A transfer matrix approach to vibration localization in mistuned blade assemblies

NASA Technical Reports Server (NTRS)

Ottarson, Gisli; Pierre, Chritophe

1993-01-01

A study of mode localization in mistuned bladed disks is performed using transfer matrices. The transfer matrix approach yields the free response of a general, mono-coupled, perfectly cyclic assembly in closed form. A mistuned structure is represented by random transfer matrices, and the expansion of these matrices in terms of the small mistuning parameter leads to the definition of a measure of sensitivity to mistuning. An approximation of the localization factor, the spatially averaged rate of exponential attenuation per blade-disk sector, is obtained through perturbation techniques in the limits of high and low sensitivity. The methodology is applied to a common model of a bladed disk and the results verified by Monte Carlo simulations. The easily calculated sensitivity measure may prove to be a valuable design tool due to its system-independent quantification of mistuning effects such as mode localization.

I-V characterization of a quantum well infrared photodetector with stepped and graded barriers

NASA Astrophysics Data System (ADS)

Nutku, F.; Erol, A.; Gunes, M.; Buklu, L. B.; Ergun, Y.; Arikan, M. C.

2012-09-01

I-V characterization of an n-type quantum well infrared photodetector which consists of stepped and graded barriers has been done under dark at temperatures between 20-300 K. Different current transport mechanisms and transition between them have been observed at temperature around 47 K. Activation energies of the electrons at various bias voltages have been obtained from the temperature dependent I-V measurements. Activation energy at zero bias has been calculated by extrapolating the bias dependence of the activation energies. Ground state energies and barrier heights of the four different quantum wells have been calculated by using an iterative technique, which depends on experimentally obtained activation energy. Ground state energies also have been calculated with transfer matrix technique and compared with iteration results. Incorporating the effect of high electron density induced electron exchange interaction on ground state energies; more consistent results with theoretical transfer matrix calculations have been obtained.

Exact first order scattering correction for vector radiative transfer in coupled atmosphere and ocean systems

NASA Astrophysics Data System (ADS)

Zhai, Peng-Wang; Hu, Yongxiang; Josset, Damien B.; Trepte, Charles R.; Lucker, Patricia L.; Lin, Bing

2012-06-01

We have developed a Vector Radiative Transfer (VRT) code for coupled atmosphere and ocean systems based on the successive order of scattering (SOS) method. In order to achieve efficiency and maintain accuracy, the scattering matrix is expanded in terms of the Wigner d functions and the delta fit or delta-M technique is used to truncate the commonly-present large forward scattering peak. To further improve the accuracy of the SOS code, we have implemented the analytical first order scattering treatment using the exact scattering matrix of the medium in the SOS code. The expansion and truncation techniques are kept for higher order scattering. The exact first order scattering correction was originally published by Nakajima and Takana.1 A new contribution of this work is to account for the exact secondary light scattering caused by the light reflected by and transmitted through the rough air-sea interface.

Fast radiative transfer models for retrieval of cloud properties in the back-scattering region: application to DSCOVR-EPIC sensor

NASA Astrophysics Data System (ADS)

Molina Garcia, Victor; Sasi, Sruthy; Efremenko, Dmitry; Doicu, Adrian; Loyola, Diego

2017-04-01

In this work, the requirements for the retrieval of cloud properties in the back-scattering region are described, and their application to the measurements taken by the Earth Polychromatic Imaging Camera (EPIC) on board the Deep Space Climate Observatory (DSCOVR) is shown. Various radiative transfer models and their linearizations are implemented, and their advantages and issues are analyzed. As radiative transfer calculations in the back-scattering region are computationally time-consuming, several acceleration techniques are also studied. The radiative transfer models analyzed include the exact Discrete Ordinate method with Matrix Exponential (DOME), the Matrix Operator method with Matrix Exponential (MOME), and the approximate asymptotic and equivalent Lambertian cloud models. To reduce the computational cost of the line-by-line (LBL) calculations, the k-distribution method, the Principal Component Analysis (PCA) and a combination of the k-distribution method plus PCA are used. The linearized radiative transfer models for retrieval of cloud properties include the Linearized Discrete Ordinate method with Matrix Exponential (LDOME), the Linearized Matrix Operator method with Matrix Exponential (LMOME) and the Forward-Adjoint Discrete Ordinate method with Matrix Exponential (FADOME). These models were applied to the EPIC oxygen-A band absorption channel at 764 nm. It is shown that the approximate asymptotic and equivalent Lambertian cloud models give inaccurate results, so an offline processor for the retrieval of cloud properties in the back-scattering region requires the use of exact models such as DOME and MOME, which behave similarly. The combination of the k-distribution method plus PCA presents similar accuracy to the LBL calculations, but it is up to 360 times faster, and the relative errors for the computed radiances are less than 1.5% compared to the results when the exact phase function is used. Finally, the linearized models studied show similar behavior, with relative errors less than 1% for the radiance derivatives, but FADOME is 2 times faster than LDOME and 2.5 times faster than LMOME.

A revised version of the transfer matrix method to analyze one-dimensional structures

NASA Technical Reports Server (NTRS)

Nitzsche, F.

1983-01-01

A new and general method to analyze both free and forced vibration characteristics of one-dimensional structures is discussed in this paper. This scheme links for the first time the classical transfer matrix method with the recently developed integrating matrix technique to integrate systems of differential equations. Two alternative approaches to the problem are presented. The first is based upon the lumped parameter model to account for the inertia properties of the structure. The second releases that constraint allowing a more precise description of the physical system. The free vibration of a straight uniform beam under different support conditions is analyzed to test the accuracy of the two models. Finally some results for the free vibration of a 12th order system representing a curved, rotating beam prove that the present method is conveniently extended to more complicated structural dynamics problems.

Effect of proton transfer on the electronic coupling in DNA

NASA Astrophysics Data System (ADS)

Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

2006-06-01

The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

Sandwiched confinement of quantum dots in graphene matrix for efficient electron transfer and photocurrent production

PubMed Central

Zhu, Nan; Zheng, Kaibo; Karki, Khadga J.; Abdellah, Mohamed; Zhu, Qiushi; Carlson, Stefan; Haase, Dörthe; Žídek, Karel; Ulstrup, Jens; Canton, Sophie E.; Pullerits, Tõnu; Chi, Qijin

2015-01-01

Quantum dots (QDs) and graphene are both promising materials for the development of new-generation optoelectronic devices. Towards this end, synergic assembly of these two building blocks is a key step but remains a challenge. Here, we show a one-step strategy for organizing QDs in a graphene matrix via interfacial self-assembly, leading to the formation of sandwiched hybrid QD-graphene nanofilms. We have explored structural features, electron transfer kinetics and photocurrent generation capacity of such hybrid nanofilms using a wide variety of advanced techniques. Graphene nanosheets interlink QDs and significantly improve electronic coupling, resulting in fast electron transfer from photoexcited QDs to graphene with a rate constant of 1.3 × 109 s−1. Efficient electron transfer dramatically enhances photocurrent generation in a liquid-junction QD-sensitized solar cell where the hybrid nanofilm acts as a photoanode. We thereby demonstrate a cost-effective method to construct large-area QD-graphene hybrid nanofilms with straightforward scale-up potential for optoelectronic applications. PMID:25996307

Sandwiched confinement of quantum dots in graphene matrix for efficient electron transfer and photocurrent production

NASA Astrophysics Data System (ADS)

Zhu, Nan; Zheng, Kaibo; Karki, Khadga J.; Abdellah, Mohamed; Zhu, Qiushi; Carlson, Stefan; Haase, Dörthe; Žídek, Karel; Ulstrup, Jens; Canton, Sophie E.; Pullerits, Tõnu; Chi, Qijin

2015-05-01

Quantum dots (QDs) and graphene are both promising materials for the development of new-generation optoelectronic devices. Towards this end, synergic assembly of these two building blocks is a key step but remains a challenge. Here, we show a one-step strategy for organizing QDs in a graphene matrix via interfacial self-assembly, leading to the formation of sandwiched hybrid QD-graphene nanofilms. We have explored structural features, electron transfer kinetics and photocurrent generation capacity of such hybrid nanofilms using a wide variety of advanced techniques. Graphene nanosheets interlink QDs and significantly improve electronic coupling, resulting in fast electron transfer from photoexcited QDs to graphene with a rate constant of 1.3 × 109 s-1. Efficient electron transfer dramatically enhances photocurrent generation in a liquid-junction QD-sensitized solar cell where the hybrid nanofilm acts as a photoanode. We thereby demonstrate a cost-effective method to construct large-area QD-graphene hybrid nanofilms with straightforward scale-up potential for optoelectronic applications.

Automatic transfer function generation for volume rendering of high-resolution x-ray 3D digital mammography images

NASA Astrophysics Data System (ADS)

Alyassin, Abdal M.

2002-05-01

3D Digital mammography (3DDM) is a new technology that provides high resolution X-ray breast tomographic data. Like any other tomographic medical imaging modalities, viewing a stack of tomographic images may require time especially if the images are of large matrix size. In addition, it may cause difficulty to conceptually construct 3D breast structures. Therefore, there is a need to readily visualize the data in 3D. However, one of the issues that hinder the usage of volume rendering (VR) is finding an automatic way to generate transfer functions that efficiently map the important diagnostic information in the data. We have developed a method that randomly samples the volume. Based on the mean and the standard deviation of these samples, the technique determines the lower limit and upper limit of a piecewise linear ramp transfer function. We have volume rendered several 3DDM data using this technique and compared visually the outcome with the result from a conventional automatic technique. The transfer function generated through the proposed technique provided superior VR images over the conventional technique. Furthermore, the improvement in the reproducibility of the transfer function correlated with the number of samples taken from the volume at the expense of the processing time.

Effects of multiple scattering and surface albedo on the photochemistry of the troposphere

NASA Technical Reports Server (NTRS)

Augustsson, T. R.; Tiwari, S. N.

1981-01-01

The effect of treatment of incoming solar radiation on the photochemistry of the troposphere is discussed. A one dimensional photochemical model of the troposphere containing the species of the nitrogen, oxygen, carbon, hydrogen, and sulfur families was developed. The vertical flux is simulated by use of the parameterized eddy diffusion coefficients. The photochemical model is coupled to a radiative transfer model that calculates the radiation field due to the incoming solar radiation which initiates much of the photochemistry of the troposphere. Vertical profiles of tropospheric species were compared with the Leighton approximation, radiative transfer, matrix inversion model. The radiative transfer code includes the effects of multiple scattering due to molecules and aerosols, pure absorption, and surface albedo on the transfer of incoming solar radiation. It is indicated that significant differences exist for several key photolysis frequencies and species number density profiles between the Leighton approximation and the profiles generated with, radiative transfer, matrix inversion technique. Most species show enhanced vertical profiles when the more realistic treatment of the incoming solar radiation field is included

Peter Waterman and T-Matrix Methods

NASA Technical Reports Server (NTRS)

Mishchenko, M. I.; Martin, P.A.

2013-01-01

This paper summarizes the scientific legacy of Peter C. Waterman (1928-2012) who introduced concepts and theoretical techniques that have had a major impact on the fields of scattering by particles and particle groups, optical particletcharacterization, radiative transfer, and remote sensing. A biographical sketch is also included.

Attachment techniques for high temperature strain

NASA Astrophysics Data System (ADS)

Wnuk, Steve P., Jr.

1993-01-01

Attachment methods for making resistive strain measurements to 2500 F were studied. A survey of available strain gages and attachment techniques was made, and the results are compiled for metal and carbon composite test materials. A theoretical analysis of strain transfer into a bonded strain gage was made, and the important physical parameters of the strain transfer medium, the ceramic matrix, were identified. A pull tester to measure pull-out tests on commonly used strain gage cements indicated that all cements tested displayed adequate strength for good strain transfer. Rokide flame sprayed coatings produced significantly stronger bonds than ceramic cements. An in-depth study of the flame spray process produced simplified installation procedures which also resulted in greater reliability and durability. Application procedures incorporating improvements made during this program are appended to the report. Strain gages installed on carbon composites, Rene' 41, 316 stainless steel, and TZM using attachment techniques developed during this program were successfully tested to 2500 F. Photographs of installation techniques, test procedures, and graphs of the test data are included in this report.

Coherence Evolution and Transfer Supplemented by Sender's Initial-State Restoring

NASA Astrophysics Data System (ADS)

Fel'dman, E. B.; Zenchuk, A. I.

2017-12-01

The evolution of quantum coherences comes with a set of conservation laws provided that the Hamiltonian governing this evolution conserves the spin-excitation number. At that, coherences do not intertwist during the evolution. Using the transmission line and the receiver in the initial ground state we can transfer the coherences to the receiver without interaction between them, although the matrix elements contributing to each particular coherence intertwist in the receiver's state. Therefore we propose a tool based on the unitary transformation at the receiver side to untwist these elements and thus restore (at least partially) the structure of the sender's initial density matrix. A communication line with two-qubit sender and receiver is considered as an example of implementation of this technique.

Effects of multiple scattering and surface albedo on the photochemistry of the troposphere. Final report, period ending 30 Nov 1981

DOE Office of Scientific and Technical Information (OSTI.GOV)

Augustsson, T.R.; Tiwari, S.N.

The effect of treatment of incoming solar radiation on the photochemistry of the troposphere is discussed. A one dimensional photochemical model of the troposphere containing the species of the nitrogen, oxygen, carbon, hydrogen, and sulfur families was developed. The vertical flux is simulated by use of the parameterized eddy diffusion coefficients. The photochemical model is coupled to a radiative transfer model that calculates the radiation field due to the incoming solar radiation which initiates much of the photochemistry of the troposphere. Vertical profiles of tropospheric species were compared with the Leighton approximation, radiative transfer, matrix inversion model. The radiative transfermore » code includes the effects of multiple scattering due to molecules and aerosols, pure absorption, and surface albedo on the transfer of incoming solar radiation. It is indicated that significant differences exist for several key photolysis frequencies and species number density profiles between the Leighton approximation and the profiles generated with, radiative transfer, matrix inversion technique. Most species show enhanced vertical profiles when the more realistic treatment of the incoming solar radiation field is included« less

An Embedded 3D Fracture Modeling Approach for Simulating Fracture-Dominated Fluid Flow and Heat Transfer in Geothermal Reservoirs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnston, Henry; Wang, Cong; Winterfeld, Philip

An efficient modeling approach is described for incorporating arbitrary 3D, discrete fractures, such as hydraulic fractures or faults, into modeling fracture-dominated fluid flow and heat transfer in fractured geothermal reservoirs. This technique allows 3D discrete fractures to be discretized independently from surrounding rock volume and inserted explicitly into a primary fracture/matrix grid, generated without including 3D discrete fractures in prior. An effective computational algorithm is developed to discretize these 3D discrete fractures and construct local connections between 3D fractures and fracture/matrix grid blocks of representing the surrounding rock volume. The constructed gridding information on 3D fractures is then added tomore » the primary grid. This embedded fracture modeling approach can be directly implemented into a developed geothermal reservoir simulator via the integral finite difference (IFD) method or with TOUGH2 technology This embedded fracture modeling approach is very promising and computationally efficient to handle realistic 3D discrete fractures with complicated geometries, connections, and spatial distributions. Compared with other fracture modeling approaches, it avoids cumbersome 3D unstructured, local refining procedures, and increases computational efficiency by simplifying Jacobian matrix size and sparsity, while keeps sufficient accuracy. Several numeral simulations are present to demonstrate the utility and robustness of the proposed technique. Our numerical experiments show that this approach captures all the key patterns about fluid flow and heat transfer dominated by fractures in these cases. Thus, this approach is readily available to simulation of fractured geothermal reservoirs with both artificial and natural fractures.« less

Processing of a fiber-reinforced transparent glass matrix composite and study of micromechanics of load transfer from matrix to fiber using micro-fluorescence spectroscopy

NASA Astrophysics Data System (ADS)

Banerjee, Debangshu

The brittleness of monolithic ceramic materials can be overcome by reinforcing them with high strength, high modulus ceramic fibers. These ceramic matrix composites exhibit improved strength, toughness, and work of fracture. Successful design of a ceramic matrix composite (CMC) depends on two factors: proper choice of fiber, matrix, and interface material, and understanding the mechanics of fracture. The conventional techniques for measuring stress and strain at a local level in CMCs are based on indirect experiments and analytical models. In recent years a couple of optical techniques have been explored for non- contact and direct evaluation of the stress and strain in materials, such as laser Raman spectroscopy and fluorescence spectroscopy. In order to employ spectroscopy to study stress in a composite, a transparent matrix was needed. In this study a SiC fiber reinforced transparent glass matrix composite was developed. A tape casting, binder burnout, and sintering route was adopted to achieve the optimum transparency with proper fiber alignment and interfacial properties. Sapphire fibers were used to act as probe to generate fluorescence signals for measuring stress. A fugitive carbon coating was developed to act as a weak interface for the sapphire fiber, which otherwise, forms a strong bond with the matrix. A fixture was designed to apply stress on the composite specimen, in situ, under the microscope of the spectrometer. Using fluorescence spectroscopy, the micromechanics of load transfer from matrix to fibers were studied. Studies were conducted on both strongly and weakly bonded fibers, as well as on single fiber, and multi fiber situations. Residual stresses arising from thermal expansion mismatch have been mapped along the fiber length with resolution in microns. Residual axial stress was found to follow a shear lag profile along the fiber length. A finite residual axial stress was detected at the fiber ends. Correction of the measured stress for sample probe interaction could not eliminate this finite stress completely. Residual axial stress was also found to vary across the fiber cross section. Analytical models predicting the stress variation along the fiber length and across fiber cross section were developed. (Abstract shortened by UMI.)

Mechanical Properties of Nanostructured Materials Determined Through Molecular Modeling Techniques

NASA Technical Reports Server (NTRS)

Clancy, Thomas C.; Gates, Thomas S.

2005-01-01

The potential for gains in material properties over conventional materials has motivated an effort to develop novel nanostructured materials for aerospace applications. These novel materials typically consist of a polymer matrix reinforced with particles on the nanometer length scale. In this study, molecular modeling is used to construct fully atomistic models of a carbon nanotube embedded in an epoxy polymer matrix. Functionalization of the nanotube which consists of the introduction of direct chemical bonding between the polymer matrix and the nanotube, hence providing a load transfer mechanism, is systematically varied. The relative effectiveness of functionalization in a nanostructured material may depend on a variety of factors related to the details of the chemical bonding and the polymer structure at the nanotube-polymer interface. The objective of this modeling is to determine what influence the details of functionalization of the carbon nanotube with the polymer matrix has on the resulting mechanical properties. By considering a range of degree of functionalization, the structure-property relationships of these materials is examined and mechanical properties of these models are calculated using standard techniques.

Transfer matrix calculation for ion optical elements using real fields

NASA Astrophysics Data System (ADS)

Mishra, P. M.; Blaum, K.; George, S.; Grieser, M.; Wolf, A.

2018-03-01

With the increasing importance of ion storage rings and traps in low energy physics experiments, an efficient transport of ion species from the ion source area to the experimental setup becomes essential. Some available, powerful software packages rely on transfer matrix calculations in order to compute the ion trajectory through the ion-optical beamline systems of high complexity. With analytical approaches, so far the transfer matrices are documented only for a few ideal ion optical elements. Here we describe an approach (using beam tracking calculations) to determine the transfer matrix for any individual electrostatic or magnetostatic ion optical element. We verify the procedure by considering the well-known cases and then apply it to derive the transfer matrix of a 90-degree electrostatic quadrupole deflector including its realistic geometry and fringe fields. A transfer line consisting of a quadrupole deflector and a quadrupole doublet is considered, where the results from the standard first order transfer matrix based ion optical simulation program implementing the derived transfer matrix is compared with the real field beam tracking simulations.

Minimum impulse three-body trajectories.

NASA Technical Reports Server (NTRS)

D'Amario, L.; Edelbaum, T. N.

1973-01-01

A rapid and accurate method of calculating optimal impulsive transfers in the restricted problem of three bodies has been developed. The technique combines a multi-conic method of trajectory integration with primer vector theory and an accelerated gradient method of trajectory optimization. A unique feature is that the state transition matrix and the primer vector are found analytical without additional integrations or differentiations. The method has been applied to the determination of optimal two and three impulse transfers between the L2 libration point and circular orbits about both the earth and the moon.

Monitoring hydraulic stimulation using telluric sounding

NASA Astrophysics Data System (ADS)

Rees, Nigel; Heinson, Graham; Conway, Dennis

2018-01-01

The telluric sounding (TS) method is introduced as a potential tool for monitoring hydraulic fracturing at depth. The advantage of this technique is that it requires only the measurement of electric fields, which are cheap and easy when compared with magnetotelluric measurements. Additionally, the transfer function between electric fields from two locations is essentially the identity matrix for a 1D Earth no matter what the vertical structure. Therefore, changes in the earth resulting from the introduction of conductive bodies underneath one of these sites can be associated with deviations away from the identity matrix, with static shift appearing as a galvanic multiplier at all periods. Singular value decomposition and eigenvalue analysis can reduce the complexity of the resulting telluric distortion matrix to simpler parameters that can be visualised in the form of Mohr circles. This technique would be useful in constraining the lateral extent of resistivity changes. We test the viability of utilising the TS method for monitoring on both a synthetic dataset and for a hydraulic stimulation of an enhanced geothermal system case study conducted in Paralana, South Australia. The synthetic data example shows small but consistent changes in the transfer functions associated with hydraulic stimulation, with grids of Mohr circles introduced as a useful diagnostic tool for visualising the extent of fluid movement. The Paralana electric field data were relatively noisy and affected by the dead band making the analysis of transfer functions difficult. However, changes in the order of 5% were observed from 5 s to longer periods. We conclude that deep monitoring using the TS method is marginal at depths in the order of 4 km and that in order to have meaningful interpretations, electric field data need to be of a high quality with low levels of site noise.[Figure not available: see fulltext.

Trapping hydrogen atoms from a neon-gas matrix: a theoretical simulation.

PubMed

Bovino, S; Zhang, P; Kharchenko, V; Dalgarno, A

2009-08-07

Hydrogen is of critical importance in atomic and molecular physics and the development of a simple and efficient technique for trapping cold and ultracold hydrogen atoms would be a significant advance. In this study we simulate a recently proposed trap-loading mechanism for trapping hydrogen atoms released from a neon matrix. Accurate ab initio quantum calculations are reported of the neon-hydrogen interaction potential and the energy- and angular-dependent elastic scattering cross sections that control the energy transfer of initially cold atoms are obtained. They are then used to construct the Boltzmann kinetic equation, describing the energy relaxation process. Numerical solutions of the Boltzmann equation predict the time evolution of the hydrogen energy distribution function. Based on the simulations we discuss the prospects of the technique.

Photonic band structures solved by a plane-wave-based transfer-matrix method.

PubMed

Li, Zhi-Yuan; Lin, Lan-Lan

2003-04-01

Transfer-matrix methods adopting a plane-wave basis have been routinely used to calculate the scattering of electromagnetic waves by general multilayer gratings and photonic crystal slabs. In this paper we show that this technique, when combined with Bloch's theorem, can be extended to solve the photonic band structure for 2D and 3D photonic crystal structures. Three different eigensolution schemes to solve the traditional band diagrams along high-symmetry lines in the first Brillouin zone of the crystal are discussed. Optimal rules for the Fourier expansion over the dielectric function and electromagnetic fields with discontinuities occurring at the boundary of different material domains have been employed to accelerate the convergence of numerical computation. Application of this method to an important class of 3D layer-by-layer photonic crystals reveals the superior convergency of this different approach over the conventional plane-wave expansion method.

Hybrid-dual-fourier tomographic algorithm for a fast three-dimensionial optical image reconstruction in turbid media

NASA Technical Reports Server (NTRS)

Alfano, Robert R. (Inventor); Cai, Wei (Inventor)

2007-01-01

A reconstruction technique for reducing computation burden in the 3D image processes, wherein the reconstruction procedure comprises an inverse and a forward model. The inverse model uses a hybrid dual Fourier algorithm that combines a 2D Fourier inversion with a 1D matrix inversion to thereby provide high-speed inverse computations. The inverse algorithm uses a hybrid transfer to provide fast Fourier inversion for data of multiple sources and multiple detectors. The forward model is based on an analytical cumulant solution of a radiative transfer equation. The accurate analytical form of the solution to the radiative transfer equation provides an efficient formalism for fast computation of the forward model.

Characterization of VOC Sources during the Texas Air Quality Study 2000 Using Proton-Transfer-Reaction Mass Spectrometry

NASA Astrophysics Data System (ADS)

Karl, T.; Jobson, T.; William, K.; Williams, E.; Stutz, J.; Goldan, P.; Fall, R.; Fehsenfeld, F.; Lindinger, W.

