian, A.; Dentz, M.; Gouze, P.

2017-12-01

Characterizing and modeling hydrodynamic reactive transport in fractured rock are critical challenges for various research fields and applications including environmental remediation, geological storage, and energy production. To this end, we consider a recently developed time domain random walk (TDRW) approach, which is adapted to reproduce anomalous transport behaviors and capture heterogeneous structural and physical properties. This method is also very well suited to optimize numerical simulations by memory-shared massive parallelization and provide numerical results at various scales. So far, the TDRW approach has been applied for modeling advective-diffusive transport with mass transfer between mobile and immobile regions and simple (theoretical) reactions in heterogeneous porous media represented as single continuum domains. We extend this approach to dual-continuum representations considering a highly permeable fracture network embedded into a poorly permeable rock matrix with heterogeneous geochemical reactions occurring in both geological structures. The resulting numerical model enables us to extend the range of the modeled heterogeneity scales with an accurate representation of solute transport processes and no assumption on the Fickianity of these processes. The proposed model is compared to existing particle-based methods that are usually used to model reactive transport in fractured rocks assuming a homogeneous surrounding matrix, and is used to evaluate the impact of the matrix heterogeneity on the apparent reaction rates for different 2D and 3D simple-to-complex fracture network configurations.

Transfer functions for protein signal transduction: application to a model of striatal neural plasticity.

PubMed

Scheler, Gabriele

2013-01-01

We present a novel formulation for biochemical reaction networks in the context of protein signal transduction. The model consists of input-output transfer functions, which are derived from differential equations, using stable equilibria. We select a set of "source" species, which are interpreted as input signals. Signals are transmitted to all other species in the system (the "target" species) with a specific delay and with a specific transmission strength. The delay is computed as the maximal reaction time until a stable equilibrium for the target species is reached, in the context of all other reactions in the system. The transmission strength is the concentration change of the target species. The computed input-output transfer functions can be stored in a matrix, fitted with parameters, and even recalled to build dynamical models on the basis of state changes. By separating the temporal and the magnitudinal domain we can greatly simplify the computational model, circumventing typical problems of complex dynamical systems. The transfer function transformation of biochemical reaction systems can be applied to mass-action kinetic models of signal transduction. The paper shows that this approach yields significant novel insights while remaining a fully testable and executable dynamical model for signal transduction. In particular we can deconstruct the complex system into local transfer functions between individual species. As an example, we examine modularity and signal integration using a published model of striatal neural plasticity. The modularizations that emerge correspond to a known biological distinction between calcium-dependent and cAMP-dependent pathways. Remarkably, we found that overall interconnectedness depends on the magnitude of inputs, with higher connectivity at low input concentrations and significant modularization at moderate to high input concentrations. This general result, which directly follows from the properties of individual transfer functions, contradicts notions of ubiquitous complexity by showing input-dependent signal transmission inactivation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heifetz, Alexander; Vilim, Richard

Super-critical carbon dioxide (S-CO2) is a promising thermodynamic cycle for advanced nuclear reactors and solar energy conversion applications. Dynamic control of the proposed recompression S-CO2 cycle is accomplished with input from resistance temperature detector (RTD) measurements of the process fluid. One of the challenges in practical implementation of S-CO2 cycle is high corrosion rate of component and sensor materials. In this paper, we develop a mathematical model of RTD sensing using eigendecomposition model of radial heat transfer in a layered long cylinder. We show that the value of RTD time constant primarily depends on the rate of heat transfer frommore » the fluid to the outer wall of RTD. We also show that for typical material properties, RTD time constant can be calculated as the sum of reciprocal eigen-values of the heat transfer matrix. Using the computational model and a set of RTD and CO2 fluid thermophysical parameter values, we calculate the value of time constant of thermowell-mounted RTD sensor at the hot side of the precooler in the S-CO2 cycle. The eigendecomposition model of RTD will be used in future studies to model sensor degradation and its impact on control of S-CO2. (C) 2016 Elsevier B.V. All rights reserved.« less

Simultaneous backward data transmission and power harvesting in an ultrasonic transcutaneous energy transfer link employing acoustically dependent electric impedance modulation.

PubMed

Ozeri, Shaul; Shmilovitz, Doron

2014-09-01

The advancement and miniaturization of body implanted medical devices pose several challenges to Ultrasonic Transcutaneous Energy Transfer (UTET), such as the need to reduce the size of the piezoelectric resonator, and the need to maximize the UTET link power-transfer efficiency. Accordingly, the same piezoelectric resonator that is used for energy harvesting at the body implant, may also be used for ultrasonic backward data transfer, for instance, through impedance modulation. This paper presents physical considerations and design guidelines of the body implanted transducer of a UTET link with impedance modulation for a backward data transfer. The acoustic matching design procedure was based on the 2×2 transfer matrix chain analysis, in addition to the Krimholtz Leedom and Matthaei KLM transmission line model. The UTET power transfer was carried out at a frequency of 765 kHz, continuous wave (CW) mode. The backward data transfer was attained by inserting a 9% load resistance variation around its matched value (550 Ohm), resulting in a 12% increase in the acoustic reflection coefficient. A backward data transmission rate of 1200 bits/s was experimentally demonstrated using amplitude shift keying, simultaneously with an acoustic power transfer of 20 mW to the implant. Copyright © 2014 Elsevier B.V. All rights reserved.

Sharp Estimates in Ruelle Theorems for Matrix Transfer Operators

NASA Astrophysics Data System (ADS)

Campbell, J.; Latushkin, Y.

A matrix coefficient transfer operator , on the space of -sections of an m-dimensional vector bundle over n-dimensional compact manifold is considered. The spectral radius of is estimated bya; and the essential spectral radius by Here is the set of ergodic f-invariant measures, and for is the measure-theoretic entropy of f, is the largest Lyapunov exponent of the cocycle over f generated by , and is the smallest Lyapunov exponent of the differential of f.

Simulation of naturally fractured reservoirs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saidi, A.M.

1983-11-01

A three-dimensional, three-phase reservoir simulator was developed to study the behavior of fully or partially fractured reservoirs. It is also demonstrated, that when a fractured reservoir is subject to a relatively large rate of pressure drop and/or it composed of relatively large blocks, the pseudo steady-state pressure concept gives large errors as compared with transient fromulation. In addition, when gravity drainage and imbibitum processes, which is the most important mechanism in the fractured reservoirs, are represented by a ''lumped parameter'' even larger errors can be produced in exchange flow between matrix and fractures. For these reasons, the matrix blocks aremore » gridded and the transfer between matrix and fractures are calculated using pressure and diffusion transient concept. In this way the gravity drainage is also calculated accurately. As the matrix-fracture exchange flow depends on the location of each matrix grid relative to the GOC and/or WOC in fracture, the exchange flow equation are derived and given for each possible case. The differential equation describing the flow of water, oil, and gas within the matrix and fracture system, each of which may contain six unknowns, are presented. The two sets of equations are solved implicitly for pressure water, and gas stauration in both matrix and fractures. The first twenty two years of the history of Haft Kel field was successfully matched with this model and the results are included.« less

Tablet potency of Tianeptine in coated tablets by near infrared spectroscopy: model optimisation, calibration transfer and confidence intervals.

PubMed

Boiret, Mathieu; Meunier, Loïc; Ginot, Yves-Michel

2011-02-20

A near infrared (NIR) method was developed for determination of tablet potency of active pharmaceutical ingredient (API) in a complex coated tablet matrix. The calibration set contained samples from laboratory and production scale batches. The reference values were obtained by high performance liquid chromatography (HPLC) and partial least squares (PLS) regression was used to establish a model. The model was challenged by calculating tablet potency of two external test sets. Root mean square errors of prediction were respectively equal to 2.0% and 2.7%. To use this model with a second spectrometer from the production field, a calibration transfer method called piecewise direct standardisation (PDS) was used. After the transfer, the root mean square error of prediction of the first test set was 2.4% compared to 4.0% without transferring the spectra. A statistical technique using bootstrap of PLS residuals was used to estimate confidence intervals of tablet potency calculations. This method requires an optimised PLS model, selection of the bootstrap number and determination of the risk. In the case of a chemical analysis, the tablet potency value will be included within the confidence interval calculated by the bootstrap method. An easy to use graphical interface was developed to easily determine if the predictions, surrounded by minimum and maximum values, are within the specifications defined by the regulatory organisation. Copyright © 2010 Elsevier B.V. All rights reserved.

Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

PubMed

Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

2005-01-27

Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

Time evolution of photon-pulse propagation in scattering and absorbing media: The dynamic radiative transfer system

NASA Astrophysics Data System (ADS)

Georgakopoulos, A.; Politopoulos, K.; Georgiou, E.

2018-03-01

A new dynamic-system approach to the problem of radiative transfer inside scattering and absorbing media is presented, directly based on first-hand physical principles. This method, the Dynamic Radiative Transfer System (DRTS), employs a dynamical system formality using a global sparse matrix, which characterizes the physical, optical and geometrical properties of the material-volume of interest. The new system state is generated by the above time-independent matrix, using simple matrix-vector multiplication for each subsequent time step. DRTS is capable of calculating accurately the time evolution of photon propagation in media of complex structure and shape. The flexibility of DRTS allows the integration of time-dependent sources, boundary conditions, different media and several optical phenomena like reflection and refraction in a unified and consistent way. Various examples of DRTS simulation results are presented for ultra-fast light pulse 3-D propagation, demonstrating greatly reduced computational cost and resource requirements compared to other methods.

Numerical examination of the factors controlling DNAPL migration through a single fracture.

PubMed

Reynolds, D A; Kueper, B H

2002-01-01

The migration of five dense nonaqueous phase liquids (DNAPLs) through a single fracture in a clay aquitard was numerically simulated with the use of a compositional simulator. The effects of fracture aperture, fracture dip, matrix porosity, and matrix organic carbon content on the migration of chlorobenzene, 1,2-dichloroethylene, trichloroethylene, tetra-chloroethylene, and 1,2-dibromoethane were examined. Boundary conditions were chosen such that DNAPL entry into the system was allowed to vary according to the stresses applied. The aperture is the most important factor of those studied controlling the migration rate of DNAPL through a single fracture embedded in a clay matrix. Loss of mass to the matrix through diffusion does not significantly retard the migration rate of the DNAPL, particularly in larger aperture fractures (e.g., 50 microm). With time, the ratio of diffusive loss to the matrix to DNAPL flux into the fracture approaches an asymptotic value lower than unity. The implication is that matrix diffusion cannot arrest the migration of DNAPL in a single fracture. The complex relationships between density, viscosity, and solubility that, to some extent, govern the migration of DNAPL through these systems prevent accurate predictions without the use of numerical models. The contamination potential of the migrating DNAPL is significantly increased through the transfer of mass to the matrix. The occurrence of opposite concentration gradients within the matrix can cause dissolved phase contamination to exist in the system for more than 1000 years after the DNAPL has been completely removed from the fracture.

Transfer-Matrix Method for Solving the Spin 1/2 Antiferromagnetic Heisenberg Chain

NASA Astrophysics Data System (ADS)

Garcia-Bach, M. A.; Klein, D. J.; Valenti, R.

Following the discovery of high Tc superconductivity in the copper oxides, there has been a great deal of interest in the RVB wave function proposed by Anderson [1]. As a warm-up exercise we have considered a valence-bond wave function for the one dimensional spin-1/2 Heisenberg chain. The main virtue of our work is to propose a new variational singlet wavefunction which is almost analytically tractable by a transfer-matrix technique. We have obtained the ground state energy for finite as well as infinite chains, in good agreement with exact results. Correlation functions, excited states, and the effects of other interactions (e.g., spin-Peierls) are also accessible within this scheme [2]. Since the ground state of the chain is known to be a singlet (Lieb & Mattis [3]), we write the appropriate wave function as a superposition of valence-bond singlets, |ψ > =∑ limits k C k | k>, where |k> is a spin configuration obtained by pairing all spins into singlet pairs, in a way which is common in valence-bond calculations of large molecules. As in that case, each configuration, |k>, can be represented by a Rümer diagram, with directed bonds connecting each pair of spins on the chain. The ck's are variational co-efficients, the form of which is determined as follows: Each singlet configuration (Rümer diagram) is divided into "zones", a "zone" corresponding to the region between two consecutive sites. Each zone is indexed by its distance from the end of the chain and by the number of bonds crossing it. Our procedure assigns a variational parameter, xij, to the jth zone, when crossed by i bonds. The resulting wavefunction for an N-site chain is written as |ψ > =∑ limits k ∏ M limits { i =1} ∏ { N -1}limits { j =1} X ij{ m ij (k)} | k> where mij(k) equals 1 when zone j is crossed by i bonds and zero otherwise. To make the calculation tractable we reduce the number of variational parameters by disallowing configurations with bonds connecting any two sites separated by more than 2M lattice points. (For simplicity, we have limited ourselves to M=3, but the scheme can be used for any M). With the simple ansatz, matrix elements can be calculated by a transfer-matrix method. To understand the transfer-matrix method note that since only local zone parameters appear in the description of each state |k>, matrix elements and overlaps, < k| bar S q bar S{ q +1} |k'> and , are completely specified by a small number of "local states" associated with each zone. Within a given zone a local state is defined by (i) the number of bonds crossing the zone and (ii), by whether the bonds originate from the initial (|k>) or final (|k'>) state. It is then easy to see that "local states" of consecutive zones are connected by a 15 × 15 transfer matrix (for the case M=3). Furthermore, the overlap matrix element can be written as a product of transfer-matrices associated with each zone of the chain. When calculating matrix elements of the Hamiltonian, an additional matrix, U, must be defined, to represent the particular zone involving the two spins connected by the Heisenberg interaction. The relevant details as well as the comparison with exact results will be given elsewhere. We are planning to ultimately apply this method to the two dimensional case, and hope to include the effects of holes.

Charge-Transfer Complexes and Photochemistry of Ozone with Ferrocene and n-Butylferrocene: A UV-vis Matrix-Isolation Study.

PubMed

Pinelo, Laura F; Kugel, Roger W; Ault, Bruce S

2015-10-15

The reactions of ozone with ferrocene (cp2Fe) and with n-butylferrocene (n-butyl cp2Fe) were studied using matrix isolation, UV-vis spectroscopy, and theoretical calculations. The codeposition of cp2Fe with O3 and of n-butyl cp2Fe with O3 into an argon matrix led to the production of 1:1 charge-transfer complexes with absorptions at 765 and 815 nm, respectively. These absorptions contribute to the green matrix color observed upon initial deposition. The charge-transfer complexes underwent photochemical reactions upon irradiation with red light (λ ≥ 600 nm). Theoretical UV-vis spectra of the charge-transfer complexes and photochemical products were calculated using TD-DFT at the B3LYP/6-311G++(d,2p) level of theory. The calculated UV-vis spectra were in good agreement with the experimental results. MO analysis of these long-wavelength transitions showed them to be n→ π* on the ozone subunit in the complex and indicated that the formation of the charge-transfer complex between ozone and cp2Fe or n-butyl cp2Fe affects how readily the π* orbital on O3 is populated when red light (λ ≥ 600 nm) is absorbed. 1:1 complexes of cp2Fe and n-butyl cp2Fe with O2 were also observed experimentally and calculated theoretically. These results support and enhance previous infrared studies of the mechanism of photooxidation of ferrocene by ozone, a reaction that has considerable significance for the formation of iron oxide thin films for a range of applications.

Fast and Accurate Hybrid Stream PCRTMSOLAR Radiative Transfer Model for Reflected Solar Spectrum Simulation in the Cloudy Atmosphere

NASA Technical Reports Server (NTRS)

Yang, Qiguang; Liu, Xu; Wu, Wan; Kizer, Susan; Baize, Rosemary R.

2016-01-01

A hybrid stream PCRTM-SOLAR model has been proposed for fast and accurate radiative transfer simulation. It calculates the reflected solar (RS) radiances with a fast coarse way and then, with the help of a pre-saved matrix, transforms the results to obtain the desired high accurate RS spectrum. The methodology has been demonstrated with the hybrid stream discrete ordinate (HSDO) radiative transfer (RT) model. The HSDO method calculates the monochromatic radiances using a 4-stream discrete ordinate method, where only a small number of monochromatic radiances are simulated with both 4-stream and a larger N-stream (N = 16) discrete ordinate RT algorithm. The accuracy of the obtained channel radiance is comparable to the result from N-stream moderate resolution atmospheric transmission version 5 (MODTRAN5). The root-mean-square errors are usually less than 5x10(exp -4) mW/sq cm/sr/cm. The computational speed is three to four-orders of magnitude faster than the medium speed correlated-k option MODTRAN5. This method is very efficient to simulate thousands of RS spectra under multi-layer clouds/aerosols and solar radiation conditions for climate change study and numerical weather prediction applications.

Pressure transfer function of a JT15D nozzle due to acoustic and convected entropy fluctuations

NASA Astrophysics Data System (ADS)

Miles, J. H.

An acoustic transmission matrix analysis of sound propagation in a variable area duct with and without flow is extended to include convected entropy fluctuations. The boundary conditions used in the analysis are a transfer function relating entropy and pressure at the nozzle inlet and the nozzle exit impedance. The nozzle pressure transfer function calculated is compared with JT15D turbofan engine nozzle data. The one dimensional theory for sound propagation in a variable area nozzle with flow but without convected entropy is good at the low engine speeds where the nozzle exit Mach number is low (M=0.2) and the duct exit impedance model is good. The effect of convected entropy appears to be so negligible that it is obscured by the inaccuracy of the nozzle exit impedance model, the lack of information on the magnitude of the convected entropy and its phase relationship with the pressure, and the scatter in the data. An improved duct exit impedance model is required at the higher engine speeds where the nozzle exit Mach number is high (M=0.56) and at low frequencies (below 120 Hz).

Triangular node for Transmission-Line Modeling (TLM) applied to bio-heat transfer.

PubMed

Milan, Hugo F M; Gebremedhin, Kifle G

2016-12-01

Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, rectangles are used to discretize two-dimensional problems. The drawback in using rectangular shapes is that instead of refining only the domain of interest, a large additional domain will also be refined in the x and y axes, which results in increased computational time and memory space. In this paper, we developed a triangular node for TLM applied to bio-heat transfer that does not have the drawback associated with the rectangular nodes. The model includes heat source, blood perfusion (advection), boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. A matrix equation for TLM, which simplifies the solution of time-domain problems or solves steady-state problems, was also developed. The predicted results were compared against results obtained from the solution of a simplified two-dimensional problem, and they agreed within 1% for a mesh length of triangular faces of 59µm±9µm (mean±standard deviation) and a time step of 1ms. Copyright © 2016 Elsevier Ltd. All rights reserved.

Semianalytical solutions for transport in aquifer and fractured clay matrix system

NASA Astrophysics Data System (ADS)

Huang, Junqi; Goltz, Mark N.

2015-09-01

A three-dimensional mathematical model that describes transport of contaminant in a horizontal aquifer with simultaneous diffusion into a fractured clay formation is proposed. A group of semianalytical solutions is derived based on specific initial and boundary conditions as well as various source functions. The analytical model solutions are evaluated by numerical Laplace inverse transformation and analytical Fourier inverse transformation. The model solutions can be used to study the fate and transport in a three-dimensional spatial domain in which a nonaqueous phase liquid exists as a pool atop a fractured low-permeability clay layer. The nonaqueous phase liquid gradually dissolves into the groundwater flowing past the pool, while simultaneously diffusing into the fractured clay formation below the aquifer. Mass transfer of the contaminant into the clay formation is demonstrated to be significantly enhanced by the existence of the fractures, even though the volume of fractures is relatively small compared to the volume of the clay matrix. The model solution is a useful tool in assessing contaminant attenuation processes in a confined aquifer underlain by a fractured clay formation.

Hierarchical analysis of the degradation of fibre-reinforced polymers under the presence of void imperfections

PubMed Central

2016-01-01

The subject of this work is the investigation of the influence of voids on the mechanical properties of fibre-reinforced polymers (FRPs) under compression loading. To specify the damage accumulation of FRPs in the presence of voids, the complex three-dimensional structure of the composite including voids was analysed and a reduced mechanical model composite was derived. The hierarchical analysis of the model composite on a micro-scale level implies the description of the stress and strain behaviour of the matrix using the photoelasticity technique and digital image correlation technology. These studies are presented along with an analytical examination of the stability of a single fibre. As a result of the experimental and analytical studies, the stiffness of the matrix and fibre as well as their bonding, the initial fibre orientation and the fibre diameter have the highest impact on the failure initiation. All these facts lead to a premature fibre–matrix debonding with ongoing loss of stability of the fibre and followed by kink-band formation. Additional studies on the meso-scale of transparent glass FRPs including a unique void showed that the experiments carried out on the model composites could be transferred to real composites. This article is part of the themed issue ‘Multiscale modelling of the structural integrity of composite materials’. PMID:27242296

Dependent scattering and absorption by densely packed discrete spherical particles: Effects of complex refractive index

NASA Astrophysics Data System (ADS)

Ma, L. X.; Tan, J. Y.; Zhao, J. M.; Wang, F. Q.; Wang, C. A.; Wang, Y. Y.

2017-07-01

Due to the dependent scattering and absorption effects, the radiative transfer equation (RTE) may not be suitable for dealing with radiative transfer in dense discrete random media. This paper continues previous research on multiple and dependent scattering in densely packed discrete particle systems, and puts emphasis on the effects of particle complex refractive index. The Mueller matrix elements of the scattering system with different complex refractive indexes are obtained by both electromagnetic method and radiative transfer method. The Maxwell equations are directly solved based on the superposition T-matrix method, while the RTE is solved by the Monte Carlo method combined with the hard sphere model in the Percus-Yevick approximation (HSPYA) to consider the dependent scattering effects. The results show that for densely packed discrete random media composed of medium size parameter particles (equals 6.964 in this study), the demarcation line between independent and dependent scattering has remarkable connections with the particle complex refractive index. With the particle volume fraction increase to a certain value, densely packed discrete particles with higher refractive index contrasts between the particles and host medium and higher particle absorption indexes are more likely to show stronger dependent characteristics. Due to the failure of the extended Rayleigh-Debye scattering condition, the HSPYA has weak effect on the dependent scattering correction at large phase shift parameters.

A microwave backscattering model for precipitation

NASA Astrophysics Data System (ADS)

Ermis, Seda

A geophysical microwave backscattering model for space borne and ground-based remote sensing of precipitation is developed and used to analyze backscattering measurements from rain and snow type precipitation. Vector Radiative Transfer (VRT) equations for a multilayered inhomogeneous medium are applied to the precipitation region for calculation of backscattered intensity. Numerical solution of the VRT equation for multiple layers is provided by the matrix doubling method to take into account close range interactions between particles. In previous studies, the VRT model was used to calculate backscattering from a rain column on a sea surface. In the model, Mie scattering theory for closely spaced scatterers was used to determine the phase matrix for each sublayer characterized by a set of parameters. The scatterers i.e. rain drops within the sublayers were modelled as spheres with complex permittivities. The rain layer was bounded by rough boundaries; the interface between the cloud and the rain column as well as the interface between the sea surface and the rain were all analyzed by using the integral equation model (IEM). Therefore, the phase matrix for the entire rain column was generated by the combination of surface and volume scattering. Besides Mie scattering, in this study, we use T-matrix approach to examine the effect of the shape to the backscattered intensities since larger raindrops are most likely oblique in shape. Analyses show that the effect of obliquity of raindrops to the backscattered wave is related with size of the scatterers and operated frequency. For the ground-based measurement system, the VRT model is applied to simulate the precipitation column on horizontal direction. Therefore, the backscattered reflectivities for each unit range of volume are calculated from the backscattering radar cross sections by considering radar range and effective illuminated area of the radar beam. The volume scattering phase matrices for each range interval are calculated by Mie scattering theory. VRT equations are solved by matrix doubling method to compute phase matrix for entire radar beam. Model results are validated with measured data by X-band dual polarization Phase Tilt Weather Radar (PTWR) for snow, rain, wet hail type precipitation. The geophysical parameters given the best fit with measured reflectivities are used in previous models i.e. Rayleigh Approximation and Mie scattering and compared with the VRT model. Results show that reflectivities calculated by VRT models are differed up to 10 dB from the Rayleigh approximation model and up to 5 dB from the Mie Scattering theory due to both multiple scattering and attenuation losses for the rain rates as high as 80 mm/h.

Three-Loop Automatic of Control System the Landfill of Household Solid Waste

NASA Astrophysics Data System (ADS)

Sereda, T. G.; Kostarev, S. N.

2017-05-01

The analysis of models of governance ground municipal solid waste (MSW). Considered a distributed circuit (spatio-temporal) ground control model. Developed a dynamic model of multicontour control landfill. Adjustable parameters are defined (the ratio of CH4 CO2 emission/fluxes, concentrations of heavy metals ions) and control (purging array, irrigation, adding reagents). Based on laboratory studies carried out with the analysis of equity flows and procedures developed by the transferring matrix that takes into account the relationship control loops. A system of differential equations in the frequency and time domains. Given the numerical approaches solving systems of differential equations in finite differential form.

Modeling and design of a pre-stressed piezoelectric stack actuator

NASA Astrophysics Data System (ADS)

Jiang, Shiping; Cheng, Lei

2017-07-01

To provide a method for designing a pre-stressed PSA with high-performance, it is very meaningful to model the dynamic characteristics of the pre-stressed PSA accurately. A novel model, which considers both the electric side and the mechanical side of the PSA as distributed systems, is put forward to describe the dynamics characteristics of the PSA and the pre-stressed PSA. The role of the pre-stressed mechanism is derived and analyzed by extended transfer matrix method, and then the principle of design of the pre-stressed mechanism is obtained. The theoretical analysis is in accordance with the experimental results.

Diffusive transfer to membranes as an effective interface between gel electrophoresis and mass spectrometry

NASA Astrophysics Data System (ADS)

Ogorzalek Loo, Rachel R.; Mitchell, Charles; Stevenson, Tracy I.; Loo, Joseph A.; Andrews, Philip C.

1997-12-01

Diffusive transfer was examined as a blotting method to transfer proteins from polyacrylamide gels to membranes for ultraviolet matrix-assisted laser desorption ionization (MALDI) mass spectrometry. The method is well-suited for transfers from isoelectric focusing (IEF) gels. Spectra have been obtained for 11 pmol of 66 kDa albumin loaded onto an IEF gel and subsequently blotted to polyethylene. Similarly, masses of intact carbonic anhydrase and hemoglobin were obtained from 14 and 20 pmol loadings. This methodology is also compatible with blotting high molecular weight proteins, as seen for 6 pmol of the 150 kDa monoclonal antibody anti-[beta]-galactosidase transferred to Goretex. Polypropylene, Teflon, Nafion and polyvinylidene difluoride (PVDF) also produced good spectra following diffusive transfer. Only analysis from PVDF required that the membrane be kept wet prior to application of matrix. Considerations in mass accuracy for analysis from large-area membranes with continuous extraction and delayed extraction were explored, as were remedies for surface charging. Vapor phase CNBr cleavage was applied to membrane-bound samples for peptide mapping.

Robustness properties of LQG optimized compensators for collocated rate sensors

NASA Technical Reports Server (NTRS)

Balakrishnan, A. V.

1994-01-01

In this paper we study the robustness with respect to stability of the closed-loop system with collocated rate sensor using LQG (mean square rate) optimized compensators. Our main result is that the transmission zeros of the compensator are precisely the structure modes when the actuator/sensor locations are 'pinned' and/or 'clamped': i.e., motion in the direction sensed is not allowed. We have stability even under parameter mismatch, except in the unlikely situation where such a mode frequency of the assumed system coincides with an undamped mode frequency of the real system and the corresponding mode shape is an eigenvector of the compensator transfer function matrix at that frequency. For a truncated modal model - such as that of the NASA LaRC Phase Zero Evolutionary model - the transmission zeros of the corresponding compensator transfer function can be interpreted as the structure modes when motion in the directions sensed is prohibited.

Heat Transfer Performances of Pool Boiling on Metal-Graphite Composite Surfaces

NASA Technical Reports Server (NTRS)

Zhang, Nengli; Chao, David F.; Yang, Wen-Jei

2000-01-01

Nucleate boiling, especially near the critical heat flux (CHF), can provide excellent economy along with high efficiency of heat transfer. However, the performance of nucleate boiling may deteriorate in a reduced gravity environment and the nucleate boiling usually has a potentially dangerous characteristic in CHF regime. That is, any slight overload can result in burnout of the boiling surface because the heat transfer will suddenly move into the film-boiling regime. Therefore, enhancement of nucleate boiling heat transfer becomes more important in reduced gravity environments. Enhancing nucleate boiling and critical heat flux can be reached using micro-configured metal-graphite composites as the boiling surface. Thermocapillary force induced by temperature difference between the graphite-fiber tips and the metal matrix, which is independent of gravity, will play an important role in bubble detachment. Thus boiling heat transfer performance does not deteriorate in a reduced-gravity environment. Based on the existing experimental data, and a two-tier theoretical model, correlation formulas are derived for nucleate boiling on the copper-graphite and aluminum-graphite composite surfaces, in both the isolated and coalesced bubble regimes. Experimental studies were performed on nucleate pool boiling of pentane on cooper-graphite (Cu-Gr) and aluminum-graphite (Al-Gr) composite surfaces with various fiber volume concentrations for heat fluxes up to 35 W per square centimeter. It is revealed that a significant enhancement in boiling heat transfer performance on the composite surfaces is achieved, due to the presence of micro-graphite fibers embedded in the matrix. The onset of nucleate boiling (the isolated bubble regime) occurs at wall superheat of about 10 C for the Cu-Gr surface and 15 C for the Al-Gr surface, much lower than their respective pure metal surfaces. Transition from an isolated bubble regime to a coalesced bubble regime in boiling occurs at a superheat of about 14 C on Cu-Gr surface and 19 C on Al-Gr surface.

Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

PubMed

Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

2010-01-01

This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed epidermis. This in vitro study has produced a robust protocol that is ready for clinical studies in the future.

Investigation of a broadband coherent perfect absorber in a multi-layer structure by using the transfer matrix method

NASA Astrophysics Data System (ADS)

Na, Jihoon; Noh, Heeso

2018-01-01

We investigated a multi-layer structure for a broadband coherent perfect absorber (CPA). The transfer matrix method (TMM) is useful for analyzing the optical properties of structures and optimizing multi-layer structures. The broadband CPA strongly depends on the phase of the light traveling in one direction and the light reflected within the structure. The TMM simulation shows that the absorption bandwidth is increased by 95% in a multi-layer CPA compared to that in a single-layer CPA.

[A cost-benefit analysis of a Mexican food-support program].

PubMed

Ventura-Alfaro, Carmelita E; Gutiérrez-Reyes, Juan P; Bertozzi-Kenefick, Stefano M; Caldés-Gómez, Natalia

2011-06-01

Objective Presenting an estimate of a Mexican food-support program (FSP) program's cost transfer ratio (CTR) from start-up (2003) to May 2005. Methods The program's activities were listed by constructing a time allocation matrix to ascertain how much time was spent on each of the program's activities by the personnel so involved. Another cost matrix was also constructed which was completed with information from the program's accountancy records. The program's total cost, activity cost and the value of given FSP transfers were thus estimated. Results Food delivery CRT for 2003, 2004 and 2005 was 0.150, 0.218, 0.230, respectively; cash CTR was 0.132in 2004 and 0.105 in 2005. Conclusion Comparing CTR values according to transfer type is a good way to promote discussion related to this topic; however, the decision for making a transfer does not depend exclusively on efficiency but on both mechanisms' effectiveness.

The application of nonlinear programming and collocation to optimal aeroassisted orbital transfers

NASA Astrophysics Data System (ADS)

Shi, Y. Y.; Nelson, R. L.; Young, D. H.; Gill, P. E.; Murray, W.; Saunders, M. A.

1992-01-01

Sequential quadratic programming (SQP) and collocation of the differential equations of motion were applied to optimal aeroassisted orbital transfers. The Optimal Trajectory by Implicit Simulation (OTIS) computer program codes with updated nonlinear programming code (NZSOL) were used as a testbed for the SQP nonlinear programming (NLP) algorithms. The state-of-the-art sparse SQP method is considered to be effective for solving large problems with a sparse matrix. Sparse optimizers are characterized in terms of memory requirements and computational efficiency. For the OTIS problems, less than 10 percent of the Jacobian matrix elements are nonzero. The SQP method encompasses two phases: finding an initial feasible point by minimizing the sum of infeasibilities and minimizing the quadratic objective function within the feasible region. The orbital transfer problem under consideration involves the transfer from a high energy orbit to a low energy orbit.

Analysis of the effectiveness of steam retorting of oil shale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jacobs, H.R.; Pensel, R.W.; Udell, K.S.

A numerical model is developed to describe the retorting of oil shale using superheated steam. The model describes not only the temperature history of the shale but predicts the evolution of shale oil from kerogen decomposition and the breakdown of the carbonates existing in the shale matrix. The heat transfer coefficients between the water and the shale are determined from experiments utilizing the model to reduce the data. Similarly the model is used with thermogravimetric analysis experiments to develop an improved kinetics expression for kerogen decomposition in a steam environment. Numerical results are presented which indicate the effect of oilmore » shale particle size and steam temperature on oil production.« less

Numerical investigation of porous materials composites reinforced with natural fibers

NASA Astrophysics Data System (ADS)

Chikhi, M.; Metidji, N.; Mokhtari, F.; Merzouk, N. k.

2018-05-01

The present article tends to predict the effective thermal properties of porous biocomposites materials. The composites matrix consists on porous materials namely gypsum and the reinforcement is a natural fiber as date palm fibers. The numerical study is done using Comsol software resolving the heat transfer equation. The results are fitted with theoretical model and experimental results. The results of this study indicate that the porosity has an effect on the Effective thermal conductivity biocompoites.

A proposed method for enhanced eigen-pair extraction using finite element methods: Theory and application

NASA Technical Reports Server (NTRS)

Jara-Almonte, J.; Mitchell, L. D.

1988-01-01

The paper covers two distinct parts: theory and application. The goal of this work was the reduction of model size with an increase in eigenvalue/vector accuracy. This method is ideal for the condensation of large truss- or beam-type structures. The theoretical approach involves the conversion of a continuum transfer matrix beam element into an 'Exact' dynamic stiffness element. This formulation is implemented in a finite element environment. This results in the need to solve a transcendental eigenvalue problem. Once the eigenvalue is determined the eigenvectors can be reconstructed with any desired spatial precision. No discretization limitations are imposed on the reconstruction. The results of such a combined finite element and transfer matrix formulation is a much smaller FEM eigenvalue problem. This formulation has the ability to extract higher eigenvalues as easily and as accurately as lower eigenvalues. Moreover, one can extract many more eigenvalues/vectors from the model than the number of degrees of freedom in the FEM formulation. Typically, the number of eigenvalues accurately extractable via the 'Exact' element method are at least 8 times the number of degrees of freedom. In contrast, the FEM usually extracts one accurate (within 5 percent) eigenvalue for each 3-4 degrees of freedom. The 'Exact' element results in a 20-30 improvement in the number of accurately extractable eigenvalues and eigenvectors.

Retroviral gene transfer of an antisense construct against membrane type 1 matrix metalloproteinase reduces the invasiveness of rheumatoid arthritis synovial fibroblasts.

PubMed

Rutkauskaite, Edita; Volkmer, Dagmar; Shigeyama, Yukio; Schedel, Jörg; Pap, Geza; Müller-Ladner, Ulf; Meinecke, Ingmar; Alexander, Dorothea; Gay, Renate E; Drynda, Susanne; Neumann, Wolfram; Michel, Beat A; Aicher, Wilhelm K; Gay, Steffen; Pap, Thomas

2005-07-01

Membrane type 1 matrix metalloproteinase (MT1-MMP) is expressed prominently in rheumatoid arthritis synovial fibroblasts (RASFs), but the specific contribution of MT1-MMP to fibroblast-mediated destruction of articular cartilage is incompletely understood. This study used gene transfer of an antisense expression construct to assess the effects of MT1-MMP inhibition on the invasiveness of RASFs. Retroviral gene transfer of a pLXIN vector-based antisense RNA expression construct (MT1-MMPalphaS) to MT1-MMP was used to stably transduce RASFs. Levels of MT1-MMP RNA and protein were determined by quantitative polymerase chain reaction, Western blotting, and immunocytochemistry in MT1-MMPalphaS-transduced RASFs as well as in control cells, with monitoring for 60 days. The effects of MT1-MMPalphaS on the invasiveness of RASFs were analyzed in the SCID mouse co-implantation model of RA. MT1-MMPalphaS-transduced RASFs produced high levels of antisense RNA that exceeded endogenous levels of MT1-MMP messenger RNA by 15-fold and resulted in a down-regulation of MT1-MMP at the protein level. Inhibition of MT1-MMP production was maintained for 60 days and significantly reduced the invasiveness of RASFs in the SCID mouse model. Whereas prominent invasion into cartilage by non-transduced and mock-transduced RASFs was observed (mean invasion scores 3.0 and 3.1, respectively), MT1-MMPalphaS-transduced cells showed only moderate invasiveness (mean invasion score 1.8; P < 0.05). The data demonstrate that an antisense RNA expression construct against MT1-MMP can be generated and expressed in RASFs for at least 60 days. Inhibition of MT1-MMP significantly reduces the cartilage degradation by RASFs.

Effect of proton transfer on the electronic coupling in DNA

NASA Astrophysics Data System (ADS)

Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

2006-06-01

The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

Generation of gas-phase ions from charged clusters: an important ionization step causing suppression of matrix and analyte ions in matrix-assisted laser desorption/ionization mass spectrometry.

PubMed

Lou, Xianwen; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W

2016-12-30

Ionization in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a very complicated process. It has been reported that quaternary ammonium salts show extremely strong matrix and analyte suppression effects which cannot satisfactorily be explained by charge transfer reactions. Further investigation of the reasons causing these effects can be useful to improve our understanding of the MALDI process. The dried-droplet and modified thin-layer methods were used as sample preparation methods. In the dried-droplet method, analytes were co-crystallized with matrix, whereas in the modified thin-layer method analytes were deposited on the surface of matrix crystals. Model compounds, tetrabutylammonium iodide ([N(Bu) 4 ]I), cesium iodide (CsI), trihexylamine (THA) and polyethylene glycol 600 (PEG 600), were selected as the test analytes given their ability to generate exclusively pre-formed ions, protonated ions and metal ion adducts respectively in MALDI. The strong matrix suppression effect (MSE) observed using the dried-droplet method might disappear using the modified thin-layer method, which suggests that the incorporation of analytes in matrix crystals contributes to the MSE. By depositing analytes on the matrix surface instead of incorporating in the matrix crystals, the competition for evaporation/ionization from charged matrix/analyte clusters could be weakened resulting in reduced MSE. Further supporting evidence for this inference was found by studying the analyte suppression effect using the same two sample deposition methods. By comparing differences between the mass spectra obtained via the two sample preparation methods, we present evidence suggesting that the generation of gas-phase ions from charged matrix/analyte clusters may induce significant suppression of matrix and analyte ions. The results suggest that the generation of gas-phase ions from charged matrix/analyte clusters is an important ionization step in MALDI-MS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Resin infiltration transfer technique

DOEpatents

Miller, David V [Pittsburgh, PA; Baranwal, Rita [Glenshaw, PA

2009-12-08

A process has been developed for fabricating composite structures using either reaction forming or polymer infiltration and pyrolysis techniques to densify the composite matrix. The matrix and reinforcement materials of choice can include, but are not limited to, silicon carbide (SiC) and zirconium carbide (ZrC). The novel process can be used to fabricate complex, net-shape or near-net shape, high-quality ceramic composites with a crack-free matrix.

On integrable boundaries in the 2 dimensional O(N) σ-models

NASA Astrophysics Data System (ADS)

Aniceto, Inês; Bajnok, Zoltán; Gombor, Tamás; Kim, Minkyoo; Palla, László

2017-09-01

We make an attempt to map the integrable boundary conditions for 2 dimensional non-linear O(N) σ-models. We do it at various levels: classically, by demanding the existence of infinitely many conserved local charges and also by constructing the double row transfer matrix from the Lax connection, which leads to the spectral curve formulation of the problem; at the quantum level, we describe the solutions of the boundary Yang-Baxter equation and derive the Bethe-Yang equations. We then show how to connect the thermodynamic limit of the boundary Bethe-Yang equations to the spectral curve.

Modeling of enhanced spontaneous parametric down-conversion in plasmonic and dielectric structures with realistic waves

NASA Astrophysics Data System (ADS)

Loot, A.; Hizhnyakov, V.

2018-05-01

A numerical study of the enhancement of the spontaneous parametric down-conversion in plasmonic and dielectric structures is considered. The modeling is done using a nonlinear transfer-matrix method which is extended to include vacuum fluctuations and realistic waves (e.g. Gaussian beam). The results indicate that in the case of short-range surface plasmon polaritons, the main limiting factor of the enhancement is the short length of the coherent buildup. In the case of long-range surface plasmon polaritons or dielectric guided waves, the very narrow resonances are the main limiting factor instead.

Numerical Simulation of Heat Transfer in Porous Metals for Cooling Applications

NASA Astrophysics Data System (ADS)

Gauna, Edgar Avalos; Zhao, Yuyuan

2017-08-01

Porous metals have low densities and novel physical, mechanical, thermal, electrical, and acoustic properties. Hence, they have attracted a large amount of interest over the last few decades. One of their applications is for thermal management in the electronics industry because of their fluid permeability and thermal conductivity. The heat transfer capability is achieved by the interaction between the internal channels within the porous metal and the coolant flowing through them. This paper studies the fluid flow and heat transfer in open-cell porous metals manufactured by space holder methods by numerical simulation using software ANSYS Fluent. A 3D geometric model of the porous structure was created based on the face-centered-cubic arrangement of spheres linked by cylinders. This model allows for different combinations of pore parameters including a wide range of porosity (50 to 80 pct), pore size (400 to 1000 µm), and metal particle size (10 to 75 µm). In this study, water was used as the coolant and copper was selected as the metal matrix. The flow rate was varied in the Darcian and Forchheimer's regimes. The permeability, form drag coefficient, and heat transfer coefficient were calculated under a range of conditions. The numerical results showed that permeability increased whereas the form drag coefficient decreased with porosity. Both permeability and form drag coefficient increased with pore size. Increasing flow rate and decreasing porosity led to better heat transfer performance.

Multivariate calibration standardization across instruments for the determination of glucose by Fourier transform near-infrared spectrometry.

PubMed

Zhang, Lin; Small, Gary W; Arnold, Mark A

2003-11-01

The transfer of multivariate calibration models is investigated between a primary (A) and two secondary Fourier transform near-infrared (near-IR) spectrometers (B, C). The application studied in this work is the use of bands in the near-IR combination region of 5000-4000 cm(-)(1) to determine physiological levels of glucose in a buffered aqueous matrix containing varying levels of alanine, ascorbate, lactate, triacetin, and urea. The three spectrometers are used to measure 80 samples produced through a randomized experimental design that minimizes correlations between the component concentrations and between the concentrations of glucose and water. Direct standardization (DS), piecewise direct standardization (PDS), and guided model reoptimization (GMR) are evaluated for use in transferring partial least-squares calibration models developed with the spectra of 64 samples from the primary instrument to the prediction of glucose concentrations in 16 prediction samples measured with each secondary spectrometer. The three algorithms are evaluated as a function of the number of standardization samples used in transferring the calibration models. Performance criteria for judging the success of the calibration transfer are established as the standard error of prediction (SEP) for internal calibration models built with the spectra of the 64 calibration samples collected with each secondary spectrometer. These SEP values are 1.51 and 1.14 mM for spectrometers B and C, respectively. When calibration standardization is applied, the GMR algorithm is observed to outperform DS and PDS. With spectrometer C, the calibration transfer is highly successful, producing an SEP value of 1.07 mM. However, an SEP of 2.96 mM indicates unsuccessful calibration standardization with spectrometer B. This failure is attributed to differences in the variance structure of the spectra collected with spectrometers A and B. Diagnostic procedures are presented for use with the GMR algorithm that forecasts the successful calibration transfer with spectrometer C and the unsatisfactory results with spectrometer B.

Development and experimental design of a novel controlled-release matrix tablet formulation for indapamide hemihydrate.

PubMed

Antovska, Packa; Ugarkovic, Sonja; Petruševski, Gjorgji; Stefanova, Bosilka; Manchevska, Blagica; Petkovska, Rumenka; Makreski, Petre

2017-11-01

Development, experimental design and in vitro in vivo correlation (IVIVC) of controlled-release matrix formulation. Development of novel oral controlled delivery system for indapamide hemihydrate, optimization of the formulation by experimental design and evaluation regarding IVIVC on a pilot scale batch as a confirmation of a well-established formulation. In vitro dissolution profiles of controlled-release tablets of indapamide hemihydrate from four different matrices had been evaluated in comparison to the originator's product Natrilix (Servier) as a direction for further development and optimization of a hydroxyethylcellulose-based matrix controlled-release formulation. A central composite factorial design had been applied for the optimization of a chosen controlled-release tablet formulation. The controlled-release tablets with appropriate physical and technological properties had been obtained with a matrix: binder concentration variations in the range: 20-40w/w% for the matrix and 1-3w/w% for the binder. The experimental design had defined the design space for the formulation and was prerequisite for extraction of a particular formulation that would be a subject for transfer on pilot scale and IVIV correlation. The release model of the optimized formulation has shown best fit to the zero order kinetics depicted with the Hixson-Crowell erosion-dependent mechanism of release. Level A correlation was obtained.

Generalized design of a zero-geometric-loss, astigmatism-free, modified four-objective multipass matrix system.

PubMed

Guo, Yin; Sun, LiQun; Yang, Zheng; Liu, Zilong

2016-02-20

During this study we constructed a generalized parametric modified four-objective multipass matrix system (MMS). We used an optical system comprising four asymmetrical spherical mirrors to improve the alignment process. The use of a paraxial equation for the design of the front transfer optics yielded the initial condition for modeling our MMS. We performed a ray tracing simulation to calculate the significant aberration of the system (astigmatism). Based on the calculated meridional and sagittal focus positions, the complementary focusing mirror was easily designed to provide an output beam free of astigmatism. We have presented an example of a 108-transit multipass system (5×7 matrix arrangement) with a relatively larger numerical aperture source (xenon light source). The whole system exhibits zero theoretical geometrical loss when simulated with Zemax software. The MMS construction strategy described in this study provides an anastigmatic output beam and the generalized approach to design a controllable matrix spot pattern on the field mirrors. Asymmetrical reflective mirrors aid in aligning the whole system with high efficiency. With the generalized design strategy in terms of optics configuration and asymmetrical fabrication method in this paper, other kinds of multipass matrix system coupled with different sources and detector systems also can be achieved.

CO2 in solid para-hydrogen: spectral splitting and the CO2···(o-H2)n clusters.

PubMed

Du, Jun-He; Wan, Lei; Wu, Lei; Xu, Gang; Deng, Wen-Ping; Liu, An-Wen; Chen, Yang; Hu, Shui-Ming

2011-02-17

Complicated high-resolution spectral structures are often observed for molecules doped in solid molecular hydrogen. The structures can result from miscellaneous effects and are often interpreted differently in references. The spectrum of the ν(3) band of CO(2) in solid para-H(2) presents a model system which exhibits rich spectral structures. With the help of the potential energy simulation of the CO(2) molecule doped in para-hydrogen matrix, and extensive experiments with different CO(2) isotopologues and different ortho-hydrogen concentrations in the matrix, the spectral features observed in p-H(2) matrix are assigned to the CO(2)···(o-H(2))(n) clusters and also to energy level splitting that is due to different alignments of the doped CO(2) molecules in the matrix. The assignments are further supported by the dynamics analysis and also by the spectrum recorded with sample codoped with O(2) which serves as catalyst transferring o-H(2) to p-H(2) in the matrix at 4 K temperature. The observed spectral features of CO(2)/pH(2) can potentially be used as an alternative readout of the temperature and orthohydrogen concentration in the solid para-hydrogen.

Thermo- and pH-responsive polymer brushes-grafted gigaporous polystyrene microspheres as a high-speed protein chromatography matrix.

PubMed

Qu, Jian-Bo; Xu, Yu-Liang; Liu, Jun-Yi; Zeng, Jing-Bin; Chen, Yan-Li; Zhou, Wei-Qing; Liu, Jian-Guo

2016-04-08

Dual thermo- and pH-responsive chromatography has been proposed using poly(N-isopropylacrylamide-co-butyl methacrylate-co-N,N-dimethylaminopropyl acrylamide) (P(NIPAM-co-BMA-co-DMAPAAM)) brushes grafted gigaporous polystyrene microspheres (GPM) as matrix. Atom transfer radical polymerization (ATRP) initiator was first coupled onto GPM through Friedel-Crafts acylation with 2-bromoisobutyryl bromide. The dual-responsive polymer brushes were then grafted onto GPM via surface-initiated ATRP. The surface composition, gigaporous structure, protein adsorption and dual-responsive chromatographic properties of the matrix (GPM-P(NIPAM-co-BMA-co-DMAPAAM) were characterized in detail. Results showed that GPM were successfully grafted with thermoresponsive cationic polymer brushes and that the gigaporous structure was well maintained. A column packed with GPM-P(NIPAM-co-BMA-co-DMAPAAM presented low backpressure, good permeability and appreciable thermo-responsibility. By changing pH of the mobile phase and temperature of the column in turn, the column can separate three model proteins at the mobile phase velocity up to 2528cmh(-1). A separation mechanism of this matrix was also proposed. All results indicate that the dual thermo- and pH-responsive chromatography matrix has great potentials in 'green' high-speed protein chromatography. Copyright © 2016 Elsevier B.V. All rights reserved.

Effect of friction on electron transfer: The two reaction coordinate case

NASA Astrophysics Data System (ADS)

Onuchic, José Nelson

1987-04-01

Electron transfer is a very important reaction in many biological processes such as photosynthesis and oxidative phosphorylation. In many of these reactions, most of the interesting dynamics can be included by using two reaction coordinates: one fast (local high frequency vibration modes) and one slow (outersphere modes such as solvent polarization). We report a model to describe this problem, which uses path integral techniques to calculate electron transfer rates, and also to obtain the Fokker-Planck equations associated with this model. Different limiting cases lead to qualitatively different results such as exponential or nonexponential time decay for the donor survival probability. Conditions for the validity of the adiabatic or the nonadiabatic limits will be discussed. Application of this model to real systems is proposed, in particular for a porphyrin rigidly linked to a quinone, which is a very interesting model compound for primary events of photosynthesis. This model can also be used for other multicoordinate biological reactions such as ligand binding to heme proteins. Also, in the concluding part of Sec. III, we discuss the important limit where the fast vibronic mode is much faster than all the other nuclear modes coupled to the problem. In this limit the fast mode ``renormalizes'' the electronic matrix element, and this considerably simplifies the treatment of the problem, reducing it to coupling only to the slow modes.

On determinant representations of scalar products and form factors in the SoV approach: the XXX case

NASA Astrophysics Data System (ADS)

Kitanine, N.; Maillet, J. M.; Niccoli, G.; Terras, V.

2016-03-01

In the present article we study the form factors of quantum integrable lattice models solvable by the separation of variables (SoVs) method. It was recently shown that these models admit universal determinant representations for the scalar products of the so-called separate states (a class which includes in particular all the eigenstates of the transfer matrix). These results permit to obtain simple expressions for the matrix elements of local operators (form factors). However, these representations have been obtained up to now only for the completely inhomogeneous versions of the lattice models considered. In this article we give a simple algebraic procedure to rewrite the scalar products (and hence the form factors) for the SoV related models as Izergin or Slavnov type determinants. This new form leads to simple expressions for the form factors in the homogeneous and thermodynamic limits. To make the presentation of our method clear, we have chosen to explain it first for the simple case of the XXX Heisenberg chain with anti-periodic boundary conditions. We would nevertheless like to stress that the approach presented in this article applies as well to a wide range of models solved in the SoV framework.

Wave propagation through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces.

PubMed

Jiao, Fengyu; Wei, Peijun; Li, Yueqiu

2018-01-01

Reflection and transmission of plane waves through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces are studied in this paper. The secular equations in the flexoelectric piezoelectric material are first derived from the general governing equation. Different from the classical piezoelectric medium, there are five kinds of coupled elastic waves in the piezoelectric material with the microstructure effects taken into consideration. The state vectors are obtained by the summation of contributions from all possible partial waves. The state transfer equation of flexoelectric piezoelectric slab is derived from the motion equation by the reduction of order, and the transfer matrix of flexoelectric piezoelectric slab is obtained by solving the state transfer equation. By using the continuous conditions at the interface and the approach of partition matrix, we get the resultant algebraic equations in term of the transfer matrix from which the reflection and transmission coefficients can be calculated. The amplitude ratios and further the energy flux ratios of various waves are evaluated numerically. The numerical results are shown graphically and are validated by the energy conservation law. Based on these numerical results, the influences of two characteristic lengths of microstructure and the flexoelectric coefficients on the wave propagation are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

A dental vision system for accurate 3D tooth modeling.

PubMed

Zhang, Li; Alemzadeh, K

2006-01-01

This paper describes an active vision system based reverse engineering approach to extract the three-dimensional (3D) geometric information from dental teeth and transfer this information into Computer-Aided Design/Computer-Aided Manufacture (CAD/CAM) systems to improve the accuracy of 3D teeth models and at the same time improve the quality of the construction units to help patient care. The vision system involves the development of a dental vision rig, edge detection, boundary tracing and fast & accurate 3D modeling from a sequence of sliced silhouettes of physical models. The rig is designed using engineering design methods such as a concept selection matrix and weighted objectives evaluation chart. Reconstruction results and accuracy evaluation are presented on digitizing different teeth models.

Matrix operator theory of radiative transfer. 1: rayleigh scattering.

PubMed

Plass, G N; Kattawar, G W; Catchings, F E

1973-02-01

An entirely rigorous method for the solution of the equations for radiative transfer based on the matrix operator theory is reviewed. The advantages of the present method are: (1) all orders of the reflection and transmission matrices are calculated at once; (2) layers of any thickness may be combined, so that a realistic model of the atmosphere can be developed from any arbitrary number of layers, each with different properties and thicknesses; (3) calculations can readily be made for large optical depths and with highly anisotropic phase functions; (4) results are obtained for any desired value of the surface albedo including the value unity and for a large number of polar and azimuthal angles including the polar angle theta = 0 degrees ; (5) all fundamental equations can be interpreted immediately in terms of the physical interactions appropriate to the problem; (6) both upward and downward radiance can be calculated at interior points from relatively simple expressions. Both the general theory and its history together with the method of calculation are discussed. As a first example of the method numerous curves are given for both the reflected and transmitted radiance for Rayleigh scattering from a homogeneous layer for a range of optical thicknesses from 0.0019 to 4096, surface albedo A = 0, 0.2, and 1, and cosine of solar zenith angle micro = 1, 0.5397, and 0.1882. It is shown that the matrix operator approach contains the doubling method as a special case.

Efficient computer algebra algorithms for polynomial matrices in control design

NASA Technical Reports Server (NTRS)

Baras, J. S.; Macenany, D. C.; Munach, R.

1989-01-01

The theory of polynomial matrices plays a key role in the design and analysis of multi-input multi-output control and communications systems using frequency domain methods. Examples include coprime factorizations of transfer functions, cannonical realizations from matrix fraction descriptions, and the transfer function design of feedback compensators. Typically, such problems abstract in a natural way to the need to solve systems of Diophantine equations or systems of linear equations over polynomials. These and other problems involving polynomial matrices can in turn be reduced to polynomial matrix triangularization procedures, a result which is not surprising given the importance of matrix triangularization techniques in numerical linear algebra. Matrices with entries from a field and Gaussian elimination play a fundamental role in understanding the triangularization process. In the case of polynomial matrices, matrices with entries from a ring for which Gaussian elimination is not defined and triangularization is accomplished by what is quite properly called Euclidean elimination. Unfortunately, the numerical stability and sensitivity issues which accompany floating point approaches to Euclidean elimination are not very well understood. New algorithms are presented which circumvent entirely such numerical issues through the use of exact, symbolic methods in computer algebra. The use of such error-free algorithms guarantees that the results are accurate to within the precision of the model data--the best that can be hoped for. Care must be taken in the design of such algorithms due to the phenomenon of intermediate expressions swell.

Coupled bending-torsion steady-state response of pretwisted, nonuniform rotating beams using a transfer-matrix method

NASA Technical Reports Server (NTRS)

Gray, Carl E., Jr.

1988-01-01

Using the Newtonian method, the equations of motion are developed for the coupled bending-torsion steady-state response of beams rotating at constant angular velocity in a fixed plane. The resulting equations are valid to first order strain-displacement relationships for a long beam with all other nonlinear terms retained. In addition, the equations are valid for beams with the mass centroidal axis offset (eccentric) from the elastic axis, nonuniform mass and section properties, and variable twist. The solution of these coupled, nonlinear, nonhomogeneous, differential equations is obtained by modifying a Hunter linear second-order transfer-matrix solution procedure to solve the nonlinear differential equations and programming the solution for a desk-top personal computer. The modified transfer-matrix method was verified by comparing the solution for a rotating beam with a geometric, nonlinear, finite-element computer code solution; and for a simple rotating beam problem, the modified method demonstrated a significant advantage over the finite-element solution in accuracy, ease of solution, and actual computer processing time required to effect a solution.

A mixture approach to the acoustic properties of a macroscopically inhomogeneous porous aluminum in the equivalent fluid approximation.

PubMed

Sacristan, C J; Dupont, T; Sicot, O; Leclaire, P; Verdière, K; Panneton, R; Gong, X L

2016-10-01

The acoustic properties of an air-saturated macroscopically inhomogeneous aluminum foam in the equivalent fluid approximation are studied. A reference sample built by forcing a highly compressible melamine foam with conical shape inside a constant diameter rigid tube is studied first. In this process, a radial compression varying with depth is applied. With the help of an assumption on the compressed pore geometry, properties of the reference sample can be modelled everywhere in the thickness and it is possible to use the classical transfer matrix method as theoretical reference. In the mixture approach, the material is viewed as a mixture of two known materials placed in a patchwork configuration and with proportions of each varying with depth. The properties are derived from the use of a mixing law. For the reference sample, the classical transfer matrix method is used to validate the experimental results. These results are used to validate the mixture approach. The mixture approach is then used to characterize a porous aluminium for which only the properties of the external faces are known. A porosity profile is needed and is obtained from the simulated annealing optimization process.