2002-12-01

We used Proton-Transfer-Reaction Mass Spectrometry (PTR-MS) for continuous real-time monitoring of volatile organic compounds (VOCs) at a site near the Houston Ship Channel during the Texas Air Quality Study 2000. Anthropogenic aromatics, alkenes, methanol, acetaldehyde, formaldehyde, acetone/propanal, a C7-Ketone, HCN and acrylonitrile were the most prominent compounds observed. Propene was the most abundant light-weight hydrocarbon detected by this technique, and was highly correlated with its oxidation products, formaldehyde and acetaldehyde, with typical propene-acetaldehyde ratios close to 1 in propene-dominated plumes. In the case of aromatic species the high time resolution of the obtained dataset helped in identifying different anthropogenic sources (e.g. industrial from urban emissions) and testing current emission inventories. In addition, a comparison with results from complimentary techniques (gas chromatography, differential optical absorption spectroscopy) was used to assess the selectivity of this on-line technique in a complex urban and industrial VOC matrix and give an interpretation of mass scans obtained by `soft' chemical ionization using proton-transfer via H3O+.

Singular value description of a digital radiographic detector: Theory and measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kyprianou, Iacovos S.; Badano, Aldo; Gallas, Brandon D.

The H operator represents the deterministic performance of any imaging system. For a linear, digital imaging system, this system operator can be written in terms of a matrix, H, that describes the deterministic response of the system to a set of point objects. A singular value decomposition of this matrix results in a set of orthogonal functions (singular vectors) that form the system basis. A linear combination of these vectors completely describes the transfer of objects through the linear system, where the respective singular values associated with each singular vector describe the magnitude with which that contribution to the objectmore » is transferred through the system. This paper is focused on the measurement, analysis, and interpretation of the H matrix for digital x-ray detectors. A key ingredient in the measurement of the H matrix is the detector response to a single x ray (or infinitestimal x-ray beam). The authors have developed a method to estimate the 2D detector shift-variant, asymmetric ray response function (RRF) from multiple measured line response functions (LRFs) using a modified edge technique. The RRF measurements cover a range of x-ray incident angles from 0 deg. (equivalent location at the detector center) to 30 deg. (equivalent location at the detector edge) for a standard radiographic or cone-beam CT geometric setup. To demonstrate the method, three beam qualities were tested using the inherent, Lu/Er, and Yb beam filtration. The authors show that measures using the LRF, derived from an edge measurement, underestimate the system's performance when compared with the H matrix derived using the RRF. Furthermore, the authors show that edge measurements must be performed at multiple directions in order to capture rotational asymmetries of the RRF. The authors interpret the results of the H matrix SVD and provide correlations with the familiar MTF methodology. Discussion is made about the benefits of the H matrix technique with regards to signal detection theory, and the characterization of shift-variant imaging systems.« less

A methodology for formulating a minimal uncertainty model for robust control system design and analysis

NASA Technical Reports Server (NTRS)

Belcastro, Christine M.; Chang, B.-C.; Fischl, Robert

1989-01-01

In the design and analysis of robust control systems for uncertain plants, the technique of formulating what is termed an M-delta model has become widely accepted and applied in the robust control literature. The M represents the transfer function matrix M(s) of the nominal system, and delta represents an uncertainty matrix acting on M(s). The uncertainty can arise from various sources, such as structured uncertainty from parameter variations or multiple unstructured uncertainties from unmodeled dynamics and other neglected phenomena. In general, delta is a block diagonal matrix, and for real parameter variations the diagonal elements are real. As stated in the literature, this structure can always be formed for any linear interconnection of inputs, outputs, transfer functions, parameter variations, and perturbations. However, very little of the literature addresses methods for obtaining this structure, and none of this literature addresses a general methodology for obtaining a minimal M-delta model for a wide class of uncertainty. Since have a delta matrix of minimum order would improve the efficiency of structured singular value (or multivariable stability margin) computations, a method of obtaining a minimal M-delta model would be useful. A generalized method of obtaining a minimal M-delta structure for systems with real parameter variations is given.

Design for active and passive flutter suppression and gust alleviation. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Karpel, M.

1981-01-01

Analytical design techniques for active and passive control of aeroelastic systems are based on a rational approximation of the unsteady aerodynamic loads in the entire Laplace domain, which yields matrix equations of motion with constant coefficients. Some existing schemes are reviewed, the matrix Pade approximant is modified, and a technique which yields a minimal number of augmented states for a desired accuracy is presented. The state-space aeroelastic model is used to design an active control system for simultaneous flutter suppression and gust alleviation. The design target is for a continuous controller which transfers some measurements taken on the vehicle to a control command applied to a control surface. Structural modifications are formulated in a way which enables the treatment of passive flutter suppression system with the same procedures by which active control systems are designed.

Activation product transport in fusion reactors. [RAPTOR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, A.C.

1983-01-01

Activated corrosion and neutron sputtering products will enter the coolant and/or tritium breeding material of fusion reactor power plants and experiments and cause personnel access problems. Radiation levels around plant components due to these products will cause difficulties with maintenance and repair operations throughout the plant. Similar problems are experienced around fission reactor systems. The determination of the transport of radioactive corrosion and neutron sputtering products through the system is achieved using the computer code RAPTOR. This code calculates the mass transfer of a number of activation products based on the corrosion and sputtering rates through the system, the depositionmore » and release characteristics of various plant components, the neturon flux spectrum, as well as other plant parameters. RAPTOR assembles a system of first order linear differential equations into a matrix equation based upon the reactor system parameters. Included in the transfer matrix are the deposition and erosion coefficients, and the decay and activation data for the various plant nodes and radioactive isotopes. A source vector supplies the corrosion and neutron sputtering source rates. This matrix equation is then solved using a matrix operator technique to give the specific activity distribution of each radioactive species throughout the plant. Once the amount of mass transfer is determined, the photon transport due to the radioactive corrosion and sputtering product sources can be evaluated, and dose rates around the plant components of interest as a function of time can be determined. This method has been used to estimate the radiation hazards around a number of fusion reactor system designs.« less

Preserving Simplecticity in the Numerical Integration of Linear Beam Optics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Christopher K.

2017-07-01

Presented are mathematical tools and methods for the development of numerical integration techniques that preserve the symplectic condition inherent to mechanics. The intended audience is for beam physicists with backgrounds in numerical modeling and simulation with particular attention to beam optics applications. The paper focuses on Lie methods that are inherently symplectic regardless of the integration accuracy order. Section 2 provides the mathematically tools used in the sequel and necessary for the reader to extend the covered techniques. Section 3 places those tools in the context of charged-particle beam optics; in particular linear beam optics is presented in terms ofmore » a Lie algebraic matrix representation. Section 4 presents numerical stepping techniques with particular emphasis on a third-order leapfrog method. Section 5 discusses the modeling of field imperfections with particular attention to the fringe fields of quadrupole focusing magnets. The direct computation of a third order transfer matrix for a fringe field is shown.« less

Improving mass transfer to soften tissues by pulsed electric fields: fundamentals and applications.

PubMed

Puértolas, E; Luengo, E; Álvarez, I; Raso, J

2012-01-01

The mass transfer phenomenon occurs in many operations of the food industry with the purpose of obtaining a given substance of interest, removing water from foods, or introducing a given substance into the food matrix. Pretreatments that modify the permeability of the cell membranes, such as grinding, heating, or enzymatic treatment, enhance the mass transfer. However, these techniques may require a significant amount of energy and can cause losses of valuable food compounds. Pulsed electric field (PEF) technology is a nonthermal processing method that causes permeabilization of cell membranes using low energy requirements and minimizing quality deterioration of the food compounds. Many practical applications of PEF for enhancing mass transfer in the food industry have been investigated. The purpose of this chapter is to give an overview of the state of the art of application of PEF for improving mass transfer in the food industry.

Gaussian-Beam Laser-Resonator Program

NASA Technical Reports Server (NTRS)

Cross, Patricia L.; Bair, Clayton H.; Barnes, Norman

1989-01-01

Gaussian Beam Laser Resonator Program models laser resonators by use of Gaussian-beam-propagation techniques. Used to determine radii of beams as functions of position in laser resonators. Algorithm used in program has three major components. First, ray-transfer matrix for laser resonator must be calculated. Next, initial parameters of beam calculated. Finally, propagation of beam through optical elements computed. Written in Microsoft FORTRAN (Version 4.01).

Transfer-Matrix Method for Solving the Spin 1/2 Antiferromagnetic Heisenberg Chain

NASA Astrophysics Data System (ADS)

Garcia-Bach, M. A.; Klein, D. J.; Valenti, R.

Following the discovery of high Tc superconductivity in the copper oxides, there has been a great deal of interest in the RVB wave function proposed by Anderson [1]. As a warm-up exercise we have considered a valence-bond wave function for the one dimensional spin-1/2 Heisenberg chain. The main virtue of our work is to propose a new variational singlet wavefunction which is almost analytically tractable by a transfer-matrix technique. We have obtained the ground state energy for finite as well as infinite chains, in good agreement with exact results. Correlation functions, excited states, and the effects of other interactions (e.g., spin-Peierls) are also accessible within this scheme [2]. Since the ground state of the chain is known to be a singlet (Lieb & Mattis [3]), we write the appropriate wave function as a superposition of valence-bond singlets, |ψ > =∑ limits k C k | k>, where |k> is a spin configuration obtained by pairing all spins into singlet pairs, in a way which is common in valence-bond calculations of large molecules. As in that case, each configuration, |k>, can be represented by a Rümer diagram, with directed bonds connecting each pair of spins on the chain. The ck's are variational co-efficients, the form of which is determined as follows: Each singlet configuration (Rümer diagram) is divided into "zones", a "zone" corresponding to the region between two consecutive sites. Each zone is indexed by its distance from the end of the chain and by the number of bonds crossing it. Our procedure assigns a variational parameter, xij, to the jth zone, when crossed by i bonds. The resulting wavefunction for an N-site chain is written as |ψ > =∑ limits k ∏ M limits { i =1} ∏ { N -1}limits { j =1} X ij{ m ij (k)} | k> where mij(k) equals 1 when zone j is crossed by i bonds and zero otherwise. To make the calculation tractable we reduce the number of variational parameters by disallowing configurations with bonds connecting any two sites separated by more than 2M lattice points. (For simplicity, we have limited ourselves to M=3, but the scheme can be used for any M). With the simple ansatz, matrix elements can be calculated by a transfer-matrix method. To understand the transfer-matrix method note that since only local zone parameters appear in the description of each state |k>, matrix elements and overlaps, < k| bar S q bar S{ q +1} |k'> and , are completely specified by a small number of "local states" associated with each zone. Within a given zone a local state is defined by (i) the number of bonds crossing the zone and (ii), by whether the bonds originate from the initial (|k>) or final (|k'>) state. It is then easy to see that "local states" of consecutive zones are connected by a 15 × 15 transfer matrix (for the case M=3). Furthermore, the overlap matrix element can be written as a product of transfer-matrices associated with each zone of the chain. When calculating matrix elements of the Hamiltonian, an additional matrix, U, must be defined, to represent the particular zone involving the two spins connected by the Heisenberg interaction. The relevant details as well as the comparison with exact results will be given elsewhere. We are planning to ultimately apply this method to the two dimensional case, and hope to include the effects of holes.

Transfer matrix method for four-flux radiative transfer.

PubMed

Slovick, Brian; Flom, Zachary; Zipp, Lucas; Krishnamurthy, Srini

2017-07-20

We develop a transfer matrix method for four-flux radiative transfer, which is ideally suited for studying transport through multiple scattering layers. The model predicts the specular and diffuse reflection and transmission of multilayer composite films, including interface reflections, for diffuse or collimated incidence. For spherical particles in the diffusion approximation, we derive closed-form expressions for the matrix coefficients and show remarkable agreement with numerical Monte Carlo simulations for a range of absorption values and film thicknesses, and for an example multilayer slab.

Fluorescence Lectin Bar-Coding of Glycoconjugates in the Extracellular Matrix of Biofilm and Bioaggregate Forming Microorganisms.

PubMed

Neu, Thomas R; Kuhlicke, Ute

2017-02-10

Microbial biofilm systems are defined as interface-associated microorganisms embedded into a self-produced matrix. The extracellular matrix represents a continuous challenge in terms of characterization and analysis. The tools applied in more detailed studies comprise extraction/chemical analysis, molecular characterization, and visualisation using various techniques. Imaging by laser microscopy became a standard tool for biofilm analysis, and, in combination with fluorescently labelled lectins, the glycoconjugates of the matrix can be assessed. By employing this approach a wide range of pure culture biofilms from different habitats were examined using the commercially available lectins. From the results, a binary barcode pattern of lectin binding can be generated. Furthermore, the results can be fine-tuned and transferred into a heat map according to signal intensity. The lectin barcode approach is suggested as a useful tool for investigating the biofilm matrix characteristics and dynamics at various levels, e.g. bacterial cell surfaces, adhesive footprints, individual microcolonies, and the gross biofilm or bio-aggregate. Hence fluorescence lectin bar-coding (FLBC) serves as a basis for a subsequent tailor-made fluorescence lectin-binding analysis (FLBA) of a particular biofilm. So far, the lectin approach represents the only tool for in situ characterization of the glycoconjugate makeup in biofilm systems.  Furthermore, lectin staining lends itself to other fluorescence techniques in order to correlate it with cellular biofilm constituents in general and glycoconjugate producers in particular.

Model reduction of nonsquare linear MIMO systems using multipoint matrix continued-fraction expansions

NASA Technical Reports Server (NTRS)

Guo, Tong-Yi; Hwang, Chyi; Shieh, Leang-San

1994-01-01

This paper deals with the multipoint Cauer matrix continued-fraction expansion (MCFE) for model reduction of linear multi-input multi-output (MIMO) systems with various numbers of inputs and outputs. A salient feature of the proposed MCFE approach to model reduction of MIMO systems with square transfer matrices is its equivalence to the matrix Pade approximation approach. The Cauer second form of the ordinary MCFE for a square transfer function matrix is generalized in this paper to a multipoint and nonsquare-matrix version. An interesting connection of the multipoint Cauer MCFE method to the multipoint matrix Pade approximation method is established. Also, algorithms for obtaining the reduced-degree matrix-fraction descriptions and reduced-dimensional state-space models from a transfer function matrix via the multipoint Cauer MCFE algorithm are presented. Practical advantages of using the multipoint Cauer MCFE are discussed and a numerical example is provided to illustrate the algorithms.

Homogeneous Liquid Phase Transfer of Graphene Oxide into Epoxy Resins.

PubMed

Amirova, Lyaysan; Surnova, Albina; Balkaev, Dinar; Musin, Delus; Amirov, Rustem; Dimiev, Ayrat M

2017-04-05

The quality of polymer composite materials depends on the distribution of the filler in the polymer matrix. Due to the presence of the oxygen functional groups, graphene oxide (GO) has a strong affinity to epoxy resins, providing potential opportunity for the uniform distribution of GO sheets in the matrix. Another advantage of GO over its nonoxidized counterpart is its ability to exfoliate to single-atomic-layer sheets in water and in some organic solvents. However, these advantages of GO have not yet been fully realized due to the lack of the methods efficiently introducing GO into the epoxy resin. Here we develop a novel homogeneous liquid phase transfer method that affords uniform distribution, and fully exfoliated condition of GO in the polymer matrix. The most pronounced alteration of properties of the cured composites is registered at the 0.10%-0.15% GO content. Addition of as little as 0.10% GO leads to the increase of the Young's modulus by 48%. Moreover, we demonstrate successful introduction of GO into the epoxy matrix containing an active diluent-modifier; this opens new venues for fabrication of improved GO-epoxy-modifier composites with a broad range of predesigned properties. The experiments done on reproducing the two literature methods, using alternative GO introduction techniques, lead to either decrease or insignificant increase of the Young's modulus of the resulting GO-epoxy composites.

Multidirectional mobilities: Advanced measurement techniques and applications

NASA Astrophysics Data System (ADS)

Ivarsson, Lars Holger

Today high noise-and-vibration comfort has become a quality sign of products in sectors such as the automotive industry, aircraft, components, households and manufacturing. Consequently, already in the design phase of products, tools are required to predict the final vibration and noise levels. These tools have to be applicable over a wide frequency range with sufficient accuracy. During recent decades a variety of tools have been developed such as transfer path analysis (TPA), input force estimation, substructuring, coupling by frequency response functions (FRF) and hybrid modelling. While these methods have a well-developed theoretical basis, their application combined with experimental data often suffers from a lack of information concerning rotational DOFs. In order to measure response in all 6 DOFs (including rotation), a sensor has been developed, whose special features are discussed in the thesis. This transducer simplifies the response measurements, although in practice the excitation of moments appears to be more difficult. Several excitation techniques have been developed to enable measurement of multidirectional mobilities. For rapid and simple measurement of the loaded mobility matrix, a MIMO (Multiple Input Multiple Output) technique is used. The technique has been tested and validated on several structures of different complexity. A second technique for measuring the loaded 6-by-6 mobility matrix has been developed. This technique employs a model of the excitation set-up, and with this model the mobility matrix is determined from sequential measurements. Measurements on ``real'' structures show that both techniques give results of similar quality, and both are recommended for practical use. As a further step, a technique for measuring the unloaded mobilities is presented. It employs the measured loaded mobility matrix in order to calculate compensation forces and moments, which are later applied in order to compensate for the loading of the measurement equipment. The developed measurement techniques have been used in a hybrid coupling of a plate-and-beam structure to study different aspects of the coupling technique. Results show that RDOFs are crucial and have to be included in this case. The importance of stiffness residuals when mobilities are estimated from modal superposition is demonstrated. Finally it is shown that proper curve fitting can correct errors from inconsistently measured data.

Optical Linear Algebra for Computational Light Transport

NASA Astrophysics Data System (ADS)

O'Toole, Matthew

Active illumination refers to optical techniques that use controllable lights and cameras to analyze the way light propagates through the world. These techniques confer many unique imaging capabilities (e.g. high-precision 3D scanning, image-based relighting, imaging through scattering media), but at a significant cost; they often require long acquisition and processing times, rely on predictive models for light transport, and cease to function when exposed to bright ambient sunlight. We develop a mathematical framework for describing and analyzing such imaging techniques. This framework is deeply rooted in numerical linear algebra, and models the transfer of radiant energy through an unknown environment with the so-called light transport matrix. Performing active illumination on a scene equates to applying a numerical operator on this unknown matrix. The brute-force approach to active illumination follows a two-step procedure: (1) optically measure the light transport matrix and (2) evaluate the matrix operator numerically. This approach is infeasible in general, because the light transport matrix is often much too large to measure, store, and analyze directly. Using principles from optical linear algebra, we evaluate these matrix operators in the optical domain, without ever measuring the light transport matrix in the first place. Specifically, we explore numerical algorithms that can be implemented partially or fully with programmable optics. These optical algorithms provide solutions to many longstanding problems in computer vision and graphics, including the ability to (1) photo-realistically change the illumination conditions of a given photo with only a handful of measurements, (2) accurately capture the 3D shape of objects in the presence of complex transport properties and strong ambient illumination, and (3) overcome the multipath interference problem associated with time-of-flight cameras. Most importantly, we introduce an all-new imaging regime---optical probing---that provides unprecedented control over which light paths contribute to a photo.

The NASTRAN theoretical manual

NASA Technical Reports Server (NTRS)

1981-01-01

Designed to accommodate additions and modifications, this commentary on NASTRAN describes the problem solving capabilities of the program in a narrative fashion and presents developments of the analytical and numerical procedures that underlie the program. Seventeen major sections and numerous subsections cover; the organizational aspects of the program, utility matrix routines, static structural analysis, heat transfer, dynamic structural analysis, computer graphics, special structural modeling techniques, error analysis, interaction between structures and fluids, and aeroelastic analysis.

Increase of tensile strength and toughness of bio-based diglycidyl ether of bisphenol A with chitin nanowhiskers

PubMed Central

Wang, Mian; Xue, Han; Feng, Zhiwei; Cheng, Binfeng; Yang, Haijie

2017-01-01

It is challenging to reinforce and toughen thermoset epoxy resins. We describe a slurry-compounding technique to transfer a uniform dispersion of chitin nanowhiskers (CW) in ethanol into an epoxy matrix. The incorporation of the hydrophilic CW reinforces the oil-soluble diglycidyl ether of bisphenol A (DGEBA). The resultant CW/epoxy bionanocomposites were transparent and showed considerably enhanced thermal and mechanical properties with tensile strength, modulus, toughness, and elongation at break being increased by 49%, 16%, 457%, and 250%, with only 2.5 wt.% CW. This improvement in strength and toughness is rare for thermoset epoxy/rigid nanofiller systems. We hypothesize that CW with many free amine groups could function not only as a nanofiller but also as a macromolecular polyamine hardener that participates in epoxy curing. The strong covalent interaction between the filler and the matrix allowed for efficient load transfer across the interfaces, which accounted for the greater strength and toughness. PMID:28604774

Increase of tensile strength and toughness of bio-based diglycidyl ether of bisphenol A with chitin nanowhiskers.

PubMed

Wang, Mian; Xue, Han; Feng, Zhiwei; Cheng, Binfeng; Yang, Haijie

2017-01-01

It is challenging to reinforce and toughen thermoset epoxy resins. We describe a slurry-compounding technique to transfer a uniform dispersion of chitin nanowhiskers (CW) in ethanol into an epoxy matrix. The incorporation of the hydrophilic CW reinforces the oil-soluble diglycidyl ether of bisphenol A (DGEBA). The resultant CW/epoxy bionanocomposites were transparent and showed considerably enhanced thermal and mechanical properties with tensile strength, modulus, toughness, and elongation at break being increased by 49%, 16%, 457%, and 250%, with only 2.5 wt.% CW. This improvement in strength and toughness is rare for thermoset epoxy/rigid nanofiller systems. We hypothesize that CW with many free amine groups could function not only as a nanofiller but also as a macromolecular polyamine hardener that participates in epoxy curing. The strong covalent interaction between the filler and the matrix allowed for efficient load transfer across the interfaces, which accounted for the greater strength and toughness.

Exactly solved mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy

NASA Astrophysics Data System (ADS)

Lisnyi, Bohdan; Strečka, Jozef

2015-03-01

The mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy is exactly solved through the generalized decoration-iteration transformation and the transfer-matrix method. The decoration-iteration transformation is first used for establishing a rigorous mapping equivalence with the corresponding spin-1 Blume-Emery-Griffiths chain, which is subsequently exactly treated within the transfer-matrix technique. Apart from three classical ground states the model exhibits three striking quantum ground states in which a singlet-dimer state of the interstitial Heisenberg spins is accompanied either with a frustrated state or a polarized state or a non-magnetic state of the nodal Ising spins. It is evidenced that two magnetization plateaus at zero and/or one-half of the saturation magnetization may appear in low-temperature magnetization curves. The specific heat may display remarkable temperature dependences with up to three and four distinct round maxima in a zero and non-zero magnetic field, respectively.

Charge-transfer crystallites as molecular electrical dopants

PubMed Central

Méndez, Henry; Heimel, Georg; Winkler, Stefanie; Frisch, Johannes; Opitz, Andreas; Sauer, Katrein; Wegner, Berthold; Oehzelt, Martin; Röthel, Christian; Duhm, Steffen; Többens, Daniel; Koch, Norbert; Salzmann, Ingo

2015-01-01

Ground-state integer charge transfer is commonly regarded as the basic mechanism of molecular electrical doping in both, conjugated polymers and oligomers. Here, we demonstrate that fundamentally different processes can occur in the two types of organic semiconductors instead. Using complementary experimental techniques supported by theory, we contrast a polythiophene, where molecular p-doping leads to integer charge transfer reportedly localized to one quaterthiophene backbone segment, to the quaterthiophene oligomer itself. Despite a comparable relative increase in conductivity, we observe only partial charge transfer for the latter. In contrast to the parent polymer, pronounced intermolecular frontier-orbital hybridization of oligomer and dopant in 1:1 mixed-stack co-crystallites leads to the emergence of empty electronic states within the energy gap of the surrounding quaterthiophene matrix. It is their Fermi–Dirac occupation that yields mobile charge carriers and, therefore, the co-crystallites—rather than individual acceptor molecules—should be regarded as the dopants in such systems. PMID:26440403

Optimal trajectories for aeroassisted orbital transfer

NASA Technical Reports Server (NTRS)

Miele, A.; Venkataraman, P.

1983-01-01

Consideration is given to classical and minimax problems involved in aeroassisted transfer from high earth orbit (HEO) to low earth orbit (LEO). The transfer is restricted to coplanar operation, with trajectory control effected by means of lift modulation. The performance of the maneuver is indexed to the energy expenditure or, alternatively, the time integral of the heating rate. Firist-order optimality conditions are defined for the classical approach, as are a sequential gradient-restoration algorithm and a combined gradient-restoration algorithm. Minimization techniques are presented for the aeroassisted transfer energy consumption and time-delay integral of the heating rate, as well as minimization of the pressure. It is shown that the eigenvalues of the Jacobian matrix of the differential system is both stiff and unstable, implying that the sequential gradient restoration algorithm in its present version is unsuitable. A new method, involving a multipoint approach to the two-poing boundary value problem, is recommended.

Numerical investigations on the effect of slenderness ratio of matrix elements in cryogenic chill down process

NASA Astrophysics Data System (ADS)

Reby Roy, K. E.; Mohammed, Jesna; Abhiroop, V. M.; Thekkethil, S. R.

2017-02-01

Cryogenic fluids have many applications in space, medicine, preservation etc. The chill-down of cryogenic fluid transfer line is a complicated phenomenon occurring in most of the cryogenic systems. The cryogenic fluid transfer line, which is initially at room temperature, has to be cooled to the temperature of the cryogen as fast as possible. When the cryogenic fluid at liquid state passes along the line, transient heat transfer between the cryogen and the transfer line causes voracious evaporation of the liquid. This paper makes a contribution to the two-phase flow along a rectangular flow passage consisting of an array of elliptically shaped matrix elements. A simplified 2D model is considered and the problem is solved using ANSYS FLUENT. The present analysis aims to study the influence of the slenderness ratio of matrix elements on the heat transfer rate and chill down time. For a comparative study, matrix elements of slenderness ratios 5 and 10 are considered. Liquid nitrogen at 74K flows through the matrix. The material of the transfer line is assumed to be aluminium which is initially at room temperature. The influence of Reynolds numbers from 800 to 3000 on chill-down is also investigated.

Matrix-free and material-enhanced laser desorption/ionization mass spectrometry for the analysis of low molecular weight compounds.

PubMed

Rainer, Matthias; Qureshi, Muhammad Nasimullah; Bonn, Günther Karl

2011-06-01

The application of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) for the analysis of low molecular weight (LMW) compounds, such as pharmacologically active constituents or metabolites, is usually hampered by employing conventional MALDI matrices owing to interferences caused by matrix molecules below 700 Da. As a consequence, interpretation of mass spectra remains challenging, although matrix suppression can be achieved under certain conditions. Unlike the conventional MALDI methods which usually suffer from background signals, matrix-free techniques have become more and more popular for the analysis of LMW compounds. In this review we describe recently introduced materials for laser desorption/ionization (LDI) as alternatives to conventionally applied MALDI matrices. In particular, we want to highlight a new method for LDI which is referred to as matrix-free material-enhanced LDI (MELDI). In matrix-free MELDI it could be clearly shown, that besides chemical functionalities, the material's morphology plays a crucial role regarding energy-transfer capabilities. Therefore, it is of great interest to also investigate parameters such as particle size and porosity to study their impact on the LDI process. Especially nanomaterials such as diamond-like carbon, C(60) fullerenes and nanoparticulate silica beads were found to be excellent energy-absorbing materials in matrix-free MELDI.

Graphene as a Novel Matrix for the Analysis of Small Molecules by MALDI-TOF MS

PubMed Central

Dong, Xiaoli; Cheng, Jinsheng; Li, Jinghong; Wang, Yinsheng

2010-01-01

Graphene was utilized for the first time as matrix for the analysis of low-molecular weight compounds using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Polar compounds including amino acids, polyamines, anticancer drugs and nucleosides could be successfully analyzed. Additionally, nonpolar compounds including steroids could be detected with high resolution and sensitivity. Compared with conventional matrix, graphene exhibited high desorption/ionization efficiency for nonpolar compounds. The graphene matrix functions as substrate to trap analytes, and it transfers energy to the analytes upon laser irradiation, which allowed for the analytes to be readily desorbed/ionized and interference of intrinsic matrix ions to be eliminated. The use of graphene as matrix avoided the fragmentation of analytes and provided good reproducibility and high salt tolerance, underscoring the potential application of graphene as matrix for MALDI-MS analysis of practical samples in complex sample matrices. We also demonstrated that the use of graphene as adsorbent for the solid-phase extraction of squalene could improve greatly the detection limit. This work not only opens a new field for applications of graphene, but also offers a new technique for high-speed analysis of low-molecular weight compounds in areas such as metabolism research and natural products characterization. PMID:20565059

Propellant management for low thrust chemical propulsion systems

NASA Technical Reports Server (NTRS)

Hamlyn, K. M.; Dergance, R. H.; Aydelott, J. C.

1981-01-01

Low-thrust chemical propulsion systems (LTPS) will be required for orbital transfer of large space systems (LSS). The work reported in this paper was conducted to determine the propellant requirements, preferred propellant management technique, and propulsion system sizes for the LTPS. Propellants were liquid oxygen (LO2) combined with liquid hydrogen (LH2), liquid methane or kerosene. Thrust levels of 100, 500, and 1000 lbf were combined with 1, 4, and 8 perigee burns for transfer from low earth orbit to geosynchronous earth orbit. This matrix of systems was evaluated with a multilayer insulation (MLI) or a spray-on-foam insulation. Vehicle sizing results indicate that a toroidal tank configuration is needed for the LO2/LH2 system. Multiple perigee burns and MLI allow far superior LSS payload capability. Propellant settling, combined with a single screen device, was found to be the lightest and least complex propellant management technique.

Matrix heat exchanger including a liquid, thermal couplant

DOEpatents

Fewell, Thomas E.; Ward, Charles T.

1976-01-01

A tube-to-tube heat exchanger is disclosed with a thermally conductive matrix between and around the tubes to define annuli between the tubes and matrix. The annuli are filled to a level with a molten metal or alloy to provide a conductive heat transfer path from one tube through the matrix to the second tube. A matrix heat exchanger of this type is particularly useful for heat transfer between fluids which would react should one leak into the second.

Two dimensional exciton polaritons in microcavities with embedded quantum wires

NASA Astrophysics Data System (ADS)

Kavokin, A. V.; Ivchenko, E. L.; Vladimirova, M. R.; Kaliteevski, M. A.; Goupalov, S. V.

1998-02-01

Optical anisotropy of the periodical array of quantum wires embedded in a semiconductor microcavity is shown to result in polarization-dependent vacuum-field Rabi-splitting and a triple-anticrossing shape of the exciton-polariton dispersion curves. Both effects originate from the resonant diffraction of light at the grating of quantum wires. The calculation has been done within the nonlocal dielectric response theory and using the 4 × 4 transfer matrix technique.

Improvement of finite element meshes - Heat transfer in an infinite cylinder

NASA Technical Reports Server (NTRS)

Kittur, Madan G.; Huston, Ronald L.; Oswald, Fred B.

1989-01-01

An extension of a structural finite element mesh improvement technique to heat conduction analysis is presented. The mesh improvement concept was originally presented by Prager in studying tapered, axially loaded bars. It was further shown that an improved mesh can be obtained by minimizing the trace of the stiffnes matrix. These procedures are extended and applied to the analysis of heat conduction in an infinitely long hollow circular cylinder.

Improvement in finite element meshes: Heat transfer in an infinite cylinder

NASA Technical Reports Server (NTRS)

Kittur, Madan G.; Huston, Ronald L.; Oswald, Fred B.

1988-01-01

An extension of a structural finite element mesh improvement technique to heat conduction analysis is presented. The mesh improvement concept was originally presented by Prager in studying tapered, axially loaded bars. It was further shown that an improved mesh can be obtained by minimizing the trace of the stiffness matrix. These procedures are extended and applied to the analysis of heat conduction in an infinitely long hollow circular cylinder.

Development of a poly(dimethylacrylamide) based matrix material for solid phase high density peptide array synthesis employing a laser based material transfer

NASA Astrophysics Data System (ADS)

Ridder, Barbara; Foertsch, Tobias C.; Welle, Alexander; Mattes, Daniela S.; von Bojnicic-Kninski, Clemens M.; Loeffler, Felix F.; Nesterov-Mueller, Alexander; Meier, Michael A. R.; Breitling, Frank

2016-12-01

Poly(dimethylacrylamide) (PDMA) based matrix materials were developed for laser-based in situ solid phase peptide synthesis to produce high density arrays. In this specific array synthesis approach, amino acid derivatives are embedded into a matrix material, serving as a ;solid; solvent material at room temperature. Then, a laser pulse transfers this mixture to the target position on a synthesis slide, where the peptide array is synthesized. Upon heating above the glass transition temperature of the matrix material, it softens, allowing diffusion of the amino acid derivatives to the synthesis surface and serving as a solvent for peptide bond formation. Here, we synthesized PDMA six-arm star polymers, offering the desired matrix material properties, using atom transfer radical polymerization. With the synthesized polymers as matrix material, we structured and synthesized arrays with combinatorial laser transfer. With densities of up to 20,000 peptide spots per cm2, the resolution could be increased compared to the commercially available standard matrix material. Time-of-Flight Secondary Ion Mass Spectrometry experiments revealed the penetration behavior of an amino acid derivative into the prepared acceptor synthesis surface and the effectiveness of the washing protocols.

Investigation of solvent-free MALDI-TOFMS sample preparation methods for the analysis of organometallic and coordination compounds.

PubMed

Hughes, Laura; Wyatt, Mark F; Stein, Bridget K; Brenton, A Gareth

2009-01-15

An investigation of various solvent-free matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS) sample preparation methods for the characterization of organometallic and coordination compounds is described. Such methods are desirable for insoluble materials, compounds that are only soluble in disadvantageous solvents, or complexes that dissociate in solution, all of which present a major "difficulty" to most mass spectrometry techniques. First-row transition metal acetylacetonate complexes, which have been characterized previously by solution preparation MALDI-TOFMS, were used to evaluate the various solvent-free procedures. These procedures comprise two distinct steps: the first being the efficient "solids mixing" (the mixing of sample and matrix), and the second being the effective transfer of the sample/matrix mixture to the MALDI target plate. This investigation shows that vortex mixing is the most efficient first step and that smearing using a microspatula is the most effective second step. In addition, the second step is shown to be much more critical than the first step in obtaining high-quality data. Case studies of truly insoluble materials highlight the importance of these techniques for the wider chemistry community.

Linear time relational prototype based learning.

PubMed

Gisbrecht, Andrej; Mokbel, Bassam; Schleif, Frank-Michael; Zhu, Xibin; Hammer, Barbara

2012-10-01

Prototype based learning offers an intuitive interface to inspect large quantities of electronic data in supervised or unsupervised settings. Recently, many techniques have been extended to data described by general dissimilarities rather than Euclidean vectors, so-called relational data settings. Unlike the Euclidean counterparts, the techniques have quadratic time complexity due to the underlying quadratic dissimilarity matrix. Thus, they are infeasible already for medium sized data sets. The contribution of this article is twofold: On the one hand we propose a novel supervised prototype based classification technique for dissimilarity data based on popular learning vector quantization (LVQ), on the other hand we transfer a linear time approximation technique, the Nyström approximation, to this algorithm and an unsupervised counterpart, the relational generative topographic mapping (GTM). This way, linear time and space methods result. We evaluate the techniques on three examples from the biomedical domain.

On the transfer matrix of the supersymmetric eight-vertex model. I. Periodic boundary conditions

NASA Astrophysics Data System (ADS)

Hagendorf, Christian; Liénardy, Jean

2018-03-01

The square-lattice eight-vertex model with vertex weights a, b, c, d obeying the relation (a^2+ab)(b^2+ab) = (c^2+ab)(d^2+ab) and periodic boundary conditions is considered. It is shown that the transfer matrix of the model for L  =  2n  +  1 vertical lines and periodic boundary conditions along the horizontal direction possesses the doubly degenerate eigenvalue \\Thetan = (a+b){\\hspace{0pt}}2n+1 . This proves a conjecture by Stroganov from 2001. The proof uses the supersymmetry of a related XYZ spin-chain Hamiltonian. The eigenstates of the transfer matrix corresponding to \\Thetan are shown to be the ground states of the spin-chain Hamiltonian. Moreover, for positive vertex weights \\Thetan is the largest eigenvalue of the transfer matrix.

Transfer matrix spectrum for cyclic representations of the 6-vertex reflection algebra by quantum separation of variables

NASA Astrophysics Data System (ADS)

Pezelier, Baptiste

2018-02-01

In this proceeding, we recall the notion of quantum integrable systems on a lattice and then introduce the Sklyanin’s Separation of Variables method. We sum up the main results for the transfer matrix spectral problem for the cyclic representations of the trigonometric 6-vertex reflection algebra associated to the Bazanov-Stroganov Lax operator. These results apply as well to the spectral analysis of the lattice sine-Gordon model with open boundary conditions. The transfer matrix spectrum (both eigenvalues and eigenstates) is completely characterized in terms of the set of solutions to a discrete system of polynomial equations. We state an equivalent characterization as the set of solutions to a Baxter’s like T-Q functional equation, allowing us to rewrite the transfer matrix eigenstates in an algebraic Bethe ansatz form.

Combined heat and mass transfer device for improving separation process

DOEpatents

Tran, Thanh Nhon

1999-01-01

A two-phase small channel heat exchange matrix simultaneously provides for heat transfer and mass transfer between the liquid and vapor phases of a multi-component mixture at a single, predetermined location within a separation column, significantly improving the thermodynamic efficiency of the separation process. The small channel heat exchange matrix is composed of a series of channels having a hydraulic diameter no greater than 5.0 millimeters for conducting a two-phase coolant. In operation, the matrix provides the liquid-vapor contacting surfaces within the separation column, such that heat and mass are transferred simultaneously between the liquid and vapor phases. The two-phase coolant allows for a uniform heat transfer coefficient to be maintained along the length of the channels and across the surface of the matrix. Preferably, a perforated, concave sheet connects each channel to an adjacent channel to facilitate the flow of the liquid and vapor phases within the column and to increase the liquid-vapor contacting surface area.

Combined heat and mass transfer device for improving separation process

DOEpatents

Tran, T.N.

1999-08-24

A two-phase small channel heat exchange matrix simultaneously provides for heat transfer and mass transfer between the liquid and vapor phases of a multi-component mixture at a single, predetermined location within a separation column, significantly improving the thermodynamic efficiency of the separation process. The small channel heat exchange matrix is composed of a series of channels having a hydraulic diameter no greater than 5.0 millimeters for conducting a two-phase coolant. In operation, the matrix provides the liquid-vapor contacting surfaces within the separation column, such that heat and mass are transferred simultaneously between the liquid and vapor phases. The two-phase coolant allows for a uniform heat transfer coefficient to be maintained along the length of the channels and across the surface of the matrix. Preferably, a perforated, concave sheet connects each channel to an adjacent channel to facilitate the flow of the liquid and vapor phases within the column and to increase the liquid-vapor contacting surface area. 12 figs.

Quantum State Transfer via Noisy Photonic and Phononic Waveguides

NASA Astrophysics Data System (ADS)

Vermersch, B.; Guimond, P.-O.; Pichler, H.; Zoller, P.

2017-03-01

We describe a quantum state transfer protocol, where a quantum state of photons stored in a first cavity can be faithfully transferred to a second distant cavity via an infinite 1D waveguide, while being immune to arbitrary noise (e.g., thermal noise) injected into the waveguide. We extend the model and protocol to a cavity QED setup, where atomic ensembles, or single atoms representing quantum memory, are coupled to a cavity mode. We present a detailed study of sensitivity to imperfections, and apply a quantum error correction protocol to account for random losses (or additions) of photons in the waveguide. Our numerical analysis is enabled by matrix product state techniques to simulate the complete quantum circuit, which we generalize to include thermal input fields. Our discussion applies both to photonic and phononic quantum networks.

Cardiac tissue engineering: from matrix design to the engineering of bionic hearts.

PubMed

Fleischer, Sharon; Feiner, Ron; Dvir, Tal

2017-04-01

The field of cardiac tissue engineering aims at replacing the scar tissue created after a patient has suffered from a myocardial infarction. Various technologies have been developed toward fabricating a functional engineered tissue that closely resembles that of the native heart. While the field continues to grow and techniques for better tissue fabrication continue to emerge, several hurdles still remain to be overcome. In this review we will focus on several key advances and recent technologies developed in the field, including biomimicking the natural extracellular matrix structure and enhancing the transfer of the electrical signal. We will also discuss recent developments in the engineering of bionic cardiac tissues which integrate the fields of tissue engineering and electronics to monitor and control tissue performance.

Hybrid transfer-matrix FDTD method for layered periodic structures.

PubMed

Deinega, Alexei; Belousov, Sergei; Valuev, Ilya

2009-03-15

A hybrid transfer-matrix finite-difference time-domain (FDTD) method is proposed for modeling the optical properties of finite-width planar periodic structures. This method can also be applied for calculation of the photonic bands in infinite photonic crystals. We describe the procedure of evaluating the transfer-matrix elements by a special numerical FDTD simulation. The accuracy of the new method is tested by comparing computed transmission spectra of a 32-layered photonic crystal composed of spherical or ellipsoidal scatterers with the results of direct FDTD and layer-multiple-scattering calculations.

Transferring elements of a density matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allahverdyan, Armen E.; Hovhannisyan, Karen V.; Yerevan State University, A. Manoogian Street 1, Yerevan

2010-01-15

We study restrictions imposed by quantum mechanics on the process of matrix-element transfer. This problem is at the core of quantum measurements and state transfer. Given two systems A and B with initial density matrices lambda and r, respectively, we consider interactions that lead to transferring certain matrix elements of unknown lambda into those of the final state r-tilde of B. We find that this process eliminates the memory on the transferred (or certain other) matrix elements from the final state of A. If one diagonal matrix element is transferred, r(tilde sign){sub aa}=lambda{sub aa}, the memory on each nondiagonal elementmore » lambda{sub an}ot ={sub b} is completely eliminated from the final density operator of A. Consider the following three quantities, Relambda{sub an}ot ={sub b}, Imlambda{sub an}ot ={sub b}, and lambda{sub aa}-lambda{sub bb} (the real and imaginary part of a nondiagonal element and the corresponding difference between diagonal elements). Transferring one of them, e.g., Rer(tilde sign){sub an}ot ={sub b}=Relambda{sub an}ot ={sub b}, erases the memory on two others from the final state of A. Generalization of these setups to a finite-accuracy transfer brings in a trade-off between the accuracy and the amount of preserved memory. This trade-off is expressed via system-independent uncertainty relations that account for local aspects of the accuracy-disturbance trade-off in quantum measurements. Thus, the general aspect of state disturbance in quantum measurements is elimination of memory on non-diagonal elements, rather than diagonalization.« less

Creep-induced residual stress strengthening in a Nicalon-fiber-reinforced BMAS-glass-ceramic-matrix composite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Widjaja, S.; Jakus, K.; Ritter, J.E.

The feasibility of inducing a compressive residual stress in the matrix of a Nicalon-fiber-reinforced BMAS-glass-ceramic-matrix composite through a creep-load transfer treatment was studied. Specimens were crept at 1100 C under constant tensile load to cause load transfer from the matrix to the fibers, then cooled under load. Upon removal of the load at room temperature, the matrix was put into compression by the elastic recovery of the fibers. This compressive residual stress in the matrix increased the room-temperature proportional limit stress of the composite. The increase in the proportional limit stress was found to be dependent upon the applied creepmore » stress, with an increase in creep stress resulting in an increase in the proportional limit stress. Acoustic emission results showed that the onset of significant matrix cracking correlated closely to the proportional limit stress. Changes in the state of residual stress in the matrix were supported by X-ray diffraction results. Fracture surfaces of all specimens exhibited fiber pullout behavior, indicating that the creep-load transfer process did not embrittle the fiber/matrix interface.« less

Design, parametrization, and pole placement of stabilizing output feedback compensators via injective cogenerator quotient signal modules.

PubMed

Blumthaler, Ingrid; Oberst, Ulrich

2012-03-01

Control design belongs to the most important and difficult tasks of control engineering and has therefore been treated by many prominent researchers and in many textbooks, the systems being generally described by their transfer matrices or by Rosenbrock equations and more recently also as behaviors. Our approach to controller design uses, in addition to the ideas of our predecessors on coprime factorizations of transfer matrices and on the parametrization of stabilizing compensators, a new mathematical technique which enables simpler design and also new theorems in spite of the many outstanding results of the literature: (1) We use an injective cogenerator signal module ℱ over the polynomial algebra [Formula: see text] (F an infinite field), a saturated multiplicatively closed set T of stable polynomials and its quotient ring [Formula: see text] of stable rational functions. This enables the simultaneous treatment of continuous and discrete systems and of all notions of stability, called T-stability. We investigate stabilizing control design by output feedback of input/output (IO) behaviors and study the full feedback IO behavior, especially its autonomous part and not only its transfer matrix. (2) The new technique is characterized by the permanent application of the injective cogenerator quotient signal module [Formula: see text] and of quotient behaviors [Formula: see text] of [Formula: see text]-behaviors B. (3) For the control tasks of tracking, disturbance rejection, model matching, and decoupling and not necessarily proper plants we derive necessary and sufficient conditions for the existence of proper stabilizing compensators with proper and stable closed loop behaviors, parametrize all such compensators as IO behaviors and not only their transfer matrices and give new algorithms for their construction. Moreover we solve the problem of pole placement or spectral assignability for the complete feedback behavior. The properness of the full feedback behavior ensures the absence of impulsive solutions in the continuous case, and that of the compensator enables its realization by Kalman state space equations or elementary building blocks. We note that every behavior admits an IO decomposition with proper transfer matrix, but that most of these decompositions do not have this property, and therefore we do not assume the properness of the plant. (4) The new technique can also be applied to more general control interconnections according to Willems, in particular to two-parameter feedback compensators and to the recent tracking framework of Fiaz/Takaba/Trentelman. In contrast to these authors, however, we pay special attention to the properness of all constructed transfer matrices which requires more subtle algorithms.

Microcontact Peeling: A Cell Micropatterning Technique for Circumventing Direct Adsorption of Proteins to Hydrophobic PDMS.

PubMed

Yokoyama, Sho; Matsui, Tsubasa S; Deguchi, Shinji

2017-06-19

Microcontact printing (μCPr) is one of the most popular techniques used for cell micropatterning. In conventional μCPr, a polydimethylsiloxane (PDMS) stamp with microfeatures is used to adsorb extracellular matrix (ECM) proteins onto the featured surface and transfer them onto particular areas of a cell culture substrate. However, some types of functional proteins other than ECM have been reported to denature upon direct adsorption to hydrophobic PDMS. Here we describe a detailed protocol of an alternative technique--microcontact peeling (μCPe)--that allows for cell micropatterning while circumventing the step of adsorbing proteins to bare PDMS. This technique employs microfeatured materials with a relatively high surface energy such as copper, instead of using a microfeatured PDMS stamp, to peel off a cell-adhesive layer present on the surface of substrates. Consequently, cell-nonadhesive substrates are exposed at the specific surface that undergoes the physical contact with the microfeatured material. Thus, although μCPe and μCPr are apparently similar, the former does not comprise a process of transferring biomolecules through hydrophobic PDMS. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Treatment of Focal Articular Cartilage Defects in the Knee

PubMed Central

Magnussen, Robert A.; Dunn, Warren R.; Carey, James L.

2008-01-01

We asked whether autologous chondrocyte implantation or osteochondral autograft transfer yields better clinical outcomes compared with one another or with traditional abrasive techniques for treatment of isolated articular cartilage defects and whether lesion size influences this clinical outcome. We performed a literature search and identified five randomized, controlled trials and one prospective comparative trial evaluating these treatment techniques in 421 patients. The operative procedures included autologous chondrocyte implantation, osteochondral autograft transfer, matrix-induced autologous chondrocyte implantation, and microfracture. Minimum followup was 1 year (mean, 1.7 years; range, 1–3 years). All studies documented greater than 95% followup for clinical outcome measures. No technique consistently had superior results compared with the others. Outcomes for microfracture tended to be worse in larger lesions. All studies reported improvement in clinical outcome measures in all treatment groups when compared with preoperative assessment; however, no control (nonoperative) groups were used in any of the studies. A large prospective trial investigating these techniques with the addition of a control group would be the best way to definitively address the clinical questions. Level of Evidence: Level II, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18196358

Non-invasive imaging of barriers to drug delivery in tumors.

PubMed

Hassid, Yaron; Eyal, Erez; Margalit, Raanan; Furman-Haran, Edna; Degani, Hadassa

2008-08-01

Solid tumors often develop high interstitial fluid pressure (IFP) as a result of increased water leakage and impaired lymphatic drainage, as well as changes in the extracellular matrix composition and elasticity. This high fluid pressure forms a barrier to drug delivery and hence, resistance to therapy. We have developed techniques based on contrast enhanced magnetic resonance imaging for mapping in tumors the vascular and transport parameters determining the delivery efficiency of blood borne substances. Sequential images are recorded during continuous infusion of a Gd-based contrast agent and analyzed according to a new physiological model, yielding maps of microvascular transfer constants, as well as outward convective interstitial transfer constants and steady state interstitial contrast agent concentrations both reflecting IFP distribution. We further demonstrated in non small cell human lung cancer xenografts the capability of our techniques to monitor in vivo collagenase induced increase in contrast agent delivery as a result of decreased IFP. These techniques can be applied to test drugs that affect angiogenesis and modulate interstitial fluid pressure and has the potential to be extended to cancer patients for assessing resistance to drug delivery.