Resonance Phenomena in Goupillaud-type Media

DTIC Science & Technology

2010-10-01

time-harmonic forcing function at one end, with the other end fixed. Analytical stress solutions are derived from a global system of recursion...relationships using z-transform methods, where the determinant of the resulting global system matrix |Am| in the z-space is a palindromic polynomial with real...media (35). The present treatment uses a global matrix method that is attributed to Knopoff (36), rather than the Thomsen-Haskell transfer matrix

Headspace versus direct immersion solid phase microextraction in complex matrixes: investigation of analyte behavior in multicomponent mixtures.

PubMed

Gionfriddo, Emanuela; Souza-Silva, Érica A; Pawliszyn, Janusz

2015-08-18

This work aims to investigate the behavior of analytes in complex mixtures and matrixes with the use of solid-phase microextraction (SPME). Various factors that influence analyte uptake such as coating chemistry, extraction mode, the physicochemical properties of analytes, and matrix complexity were considered. At first, an aqueous system containing analytes bearing different hydrophobicities, molecular weights, and chemical functionalities was investigated by using commercially available liquid and solid porous coatings. The differences in the mass transfer mechanisms resulted in a more pronounced occurrence of coating saturation in headspace mode. Contrariwise, direct immersion extraction minimizes the occurrence of artifacts related to coating saturation and provides enhanced extraction of polar compounds. In addition, matrix-compatible PDMS-modified solid coatings, characterized by a new morphology that avoids coating fouling, were compared to their nonmodified analogues. The obtained results indicate that PDMS-modified coatings reduce artifacts associated with coating saturation, even in headspace mode. This factor, coupled to their matrix compatibility, make the use of direct SPME very practical as a quantification approach and the best choice for metabolomics studies where wide coverage is intended. To further understand the influence on analyte uptake on a system where additional interactions occur due to matrix components, ex vivo and in vivo sampling conditions were simulated using a starch matrix model, with the aim of mimicking plant-derived materials. Our results corroborate the fact that matrix handling can affect analyte/matrix equilibria, with consequent release of high concentrations of previously bound hydrophobic compounds, potentially leading to coating saturation. Direct immersion SPME limited the occurrence of the artifacts, which confirms the suitability of SPME for in vivo applications. These findings shed light into the implementation of in vivo SPME strategies in quantitative metabolomics studies of complex plant-based systems.

An ambiguity of information content and error in an ill-posed satellite inversion

NASA Astrophysics Data System (ADS)

Koner, Prabhat

According to Rodgers (2000, stochastic approach), the averaging kernel (AK) is the representational matrix to understand the information content in a scholastic inversion. On the other hand, in deterministic approach this is referred to as model resolution matrix (MRM, Menke 1989). The analysis of AK/MRM can only give some understanding of how much regularization is imposed on the inverse problem. The trace of the AK/MRM matrix, which is the so-called degree of freedom from signal (DFS; stochastic) or degree of freedom in retrieval (DFR; deterministic). There are no physical/mathematical explanations in the literature: why the trace of the matrix is a valid form to calculate this quantity? We will present an ambiguity between information and error using a real life problem of SST retrieval from GOES13. The stochastic information content calculation is based on the linear assumption. The validity of such mathematics in satellite inversion will be questioned because it is based on the nonlinear radiative transfer and ill-conditioned inverse problems. References: Menke, W., 1989: Geophysical data analysis: discrete inverse theory. San Diego academic press. Rodgers, C.D., 2000: Inverse methods for atmospheric soundings: theory and practice. Singapore :World Scientific.

Theory and experimental results of transfer-NOE experiments. 1. The influence of the off rate versus cross-relaxation rates

NASA Astrophysics Data System (ADS)

Lippens, R. M.; Cerf, C.; Hallenga, K.

The theory of the transferred nuclear Overhauser effect is presented in the framework of an extended relaxation matrix representation. This matrix representation allows a coherent description of all one- and two-dimensional experiments. We present analytical solutions for the buildup of magnetization in the 2D transfer-NOE experiment, for all ratios of the off rate k to the cross-relaxation rates R involved. We show that systematic deviations in distance determination occur when the off rate becomes comparable to or smaller than the relaxation rates. Experimental results on the peptide/protein system oxytocin/neurophysin confirming this analysis are presented. The importance of residual mobility in the bound ligand, as demonstrated by the experimental data, is also discussed.

Betatron motion with coupling of horizontal and vertical degrees of freedom

DOE Office of Scientific and Technical Information (OSTI.GOV)

S. A. Bogacz; V. A. Lebedev

2002-11-21

The Courant-Snyder parameterization of one-dimensional linear betatron motion is generalized to two-dimensional coupled linear motion. To represent the 4 x 4 symplectic transfer matrix the following ten parameters were chosen: four beta-functions, four alpha-functions and two betatron phase advances which have a meaning similar to the Courant-Snyder parameterization. Such a parameterization works equally well for weak and strong coupling and can be useful for analysis of coupled betatron motion in circular accelerators as well as in transfer lines. Similarly, the transfer matrix, the bilinear form describing the phase space ellipsoid and the second order moments are related to the eigen-vectors.more » Corresponding equations can be useful in interpreting tracking results and experimental data.« less

LANDSAT-D investigations in snow hydrology

NASA Technical Reports Server (NTRS)

Dozier, J.

1983-01-01

Progress on the registration of TM data to digital topographic data; on comparison of TM, MSS and NOAA meteorological satellite data for snowcover mapping; and on radiative transfer models for atmospheric correction is reported. Some methods for analyzing spatial contiguity of snow within the snow covered area were selected. The methods are based on a two-channel version of the grey level co-occurence matrix, combined with edge detection derived from an algorithm for computing slopes and exposures from digital terrain data.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suhendi, Endi; Syariati, Rifki; Noor, Fatimah A.

We modeled a tunneling current in a p-n junction based on armchair graphene nanoribbons (AGNRs) by using an Airy function approach (AFA) and a transfer matrix method (TMM). We used β-type AGNRs, in which its band gap energy and electron effective mass depends on its width as given by the extended Huckel theory. It was shown that the tunneling currents evaluated by employing the AFA are the same as those obtained under the TMM. Moreover, the calculated tunneling current was proportional to the voltage bias and inversely with temperature.

Tunable overlapping long-period fiber grating and its bending vector sensing application

NASA Astrophysics Data System (ADS)

Hu, Wei; Zhang, Weigang; Chen, Lei; Wang, Song; Zhang, Yunshan; Zhang, Yanxin; Kong, Lingxin; Yu, Lin; Yan, Tieyi; Li, Yanping

2018-03-01

A novel overlapping long-period fiber grating (OLPFG) is proposed and experimentally demonstrated in this paper. The OLPFG is composed of two partially overlapping long-period fiber gratings (LPFG). Based on the coupled model theory and transfer matrix method, it is found that the phase shift LPFG and LPFGs interference are two special situations of the proposed OLPFG. Moreover, the confirmation experiments verified that the proposed OLPFG has a high bending sensitivity in opposite directions, and the temperature crosstalk can be compensated spontaneously.

Numerical Modeling of Fiber-Reinforced Metal Matrix Composite Processing by the Liquid Route: Literature Contribution

NASA Astrophysics Data System (ADS)

Lacoste, Eric; Arvieu, Corinne; Mantaux, Olivier

2018-04-01

One of the technologies used to produce metal matrix composites (MMCs) is liquid route processing. One solution is to inject a liquid metal under pressure or at constant rate through a fibrous preform. This foundry technique overcomes the problem of the wettability of ceramic fibers by liquid metal. The liquid route can also be used to produce semiproducts by coating a filament with a molten metal. These processes involve physical phenomena combined with mass and heat transfer and phase change. The phase change phenomena related to solidification and also to the melting of the metal during the process notably result in modifications to the permeability of porous media, in gaps in impregnation, in the appearance of defects (porosities), and in segregation in the final product. In this article, we provide a state-of-the-art review of numerical models and simulation developed to study these physical phenomena involved in MMC processing by the liquid route.

Preserving Simplecticity in the Numerical Integration of Linear Beam Optics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Christopher K.

2017-07-01

Presented are mathematical tools and methods for the development of numerical integration techniques that preserve the symplectic condition inherent to mechanics. The intended audience is for beam physicists with backgrounds in numerical modeling and simulation with particular attention to beam optics applications. The paper focuses on Lie methods that are inherently symplectic regardless of the integration accuracy order. Section 2 provides the mathematically tools used in the sequel and necessary for the reader to extend the covered techniques. Section 3 places those tools in the context of charged-particle beam optics; in particular linear beam optics is presented in terms ofmore » a Lie algebraic matrix representation. Section 4 presents numerical stepping techniques with particular emphasis on a third-order leapfrog method. Section 5 discusses the modeling of field imperfections with particular attention to the fringe fields of quadrupole focusing magnets. The direct computation of a third order transfer matrix for a fringe field is shown.« less

Quantum spin liquid signatures in Kitaev-like frustrated magnets

NASA Astrophysics Data System (ADS)

Gohlke, Matthias; Wachtel, Gideon; Yamaji, Youhei; Pollmann, Frank; Kim, Yong Baek

2018-02-01

Motivated by recent experiments on α -RuCl3 , we investigate a possible quantum spin liquid ground state of the honeycomb-lattice spin model with bond-dependent interactions. We consider the K -Γ model, where K and Γ represent the Kitaev and symmetric-anisotropic interactions between spin-1/2 moments on the honeycomb lattice. Using the infinite density matrix renormalization group, we provide compelling evidence for the existence of quantum spin liquid phases in an extended region of the phase diagram. In particular, we use transfer-matrix spectra to show the evolution of two-particle excitations with well-defined two-dimensional dispersion, which is a strong signature of a quantum spin liquid. These results are compared with predictions from Majorana mean-field theory and used to infer the quasiparticle excitation spectra. Further, we compute the dynamical structure factor using finite-size cluster computations and show that the results resemble the scattering continuum seen in neutron-scattering experiments on α -RuCl3 . We discuss these results in light of recent and future experiments.

Intrasystem Analysis Program (IAP) code summaries

NASA Astrophysics Data System (ADS)

Dobmeier, J. J.; Drozd, A. L. S.; Surace, J. A.

1983-05-01

This report contains detailed descriptions and capabilities of the codes that comprise the Intrasystem Analysis Program. The four codes are: Intrasystem Electromagnetic Compatibility Analysis Program (IEMCAP), General Electromagnetic Model for the Analysis of Complex Systems (GEMACS), Nonlinear Circuit Analysis Program (NCAP), and Wire Coupling Prediction Models (WIRE). IEMCAP is used for computer-aided evaluation of electromagnetic compatibility (ECM) at all stages of an Air Force system's life cycle, applicable to aircraft, space/missile, and ground-based systems. GEMACS utilizes a Method of Moments (MOM) formalism with the Electric Field Integral Equation (EFIE) for the solution of electromagnetic radiation and scattering problems. The code employs both full matrix decomposition and Banded Matrix Iteration solution techniques and is expressly designed for large problems. NCAP is a circuit analysis code which uses the Volterra approach to solve for the transfer functions and node voltage of weakly nonlinear circuits. The Wire Programs deal with the Application of Multiconductor Transmission Line Theory to the Prediction of Cable Coupling for specific classes of problems.

Inverse estimation of the elastic and anelastic properties of the porous frame of anisotropic open-cell foams.

PubMed

Cuenca, Jacques; Göransson, Peter

2012-08-01

This paper presents a method for simultaneously identifying both the elastic and anelastic properties of the porous frame of anisotropic open-cell foams. The approach is based on an inverse estimation procedure of the complex stiffness matrix of the frame by performing a model fit of a set of transfer functions of a sample of material subjected to compression excitation in vacuo. The material elastic properties are assumed to have orthotropic symmetry and the anelastic properties are described using a fractional-derivative model within the framework of an augmented Hooke's law. The inverse estimation problem is formulated as a numerical optimization procedure and solved using the globally convergent method of moving asymptotes. To show the feasibility of the approach a numerically generated target material is used here as a benchmark. It is shown that the method provides the full frequency-dependent orthotropic complex stiffness matrix within a reasonable degree of accuracy.

Carbon Dots and 9AA as a Binary Matrix for the Detection of Small Molecules by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Chen, Yongli; Gao, Dan; Bai, Hangrui; Liu, Hongxia; Lin, Shuo; Jiang, Yuyang

2016-07-01

Application of matrix-assisted laser-desorption/ionization mass spectrometry (MALDI MS) to analyze small molecules have some limitations, due to the inhomogeneous analyte/matrix co-crystallization and interference of matrix-related peaks in low m/z region. In this work, carbon dots (CDs) were for the first time applied as a binary matrix with 9-Aminoacridine (9AA) in MALDI MS for small molecules analysis. By 9AA/CDs assisted desorption/ionization (D/I) process, a wide range of small molecules, including nucleosides, amino acids, oligosaccharides, peptides, and anticancer drugs with a higher sensitivity were demonstrated in the positive ion mode. A detection limit down to 5 fmol was achieved for cytidine. 9AA/CDs matrix also exhibited excellent reproducibility compared with 9AA matrix. Moreover, by exploring the ionization mechanism of the matrix, the influence factors might be attributed to the four parts: (1) the strong UV absorption of 9AA/CDs due to their π-conjugated network; (2) the carboxyl groups modified on the CDs surface act as protonation sites for proton transfer in positive ion mode; (3) the thin layer crystal of 9AA/CDs could reach a high surface temperature more easily and lower transfer energy for LDI MS; (4) CDs could serve as a matrix additive to suppress 9AA ionization. Furthermore, this matrix was allowed for the analysis of glucose as well as nucleosides in human urine, and the level of cytidine was quantified with a linear range of 0.05-5 mM (R2 > 0.99). Therefore, the 9AA/CDs matrix was proven to be an effective MALDI matrix for the analysis of small molecules with improved sensitivity and reproducibility. This work provides an alternative solution for small molecules detection that can be further used in complex samples analysis.

One-dimensional pressure transfer models for acoustic-electric transmission channels

NASA Astrophysics Data System (ADS)

Wilt, K. R.; Lawry, T. J.; Scarton, H. A.; Saulnier, G. J.

2015-09-01

A method for modeling piezoelectric-based ultrasonic acoustic-electric power and data transmission channels is presented. These channels employ piezoelectric disk transducers to convey signals across a series of physical layers using ultrasonic waves. This model decomposes the mechanical pathway of the signal into individual ultrasonic propagation layers which are generally independent of the layer's adjacent domains. Each layer is represented by a two-by-two traveling pressure wave transfer matrix which relates the forward and reverse pressure waves on one side of the layer to the pressure waves on the opposite face, where each face is assumed to be in contact with a domain of arbitrary reference acoustic impedance. A rigorous implementation of ultrasonic beam spreading is introduced and implemented within applicable domains. Compatible pressure-wave models for piezoelectric transducers are given, which relate the electric voltage and current interface of the transducer to the pressure waves on one mechanical interface while also allowing for passive acoustic loading of the secondary mechanical interface. It is also shown that the piezoelectric model's electrical interface is compatible with transmission line parameters (ABCD-parameters), allowing for connection of electronic components and networks. The model is shown to be capable of reproducing the behavior of realistic physical channels.

Analysis and measurement of the transfer matrix of a 9-cell, 1.3-GHz superconducting cavity

DOE PAGES

Halavanau, A.; Eddy, N.; Edstrom, D.; ...

2017-04-13

Superconducting linacs are capable of producing intense, stable, high-quality electron beams that have found widespread applications in science and industry. Here, the 9-cell, 1.3-GHz superconducting standing-wave accelerating rf cavity originally developed for e +/e - linear-collider applications has been broadly employed in various superconducting-linac designs. In this paper we discuss the transfer matrix of such a cavity and present its measurement performed at the Fermilab Accelerator Science and Technology (FAST) facility. Finally, the experimental results are found to be in agreement with analytical calculations and numerical simulations.

Optical Linear Algebra for Computational Light Transport

NASA Astrophysics Data System (ADS)

O'Toole, Matthew

Active illumination refers to optical techniques that use controllable lights and cameras to analyze the way light propagates through the world. These techniques confer many unique imaging capabilities (e.g. high-precision 3D scanning, image-based relighting, imaging through scattering media), but at a significant cost; they often require long acquisition and processing times, rely on predictive models for light transport, and cease to function when exposed to bright ambient sunlight. We develop a mathematical framework for describing and analyzing such imaging techniques. This framework is deeply rooted in numerical linear algebra, and models the transfer of radiant energy through an unknown environment with the so-called light transport matrix. Performing active illumination on a scene equates to applying a numerical operator on this unknown matrix. The brute-force approach to active illumination follows a two-step procedure: (1) optically measure the light transport matrix and (2) evaluate the matrix operator numerically. This approach is infeasible in general, because the light transport matrix is often much too large to measure, store, and analyze directly. Using principles from optical linear algebra, we evaluate these matrix operators in the optical domain, without ever measuring the light transport matrix in the first place. Specifically, we explore numerical algorithms that can be implemented partially or fully with programmable optics. These optical algorithms provide solutions to many longstanding problems in computer vision and graphics, including the ability to (1) photo-realistically change the illumination conditions of a given photo with only a handful of measurements, (2) accurately capture the 3D shape of objects in the presence of complex transport properties and strong ambient illumination, and (3) overcome the multipath interference problem associated with time-of-flight cameras. Most importantly, we introduce an all-new imaging regime---optical probing---that provides unprecedented control over which light paths contribute to a photo.

Dehydration reactions, mass transfer and rock deformation relationships during subduction of Alpine metabauxites: insights from LIBS compositional profiles between metamorphic veins

NASA Astrophysics Data System (ADS)

Verlaguet, Anne; Brunet, Fabrice; Goffé, Bruno; Menut, Denis; Findling, Nathaniel; Poinssot, Christophe

2013-04-01

In subduction zones, the significant amounts of aqueous fluid released in the course of the successive dehydration reactions occurring during prograde metamorphism are expected to strongly influence the rock rheology, as well as kinetics of metamorphic reactions and mass transfer efficiency. Mineralized veins, ubiquitous in metamorphic rocks, can be seen as preserved witnesses of fluid and mass redistribution that partly accommodate the rock deformation (lateral segregation). However, the driving forces and mechanisms of mass transfer towards fluid-filled open spaces remain somewhat unclear. The aim of this study is to investigate the vein-forming processes and the modalities of mass transfer during local fluid-rock interactions, and their links with fluid production and rock deformation, with new insights from Laser Induced Breakdown Spectroscopy (LIBS) profiles. This study focuses on karstic pockets (metre scale) of Triassic metabauxites embedded in thick carbonate units, that have been isolated from large-scale fluid flow during HP-LT Alpine metamorphism (W. Vanoise, French Alps). These rocks display several generations of metamorphic veins containing various Al-bearing minerals, which give particular insights into mass transfer processes. It is proposed that the internally-derived fluid (~13 vol% produced by successive dehydration reactions) has promoted the opening of fluid-filled open spaces (euhedral habits of vein minerals) and served as medium for diffusive mass transfer from rock to vein. Based on mineralogical and textural features, two vein types can be distinguished: (1) some veins are filled with newly formed products of either prograde (chloritoid) or retrograde (chlorite) metamorphic reactions; in this case, fluid-filled open spaces seem to offer energetically favourable nucleation/growth sites; (2) the second vein type is filled with cookeite (Li-Al-rich chlorite) or pyrophyllite, that were present in the host rock prior to the vein formation. In this closed chemical system, mass transfer from rock to vein was achieved through the fluid, in a dissolution-transport-precipitation process, possibly stress-assisted. To investigate the modalities of mass transfer towards this second vein type, LIBS profiles were performed in the rock matrix, taking Li concentration as a proxy for cookeite distribution. Cookeite is highly concentrated (40-70 vol%) in regularly spaced veins, and the LIBS profiles show that cookeite is evenly distributed in the rock matrix comprised between two veins. The absence of diffusion profiles suggests that the characteristic diffusion length for Li, Al and Si is greater than or equal to the distance separating two cookeite veins (3-6 cm). This is in agreement with characteristic diffusion lengths calculated from both grain boundary and pore fluid diffusion coefficients, for the estimated duration of the peak of metamorphism. Concerning mass transfer driving forces, phyllosilicates have very different morphologies in the rock matrix (fibers) compared to veins (euhedral crystals): fluid-mineral interfacial energy may be maximal in the small matrix pores, which can maintain higher cookeite solubility than in fluid-filled open spaces. Therefore, as soon as veins open, chemical potential gradients may develop and drive cookeite transfer from rock matrix to veins.

The Role of Initial Learning, Problem Features, Prior Knowledge, and Pattern Recognition on Transfer Success

ERIC Educational Resources Information Center

Dinsmore, Daniel L.; Baggetta, Peter; Doyle, Stephanie; Loughlin, Sandra M.

2014-01-01

The purpose of this study was to demonstrate that transfer ability (positive and negative) varies depending on the nature of the problems, using the knowledge transfer matrix, as well as being dependent on the individual differences of the learner. A total of 178 participants from the United States and New Zealand completed measures of prior…

Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules

NASA Astrophysics Data System (ADS)

Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.

1997-07-01

Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.

Methods for heat transfer and temperature field analysis of the insulated diesel phase 2 progress report

NASA Technical Reports Server (NTRS)

Morel, T.; Kerlbar, R.; Fort, E. F.; Blumberg, P. N.

1985-01-01

This report describes work done during Phase 2 of a 3 year program aimed at developing a comprehensive heat transfer and thermal analysis methodology for design analysis of insulated diesel engines. The overall program addresses all the key heat transfer issues: (1) spatially and time-resolved convective and radiative in-cylinder heat transfer, (2) steady-state conduction in the overall structure, and (3) cyclical and load/speed temperature transients in the engine structure. During Phase 2, radiation heat transfer model was developed, which accounts for soot formation and burn up. A methodology was developed for carrying out the multi-dimensional finite-element heat conduction calculations within the framework of thermodynamic cycle codes. Studies were carried out using the integrated methodology to address key issues in low heat rejection engines. A wide ranging design analysis matrix was covered, including a variety of insulation strategies, recovery devices and base engine configurations. A single cylinder Cummins engine was installed at Purdue University, and it was brought to a full operational status. The development of instrumentation was continued, concentrating on radiation heat flux detector, total heat flux probe, and accurate pressure-crank angle data acquisition.

A novel mesoporous silica nanosphere matrix for the immobilization of proteins and their applications as electrochemical biosensor.

PubMed

Li, Juan; Qin, Xingzhang; Yang, Zhanjun; Qi, Huamei; Xu, Qin; Diao, Guowang

2013-01-30

A mesoporous silica nanoshpere (MSN) was proposed to modify glassy carbon electrode (GCE) for the immobilization of protein. Using glucose oxidase (GOD) as a model, direct electrochemistry of protein and biosensing at the MSN modified GCE was studied for the first time. The MNS had large surface area and offered a favorable microenvironment for facilitating the direct electron transfer between enzyme and electrode surface. Scanning electron microscopy, transmission electron microscopy, UV-vis spectroscopy and cyclic voltammetry were used to examine the interaction between GOD and the MSN matrix. The results demonstrated that the immobilized enzyme on the MSN retained its native structure and bioactivity. In addition, the electrochemical reaction showed a surface controlled, reversible two-proton and two-electron transfer process with the apparent electron transfer rate constant of 3.96 s(-1). The MNS-based glucose biosensor exhibited the two linear ranges of 0.04-2.0 mM and 2.0-4.8 mM, a high sensitivity of 14.5 mA M(-1) cm(-2) and a low detection limit of 0.02 mM at signal-to-noise of 3. The proposed biosensor showed excellent selectivity, good reproducibility, acceptable stability and could be successfully applied in the reagentless detection of glucose in real samples at -0.45 V. The work displayed that mesoporous silica nanosphere provided a promising approach for immobilizing proteins and fabrication of excellent biosensors. Copyright © 2012 Elsevier B.V. All rights reserved.

Matrix Organizational Structure and Its Effects Upon Education Organizations.

ERIC Educational Resources Information Center

Yates, James R.

Applying matrix organizational structure to the organization of special education services is the focus of this paper. Beginning with a list of ways in which educational organizations differ from business or military organizations, the author warns that educators must be cautious when transferring organizational structures from other disciplines…

Societal and economic valuation of technology-transfer deals

NASA Astrophysics Data System (ADS)

Holmes, Joseph S., Jr.

2009-09-01

The industrial adoption of concepts such as open innovation brings new legitimacy to activities technology-transfer professionals have conducted for over 20 years. This movement highlights the need for an increased understanding of the valuation of intellectual property (IP) and technology-transfer deals. Valuation, though a centerpiece of corporate finance, is more challenging when applied to the inherent uncertainty surrounding innovation. Technology-transfer professionals are often overwhelmed by the complexity and data requirements of valuation techniques and skeptical of their applicability to and utility for technology transfer. The market longs for an approach which bridges the gap between valuation fundamentals and technology-transfer realities. This paper presents the foundations of a simple, flexible, precise/accurate, and useful framework for considering the valuation of technology-transfer deals. The approach is predicated on a 12-factor model—a 3×4 value matrix predicated on categories of economic, societal, and strategic value. Each of these three categories consists of three core subcategories followed by a fourth "other" category to facilitate inevitable special considerations. This 12-factor value matrix provides a framework for harvesting data during deals and for the application of best-of-breed valuation techniques which can be employed on a per-factor basis. Future work will include framework implementation within a database platform.

ZnO/Cu nanocomposite: a platform for direct electrochemistry of enzymes and biosensing applications.

PubMed

Yang, Chi; Xu, Chunxiang; Wang, Xuemei

2012-03-06

Unique structured nanomaterials can facilitate the direct electron transfer between redox proteins and the electrodes. Here, in situ directed growth on an electrode of a ZnO/Cu nanocomposite was prepared by a simple corrosion approach, which enables robust mechanical adhesion and electrical contact between the nanostructured ZnO and the electrodes. This is great help to realize the direct electron transfer between the electrode surface and the redox protein. SEM images demonstrate that the morphology of the ZnO/Cu nanocomposite has a large specific surface area, which is favorable to immobilize the biomolecules and construct biosensors. Using glucose oxidase (GOx) as a model, this ZnO/Cu nanocomposite is employed for immobilization of GOx and the construction of the glucose biosensor. Direct electron transfer of GOx is achieved at ZnO/Cu nanocomposite with a high heterogeneous electron transfer rate constant of 0.67 ± 0.06 s(-1). Such ZnO/Cu nanocomposite provides a good matrix for direct electrochemistry of enzymes and mediator-free enzymatic biosensors.

Simulation results for a multirate mass transfer modell for immiscible displacement of two fluids in highly heterogeneous porous media

NASA Astrophysics Data System (ADS)

Tecklenburg, Jan; Neuweiler, Insa; Dentz, Marco; Carrera, Jesus; Geiger, Sebastian

2013-04-01

Flow processes in geotechnical applications do often take place in highly heterogeneous porous media, such as fractured rock. Since, in this type of media, classical modelling approaches are problematic, flow and transport is often modelled using multi-continua approaches. From such approaches, multirate mass transfer models (mrmt) can be derived to describe the flow and transport in the "fast" or mobile zone of the medium. The porous media is then modeled with one mobile zone and multiple immobile zones, where the immobile zones are connected to the mobile zone by single rate mass transfer. We proceed from a mrmt model for immiscible displacement of two fluids, where the Buckley-Leverett equation is expanded by a sink-source-term which is nonlocal in time. This sink-source-term models exchange with an immobile zone with mass transfer driven by capillary diffusion. This nonlinear diffusive mass transfer can be approximated for particular imbibition or drainage cases by a linear process. We present a numerical scheme for this model together with simulation results for a single fracture test case. We solve the mrmt model with the finite volume method and explicit time integration. The sink-source-term is transformed to multiple single rate mass transfer processes, as shown by Carrera et. al. (1998), to make it local in time. With numerical simulations we studied immiscible displacement in a single fracture test case. To do this we calculated the flow parameters using information about the geometry and the integral solution for two phase flow by McWorther and Sunnada (1990). Comparision to the results of the full two dimensional two phase flow model by Flemisch et. al. (2011) show good similarities of the saturation breakthrough curves. Carrera, J., Sanchez-Vila, X., Benet, I., Medina, A., Galarza, G., and Guimera, J.: On matrix diffusion: formulations, solution methods and qualitative effects, Hydrogeology Journal, 6, 178-190, 1998. Flemisch, B., Darcis, M., Erbertseder, K., Faigle, B., Lauser, A. et al.: Dumux: Dune for multi-{Phase, Component, Scale, Physics, ...} flow and transport in porous media, Advances in Water Resources, 34, 1102-1112, 2011. McWhorter, D. B., and Sunada, D. K.: Exact integral solutions for two-phase flow, Water Resources Research, 26(3), 399-413, 1990.

Organic light-emitting diodes for lighting: High color quality by controlling energy transfer processes in host-guest-systems

NASA Astrophysics Data System (ADS)

Weichsel, Caroline; Reineke, Sebastian; Furno, Mauro; Lüssem, Björn; Leo, Karl

2012-02-01

Exciton generation and transfer processes in a multilayer organic light-emitting diode (OLED) are studied in order to realize OLEDs with warm white color coordinates and high color-rendering index (CRI). We investigate a host-guest-system containing four phosphorescent emitters and two matrix materials with different transport properties. We show, by time-resolved spectroscopy, that an energy back-transfer from the blue emitter to the matrix materials occurs, which can be used to transport excitons to the other emitter molecules. Furthermore, we investigate the excitonic and electronic transfer processes by designing suitable emission layer stacks. As a result, we obtain an OLED with Commission Internationale de lÉclairage (CIE) coordinates of (0.444;0.409), a CRI of 82, and a spectrum independent of the applied current. The OLED shows an external quantum efficiency of 10% and a luminous efficacy of 17.4 lm/W at 1000 cd/m2.

Sandwiched confinement of quantum dots in graphene matrix for efficient electron transfer and photocurrent production

PubMed Central

Zhu, Nan; Zheng, Kaibo; Karki, Khadga J.; Abdellah, Mohamed; Zhu, Qiushi; Carlson, Stefan; Haase, Dörthe; Žídek, Karel; Ulstrup, Jens; Canton, Sophie E.; Pullerits, Tõnu; Chi, Qijin

2015-01-01

Quantum dots (QDs) and graphene are both promising materials for the development of new-generation optoelectronic devices. Towards this end, synergic assembly of these two building blocks is a key step but remains a challenge. Here, we show a one-step strategy for organizing QDs in a graphene matrix via interfacial self-assembly, leading to the formation of sandwiched hybrid QD-graphene nanofilms. We have explored structural features, electron transfer kinetics and photocurrent generation capacity of such hybrid nanofilms using a wide variety of advanced techniques. Graphene nanosheets interlink QDs and significantly improve electronic coupling, resulting in fast electron transfer from photoexcited QDs to graphene with a rate constant of 1.3 × 109 s−1. Efficient electron transfer dramatically enhances photocurrent generation in a liquid-junction QD-sensitized solar cell where the hybrid nanofilm acts as a photoanode. We thereby demonstrate a cost-effective method to construct large-area QD-graphene hybrid nanofilms with straightforward scale-up potential for optoelectronic applications. PMID:25996307

Ultrafast energy transfer with competing channels: Non-equilibrium Förster and Modified Redfield theories

NASA Astrophysics Data System (ADS)

Seibt, Joachim; Mančal, Tomáš

2017-05-01

We derive equations of motion for the reduced density matrix of a molecular system which undergoes energy transfer dynamics competing with fast internal conversion channels. Environmental degrees of freedom of such a system have no time to relax to quasi-equilibrium in the electronic excited state of the donor molecule, and thus the conditions of validity of Förster and Modified Redfield theories in their standard formulations do not apply. We derive non-equilibrium versions of the two well-known rate theories and apply them to the case of carotenoid-chlorophyll energy transfer. Although our reduced density matrix approach does not account for the formation of vibronic excitons, it still confirms the important role of the donor ground-state vibrational states in establishing the resonance energy transfer conditions. We show that it is essential to work with a theory valid in a strong system-bath interaction regime to obtain correct dependence of the rates on donor-acceptor energy gap.

Sandwiched confinement of quantum dots in graphene matrix for efficient electron transfer and photocurrent production

NASA Astrophysics Data System (ADS)

Zhu, Nan; Zheng, Kaibo; Karki, Khadga J.; Abdellah, Mohamed; Zhu, Qiushi; Carlson, Stefan; Haase, Dörthe; Žídek, Karel; Ulstrup, Jens; Canton, Sophie E.; Pullerits, Tõnu; Chi, Qijin

2015-05-01

Quantum dots (QDs) and graphene are both promising materials for the development of new-generation optoelectronic devices. Towards this end, synergic assembly of these two building blocks is a key step but remains a challenge. Here, we show a one-step strategy for organizing QDs in a graphene matrix via interfacial self-assembly, leading to the formation of sandwiched hybrid QD-graphene nanofilms. We have explored structural features, electron transfer kinetics and photocurrent generation capacity of such hybrid nanofilms using a wide variety of advanced techniques. Graphene nanosheets interlink QDs and significantly improve electronic coupling, resulting in fast electron transfer from photoexcited QDs to graphene with a rate constant of 1.3 × 109 s-1. Efficient electron transfer dramatically enhances photocurrent generation in a liquid-junction QD-sensitized solar cell where the hybrid nanofilm acts as a photoanode. We thereby demonstrate a cost-effective method to construct large-area QD-graphene hybrid nanofilms with straightforward scale-up potential for optoelectronic applications.

Stress transfer of a Kevlar 49 fiber pullout test studied by micro-Raman spectroscopy.

PubMed

Lei, Zhenkun; Wang, Quan; Qiu, Wei

2013-06-01

The interfacial stress transfer behavior of a Kevlar 49 aramid fiber-epoxy matrix was studied with fiber pullout tests, the fibers of which were stretched by a homemade microloading device. Raman spectra on the embedded fiber were recorded by micro-Raman spectroscopy, under different strain levels. Then, the fiber axial stress was obtained by the relationship between the stress and Raman shift of the aramid fiber. Experimental results revealed that the fiber axial stress increased significantly with the load. The shear stress concentration occurred at the fiber entry to the epoxy resin. Thus, interfacial friction stages exist in the debonded fiber segment, and the interfacial friction shear stress is constant within one stage. The experimental results are consistent with the theoretical model predictions.

The influence of electric charge transferred during electro-mechanical reshaping on mechanical behavior of cartilage

NASA Astrophysics Data System (ADS)

Protsenko, Dimitry E.; Lim, Amanda; Wu, Edward C.; Manuel, Cyrus; Wong, Brian J. F.

2011-03-01

Electromechanical reshaping (EMR) of cartilage has been suggested as an alternative to the classical surgical techniques of modifying the shape of facial cartilages. The method is based on exposure of mechanically deformed cartilaginous tissue to a low level electric field. Electro-chemical reactions within the tissue lead to reduction of internal stress, and establishment of a new equilibrium shape. The same reactions offset the electric charge balance between collagen and proteoglycan matrix and interstitial fluid responsible for maintenance of cartilage mechanical properties. The objective of this study was to investigate correlation between the electric charge transferred during EMR and equilibrium elastic modulus. We used a finite element model based on the triphasic theory of cartilage mechanical properties to study how electric charges transferred in the electro-chemical reactions in cartilage can change its mechanical responses to step displacements in unconfined compression. The concentrations of the ions, the strain field and the fluid and ion velocities within the specimen subject to an applied mechanical deformation were estimated and apparent elastic modulus (the ratio of the equilibrium axial stress to the axial strain) was calculated as a function of transferred charge. The results from numerical calculations showed that the apparent elastic modulus decreases with increase in electric charge transfer. To compare numerical model with experimental observation we measured elastic modulus of cartilage as a function of electric charge transferred in electric circuit during EMR. Good correlation between experimental and theoretical data suggests that electric charge disbalance is responsible for alteration of cartilage mechanical properties.

Design of UV laser pulses for the preparation of matrix isolated homonuclear diatomic molecules in selective vibrational superposition states.

PubMed

Korolkov, M V; Manz, J

2007-05-07

The preparation of matrix isolated homonuclear diatomic molecules in a vibrational superposition state c0Phie=1,v=0+cjPhie=1,v=j, with large (|c0|2 approximately 1) plus small contributions (|cj|2<1) of the ground v=0 and specific v=j low excited vibrational eigenstates, respectively, in the electronic ground (e=1) state, and without any net population transfer to electronic excited (e>1) states, is an important challenge; it serves as a prerequisite for coherent spin control. For this purpose, the authors investigate two scenarios of laser pulse control, involving sequential or intrapulse pump- and dump-type transitions via excited vibronic states Phiex,k with a dominant singlet or triplet character. The mechanisms are demonstrated by means of quantum simulations for representative nuclear wave packets on coupled potential energy surfaces, using as an example a one-dimensional model for Cl2 in an Ar matrix. A simple three-state model (including Phi1,0, Phi1,j and Phiex,k) allows illuminating analyses and efficient determinations of the parameters of the laser pulses based on the values of the transition energies and dipole couplings of the transient state which are derived from the absorption spectra.

Algorithms for Efficient Computation of Transfer Functions for Large Order Flexible Systems

NASA Technical Reports Server (NTRS)

Maghami, Peiman G.; Giesy, Daniel P.

1998-01-01

An efficient and robust computational scheme is given for the calculation of the frequency response function of a large order, flexible system implemented with a linear, time invariant control system. Advantage is taken of the highly structured sparsity of the system matrix of the plant based on a model of the structure using normal mode coordinates. The computational time per frequency point of the new computational scheme is a linear function of system size, a significant improvement over traditional, still-matrix techniques whose computational times per frequency point range from quadratic to cubic functions of system size. This permits the practical frequency domain analysis of systems of much larger order than by traditional, full-matrix techniques. Formulations are given for both open- and closed-loop systems. Numerical examples are presented showing the advantages of the present formulation over traditional approaches, both in speed and in accuracy. Using a model with 703 structural modes, the present method was up to two orders of magnitude faster than a traditional method. The present method generally showed good to excellent accuracy throughout the range of test frequencies, while traditional methods gave adequate accuracy for lower frequencies, but generally deteriorated in performance at higher frequencies with worst case errors being many orders of magnitude times the correct values.

Direct Determination of Hydroxymethyl Conformations of Plant Cell Wall Cellulose Using 1H Polarization Transfer Solid-State NMR.

PubMed

Phyo, Pyae; Wang, Tuo; Yang, Yu; O'Neill, Hugh; Hong, Mei

2018-05-14

In contrast to the well-studied crystalline cellulose of microbial and animal origins, cellulose in plant cell walls is disordered due to its interactions with matrix polysaccharides. Plant cell wall (PCW) is an undisputed source of sustainable global energy; therefore, it is important to determine the molecular structure of PCW cellulose. The most reactive component of cellulose is the exocyclic hydroxymethyl group: when it adopts the tg conformation, it stabilizes intrachain and interchain hydrogen bonding, while gt and gg conformations destabilize the hydrogen-bonding network. So far, information about the hydroxymethyl conformation in cellulose has been exclusively obtained from 13 C chemical shifts of monosaccharides and oligosaccharides, which do not reflect the environment of cellulose in plant cell walls. Here, we use solid-state Nuclear Magnetic Resonance (ssNMR) spectroscopy to measure the hydroxymethyl torsion angle of cellulose in two model plants, by detecting distance-dependent polarization transfer between H4 and H6 protons in 2D 13 C- 13 C correlation spectra. We show that the interior crystalline portion of cellulose microfibrils in Brachypodium and Arabidopsis cell walls exhibits H4-H6 polarization transfer curves that are indicative of a tg conformation, whereas surface cellulose chains exhibit slower H4-H6 polarization transfer that is best fit to the gt conformation. Joint constraints by the H4-H6 polarization transfer curves and 13 C chemical shifts indicate that it is unlikely for interior cellulose to have a significant population of the gt and gg conformation mixed with the tg conformation, while surface cellulose may adopt a small percentage of the gg conformation. These results provide new constraints to the structure and matrix interactions of cellulose in plant cell walls, and represent the first direct determination of a torsion angle in an important noncrystalline carbohydrate polymer.

Effective representation of amide III, II, I, and A modes on local vibrational modes: Analysis of ab initio quantum calculation results.

PubMed

Hahn, Seungsoo

2016-10-28

The Hamiltonian matrix for the first excited vibrational states of a protein can be effectively represented by local vibrational modes constituting amide III, II, I, and A modes to simulate various vibrational spectra. Methods for obtaining the Hamiltonian matrix from ab initio quantum calculation results are discussed, where the methods consist of three steps: selection of local vibrational mode coordinates, calculation of a reduced Hessian matrix, and extraction of the Hamiltonian matrix from the Hessian matrix. We introduce several methods for each step. The methods were assessed based on the density functional theory calculation results of 24 oligopeptides with four different peptide lengths and six different secondary structures. The completeness of a Hamiltonian matrix represented in the reduced local mode space is improved by adopting a specific atom group for each amide mode and reducing the effect of ignored local modes. The calculation results are also compared to previous models using C=O stretching vibration and transition dipole couplings. We found that local electric transition dipole moments of the amide modes are mainly bound on the local peptide planes. Their direction and magnitude are well conserved except amide A modes, which show large variation. Contrary to amide I modes, the vibrational coupling constants of amide III, II, and A modes obtained by analysis of a dipeptide are not transferable to oligopeptides with the same secondary conformation because coupling constants are affected by the surrounding atomic environment.

Design for active and passive flutter suppression and gust alleviation. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Karpel, M.

1981-01-01

Analytical design techniques for active and passive control of aeroelastic systems are based on a rational approximation of the unsteady aerodynamic loads in the entire Laplace domain, which yields matrix equations of motion with constant coefficients. Some existing schemes are reviewed, the matrix Pade approximant is modified, and a technique which yields a minimal number of augmented states for a desired accuracy is presented. The state-space aeroelastic model is used to design an active control system for simultaneous flutter suppression and gust alleviation. The design target is for a continuous controller which transfers some measurements taken on the vehicle to a control command applied to a control surface. Structural modifications are formulated in a way which enables the treatment of passive flutter suppression system with the same procedures by which active control systems are designed.

Drawing a different picture with pencil lead as matrix-assisted laser desorption/ionization matrix for fullerene derivatives.

PubMed

Nye, Leanne C; Hungerbühler, Hartmut; Drewello, Thomas

2018-02-01

Inspired by reports on the use of pencil lead as a matrix-assisted laser desorption/ionization matrix, paving the way towards matrix-free matrix-assisted laser desorption/ionization, the present investigation evaluates its usage with organic fullerene derivatives. Currently, this class of compounds is best analysed using the electron transfer matrix trans-2-[3-(4-tert-butylphenyl)-2-methyl-2-propenylidene] malononitrile (DCTB), which was employed as the standard here. The suitability of pencil lead was additionally compared to direct (i.e. no matrix) laser desorption/ionization-mass spectrometry. The use of (DCTB) was identified as the by far gentler method, producing spectra with abundant molecular ion signals and much reduced fragmentation. Analytically, pencil lead was found to be ineffective as a matrix, however, appears to be an extremely easy and inexpensive method for producing sodium and potassium adducts.

Remnants of the devil's staircase of phase transitions in the model of dimer adsorption at nonzero temperature

NASA Astrophysics Data System (ADS)

Akimenko, S. S.; Fefelov, V. F.; Myshlyavtsev, A. V.; Stishenko, P. V.

2018-02-01

The model of dimers adsorption on hexagonal lattice with different orientations to surface and hard-spheres lateral interactions has been studied at nonzero temperature. The transfer-matrix method was used as the main one and the Monte Carlo method was used for checking of some extreme cases. Adsorption isotherms, dependencies of the entropy from the density of the adsorption layer and of the energy from the system temperature at certain points of the phase space, were computed. It was found that at least the first ten phases of the ground state still persist at nonzero temperatures.

MIMO system identification using frequency response data

NASA Technical Reports Server (NTRS)

Medina, Enrique A.; Irwin, R. D.; Mitchell, Jerrel R.; Bukley, Angelia P.

1992-01-01

A solution to the problem of obtaining a multi-input, multi-output statespace model of a system from its individual input/output frequency responses is presented. The Residue Identification Algorithm (RID) identifies the system poles from a transfer function model of the determinant of the frequency response data matrix. Next, the residue matrices of the modes are computed guaranteeing that each input/output frequency response is fitted in the least squares sense. Finally, a realization of the system is computed. Results of the application of RID to experimental frequency responses of a large space structure ground test facility are presented and compared to those obtained via the Eigensystem Realization Algorithm.

Long-range electron transfer in a model for DNA

NASA Astrophysics Data System (ADS)

Endres, R. G.; Cox, D. L.

2001-03-01

Long-range electron transfer (ET) between well separated donor (D) and acceptor (A) sites through quantum mechanical tunneling is essential to many biological processes like respiration, photosynthesis and possibly DNA repair and damage. We are investigating the distance dependence of the electronic transition matrix element H_DA and hence of the electron transfer rate in a model for DNA. Fluorescence quenching in DNA at D-A distances of 40 Åand more suggests ET with an unusually high decay length β-1 of order 10 Å (S.O.Kelley and J.K.Barton, in:Metal Ions in Biological Systems), A.Sigel and H.Sigel, Eds., Marcel Dekker, New York, Vol.36, 1999. Assuming strong electron interactions on the D complex and suitable energetics, this could be explained by formation of a many electron Kondo boundstate. We obtain H_DA from the splitting between the two lowest adiabatic electronic eigenenergies, which constitute the potential energy surfaces (PES) of the nuclear motion in lowest order Born-Oppenheimer approximation. The PES are constructed by coupling D and A to local breathing modes and by making a semi-analytical variational ansatz for the adiabatic eigenstates. The results from the PES are compared with results from the Mulliken-Hush algorithm.

Properties of Zero-Free Transfer Function Matrices

NASA Astrophysics Data System (ADS)

D. O. Anderson, Brian; Deistler, Manfred

Transfer functions of linear, time-invariant finite-dimensional systems with more outputs than inputs, as arise in factor analysis (for example in econometrics), have, for state-variable descriptions with generic entries in the relevant matrices, no finite zeros. This paper gives a number of characterizations of such systems (and indeed square discrete-time systems with no zeros), using state-variable, impulse response, and matrix-fraction descriptions. Key properties include the ability to recover the input values at any time from a bounded interval of output values, without any knowledge of an initial state, and an ability to verify the no-zero property in terms of a property of the impulse response coefficient matrices. Results are particularized to cases where the transfer function matrix in question may or may not have a zero at infinity or a zero at zero.

Collisional Dynamics of the B 3Pi(O+) State of Bromine Monochloride.

DTIC Science & Technology

1986-08-01

many useful discussions on energy transfer studies and continual friendship, to Lt. Brian McFeeters for execution of an RKR program, and to AFWL...2 C. The Halogens and Interhalogens.................... 6 D. The Study of Molecular Energy Transfer............ 9 E. Problem...Matrix.............. 137 8. The BrCl(B) Quenching Mechanism................ 144 9. Energy Transfer with Rare Gases................ 145 10. Summary of

Computing the Density Matrix in Electronic Structure Theory on Graphics Processing Units.

PubMed

Cawkwell, M J; Sanville, E J; Mniszewski, S M; Niklasson, Anders M N

2012-11-13

The self-consistent solution of a Schrödinger-like equation for the density matrix is a critical and computationally demanding step in quantum-based models of interatomic bonding. This step was tackled historically via the diagonalization of the Hamiltonian. We have investigated the performance and accuracy of the second-order spectral projection (SP2) algorithm for the computation of the density matrix via a recursive expansion of the Fermi operator in a series of generalized matrix-matrix multiplications. We demonstrate that owing to its simplicity, the SP2 algorithm [Niklasson, A. M. N. Phys. Rev. B2002, 66, 155115] is exceptionally well suited to implementation on graphics processing units (GPUs). The performance in double and single precision arithmetic of a hybrid GPU/central processing unit (CPU) and full GPU implementation of the SP2 algorithm exceed those of a CPU-only implementation of the SP2 algorithm and traditional matrix diagonalization when the dimensions of the matrices exceed about 2000 × 2000. Padding schemes for arrays allocated in the GPU memory that optimize the performance of the CUBLAS implementations of the level 3 BLAS DGEMM and SGEMM subroutines for generalized matrix-matrix multiplications are described in detail. The analysis of the relative performance of the hybrid CPU/GPU and full GPU implementations indicate that the transfer of arrays between the GPU and CPU constitutes only a small fraction of the total computation time. The errors measured in the self-consistent density matrices computed using the SP2 algorithm are generally smaller than those measured in matrices computed via diagonalization. Furthermore, the errors in the density matrices computed using the SP2 algorithm do not exhibit any dependence of system size, whereas the errors increase linearly with the number of orbitals when diagonalization is employed.

Kinetic experiments for evaluating the Nernst-Monod model for anode-respiring bacteria (ARB) in a biofilm anode.

PubMed

Torres, César I; Marcus, Andrew Kato; Parameswaran, Prathap; Rittmann, Bruce E

2008-09-01

Anode-respiring bacteria (ARB) are able to transfer electrons from reduced substrates to a solid electrode. Previously, we developed a biofilm model based on the Nernst-Monod equation to describe the anode potential losses of ARB that transfer electrons through a solid conductive matrix. In this work, we develop an experimental setup to demonstrate how well the Nernst-Monod equation is able to represent anode potential losses in an ARB biofilm. We performed low-scan cyclic voltammetry (LSCV) throughout the growth phase of an ARB biofilm on a graphite electrode growing on acetate in continuous mode. The (j)V response of 9 LSCVs corresponded well to the Nernst-Monod equation, and the half-saturation potential (E(KA)) was -0.425 +/- 0.002 V vs Ag/AgCl at 30 degrees C (-0.155 +/- 0.002 V vs SHE). Anode-potential losses from the potential of acetate reached approximately 0.225 V at current density saturation, and this loss was determined by our microbial community's E(KA) value. The LSCVs at high current densities showed no significant deviation from the Nernst-Monod ideal shape, indicating that the conductivity of the biofilm matrix (kappa(bio)) was high enough (> or = 0.5 mS/cm) that potential loss did not affect the performance of the biofilm anode. Our results confirm the applicability of the Nernst-Monod equation for a conductive biofilm anode and give insights of the processes that dominate anode potential losses in microbial fuel cells.

Numerical Upscaling of Solute Transport in Fractured Porous Media Based on Flow Aligned Blocks

NASA Astrophysics Data System (ADS)

Leube, P.; Nowak, W.; Sanchez-Vila, X.

2013-12-01

High-contrast or fractured-porous media (FPM) pose one of the largest unresolved challenges for simulating large hydrogeological systems. The high contrast in advective transport between fast conduits and low-permeability rock matrix, including complex mass transfer processes, leads to the typical complex characteristics of early bulk arrivals and long tailings. Adequate direct representation of FPM requires enormous numerical resolutions. For large scales, e.g. the catchment scale, and when allowing for uncertainty in the fracture network architecture or in matrix properties, computational costs quickly reach an intractable level. In such cases, multi-scale simulation techniques have become useful tools. They allow decreasing the complexity of models by aggregating and transferring their parameters to coarser scales and so drastically reduce the computational costs. However, these advantages come at a loss of detail and accuracy. In this work, we develop and test a new multi-scale or upscaled modeling approach based on block upscaling. The novelty is that individual blocks are defined by and aligned with the local flow coordinates. We choose a multi-rate mass transfer (MRMT) model to represent the remaining sub-block non-Fickian behavior within these blocks on the coarse scale. To make the scale transition simple and to save computational costs, we capture sub-block features by temporal moments (TM) of block-wise particle arrival times to be matched with the MRMT model. By predicting spatial mass distributions of injected tracers in a synthetic test scenario, our coarse-scale solution matches reasonably well with the corresponding fine-scale reference solution. For predicting higher TM-orders (such as arrival time and effective dispersion), the prediction accuracy steadily decreases. This is compensated to some extent by the MRMT model. If the MRMT model becomes too complex, it loses its effect. We also found that prediction accuracy is sensitive to the choice of the effective dispersion coefficients and on the block resolution. A key advantage of the flow-aligned blocks is that the small-scale velocity field is reproduced quite accurately on the block-scale through their flow alignment. Thus, the block-scale transverse dispersivities remain in the similar magnitude as local ones, and they do not have to represent macroscopic uncertainty. Also, the flow-aligned blocks minimize numerical dispersion when solving the large-scale transport problem.

Flexible aircraft dynamic modeling for dynamic analysis and control synthesis

NASA Technical Reports Server (NTRS)

Schmidt, David K.

1989-01-01

The linearization and simplification of a nonlinear, literal model for flexible aircraft is highlighted. Areas of model fidelity that are critical if the model is to be used for control system synthesis are developed and several simplification techniques that can deliver the necessary model fidelity are discussed. These techniques include both numerical and analytical approaches. An analytical approach, based on first-order sensitivity theory is shown to lead not only to excellent numerical results, but also to closed-form analytical expressions for key system dynamic properties such as the pole/zero factors of the vehicle transfer-function matrix. The analytical results are expressed in terms of vehicle mass properties, vibrational characteristics, and rigid-body and aeroelastic stability derivatives, thus leading to the underlying causes for critical dynamic characteristics.

Prediction of equibiaxial loading stress in collagen-based extracellular matrix using a three-dimensional unit cell model.

PubMed

Susilo, Monica E; Bell, Brett J; Roeder, Blayne A; Voytik-Harbin, Sherry L; Kokini, Klod; Nauman, Eric A

2013-03-01

Mechanical signals are important factors in determining cell fate. Therefore, insights as to how mechanical signals are transferred between the cell and its surrounding three-dimensional collagen fibril network will provide a basis for designing the optimum extracellular matrix (ECM) microenvironment for tissue regeneration. Previously we described a cellular solid model to predict fibril microstructure-mechanical relationships of reconstituted collagen matrices due to unidirectional loads (Acta Biomater 2010;6:1471-86). The model consisted of representative volume elements made up of an interconnected network of flexible struts. The present study extends this work by adapting the model to account for microstructural anisotropy of the collagen fibrils and a biaxial loading environment. The model was calibrated based on uniaxial tensile data and used to predict the equibiaxial tensile stress-stretch relationship. Modifications to the model significantly improved its predictive capacity for equibiaxial loading data. With a comparable fibril length (model 5.9-8μm, measured 7.5μm) and appropriate fibril anisotropy the anisotropic model provides a better representation of the collagen fibril microstructure. Such models are important tools for tissue engineering because they facilitate prediction of microstructure-mechanical relationships for collagen matrices over a wide range of microstructures and provide a framework for predicting cell-ECM interactions. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Aeroelastic analysis of a troposkien-type wind turbine blade

NASA Technical Reports Server (NTRS)

Nitzsche, F.

1981-01-01

The linear aeroelastic equations for one curved blade of a vertical axis wind turbine in state vector form are presented. The method is based on a simple integrating matrix scheme together with the transfer matrix idea. The method is proposed as a convenient way of solving the associated eigenvalue problem for general support conditions.

Collisional transfer of population and orientation in sodium potassium

NASA Astrophysics Data System (ADS)

Wolfe, Christopher Matthew

Collisional spectral satellite lines have been identified in recent optical-optical double resonance (OODR) excitation spectra of the NaK molecule. These satellite lines represent both a transfer of population, and a partial preservation of angular momentum orientation, to a rotational level adjacent to the one directly excited by the pump laser beam. A rate equation model was used to study the intensities of these satellite lines as a function of argon pressure and heat pipe oven temperature, in order to separate the collisional effects of argon and potassium atoms (being the most populous species in the vapor by an order of magnitude over the third most populous). Using a fit of this rate equation model to the data, it was found that collisions between NaK and potassium are more likely to transfer population and destroy orientation than argon collisions, and also more likely to transfer population to rotational levels higher in energy than the one being pumped (i.e. a propensity for positive Delta J collisions). Also, collisions between NaK and argon atoms show a propensity toward even-numbered changes in J. In addition to the above study, an analysis of collisional line broadening and velocity-changes in J-changing collisions was performed, showing potassium has a higher line broadening rate coefficient, as well as a smaller velocity change in J-changing collisions, than argon. A program was also written in Fortran 90/95 which solves the density matrix equations of motion in steady state for a coupled system of 3 (or 4) energy levels with their constituent degenerate magnetic sublevels. The solution to these equations yields the populations of each sublevel in steady state, as well as the laser-induced coherences between each sublevel (which are needed to model the polarization spectroscopy lineshape precisely). Development of an appropriate theoretical model for collisional transfer will yield a more rigorous study of the problem than the empirical rate equation model used in the analysis of our experiment.

Spectral analysis of the UFBG-based acousto—optical modulator in V-I transmission matrix formalism

NASA Astrophysics Data System (ADS)

Wu, Liang-Ying; Pei, Li; Liu, Chao; Wang, Yi-Qun; Weng, Si-Jun; Wang, Jian-Shuai

2014-11-01

In this study, the V-I transmission matrix formalism (V-I method) is proposed to analyze the spectrum characteristics of the uniform fiber Bragg grating (FBG)-based acousto—optic modulators (UFBG-AOM). The simulation results demonstrate that both the amplitude of the acoustically induced strain and the frequency of the acoustic wave (AW) have an effect on the spectrum. Additionally, the wavelength spacing between the primary reflectivity peak and the secondary reflectivity peak is proportional to the acoustic frequency with the ratio 0.1425 nm/MHz. Meanwhile, we compare the amount of calculation. For the FBG whose period is M, the calculation of the V-I method is 4 × (2M-1) in addition/subtraction, 8 × (2M - 1) in multiply/division and 2M in exponent arithmetic, which is almost a quarter of the multi-film method and transfer matrix (TM) method. The detailed analysis indicates that, compared with the conventional multi-film method and transfer matrix (TM) method, the V-I method is faster and less complex.

Unveiling the Semicoherent Interface with Definite Orientation Relationships between Reinforcements and Matrix in Novel Al3BC/Al Composites.

PubMed

Zhao, Yongfeng; Qian, Zhao; Ma, Xia; Chen, Houwen; Gao, Tong; Wu, Yuying; Liu, Xiangfa

2016-10-05

High-strength lightweight Al-based composites are promising materials for a wide range of applications. To provide high performance, a strong bonding interface for effective load transfer from the matrix to the reinforcement is essential. In this work, the novel Al 3 BC reinforced Al composites have been in situ fabricated through a liquid-solid reaction method and the bonding interface between Al 3 BC and Al matrix has been unveiled. The HRTEM characterizations on the Al 3 BC/Al interface verify it to be a semicoherent bonding structure with definite orientation relationships: (0001) Al 3 BC //(11̅1) Al ;[112̅0] Al 3 BC //[011] Al . Periodic arrays of geometrical misfit dislocations are also observed along the interface at each (0001) Al 3 BC plane or every five (11̅1) Al planes. This kind of interface between the reinforcement and the matrix is strong enough for effective load transfer, which would lead to the evidently improved strength and stiffness of the introduced new Al 3 BC/Al composites.