Non-Invasive Imaging of Barriers to Drug Delivery in Tumors

PubMed Central

Hassid, Yaron; Eyal, Erez; Margalit, Raanan; Furman-Haran, Edna; Degani, Hadassa

2011-01-01

Solid tumors often develop high interstitial fluid pressure (IFP) as a result of increased water leakage and impaired lymphatic drainage, as well as changes in the extracellular matrix composition and elasticity. This high fluid pressure forms a barrier to drug delivery and hence, resistance to therapy. We have developed techniques based on contrast enhanced magnetic resonance imaging for mapping in tumors the vascular and transport parameters determining the delivery efficiency of blood borne substances. Sequential images are recorded during continuous infusion of a Gd-based contrast agent and analyzed according to a new physiological model, yielding maps of microvascular transfer constants, as well as outward convective interstitial transfer constants and steady state interstitial contrast agent concentrations both reflecting IFP distribution. We further demonstrated in non small cell human lung cancer xenografts the capability of our techniques to monitor in vivo collagenase induced increase in contrast agent delivery as a result of decreased IFP. These techniques can be applied to test drugs that affect angiogenesis and modulate interstitial fluid pressure and has the potential to be extended to cancer patients for assessing resistance to drug delivery. PMID:18638494

The Linear Parameters and the Decoupling Matrix for Linearly Coupled Motion in 6 Dimensional Phase Space

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parzen, George

It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 x 6 matrix, R. R will be called the decoupling matrix. It will be shown that of the 36 elements of the 6 x 6 decoupling matrix R, only 12 elements are independent. This may be contrasted with the results for motion in 4- dimensional phase space, wheremore » R has 4 independent elements. A set of equations is given from which the 12 elements of R can be computed from the one period transfer matrix. This set of equations also allows the linear parameters, the β i,α i, i = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix. An alternative procedure for computing the linear parameters,β i,α i, i = 1, 3, and the 12 independent elements of the decoupling matrix R is also given which depends on computing the eigenvectors of the one period transfer matrix. These results can be used in a tracking program, where the one period transfer matrix can be computed by multiplying the transfer matrices of all the elements in a period, to compute the linear parameters α i and β i, i = 1, 3, and the elements of the decoupling matrix R. The procedure presented here for studying coupled motion in 6-dimensional phase space can also be applied to coupled motion in 4-dimensional phase space, where it may be a useful alternative procedure to the procedure presented by Edwards and Teng. In particular, it gives a simpler programing procedure for computing the beta functions and the emittances for coupled motion in 4-dimensional phase space.« less

The linear parameters and the decoupling matrix for linearly coupled motion in 6 dimensional phase space. Informal report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parzen, G.

It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 {times} 6 matrix, R. R will be called the decoupling matrix. It will be shown that of the 36 elements of the 6 {times} 6 decoupling matrix R, only 12 elements are independent. This may be contrasted with the results for motion in 4-dimensional phase space, where Rmore » has 4 independent elements. A set of equations is given from which the 12 elements of R can be computed from the one period transfer matrix. This set of equations also allows the linear parameters, {beta}{sub i}, {alpha}{sub i} = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix. An alternative procedure for computing the linear parameters, the {beta}{sub i}, {alpha}{sub i} i = 1, 3, and the 12 independent elements of the decoupling matrix R is also given which depends on computing the eigenvectors of the one period transfer matrix. These results can be used in a tracking program, where the one period transfer matrix can be computed by multiplying the transfer matrices of all the elements in a period, to compute the linear parameters {alpha}{sub i} and {beta}{sub i}, i = 1, 3, and the elements of the decoupling matrix R. The procedure presented here for studying coupled motion in 6-dimensional phase space can also be applied to coupled motion in 4-dimensional phase space, where it may be a useful alternative procedure to the procedure presented by Edwards and Teng. In particular, it gives a simpler programming procedure for computing the beta functions and the emittances for coupled motion in 4-dimensional phase space.« less

Molecular Basis for Electron Flow Within Metal-and Electrode-Reducing Biofilms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bond, Daniel R.

2016-11-01

Electrochemical, spectral, genetic, and biochemical techniques were developed to reveal that a diverse suite of redox proteins and structural macromolecules outside the cell work together to move electrons long distances between Geobacter cells to metals and electrodes. In this project, we greatly expanded the known participants in the electron transfer pathway of Geobacter. For example, in addition to well-studied pili, polysaccharides contribute to anchoring, different cytochromes are required under different conditions, strategies change with redox potential, and the localization of these components can change depending on where cells are located in a biofilm. By inventing new electrodes compatible with real-timemore » spectral measurements, we were able to visualize the redox status of biofilms in action, leading to a hypothesis that long-distance electron transfer is ultimately limiting in these systems and redox potentials change within biofilms. The goals of this project were met, as we were able to 1) identify new elements crucial to the expression, assembly and function of the extracellular electron transfer phenotype 2) expand spectral and electrochemical techniques to define the mechanism and route of electron transfer through the matrix, and 3) combine this knowledge to build the next generation of genetic tools for study of this complex process.« less

Optics of short-pitch deformed-helix ferroelectric liquid crystals: Symmetries, exceptional points, and polarization-resolved angular patterns

NASA Astrophysics Data System (ADS)

Kiselev, Alexei D.; Chigrinov, Vladimir G.

2014-10-01

In order to explore electric-field-induced transformations of polarization singularities in the polarization-resolved angular (conoscopic) patterns emerging after deformed-helix ferroelectric liquid crystal (DHFLC) cells with subwavelength helix pitch, we combine the transfer matrix formalism with the results for the effective dielectric tensor of biaxial FLCs evaluated using an improved technique of averaging over distorted helical structures. Within the framework of the transfer matrix method, we deduce a number of symmetry relations and show that the symmetry axis of L lines (curves of linear polarization) is directed along the major in-plane optical axis which rotates under the action of the electric field. When the angle between this axis and the polarization plane of incident linearly polarized light is above its critical value, the C points (points of circular polarization) appear in the form of symmetrically arranged chains of densely packed star-monstar pairs. We also emphasize the role of phase singularities of a different kind and discuss the enhanced electro-optic response of DHFLCs near the exceptional point where the condition of zero-field isotropy is fulfilled.

Transfer matrix approach to the persistent current in quantum rings: Application to hybrid normal-superconducting rings

NASA Astrophysics Data System (ADS)

Nava, Andrea; Giuliano, Rosa; Campagnano, Gabriele; Giuliano, Domenico

2016-11-01

Using the properties of the transfer matrix of one-dimensional quantum mechanical systems, we derive an exact formula for the persistent current across a quantum mechanical ring pierced by a magnetic flux Φ as a single integral of a known function of the system's parameters. Our approach provides exact results at zero temperature, which can be readily extended to a finite temperature T . We apply our technique to exactly compute the persistent current through p -wave and s -wave superconducting-normal hybrid rings, deriving full plots of the current as a function of the applied flux at various system's scales. Doing so, we recover at once a number of effects such as the crossover in the current periodicity on increasing the size of the ring and the signature of the topological phase transition in the p -wave case. In the limit of a large ring size, resorting to a systematic expansion in inverse powers of the ring length, we derive exact analytic closed-form formulas, applicable to a number of cases of physical interest.

Matrix-algebra-based calculations of the time evolution of the binary spin-bath model for magnetization transfer.

PubMed

Müller, Dirk K; Pampel, André; Möller, Harald E

2013-05-01

Quantification of magnetization-transfer (MT) experiments are typically based on the assumption of the binary spin-bath model. This model allows for the extraction of up to six parameters (relative pool sizes, relaxation times, and exchange rate constants) for the characterization of macromolecules, which are coupled via exchange processes to the water in tissues. Here, an approach is presented for estimating MT parameters acquired with arbitrary saturation schemes and imaging pulse sequences. It uses matrix algebra to solve the Bloch-McConnell equations without unwarranted simplifications, such as assuming steady-state conditions for pulsed saturation schemes or neglecting imaging pulses. The algorithm achieves sufficient efficiency for voxel-by-voxel MT parameter estimations by using a polynomial interpolation technique. Simulations, as well as experiments in agar gels with continuous-wave and pulsed MT preparation, were performed for validation and for assessing approximations in previous modeling approaches. In vivo experiments in the normal human brain yielded results that were consistent with published data. Copyright © 2013 Elsevier Inc. All rights reserved.

Atmospheric pressure matrix-assisted laser desorption ionization as a plume diagnostic tool in laser evaporation methods

NASA Astrophysics Data System (ADS)

Callahan, John H.; Galicia, Marsha C.; Vertes, Akos

2002-09-01

Laser evaporation techniques, including matrix-assisted pulsed laser evaporation (MAPLE), are attracting increasing attention due to their ability to deposit thin layers of undegraded synthetic and biopolymers. Laser evaporation methods can be implemented in reflection geometry with the laser and the substrate positioned on the same side of the target. In some applications (e.g. direct write, DW), however, transmission geometry is used, i.e. the thin target is placed between the laser and the substrate. In this case, the laser pulse perforates the target and transfers some target material to the substrate. In order to optimize evaporation processes it is important to know the composition of the target plume and the material deposited from the plume. We used a recently introduced analytical method, atmospheric pressure matrix-assisted laser desorption ionization (AP-MALDI) to characterize the ionic components of the plume both in reflection and in transmission geometry. This technique can also be used to directly probe materials deposited on surfaces (such as glass slides) by laser evaporation methods. The test compound (small peptides, e.g. Angiotensin I, ATI or Substance P) was mixed with a MALDI matrix (α-cyano-4-hydroxycinnamic acid (CHCA), sinapinic acid (SA) or 2,5-dihydroxybenzoic acid (DHB)) and applied to the stainless steel (reflection geometry) or transparent conducting (transmission geometry) target holder. In addition to the classical dried droplet method, we also used electrospray target deposition to gain better control of crystallite size, thickness and homogeneity. The target was mounted in front of the inlet orifice of an ion trap mass spectrometer (IT-MS) that sampled the ionic components of the plume generated by a nitrogen laser. We studied the effect of several parameters, such as, the orifice to target distance, illumination geometry, extracting voltage distribution and sample preparation on the generated ions. Various analyte-matrix and matrix-matrix cluster ions were observed with relatively low abundance of the matrix ions.

A review of the matrix-exponential formalism in radiative transfer

NASA Astrophysics Data System (ADS)

Efremenko, Dmitry S.; Molina García, Víctor; Gimeno García, Sebastián; Doicu, Adrian

2017-07-01

This paper outlines the matrix exponential description of radiative transfer. The eigendecomposition method which serves as a basis for computing the matrix exponential and for representing the solution in a discrete ordinate setting is considered. The mathematical equivalence of the discrete ordinate method, the matrix operator method, and the matrix Riccati equations method is proved rigorously by means of the matrix exponential formalism. For optically thin layers, approximate solution methods relying on the Padé and Taylor series approximations to the matrix exponential, as well as on the matrix Riccati equations, are presented. For optically thick layers, the asymptotic theory with higher-order corrections is derived, and parameterizations of the asymptotic functions and constants for a water-cloud model with a Gamma size distribution are obtained.

Rotordynamic analysis using the Complex Transfer Matrix: An application to elastomer supports using the viscoelastic correspondence principle

NASA Astrophysics Data System (ADS)

Varney, Philip; Green, Itzhak

2014-11-01

Numerous methods are available to calculate rotordynamic whirl frequencies, including analytic methods, finite element analysis, and the transfer matrix method. The typical real-valued transfer matrix (RTM) suffers from several deficiencies, including lengthy computation times and the inability to distinguish forward and backward whirl. Though application of complex coordinates in rotordynamic analysis is not novel per se, specific advantages gained from using such coordinates in a transfer matrix analysis have yet to be elucidated. The present work employs a complex coordinate redefinition of the transfer matrix to obtain reduced forms of the elemental transfer matrices in inertial and rotating reference frames, including external stiffness and damping. Application of the complex-valued state variable redefinition results in a reduction of the 8×8 RTM to the 4×4 Complex Transfer Matrix (CTM). The CTM is advantageous in that it intrinsically separates forward and backward whirl, eases symbolic manipulation by halving the transfer matrices’ dimension, and provides significant improvement in computation time. A symbolic analysis is performed on a simple overhung rotor to demonstrate the mathematical motivation for whirl frequency separation. The CTM's utility is further shown by analyzing a rotordynamic system supported by viscoelastic elastomer rings. Viscoelastic elastomer ring supports can provide significant damping while reducing the cost and complexity associated with conventional components such as squeeze film dampers. The stiffness and damping of a viscoelastic damper ring are determined herein as a function of whirl frequency using the viscoelastic correspondence principle and a constitutive fractional calculus viscoelasticity model. The CTM is then employed to obtain the characteristic equation, where the whirl frequency dependent stiffness and damping of the elastomer supports are included. The Campbell diagram is shown, demonstrating the CTM's ability to intrinsically separate synchronous whirl direction for a non-trivial rotordynamic system. Good agreement is found between the CTM results and previously obtained analytic and experimental results for the elastomer ring supported rotordynamic system.

The Relationship between N-Back Performance and Matrix Reasoning--Implications for Training and Transfer

ERIC Educational Resources Information Center

Jaeggi, Susanne M.; Studer-Luethi, Barbara; Buschkuehl, Martin; Su, Yi-Fen; Jonides, John; Perrig, Walter J.

2010-01-01

We have previously demonstrated that training on a dual n-back task results in improvements in fluid intelligence ("Gf") as measured by matrix reasoning tasks. Here, we explored the underlying mechanisms of this transfer effect in two studies, and we evaluated the transfer potential of a single n-back task. In the first study, we demonstrated that…

Polarimetric signatures of a canopy of dielectric cylinders based on first and second order vector radiative transfer theory

NASA Technical Reports Server (NTRS)

Tsang, Leung; Chan, Chi Hou; Kong, Jin AU; Joseph, James

1992-01-01

Complete polarimetric signatures of a canopy of dielectric cylinders overlying a homogeneous half space are studied with the first and second order solutions of the vector radiative transfer theory. The vector radiative transfer equations contain a general nondiagonal extinction matrix and a phase matrix. The energy conservation issue is addressed by calculating the elements of the extinction matrix and the elements of the phase matrix in a manner that is consistent with energy conservation. Two methods are used. In the first method, the surface fields and the internal fields of the dielectric cylinder are calculated by using the fields of an infinite cylinder. The phase matrix is calculated and the extinction matrix is calculated by summing the absorption and scattering to ensure energy conservation. In the second method, the method of moments is used to calculate the elements of the extinction and phase matrices. The Mueller matrix based on the first order and second order multiple scattering solutions of the vector radiative transfer equation are calculated. Results from the two methods are compared. The vector radiative transfer equations, combined with the solution based on method of moments, obey both energy conservation and reciprocity. The polarimetric signatures, copolarized and depolarized return, degree of polarization, and phase differences are studied as a function of the orientation, sizes, and dielectric properties of the cylinders. It is shown that second order scattering is generally important for vegetation canopy at C band and can be important at L band for some cases.

The matrix effect in secondary ion mass spectrometry

NASA Astrophysics Data System (ADS)

Seah, M. P.; Shard, A. G.

2018-05-01

Matrix effects in the secondary ion mass spectrometry (SIMS) of selected elemental systems have been analyzed to investigate the applicability of a mathematical description of the matrix effect, called here the charge transfer (CT) model. This model was originally derived for proton exchange and organic positive secondary ions, to characterise the enhancement or suppression of intensities in organic binary systems. In the systems considered in this paper protons are specifically excluded, which enables an assessment of whether the model applies for electrons as well. The present importance is in organic systems but, here we analyse simpler inorganic systems. Matrix effects in elemental systems cannot involve proton transfer if there are no protons present but may be caused by electron transfer and so electron transfer may also be involved in the matrix effects for organic systems. There are general similarities in both the magnitudes of the ion intensities as well as the matrix effects for both positive and negative secondary ions in both systems and so the CT model may be more widely applicable. Published SIMS analyses of binary elemental mixtures are analyzed. The data of Kim et al., for the Pt/Co system, provide, with good precision, data for such a system. This gives evidence for the applicability of the CT model, where electron, rather than proton, transfer is the matrix enhancing and suppressing mechanism. The published data of Prudon et al., for the important Si/Ge system, provides further evidence for the effects for both positive and negative secondary ions and allows rudimentary rules to be developed for the enhancing and suppressing species.

Chemical analysis of pharmaceuticals and explosives in fingermarks using matrix-assisted laser desorption ionization/time-of-flight mass spectrometry.

PubMed

Kaplan-Sandquist, Kimberly; LeBeau, Marc A; Miller, Mark L

2014-02-01

Chemical analysis of latent fingermarks, "touch chemistry," has the potential of providing intelligence or forensically relevant information. Matrix-assisted laser desorption ionization/time-of-flight mass spectrometry (MALDI/TOF MS) was used as an analytical platform for obtaining mass spectra and chemical images of target drugs and explosives in fingermark residues following conventional fingerprint development methods and MALDI matrix processing. There were two main purposes of this research: (1) develop effective laboratory methods for detecting drugs and explosives in fingermark residues and (2) determine the feasibility of detecting drugs and explosives after casual contact with pills, powders, and residues. Further, synthetic latent print reference pads were evaluated as mimics of natural fingermark residue to determine if the pads could be used for method development and quality control. The results suggest that artificial amino acid and sebaceous oil residue pads are not suitable to adequately simulate natural fingermark chemistry for MALDI/TOF MS analysis. However, the pads were useful for designing experiments and setting instrumental parameters. Based on the natural fingermark residue experiments, handling whole or broken pills did not transfer sufficient quantities of drugs to allow for definitive detection. Transferring drugs or explosives in the form of powders and residues was successful for preparing analytes for detection after contact with fingers and deposition of fingermark residue. One downfall to handling powders was that the analyte particles were easily spread beyond the original fingermark during development. Analyte particles were confined in the original fingermark when using transfer residues. The MALDI/TOF MS was able to detect procaine, pseudoephedrine, TNT, and RDX from contact residue under laboratory conditions with the integration of conventional fingerprint development methods and MALDI matrix. MALDI/TOF MS is a nondestructive technique which provides chemical information in both the mass spectra and chemical images. Published by Elsevier Ireland Ltd.

Calibration of polarimetric radar systems with good polarization isolation

NASA Technical Reports Server (NTRS)

Sarabandi, Kamal; Ulaby, Fawwaz T.; Tassoudji, M. Ali

1990-01-01

A practical technique is proposed for calibrating single-antenna polarimetric radar systems using a metal sphere plus any second target with a strong cross-polarized radar cross section. This technique assumes perfect isolation between antenna ports. It is shown that all magnitudes and phases (relative to one of the like-polarized linear polarization configurations) of the radar transfer function can be calibrated without knowledge of the scattering matrix of the second target. Comparison of the values measured (using this calibration technique) for a tilted cylinder at X-band with theoretical values shows agreement within + or - 0.3 dB in magnitude and + or - 5 degrees in phase. The radar overall cross-polarization isolation was 25 dB. The technique is particularly useful for calibrating a radar under field conditions, because it does not require the careful alignment of calibration targets.

Reduced modeling of flexible structures for decentralized control

NASA Technical Reports Server (NTRS)

Yousuff, A.; Tan, T. M.; Bahar, L. Y.; Konstantinidis, M. F.

1986-01-01

Based upon the modified finite element-transfer matrix method, this paper presents a technique for reduced modeling of flexible structures for decentralized control. The modeling decisions are carried out at (finite-) element level, and are dictated by control objectives. A simply supported beam with two sets of actuators and sensors (linear force actuator and linear position and velocity sensors) is considered for illustration. In this case, it is conjectured that the decentrally controlled closed loop system is guaranteed to be at least marginally stable.

Energy Transfer Efficiency from ZnO-Nanocrystals to Eu3+ Ions Embedded in SiO₂ Film for Emission at 614 nm.

PubMed

Mangalam, Vivek; Pita, Kantisara

2017-08-10

In this work, we study the energy transfer mechanism from ZnO nanocrystals (ZnO-nc) to Eu 3+ ions by fabricating thin-film samples of ZnO-nc and Eu 3+ ions embedded in a SiO₂ matrix using the low-cost sol-gel technique. The time-resolved photoluminescence (TRPL) measurements from the samples were analyzed to understand the contribution of energy transfer from the various ZnO-nc emission centers to Eu 3+ ions. The decay time obtained from the TRPL measurements was used to calculate the energy transfer efficiencies from the ZnO-nc emission centers, and these results were compared with the energy transfer efficiencies calculated from steady-state photoluminescence emission results. The results in this work show that high transfer efficiencies from the excitonic and Zn defect emission centers is mostly due to the energy transfer from ZnO-nc to Eu 3+ ions which results in the radiative emission from the Eu 3+ ions at 614 nm, while the energy transfer from the oxygen defect emissions is most probably due to the energy transfer from ZnO-nc to the new defects created due to the incorporation of the Eu 3+ ions.

Reliability analysis of laminated CMC components through shell subelement techniques

NASA Technical Reports Server (NTRS)

Starlinger, Alois; Duffy, Stephen F.; Gyekenyesi, John P.

1992-01-01

An updated version of the integrated design program Composite Ceramics Analysis and Reliability Evaluation of Structures (C/CARES) was developed for the reliability evaluation of ceramic matrix composites (CMC) laminated shell components. The algorithm is now split into two modules: a finite-element data interface program and a reliability evaluation algorithm. More flexibility is achieved, allowing for easy implementation with various finite-element programs. The interface program creates a neutral data base which is then read by the reliability module. This neutral data base concept allows easy data transfer between different computer systems. The new interface program from the finite-element code Matrix Automated Reduction and Coupling (MARC) also includes the option of using hybrid laminates (a combination of plies of different materials or different layups) and allows for variations in temperature fields throughout the component. In the current version of C/CARES, a subelement technique was implemented, enabling stress gradients within an element to be taken into account. The noninteractive reliability function is now evaluated at each Gaussian integration point instead of using averaging techniques. As a result of the increased number of stress evaluation points, considerable improvements in the accuracy of reliability analyses were realized.

A method to model latent heat for transient analysis using NASTRAN

NASA Technical Reports Server (NTRS)

Harder, R. L.

1982-01-01

A sample heat transfer analysis is demonstrated which includes the heat of fusion. The method can be used to analyze a system with nonconstant specific heat. The enthalpy is introduced as an independent degree of freedom at each node. The user input consists of a curve of temperature as a function of enthalpy, which may include a constant temperature phase change. The basic NASTRAN heat transfer capability is used to model the effects of latent heat with existing direct matrix output and nonlinear load data cards. Although some user care is required, the numerical stability of the integration is quite good when the given recommendations are followed. The theoretical equations used and the NASTRAN techniques are shown.

Correlation of structural properties with energy transfer of Eu-doped ZnO thin films prepared by sol-gel process and magnetron reactive sputtering

PubMed Central

Petersen, Julien; Brimont, Christelle; Gallart, Mathieu; Schmerber, Guy; Gilliot, Pierre; Ulhaq-Bouillet, Corinne; Rehspringer, Jean-Luc; Colis, Silviu; Becker, Claude; Slaoui, Abdelillah; Dinia, Aziz

2010-01-01

We investigated the structural and optical properties of Eu-doped ZnO thin films made by sol-gel technique and magnetron reactive sputtering on Si (100) substrate. The films elaborated by sol-gel process are polycrystalline while the films made by sputtering show a strongly textured growth along the c-axis. X-ray diffraction patterns and transmission electron microscopy analysis show that all samples are free of spurious phases. The presence of Eu2+ and Eu3+ into the ZnO matrix has been confirmed by x-ray photoemission spectroscopy. This means that a small fraction of Europium substitutes Zn2+ as Eu2+ into the ZnO matrix; the rest of Eu being in the trivalent state. This is probably due to the formation of Eu2O3 oxide at the surface of ZnO particles. This is at the origin of the strong photoluminescence band observed at 2 eV, which is characteristic of the 5D0→7F2 Eu3+ transition. In addition the photoluminescence excitonic spectra showed efficient energy transfer from the ZnO matrix to the Eu3+ ion, which is qualitatively similar for both films although the sputtered films have a better structural quality compared to the sol-gel process grown films. PMID:20644657

Experimental Determination of the Dynamic Hydraulic Transfer Function for the J-2X Oxidizer Turbopump. Part One; Methodology

NASA Technical Reports Server (NTRS)

Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave

2011-01-01

An advanced methodology for extracting the hydraulic dynamic pump transfer matrix (Yp) for a cavitating liquid rocket engine turbopump inducer+impeller has been developed. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Laboratory pulsed subscale waterflow test of the J-2X oxygen turbo pump is introduced and our new extraction method applied to the data collected. From accurate measures of pump inlet and discharge perturbational mass flows and pressures, and one-dimensional flow models that represents complete waterflow loop physics, we are able to derive Yp and hence extract the characteristic pump parameters: compliance, pump gain, impedance, mass flow gain. Detailed modeling is necessary to accurately translate instrument plane measurements to the pump inlet and discharge and extract Yp. We present the MSFC Dynamic Lump Parameter Fluid Model Framework and describe critical dynamic component details. We report on fit minimization techniques, cost (fitness) function derivation, and resulting model fits to our experimental data are presented. Comparisons are made to alternate techniques for spatially translating measurement stations to actual pump inlet and discharge.

Integrability and conformal data of the dimer model

NASA Astrophysics Data System (ADS)

Morin-Duchesne, Alexi; Rasmussen, Jørgen; Ruelle, Philippe

2016-04-01

The central charge of the dimer model on the square lattice is still being debated in the literature. In this paper, we provide evidence supporting the consistency of a c=-2 description. Using Lieb’s transfer matrix and its description in terms of the Temperley-Lieb algebra {{TL}}n at β =0, we provide a new solution of the dimer model in terms of the model of critical dense polymers on a tilted lattice and offer an understanding of the lattice integrability of the dimer model. The dimer transfer matrix is analyzed in the scaling limit, and the result for {L}0-\\frac{c}{24} is expressed in terms of fermions. Higher Virasoro modes are likewise constructed as limits of elements of {{TL}}n and are found to yield a c=-2 realization of the Virasoro algebra, familiar from fermionic bc ghost systems. In this realization, the dimer Fock spaces are shown to decompose, as Virasoro modules, into direct sums of Feigin-Fuchs modules, themselves exhibiting reducible yet indecomposable structures. In the scaling limit, the eigenvalues of the lattice integrals of motion are found to agree exactly with those of the c=-2 conformal integrals of motion. Consistent with the expression for {L}0-\\frac{c}{24} obtained from the transfer matrix, we also construct higher Virasoro modes with c = 1 and find that the dimer Fock space is completely reducible under their action. However, the transfer matrix is found not to be a generating function for the c = 1 integrals of motion. Although this indicates that Lieb’s transfer matrix description is incompatible with the c = 1 interpretation, it does not rule out the existence of an alternative, c = 1 compatible, transfer matrix description of the dimer model.

Algorithms for Efficient Computation of Transfer Functions for Large Order Flexible Systems

NASA Technical Reports Server (NTRS)

Maghami, Peiman G.; Giesy, Daniel P.

1998-01-01

An efficient and robust computational scheme is given for the calculation of the frequency response function of a large order, flexible system implemented with a linear, time invariant control system. Advantage is taken of the highly structured sparsity of the system matrix of the plant based on a model of the structure using normal mode coordinates. The computational time per frequency point of the new computational scheme is a linear function of system size, a significant improvement over traditional, still-matrix techniques whose computational times per frequency point range from quadratic to cubic functions of system size. This permits the practical frequency domain analysis of systems of much larger order than by traditional, full-matrix techniques. Formulations are given for both open- and closed-loop systems. Numerical examples are presented showing the advantages of the present formulation over traditional approaches, both in speed and in accuracy. Using a model with 703 structural modes, the present method was up to two orders of magnitude faster than a traditional method. The present method generally showed good to excellent accuracy throughout the range of test frequencies, while traditional methods gave adequate accuracy for lower frequencies, but generally deteriorated in performance at higher frequencies with worst case errors being many orders of magnitude times the correct values.

Circular lasers for telecommunications and rf/photonics applications

NASA Astrophysics Data System (ADS)

Griffel, Giora

2000-04-01

Following a review of ring resonator research in the past decade we shall report a novel bi-level etching technique that permits the use of standard photolithography for coupling to deeply-etched ring resonator structures. The technique is employed to demonstrate InGaAsP laterally- coupled racetrack ring resonators laser with record low threshold currents of 66 mA. The racetrack laser have curved sections of 150 micrometers radius with negligible bending loss. The lasers operate CW single mode up to nearly twice threshold with a 26 dB side-mode-suppression ratio. We shall also present a transfer matrix formalism for the analysis of ring resonator arrays and indicate application examples for flat band filter synthesis.

Real time estimation of ship motions using Kalman filtering techniques

NASA Technical Reports Server (NTRS)

Triantafyllou, M. S.; Bodson, M.; Athans, M.

1983-01-01

The estimation of the heave, pitch, roll, sway, and yaw motions of a DD-963 destroyer is studied, using Kalman filtering techniques, for application in VTOL aircraft landing. The governing equations are obtained from hydrodynamic considerations in the form of linear differential equations with frequency dependent coefficients. In addition, nonminimum phase characteristics are obtained due to the spatial integration of the water wave forces. The resulting transfer matrix function is irrational and nonminimum phase. The conditions for a finite-dimensional approximation are considered and the impact of the various parameters is assessed. A detailed numerical application for a DD-963 destroyer is presented and simulations of the estimations obtained from Kalman filters are discussed.

Comprehensive photonics-electronics convergent simulation and its application to high-speed electronic circuit integration on a Si/Ge photonic chip

NASA Astrophysics Data System (ADS)

Takeda, Kotaro; Honda, Kentaro; Takeya, Tsutomu; Okazaki, Kota; Hiraki, Tatsurou; Tsuchizawa, Tai; Nishi, Hidetaka; Kou, Rai; Fukuda, Hiroshi; Usui, Mitsuo; Nosaka, Hideyuki; Yamamoto, Tsuyoshi; Yamada, Koji

2015-01-01

We developed a design technique for a photonics-electronics convergence system by using an equivalent circuit of optical devices in an electrical circuit simulator. We used the transfer matrix method to calculate the response of an optical device. This method used physical parameters and dimensions of optical devices as calculation parameters to design a device in the electrical circuit simulator. It also used an intermediate frequency to express the wavelength dependence of optical devices. By using both techniques, we simulated bit error rates and eye diagrams of optical and electrical integrated circuits and calculated influences of device structure change and wavelength shift penalty.

Frequency domain system identification methods - Matrix fraction description approach

NASA Technical Reports Server (NTRS)

Horta, Luca G.; Juang, Jer-Nan

1993-01-01

This paper presents the use of matrix fraction descriptions for least-squares curve fitting of the frequency spectra to compute two matrix polynomials. The matrix polynomials are intermediate step to obtain a linearized representation of the experimental transfer function. Two approaches are presented: first, the matrix polynomials are identified using an estimated transfer function; second, the matrix polynomials are identified directly from the cross/auto spectra of the input and output signals. A set of Markov parameters are computed from the polynomials and subsequently realization theory is used to recover a minimum order state space model. Unevenly spaced frequency response functions may be used. Results from a simple numerical example and an experiment are discussed to highlight some of the important aspect of the algorithm.

Chemical Reactions Triggered Using Electrons Photodetached from "Clean" Distributions of Anions Deposited in Cryogenic Matrices via Counterion Codeposition.

PubMed

Ludwig, Ryan M; Moore, David T

2014-09-04

Application of matrix isolation spectroscopy to ionic species is typically complicated by the presence of neutral contaminants during matrix deposition. Herein we demonstrate that simultaneous deposition of balanced currents of counterions with mass-selected ions of interest generates "clean" distributions of matrix-isolated metal carbonyl anions, where the only bands appearing in the CO-stretching region of the vibrational spectrum arise from ions. (Neutrals are initially absent.) Photodetachment by mild irradiation with visible light leads to complete conversion of the anions into their corresponding neutral species. The photodetached electrons, in turn, initiate covalent chemistry, inducing C-C bond formation following electron-capture by CO van der Waals dimers to produce trans-OCCO(-). The initial clean distribution of ions enables clear connections to be drawn between the spectral changes occurring at each experimental step, thus demonstrating the potential of the counterion codeposition technique to facilitate detailed studies of chemistry involving ions and electron transfer in cryogenic matrices.

Matrix method for two-dimensional waveguide mode solution

NASA Astrophysics Data System (ADS)

Sun, Baoguang; Cai, Congzhong; Venkatesh, Balajee Seshasayee

2018-05-01

In this paper, we show that the transfer matrix theory of multilayer optics can be used to solve the modes of any two-dimensional (2D) waveguide for their effective indices and field distributions. A 2D waveguide, even composed of numerous layers, is essentially a multilayer stack and the transmission through the stack can be analysed using the transfer matrix theory. The result is a transfer matrix with four complex value elements, namely A, B, C and D. The effective index of a guided mode satisfies two conditions: (1) evanescent waves exist simultaneously in the first (cladding) layer and last (substrate) layer, and (2) the complex element D vanishes. For a given mode, the field distribution in the waveguide is the result of a 'folded' plane wave. In each layer, there is only propagation and absorption; at each boundary, only reflection and refraction occur, which can be calculated according to the Fresnel equations. As examples, we show that this method can be used to solve modes supported by the multilayer step-index dielectric waveguide, slot waveguide, gradient-index waveguide and various plasmonic waveguides. The results indicate the transfer matrix method is effective for 2D waveguide mode solution in general.

Adaptive Inverse Control for Rotorcraft Vibration Reduction

NASA Technical Reports Server (NTRS)

Jacklin, Stephen A.

1985-01-01

This thesis extends the Least Mean Square (LMS) algorithm to solve the mult!ple-input, multiple-output problem of alleviating N/Rev (revolutions per minute by number of blades) helicopter fuselage vibration by means of adaptive inverse control. A frequency domain locally linear model is used to represent the transfer matrix relating the higher harmonic pitch control inputs to the harmonic vibration outputs to be controlled. By using the inverse matrix as the controller gain matrix, an adaptive inverse regulator is formed to alleviate the N/Rev vibration. The stability and rate of convergence properties of the extended LMS algorithm are discussed. It is shown that the stability ranges for the elements of the stability gain matrix are directly related to the eigenvalues of the vibration signal information matrix for the learning phase, but not for the control phase. The overall conclusion is that the LMS adaptive inverse control method can form a robust vibration control system, but will require some tuning of the input sensor gains, the stability gain matrix, and the amount of control relaxation to be used. The learning curve of the controller during the learning phase is shown to be quantitatively close to that predicted by averaging the learning curves of the normal modes. For higher order transfer matrices, a rough estimate of the inverse is needed to start the algorithm efficiently. The simulation results indicate that the factor which most influences LMS adaptive inverse control is the product of the control relaxation and the the stability gain matrix. A small stability gain matrix makes the controller less sensitive to relaxation selection, and permits faster and more stable vibration reduction, than by choosing the stability gain matrix large and the control relaxation term small. It is shown that the best selections of the stability gain matrix elements and the amount of control relaxation is basically a compromise between slow, stable convergence and fast convergence with increased possibility of unstable identification. In the simulation studies, the LMS adaptive inverse control algorithm is shown to be capable of adapting the inverse (controller) matrix to track changes in the flight conditions. The algorithm converges quickly for moderate disturbances, while taking longer for larger disturbances. Perfect knowledge of the inverse matrix is not required for good control of the N/Rev vibration. However it is shown that measurement noise will prevent the LMS adaptive inverse control technique from controlling the vibration, unless the signal averaging method presented is incorporated into the algorithm.

A test for interfacial effects and stress transfer in ceramic matrix composites

NASA Technical Reports Server (NTRS)

1988-01-01

A test specimen was devised for measuring stress transfer between a high modulus fiber and a ceramic matrix. Single filaments of SiC were embedded in chemically vapor deposited SiC on a thin plate of molybdenum. The CVD overcoating which encapsulated the fiber was continuous with a coating of SiC on the molybdenum. When placed in a microtensile test device and loaded in the fiber direction, the fiber fracture characteristics provide information on the fiber/matrix adhesion and stress transfer. Problems were encountered due to the formation of a weak boundary between the SiC and the molybdenum which obviated any meaningful tensile tests. Also, the high CVD temperature used in fabricating these specimens restrict the fiber, matrix (and substrate) to materials having similar thermal coefficients of expansion in order to minimize thermal stresses.

Development of a hybrid wave based-transfer matrix model for sound transmission analysis.

PubMed

Dijckmans, A; Vermeir, G

2013-04-01

In this paper, a hybrid wave based-transfer matrix model is presented that allows for the investigation of the sound transmission through finite multilayered structures placed between two reverberant rooms. The multilayered structure may consist of an arbitrary configuration of fluid, elastic, or poro-elastic layers. The field variables (structural displacements and sound pressures) are expanded in terms of structural and acoustic wave functions. The boundary and continuity conditions in the rooms determine the participation factors in the pressure expansions. The displacement of the multilayered structure is determined by the mechanical impedance matrix, which gives a relation between the pressures and transverse displacements at both sides of the structure. The elements of this matrix are calculated with the transfer matrix method. First, the hybrid model is numerically validated. Next a comparison is made with sound transmission loss measurements of a hollow brick wall and a sandwich panel. Finally, numerical simulations show the influence of structural damping, room dimensions and plate dimensions on the sound transmission loss of multilayered structures.

Discriminative Transfer Subspace Learning via Low-Rank and Sparse Representation.

PubMed

Xu, Yong; Fang, Xiaozhao; Wu, Jian; Li, Xuelong; Zhang, David

2016-02-01

In this paper, we address the problem of unsupervised domain transfer learning in which no labels are available in the target domain. We use a transformation matrix to transfer both the source and target data to a common subspace, where each target sample can be represented by a combination of source samples such that the samples from different domains can be well interlaced. In this way, the discrepancy of the source and target domains is reduced. By imposing joint low-rank and sparse constraints on the reconstruction coefficient matrix, the global and local structures of data can be preserved. To enlarge the margins between different classes as much as possible and provide more freedom to diminish the discrepancy, a flexible linear classifier (projection) is obtained by learning a non-negative label relaxation matrix that allows the strict binary label matrix to relax into a slack variable matrix. Our method can avoid a potentially negative transfer by using a sparse matrix to model the noise and, thus, is more robust to different types of noise. We formulate our problem as a constrained low-rankness and sparsity minimization problem and solve it by the inexact augmented Lagrange multiplier method. Extensive experiments on various visual domain adaptation tasks show the superiority of the proposed method over the state-of-the art methods. The MATLAB code of our method will be publicly available at http://www.yongxu.org/lunwen.html.

Laplace Transform Based Radiative Transfer Studies

NASA Astrophysics Data System (ADS)

Hu, Y.; Lin, B.; Ng, T.; Yang, P.; Wiscombe, W.; Herath, J.; Duffy, D.

2006-12-01

Multiple scattering is the major uncertainty for data analysis of space-based lidar measurements. Until now, accurate quantitative lidar data analysis has been limited to very thin objects that are dominated by single scattering, where photons from the laser beam only scatter a single time with particles in the atmosphere before reaching the receiver, and simple linear relationship between physical property and lidar signal exists. In reality, multiple scattering is always a factor in space-based lidar measurement and it dominates space- based lidar returns from clouds, dust aerosols, vegetation canopy and phytoplankton. While multiple scattering are clear signals, the lack of a fast-enough lidar multiple scattering computation tool forces us to treat the signal as unwanted "noise" and use simple multiple scattering correction scheme to remove them. Such multiple scattering treatments waste the multiple scattering signals and may cause orders of magnitude errors in retrieved physical properties. Thus the lack of fast and accurate time-dependent radiative transfer tools significantly limits lidar remote sensing capabilities. Analyzing lidar multiple scattering signals requires fast and accurate time-dependent radiative transfer computations. Currently, multiple scattering is done with Monte Carlo simulations. Monte Carlo simulations take minutes to hours and are too slow for interactive satellite data analysis processes and can only be used to help system / algorithm design and error assessment. We present an innovative physics approach to solve the time-dependent radiative transfer problem. The technique utilizes FPGA based reconfigurable computing hardware. The approach is as following, 1. Physics solution: Perform Laplace transform on the time and spatial dimensions and Fourier transform on the viewing azimuth dimension, and convert the radiative transfer differential equation solving into a fast matrix inversion problem. The majority of the radiative transfer computation goes to matrix inversion processes, FFT and inverse Laplace transforms. 2. Hardware solutions: Perform the well-defined matrix inversion, FFT and Laplace transforms on highly parallel, reconfigurable computing hardware. This physics-based computational tool leads to accurate quantitative analysis of space-based lidar signals and improves data quality of current lidar mission such as CALIPSO. This presentation will introduce the basic idea of this approach, preliminary results based on SRC's FPGA-based Mapstation, and how we may apply it to CALIPSO data analysis.

A Versatile Integrated Ambient Ionization Source Platform.

PubMed

Ai, Wanpeng; Nie, Honggang; Song, Shiyao; Liu, Xiaoyun; Bai, Yu; Liu, Huwei

2018-04-30

The pursuit of high-throughput sample analysis from complex matrix demands development of multiple ionization techniques with complementary specialties. A versatile integrated ambient ionization source (iAmIS) platform is proposed in this work, based on the idea of integrating multiple functions, enhancing the efficiency of current ionization techniques, extending the applications, and decreasing the cost of the instrument. The design of the iAmIS platform combines flowing atmospheric pressure afterglow (FAPA) source/direct analysis in real time (DART), dielectric barrier discharge ionization (DBDI)/low-temperature plasma (LTP), desorption electrospray ionization (DESI), and laser desorption (LD) technique. All individual and combined ionization modes can be easily attained by modulating parameters. In particular, the FAPA/DART&DESI mode can realize the detection of polar and nonpolar compounds at the same time with two different ionization mechanisms: proton transfer and charge transfer. The introduction of LD contributes to the mass spectrometry imaging and the surface-assisted laser desorption (SALDI) under ambient condition. Compared with other individual or multi-mode ion source, the iAmIS platform provides the flexibility of choosing different ionization modes, broadens the scope of the analyte detection, and facilitates the analysis of complex samples. Graphical abstract ᅟ.

A Versatile Integrated Ambient Ionization Source Platform

NASA Astrophysics Data System (ADS)

Ai, Wanpeng; Nie, Honggang; Song, Shiyao; Liu, Xiaoyun; Bai, Yu; Liu, Huwei

2018-04-01

The pursuit of high-throughput sample analysis from complex matrix demands development of multiple ionization techniques with complementary specialties. A versatile integrated ambient ionization source (iAmIS) platform is proposed in this work, based on the idea of integrating multiple functions, enhancing the efficiency of current ionization techniques, extending the applications, and decreasing the cost of the instrument. The design of the iAmIS platform combines flowing atmospheric pressure afterglow (FAPA) source/direct analysis in real time (DART), dielectric barrier discharge ionization (DBDI)/low-temperature plasma (LTP), desorption electrospray ionization (DESI), and laser desorption (LD) technique. All individual and combined ionization modes can be easily attained by modulating parameters. In particular, the FAPA/DART&DESI mode can realize the detection of polar and nonpolar compounds at the same time with two different ionization mechanisms: proton transfer and charge transfer. The introduction of LD contributes to the mass spectrometry imaging and the surface-assisted laser desorption (SALDI) under ambient condition. Compared with other individual or multi-mode ion source, the iAmIS platform provides the flexibility of choosing different ionization modes, broadens the scope of the analyte detection, and facilitates the analysis of complex samples. [Figure not available: see fulltext.

A spatial decision support system (SDSS) for sustainable tourism planning in Cameron Highlands, Malaysia

NASA Astrophysics Data System (ADS)

Aminu, M.; Matori, A. N.; Yusof, K. W.

2014-02-01

The study describes a methodological approach based on an integrated use of Geographic Information System (GIS) and Analytic Network Process (ANP) of Multi Criteria Evaluation (MCE) to determine nature conservation and tourism development priorities among the highland areas. A set of criteria and indicators were defined to evaluate the highlands biodiversity conservation and tourism development. Pair wise comparison technique was used in order to support solution of a decision problem by evaluating possible alternatives from different perspectives. After the weights have been derived from the pairwise comparison technique, the next step was to compute the unweighted supermatrix, weighted supermatrix and the limit matrix. The limit matrix was normalized to obtain the priorities and the results transferred into GIS environment. Elements evaluated and ranked were represented by criterion maps. Map layers reflecting the opinion of different experts involved were summed using the weighted overlay approach of GIS. Subsequently sustainable tourism development scenarios were generated. The generation of scenarios highlighted the critical issues of the decision problem because it allows one to gradually narrow down a problem.

Carbon based sample supports and matrices for laser desorption/ ionization mass spectrometry.

PubMed

Rainer, Matthias; Najam-ul-Haq, Muhammad; Huck, Christian W; Vallant, Rainer M; Heigl, Nico; Hahn, Hans; Bakry, Rania; Bonn, Günther K

2007-01-01

Laser desorption/ionization mass spectrometry (LDI-MS) is a widespread and powerful technique for mass analysis allowing the soft ionization of molecules such as peptides, proteins and carbohydrates. In many applications, an energy absorbing matrix has to be added to the analytes in order to protect them from being fragmented by direct laser beam. LDI-MS in conjunction with matrix is commonly referred as matrix-assisted LDI (MALDI). One of the striking disadvantages of this method is the desorption of matrix molecules, which causes interferences originating from matrix background ions in lower mass range (< 1000 Da). This has been led to the development of a variety of different carbon based LDI sample supports, which are capable of absorbing laser light and simultaneously transfering energy to the analytes for desorption. Furthermore carbon containing sample supports are used as carrier materials for the specific binding and preconcentration of molecules out of complex samples. Their subsequent analysis with MALDI mass spectrometry allows performing studies in metabolomics and proteomics. Finally a thin layer of carbon significantly improves sensitivity concerning detection limit. Analytes in low femtomole and attomole range can be detected in this regard. In the present article, these aspects are reviewed from patents where nano-based carbon materials are comprehensively utilized.

Centralized PI control for high dimensional multivariable systems based on equivalent transfer function.

PubMed

Luan, Xiaoli; Chen, Qiang; Liu, Fei

2014-09-01

This article presents a new scheme to design full matrix controller for high dimensional multivariable processes based on equivalent transfer function (ETF). Differing from existing ETF method, the proposed ETF is derived directly by exploiting the relationship between the equivalent closed-loop transfer function and the inverse of open-loop transfer function. Based on the obtained ETF, the full matrix controller is designed utilizing the existing PI tuning rules. The new proposed ETF model can more accurately represent the original processes. Furthermore, the full matrix centralized controller design method proposed in this paper is applicable to high dimensional multivariable systems with satisfactory performance. Comparison with other multivariable controllers shows that the designed ETF based controller is superior with respect to design-complexity and obtained performance. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Miniaturized LEDs for flat-panel displays

NASA Astrophysics Data System (ADS)

Radauscher, Erich J.; Meitl, Matthew; Prevatte, Carl; Bonafede, Salvatore; Rotzoll, Robert; Gomez, David; Moore, Tanya; Raymond, Brook; Cok, Ronald; Fecioru, Alin; Trindade, António Jose; Fisher, Brent; Goodwin, Scott; Hines, Paul; Melnik, George; Barnhill, Sam; Bower, Christopher A.

2017-02-01

Inorganic light emitting diodes (LEDs) serve as bright pixel-level emitters in displays, from indoor/outdoor video walls with pixel sizes ranging from one to thirty millimeters to micro displays with more than one thousand pixels per inch. Pixel sizes that fall between those ranges, roughly 50 to 500 microns, are some of the most commercially significant ones, including flat panel displays used in smart phones, tablets, and televisions. Flat panel displays that use inorganic LEDs as pixel level emitters (μILED displays) can offer levels of brightness, transparency, and functionality that are difficult to achieve with other flat panel technologies. Cost-effective production of μILED displays requires techniques for precisely arranging sparse arrays of extremely miniaturized devices on a panel substrate, such as transfer printing with an elastomer stamp. Here we present lab-scale demonstrations of transfer printed μILED displays and the processes used to make them. Demonstrations include passive matrix μILED displays that use conventional off-the shelf drive ASICs and active matrix μILED displays that use miniaturized pixel-level control circuits from CMOS wafers. We present a discussion of key considerations in the design and fabrication of highly miniaturized emitters for μILED displays.

Torsional vibration measurements on rotating shaft system using laser doppler vibrometer

NASA Astrophysics Data System (ADS)

Xiang, Ling; Yang, Shixi; Gan, Chunbiao

2012-11-01

In this work, a laser torsional vibrameter was used to measure the torsion vibration of a rotating shaft system under electrical network impact. Based on the principles of laser Doppler velocimetry, the laser torsional vibrometer (LTV) are non-contact measurement of torsional oscillation of rotating shafts, offering significant advantages over conventional techniques. Furthermore, a highly complex shafting system is analyzed by a modified Riccati torsional transfer matrix. The system is modeled as a chain consisting of an elastic spring with concentrated mass points, and the multi-segments lumped mass model is established for this shafting system. By the modified Riccati torsional transfer matrix method, an accumulated calculation is effectively eliminated to obtain the natural frequencies. The electrical network impacts can activize the torsional vibration of shaft system, and the activized torsion vibration frequencies contained the natural frequencies of shaft system. The torsional vibrations of the shaft system were measured under electrical network impacts in laser Doppler torsional vibrometer. By comparisons, the natural frequencies by measurement were consistent with the values by calculation. The results verify the instrument is robust, user friendly and can be calibrated in situ. The laser torsional vibrometer represents a significant step forward in rotating machinery diagnostics.

Generalization of the Mulliken-Hush treatment for the calculation of electron transfer matrix elements

NASA Astrophysics Data System (ADS)

Cave, Robert J.; Newton, Marshall D.

1996-01-01

A new method for the calculation of the electronic coupling matrix element for electron transfer processes is introduced and results for several systems are presented. The method can be applied to ground and excited state systems and can be used in cases where several states interact strongly. Within the set of states chosen it is a non-perturbative treatment, and can be implemented using quantities obtained solely in terms of the adiabatic states. Several applications based on quantum chemical calculations are briefly presented. Finally, since quantities for adiabatic states are the only input to the method, it can also be used with purely experimental data to estimate electron transfer matrix elements.