Simultaneous heat and mass transfer inside a vertical channel in evaporating a heated falling glycols liquid film

NASA Astrophysics Data System (ADS)

Nait Alla, Abderrahman; Feddaoui, M'barek; Meftah, Hicham

2015-12-01

The interactive effects of heat and mass transfer in the evaporation of ethylene and propylene glycol flowing as falling films on vertical channel was investigated. The liquid film falls along a left plate which is externally subjected to a uniform heat flux while the right plate is the dry wall and is kept thermally insulated. The model solves the coupled governing equations in both phases together with the boundary and interfacial conditions. The systems of equations obtained by using an implicit finite difference method are solved by Tridiagonal Matrix Algorithm. The influence of the inlet liquid flow, Reynolds number in the gas flow and the wall heat flux on the intensity of heat and mass transfers are examined. A comparison between the results obtained for studied glycols and water in the same conditions is made. The results indicate that water evaporates in more intense way in comparison to glycols and the increase of gas flow rate tends to improve slightly the evaporation.

FDTD and transfer matrix methods for evaluating the performance of photonic crystal based microcavities for exciton-polaritons

NASA Astrophysics Data System (ADS)

Liu, Yi-Cheng; Byrnes, Tim

2016-11-01

We investigate alternative microcavity structures for exciton-polaritons consisting of photonic crystals instead of distributed Bragg reflectors. Finite-difference time-domain simulations and scattering transfer matrix methods are used to evaluate the cavity performance. The results are compared with conventional distributed Bragg reflectors. We find that in terms of the photon lifetime, the photonic crystal based microcavities are competitive, with typical lifetimes in the region of ∼20 ps being achieved. The photonic crystal microcavities have the advantage that they are compact and are frequency adjustable, showing that they are viable to investigate exciton-polariton condensation physics.

Effects of damage and thermal residual stresses on the overall elastoplastic behavior of particle-reinforced metal matrix composites

NASA Astrophysics Data System (ADS)

Liu, Haitao

The objective of the present study is to investigate damage mechanisms and thermal residual stresses of composites, and to establish the frameworks to model the particle-reinforced metal matrix composites with particle-matrix interfacial debonding, particle cracking or thermal residual stresses. An evolutionary interfacial debonding model is proposed for the composites with spheroidal particles. The construction of the equivalent stiffness is based on the fact that when debonding occurs in a certain direction, the load-transfer ability will lose in that direction. By using this equivalent method, the interfacial debonding problem can be converted into a composite problem with perfectly bonded inclusions. Considering the interfacial debonding is a progressive process in which the debonding area increases in proportion to external loading, a progressive interfacial debonding model is proposed. In this model, the relation between external loading and the debonding area is established using a normal stress controlled debonding criterion. Furthermore, an equivalent orthotropic stiffness tensor is constructed based on the debonding areas. This model is able to study the composites with randomly distributed spherical particles. The double-inclusion theory is recalled to model the particle cracking problems. Cracks inside particles are treated as penny-shape particles with zero stiffness. The disturbed stress field due to the existence of a double-inclusion is expressed explicitly. Finally, a thermal mismatch eigenstrain is introduced to simulate the inconsistent expansions of the matrix and the particles due to the difference of the coefficients of thermal expansion. Micromechanical stress and strain fields are calculated due to the combination of applied external loads and the prescribed thermal mismatch eigenstrains. For all of the above models, ensemble-volume averaging procedures are employed to derive the effective yield function of the composites. Numerical simulations are performed to analyze the effects of various parameters and several good agreements between our model's predictions and experimental results are obtained. It should be mentioned that all of expressions in the frameworks are explicitly derived and these analytical results are easy to be adopted in other related investigations.

Addressable test matrix for measuring analog transfer characteristics of test elements used for integrated process control and device evaluation

NASA Technical Reports Server (NTRS)

Buehler, Martin G. (Inventor)

1988-01-01

A set of addressable test structures, each of which uses addressing schemes to access individual elements of the structure in a matrix, is used to test the quality of a wafer before integrated circuits produced thereon are diced, packaged and subjected to final testing. The electrical characteristic of each element is checked and compared to the electrical characteristic of all other like elements in the matrix. The effectiveness of the addressable test matrix is in readily analyzing the electrical characteristics of the test elements and in providing diagnostic information.

Numerical implementation, verification and validation of two-phase flow four-equation drift flux model with Jacobian-free Newton–Krylov method

DOE PAGES

Zou, Ling; Zhao, Haihua; Zhang, Hongbin

2016-08-24

This study presents a numerical investigation on using the Jacobian-free Newton–Krylov (JFNK) method to solve the two-phase flow four-equation drift flux model with realistic constitutive correlations (‘closure models’). The drift flux model is based on Isshi and his collaborators’ work. Additional constitutive correlations for vertical channel flow, such as two-phase flow pressure drop, flow regime map, wall boiling and interfacial heat transfer models, were taken from the RELAP5-3D Code Manual and included to complete the model. The staggered grid finite volume method and fully implicit backward Euler method was used for the spatial discretization and time integration schemes, respectively. Themore » Jacobian-free Newton–Krylov method shows no difficulty in solving the two-phase flow drift flux model with a discrete flow regime map. In addition to the Jacobian-free approach, the preconditioning matrix is obtained by using the default finite differencing method provided in the PETSc package, and consequently the labor-intensive implementation of complex analytical Jacobian matrix is avoided. Extensive and successful numerical verification and validation have been performed to prove the correct implementation of the models and methods. Code-to-code comparison with RELAP5-3D has further demonstrated the successful implementation of the drift flux model.« less

Generalized Friedberg-Lee model for CP violation in neutrino physics

NASA Astrophysics Data System (ADS)

Razzaghi, N.; Gousheh, S. S.

2012-09-01

We propose a phenomenological model of Dirac neutrino mass operator based on the Friedberg-Lee neutrino mass model to include CP violation. By considering the most general set of complex coefficients, and imposing the condition that the mass eigenvalues are real, we find a neutrino mass matrix which is non-Hermitian, symmetric, and magic. In particular, we find that the requirement of obtaining real mass eigenvalues by transferring the residual phases to the mass eigenstates self-consistently dictates the following relationship between the imaginary part of the mass matrix elements B and the parameters of the Friedberg-Lee model: B=±(3)/(4)(a-br)2sin⁡22θ13cos⁡2θ12. We obtain inverted neutrino mass hierarchy m3=0. Making a correspondence between our model and the experimental data produces stringent conditions on the parameters as follows: 35.06°≲θ12≲36.27°, θ23=45°, 7.27°≲θ13≲11.09°, and 82.03°≲δ≲85.37°. We get mildly broken μ-τ symmetry, which reduces the resultant neutrino mixing pattern from tri-bimaximal to trimaximal. The CP violation as measured by the Jarlskog parameter is restricted by 0.027≲J≲0.044.

Gene transfer device utilizing micron-spiked electrodes produced by the self-organization phenomenon of Fe-alloy.

PubMed

Miyano, Naoki; Inoue, Yuuki; Teramura, Yuji; Fujii, Keisuke; Tsumori, Fujio; Iwata, Hiroo; Kotera, Hidetoshi

2008-07-01

In the diffusional phase transformation of two-phase alloys, the new phase precipitates form the matrix phase at specific temperatures, followed by the formation of a mixed microstructure comprising the precipitate and the matrix. It has been found that by specific chemical-etching treatment, the precipitate in Fe-25Cr-6Ni alloy projects substantially and clusters at the surface. The configuration of the precipitate has an extremely high aspect ratio: it is several microns in width and several tens of microns in length (known as micron-spiked). This study targets the development of a gene transfer device with a micro-spike produced based on the self-organization phenomenon of the Fe-25Cr-6Ni alloy. With this spike-projected device, we tried to efficiently transfer plasmid DNA into adherent cells by electric pulse-triggered gene transfer using a plasmid-loaded electrode (electroporation-based reverse transfection). The spiked structure was applied to a substrate of the device to allow efficient gene transfer into adherent cells, although the general substrate was flat and had a smooth surface. The results suggest that this unique spike-projected device has potential applications in gene transfer devices for the analysis of the human genome in the post-genome period.

Growth factor transgenes interactively regulate articular chondrocytes.

PubMed

Shi, Shuiliang; Mercer, Scott; Eckert, George J; Trippel, Stephen B

2013-04-01

Adult articular chondrocytes lack an effective repair response to correct damage from injury or osteoarthritis. Polypeptide growth factors that stimulate articular chondrocyte proliferation and cartilage matrix synthesis may augment this response. Gene transfer is a promising approach to delivering such factors. Multiple growth factor genes regulate these cell functions, but multiple growth factor gene transfer remains unexplored. We tested the hypothesis that multiple growth factor gene transfer selectively modulates articular chondrocyte proliferation and matrix synthesis. We tested the hypothesis by delivering combinations of the transgenes encoding insulin-like growth factor I (IGF-I), fibroblast growth factor-2 (FGF-2), transforming growth factor beta1 (TGF-β1), bone morphogenetic protein-2 (BMP-2), and bone morphogenetic protien-7 (BMP-7) to articular chondrocytes and measured changes in the production of DNA, glycosaminoglycan, and collagen. The transgenes differentially regulated all these chondrocyte activities. In concert, the transgenes interacted to generate widely divergent responses from the cells. These interactions ranged from inhibitory to synergistic. The transgene pair encoding IGF-I and FGF-2 maximized cell proliferation. The three-transgene group encoding IGF-I, BMP-2, and BMP-7 maximized matrix production and also optimized the balance between cell proliferation and matrix production. These data demonstrate an approach to articular chondrocyte regulation that may be tailored to stimulate specific cell functions, and suggest that certain growth factor gene combinations have potential value for cell-based articular cartilage repair. Copyright © 2012 Wiley Periodicals, Inc.

Analysis of transition-metal acetylacetonate complexes by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

PubMed

Wyatt, Mark F; Havard, Stephen; Stein, Bridget K; Brenton, A Gareth

2008-01-01

Transition-metal acetylacetonate complexes of the form Metal(acac)(2), where Metal = Fe(II), Co(II), Ni(II), Cu(II), and Zn(II), and Metal(acac)(3), where Metal = V(III), Cr(III), Mn(III), Fe(III), and Co(III), were investigated by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS). The data was acquired using the aprotic, electron transfer matrix, 2-[(2E)-3-(4-tert-butylphenyl)-2-methylprop-2-enylidene]malononitrile (DCTB), and the observation of positive radical ions is shown clearly to depend on the metal element and the oxidation state it occupies. The ionization energy of DCTB was calculated to be 8.08 eV by density functional theory methods, which is notably lower than the experimental value, but within the range of other computational values. This value is very close to those of the analytes, so the existing electron transfer mechanism which is based on the ionization energies of the matrix and analyte, cannot be used predictively. Similarly, the data neither proves nor disproves the validity of the existing electron transfer ionization mechanism, with respect to metal coordination complexes without strong chromophores. In this case, periodic trends may be more useful in explaining the observed species and the prediction of species from sets of similar complexes. The addition of a sodium salt benefits the MALDI-TOFMS characterization of certain compounds studied, but the benefit of the addition of ammonium or silver salts is negligible.

An Initial Non-Equilibrium Porous-Media Model for CFD Simulation of Stirling Regenerators

NASA Technical Reports Server (NTRS)

Tew, Roy; Simon, Terry; Gedeon, David; Ibrahim, Mounir; Rong, Wei

2006-01-01

The objective of this paper is to define empirical parameters (or closwre models) for an initial thermai non-equilibrium porous-media model for use in Computational Fluid Dynamics (CFD) codes for simulation of Stirling regenerators. The two CFD codes currently being used at Glenn Research Center (GRC) for Stirling engine modeling are Fluent and CFD-ACE. The porous-media models available in each of these codes are equilibrium models, which assmne that the solid matrix and the fluid are in thermal equilibrium at each spatial location within the porous medium. This is believed to be a poor assumption for the oscillating-flow environment within Stirling regenerators; Stirling 1-D regenerator models, used in Stirling design, we non-equilibrium regenerator models and suggest regenerator matrix and gas average temperatures can differ by several degrees at a given axial location end time during the cycle. A NASA regenerator research grant has been providing experimental and computational results to support definition of various empirical coefficients needed in defining a noa-equilibrium, macroscopic, porous-media model (i.e., to define "closure" relations). The grant effort is being led by Cleveland State University, with subcontractor assistance from the University of Minnesota, Gedeon Associates, and Sunpower, Inc. Friction-factor and heat-transfer correlations based on data taken with the NASAlSunpower oscillating-flow test rig also provide experimentally based correlations that are useful in defining parameters for the porous-media model; these correlations are documented in Gedeon Associates' Sage Stirling-Code Manuals. These sources of experimentally based information were used to define the following terms and parameters needed in the non-equilibrium porous-media model: hydrodynamic dispersion, permeability, inertial coefficient, fluid effective thermal conductivity (including themal dispersion and estimate of tortuosity effects}, and fluid-solid heat transfer coefficient. Solid effective thermal conductivity (including the effect of tortuosity) was also estimated. Determination of the porous-media model parameters was based on planned use in a CFD model of Infinia's Stirling Technology Demonstration Convertor (TDC), which uses a random-fiber regenerator matrix. The non-equilibrium porous-media model presented is considered to be an initial, or "draft," model for possible incorporation in commercial CFD codes, with the expectation that the empirical parameters will likely need to be updated once resulting Stirling CFD model regenerator and engine results have been analyzed. The emphasis of the paper is on use of available data to define empirical parameters (and closure models) needed in a thermal non-equilibrium porous-media model for Stirling regenerator simulation. Such a model has not yet been implemented by the authors or their associates. However, it is anticipated that a thermal non-equilibrium model such as that presented here, when iacorporated in the CFD codes, will improve our ability to accurately model Stirling regenerators with CFD relative to current thermal-equilibrium porous-media models.

Correlation of AH-1G airframe flight vibration data with a coupled rotor-fuselage analysis

NASA Technical Reports Server (NTRS)

Sangha, K.; Shamie, J.

1990-01-01

The formulation and features of the Rotor-Airframe Comprehensive Analysis Program (RACAP) is described. The analysis employs a frequency domain, transfer matrix approach for the blade structural model, a time domain wake or momentum theory aerodynamic model, and impedance matching for rotor-fuselage coupling. The analysis is applied to the AH-1G helicopter, and a correlation study is conducted on fuselage vibration predictions. The purpose of the study is to evaluate the state-of-the-art in helicopter fuselage vibration prediction technology. The fuselage vibration predicted using RACAP are fairly good in the vertical direction and somewhat deficient in the lateral/longitudinal directions. Some of these deficiencies are traced to the fuselage finite element model.

Heat exchanger and method of making. [bonding rocket chambers with a porous metal matrix

NASA Technical Reports Server (NTRS)

Fortini, A.; Kazaroff, J. M. (Inventor)

1978-01-01

A heat exchanger of increased effectiveness is disclosed. A porous metal matrix is disposed in a metal chamber or between walls through which a heat-transfer fluid is directed. The porous metal matrix has internal bonds and is bonded to the chamber in order to remove all thermal contact resistance within the composite structure. Utilization of the invention in a rocket chamber is disclosed as a specific use. Also disclosed is a method of constructing the heat exchanger.

Enhanced Mechanical Properties of Graphene (Reduced Graphene Oxide)/Aluminum Composites with a Bioinspired Nanolaminated Structure.

PubMed

Li, Zan; Guo, Qiang; Li, Zhiqiang; Fan, Genlian; Xiong, Ding-Bang; Su, Yishi; Zhang, Jie; Zhang, Di

2015-12-09

Bulk graphene (reduced graphene oxide)-reinforced Al matrix composites with a bioinspired nanolaminated microstructure were fabricated via a composite powder assembly approach. Compared with the unreinforced Al matrix, these composites were shown to possess significantly improved stiffness and tensile strength, and a similar or even slightly higher total elongation. These observations were interpreted by the facilitated load transfer between graphene and the Al matrix, and the extrinsic toughening effect as a result of the nanolaminated microstructure.

Modular Exhaust Design and Manufacturing Techniques for Low Cost Mid Volume Rapid Buidl to Order Systems

DTIC Science & Technology

2014-08-06

the pressure field is uniform across them, but which allow mass flow to be diverted. Series elements have a constant mass flow across the ports...they can be used to calculate the pressure and mass flow after the element from the pressure and mass flow prior to the element, as shown in...the matrix product of each transfer matrix in turn. The final matrix gives no information about the pressures and mass flows within the element

Use of modflow drain package for simulating inter-basin transfer in abandoned coal mines

USGS Publications Warehouse

Kozar, Mark D.; McCoy, Kurt J.

2017-01-01

Simulation of groundwater flow in abandoned mines is difficult, especially where flux to and from mines is unknown or poorly quantified, and inter-basin transfer of groundwater occurs. A 3-year study was conducted in the Elkhorn area, West Virginia to better understand groundwater-flow processes and inter-basin transfer in above drainage abandoned coal mines. The study area was specifically selected, as all mines are located above the elevation of tributary receiving streams, to allow accurate measurements of discharge from mine portals and tributaries for groundwater model calibration. Abandoned mine workings were simulated in several ways, initially as a layer of high hydraulic conductivity bounded by lower permeability rock in adjacent strata, and secondly as rows of higher hydraulic conductivity embedded within a lower hydraulic conductivity coal aquifer matrix. Regardless of the hydraulic conductivity assigned to mine workings, neither approach to simulate mine workings could accurately reproduce the inter-basin transfer of groundwater from adjacent watersheds. To resolve the problem, a third approach was developed. The MODFLOW DRAIN package was used to simulate seepage into and through mine workings discharging water under unconfined conditions to Elkhorn Creek, North Fork, and tributaries of the Bluestone River. Drain nodes were embedded in a matrix of uniform hydraulic conductivity cells that represented the coal mine aquifer. Drain heads were empirically defined from well observations, and elevations were based on structure contours for the Pocahontas No. 3 mine workings. Use of the DRAIN package to simulate mine workings as an internal boundary condition resolved the inter-basin transfer problem, and effectively simulated a shift from a topographic- dominated to a dip-dominated flow system, by dewatering overlying unmined strata and shifting the groundwater drainage divide up dip within the Pocahontas No. 3 coal seam several kilometers into the adjacent Bluestone River Watershed. Model simulations prior to use of the DRAIN package for simulating mine workings produced estimated flows of 0.32 to 0.34 m3/s in each of the similar sized Elkhorn Creek and North Fork Watersheds, but failed to estimate inter-basin transfer of groundwater from the adjacent Bluestone River Watershed. The simulation of mine entries and discharge using the MODFLOW DRAIN package produced estimated flows of 0.46 and 0.26 m3/s for the Elkhorn Creek and North Fork watersheds respectively, which matched well measured flows for the respective watersheds of 0.47 and 0.26 m3/s.

Calculation of electronic coupling matrix elements for ground and excited state electron transfer reactions: Comparison of the generalized Mulliken-Hush and block diagonalization methods

NASA Astrophysics Data System (ADS)

Cave, Robert J.; Newton, Marshall D.

1997-06-01

Two independent methods are presented for the nonperturbative calculation of the electronic coupling matrix element (Hab) for electron transfer reactions using ab initio electronic structure theory. The first is based on the generalized Mulliken-Hush (GMH) model, a multistate generalization of the Mulliken Hush formalism for the electronic coupling. The second is based on the block diagonalization (BD) approach of Cederbaum, Domcke, and co-workers. Detailed quantitative comparisons of the two methods are carried out based on results for (a) several states of the system Zn2OH2+ and (b) the low-lying states of the benzene-Cl atom complex and its contact ion pair. Generally good agreement between the two methods is obtained over a range of geometries. Either method can be applied at an arbitrary nuclear geometry and, as a result, may be used to test the validity of the Condon approximation. Examples of nonmonotonic behavior of the electronic coupling as a function of nuclear coordinates are observed for Zn2OH2+. Both methods also yield a natural definition of the effective distance (rDA) between donor (D) and acceptor (A) sites, in contrast to earlier approaches which required independent estimates of rDA, generally based on molecular structure data.

Review of magnetic refrigeration system as alternative to conventional refrigeration system

NASA Astrophysics Data System (ADS)

Mezaal, N. A.; Osintsev, K. V.; Zhirgalova, T. B.

2017-10-01

The refrigeration system is one of the most important systems in industry. Developers are constantly seeking for how to avoid the damage to the environment. Magnetic refrigeration is an emerging, environment-friendly technology based on a magnetic solid that acts as a refrigerant by magneto-caloric effect (MCE). In the case of ferromagnetic materials, MCE warms as the magnetic moments of the atom are aligned by the application of a magnetic field. There are two types of magnetic phase changes that may occur at the Curie point: first order magnetic transition (FOMT) and second order magnetic transition (SOMT). The reference cycle for magnetic refrigeration is AMR (Active Magnetic Regenerative cycle), where the magnetic material matrix works both as a refrigerating medium and as a heat regenerating medium, while the fluid flowing in the porous matrix works as a heat transfer medium. Regeneration can be accomplished by blowing a heat transfer fluid in a reciprocating fashion through the regenerator made of magnetocaloric material that is alternately magnetized and demagnetized. Many magnetic refrigeration prototypes with different designs and software models have been built in different parts of the world. In this paper, the authors try to shed light on the magnetic refrigeration and show its effectiveness compared with conventional refrigeration methods.

Numerical Modeling of Two-Terminal Quantum Well Devices

DTIC Science & Technology

1989-04-17

transfer matrix methods . This was implemented for a perfectly symmetric resonant tunneling structure such as the one shown in figure 3. This technique has...occur for mean well widths near 0.08v or 0.09v. This situation requires further analysis . The situation for the well width of 70A, yielded low Q...WSe.4W AA L1ot. OVefol striwe Tunmelen "ers (a) (b) Figure 1: Pseudomorphic InO. 5 3 Ga 0 .4 7 As/AlA3/ InAa resonant tunneling diodes proposed in

Viscoelastic behavior and life-time predictions

NASA Technical Reports Server (NTRS)

Dillard, D. A.; Brinson, H. F.

1985-01-01

Fiber reinforced plastics were considered for many structural applications in automotive, aerospace and other industries. A major concern was and remains the failure modes associated with the polymer matrix which serves to bind the fibers together and transfer the load through connections, from fiber to fiber and ply to ply. An accelerated characterization procedure for prediction of delayed failures was developed. This method utilizes time-temperature-stress-moisture superposition principles in conjunction with laminated plate theory. Because failures are inherently nonlinear, the testing and analytic modeling for both moduli and strength is based upon nonlinear viscoelastic concepts.

Lattice modeling and calibration with turn-by-turn orbit data

NASA Astrophysics Data System (ADS)

Huang, Xiaobiao; Sebek, Jim; Martin, Don

2010-11-01

A new method that explores turn-by-turn beam position monitor (BPM) data to calibrate lattice models of accelerators is proposed. The turn-by-turn phase space coordinates at one location of the ring are first established using data from two BPMs separated by a simple section with a known transfer matrix, such as a drift space. The phase space coordinates are then tracked with the model to predict positions at other BPMs, which can be compared to measurements. The model is adjusted to minimize the difference between the measured and predicted orbit data. BPM gains and rolls are included as fitting variables. This technique can be applied to either the entire or a section of the ring. We have tested the method experimentally on a part of the SPEAR3 ring.

GOCE gravity gradient data for lithospheric modeling - From well surveyed to frontier areas

NASA Astrophysics Data System (ADS)

Bouman, J.; Ebbing, J.; Gradmann, S.; Fuchs, M.; Fattah, R. Abdul; Meekes, S.; Schmidt, M.; Lieb, V.; Haagmans, R.

2012-04-01

We explore how GOCE gravity gradient data can improve modeling of the Earth's lithosphere and thereby contribute to a better understanding of the Earth's dynamic processes. The idea is to invert satellite gravity gradients and terrestrial gravity data in the well explored and understood North-East Atlantic Margin and to compare the results of this inversion, providing improved information about the lithosphere and upper mantle, with results obtained by means of models based upon other sources like seismics and magnetic field information. Transfer of the obtained knowledge to the less explored Rub' al Khali desert is foreseen. We present a case study for the North-East Atlantic margin, where we analyze the use of satellite gravity gradients by comparison with a well-constrained 3D density model that provides a detailed picture from the upper mantle to the top basement (base of sediments). The latter horizon is well resolved from gravity and especially magnetic data, whereas sedimentary layers are mainly constrained from seismic studies, but do in general not show a prominent effect in the gravity and magnetic field. We analyze how gravity gradients can increase confidence in the modeled structures by calculating a sensitivity matrix for the existing 3D model. This sensitivity matrix describes the relation between calculated gravity gradient data and geological structures with respect to their depth, extent and relative density contrast. As the sensitivity of the modeled bodies varies for different tensor components, we can use this matrix for a weighted inversion of gradient data to optimize the model. This sensitivity analysis will be used as input to study the Rub' al Khali desert in Saudi Arabia. In terms of modeling and data availability this is a frontier area. Here gravity gradient data will be used to better identify the extent of anomalous structures within the basin, with the goal to improve the modeling for hydrocarbon exploration purposes.

Fracture and crack growth in orthotropic laminates. Part 1: Analysis of a hybrid, unidirectional laminate with damage

NASA Technical Reports Server (NTRS)

Goree, J. G.

1982-01-01

The fracture behavior of unifirectional hybrid (buffer strip) composite laminates is studied. Three particular solutions are discussed: (1) broken fibers in a unidirectional half plane; (2) adjoined half planes of different fiber and matrix properties and (3) the solution of two half planes bounding a third distinct region of finite width. This finite width region represents a buffer strip and the potential of this strip to arrest a crack that originates in one of the half planes is investigated. The analysis is based on a materials modeling approach using the classical shear lag assumption to described the stress transfer between fibers. Explicit fiber and matrix properties of the three regions are retained and changes in the laminate behavior as a function of the relative material properties, buffer strip width and initial crack length are discussed.

Charge Transfer in Collisions of S^4+ with H.

NASA Astrophysics Data System (ADS)

Stancil, P. C.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Zygelman, B.

2001-05-01

Charge transfer processes due to collisions of ground state S^4+ ions with atomic hydrogen were investigated for energies between 1 meV/u and 10 MeV/u using the quantum-mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling, classical trajectory Monte Carlo (CTMC), and continuum distorted wave methods. The MOCC calculations utilized ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. A number of variants of the CTMC approach were explored, including different momentum and radial distributions for the initial state, as well as effective charge and quantum-defect models to determine the corresponding quantum state after capture into final partially-stripped S^3+ excited classical states. Hydrogen target isotope effects were explored and rate coefficients for temperatures between 100 and 10^6 K will be presented

Nanostructured 2D cellular materials in silicon by sidewall transfer lithography NEMS

NASA Astrophysics Data System (ADS)

Syms, Richard R. A.; Liu, Dixi; Ahmad, Munir M.

2017-07-01

Sidewall transfer lithography (STL) is demonstrated as a method for parallel fabrication of 2D nanostructured cellular solids in single-crystal silicon. The linear mechanical properties of four lattices (perfect and defected diamond; singly and doubly periodic honeycomb) with low effective Young’s moduli and effective Poisson’s ratio ranging from positive to negative are modelled using analytic theory and the matrix stiffness method with an emphasis on boundary effects. The lattices are fabricated with a minimum feature size of 100 nm and an aspect ratio of 40:1 using single- and double-level STL and deep reactive ion etching of bonded silicon-on-insulator. Nanoelectromechanical systems (NEMS) containing cellular materials are used to demonstrate stretching, bending and brittle fracture. Predicted edge effects are observed, theoretical values of Poisson’s ratio are verified and failure patterns are described.

Prefabricated microvascular autograft in tracheal reconstruction.

PubMed

Fayad, J; Kuriloff, D B

1994-10-01

Tracheal reconstruction continues to be a challenge in head and neck surgery. Numerous techniques, including the use of alloplasts, composite grafts, and staged laryngotracheal troughs, have met with limited success because of implant exposure, infection, persistent granulation tissue, and eventual restenosis. With recently introduced techniques for soft-tissue molding, bone induction with bone morphogenetic protein, and microvascular free tissue transfer, a rodent model was developed to create a well-vascularized tracheal autograft. In this model, a rigid tube having the same dimensions and flexibility as the native trachea was created by wrapping a cylindrical silicone tracheal mold with a layer of vascularized adductor thigh muscle pedicled on the femoral vessels in the groin. Tracheal rings were created by filing transverse troughs in the muscle bed with bone morphogenetic protein-primed demineralized bone matrix before wrapping around the silicone mold. Grafts harvested at 2 weeks demonstrated rigid skeletal support provided by heterotopic bone formation in the form of rings and a smooth inner lining produced by fibroplasia. Bone transformation was controlled and restricted to the muscle troughs, allowing intervening regions of soft tissue and thus producing a flexible neotrachia. With this model, a homologous, vascularized tracheal autograft capable of microvascular free tissue transfer was fabricated based on the femoral vessels. Prefabrication of composite grafts, through the use of soft-tissue molding, bone induction, and subsequent free tissue transfer, has an unlimited potential for use in head and neck reconstruction.