A simulated RTM process for fabricating polyimide (AMB-21) carbon fiber composites

NASA Technical Reports Server (NTRS)

Avva, V. Sarma; Sadler, Robert L.; Thomas, Shanon

1995-01-01

An experimental polyimide matrix, AMB-21 - supplied by NASA/LeRC, was especially formulated to be non-carcinogenic. It was also expected to be amenable to a Resin Transfer Molding Process (RTM). AMB-21 is a solid at room temperature and must be heated to a very high temperature to obtain a fluid state. However, even after heating it to a realistic high temperature, it was found to be too viscous for use in a RTM process. As a result, a promising approach was experimented leading to the introduction of the resin into a solvent solution in order to obtain a viscosity suitable for RTM. A mixture of methanol and tetrahydroferone was found to be a suitable solvent mixture. The matrix solution was introduced into carbon-fiber preform using two techniques: (1) injection of matrix into a Resin Transfer Mold after positioning the preform into the 'mold cavity', and (2) infiltration of matrix into the preform using the 'autoclave through-the-thickness transfer process'. After completing the resin transfer (infiltration) process, the 'filled' preform was heated to 300 F for one hour to reduce the solvent content. The temperature was then increased to 400 F under a vacuum to complete the solvent evaporation and to remove volatile products of the polyimide imidization. The impregnated preform was removed from the mold and press-cured at 200 psi and 600 FF for two hours. The resulting panel was found to be of reasonably good quality. This observation was based on the results obtained from short beam shear strength (700-8000 psi) tests and microscopic examination of the cross-section indicating a very low level of porosity. Further, the flash around the molded panels from the compression molding was free of porosity indicating the removal of volatiles, solvents, and other imidization products. Based on these studies, a new RTM mold containing a diaphragm capable of applying 200 psi at 600 F has been designed and constructed with the expectation that it will allow the incorporation of all of the above processing steps, including the consolidation with the preform in the mold cavity. Moreover, the new diaphragm design will enable to process larger preform panels. Processing studies with the diaphragm mold are being initiated.

Self-assembly of an electronically conductive network through microporous scaffolds.

PubMed

Sebastian, H Bri; Bryant, Steven L

2017-06-15

Electron transfer spanning significant distances through a microporous structure was established via the self-assembly of an electronically conductive iridium oxide nanowire matrix enveloping the pore walls. Microporous formations were simulated using two scaffold materials of varying physical and chemical properties; paraffin wax beads, and agar gel. Following infiltration into the micropores, iridium nanoparticles self-assembled at the pore wall/ethanol interface. Subsequently, cyclic voltammetry was employed to electrochemically crosslink the metal, erecting an interconnected, and electronically conductive metal oxide nanowire matrix. Electrochemical and spectral characterization techniques confirmed the formation of oxide nanowire matrices encompassing lengths of at least 1.6mm, 400× distances previously achieved using iridium nanoparticles. Nanowire matrices were engaged as biofuel cell anodes, where electrons were donated to the nanowires by a glucose oxidizing enzyme. Copyright © 2017 Elsevier Inc. All rights reserved.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Resonant tunneling in GaAs/Al xGa 1-xAs superlattices with aperiodic potential profiles

NASA Astrophysics Data System (ADS)

Djelti, R.; Aziz, Z.; Bentata, S.; Besbes, A.

2011-12-01

Using the exact Airy function formalism and the transfer-matrix technique, we have numerically investigated in this paper the effect of intentional correlations in spatial disorder on transmission properties of one-dimensional superlattices. Such systems consist of two different structures randomly distributed along the growth direction, with the additional constraint that barriers (wells) of one kind always appear in triply. It is shown that the intentional correlations in disorder and superlattices structural parameters are responsible to obtain resonant tunneling in aperiodic structure.

Numerical Modeling of Two-Terminal Quantum Well Devices

DTIC Science & Technology

1989-04-17

transfer matrix methods . This was implemented for a perfectly symmetric resonant tunneling structure such as the one shown in figure 3. This technique has...occur for mean well widths near 0.08v or 0.09v. This situation requires further analysis . The situation for the well width of 70A, yielded low Q...WSe.4W AA L1ot. OVefol striwe Tunmelen "ers (a) (b) Figure 1: Pseudomorphic InO. 5 3 Ga 0 .4 7 As/AlA3/ InAa resonant tunneling diodes proposed in

Quantum phase transitions in the S=(1)/(2) distorted diamond chain

NASA Astrophysics Data System (ADS)

Li, Yan-Chao; Li, Shu-Shen

2008-11-01

By means of the second derivative of the ground-state and first-excited energy, the quantum phase transitions (QPTs) for the distorted diamond chain (DDC) with ferromagnetic and antiferromagnetic frustrated interactions and the trimerized case are investigated, respectively. Our results show the plentiful quantum phases owing to the spin interaction competitions in the model. Meanwhile, by using the transfer-matrix renormalization-group technique, we study the two-site thermal entanglement of the DDC model in the thermodynamic limit for a further understanding of the QPTs.

Multi-spectrometer calibration transfer based on independent component analysis.

PubMed

Liu, Yan; Xu, Hao; Xia, Zhenzhen; Gong, Zhiyong

2018-02-26

Calibration transfer is indispensable for practical applications of near infrared (NIR) spectroscopy due to the need for precise and consistent measurements across different spectrometers. In this work, a method for multi-spectrometer calibration transfer is described based on independent component analysis (ICA). A spectral matrix is first obtained by aligning the spectra measured on different spectrometers. Then, by using independent component analysis, the aligned spectral matrix is decomposed into the mixing matrix and the independent components of different spectrometers. These differing measurements between spectrometers can then be standardized by correcting the coefficients within the independent components. Two NIR datasets of corn and edible oil samples measured with three and four spectrometers, respectively, were used to test the reliability of this method. The results of both datasets reveal that spectra measurements across different spectrometers can be transferred simultaneously and that the partial least squares (PLS) models built with the measurements on one spectrometer can predict that the spectra can be transferred correctly on another.

Sparse matrix-vector multiplication on network-on-chip

NASA Astrophysics Data System (ADS)

Sun, C.-C.; Götze, J.; Jheng, H.-Y.; Ruan, S.-J.

2010-12-01

In this paper, we present an idea for performing matrix-vector multiplication by using Network-on-Chip (NoC) architecture. In traditional IC design on-chip communications have been designed with dedicated point-to-point interconnections. Therefore, regular local data transfer is the major concept of many parallel implementations. However, when dealing with the parallel implementation of sparse matrix-vector multiplication (SMVM), which is the main step of all iterative algorithms for solving systems of linear equation, the required data transfers depend on the sparsity structure of the matrix and can be extremely irregular. Using the NoC architecture makes it possible to deal with arbitrary structure of the data transfers; i.e. with the irregular structure of the sparse matrices. So far, we have already implemented the proposed SMVM-NoC architecture with the size 4×4 and 5×5 in IEEE 754 single float point precision using FPGA.

An information hidden model holding cover distributions

NASA Astrophysics Data System (ADS)

Fu, Min; Cai, Chao; Dai, Zuxu

2018-03-01

The goal of steganography is to embed secret data into a cover so no one apart from the sender and intended recipients can find the secret data. Usually, the way the cover changing was decided by a hidden function. There were no existing model could be used to find an optimal function which can greatly reduce the distortion the cover suffered. This paper considers the cover carrying secret message as a random Markov chain, taking the advantages of a deterministic relation between initial distributions and transferring matrix of the Markov chain, and takes the transferring matrix as a constriction to decrease statistical distortion the cover suffered in the process of information hiding. Furthermore, a hidden function is designed and the transferring matrix is also presented to be a matrix from the original cover to the stego cover. Experiment results show that the new model preserves a consistent statistical characterizations of original and stego cover.

Optimization of a two-dimensional liquid chromatography-supercritical fluid chromatography-mass spectrometry (2D-LC-SFS-MS) system to assess "in-vivo" inter-conversion of chiral drug molecules.

PubMed

Goel, Meenakshi; Larson, Eli; Venkatramani, C J; Al-Sayah, Mohammad A

2018-05-01

Enantioselective analysis is an essential requirement during the pharmaceutical development of chiral drug molecules. In pre-clinical and clinical studies, the Food and Drug Administration (FDA) mandates the assessment of "in vivo" inter-conversion of chiral drugs to determine their physiological effects. In-vivo analysis of the active pharmaceutical ingredient (API) and its potential metabolites could be quite challenging due to their low abundance (ng/mL levels) and matrix interferences. Therefore, highly selective and sensitive analytical techniques are required to separate the API and its metabolites from the matrix components and one another. Additionally, for chiral APIs, further analytical separation is required to resolve the API and its potential metabolites from their corresponding enantiomers. In this work, we demonstrate the optimization of our previously designed two-dimensional liquid chromatography-supercritical fluid chromatography-mass spectrometry (2D-LC-SFC -MS) system to achieve 10 ng/mL detection limit [1]. The first LC dimension, used as a desalting step, could efficiently separate the API from its potential metabolites and matrix components. The API and its metabolites were then trapped/focused on small trapping columns and transferred onto the second SFC dimension for chiral separation. Detection can be achieved by ultra-violet (UV) or MS detection. Different system parameters such as column dimensions, transfer volumes, trapping column stationary phase, system tubing internal diameter (i.d.), and detection techniques, were optimized to enhance the sensitivity of the 2D-LC-SFC-MS system. The limit of detection was determined to be 10 ng/mL. An application is described where a mouse hepatocyte treated sample was analyzed using the optimized 2D-LC-SFC-MS system with successful assessment of the ratio of API to its metabolite (1D-LC), as well as the corresponding enantiomeric excess values (% e.e.) of each (2D-SFC). Copyright © 2018 Elsevier B.V. All rights reserved.

Electronic coupling matrix elements from charge constrained density functional theory calculations using a plane wave basis set

NASA Astrophysics Data System (ADS)

Oberhofer, Harald; Blumberger, Jochen

2010-12-01

We present a plane wave basis set implementation for the calculation of electronic coupling matrix elements of electron transfer reactions within the framework of constrained density functional theory (CDFT). Following the work of Wu and Van Voorhis [J. Chem. Phys. 125, 164105 (2006)], the diabatic wavefunctions are approximated by the Kohn-Sham determinants obtained from CDFT calculations, and the coupling matrix element calculated by an efficient integration scheme. Our results for intermolecular electron transfer in small systems agree very well with high-level ab initio calculations based on generalized Mulliken-Hush theory, and with previous local basis set CDFT calculations. The effect of thermal fluctuations on the coupling matrix element is demonstrated for intramolecular electron transfer in the tetrathiafulvalene-diquinone (Q-TTF-Q-) anion. Sampling the electronic coupling along density functional based molecular dynamics trajectories, we find that thermal fluctuations, in particular the slow bending motion of the molecule, can lead to changes in the instantaneous electron transfer rate by more than an order of magnitude. The thermal average, ( {< {| {H_ab } |^2 } > } )^{1/2} = 6.7 {mH}, is significantly higher than the value obtained for the minimum energy structure, | {H_ab } | = 3.8 {mH}. While CDFT in combination with generalized gradient approximation (GGA) functionals describes the intermolecular electron transfer in the studied systems well, exact exchange is required for Q-TTF-Q- in order to obtain coupling matrix elements in agreement with experiment (3.9 mH). The implementation presented opens up the possibility to compute electronic coupling matrix elements for extended systems where donor, acceptor, and the environment are treated at the quantum mechanical (QM) level.

Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

PubMed

Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

2010-01-01

This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed epidermis. This in vitro study has produced a robust protocol that is ready for clinical studies in the future.

Efficient computer algebra algorithms for polynomial matrices in control design

NASA Technical Reports Server (NTRS)

Baras, J. S.; Macenany, D. C.; Munach, R.

1989-01-01

The theory of polynomial matrices plays a key role in the design and analysis of multi-input multi-output control and communications systems using frequency domain methods. Examples include coprime factorizations of transfer functions, cannonical realizations from matrix fraction descriptions, and the transfer function design of feedback compensators. Typically, such problems abstract in a natural way to the need to solve systems of Diophantine equations or systems of linear equations over polynomials. These and other problems involving polynomial matrices can in turn be reduced to polynomial matrix triangularization procedures, a result which is not surprising given the importance of matrix triangularization techniques in numerical linear algebra. Matrices with entries from a field and Gaussian elimination play a fundamental role in understanding the triangularization process. In the case of polynomial matrices, matrices with entries from a ring for which Gaussian elimination is not defined and triangularization is accomplished by what is quite properly called Euclidean elimination. Unfortunately, the numerical stability and sensitivity issues which accompany floating point approaches to Euclidean elimination are not very well understood. New algorithms are presented which circumvent entirely such numerical issues through the use of exact, symbolic methods in computer algebra. The use of such error-free algorithms guarantees that the results are accurate to within the precision of the model data--the best that can be hoped for. Care must be taken in the design of such algorithms due to the phenomenon of intermediate expressions swell.

Parallel family trees for transfer matrices in the Potts model

NASA Astrophysics Data System (ADS)

Navarro, Cristobal A.; Canfora, Fabrizio; Hitschfeld, Nancy; Navarro, Gonzalo

2015-02-01

The computational cost of transfer matrix methods for the Potts model is related to the question in how many ways can two layers of a lattice be connected? Answering the question leads to the generation of a combinatorial set of lattice configurations. This set defines the configuration space of the problem, and the smaller it is, the faster the transfer matrix can be computed. The configuration space of generic (q , v) transfer matrix methods for strips is in the order of the Catalan numbers, which grows asymptotically as O(4m) where m is the width of the strip. Other transfer matrix methods with a smaller configuration space indeed exist but they make assumptions on the temperature, number of spin states, or restrict the structure of the lattice. In this paper we propose a parallel algorithm that uses a sub-Catalan configuration space of O(3m) to build the generic (q , v) transfer matrix in a compressed form. The improvement is achieved by grouping the original set of Catalan configurations into a forest of family trees, in such a way that the solution to the problem is now computed by solving the root node of each family. As a result, the algorithm becomes exponentially faster than the Catalan approach while still highly parallel. The resulting matrix is stored in a compressed form using O(3m ×4m) of space, making numerical evaluation and decompression to be faster than evaluating the matrix in its O(4m ×4m) uncompressed form. Experimental results for different sizes of strip lattices show that the parallel family trees (PFT) strategy indeed runs exponentially faster than the Catalan Parallel Method (CPM), especially when dealing with dense transfer matrices. In terms of parallel performance, we report strong-scaling speedups of up to 5.7 × when running on an 8-core shared memory machine and 28 × for a 32-core cluster. The best balance of speedup and efficiency for the multi-core machine was achieved when using p = 4 processors, while for the cluster scenario it was in the range p ∈ [ 8 , 10 ] . Because of the parallel capabilities of the algorithm, a large-scale execution of the parallel family trees strategy in a supercomputer could contribute to the study of wider strip lattices.

Solute Migration from the Aquifer Matrix into a Solution Conduit and the Reverse.

PubMed

Li, Guangquan; Field, Malcolm S

2016-09-01

A solution conduit has a permeable wall allowing for water exchange and solute transfer between the conduit and its surrounding aquifer matrix. In this paper, we use Laplace Transform to solve a one-dimensional equation constructed using the Euler approach to describe advective transport of solute in a conduit, a production-value problem. Both nonuniform cross-section of the conduit and nonuniform seepage at the conduit wall are considered in the solution. Physical analysis using the Lagrangian approach and a lumping method is performed to verify the solution. Two-way transfer between conduit water and matrix water is also investigated by using the solution for the production-value problem as a first-order approximation. The approximate solution agrees well with the exact solution if dimensionless travel time in the conduit is an order of magnitude smaller than unity. Our analytical solution is based on the assumption that the spatial and/or temporal heterogeneity in the wall solute flux is the dominant factor in the spreading of spring-breakthrough curves, and conduit dispersion is only a secondary mechanism. Such an approach can lead to the better understanding of water exchange and solute transfer between conduits and aquifer matrix. Euler and Lagrangian approaches are used to solve transport in conduit. Two-way transfer between conduit and matrix is investigated. The solution is applicable to transport in conduit of persisting solute from matrix. © 2016, National Ground Water Association.

Comparative study between the results of effective index based matrix method and characterization of fabricated SU-8 waveguide

NASA Astrophysics Data System (ADS)

Samanta, Swagata; Dey, Pradip Kumar; Banerji, Pallab; Ganguly, Pranabendu

2017-01-01

A study regarding the validity of effective-index based matrix method (EIMM) for the fabricated SU-8 channel waveguides is reported. The design method is extremely fast compared to other existing numerical techniques, such as, BPM and FDTD. In EIMM, the effective index method was applied in depth direction of the waveguide and the resulted lateral index profile was analyzed by a transfer matrix method. By EIMM one can compute the guided mode propagation constants and mode profiles for each mode for any dimensions of the waveguides. The technique may also be used to design single mode waveguide. SU-8 waveguide fabrication was carried out by continuous-wave direct laser writing process at 375 nm wavelength. The measured propagation losses of these wire waveguides having air and PDMS as superstrates were 0.51 dB/mm and 0.3 dB/mm respectively. The number of guided modes, obtained theoretically as well as experimentally, for air-cladded waveguide was much more than that of PDMS-cladded waveguide. We were able to excite the isolated fundamental mode for the later by precise fiber positioning, and mode image was recorded. The mode profiles, mode indices, and refractive index profiles were extracted from this mode image of the fundamental mode which matched remarkably well with the theoretical predictions.

Heat Transfer Characteristics of Regenerator Matrix (Case of Packed Wire Gauzes)

NASA Technical Reports Server (NTRS)

Hamaguchi, K.; Takahashi, S.; Miyabe, H.

1984-01-01

The average heat transfer coefficient in the matrix of laminated wire screens (10 to 250 mesh) for a Stirling engine heat exchanger was studied experimentally. The data are correlated by N sub ud = 0.42 R sub ed 0.56 (3 or = R sub ed or = 400), and R sub ed are the Nusselt and Reynolds nubmers based on the wire diameter. The pressure drop decreased and the heat transfer increased as the wire diameter was decreased.

A Transfer Learning Approach for Applying Matrix Factorization to Small ITS Datasets

ERIC Educational Resources Information Center

Voß, Lydia; Schatten, Carlotta; Mazziotti, Claudia; Schmidt-Thieme, Lars

2015-01-01

Machine Learning methods for Performance Prediction in Intelligent Tutoring Systems (ITS) have proven their efficacy; specific methods, e.g. Matrix Factorization (MF), however suffer from the lack of available information about new tasks or new students. In this paper we show how this problem could be solved by applying Transfer Learning (TL),…

Toda theories as contractions of affine Toda theories

NASA Astrophysics Data System (ADS)

Aghamohammadi, A.; Khorrami, M.; Shariati, A.

1996-02-01

Using a contraction procedure, we obtain Toda theories and their structures, from affine Toda theories and their corresponding structures. By structures, we mean the equation of motion, the classical Lax pair, the boundary term for half line theories, and the quantum transfer matrix. The Lax pair and the transfer matrix so obtained, depend nontrivially on the spectral parameter.

A Synthetic Approach to the Transfer Matrix Method in Classical and Quantum Physics

ERIC Educational Resources Information Center

Pujol, O.; Perez, J. P.

2007-01-01

The aim of this paper is to propose a synthetic approach to the transfer matrix method in classical and quantum physics. This method is an efficient tool to deal with complicated physical systems of practical importance in geometrical light or charged particle optics, classical electronics, mechanics, electromagnetics and quantum physics. Teaching…

Room temperature enhanced red emission from novel Eu(3+) doped ZnO nanocrystals uniformly dispersed in nanofibers.

PubMed

Zhang, Yongzhe; Liu, Yanxia; Li, Xiaodong; Wang, Qi Jie; Xie, Erqing

2011-10-14

Achieving red emission from ZnO-based materials has long been a goal for researchers in order to realize, for instance, full-color display panels and solid-state light-emitting devices. However, the current technique using Eu(3+) doped ZnO for red emission generation has a significant drawback in that the energy transfer from ZnO to Eu(3+) is inefficient, resulting in a low intensity red emission. In this paper, we report an efficient energy transfer scheme for enhanced red emission from Eu(3+) doped ZnO nanocrystals by fabricating polymer nanofibers embedded with Eu(3+) doped ZnO nanocrystals to facilitate the energy transfer. In the fabrication, ZnO nanocrystals are uniformly dispersed in polymer nanofibers prepared by the high electrical field electrospinning technique. Enhanced red emission without defect radiation from the ZnO matrix is observed. Three physical mechanisms for this observation are provided and explained, namely a small ZnO crystal size, uniformity distribution of ZnO nanocrystals in polymers (PVA in this case), and strong bonding between ZnO and polymer through the -OH group bonding. These explanations are supported by high resolution transmission emission microscopy measurements, resonant Raman scattering characterizations, photoluminescence spectra and photoluminescence excitation spectra measurements. In addition, two models exploring the 'accumulation layer' and 'depletion layer' are developed to explain the reasons for the more efficient energy transfer in our ZnO nanocrystal system compared to that in the previous reports. This study provides an important approach to achieve enhanced energy transfer from nanocrystals to ions which could be widely adopted in rare earth ion doped materials. These discoveries also provide more insights into other energy transfer problems in, for example, dye-sensitized solar cells and quantum dot solar cells.

Ferrocene pixels by laser-induced forward transfer: towards flexible microelectrode printing

NASA Astrophysics Data System (ADS)

Mitu, B.; Matei, A.; Filipescu, M.; Palla Papavlu, A.; Bercea, A.; Lippert, T.; Dinescu, M.

2017-03-01

The aim of this work is to demonstrate the potential of laser-induced forward transfer (LIFT) as a printing technology, alternative to standard microfabrication techniques, in the area of flexible micro-electrode fabrication. First, ferrocene thin films are deposited onto fused silica and fused silica substrates previously coated with a photodegradable polymer film (triazene polymer) by matrix assisted pulsed laser evaporation (MAPLE). The morphology and chemical structure of the ferrocene thin films deposited by MAPLE has been investigated by atomic force microscopy and Fourier transformed infrared spectroscopy, and no structural damage occurs as a result of the laser deposition. Second, LIFT is applied to print for the first time ferrocene pixels and lines onto flexible polydimethylsiloxane (PDMS) substrates. The ferrocene pixels and lines are flawlessly transferred onto the PDMS substrates in air at room temperature, without the need of additional conventional photolithography processes. We believe that these results are very promising for a variety of applications ranging from flexible electronics to lab-on-a-chip devices, MEMS, and medical implants.

Analysis of simplified heat transfer models for thermal property determination of nano-film by TDTR method

NASA Astrophysics Data System (ADS)

Wang, Xinwei; Chen, Zhe; Sun, Fangyuan; Zhang, Hang; Jiang, Yuyan; Tang, Dawei

2018-03-01

Heat transfer in nanostructures is of critical importance for a wide range of applications such as functional materials and thermal management of electronics. Time-domain thermoreflectance (TDTR) has been proved to be a reliable measurement technique for the thermal property determinations of nanoscale structures. However, it is difficult to determine more than three thermal properties at the same time. Heat transfer model simplifications can reduce the fitting variables and provide an alternative way for thermal property determination. In this paper, two simplified models are investigated and analyzed by the transform matrix method and simulations. TDTR measurements are performed on Al-SiO2-Si samples with different SiO2 thickness. Both theoretical and experimental results show that the simplified tri-layer model (STM) is reliable and suitable for thin film samples with a wide range of thickness. Furthermore, the STM can also extract the intrinsic thermal conductivity and interfacial thermal resistance from serial samples with different thickness.

A study of pilot modeling in multi-controller tasks

NASA Technical Reports Server (NTRS)

Whitbeck, R. F.; Knight, J. R.

1972-01-01

A modeling approach, which utilizes a matrix of transfer functions to describe the human pilot in multiple input, multiple output control situations, is studied. The approach used was to extend a well established scalar Wiener-Hopf minimization technique to the matrix case and then study, via a series of experiments, the data requirements when only finite record lengths are available. One of these experiments was a two-controller roll tracking experiment designed to force the pilot to use rudder in order to coordinate and reduce the effects of aileron yaw. One model was computed for the case where the signals used to generate the spectral matrix are error and bank angle while another model was computed for the case where error and yaw angle are the inputs. Several anomalies were observed to be present in the experimental data. These are defined by the descriptive terms roll up, break up, and roll down. Due to these algorithm induced anomalies, the frequency band over which reliable estimates of power spectra can be achieved is considerably less than predicted by the sampling theorem.

High performance organic distributed Bragg reflector lasers fabricated by dot matrix holography.

PubMed

Wan, Wenqiang; Huang, Wenbin; Pu, Donglin; Qiao, Wen; Ye, Yan; Wei, Guojun; Fang, Zongbao; Zhou, Xiaohong; Chen, Linsen

2015-12-14

We report distributed Bragg reflector (DBR) polymer lasers fabricated using dot matrix holography. Pairs of distributed Bragg reflector mirrors with variable mirror separations are fabricated and a novel energy transfer blend consisting of a blue-emitting conjugated polymer and a red-emitting one is spin-coated onto the patterned substrate to complete the device. Under optical pumping, the device emits sing-mode lasing around 622 nm with a bandwidth of 0.41 nm. The working threshold is as low as 13.5 μJ/cm² (~1.68 kW/cm²) and the measured slope efficiency reaches 5.2%. The distributed feedback (DFB) cavity and the DBR cavity resonate at the same lasing wavelength while the DFB laser shows a much higher threshold. We further show that flexible DBR lasers can be conveniently fabricated through the UV-imprinting technique by using the patterned silica substrate as the mold. Dot matrix holography represents a versatile approach to control the number, the size, the location and the orientation of DBR mirrors, thus providing great flexibility in designing DBR lasers.

Covalent Label Transfer between Peroxisomal Importomer Components Reveals Export-driven Import Interactions.

PubMed

Bhogal, Moninder S; Lanyon-Hogg, Thomas; Johnston, Katherine A; Warriner, Stuart L; Baker, Alison

2016-01-29

Peroxisomes are vital metabolic organelles found in almost all eukaryotic organisms, and they rely exclusively on import of their matrix protein content from the cytosol. In vitro import of proteins into isolated peroxisomal fractions has provided a wealth of knowledge on the import process. However, the common method of protease protection garnered no information on the import of an N-terminally truncated PEX5 (PEX5C) receptor construct or peroxisomal malate dehydrogenase 1 (pMDH1) cargo protein into sunflower peroxisomes because of high degrees of protease susceptibility or resistance, respectively. Here we present a means for analysis of in vitro import through a covalent biotin label transfer and employ this method to the import of PEX5C. Label transfer demonstrates that the PEX5C construct is monomeric under the conditions of the import assay. This technique was capable of identifying the PEX5-PEX14 interaction as the first interaction of the import process through competition experiments. Labeling of the peroxisomal protein import machinery by PEX5C demonstrated that this interaction was independent of added cargo protein, and, strikingly, the interaction between PEX5C and the import machinery was shown to be ATP-dependent. These important mechanistic insights highlight the power of label transfer in studying interactions, rather than proteins, of interest and demonstrate that this technique should be applied to future studies of peroxisomal in vitro import. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Beam-tracing model for predicting sound fields in rooms with multilayer bounding surfaces

NASA Astrophysics Data System (ADS)

Wareing, Andrew; Hodgson, Murray

2005-10-01

This paper presents the development of a wave-based room-prediction model for predicting steady-state sound fields in empty rooms with specularly reflecting, multilayer surfaces. A triangular beam-tracing model with phase, and a transfer-matrix approach to model the surfaces, were involved. Room surfaces were modeled as multilayers of fluid, solid, or porous materials. Biot theory was used in the transfer-matrix formulation of the porous layer. The new model consisted of the transfer-matrix model integrated into the beam-tracing algorithm. The transfer-matrix model was validated by comparing predictions with those by theory, and with experiment. The test surfaces were a glass plate, double drywall panels, double steel panels, a carpeted floor, and a suspended-acoustical ceiling. The beam-tracing model was validated in the cases of three idealized room configurations-a small office, a corridor, and a small industrial workroom-with simple boundary conditions. The number of beams, the reflection order, and the frequency resolution required to obtain accurate results were investigated. Beam-tracing predictions were compared with those by a method-of-images model with phase. The model will be used to study sound fields in rooms with local- or extended-reaction multilayer surfaces.

Fast mean and variance computation of the diffuse sound transmission through finite-sized thick and layered wall and floor systems

NASA Astrophysics Data System (ADS)

Decraene, Carolina; Dijckmans, Arne; Reynders, Edwin P. B.

2018-05-01

A method is developed for computing the mean and variance of the diffuse field sound transmission loss of finite-sized layered wall and floor systems that consist of solid, fluid and/or poroelastic layers. This is achieved by coupling a transfer matrix model of the wall or floor to statistical energy analysis subsystem models of the adjacent room volumes. The modal behavior of the wall is approximately accounted for by projecting the wall displacement onto a set of sinusoidal lateral basis functions. This hybrid modal transfer matrix-statistical energy analysis method is validated on multiple wall systems: a thin steel plate, a polymethyl methacrylate panel, a thick brick wall, a sandwich panel, a double-leaf wall with poro-elastic material in the cavity, and a double glazing. The predictions are compared with experimental data and with results obtained using alternative prediction methods such as the transfer matrix method with spatial windowing, the hybrid wave based-transfer matrix method, and the hybrid finite element-statistical energy analysis method. These comparisons confirm the prediction accuracy of the proposed method and the computational efficiency against the conventional hybrid finite element-statistical energy analysis method.

Application of unsteady flow rate evaluations to identify the dynamic transfer function of a cavitatingVenturi

NASA Astrophysics Data System (ADS)

Marie-Magdeleine, A.; Fortes-Patella, R.; Lemoine, N.; Marchand, N.

2012-11-01

This study concerns the simulation of the implementation of the Kinetic Differential Pressure (KDP) method used for the unsteady mass flow rate evaluation in order to identify the dynamic transfer matrix of a cavitatingVenturi. Firstly, the equations of the IZ code used for this simulation are introduced. Next, the methodology for evaluating unsteady pressures and mass flow rates at the inlet and the outlet of the cavitatingVenturi and for identifying the dynamic transfer matrix is presented. Later, the robustness of the method towards measurement uncertainties implemented as a Gaussian white noise is studied. The results of the numerical simulations let us estimate the system linearity domain and to perform the Empirical Transfer Function Evaluation on the inlet frequency per frequency signal and on the chirp signal tests. Then the pressure data obtained with the KDP method is taken and the identification procedure by ETFE and by the user-made Auto-Recursive Moving-Average eXogenous algorithms is performed and the obtained transfer matrix coefficients are compared with those obtained from the simulated input and output data.

Dispersion relations of elastic waves in one-dimensional piezoelectric/piezomagnetic phononic crystal with functionally graded interlayers.

PubMed

Guo, Xiao; Wei, Peijun; Lan, Man; Li, Li

2016-08-01

The effects of functionally graded interlayers on dispersion relations of elastic waves in a one-dimensional piezoelectric/piezomagnetic phononic crystal are studied in this paper. First, the state transfer equation of the functionally graded interlayer is derived from the motion equation by the reduction of order (from second order to first order). The transfer matrix of the functionally graded interlayer is obtained by solving the state transfer equation with the spatial-varying coefficient. Based on the transfer matrixes of the piezoelectric slab, the piezomagnetic slab and the functionally graded interlayers, the total transfer matrix of a single cell is obtained. Further, the Bloch theorem is used to obtain the resultant dispersion equations of in-plane and anti-plane Bloch waves. The dispersion equations are solved numerically and the numerical results are shown graphically. Five kinds of profiles of functionally graded interlayers between a piezoelectric slab and a piezomagnetic slab are considered. It is shown that the functionally graded interlayers have evident influences on the dispersion curves and the band gaps. Copyright © 2016 Elsevier B.V. All rights reserved.

Topology-driven phase transitions in the classical monomer-dimer-loop model.

PubMed

Li, Sazi; Li, Wei; Chen, Ziyu

2015-06-01

In this work, we investigate the classical loop models doped with monomers and dimers on a square lattice, whose partition function can be expressed as a tensor network (TN). In the thermodynamic limit, we use the boundary matrix product state technique to contract the partition function TN, and determine the thermodynamic properties with high accuracy. In this monomer-dimer-loop model, we find a second-order phase transition between a trivial monomer-condensation and a loop-condensation (LC) phase, which cannot be distinguished by any local order parameter, while nevertheless the two phases have distinct topological properties. In the LC phase, we find two degenerate dominating eigenvalues in the transfer-matrix spectrum, as well as a nonvanishing (nonlocal) string order parameter, both of which identify the topological ergodicity breaking in the LC phase and can serve as the order parameter for detecting the phase transitions.

Finite-temperature dynamic structure factor of the spin-1 XXZ chain with single-ion anisotropy

NASA Astrophysics Data System (ADS)

Lange, Florian; Ejima, Satoshi; Fehske, Holger

2018-02-01

Improving matrix-product state techniques based on the purification of the density matrix, we are able to accurately calculate the finite-temperature dynamic response of the infinite spin-1 XXZ chain with single-ion anisotropy in the Haldane, large-D , and antiferromagnetic phases. Distinct thermally activated scattering processes make a significant contribution to the spectral weight in all cases. In the Haldane phase, intraband magnon scattering is prominent, and the on-site anisotropy causes the magnon to split into singlet and doublet branches. In the large-D phase response, the intraband signal is separated from an exciton-antiexciton continuum. In the antiferromagnetic phase, holons are the lowest-lying excitations, with a gap that closes at the transition to the Haldane state. At finite temperatures, scattering between domain-wall excitations becomes especially important and strongly enhances the spectral weight for momentum transfer π .

Casting of weldable graphite/magnesium metal matrix composites with built-in metallic inserts

NASA Technical Reports Server (NTRS)

Lee, Jonathan A.; Kashalikar, Uday; Majkowski, Patricia

1994-01-01

Technology innovations directed at the advanced development of a potentially low cost and weldable graphite/magnesium metal matrix composites (MMC) through near net shape pressure casting are described. These MMC components uniquely have built-in metallic inserts to provide an innovative approach for joining or connecting other MMC components through conventional joining techniques such as welding, brazing, mechanical fasteners, etc. Moreover, the metallic inserts trapped within the MMC components can be made to transfer the imposed load efficiently to the continuous graphite fiber reinforcement thus producing stronger, stiffer, and more reliable MMC components. The use of low pressure near net shape casting is economical compared to other MMC fabrication processes. These castable and potentially weldable MMC components can provide great payoffs in terms of high strength, high stiffness, low thermal expansion, lightweight, and easily joinable MMC components for several future NASA space structural, industrial, and commercial applications.

The vector radiative transfer numerical model of coupled ocean-atmosphere system using the matrix-operator method

NASA Astrophysics Data System (ADS)

Xianqiang, He; Delu, Pan; Yan, Bai; Qiankun, Zhu

2005-10-01

The numerical model of the vector radiative transfer of the coupled ocean-atmosphere system is developed based on the matrix-operator method, which is named PCOART. In PCOART, using the Fourier analysis, the vector radiative transfer equation (VRTE) splits up into a set of independent equations with zenith angle as only angular coordinate. Using the Gaussian-Quadrature method, VRTE is finally transferred into the matrix equation, which is calculated by using the adding-doubling method. According to the reflective and refractive properties of the ocean-atmosphere interface, the vector radiative transfer numerical model of ocean and atmosphere is coupled in PCOART. By comparing with the exact Rayleigh scattering look-up-table of MODIS(Moderate-resolution Imaging Spectroradiometer), it is shown that PCOART is an exact numerical calculation model, and the processing methods of the multi-scattering and polarization are correct in PCOART. Also, by validating with the standard problems of the radiative transfer in water, it is shown that PCOART could be used to calculate the underwater radiative transfer problems. Therefore, PCOART is a useful tool to exactly calculate the vector radiative transfer of the coupled ocean-atmosphere system, which can be used to study the polarization properties of the radiance in the whole ocean-atmosphere system and the remote sensing of the atmosphere and ocean.

Superconducting coil and method of stress management in a superconducting coil

DOEpatents

McIntyre, Peter M.; Shen, Weijun; Diaczenko, Nick; Gross, Dan A.

1999-01-01

A superconducting coil (12) having a plurality of superconducting layers (18) is provided. Each superconducting layer (18) may have at least one superconducting element (20) which produces an operational load. An outer support structure (24) may be disposed outwardly from the plurality of layers (18). A load transfer system (22) may be coupled between at least one of the superconducting elements (20) and the outer support structure (24). The load transfer system (22) may include a support matrix structure (30) operable to transfer the operational load from the superconducting element (20) directly to the outer support structure (24). A shear release layer (40) may be disposed, in part, between the superconducting element (20) and the support matrix structure (30) for relieving a shear stress between the superconducting element (20) and the support matrix structure (30). A compliant layer (42) may also be disposed, in part, between the superconducting element (20) and the support matrix structure (30) for relieving a compressive stress on the superconducting element (20).

Experimental Waterflow Determination of the Dynamic Hydraulic Transfer Function for the J-2X Oxidizer Turbopump. Part Two; Results and Interpretation

NASA Technical Reports Server (NTRS)

Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave

2011-01-01

Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

Study of Anti-Vortex Baffle Effect in Suppressing Swirling Flow in LOX Tank

NASA Technical Reports Server (NTRS)

Yang, H. Q.; Peugeot, John

2011-01-01

Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

Electrodialytic matrix isolation for metal cations.

PubMed

Ohira, Shin-Ichi; Hiroyama, Yuri; Nakamura, Koretaka; Koda, Takumi; Dasgupta, Purnendu K; Toda, Kei

2015-01-01

Electrodialytic ion transfer was studied as a matrix isolation tool for heavy metal determinations. An ion transfer device (ITD) was used for the transfer of heavy metal cations. Under optimized flow rates applied voltage and receptor composition, heavy metal ions were quantitatively transferred at concentrations spanning µg L(-1) to mg L(-1). As long as the sample pH was acidic, there was no significant sample pH effect on the transfer efficiencies. Significant salt concentrations (>1 mM NaCl), however, decreased the transfer efficiency. This could be ameliorated (up to 5 mM NaCl) by transient instead of continuous sample introduction. The device was applied to the determination of Fe, Cu and Zn in equine and bovine serum; the reproducibility was better than conventional digestion method. Copyright © 2014 Elsevier B.V. All rights reserved.

A scattering model for defoliated vegetation

NASA Technical Reports Server (NTRS)

Karam, M. A.; Fung, A. K.

1986-01-01

A scattering model for defoliated vegetation is conceived as a layer of dielectric, finite-length cylinders with specified size and orientation distributions above an irregular ground surface. The scattering phase matrix of a single cylinder is computed, then the radiative transfer technique is applied to link volume scattering from vegetation to surface scattering from the soil surface. Polarized and depolarized scattering are computed and the effects of the cylinder size and orientation distributions are illustrated. It is found that size and orientation distributions have significant effects on the backscattered signal. The model is compared with scattering from defoliated trees and agricultural crops.

Exciton-polariton dynamics in a GaAs bulk microcavity

NASA Astrophysics Data System (ADS)

Ceccherini, S.; Gurioli, M.; Bogani, F.; Colocci, M.; Tredicucci, A.; Bassani, F.; Beltram, F.; Sorba, L.

1998-01-01

We present a full analysis of exciton dynamics in a GaAs λ/2 bulk microcavity following excitation by ultrafast laser pulses. Coherent dynamics was probed by means of an interferometric technique; beating and dephasing times were studied for various excitation intensities. At high incident power, population effects begin to show up reducing exciton oscillator strength and suppressing Rabi splitting. This feature produces marked non-linearities in the input-output characteristic of the optical functions, which were studied in view of reaching bistable operation. Theoretical calculations performed within the transfer-matrix framework show good agreement with experimental results.

Flexible aircraft dynamic modeling for dynamic analysis and control synthesis

NASA Technical Reports Server (NTRS)

Schmidt, David K.

1989-01-01

The linearization and simplification of a nonlinear, literal model for flexible aircraft is highlighted. Areas of model fidelity that are critical if the model is to be used for control system synthesis are developed and several simplification techniques that can deliver the necessary model fidelity are discussed. These techniques include both numerical and analytical approaches. An analytical approach, based on first-order sensitivity theory is shown to lead not only to excellent numerical results, but also to closed-form analytical expressions for key system dynamic properties such as the pole/zero factors of the vehicle transfer-function matrix. The analytical results are expressed in terms of vehicle mass properties, vibrational characteristics, and rigid-body and aeroelastic stability derivatives, thus leading to the underlying causes for critical dynamic characteristics.

Prototype of an Interface for Hyphenating Distillation with Gas Chromatography and Mass Spectrometry

PubMed Central

Tang, Ya-Ru; Yang, Hui-Hsien; Urban, Pawel L.

2017-01-01

Chemical analysis of complex matrices—containing hundreds of compounds—is challenging. Two-dimensional separation techniques provide an efficient way to reduce complexity of mixtures analyzed by mass spectrometry (MS). For example, gasoline is a mixture of numerous compounds, which can be fractionated by distillation techniques. However, coupling conventional distillation with other separations as well as MS is not straightforward. We have established an automatic system for online coupling of simple microscale distillation with gas chromatography (GC) and electron ionization MS. The developed system incorporates an interface between the distillation condenser and the injector of a fused silica capillary GC column. Development of this multidimensional separation (distillation-GC-MS) was preceded by a series of preliminary off-line experiments. In the developed technique, the components with different boiling points are fractionated and instantly analyzed by GC-MS. The obtained data sets illustrate dynamics of the distillation process. An important advantage of the distillation-GC-MS technique is that raw samples can directly be analyzed without removal of the non-volatile matrix residues that could contaminate the GC injection port and the column. Distilling the samples immediately before the injection to the GC column may reduce possible matrix effects—especially in the early phase of separation, when molecules with different volatilities co-migrate. It can also reduce losses of highly volatile components (during fraction collection and transfer). The two separation steps are partly orthogonal, what can slightly increase selectivity of the entire analysis. PMID:28337400

The analytical transfer matrix method for PT-symmetric complex potential

NASA Astrophysics Data System (ADS)

Naceri, Leila; Hammou, Amine B.

2017-07-01

We have extended the analytical transfer matrix (ATM) method to solve quantum mechanical bound state problems with complex PT-symmetric potentials. Our work focuses on a class of models studied by Bender and Jones, we calculate the energy eigenvalues, discuss the critical values of g and compare the results with those obtained from other methods such as exact numerical computation and WKB approximation method.

Complete spatiotemporal characterization and optical transfer matrix inversion of a 420 mode fiber.

PubMed

Carpenter, Joel; Eggleton, Benjamin J; Schröder, Jochen

2016-12-01

The ability to measure a scattering medium's optical transfer matrix, the mapping between any spatial input and output, has enabled applications such as imaging to be performed through media which would otherwise be opaque due to scattering. However, the scattering of light occurs not just in space, but also in time. We complete the characterization of scatter by extending optical transfer matrix methods into the time domain, allowing any spatiotemporal input state at one end to be mapped directly to its corresponding spatiotemporal output state. We have measured the optical transfer function of a multimode fiber in its entirety; it consists of 420 modes in/out at 32768 wavelengths, the most detailed complete characterization of multimode waveguide light propagation to date, to the best of our knowledge. We then demonstrate the ability to generate any spatial/polarization state at the output of the fiber at any wavelength, as well as predict the temporal response of any spatial/polarization input state.

A novel thermal management system for improving discharge/charge performance of Li-ion battery packs under abuse

NASA Astrophysics Data System (ADS)

Arora, Shashank; Kapoor, Ajay; Shen, Weixiang

2018-02-01

Parasitic load, which describes electrical energy consumed by battery thermal management system (TMS), is an important design criterion for battery packs. Passive TMSs using phase change materials (PCMs) are thus generating much interest. However, PCMs suffer from low thermal conductivities. Most current thermal conductivity enhancement techniques involve addition of foreign particles to PCMs. Adding foreign particles increases effective thermal conductivity of PCM-systems but at expense of their latent heat capacity. This paper presents an alternate approach for improving thermal performance of PCM-based TMSs. The introduced technique involves placing battery cells in a vertically inverted position within the battery-pack. It is demonstrated through experiments that inverted cell-layout facilitates build-up of convection current in the pack, which in turn minimises thermal variations within the PCM matrix by enabling PCM mass transfer between the top and the bottom regions of the battery pack. The proposed system is found capable of maintaining tight control over battery cell temperature even during abusive usage, defined as high-rate repetitive cycling with minimal rest periods. In addition, this novel TMS can recover waste heat from PCM-matrix through thermoelectric devices, thereby resulting in a negative parasitic load for TMS.

Stress transfer during different deformation stages in a nano-precipitate-strenthened Ni-Ti shape memory alloy

DOE PAGES

Dong, Y. H.; Cong, D. Y.; Nie, Z. H.; ...

2015-11-16

Understanding the role of fine coherent precipitates in the micromechanical behavior of precipitate-strengthened shape memory alloys (SMAs), which still remains a mystery heretofore, is of crucial importance to the design of advanced SMAs with optimal functional and mechanical properties. Here, we investigate the lattice strain evolution of, and the stress partition between the nanoscale Ni 4Ti 3 precipitates and the matrix in a precipitate-strengthened Ni-Ti SMA during different deformation stages by in-situ synchrotron high-energy X-ray diffraction technique. We found that, during R-phase reorientation and stress-induced martensitic transformation, which both involve the shear deformation process, the lattice strain of the nanoscalemore » precipitates drastically increases by a magnitude of 0.5%, which corresponds to an abrupt increase of ~520 MPa in internal stress. This indicates that stress repartition occurs and most of the stress is transferred to the precipitates during the shear deformation of the matrix. Lastly, it is further revealed that the nanoscale precipitates which only have a low volume fraction bear a considerable amount of applied stress during all deformation stages investigated, implying that the nanoscale precipitates play an important role in the deformation behavior of the precipitate-strengthened Ni-Ti SMAs.« less

Stress transfer during different deformation stages in a nano-precipitate-strengthened Ni-Ti shape memory alloy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Y. H.; Cong, D. Y., E-mail: dycong@ustb.edu.cn; He, Z. B.

2015-11-16

Understanding the role of fine coherent precipitates in the micromechanical behavior of precipitate-strengthened shape memory alloys (SMAs), which still remains a mystery heretofore, is of crucial importance to the design of advanced SMAs with optimal functional and mechanical properties. Here, we investigate the lattice strain evolution of, and the stress partition between the nanoscale Ni{sub 4}Ti{sub 3} precipitates and the matrix in a precipitate-strengthened Ni-Ti SMA during different deformation stages by in-situ synchrotron high-energy X-ray diffraction technique. We found that, during R-phase reorientation and stress-induced martensitic transformation, which both involve the shear deformation process, the lattice strain of the nanoscalemore » precipitates drastically increases by a magnitude of 0.5%, which corresponds to an abrupt increase of ∼520 MPa in internal stress. This indicates that stress repartition occurs and most of the stress is transferred to the precipitates during the shear deformation of the matrix. It is further revealed that the nanoscale precipitates which only have a low volume fraction bear a considerable amount of applied stress during all deformation stages investigated, implying that the nanoscale precipitates play an important role in the deformation behavior of the precipitate-strengthened Ni-Ti SMAs.« less

Hypergraph partitioning implementation for parallelizing matrix-vector multiplication using CUDA GPU-based parallel computing

NASA Astrophysics Data System (ADS)

Murni, Bustamam, A.; Ernastuti, Handhika, T.; Kerami, D.

2017-07-01

Calculation of the matrix-vector multiplication in the real-world problems often involves large matrix with arbitrary size. Therefore, parallelization is needed to speed up the calculation process that usually takes a long time. Graph partitioning techniques that have been discussed in the previous studies cannot be used to complete the parallelized calculation of matrix-vector multiplication with arbitrary size. This is due to the assumption of graph partitioning techniques that can only solve the square and symmetric matrix. Hypergraph partitioning techniques will overcome the shortcomings of the graph partitioning technique. This paper addresses the efficient parallelization of matrix-vector multiplication through hypergraph partitioning techniques using CUDA GPU-based parallel computing. CUDA (compute unified device architecture) is a parallel computing platform and programming model that was created by NVIDIA and implemented by the GPU (graphics processing unit).

Macro- to microscale strain transfer in fibrous tissues is heterogeneous and tissue-specific.

PubMed

Han, Woojin M; Heo, Su-Jin; Driscoll, Tristan P; Smith, Lachlan J; Mauck, Robert L; Elliott, Dawn M

2013-08-06

Mechanical deformation applied at the joint or tissue level is transmitted through the macroscale extracellular matrix to the microscale local matrix, where it is transduced to cells within these tissues and modulates tissue growth, maintenance, and repair. The objective of this study was to investigate how applied tissue strain is transferred through the local matrix to the cell and nucleus in meniscus, tendon, and the annulus fibrosus, as well as in stem cell-seeded scaffolds engineered to reproduce the organized microstructure of these native tissues. To carry out this study, we developed a custom confocal microscope-mounted tensile testing device and simultaneously monitored strain across multiple length scales. Results showed that mean strain was heterogeneous and significantly attenuated, but coordinated, at the local matrix level in native tissues (35-70% strain attenuation). Conversely, freshly seeded scaffolds exhibited very direct and uniform strain transfer from the tissue to the local matrix level (15-25% strain attenuation). In addition, strain transfer from local matrix to cells and nuclei was dependent on fiber orientation and tissue type. Histological analysis suggested that different domains exist within these fibrous tissues, with most of the tissue being fibrous, characterized by an aligned collagen structure and elongated cells, and other regions being proteoglycan (PG)-rich, characterized by a dense accumulation of PGs and rounder cells. In meniscus, the observed heterogeneity in strain transfer correlated strongly with cellular morphology, where rounder cells located in PG-rich microdomains were shielded from deformation, while elongated cells in fibrous microdomains deformed readily. Collectively, these findings suggest that different tissues utilize distinct strain-attenuating mechanisms according to their unique structure and cellular phenotype, and these differences likely alter the local biologic response of such tissues and constructs in response to mechanical perturbation. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Extension of modified power method to two-dimensional problems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Peng; Ulsan National Institute of Science and Technology, 50 UNIST-gil, Ulsan 44919; Lee, Hyunsuk

2016-09-01

In this study, the generalized modified power method was extended to two-dimensional problems. A direct application of the method to two-dimensional problems was shown to be unstable when the number of requested eigenmodes is larger than a certain problem dependent number. The root cause of this instability has been identified as the degeneracy of the transfer matrix. In order to resolve this instability, the number of sub-regions for the transfer matrix was increased to be larger than the number of requested eigenmodes; and a new transfer matrix was introduced accordingly which can be calculated by the least square method. Themore » stability of the new method has been successfully demonstrated with a neutron diffusion eigenvalue problem and the 2D C5G7 benchmark problem. - Graphical abstract:.« less

Preparation and application of in-fibre internal standardization solid-phase microextraction.