A multi-state fragment charge difference approach for diabatic states in electron transfer: Extension and automation

NASA Astrophysics Data System (ADS)

Yang, Chou-Hsun; Hsu, Chao-Ping

2013-10-01

The electron transfer (ET) rate prediction requires the electronic coupling values. The Generalized Mulliken-Hush (GMH) and Fragment Charge Difference (FCD) schemes have been useful approaches to calculate ET coupling from an excited state calculation. In their typical form, both methods use two eigenstates in forming the target charge-localized diabatic states. For problems involve three or four states, a direct generalization is possible, but it is necessary to pick and assign the locally excited or charge-transfer states involved. In this work, we generalize the 3-state scheme for a multi-state FCD without the need of manual pick or assignment for the states. In this scheme, the diabatic states are obtained separately in the charge-transfer or neutral excited subspaces, defined by their eigenvalues in the fragment charge-difference matrix. In each subspace, the Hamiltonians are diagonalized, and there exist off-diagonal Hamiltonian matrix elements between different subspaces, particularly the charge-transfer and neutral excited diabatic states. The ET coupling values are obtained as the corresponding off-diagonal Hamiltonian matrix elements. A similar multi-state GMH scheme can also be developed. We test the new multi-state schemes for the performance in systems that have been studied using more than two states with FCD or GMH. We found that the multi-state approach yields much better charge-localized states in these systems. We further test for the dependence on the number of state included in the calculation of ET couplings. The final coupling values are converged when the number of state included is increased. In one system where experimental value is available, the multi-state FCD coupling value agrees better with the previous experimental result. We found that the multi-state GMH and FCD are useful when the original two-state approach fails.

Boundary transfer matrices and boundary quantum KZ equations

NASA Astrophysics Data System (ADS)

Vlaar, Bart

2015-07-01

A simple relation between inhomogeneous transfer matrices and boundary quantum Knizhnik-Zamolodchikov (KZ) equations is exhibited for quantum integrable systems with reflecting boundary conditions, analogous to an observation by Gaudin for periodic systems. Thus, the boundary quantum KZ equations receive a new motivation. We also derive the commutativity of Sklyanin's boundary transfer matrices by merely imposing appropriate reflection equations, in particular without using the conditions of crossing symmetry and unitarity of the R-matrix.

Photoinduced Charge Transfer from Titania to Surface Doping Site

PubMed Central

Inerbaev, Talgat; Hoefelmeyer, James D.; Kilin, Dmitri S.

2013-01-01

We evaluate a theoretical model in which Ru is substituting for Ti at the (100) surface of anatase TiO2. Charge transfer from the photo-excited TiO2 substrate to the catalytic site triggers the photo-catalytic event (such as water oxidation or reduction half-reaction). We perform ab-initio computational modeling of the charge transfer dynamics on the interface of TiO2 nanorod and catalytic site. A slab of TiO2 represents a fragment of TiO2 nanorod in the anatase phase. Titanium to ruthenium replacement is performed in a way to match the symmetry of TiO2 substrate. One molecular layer of adsorbed water is taken into consideration to mimic the experimental conditions. It is found that these adsorbed water molecules saturate dangling surface bonds and drastically affect the electronic properties of systems investigated. The modeling is performed by reduced density matrix method in the basis of Kohn-Sham orbitals. A nano-catalyst modeled through replacement defect contributes energy levels near the bottom of the conduction band of TiO2 nano-structure. An exciton in the nano-rod is dissipating due to interaction with lattice vibrations, treated through non-adiabatic coupling. The electron relaxes to conduction band edge and then to the Ru cite with faster rate than hole relaxes to the Ru cite. These results are of the importance for an optimal design of nano-materials for photo-catalytic water splitting and solar energy harvesting. PMID:23795229

Photoinduced Charge Transfer from Titania to Surface Doping Site.

PubMed

Inerbaev, Talgat; Hoefelmeyer, James D; Kilin, Dmitri S

2013-05-16

We evaluate a theoretical model in which Ru is substituting for Ti at the (100) surface of anatase TiO 2 . Charge transfer from the photo-excited TiO 2 substrate to the catalytic site triggers the photo-catalytic event (such as water oxidation or reduction half-reaction). We perform ab-initio computational modeling of the charge transfer dynamics on the interface of TiO 2 nanorod and catalytic site. A slab of TiO 2 represents a fragment of TiO 2 nanorod in the anatase phase. Titanium to ruthenium replacement is performed in a way to match the symmetry of TiO 2 substrate. One molecular layer of adsorbed water is taken into consideration to mimic the experimental conditions. It is found that these adsorbed water molecules saturate dangling surface bonds and drastically affect the electronic properties of systems investigated. The modeling is performed by reduced density matrix method in the basis of Kohn-Sham orbitals. A nano-catalyst modeled through replacement defect contributes energy levels near the bottom of the conduction band of TiO 2 nano-structure. An exciton in the nano-rod is dissipating due to interaction with lattice vibrations, treated through non-adiabatic coupling. The electron relaxes to conduction band edge and then to the Ru cite with faster rate than hole relaxes to the Ru cite. These results are of the importance for an optimal design of nano-materials for photo-catalytic water splitting and solar energy harvesting.

Computational Challenges of 3D Radiative Transfer in Atmospheric Models

NASA Astrophysics Data System (ADS)

Jakub, Fabian; Bernhard, Mayer

2017-04-01

The computation of radiative heating and cooling rates is one of the most expensive components in todays atmospheric models. The high computational cost stems not only from the laborious integration over a wide range of the electromagnetic spectrum but also from the fact that solving the integro-differential radiative transfer equation for monochromatic light is already rather involved. This lead to the advent of numerous approximations and parameterizations to reduce the cost of the solver. One of the most prominent one is the so called independent pixel approximations (IPA) where horizontal energy transfer is neglected whatsoever and radiation may only propagate in the vertical direction (1D). Recent studies implicate that the IPA introduces significant errors in high resolution simulations and affects the evolution and development of convective systems. However, using fully 3D solvers such as for example MonteCarlo methods is not even on state of the art supercomputers feasible. The parallelization of atmospheric models is often realized by a horizontal domain decomposition, and hence, horizontal transfer of energy necessitates communication. E.g. a cloud's shadow at a low zenith angle will cast a long shadow and potentially needs to communication through a multitude of processors. Especially light in the solar spectral range may travel long distances through the atmosphere. Concerning highly parallel simulations, it is vital that 3D radiative transfer solvers put a special emphasis on parallel scalability. We will present an introduction to intricacies computing 3D radiative heating and cooling rates as well as report on the parallel performance of the TenStream solver. The TenStream is a 3D radiative transfer solver using the PETSc framework to iteratively solve a set of partial differential equation. We investigate two matrix preconditioners, (a) geometric algebraic multigrid preconditioning(MG+GAMG) and (b) block Jacobi incomplete LU (ILU) factorization. The TenStream solver is tested for up to 4096 cores and shows a parallel scaling efficiency of 80-90% on various supercomputers.

Novel Architectures for Achieving Direct Electron Transfer in Enzymatic Biofuel Cells

NASA Astrophysics Data System (ADS)

Blaik, Rita A.

Enzymatic biofuel cells are a promising source of alternative energy for small device applications, but still face the challenge of achieving direct electron transfer with high enzyme concentrations in a simple system. In this dissertation, methods of constructing electrodes consisting of enzymes attached to nanoparticle-enhanced substrates that serve as high surface area templates are evaluated. In the first method described, glucose oxidase is covalently attached to gold nanoparticles that are assembled onto genetically engineered M13 bacteriophage. The resulting anodes achieve a high peak current per area and a significant improvement in enzyme surface coverage. In the second system, fructose dehydrogenase, a membrane-bound enzyme that has the natural ability to achieve direct electron transfer, is immobilized into a matrix consisting of binders and carbon nanotubes to extend the lifetime of the anode. For the cathode, bilirubin oxidase is immobilized in a carbon nanotube and sol-gel matrix to achieve direct electron transfer. Finally, a full fuel cell consisting of both an anode and cathode is constructed and evaluated with each system described.

Transfer-matrices for series-type microwave antenna circuits. [L-band radiometer

NASA Technical Reports Server (NTRS)

Schmidt, R. F.

1981-01-01

Transfer matrices are developed which permit analysis and computer evaluation of certain series type microwave antenna circuits associated with an L-Band microwave radiometer (LBMR) under investigation at Goddard Space Flight Center. This radiometer is one of several diverse instrument designs to be used for the determination of soil moisture, sea state, salinity, and temperature data. Four port matrix notation is used throughout for the evaluation of LBMR circuits with mismatched couplers and lossy transmission lines. Matrix parameters in examples are predicted on an impedance analysis and an assumption of an array aperture distribution. The notation presented is easily adapted to longer and more varied chains of matrices, and to matrices of larger dimension.

Matrix resin effects in composite delamination - Mode I fracture aspects

NASA Technical Reports Server (NTRS)

Hunston, Donald L.; Moulton, Richard J.; Johnston, Norman J.; Bascom, Willard D.

1987-01-01

A number of thermoset, toughened thermoset, and thermoplastic resin matrix systems were characterized for Mode I critical strain energy release rates, and their composites were tested for interlaminar critical strain energy release rates using the double cantilever beam method. A clear correlation is found between the two sets of data. With brittle resins, the interlaminar critical strain energy release rates are somewhat larger than the neat resin values due to a full transfer of the neat resin toughness to the composite and toughening mechanisms associated with crack growth. With tougher matrices, the higher critical strain energy release rates are only partially transferred to the composites, presumably because the fibers restrict the crack-tip deformation zones.

Temperature distribution of thick thermoset composites

NASA Astrophysics Data System (ADS)

Guo, Zhan-Sheng; Du, Shanyi; Zhang, Boming

2004-05-01

The development of temperature distribution of thick polymeric matrix laminates during an autoclave vacuum bag process was measured and compared with numerically calculated results. The finite element formulation of the transient heat transfer problem was carried out for polymeric matrix composite materials from the heat transfer differential equations including internal heat generation produced by exothermic chemical reactions. Software based on the general finite element software package was developed for numerical simulation of the entire composite process. From the experimental and numerical results, it was found that the measured temperature profiles were in good agreement with the numerical ones, and conventional cure cycles recommended by prepreg manufacturers for thin laminates should be modified to prevent temperature overshoot.

Scaling in the vicinity of the four-state Potts fixed point

NASA Astrophysics Data System (ADS)

Blöte, H. W. J.; Guo, Wenan; Nightingale, M. P.

2017-08-01

We study a self-dual generalization of the Baxter-Wu model, employing results obtained by transfer matrix calculations of the magnetic scaling dimension and the free energy. While the pure critical Baxter-Wu model displays the critical behavior of the four-state Potts fixed point in two dimensions, in the sense that logarithmic corrections are absent, the introduction of different couplings in the up- and down triangles moves the model away from this fixed point, so that logarithmic corrections appear. Real couplings move the model into the first-order range, away from the behavior displayed by the nearest-neighbor, four-state Potts model. We also use complex couplings, which bring the model in the opposite direction characterized by the same type of logarithmic corrections as present in the four-state Potts model. Our finite-size analysis confirms in detail the existing renormalization theory describing the immediate vicinity of the four-state Potts fixed point.

Theoretical Modeling of Various Spectroscopies for Cuprates and Topological Insulators

NASA Astrophysics Data System (ADS)

Basak, Susmita

Spectroscopies resolved highly in momentum, energy and/or spatial dimensions are playing an important role in unraveling key properties of wide classes of novel materials. However, spectroscopies do not usually provide a direct map of the underlying electronic spectrum, but act as a complex 'filter' to produce a 'mapping' of the underlying energy levels, Fermi surfaces (FSs) and excitation spectra. The connection between the electronic spectrum and the measured spectra is described as a generalized 'matrix element effect'. The nature of the matrix element involved differs greatly between different spectroscopies. For example, in angle-resolved photoemission (ARPES) an incoming photon knocks out an electron from the sample and the energy and momentum of the photoemitted electron is measured. This is quite different from what happens in K-edge resonant inelastic X-ray scattering (RIXS), where an X-ray photon is scattered after inducing electronic transitions near the Fermi energy through an indirect second order process, or in Compton scattering where the incident X-ray photon is scattered inelastically from an electron transferring energy and momentum to the scattering electron. For any given spectroscopy, the matrix element is, in general, a complex function of the phase space of the experiment, e.g. energy/polarization of the incoming photon and the energy/momentum/spin of the photoemitted electron in the case of ARPES. The matrix element can enhance or suppress signals from specific states, or merge signals of groups of states, making a good understanding of the matrix element effects important for not only a robust interpretation of the spectra, but also for ascertaining optimal regions of the experimental phase space for zooming in on states of the greatest interest. In this thesis I discuss a comprehensive scheme for modeling various highly resolved spectroscopies of the cuprates and topological insulators (TIs) where effects of matrix element, crystal structure, strong electron correlations (for cuprates) and spin-orbit coupling (for TIs) are included realistically in material-specific detail. Turning to the cuprates, in order to obtain a realistic description of various spectroscopies, one must include not only the effects of the matrix elements and the complexity of the crystal structure, but also of strong electronic correlations beyond the local density approximation (LDA)-based conventional picture, so that the physics of kinks, pseudogaps and superconductivity can be taken into account properly. In this connection, a self-consistent, intermediate coupling scheme informed by material-specific, first-principles band structures has been developed, where electron correlation effects beyond the LDA are incorporated via appropriate self-energy corrections to the electron and hole one-particle Green's functions. Here the antiferromagnetic (AFM) order is used as the simplest model of a competing order. A number of salient features of the resulting electronic spectrum and its energy, momentum and doping dependencies are in accord with experimental observations in electron as well as hole doped cuprates. This scheme thus provides a reasonable basis for undertaking a comprehensive, beyond-LDA level of modeling of various spectroscopies. The specific topics considered here are: (i) Origin of high-energy kink or the waterfall effect found in ARPES; (ii) Identification of the three energy scales observed in RIXS spectra as the pseudogap, charge transfer gap, and Mott gap; (iii) Evolution of the electron momentum densities with holedoping as seen in Compton scattering experiments. For three dimensional topological insulators, the ARPES and scanning tunneling microscopy (STM) spectra has been analyzed using a tight-binding model as well as a k · p model. The spin-orbit coupling, which is essential to produce the characteristic features of the surface states of a TI, is included realistically in the above models. In our generalized k · p model Dresselhaus spin-orbit coupling term extends up to fifth order to reproduce the correct spin-polarization of the surface electrons. These model calculations explain a number of important features associated with the energy and spins of the surface electrons of the first and second generations of TIs. The specific issues addressed in this article are: (i) Non-orthogonality between spin and momentum of the surface electrons; (ii) Electron dynamics at the TI-metal interface; (iii) Origin of the broken time-reversal symmetry observed in the Fourier transform scanning tunneling spectroscopy.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Algebraic Bethe ansatz for the XXX chain with triangular boundaries and Gaudin model

NASA Astrophysics Data System (ADS)

Cirilo António, N.; Manojlović, N.; Salom, I.

2014-12-01

We implement fully the algebraic Bethe ansatz for the XXX Heisenberg spin chain in the case when both boundary matrices can be brought to the upper-triangular form. We define the Bethe vectors which yield the strikingly simple expression for the off shell action of the transfer matrix, deriving the spectrum and the relevant Bethe equations. We explore further these results by obtaining the off shell action of the generating function of the Gaudin Hamiltonians on the corresponding Bethe vectors through the so-called quasi-classical limit. Moreover, this action is as simple as it could possibly be, yielding the spectrum and the Bethe equations of the Gaudin model.

Electrostatics of electron-hole interactions in van der Waals heterostructures

NASA Astrophysics Data System (ADS)

Cavalcante, L. S. R.; Chaves, A.; Van Duppen, B.; Peeters, F. M.; Reichman, D. R.

2018-03-01

The role of dielectric screening of electron-hole interaction in van der Waals heterostructures is theoretically investigated. A comparison between models available in the literature for describing these interactions is made and the limitations of these approaches are discussed. A simple numerical solution of Poisson's equation for a stack of dielectric slabs based on a transfer matrix method is developed, enabling the calculation of the electron-hole interaction potential at very low computational cost and with reasonable accuracy. Using different potential models, direct and indirect exciton binding energies in these systems are calculated within Wannier-Mott theory, and a comparison of theoretical results with recent experiments on excitons in two-dimensional materials is discussed.

Nano-sized Adsorbate Structure Formation in Anisotropic Multilayer System

NASA Astrophysics Data System (ADS)

Kharchenko, Vasyl O.; Kharchenko, Dmitrii O.; Yanovsky, Vladimir V.

2017-05-01

In this article, we study dynamics of adsorbate island formation in a model plasma-condensate system numerically. We derive the generalized reaction-diffusion model for adsorptive multilayer system by taking into account anisotropy in transfer of adatoms between neighbor layers induced by electric field. It will be found that with an increase in the electric field strength, a structural transformation from nano-holes inside adsorbate matrix toward separated nano-sized adsorbate islands on a substrate is realized. Dynamics of adsorbate island sizes and corresponding distributions are analyzed in detail. This study provides an insight into details of self-organization of adatoms into nano-sized adsorbate islands in anisotropic multilayer plasma-condensate systems.

Matrix form of Legendre polynomials for solving linear integro-differential equations of high order

NASA Astrophysics Data System (ADS)

Kammuji, M.; Eshkuvatov, Z. K.; Yunus, Arif A. M.

2017-04-01

This paper presents an effective approximate solution of high order of Fredholm-Volterra integro-differential equations (FVIDEs) with boundary condition. Legendre truncated series is used as a basis functions to estimate the unknown function. Matrix operation of Legendre polynomials is used to transform FVIDEs with boundary conditions into matrix equation of Fredholm-Volterra type. Gauss Legendre quadrature formula and collocation method are applied to transfer the matrix equation into system of linear algebraic equations. The latter equation is solved by Gauss elimination method. The accuracy and validity of this method are discussed by solving two numerical examples and comparisons with wavelet and methods.

Theoretical study of solvent effects on the electronic coupling matrix elements in rigidly linked donor-acceptor systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cave, R.J.; Newton, M.D.; Kumar, K.

1995-12-07

The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.

Thermal Analysis of Filler Reinforced Polymeric Composites

NASA Astrophysics Data System (ADS)

Ghadge, Mahesh Devidas

Improving heat dissipating property of composite materials is becoming increasingly important in domains ranging from the automotive industry, electronic devices to aeronautical industry. Effective heat dissipation is required especially in aircraft and racing tires to guarantee high performance and good service life [1]. The present study is focused on improving the thermal conductivity of Emulsion-styrene butadiene rubber (ESBR) which is a cheap alternative to other rubber composites. The disadvantages of ESBR are low thermal conductivity and high heat generation. Adding fillers with high thermal conductivity to ESBR is proposed as a technique for improving the thermal conductivity of ESBR. The purpose of the research is to predict the thermal conductivity of ESBR when filled with fillers of much higher thermal conductivity and also to find out to what extent the filler properties affect the heat transfer capabilities of the composite matrix. The influence of different filler shapes i.e. spherical, cylindrical and platelets on the overall thermal capability of composite matrix is studied, the finite element modelings are conducted using Abaqus. Three-dimensional and two-dimensional models are created in Abaqus to simulate the microstructure of the composite matrix filled with fillers. Results indicate that the overall thermal conductivity increases with increasing filler loading i.e. for a filler volume fraction of 0.27, the conductivity increased by around 50%. Filler shapes, orientation angle, and aspect ratio of the fillers significantly influences the thermal conductivity. Conductivity increases with increasing aspect ratio (length/diameter) of the cylindrical fillers since longer conductive chains are able to form at the same volume percentage as compared to spherical fillers. The composite matrix reaches maximum thermal conductivity when the cylindrical fillers are oriented in the direction of heat flow. The heat conductivity predicted by FEM for ESBR is compared with that predicted by mean field theories. At low volume fractions the FEM and mean field theory results are matching. However, at high volume fractions, the results obtained by the two methods are not in agreement. This is due to the fact that mean field theory do not consider the particle interactions happening at higher volume fractions. The present analysis can be used to tailor the thermal properties of ESBR for required thermal conductivity for a wide range of applications such as racing tires, electronic gadgets or aeronautical components. In addition, the proposed FEM models can be used to design and optimize the properties of new composite materials providing more insight into the thermal conductivity of composite polymers and aid in understanding heat transfer mechanism of reinforced polymers.

Linearized blade row compression component model. Stability and frequency response analysis of a J85-3 compressor

NASA Technical Reports Server (NTRS)

Tesch, W. A.; Moszee, R. H.; Steenken, W. G.

1976-01-01

NASA developed stability and frequency response analysis techniques were applied to a dynamic blade row compression component stability model to provide a more economic approach to surge line and frequency response determination than that provided by time-dependent methods. This blade row model was linearized and the Jacobian matrix was formed. The clean-inlet-flow stability characteristics of the compressors of two J85-13 engines were predicted by applying the alternate Routh-Hurwitz stability criterion to the Jacobian matrix. The predicted surge line agreed with the clean-inlet-flow surge line predicted by the time-dependent method to a high degree except for one engine at 94% corrected speed. No satisfactory explanation of this discrepancy was found. The frequency response of the linearized system was determined by evaluating its Laplace transfer function. The results of the linearized-frequency-response analysis agree with the time-dependent results when the time-dependent inlet total-pressure and exit-flow function amplitude boundary conditions are less than 1 percent and 3 percent, respectively. The stability analysis technique was extended to a two-sector parallel compressor model with and without interstage crossflow and predictions were carried out for total-pressure distortion extents of 180 deg, 90 deg, 60 deg, and 30 deg.

MICRO-SCALE CFD MODELING OF OSCILLATING FLOW IN A REGENERATOR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheadle, M. J.; Nellis, G. F.; Klein, S. A.

2010-04-09

Regenerator models used by designers are macro-scale models that do not explicitly consider interactions between the fluid and the solid matrix. Rather, the heat transfer coefficient and pressure drop are calculated using correlations for Nusselt number and friction factor. These correlations are typically based on steady flow data. The error associated with using steady flow correlations to characterize the oscillatory flow that is actually present in the regenerator is not well understood. Oscillating flow correlations based on experimental data do exist in the literature; however, these results are often conflicting. This paper uses a micro-scale computational fluid dynamic (CFD) modelmore » of a unit-cell of a regenerator matrix to determine the conditions for which oscillating flow affects friction factor. These conditions are compared to those found in typical pulse tube regenerators to determine whether oscillatory flow is of practical importance. CFD results clearly show a transition Valensi number beyond which oscillating flow significantly increases the friction factor. This transition Valensi number increases with Reynolds number. Most practical pulse tube regenerators will operate below this Valensi transition number and therefore this study suggests that the effect of flow oscillation on pressure drop can be neglected in macro-scale regenerator models.« less

From the quantum transfer matrix to the quench action: the Loschmidt echo in XXZ Heisenberg spin chains

NASA Astrophysics Data System (ADS)

Piroli, Lorenzo; Pozsgay, Balázs; Vernier, Eric

2017-02-01

We consider the computation of the Loschmidt echo after quantum quenches in the interacting XXZ Heisenberg spin chain both for real and imaginary times. We study two-site product initial states, focusing in particular on the Néel and tilted Néel states. We apply the quantum transfer matrix (QTM) approach to derive generalized TBA equations, which follow from the fusion hierarchy of the appropriate QTM’s. Our formulas are valid for arbitrary imaginary time and for real times at least up to a time t 0, after which the integral equations have to be modified. In some regimes, t 0 is seen to be either very large or infinite, allowing to explore in detail the post-quench dynamics of the system. As an important part of our work, we show that for the Néel state our imaginary time results can be recovered by means of the quench action approach, unveiling a direct connection with the quantum transfer matrix formalism. In particular, we show that in the zero-time limit, the study of our TBA equations allows for a simple alternative derivation of the recently obtained Bethe ansatz distribution functions for the Néel, tilted Néel and tilted ferromagnet states.

Heat transfer enhancement of PCM melting in 2D horizontal elliptical tube using metallic porous matrix

NASA Astrophysics Data System (ADS)

Jourabian, Mahmoud; Farhadi, Mousa; Rabienataj Darzi, Ahmad Ali

2016-12-01

In this study, the melting process of ice as a phase-change material (PCM) saturated with a nickel-steel porous matrix inside a horizontal elliptical tube is investigated. Due to the low thermal conductivity of the PCM, it is motivated to augment the heat transfer performance of the system simultaneously by finding an optimum value of the aspect ratio and impregnating a metallic porous matrix into the base PCM. The lattice Boltzmann method with a double distribution function formulated based on the enthalpy method, is applied at the representative elementary volume scale under the local thermal equilibrium assumption between the PCM and porous matrix in the composite. While reducing or increasing the aspect ratio of the circular tubes leads to the expedited melting, the 90° inclination of each elliptical tube in the case of the pure PCM melting does not affect the melting rate. With the reduction in the porosity, the effective thermal conductivity and melting rate in all tubes promoted. Although the natural convection is fully suppressed due to the significant flow blockage in the porous structure, the melting rates are generally increased in all cases.

Higher-order compositional modeling of three-phase flow in 3D fractured porous media based on cross-flow equilibrium

NASA Astrophysics Data System (ADS)

Moortgat, Joachim; Firoozabadi, Abbas

2013-10-01

Numerical simulation of multiphase compositional flow in fractured porous media, when all the species can transfer between the phases, is a real challenge. Despite the broad applications in hydrocarbon reservoir engineering and hydrology, a compositional numerical simulator for three-phase flow in fractured media has not appeared in the literature, to the best of our knowledge. In this work, we present a three-phase fully compositional simulator for fractured media, based on higher-order finite element methods. To achieve computational efficiency, we invoke the cross-flow equilibrium (CFE) concept between discrete fractures and a small neighborhood in the matrix blocks. We adopt the mixed hybrid finite element (MHFE) method to approximate convective Darcy fluxes and the pressure equation. This approach is the most natural choice for flow in fractured media. The mass balance equations are discretized by the discontinuous Galerkin (DG) method, which is perhaps the most efficient approach to capture physical discontinuities in phase properties at the matrix-fracture interfaces and at phase boundaries. In this work, we account for gravity and Fickian diffusion. The modeling of capillary effects is discussed in a separate paper. We present the mathematical framework, using the implicit-pressure-explicit-composition (IMPEC) scheme, which facilitates rigorous thermodynamic stability analyses and the computation of phase behavior effects to account for transfer of species between the phases. A deceptively simple CFL condition is implemented to improve numerical stability and accuracy. We provide six numerical examples at both small and larger scales and in two and three dimensions, to demonstrate powerful features of the formulation.

Dehydration reactions, mass transfer and rock deformation relationships during subduction of Alpine metabauxites: insights from LIBS compositional profiles between metamorphic veins

NASA Astrophysics Data System (ADS)

Verlaguet, A.; Brunet, F.; Goffe, B.; Menut, D.; Findling, N.; Poinssot, C.

2011-12-01

In subduction zones, the significant amounts of aqueous fluid released in the course of the successive dehydration reactions occurring during prograde metamorphism are expected to strongly influence the rock rheology, as well as kinetics of metamorphic reactions and mass transfer efficiency. Mineralized veins, ubiquitous in metamorphic rocks, can be seen as preserved witnesses of fluid and mass redistribution that partly accommodate the rock deformation (lateral segregation). However, the driving forces and mechanisms of mass transfer towards fluid-filled open spaces remain somewhat unclear. The aim of this study is to investigate the modalities of mass transfer during local fluid-rock interactions, and their links with fluid production and rock deformation. This study focuses on karstic pockets (metre scale) of Triassic metabauxites embedded in thick carbonate units, that have been isolated from large-scale fluid flow during HP-LT Alpine metamorphism (W. Vanoise, French Alps). These rocks display several generations of metamorphic veins containing various Al-bearing minerals, which give particular insights into mass transfer processes. It is proposed that the internally-derived fluid (~13 vol% produced by successive dehydration reactions) has promoted the opening of fluid-filled open spaces (euhedral habits of vein minerals) and served as medium for diffusive mass transfer from rock to vein. Based on mineralogical and textural features, two vein types can be distinguished: (1) some veins are filled with newly formed products of either prograde (chloritoid) or retrograde (chlorite) metamorphic reactions; in this case, fluid-filled open spaces seem to offer energetically favourable nucleation/growth sites; (2) the second vein type is filled with cookeite (Li-Al-rich chlorite) or pyrophyllite, that were present in the host rock prior to the vein formation. In this closed chemical system, mass transfer from rock to vein was achieved through the fluid, in a dissolution-transport-precipitation process, possibly stress-assisted. Cookeite is highly concentrated (40-70 vol%) in regularly spaced veins. Laser Induced Breakdown Spectroscopy profiles show that cookeite is evenly distributed in the rock matrix comprised between two veins. The absence of diffusion profiles suggests that the characteristic diffusion length for Li, Al and Si is greater than or equal to the distance separating two cookeite veins (3-6 cm). This is in agreement with characteristic diffusion lengths calculated from both grain boundary and pore fluid diffusion coefficients, for the estimated duration of the peak of metamorphism. Phyllosilicates have very different morphologies in the rock matrix (fibers) compared to veins (euhedral crystals): fluid-mineral interfacial energy may be maximal in the small matrix pores, which can maintain higher cookeite solubility than in fluid-filled open spaces. Therefore, as soon as veins open, chemical potential gradients may develop and drive cookeite transfer from rock matrix to veins.

Deformation behavior of Nb nanowires in TiNiCu shape memory alloy matrix

DOE PAGES

Jiang, Daqiang; Liu, Yinong; Yu, Cun; ...

2015-08-18

An in-situ nanowire Nb/TiNiCu composite is fabricated based on the concept of strain under-matching between a phase transforming matrix and high strength nanomaterials. The deformation behavior of the Nb nanowire was investigated by means of in-situ synchrotron X-ray diffraction when the TiNiCu matrix underwent different deformation modes. The maximum lattice strain of the Nb nanowires was about 5% when the matrix deformed via martensitic transformation or 1% when deforming plastically by dislocation slip. As a result, the Nb nanowires showed a lattice strain of 3.5% when the matrix deformed in the mixed mode of plastic deformation and martensitic transformation, whichmore » means that the occurrence of plastic deformation does not impede load transfer from the matrix to the nanowires.« less

PNNL Technical Support to The Implementation of EMTA and EMTA-NLA Models in Autodesk® Moldflow® Packages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Ba Nghiep; Wang, Jin

2012-12-01

Under the Predictive Engineering effort, PNNL developed linear and nonlinear property prediction models for long-fiber thermoplastics (LFTs). These models were implemented in PNNL’s EMTA and EMTA-NLA codes. While EMTA is a standalone software for the computation of the composites thermoelastic properties, EMTA-NLA presents a series of nonlinear models implemented in ABAQUS® via user subroutines for structural analyses. In all these models, it is assumed that the fibers are linear elastic while the matrix material can exhibit a linear or typical nonlinear behavior depending on the loading prescribed to the composite. The key idea is to model the constitutive behavior ofmore » the matrix material and then to use an Eshelby-Mori-Tanaka approach (EMTA) combined with numerical techniques for fiber length and orientation distributions to determine the behavior of the as-formed composite. The basic property prediction models of EMTA and EMTA-NLA have been subject for implementation in the Autodesk® Moldflow® software packages. These models are the elastic stiffness model accounting for fiber length and orientation distributions, the fiber/matrix interface debonding model, and the elastic-plastic models. The PNNL elastic-plastic models for LFTs describes the composite nonlinear stress-strain response up to failure by an elastic-plastic formulation associated with either a micromechanical criterion to predict failure or a continuum damage mechanics formulation coupling damage to plasticity. All the models account for fiber length and orientation distributions as well as fiber/matrix debonding that can occur at any stage of loading. In an effort to transfer the technologies developed under the Predictive Engineering project to the American automotive and plastics industries, PNNL has obtained the approval of the DOE Office of Vehicle Technologies to provide Autodesk, Inc. with the technical support for the implementation of the basic property prediction models of EMTA and EMTA-NLA in the Autodesk® Moldflow® packages. This report summarizes the recent results from Autodesk Simulation Moldlow Insight (ASMI) analyses using the EMTA models and EMTA-NLA/ABAQUS® analyses for further assessment of the EMTA-NLA models to support their implementation in Autodesk Moldflow Structural Alliance (AMSA). PNNL’s technical support to Autodesk, Inc. included (i) providing the theoretical property prediction models as described in published journal articles and reports, (ii) providing explanations of these models and computational procedure, (iii) providing the necessary LFT data for process simulations and property predictions, and (iv) performing ABAQUS/EMTA-NLA analyses to further assess and illustrate the models for selected LFT materials.« less

Autonomous frequency domain identification: Theory and experiment

NASA Technical Reports Server (NTRS)

Yam, Yeung; Bayard, D. S.; Hadaegh, F. Y.; Mettler, E.; Milman, M. H.; Scheid, R. E.

1989-01-01

The analysis, design, and on-orbit tuning of robust controllers require more information about the plant than simply a nominal estimate of the plant transfer function. Information is also required concerning the uncertainty in the nominal estimate, or more generally, the identification of a model set within which the true plant is known to lie. The identification methodology that was developed and experimentally demonstrated makes use of a simple but useful characterization of the model uncertainty based on the output error. This is a characterization of the additive uncertainty in the plant model, which has found considerable use in many robust control analysis and synthesis techniques. The identification process is initiated by a stochastic input u which is applied to the plant p giving rise to the output. Spectral estimation (h = P sub uy/P sub uu) is used as an estimate of p and the model order is estimated using the produce moment matrix (PMM) method. A parametric model unit direction vector p is then determined by curve fitting the spectral estimate to a rational transfer function. The additive uncertainty delta sub m = p - unit direction vector p is then estimated by the cross spectral estimate delta = P sub ue/P sub uu where e = y - unit direction vectory y is the output error, and unit direction vector y = unit direction vector pu is the computed output of the parametric model subjected to the actual input u. The experimental results demonstrate the curve fitting algorithm produces the reduced-order plant model which minimizes the additive uncertainty. The nominal transfer function estimate unit direction vector p and the estimate delta of the additive uncertainty delta sub m are subsequently available to be used for optimization of robust controller performance and stability.

Predicting vertically-nonsequential wetting patterns with a source-responsive model

USGS Publications Warehouse

Nimmo, John R.; Mitchell, Lara

2013-01-01

Water infiltrating into soil of natural structure often causes wetting patterns that do not develop in an orderly sequence. Because traditional unsaturated flow models represent a water advance that proceeds sequentially, they fail to predict irregular development of water distribution. In the source-responsive model, a diffuse domain (D) represents flow within soil matrix material following traditional formulations, and a source-responsive domain (S), characterized in terms of the capacity for preferential flow and its degree of activation, represents preferential flow as it responds to changing water-source conditions. In this paper we assume water undergoing rapid source-responsive transport at any particular time is of negligibly small volume; it becomes sensible at the time and depth where domain transfer occurs. A first-order transfer term represents abstraction from the S to the D domain which renders the water sensible. In tests with lab and field data, for some cases the model shows good quantitative agreement, and in all cases it captures the characteristic patterns of wetting that proceed nonsequentially in the vertical direction. In these tests we determined the values of the essential characterizing functions by inverse modeling. These functions relate directly to observable soil characteristics, rendering them amenable to evaluation and improvement through hydropedologic development.

Uptake Kinetics and Trophic Transfer of Tungsten from Cabbage to a Herbivorous Animal Model

DOE PAGES

Lindsay, James H.; Kennedy, Alan J.; Seiter-Moser, Jennifer M.; ...

2017-10-20

This paper builds on previous studies on military-relevant tungsten (W) to more thoroughly explore environmental pathways and bioaccumulation kinetics during direct soil exposure versus trophic transfer and elucidate its relative accumulation and speciation in different snail organs. The modeled steady-state concentration and bioaccumulation factor (BAF) of W from soil into cabbage were 302 mg/kg and 0.55, respectively. Steady-state concentrations (34 mg/kg) and BAF values (0.05) obtained for the snail directly exposed to contaminated soil were lower than trophic transfer by consumption of W-contaminated cabbage (tissue concentration of 86 mg/kg; BAF of 0.36). Thus, consumption of contaminated food is the mostmore » important pathway for W mobility in this food chain. The highest concentrations of W compartmentalization were in the snail’s hepatopancreas based on wet chemistry and synchrotron-based investigations. Chemical speciation via inductively couple plasma mass spectrometry showed a higher degree of polytungstate partitioning in the hepatopancreas relative to the rest of the body. Based on synchrotron analysis, W was incorporated into the shell matrix during exposure, particularly during the regeneration of damaged shell. Finally, this offers the potential for application of the shell as a longer-term biomonitoring and forensics tool for historic exposure.« less

Uptake Kinetics and Trophic Transfer of Tungsten from Cabbage to a Herbivorous Animal Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, James H.; Kennedy, Alan J.; Seiter-Moser, Jennifer M.

This paper builds on previous studies on military-relevant tungsten (W) to more thoroughly explore environmental pathways and bioaccumulation kinetics during direct soil exposure versus trophic transfer and elucidate its relative accumulation and speciation in different snail organs. The modeled steady-state concentration and bioaccumulation factor (BAF) of W from soil into cabbage were 302 mg/kg and 0.55, respectively. Steady-state concentrations (34 mg/kg) and BAF values (0.05) obtained for the snail directly exposed to contaminated soil were lower than trophic transfer by consumption of W-contaminated cabbage (tissue concentration of 86 mg/kg; BAF of 0.36). Thus, consumption of contaminated food is the mostmore » important pathway for W mobility in this food chain. The highest concentrations of W compartmentalization were in the snail’s hepatopancreas based on wet chemistry and synchrotron-based investigations. Chemical speciation via inductively couple plasma mass spectrometry showed a higher degree of polytungstate partitioning in the hepatopancreas relative to the rest of the body. Based on synchrotron analysis, W was incorporated into the shell matrix during exposure, particularly during the regeneration of damaged shell. Finally, this offers the potential for application of the shell as a longer-term biomonitoring and forensics tool for historic exposure.« less

Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

NASA Astrophysics Data System (ADS)

Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

2007-12-01

This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

Activation product transport in fusion reactors. [RAPTOR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, A.C.

1983-01-01

Activated corrosion and neutron sputtering products will enter the coolant and/or tritium breeding material of fusion reactor power plants and experiments and cause personnel access problems. Radiation levels around plant components due to these products will cause difficulties with maintenance and repair operations throughout the plant. Similar problems are experienced around fission reactor systems. The determination of the transport of radioactive corrosion and neutron sputtering products through the system is achieved using the computer code RAPTOR. This code calculates the mass transfer of a number of activation products based on the corrosion and sputtering rates through the system, the depositionmore » and release characteristics of various plant components, the neturon flux spectrum, as well as other plant parameters. RAPTOR assembles a system of first order linear differential equations into a matrix equation based upon the reactor system parameters. Included in the transfer matrix are the deposition and erosion coefficients, and the decay and activation data for the various plant nodes and radioactive isotopes. A source vector supplies the corrosion and neutron sputtering source rates. This matrix equation is then solved using a matrix operator technique to give the specific activity distribution of each radioactive species throughout the plant. Once the amount of mass transfer is determined, the photon transport due to the radioactive corrosion and sputtering product sources can be evaluated, and dose rates around the plant components of interest as a function of time can be determined. This method has been used to estimate the radiation hazards around a number of fusion reactor system designs.« less

Stress transfer and matrix-cohesive fracture mechanism in microfibrillated cellulose-gelatin nanocomposite films.

PubMed

Quero, Franck; Padilla, Cristina; Campos, Vanessa; Luengo, Jorge; Caballero, Leonardo; Melo, Francisco; Li, Qiang; Eichhorn, Stephen J; Enrione, Javier

2018-09-01

Microfibrillated cellulose (MFC) obtained from eucalyptus was embedded in gelatin from two sources; namely bovine and salmon gelatin. Raman spectroscopy revealed that stress is transferred more efficiently from bovine gelatin to the MFC when compared to salmon gelatin. Young's modulus, tensile strength, strain at failure and work of fracture of the nanocomposite films were improved by ∼67, 131, 43 y 243% respectively when using salmon gelatin as matrix material instead of bovine gelatin. Imaging of the tensile fracture surface of the MFC-gelatin nanocomposites revealed that crack formation occurs predominantly within bovine and salmon gelatin matrices rather than within the MFC or at the MFC/gelatin interface. This suggests that the mechanical failure mechanism in these nanocomposite materials is predominantly governed by a matrix-cohesive fracture mechanism. Both strength and flexibility are desirable properties for composite coatings made from gelatin-based materials, and so the findings of this study could assist in their utilization in the food and pharmaceutical industry. Copyright © 2018 Elsevier Ltd. All rights reserved.

Compression response of tri-axially braided textile composites

NASA Astrophysics Data System (ADS)

Song, Shunjun

2007-12-01

This thesis is concerned with characterizing the compression stiffness and compression strength of 2D tri-axially braided textile composites (2DTBC). Two types of 2DTBC are considered differing only on the resin type, while the textile fiber architecture is kept the same with bias tows at 45 degrees to the axial tows. Experimental, analytical and computational methods are described based on the results generated in this study. Since these composites are manufactured using resin transfer molding, the intended and as manufactured composite samples differ in their microstructure due to consolidation and thermal history effects in the manufacturing cycle. These imperfections are measured and the effect of these imperfections on the compression stiffness and strength are characterized. Since the matrix is a polymer material, the nonuniform thermal history undergone by the polymer at manufacturing (within the composite and in the presence of fibers) renders its properties to be non-homogenous. The effects of these non-homogeneities are captured through the definition of an equivalent in-situ matrix material. A method to characterize the mechanical properties of the in-situ matrix is also described. Fiber tow buckling, fiber tow kinking and matrix microcracking are all observed in the experiments. These failure mechanisms are captured through a computational model that uses the finite element (FE) technique to discretize the structure. The FE equations are solved using the commercial software ABAQUS version 6.5. The fiber tows are modeled as transversely isotropic elastic-plastic solids and the matrix is modeled as an isotropic elastic-plastic solid with and without microcracking damage. Because the 2DTBC is periodic, the question of how many repeat units are necessary to model the compression stiffness and strength are examined. Based on the computational results, the correct representative unit cell for this class of materials is identified. The computational models and results presented in the thesis provide a means to assess the compressive strength of 2DTBC and its dependence on various microstructural parameters. The essential features (for example, fiber kinking) of 2DTBC under compressive loading are captured accurately and the results are validated by the compression experiments. Due to the requirement of large computational resources for the unit cell studies, simplified models that use less computer resources but sacrifice some accuracy are presented for use in engineering design. A combination of the simplified models is shown to provide a good prediction of the salient features (peak strength and plateau strength) of these materials under compression loading. The incorporation of matrix strain rate effects, a study of the effect of the bias tow angle and the inclusion of viscoelastic/viscoplastic behavior for the study of fatigue are suggested as extensions to this work.

Fatigue 󈨛. Papers presented at the International Conference on Fatigue and Fatigue Threshold (3rd) Held in Charlottesville, Virginia on June 28-July 3, 1987. Volume 3.

DTIC Science & Technology

1987-10-15

cracks and loss of fiber-matrix bond, leadin, to nonuniform loading (tensile overload) of composite structure. Figures 13 through 15 show the micro...propagation within the matrix, and alon- the interface, leading to a nonuniform load transfer from matrix to fibers, and causing tensile overload failure...long cracks, were attributed to high cyclic strains at crack tips within grains of maximum crystallographic orientation. Ma and Laire (4) studying the

High Temperature Deformation Mechanism in Hierarchical and Single Precipitate Strengthened Ferritic Alloys by In Situ Neutron Diffraction Studies.

PubMed

Song, Gian; Sun, Zhiqian; Li, Lin; Clausen, Bjørn; Zhang, Shu Yan; Gao, Yanfei; Liaw, Peter K

2017-04-07

The ferritic Fe-Cr-Ni-Al-Ti alloys strengthened by hierarchical-Ni 2 TiAl/NiAl or single-Ni 2 TiAl precipitates have been developed and received great attentions due to their superior creep resistance, as compared to conventional ferritic steels. Although the significant improvement of the creep resistance is achieved in the hierarchical-precipitate-strengthened ferritic alloy, the in-depth understanding of its high-temperature deformation mechanisms is essential to further optimize the microstructure and mechanical properties, and advance the development of the creep resistant materials. In the present study, in-situ neutron diffraction has been used to investigate the evolution of elastic strain of constitutive phases and their interactions, such as load-transfer/load-relaxation behavior between the precipitate and matrix, during tensile deformation and stress relaxation at 973 K, which provide the key features in understanding the governing deformation mechanisms. Crystal-plasticity finite-element simulations were employed to qualitatively compare the experimental evolution of the elastic strain during tensile deformation at 973 K. It was found that the coherent elastic strain field in the matrix, created by the lattice misfit between the matrix and precipitate phases for the hierarchical-precipitate-strengthened ferritic alloy, is effective in reducing the diffusional relaxation along the interface between the precipitate and matrix phases, which leads to the strong load-transfer capability from the matrix to precipitate.

Mechanical model development of rolling bearing-rotor systems: A review

NASA Astrophysics Data System (ADS)

Cao, Hongrui; Niu, Linkai; Xi, Songtao; Chen, Xuefeng

2018-03-01

The rolling bearing rotor (RBR) system is the kernel of many rotating machines, which affects the performance of the whole machine. Over the past decades, extensive research work has been carried out to investigate the dynamic behavior of RBR systems. However, to the best of the authors' knowledge, no comprehensive review on RBR modelling has been reported yet. To address this gap in the literature, this paper reviews and critically discusses the current progress of mechanical model development of RBR systems, and identifies future trends for research. Firstly, five kinds of rolling bearing models, i.e., the lumped-parameter model, the quasi-static model, the quasi-dynamic model, the dynamic model, and the finite element (FE) model are summarized. Then, the coupled modelling between bearing models and various rotor models including De Laval/Jeffcott rotor, rigid rotor, transfer matrix method (TMM) models and FE models are presented. Finally, the paper discusses the key challenges of previous works and provides new insights into understanding of RBR systems for their advanced future engineering applications.

Analytical Model of Water Flow in Coal with Active Matrix

NASA Astrophysics Data System (ADS)

Siemek, Jakub; Stopa, Jerzy

2014-12-01

This paper presents new analytical model of gas-water flow in coal seams in one dimension with emphasis on interactions between water flowing in cleats and coal matrix. Coal as a flowing system, can be viewed as a solid organic material consisting of two flow subsystems: a microporous matrix and a system of interconnected macropores and fractures. Most of gas is accumulated in the microporous matrix, where the primary flow mechanism is diffusion. Fractures and cleats existing in coal play an important role as a transportation system for macro scale flow of water and gas governed by Darcy's law. The coal matrix can imbibe water under capillary forces leading to exchange of mass between fractures and coal matrix. In this paper new partial differential equation for water saturation in fractures has been formulated, respecting mass exchange between coal matrix and fractures. Exact analytical solution has been obtained using the method of characteristics. The final solution has very simple form that may be useful for practical engineering calculations. It was observed that the rate of exchange of mass between the fractures and the coal matrix is governed by an expression which is analogous to the Newton cooling law known from theory of heat exchange, but in present case the mass transfer coefficient depends not only on coal and fluid properties but also on time and position. The constant term of mass transfer coefficient depends on relation between micro porosity and macro porosity of coal, capillary forces, and microporous structure of coal matrix. This term can be expressed theoretically or obtained experimentally. W artykule zaprezentowano nowy model matematyczny przepływu wody i gazu w jednowymiarowej warstwie węglowej z uwzględnieniem wymiany masy między systemem szczelin i matrycą węglową. Węgiel jako system przepływowy traktowany jest jako układ o podwójnej porowatości i przepuszczalności, składający się z mikroporowatej matrycy węglowej oraz z systemu szczelin, spękań i ewentualnie największych porów. Przepływowi w systemie szczelin towarzyszyć może wymiana masy z matrycą, której intensywność zależy m.in. od właściwości węgla i warunków panujących w układzie przepływowym. W szczególności matryca węglowa może pochłaniać wodę pod wpływem sił kapilarnych, co wpływa na przepływ w szczelinach. W artykule zostało zaproponowane równanie różniczkowe cząstkowe opisujące nasycenie wodą w systemie szczelin z uwzględnieniem wymiany masy z matrycą pod wpływem sił kapilarnych. Podano dokładne rozwiązanie analityczne, które może być zastosowane w praktyce inżynierskiej. Zauważono, że szybkość wymiany masy między szczelinami i matrycą wyraża się formułą analogiczną do prawa stygnięcia Newtona, ale w analizowanym przypadku współczynnik wymiany masy zależy nie tylko od właściwości węgla i płynów ale również od położenia i czasu. Stały człon tego współczynnika może być obliczony teoretycznie lub wyznaczony eksperymentalnie

Controller design via structural reduced modeling by FETM

NASA Technical Reports Server (NTRS)

Yousuff, A.

1986-01-01

The Finite Element - Transfer Matrix (FETM) method has been developed to reduce the computations involved in analysis of structures. This widely accepted method, however, has certain limitations, and does not directly produce reduced models for control design. To overcome these shortcomings, a modification of FETM method has been developed. The modified FETM method easily produces reduced models that are tailored toward subsequent control design. Other features of this method are its ability to: (1) extract open loop frequencies and mode shapes with less computations, (2) overcome limitations of the original FETM method, and (3) simplify the procedures for output feedback, constrained compensation, and decentralized control. This semi annual report presents the development of the modified FETM, and through an example, illustrates its applicability to an output feedback and a decentralized control design.

Optimal laser wavelength for efficient laser power converter operation over temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Höhn, O., E-mail: oliver.hoehn@ise.fraunhofer.de; Walker, A. W.; Bett, A. W.

2016-06-13

A temperature dependent modeling study is conducted on a GaAs laser power converter to identify the optimal incident laser wavelength for optical power transmission. Furthermore, the respective temperature dependent maximal conversion efficiencies in the radiative limit as well as in a practically achievable limit are presented. The model is based on the transfer matrix method coupled to a two-diode model, and is calibrated to experimental data of a GaAs photovoltaic device over laser irradiance and temperature. Since the laser wavelength does not strongly influence the open circuit voltage of the laser power converter, the optimal laser wavelength is determined tomore » be in the range where the external quantum efficiency is maximal, but weighted by the photon flux of the laser.« less

Controller design via structural reduced modeling by FETM

NASA Technical Reports Server (NTRS)

Yousuff, Ajmal

1987-01-01

The Finite Element-Transfer Matrix (FETM) method has been developed to reduce the computations involved in analysis of structures. This widely accepted method, however, has certain limitations, and does not address the issues of control design. To overcome these, a modification of the FETM method has been developed. The new method easily produces reduced models tailored toward subsequent control design. Other features of this method are its ability to: (1) extract open loop frequencies and mode shapes with less computations, (2) overcome limitations of the original FETM method, and (3) simplify the design procedures for output feedback, constrained compensation, and decentralized control. This report presents the development of the new method, generation of reduced models by this method, their properties, and the role of these reduced models in control design. Examples are included to illustrate the methodology.

An Innovative Sensing Approach Using Carbon Nanotube-Based Composites for Structural Health Monitoring of Concrete Structures

NASA Astrophysics Data System (ADS)

Dwivedi, Vatsal

This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.

Resonance Energy Transfer Studies from Derivatives of Thiophene Substituted 1,3,4-Oxadiazoles to Coumarin-334 Dye in Liquid and Dye-Doped Polymer Media

NASA Astrophysics Data System (ADS)

Naik, Lohit; Deshapande, Narahari; Khazi, Imtiyaz Ahamed M.; Malimath, G. H.

2018-02-01

In the present work, we have carried out energy transfer studies using newly synthesised derivatives of thiophene substituted 1,3,4-oxadiazoles namely, 2-(-4-(thiophene-3-yl)phenyl)-5-(5-(thiophene-3-yl)thiophene-2-yl)-1,3,4-oxadiazole [TTO], 2-(-4-(benzo[b]thiophene-2-yl)phenyl)-5-(5-(benzo[b]thiophene-2-yl)-1,3,4-oxadiozole [TBO] and 2-(4-(4-(trifluoromethyl)phenyl)phenyl)-5-(5-(4-(trifluoromethyl)phenyl)thiophen-2-yl)-1,3,4-oxadiazole [TMO] as donors and laser dye coumarin-334 as acceptor in ethanol and dye-doped polymer (poly(methyl methacrylate) (PMMA)) media following steady-state and time-resolved fluorescence methods. Bimolecular quenching constant ( k q), translation diffusion rate parameter ( k d), diffusion length ( D l), critical transfer distance ( R 0), donor- acceptor distance ( r) and energy transfer efficiency ( E T) are calculated. It is observed that, critical transfer distance is more than the diffusion length for all the pairs. Further, bimolecular quenching constant is also more than the translation diffusion rate parameter. Hence, our experimental findings suggest that overall energy transfer is due to Förster resonance energy transfer (FRET) between donor and acceptor in both the media and for all the pairs. In addition, considerable increase in fluorescence intensity and energy transfer efficiency is observed in dye-doped polymer matrix systems as compared to liquid media. This suggests that, these donor-acceptor pairs doped in PMMA matrix may be used for applications such as energy transfer dye lasers (ETDL) to improve the efficiency and photostability, to enhance tunability and for plastic scintillation detectors.

Multi-cut solutions in Chern-Simons matrix models

NASA Astrophysics Data System (ADS)

Morita, Takeshi; Sugiyama, Kento

2018-04-01

We elaborate the Chern-Simons (CS) matrix models at large N. The saddle point equations of these matrix models have a curious structure which cannot be seen in the ordinary one matrix models. Thanks to this structure, an infinite number of multi-cut solutions exist in the CS matrix models. Particularly we exactly derive the two-cut solutions at finite 't Hooft coupling in the pure CS matrix model. In the ABJM matrix model, we argue that some of multi-cut solutions might be interpreted as a condensation of the D2-brane instantons.

Coupled near-field and far-field exposure assessment framework for chemicals in consumer products.

PubMed

Fantke, Peter; Ernstoff, Alexi S; Huang, Lei; Csiszar, Susan A; Jolliet, Olivier

2016-09-01

Humans can be exposed to chemicals in consumer products through product use and environmental emissions over the product life cycle. Exposure pathways are often complex, where chemicals can transfer directly from products to humans during use or exchange between various indoor and outdoor compartments until sub-fractions reach humans. To consistently evaluate exposure pathways along product life cycles, a flexible mass balance-based assessment framework is presented structuring multimedia chemical transfers in a matrix of direct inter-compartmental transfer fractions. By matrix inversion, we quantify cumulative multimedia transfer fractions and exposure pathway-specific product intake fractions defined as chemical mass taken in by humans per unit mass of chemical in a product. Combining product intake fractions with chemical mass in the product yields intake estimates for use in life cycle impact assessment and chemical alternatives assessment, or daily intake doses for use in risk-based assessment and high-throughput screening. Two illustrative examples of chemicals used in personal care products and flooring materials demonstrate how this matrix-based framework offers a consistent and efficient way to rapidly compare exposure pathways for adult and child users and for the general population. This framework constitutes a user-friendly approach to develop, compare and interpret multiple human exposure scenarios in a coupled system of near-field ('user' environment), far-field and human intake compartments, and helps understand the contribution of individual pathways to overall human exposure in various product application contexts to inform decisions in different science-policy fields for which exposure quantification is relevant. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

A new method for the calculation of the conductivity of inhomogeneous systems

NASA Astrophysics Data System (ADS)

Byshkin, M. S.; Turkin, A. A.

2005-06-01

A new method for computing the conductivity of random irregular resistor networks is developed. This method is a generalization of the transfer-matrix technique, proposed by Derrida and Vannimenus for regular 2D and 3D lattices. At the same time for large systems the method presented in this paper is more efficient than the transfer-matrix technique. To demonstrate the method it is applied to a cubic lattice at the percolation threshold and away from it. The conductivity has been found for lattices with size up to 3243. The ratio between the conductivity exponent t and the correlation length exponent η was estimated to be t/η = 2.315, in good agreement with the literature data.

Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

NASA Astrophysics Data System (ADS)

Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

2018-03-01

We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

Coherence Evolution and Transfer Supplemented by Sender's Initial-State Restoring

NASA Astrophysics Data System (ADS)

Fel'dman, E. B.; Zenchuk, A. I.

2017-12-01

The evolution of quantum coherences comes with a set of conservation laws provided that the Hamiltonian governing this evolution conserves the spin-excitation number. At that, coherences do not intertwist during the evolution. Using the transmission line and the receiver in the initial ground state we can transfer the coherences to the receiver without interaction between them, although the matrix elements contributing to each particular coherence intertwist in the receiver's state. Therefore we propose a tool based on the unitary transformation at the receiver side to untwist these elements and thus restore (at least partially) the structure of the sender's initial density matrix. A communication line with two-qubit sender and receiver is considered as an example of implementation of this technique.

Thermal Energy Transfer Through All Ceramic Restorations

DTIC Science & Technology

2016-06-01

particles, but newer generations have reduced the size and narrowed the range of particles in the matrix . This evolution in ceramics improved the...crystalline second phase. These ceramics have a lithium silicate glass matrix with approximately 70% lithium-disilicate crystal fill. The micron size and... composition category described by Giordano and McLaren are the Interpenetrating Phase Ceramics . These ceramics were developed as an alternative to the

Energy transfer in PPV-based conjugated polymers: a defocused widefield fluorescence microscopy study.

PubMed

Hooley, E N; Tilley, A J; White, J M; Ghiggino, K P; Bell, T D M

2014-04-21

Both pendant and main chain conjugated MEH-PPV based polymers have been studied at the level of single chains using confocal and widefield fluorescence microscopy techniques. In particular, defocused widefield fluorescence is applied to reveal the extent of energy transfer in these polymers by identifying whether they act as single emitters. For main chain conjugated MEH-PPV, molecular weight and the surrounding matrix play a primary role in determining energy transport processes and whether single emitter behaviour is observed. Surprisingly in polymers with a saturated backbone but containing the same pendant MEH-PPV oligomer on each repeating unit, intra-chain energy transfer to a single emitter is also apparent. The results imply there is chromophore heterogeneity that can facilitate energy funneling to the emitting site. Both main chain conjugated and pendant MEH-PPV polymers exhibit changes in orientation of the emission dipole during a fluorescence trajectory of many seconds, whereas a model MEH-PPV oligomer does not. The results suggest that, in the polymers, the nature of the emitting chromophores can change during the time trajectory.

Structures of glycans bound to receptors from saturation transfer difference (STD) NMR spectroscopy: quantitative analysis by using CORCEMA-ST.

PubMed

Enríquez-Navas, Pedro M; Guzzi, Cinzia; Muñoz-García, Juan C; Nieto, Pedro M; Angulo, Jesús

2015-01-01

Glycan-receptor interactions are of fundamental relevance for a large number of biological processes, and their kinetics properties (medium/weak binding affinities) make them appropriated to be studied by ligand observed NMR techniques, among which saturation transfer difference (STD) NMR spectroscopy has been shown to be a very robust and powerful approach. The quantitative analysis of the results from a STD NMR study of a glycan-receptor interaction is essential to be able to translate the resulting spectral intensities into a 3D molecular model of the complex. This chapter describes how to carry out such a quantitative analysis by means of the Complete Relaxation and Conformational Exchange Matrix Approach for STD NMR (CORCEMA-ST), in general terms, and an example of a previous work on an antibody-glycan interaction is also shown.

Effects of Amine and Anhydride Curing Agents on the VARTM Matrix Processing Properties

NASA Technical Reports Server (NTRS)

Grimsley, Brian W.; Hubert, Pascal; Song, Xiaolan; Cano, Roberto J.; Loos, Alfred C.; Pipes, R. Byron

2002-01-01

To ensure successful application of composite structure for aerospace vehicles, it is necessary to develop material systems that meet a variety of requirements. The industry has recently developed a number of low-viscosity epoxy resins to meet the processing requirements associated with vacuum assisted resin transfer molding (VARTM) of aerospace components. The curing kinetics and viscosity of two of these resins, an amine-cured epoxy system, Applied Poleramic, Inc. VR-56-4 1, and an anhydride-cured epoxy system, A.T.A.R.D. Laboratories SI-ZG-5A, have been characterized for application in the VARTM process. Simulations were carried out using the process model, COMPRO, to examine heat transfer, curing kinetics and viscosity for different panel thicknesses and cure cycles. Results of these simulations indicate that the two resins have significantly different curing behaviors and flow characteristics.

Direct detection of ligand binding to Sepharose-immobilised protein using saturation transfer double difference (STDD) NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haselhorst, Thomas; Muenster-Kuehnel, Anja K.; Oschlies, Melanie

2007-08-10

We report an easy and direct application of 'Saturation Transfer Double Difference' (STDD) NMR spectroscopy to identify ligands that bind to a Sepharose-immobilised target protein. The model protein, cytidine 5'-monophosphate sialic acid (CMP-Sia) synthetase, was expressed as a Strep-Tag II fusion protein and immobilised on Strep-Tactin Sepharose. STD NMR experiments of the protein-enriched Sepharose matrix in the presence of a binding ligand (cytidine 5'-triphosphate, CTP) and a non-binding ligand ({alpha}/{beta}-glucose) clearly show that CTP binds to the immobilised enzyme, whereas glucose has no affinity. This approach has three major advantages: (a) only low quantities of protein are required, (b) nomore » specialised NMR technology or the application of additional data analysis by non-routine methods is required, and (c) easy multiple use of the immobilised protein is available.« less

Building the analytical response in frequency domain of AC biased bolometers. Application to Planck/HFI

NASA Astrophysics Data System (ADS)

Sauvé, Alexandre; Montier, Ludovic

2016-12-01

Context: Bolometers are high sensitivity detector commonly used in Infrared astronomy. The HFI instrument of the Planck satellite makes extensive use of them, but after the satellite launch two electronic related problems revealed critical. First an unexpected excess response of detectors at low optical excitation frequency for ν < 1 Hz, and secondly the Analog To digital Converter (ADC) component had been insufficiently characterized on-ground. These two problems require an exquisite knowledge of detector response. However bolometers have highly nonlinear characteristics, coming from their electrical and thermal coupling making them very difficult to model. Goal: We present a method to build the analytical transfer function in frequency domain which describe the voltage response of an Alternative Current (AC) biased bolometer to optical excitation, based on the standard bolometer model. This model is built using the setup of the Planck/HFI instrument and offers the major improvement of being based on a physical model rather than the currently in use had-hoc model based on Direct Current (DC) bolometer theory. Method: The analytical transfer function expression will be presented in matrix form. For this purpose, we build linearized versions of the bolometer electro thermal equilibrium. A custom description of signals in frequency is used to solve the problem with linear algebra. The model performances is validated using time domain simulations. Results: The provided expression is suitable for calibration and data processing. It can also be used to provide constraints for fitting optical transfer function using real data from steady state electronic response and optical response. The accurate description of electronic response can also be used to improve the ADC nonlinearity correction for quickly varying optical signals.

The Mineral–Collagen Interface in Bone

PubMed Central

2015-01-01

The interface between collagen and the mineral reinforcement phase, carbonated hydroxyapatite (cAp), is essential for bone’s remarkable functionality as a biological composite material. The very small dimensions of the cAp phase and the disparate natures of the reinforcement and matrix are essential to the material’s performance but also complicate study of this interface. This article summarizes what is known about the cAp-collagen interface in bone and begins with descriptions of the matrix and reinforcement roles in composites, of the phases bounding the interface, of growth of cAp growing within the collagen matrix, and of the effect of intra- and extrafibrilar mineral on determinations of interfacial properties. Different observed interfacial interactions with cAp (collagen, water, non-collagenous proteins) are reviewed; experimental results on interface interactions during loading are reported as are their influence on macroscopic mechanical properties; conclusions of numerical modeling of interfacial interactions are also presented. The data suggest interfacial interlocking (bending of collagen molecules around cAp nanoplatelets) and water-mediated bonding between collagen and cAp are essential to load transfer. The review concludes with descriptions of areas where new research is needed to improve understanding of how the interface functions. PMID:25824581

Emission mechanisms in stabilized iron-passivated porous silicon: Temperature and laser power dependences

NASA Astrophysics Data System (ADS)

Rahmani, M.; Moadhen, A.; Mabrouk Kamkoum, A.; Zaïbi, M.-A.; Chtourou, R.; Haji, L.; Oueslati, M.

2012-02-01

Photoluminescence (PL) measurements of porous silicon (PS) and iron-porous silicon nanocomposites (PS/Fe) with stable optical properties versus temperature and laser power density have been investigated. The presence of iron in PS matrix is confirmed by Raman spectroscopy. The PL intensity of PS and PS/Fe increases at low temperature, the evolution of integrated PL intensity follows the modified Arrhenius model. The incorporation of iron in PS matrix reduces the activation energy traducing the existence of shallow levels related to iron atoms. Also, the temperature dependence of the porous silicon PL peak position follows a linear evolution at high temperature and a quadratic one at low temperature. Such evolution is due to the thermal carriers' redistribution and an energy transfer. Similarly, we have compared the laser power dependence of the PL in PS and PS/Fe layers. The results prove that the recombination process in PS is realised through the lower energy traps localised in the electronic gap. However, the observed emission in PS/Fe is essentially due to direct transitions. So, we can conclude that the presence of iron in PS matrix induces a strong modification of the PL mechanisms.

Identification and Quantification of Carbon Phases in Conversion Fuel for the Transient Reactor Test Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, Robert; Mata, Angelica; Dunzik-Gougar, Mary Lou

2016-06-01

As part of an overall effort to convert US research reactors to low-enriched uranium (LEU) fuel use, a LEU conversion fuel is being designed for the Transient Reactor Test Facility (TREAT) at the Idaho National Laboratory. TREAT fuel compacts are comprised of UO2 fuel particles in a graphitic matrix material. In order to refine heat transfer modeling, as well as determine other physical and nuclear characteristics of the fuel, the amount and type of graphite and non-graphite phases within the fuel matrix must be known. In this study, we performed a series of complementary analyses, designed to allow detailed characterizationmore » of the graphite and phenolic resin based fuel matrix. Methods included Scanning Electron and Transmission Electron Microscopies, Raman spectroscopy, X-ray Diffraction, and Dual-Beam Focused Ion Beam Tomography. Our results indicate that no single characterization technique will yield all of the desired information; however, through the use of statistical and empirical data analysis, such as curve fitting, partial least squares regression, volume extrapolation and spectra peak ratios, a degree of certainty for the quantity of each phase can be obtained.« less

Nanomechanical modeling of interfaces of polyvinyl alcohol (PVA)/clay nanocomposite

NASA Astrophysics Data System (ADS)

Paliwal, Bhasker; Lawrimore, William B.; Chandler, Mei Q.; Horstemeyer, Mark F.

2017-05-01

We study interfacial debonding of several representative structures of polyvinyl alcohol (PVA)/pyrophillite-clay systems - both gallery-interface (polymer/clay interface in the interlayer region containing polymer between clay layers stacked parallel to each other) and matrix-interphase (polymer/clay interphase-region when individual clay layers are well separated and dispersed in the polymer matrix) - using molecular dynamics simulations, while explicitly accounting for shearing/sliding (i.e. Mode-II) deformation mode. Ten nanocomposite geometries (five 2-D periodic structures for tension and five 1-D periodic structures for shearing) were constructed to quantify the structure-property relations by varying the number density of polymer chains, length of polymer chains and model dimensions related to the interface deformation. The results were subsequently mapped into a cohesive traction-separation law, including evaluation of peak traction and work of separation that are used to characterise the interface load transfer for larger length scale micromechanical models. Results suggest that under a crack nucleation opening mode (i.e. Mode-I), the matrix-interphase exhibits noticeably greater strength and a greater work of separation compared to the gallery-interface; however, they were similar under the shearing/sliding mode of deformation. When compared to shearing/sliding, the tensile peak opening mode stresses were considerably greater but the displacement at the peak stress, the displacement at the final failure and the work of separation were considerably lower. Results also suggest that PVA/clay nanocomposites with higher degree of exfoliation compared with nanocomposites with higher clay-intercalation can potentially display higher strength under tension-dominated loading for a given clay volume fraction.

The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

NASA Astrophysics Data System (ADS)

Henry, Jackson; Blair, Enrique P.

2018-02-01

Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

Automatic computation of transfer functions

DOEpatents

Atcitty, Stanley; Watson, Luke Dale

2015-04-14

Technologies pertaining to the automatic computation of transfer functions for a physical system are described herein. The physical system is one of an electrical system, a mechanical system, an electromechanical system, an electrochemical system, or an electromagnetic system. A netlist in the form of a matrix comprises data that is indicative of elements in the physical system, values for the elements in the physical system, and structure of the physical system. Transfer functions for the physical system are computed based upon the netlist.

Ultrawide low frequency band gap of phononic crystal in nacreous composite material

NASA Astrophysics Data System (ADS)

Yin, J.; Huang, J.; Zhang, S.; Zhang, H. W.; Chen, B. S.

2014-06-01

The band structure of a nacreous composite material is studied by two proposed models, where an ultrawide low frequency band gap is observed. The first model (tension-shear chain model) with two phases including brick and mortar is investigated to describe the wave propagation in the nacreous composite material, and the dispersion relation is calculated by transfer matrix method and Bloch theorem. The results show that the frequency ranges of the pass bands are quite narrow, because a special tension-shear chain motion in the nacreous composite material is formed by some very slow modes. Furthermore, the second model (two-dimensional finite element model) is presented to investigate its band gap by a multi-level substructure scheme. Our findings will be of great value to the design and synthesis of vibration isolation materials in a wide and low frequency range. Finally, the transmission characteristics are calculated to verify the results.

Targeting Ballistic Lunar Capture Trajectories Using Periodic Orbits in the Sun-Earth CRTBP

NASA Technical Reports Server (NTRS)

Cooley, D.S.; Griesemer, Paul Ricord; Ocampo, Cesar

2009-01-01

A particular periodic orbit in the Earth-Sun circular restricted three body problem is shown to have the characteristics needed for a ballistic lunar capture transfer. An injection from a circular parking orbit into the periodic orbit serves as an initial guess for a targeting algorithm. By targeting appropriate parameters incrementally in increasingly complicated force models and using precise derivatives calculated from the state transition matrix, a reliable algorithm is produced. Ballistic lunar capture trajectories in restricted four body systems are shown to be able to be produced in a systematic way.

Effective load transfer by a chromium carbide nanostructure in a multi-walled carbon nanotube/copper matrix composite

NASA Astrophysics Data System (ADS)

Cho, Seungchan; Kikuchi, Keiko; Kawasaki, Akira; Kwon, Hansang; Kim, Yangdo

2012-08-01

Multi-walled carbon nanotube (MWCNT) reinforced copper (Cu) matrix composites, which exhibit chromium (Cr) carbide nanostructures at the MWCNT/Cu interface, were prepared through a carbide formation using CuCr alloy powder. The fully densified and oriented MWCNTs dispersed throughout the composites were prepared using spark plasma sintering (SPS) followed by hot extrusion. The tensile strengths of the MWCNT/CuCr composites increased with increasing MWCNTs content, while the tensile strength of MWCNT/Cu composite decreased from that of monolithic Cu. The enhanced tensile strength of the MWCNT/CuCr composites is a result of possible load-transfer mechanisms of the interfacial Cr carbide nanostructures. The multi-wall failure of MWCNTs observed in the fracture surface of the MWCNT/CuCr composites indicates an improvement in the load-bearing capacity of the MWCNTs. This result shows that the Cr carbide nanostructures effectively transferred the tensile load to the MWCNTs during fracture through carbide nanostructure formation in the MWCNT/Cu composite.

Effective matrix diffusion in kilometer‐scale transport in fractured crystalline rock

USGS Publications Warehouse

Shapiro, Allen M.

2001-01-01

Concentrations of tritium (3H) and dichlorodifluoromethane (CFC‐12) in water samples taken from glacial drift and fractured crystalline rock over 4 km2 in central New Hampshire are interpreted to identify a conceptual model of matrix diffusion and the magnitude of the diffusion coefficient. Dispersion and mass transfer to and from fractures has affected the 3H concentration to the extent that the peak 3H concentration of the 1960s is no longer distinguishable. Because of heterogeneity in the bedrock the sparsely distributed chemical data do not warrant a three‐dimensional transport model. Instead, a one‐dimensional model of CFC‐12 and 3H migration along flow lines in the glacial drift and bedrock is used to place bounds on the processes affecting kilometer‐scale transport, arid model parameters are varied to reproduce the measured relation between 3H and CFC‐12, rather than their spatial distributions. A model of mass exchange to and from fractures that is dependent on the time‐varying concentration gradient at fracture surfaces qualitatively reproduces the measured relation between 3H and CFC‐12 with an upper bound for the fracture dispersivity approximately equal to 250 m and a lower bound for the effective matrix diffusion coefficient equal to 1 m2 yr−1. The diffusion coefficient at the kilometer scale is at least 3 orders of magnitude greater than laboratory estimates of diffusion in crystalline rock. The large diffusion coefficient indicates that diffusion into an immobile fluid phase (rock matrix) is masked at the kilometer scale by advective mass exchange between fractures with large contrasts in trarismissivity. The measured transmissivity of fractures in the study area varies over more than 6 orders of magnitude. Advective mass exchange from high‐permeability fractures to low‐permeability fractures results in short migration distances of a chemical constituent in low‐permeability fractures over an extended period of time before reentering high‐permeability fractures; viewed at the kilometer scale, this process is analogous to the chemical constituent diffusing into and out of an immobile fluid phase.

Temporal switching of homo-FRET pathways in single-chromophore dimer models of π-conjugated polymers.

PubMed

Stangl, Thomas; Bange, Sebastian; Schmitz, Daniela; Würsch, Dominik; Höger, Sigurd; Vogelsang, Jan; Lupton, John M

2013-01-09

A set of π-conjugated oligomer dimers templated in molecular scaffolds is presented as a model system for studying the interactions between chromophores in conjugated polymers (CPs). Single-molecule spectroscopy was used to reveal energy transfer dynamics between two oligomers in either a parallel or oblique-angle geometry. In particular, the conformation of single molecules embedded in a host matrix was investigated via polarized excitation and emission fluorescence microscopy in combination with fluorescence correlation spectroscopy. While the intramolecular interchromophore conformation was found to have no impact on the fluorescence quantum yield, lifetime, or photon statistics (antibunching), the long-term nonequilibrium dynamics of energy transfer within these bichromophoric systems was accessible by studying the linear dichroism in emission at the single-molecule level, which revealed reversible switching of the emission between the two oligomers. In bulk polymer films, interchromophore coupling promotes the migration of excitation energy to quenching sites. Realizing the presence and dynamics of such interactions is crucial for understanding limitations on the quantum efficiency of larger CP materials.

Advanced Doubling Adding Method for Radiative Transfer in Planetary Atmospheres

NASA Astrophysics Data System (ADS)

Liu, Quanhua; Weng, Fuzhong

2006-12-01

The doubling adding method (DA) is one of the most accurate tools for detailed multiple-scattering calculations. The principle of the method goes back to the nineteenth century in a problem dealing with reflection and transmission by glass plates. Since then the doubling adding method has been widely used as a reference tool for other radiative transfer models. The method has never been used in operational applications owing to tremendous demand on computational resources from the model. This study derives an analytical expression replacing the most complicated thermal source terms in the doubling adding method. The new development is called the advanced doubling adding (ADA) method. Thanks also to the efficiency of matrix and vector manipulations in FORTRAN 90/95, the advanced doubling adding method is about 60 times faster than the doubling adding method. The radiance (i.e., forward) computation code of ADA is easily translated into tangent linear and adjoint codes for radiance gradient calculations. The simplicity in forward and Jacobian computation codes is very useful for operational applications and for the consistency between the forward and adjoint calculations in satellite data assimilation.

A Model To Estimate the Sources of Tobacco-Specific Nitrosamines in Cigarette Smoke.

PubMed

Lipowicz, Peter J; Seeman, Jeffrey I

2017-08-21

Tobacco-specific nitrosamines (TSNAs) are one of the most extensively and continually studied classes of compounds found in tobacco and cigarette smoke.1-5 The TSNAs N-nitrosonornicotine (NNN) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) have been characterized by the US Food and Drug Administration (FDA) as harmful and potentially harmful constituents in tobacco products,6 and cigarette manufacturers report their levels in cigarette tobacco filler and cigarette smoke to the FDA. NNN and NNK are classified by IARC as carcinogenic to humans.7 TSNAs transfer from tobacco to smoke by evaporation driven by heat and the flow of gases down the cigarette rod. Other TSNA sources in smoke include pyrorelease, where room temperature-unextractable TSNAs are released by smoking, and pyrosynthesis, where TSNAs are formed by reactions during smoking. We propose the first model that quantifies these three sources of TSNA in smoke. In our model, evaporative transfer efficiency of a TSNA is equated to the evaporative transfer efficiency of nicotine. Smoke TSNA measured in excess of what is transferred by evaporation is termed "pyrogeneration," which is the net sum of pyrorelease and pyrosynthesis minus pyrodegredation. This model requires no internal standard, is applicable to commercial cigarettes "as is," and uses existing analytical methods. This model was applied to archived Philip Morris USA data. For commercial blended cigarettes, NNN pyrogeneration appears to be unimportant, but NNK pyrogeneration contributes roughly 30-70% of NNK in smoke with the greater contribution at lower tobacco NNK levels. This means there is an opportunity to significantly reduce smoke NNK by up to 70% if pyrogeneration can be decreased or eliminated, perhaps by finding a way to grow and cure tobacco with reduced matrix-bound NNK. For burley research cigarettes, pyrogeneration may account for 90% or more of both NNN and NNK in smoke.

Theoretical Investigation of OCN(-) Charge Transfer Complexes in Condensed Phase Media: Spectroscopic Properties in Amorphous Ice

NASA Technical Reports Server (NTRS)

Park, Jin-Young; Woon, David E.

2004-01-01

Density functional theory (DFT) calculations of cyanate (OCN(-)) charge-transfer complexes were performed to model the "XCN" feature observed in interstellar icy grain mantles. OCN(-) charge-transfer complexes were formed from precursor combinations of HNCO or HOCN with either NH3 or H2O. Three different solvation strategies for realistically modeling the ice matrix environment were explored, including (1) continuum solvation, (2) pure DFT cluster calculations, and (3) an ONIOM DFT/PM3 cluster calculation. The model complexes were evaluated by their ability to reproduce seven spectroscopic measurements associated with XCN: the band origin of the OCN(-) asymmetric stretching mode, shifts in that frequency due to isotopic substitutions of C, N, O, and H, plus two weak features. The continuum solvent field method produced results consistent with some of the experimental data but failed to account for other behavior due to its limited capacity to describe molecular interactions with solvent. DFT cluster calculations successfully reproduced the available spectroscopic measurements very well. In particular, the deuterium shift showed excellent agreement in complexes where OCN(-) was fully solvated. Detailed studies of representative complexes including from two to twelve water molecules allowed the exploration of various possible solvation structures and provided insights into solvation trends. Moreover, complexes arising from cyanic or isocyanic acid in pure water suggested an alternative mechanism for the formation of OCN(-) charge-transfer complexes without the need for a strong base such as NH3 to be present. An extended ONIOM (B3LYP/PM3) cluster calculation was also performed to assess the impact of a more realistic environment on HNCO dissociation in pure water.

A new fracture mechanics model for multiple matrix cracks of SiC fiber reinforced brittle-matrix composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okabe, T.; Takeda, N.; Komotori, J.

1999-11-26

A new model is proposed for multiple matrix cracking in order to take into account the role of matrix-rich regions in the cross section in initiating crack growth. The model is used to predict the matrix cracking stress and the total number of matrix cracks. The model converts the matrix-rich regions into equivalent penny shape crack sizes and predicts the matrix cracking stress with a fracture mechanics crack-bridging model. The estimated distribution of matrix cracking stresses is used as statistical input to predict the number of matrix cracks. The results show good agreement with the experimental results by replica observations.more » Therefore, it is found that the matrix cracking behavior mainly depends on the distribution of matrix-rich regions in the composite.« less

The Extracellular Matrix in Photosynthetic Mats: A Cyanobacterial Gingerbread House

NASA Astrophysics Data System (ADS)

Stuart, R.; Stannard, W.; Bebout, B.; Pett-Ridge, J.; Mayali, X.; Weber, P. K.; Lipton, M. S.; Lee, J.; Everroad, R. C.; Thelen, M.

2014-12-01

Hypersaline laminated cyanobacterial mats are excellent model systems for investigating photoautotrophic contributions to biogeochemical cycling on a millimeter scale. These self-sustaining ecosystems are characterized by steep physiochemical gradients that fluctuate dramatically on hour timescales, providing a dynamic environment to study microbial response. However, elucidating the distribution of energy from light absorption into biomass requires a complete understanding of the various constituents of the mat. Extracellular polymeric substances (EPS), which can be composed of proteins, polysaccharides, lipids and DNA are a major component of these mats and may function in the redistribution of nutrients and metabolites within the community. To test this notion, we established a model mat-building culture for comparison with the phylogenetically diverse natural mat communities. In these two systems we determined how proteins and glycans in the matrix changed as a function of light and tracked nutrient flow from the matrix. Using mass spectrometry metaproteomics analysis, we found homologous proteins in both field and culture extracellular matrix that point to cyanobacterial turnover of amino acids, inorganic nutrients, carbohydrates and nucleic acids from the EPS. Other abundant functions identified included oxidative stress response from both the cyanobacteria and heterotrophs and cyanobacterial structural proteins that may play a role in mat cohesion. Several degradative enzymes also varied in abundance in the EPS in response to light availability, suggesting active secretion. To further test cyanobacterial EPS turnover, we generated isotopically-labeled EPS and used NanoSIMS to trace uptake of this labeled EPS. Our findings suggest Cyanobacteria may facilitate nutrient transfer to other groups, as well as uptake of their own products through degradation of EPS components. This work provides evidence for the essential roles of EPS for storage, structural cohesion and protection, with active light-dependent turnover by both Cyanobacteria and the heterotrophic community.

Analysis of heating, ventilation, and air conditioning ducts as a radio frequency communication channel

NASA Astrophysics Data System (ADS)

Nikitin, Pavel Viktorovich

2002-01-01

A typical HVAC duct system is a network of interconnected hollow metal pipes which can serve as waveguides and carry electromagnetic waves. This work presents an analysis of this system as a radio frequency communication channel. Two main parts of the analysis include channel modelling and antenna design. The propagation modelling approach used here is based on the waveguide mode theory and employs the transfer matrix method to describe propagation through various cascaded HVAC elements. This allows one to model the channel response in the frequency domain. Impulse response characteristics of the ducts are also analyzed in this work. The approximate transfer matrices of cylindrical straight sections, bends, and tapers are derived analytically. The transforming properties of cylindrical T-junctions are analyzed experimentally. Antenna designs in waveguides and free-space are different. In waveguides, mode excitation characteristics are important as well as the impedance match. The criteria for antenna design in waveguides are presented here. Antennas analyzed in this work are monopole antennas, dipole antennas, and antenna arrays. The developed model can predict both channel response and antenna characteristics for a given geometry and dimensions of the duct system and the antennas. The model is computationally efficient and can potentially be applied to duct systems of multiple story buildings. The accuracy of the model has been validated with extensive experimental measurements on real HVAC ducts.

On the Equivalence of the Summation and Transfer-Matrix Methods in Wave Propagation through Multilayers of Lossless and Lossy Media

ERIC Educational Resources Information Center

Pereyra, Pedro; Robledo-Martinez, Arturo

2009-01-01

We explicitly show that the well-known transmission and reflection amplitudes of planar slabs, obtained via an algebraic summation of Fresnel amplitudes, are completely equivalent to those obtained from transfer matrices in the scattering approach. This equivalence makes the finite periodic systems theory a powerful alternative to the cumbersome…

Real-time observation of intramolecular proton transfer in the electronic ground state of chloromalonaldehyde: an ab initio study of time-resolved photoelectron spectra.

PubMed

do N Varella, Márcio T; Arasaki, Yasuki; Ushiyama, Hiroshi; Takatsuka, Kazuo; Wang, Kwanghsi; McKoy, Vincent

2007-02-07

The authors report on studies of time-resolved photoelectron spectra of intramolecular proton transfer in the ground state of chloromalonaldehyde, employing ab initio photoionization matrix elements and effective potential surfaces of reduced dimensionality, wherein the couplings of proton motion to the other molecular vibrational modes are embedded by averaging over classical trajectories. In the simulations, population is transferred from the vibrational ground state to vibrationally hot wave packets by pumping to an excited electronic state and dumping with a time-delayed pulse. These pump-dump-probe simulations demonstrate that the time-resolved photoelectron spectra track proton transfer in the electronic ground state well and, furthermore, that the geometry dependence of the matrix elements enhances the tracking compared with signals obtained with the Condon approximation. Photoelectron kinetic energy distributions arising from wave packets localized in different basins are also distinguishable and could be understood, as expected, on the basis of the strength of the optical couplings in different regions of the ground state potential surface and the Franck-Condon overlaps of the ground state wave packets with the vibrational eigenstates of the ion potential surface.

A vibration model for centrifugal contactors

NASA Astrophysics Data System (ADS)

Leonard, R. A.; Wasserman, M. O.; Wygmans, D. G.

1992-11-01

Using the transfer matrix method, we created the Excel worksheet 'Beam' for analyzing vibrations in centrifugal contactors. With this worksheet, a user can calculate the first natural frequency of the motor/rotor system for a centrifugal contactor. We determined a typical value for the bearing stiffness (k(sub B)) of a motor after measuring the k(sub B) value for three different motors. The k(sub B) value is an important parameter in this model, but it is not normally available for motors. The assumptions that we made in creating the Beam worksheet were verified by comparing the calculated results with those from a VAX computer program, BEAM IV. The Beam worksheet was applied to several contactor designs for which we have experimental data and found to work well.

Problems encountered with conventional fiber-reinforced composites

NASA Technical Reports Server (NTRS)

Landel, R. F.

1981-01-01

Preparational, computational, and operational problems associated with fiber-reinforced composites (FRC) are reviewed. Initial preparation of FRCs is shown to involve consideration of the type of prepreg, the setting time, cure conditions and cycles, and cure temperatures. The effects of the choice of bonding agents, the fiber transfer length, and individual fiber responses to bonding agents are noted to have an impact on fiber strength, moisture uptake, and fatigue resistance. The deformation prior to failure and the failure region are modeled through models of mini-, micro- and macro mechanics formulations employing a stiffness matrix, failure criterion, or fracture mechanics. The detection, evaluation, and repair of defects comprises the operational domain, and it is stressed that no good repair techniques exist for FRCs.

Phase transition in the spin- 3 / 2 Blume-Emery-Griffiths model with antiferromagnetic second neighbor interactions

NASA Astrophysics Data System (ADS)

Yezli, M.; Bekhechi, S.; Hontinfinde, F.; EZ-Zahraouy, H.

2016-04-01

Two nonperturbative methods such as Monte-Carlo simulation (MC) and Transfer-Matrix Finite-Size-Scaling calculations (TMFSS) have been used to study the phase transition of the spin- 3 / 2 ​Blume-Emery-Griffiths model (BEG) with quadrupolar and antiferromagnetic next-nearest-neighbor exchange interactions. Ground state and finite temperature phase diagrams are obtained by means of these two methods. New degenerate phases are found and only second order phase transitions occur for all values of the parameter interactions. No sign of the intermediate phase is found from both methods. Critical exponents are also obtained from TMFSS calculations. Ising criticality and nonuniversal behaviors are observed depending on the strength of the second neighbor interaction.

Vibrational and vibronic coherences in the dynamics of the FMO complex

NASA Astrophysics Data System (ADS)

Liu, Xiaomeng; Kühn, Oliver

2016-12-01

The coupled exciton-vibrational dynamics of a seven site Frenkel exciton model of the Fenna-Matthews-Olson (FMO) complex is investigated using a Quantum Master Equation approach. Thereby, one vibrational mode per monomer is treated explicitly as being part of the relevant system. Emphasis is put on the comparison of this model with that of a purely excitonic relevant system. Further, the effects of two different approximations to the exciton-vibrational basis are investigated, namely the one- and two-particle description. Analysis of the vibronic and vibrational density matrix in the site basis points to the importance of on- and inter-site coherences for the exciton transfer. Here, one- and two-particle approximations give rise to qualitatively different results.