PubMed

Zhao, Wennan; Ouyang, Gangfeng; Pawliszyn, Janusz

2007-03-01

The in-fibre standardization method is a novel approach that has been developed for field sampling/sample preparation, in which an internal standard is pre-loaded onto a solid-phase microextraction (SPME) fibre for calibration of the extraction of target analytes in field samples. The same method can also be used for in-vial sample analysis. In this study, different techniques to load the standard to a non-porous SPME fibre were investigated. It was found that the appropriateness of the technique depends on the physical properties of the standards that are used for the analysis. Headspace extraction of the standard dissolved in pumping oil works well for volatile compounds. Conversely, headspace extraction of the pure standard is an effective approach for semi-volatile compounds. For compounds with low volatility, a syringe-fibre transfer method and direct extraction of the standard dissolved in a solvent exhibited a good reproducibility (<5% RSD). The main advantage of the approaches investigated in this study is that the standard generation vials can be reused for hundreds of analyses without exhibiting significant loss. Moreover, most of the standard loading processes studied can be performed automatically, which is efficient and precise. Finally, the standard loading technique and in-fibre standardization method were applied to a complex matrix (milk) and the results illustrated that the matrix effect can be effectively compensated for with this approach.

Prefabricated microvascular autograft in tracheal reconstruction.

PubMed

Fayad, J; Kuriloff, D B

1994-10-01

Tracheal reconstruction continues to be a challenge in head and neck surgery. Numerous techniques, including the use of alloplasts, composite grafts, and staged laryngotracheal troughs, have met with limited success because of implant exposure, infection, persistent granulation tissue, and eventual restenosis. With recently introduced techniques for soft-tissue molding, bone induction with bone morphogenetic protein, and microvascular free tissue transfer, a rodent model was developed to create a well-vascularized tracheal autograft. In this model, a rigid tube having the same dimensions and flexibility as the native trachea was created by wrapping a cylindrical silicone tracheal mold with a layer of vascularized adductor thigh muscle pedicled on the femoral vessels in the groin. Tracheal rings were created by filing transverse troughs in the muscle bed with bone morphogenetic protein-primed demineralized bone matrix before wrapping around the silicone mold. Grafts harvested at 2 weeks demonstrated rigid skeletal support provided by heterotopic bone formation in the form of rings and a smooth inner lining produced by fibroplasia. Bone transformation was controlled and restricted to the muscle troughs, allowing intervening regions of soft tissue and thus producing a flexible neotrachia. With this model, a homologous, vascularized tracheal autograft capable of microvascular free tissue transfer was fabricated based on the femoral vessels. Prefabrication of composite grafts, through the use of soft-tissue molding, bone induction, and subsequent free tissue transfer, has an unlimited potential for use in head and neck reconstruction.

Registration using natural features for augmented reality systems.

PubMed

Yuan, M L; Ong, S K; Nee, A Y C

2006-01-01

Registration is one of the most difficult problems in augmented reality (AR) systems. In this paper, a simple registration method using natural features based on the projective reconstruction technique is proposed. This method consists of two steps: embedding and rendering. Embedding involves specifying four points to build the world coordinate system on which a virtual object will be superimposed. In rendering, the Kanade-Lucas-Tomasi (KLT) feature tracker is used to track the natural feature correspondences in the live video. The natural features that have been tracked are used to estimate the corresponding projective matrix in the image sequence. Next, the projective reconstruction technique is used to transfer the four specified points to compute the registration matrix for augmentation. This paper also proposes a robust method for estimating the projective matrix, where the natural features that have been tracked are normalized (translation and scaling) and used as the input data. The estimated projective matrix will be used as an initial estimate for a nonlinear optimization method that minimizes the actual residual errors based on the Levenberg-Marquardt (LM) minimization method, thus making the results more robust and stable. The proposed registration method has three major advantages: 1) It is simple, as no predefined fiducials or markers are used for registration for either indoor and outdoor AR applications. 2) It is robust, because it remains effective as long as at least six natural features are tracked during the entire augmentation, and the existence of the corresponding projective matrices in the live video is guaranteed. Meanwhile, the robust method to estimate the projective matrix can obtain stable results even when there are some outliers during the tracking process. 3) Virtual objects can still be superimposed on the specified areas, even if some parts of the areas are occluded during the entire process. Some indoor and outdoor experiments have been conducted to validate the performance of this proposed method.

General transfer matrix formalism to calculate DNA-protein-drug binding in gene regulation: application to OR operator of phage lambda.

PubMed

Teif, Vladimir B

2007-01-01

The transfer matrix methodology is proposed as a systematic tool for the statistical-mechanical description of DNA-protein-drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the O(R) operator of phage lambda. The transfer matrix formalism allowed the description of the lambda-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI-Cro-RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the O(R) and O(L) operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters P(R) and P(RM) becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed.

General transfer matrix formalism to calculate DNA–protein–drug binding in gene regulation: application to OR operator of phage λ

PubMed Central

Teif, Vladimir B.

2007-01-01

The transfer matrix methodology is proposed as a systematic tool for the statistical–mechanical description of DNA–protein–drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the OR operator of phage λ. The transfer matrix formalism allowed the description of the λ-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI–Cro–RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the OR and OL operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters PR and PRM becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed. PMID:17526526

Structures of glycans bound to receptors from saturation transfer difference (STD) NMR spectroscopy: quantitative analysis by using CORCEMA-ST.

PubMed

Enríquez-Navas, Pedro M; Guzzi, Cinzia; Muñoz-García, Juan C; Nieto, Pedro M; Angulo, Jesús

2015-01-01

Glycan-receptor interactions are of fundamental relevance for a large number of biological processes, and their kinetics properties (medium/weak binding affinities) make them appropriated to be studied by ligand observed NMR techniques, among which saturation transfer difference (STD) NMR spectroscopy has been shown to be a very robust and powerful approach. The quantitative analysis of the results from a STD NMR study of a glycan-receptor interaction is essential to be able to translate the resulting spectral intensities into a 3D molecular model of the complex. This chapter describes how to carry out such a quantitative analysis by means of the Complete Relaxation and Conformational Exchange Matrix Approach for STD NMR (CORCEMA-ST), in general terms, and an example of a previous work on an antibody-glycan interaction is also shown.

Optical implementation of systolic array processing

NASA Technical Reports Server (NTRS)

Caulfield, H. J.; Rhodes, W. T.; Foster, M. J.; Horvitz, S.

1981-01-01

Algorithms for matrix vector multiplication are implemented using acousto-optic cells for multiplication and input data transfer and using charge coupled devices detector arrays for accumulation and output of the results. No two dimensional matrix mask is required; matrix changes are implemented electronically. A system for multiplying a 50 component nonnegative real vector by a 50 by 50 nonnegative real matrix is described. Modifications for bipolar real and complex valued processing are possible, as are extensions to matrix-matrix multiplication and multiplication of a vector by multiple matrices.

SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

NASA Astrophysics Data System (ADS)

Padhee, Varsha

Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any converter. This conceivably aids the sizing and design of output passive filters. An analytical estimation method has been presented to achieve this purpose for am IMC. Knowledge of the fundamental component in output voltage can be utilized to calculate its Total Harmonic Distortion (THD). The effectiveness of the proposed SVPWM algorithms and the analytical estimation technique is substantiated by simulations in MATLAB / Simulink and experiments on a laboratory prototype of the IMC. Proper comparison plots have been provided to contrast the performance of the proposed methods with the conventional SVPWM method. The behavior of output voltage distortion and CMV with variation in operating parameters like modulation index and output frequency has also been analyzed.

Acoustic response of a rectangular levitator with orifices

NASA Technical Reports Server (NTRS)

El-Raheb, Michael; Wagner, Paul

1990-01-01

The acoustic response of a rectangular cavity to speaker-generated excitation through waveguides terminating at orifices in the cavity walls is analyzed. To find the effects of orifices, acoustic pressure is expressed by eigenfunctions satisfying Neumann boundary conditions as well as by those satisfying Dirichlet ones. Some of the excess unknowns can be eliminated by point constraints set over the boundary, by appeal to Lagrange undetermined multipliers. The resulting transfer matrix must be further reduced by partial condensation to the order of a matrix describing unmixed boundary conditions. If the cavity is subjected to an axial temperature dependence, the transfer matrix is determined numerically.

Biaxial (Tension-Torsion) Testing of an Oxide/Oxide Ceramic Matrix Composite

DTIC Science & Technology

2013-03-01

estimation algorithms and constants . . . . . . . . . . . . . 61 4.27 Biaxial (tension-torsion) load spreadsheet with independent axial load and torsion...through the composite and provides the main load - bearing capability. The interaction of the two (or more) phases takes place in the interface. The...transfer loads between fibers[15]. The fiber-to-fiber load transfer mechanism provided by the matrix plays a major role in the load - bearing properties of the

An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

2013-02-07

Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

PubMed

Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

2013-02-07

Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

Energy transfer in PPV-based conjugated polymers: a defocused widefield fluorescence microscopy study.

PubMed

Hooley, E N; Tilley, A J; White, J M; Ghiggino, K P; Bell, T D M

2014-04-21

Both pendant and main chain conjugated MEH-PPV based polymers have been studied at the level of single chains using confocal and widefield fluorescence microscopy techniques. In particular, defocused widefield fluorescence is applied to reveal the extent of energy transfer in these polymers by identifying whether they act as single emitters. For main chain conjugated MEH-PPV, molecular weight and the surrounding matrix play a primary role in determining energy transport processes and whether single emitter behaviour is observed. Surprisingly in polymers with a saturated backbone but containing the same pendant MEH-PPV oligomer on each repeating unit, intra-chain energy transfer to a single emitter is also apparent. The results imply there is chromophore heterogeneity that can facilitate energy funneling to the emitting site. Both main chain conjugated and pendant MEH-PPV polymers exhibit changes in orientation of the emission dipole during a fluorescence trajectory of many seconds, whereas a model MEH-PPV oligomer does not. The results suggest that, in the polymers, the nature of the emitting chromophores can change during the time trajectory.

Multiscale strain analysis of tissue equivalents using a custom-designed biaxial testing device.

PubMed

Bell, B J; Nauman, E; Voytik-Harbin, S L

2012-03-21

Mechanical signals transferred between a cell and its extracellular matrix play an important role in regulating fundamental cell behavior. To further define the complex mechanical interactions between cells and matrix from a multiscale perspective, a biaxial testing device was designed and built. Finite element analysis was used to optimize the cruciform specimen geometry so that stresses within the central region were concentrated and homogenous while minimizing shear and grip effects. This system was used to apply an equibiaxial loading and unloading regimen to fibroblast-seeded tissue equivalents. Digital image correlation and spot tracking were used to calculate three-dimensional strains and associated strain transfer ratios at macro (construct), meso, matrix (collagen fibril), cell (mitochondria), and nuclear levels. At meso and matrix levels, strains in the 1- and 2-direction were statistically similar throughout the loading-unloading cycle. Interestingly, a significant amplification of cellular and nuclear strains was observed in the direction perpendicular to the cell axis. Findings indicate that strain transfer is dependent upon local anisotropies generated by the cell-matrix force balance. Such multiscale approaches to tissue mechanics will assist in advancement of modern biomechanical theories as well as development and optimization of preconditioning regimens for functional engineered tissue constructs. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Puzzle Imaging: Using Large-Scale Dimensionality Reduction Algorithms for Localization.

PubMed

Glaser, Joshua I; Zamft, Bradley M; Church, George M; Kording, Konrad P

2015-01-01

Current high-resolution imaging techniques require an intact sample that preserves spatial relationships. We here present a novel approach, "puzzle imaging," that allows imaging a spatially scrambled sample. This technique takes many spatially disordered samples, and then pieces them back together using local properties embedded within the sample. We show that puzzle imaging can efficiently produce high-resolution images using dimensionality reduction algorithms. We demonstrate the theoretical capabilities of puzzle imaging in three biological scenarios, showing that (1) relatively precise 3-dimensional brain imaging is possible; (2) the physical structure of a neural network can often be recovered based only on the neural connectivity matrix; and (3) a chemical map could be reproduced using bacteria with chemosensitive DNA and conjugative transfer. The ability to reconstruct scrambled images promises to enable imaging based on DNA sequencing of homogenized tissue samples.

Identification and Quantification of Carbon Phases in Conversion Fuel for the Transient Reactor Test Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, Robert; Mata, Angelica; Dunzik-Gougar, Mary Lou

2016-06-01

As part of an overall effort to convert US research reactors to low-enriched uranium (LEU) fuel use, a LEU conversion fuel is being designed for the Transient Reactor Test Facility (TREAT) at the Idaho National Laboratory. TREAT fuel compacts are comprised of UO2 fuel particles in a graphitic matrix material. In order to refine heat transfer modeling, as well as determine other physical and nuclear characteristics of the fuel, the amount and type of graphite and non-graphite phases within the fuel matrix must be known. In this study, we performed a series of complementary analyses, designed to allow detailed characterizationmore » of the graphite and phenolic resin based fuel matrix. Methods included Scanning Electron and Transmission Electron Microscopies, Raman spectroscopy, X-ray Diffraction, and Dual-Beam Focused Ion Beam Tomography. Our results indicate that no single characterization technique will yield all of the desired information; however, through the use of statistical and empirical data analysis, such as curve fitting, partial least squares regression, volume extrapolation and spectra peak ratios, a degree of certainty for the quantity of each phase can be obtained.« less

Weighted graph based ordering techniques for preconditioned conjugate gradient methods

NASA Technical Reports Server (NTRS)

Clift, Simon S.; Tang, Wei-Pai

1994-01-01

We describe the basis of a matrix ordering heuristic for improving the incomplete factorization used in preconditioned conjugate gradient techniques applied to anisotropic PDE's. Several new matrix ordering techniques, derived from well-known algorithms in combinatorial graph theory, which attempt to implement this heuristic, are described. These ordering techniques are tested against a number of matrices arising from linear anisotropic PDE's, and compared with other matrix ordering techniques. A variation of RCM is shown to generally improve the quality of incomplete factorization preconditioners.

Algorithms and software used in selecting structure of machine-training cluster based on neurocomputers

NASA Astrophysics Data System (ADS)

Romanchuk, V. A.; Lukashenko, V. V.

2018-05-01

The technique of functioning of a control system by a computing cluster based on neurocomputers is proposed. Particular attention is paid to the method of choosing the structure of the computing cluster due to the fact that the existing methods are not effective because of a specialized hardware base - neurocomputers, which are highly parallel computer devices with an architecture different from the von Neumann architecture. A developed algorithm for choosing the computational structure of a cloud cluster is described, starting from the direction of data transfer in the flow control graph of the program and its adjacency matrix.

Conductance of single microRNAs chains related to the autism spectrum disorder

NASA Astrophysics Data System (ADS)

Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

2014-09-01

The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.

Experimental study on slow flexural waves around the defect modes in a phononic crystal beam using fiber Bragg gratings

NASA Astrophysics Data System (ADS)

Chuang, Kuo-Chih; Zhang, Zhi-Qiang; Wang, Hua-Xin

2016-12-01

This work experimentally studies influences of the point defect modes on the group velocity of flexural waves in a phononic crystal Timoshenko beam. Using the transfer matrix method with a supercell technique, the band structures and the group velocities around the defect modes are theoretically obtained. Particularly, to demonstrate the existence of the localized defect modes inside the band gaps, a high-sensitivity fiber Bragg grating sensing system is set up and the displacement transmittance is measured. Slow propagation of flexural waves via defect coupling in the phononic crystal beam is then experimentally demonstrated with Hanning windowed tone burst excitations.

The phonon-polariton spectrum of one-dimensional Rudin-Shapiro photonic superlattices with uniaxial polar materials

NASA Astrophysics Data System (ADS)

Gómez-Urrea, H. A.; Duque, C. A.; Mora-Ramos, M. E.

2015-11-01

The properties of the optical-phonon-associated polaritonic modes that appear under oblique light incidence in 1D superlattices made of photonic materials are studied. The investigated systems result from the periodic repetition of quasiregular Rudin-Shapiro (RS) multilayer units. It is assume that the structure consists of both passive non-dispersive layers of constant refraction index and active layers of uniaxial polar materials. In particular, we consider III-V wurtzite nitrides. The optical axis of these polaritonic materials is taken along the growth direction. Maxwell equations are solved using the transfer matrix technique for all admissible values of the incidence angle.

Finite-size effects on the static properties of a single-chain magnet

NASA Astrophysics Data System (ADS)

Bogani, L.; Sessoli, R.; Pini, M. G.; Rettori, A.; Novak, M. A.; Rosa, P.; Massi, M.; Fedi, M. E.; Giuntini, L.; Caneschi, A.; Gatteschi, D.

2005-08-01

We study the role of defects in the “single-chain magnet” CoPhOMe by inserting a controlled number of diamagnetic impurities. The samples are analyzed with unprecedented accuracy with the particle induced x-ray emission technique, and with ac and dc magnetic measurements. In an external applied field the system shows an unexpected behavior, giving rise to a double peak in the susceptibility. The static thermodynamic properties of the randomly diluted Ising chain with alternating g values are then exactly obtained via a transfer matrix approach. These results are compared to the experimental behavior of CoPhOMe, showing qualitative agreement.

Modeling techniques for quantum cascade lasers

NASA Astrophysics Data System (ADS)

Jirauschek, Christian; Kubis, Tillmann

2014-03-01

Quantum cascade lasers are unipolar semiconductor lasers covering a wide range of the infrared and terahertz spectrum. Lasing action is achieved by using optical intersubband transitions between quantized states in specifically designed multiple-quantum-well heterostructures. A systematic improvement of quantum cascade lasers with respect to operating temperature, efficiency, and spectral range requires detailed modeling of the underlying physical processes in these structures. Moreover, the quantum cascade laser constitutes a versatile model device for the development and improvement of simulation techniques in nano- and optoelectronics. This review provides a comprehensive survey and discussion of the modeling techniques used for the simulation of quantum cascade lasers. The main focus is on the modeling of carrier transport in the nanostructured gain medium, while the simulation of the optical cavity is covered at a more basic level. Specifically, the transfer matrix and finite difference methods for solving the one-dimensional Schrödinger equation and Schrödinger-Poisson system are discussed, providing the quantized states in the multiple-quantum-well active region. The modeling of the optical cavity is covered with a focus on basic waveguide resonator structures. Furthermore, various carrier transport simulation methods are discussed, ranging from basic empirical approaches to advanced self-consistent techniques. The methods include empirical rate equation and related Maxwell-Bloch equation approaches, self-consistent rate equation and ensemble Monte Carlo methods, as well as quantum transport approaches, in particular the density matrix and non-equilibrium Green's function formalism. The derived scattering rates and self-energies are generally valid for n-type devices based on one-dimensional quantum confinement, such as quantum well structures.

Modeling techniques for quantum cascade lasers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jirauschek, Christian; Kubis, Tillmann

2014-03-15

Quantum cascade lasers are unipolar semiconductor lasers covering a wide range of the infrared and terahertz spectrum. Lasing action is achieved by using optical intersubband transitions between quantized states in specifically designed multiple-quantum-well heterostructures. A systematic improvement of quantum cascade lasers with respect to operating temperature, efficiency, and spectral range requires detailed modeling of the underlying physical processes in these structures. Moreover, the quantum cascade laser constitutes a versatile model device for the development and improvement of simulation techniques in nano- and optoelectronics. This review provides a comprehensive survey and discussion of the modeling techniques used for the simulation ofmore » quantum cascade lasers. The main focus is on the modeling of carrier transport in the nanostructured gain medium, while the simulation of the optical cavity is covered at a more basic level. Specifically, the transfer matrix and finite difference methods for solving the one-dimensional Schrödinger equation and Schrödinger-Poisson system are discussed, providing the quantized states in the multiple-quantum-well active region. The modeling of the optical cavity is covered with a focus on basic waveguide resonator structures. Furthermore, various carrier transport simulation methods are discussed, ranging from basic empirical approaches to advanced self-consistent techniques. The methods include empirical rate equation and related Maxwell-Bloch equation approaches, self-consistent rate equation and ensemble Monte Carlo methods, as well as quantum transport approaches, in particular the density matrix and non-equilibrium Green's function formalism. The derived scattering rates and self-energies are generally valid for n-type devices based on one-dimensional quantum confinement, such as quantum well structures.« less

Nuclear waste storage container with metal matrix

DOEpatents

Sump, Kenneth R.

1978-01-01

The invention relates to a storage container for high-level waste having a metal matrix for the high-level waste, thereby providing greater impact strength for the waste container and increasing heat transfer properties.

Diagonalization of transfer matrix of supersymmetry U{sub q}(sl-caret(M+1|N+1)) chain with a boundary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kojima, Takeo

2013-04-15

We study the supersymmetry U{sub q}(sl-caret(M+1|N+1)) analogue of the supersymmetric t-J model with a boundary. Our approach is based on the algebraic analysis method of solvable lattice models. We diagonalize the commuting transfer matrix by using the bosonizations of the vertex operators associated with the quantum affine supersymmetry U{sub q}(sl-caret(M+1|N+1)).

Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

2001-04-01

Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

Contaminant sequestration in karstic aquifers: Experiments and quantification

NASA Astrophysics Data System (ADS)

Li, Guangquan; Loper, David E.; Kung, Robin

2008-02-01

A karstic aquifer typically has significant secondary porosity consisting of an interconnected system of caves or conduits. Conduit-borne contaminants can enter the contiguous limestone matrix, remain inside for a longer time than in the conduit, and subsequently be flushed out. This retention or sequestration can significantly influence the fate of contaminants within the aquifer and alter the shape of the breakthrough curve. The mechanisms involved in sequestration have been identified and quantified by analysis of the breakthrough curves generated by a set of laboratory experiments in which a conduit, porous limestone matrix, and conservative contaminant were simulated by a porous-walled pipe, chamber of closely packed glass beads, and salt, respectively. Experiments were conducted with both active and passive transfer of water between conduit and matrix, simulating differing hydrogeologic regimes. In active transfer the primary control parameter is the volume of water transferred; sequestration is primarily due to advection with the effects of diffusion and dispersion being minimal. In passive transfer the control parameters are the conduit Reynolds number and the duration that contaminant resides in the conduit; sequestration is caused by the combined effects of the conduit pressure drop, pressure variation due to bedform, and diffusion. Active and passive transfer can be unified by analyzing the ratio of the scale of pressure variation to the conduit length. In accordance with the resolved mechanisms a variety of models have been constructed to recover solute distributions in the matrix and to regenerate breakthrough curves. These analyses and models provide a potential approach to investigate contaminant migration in karstic aquifers.

A Clinical Comparative Study of 3-Dimensional Accuracy between Digital and Conventional Implant Impression Techniques.

PubMed

Alsharbaty, Mohammed Hussein M; Alikhasi, Marzieh; Zarrati, Simindokht; Shamshiri, Ahmed Reza

2018-02-09

To evaluate the accuracy of a digital implant impression technique using a TRIOS 3Shape intraoral scanner (IOS) compared to conventional implant impression techniques (pick-up and transfer) in clinical situations. Thirty-six patients who had two implants (Implantium, internal connection) ranging in diameter between 3.8 and 4.8 mm in posterior regions participated in this study after signing a consent form. Thirty-six reference models (RM) were fabricated by attaching two impression copings intraorally, splinted with autopolymerizing acrylic resin, verified by sectioning through the middle of the index, and rejoined again with freshly mixed autopolymerizing acrylic resin pattern (Pattern Resin) with the brush bead method. After that, the splinted assemblies were attached to implant analogs (DANSE) and impressed with type III dental stone (Gypsum Microstone) in standard plastic die lock trays. Thirty-six working casts were fabricated for each conventional impression technique (i.e., pick-up and transfer). Thirty-six digital impressions were made with a TRIOS 3Shape IOS. Eight of the digitally scanned files were damaged; 28 digital scan files were retrieved to STL format. A coordinate-measuring machine (CMM) was used to record linear displacement measurements (x, y, and z-coordinates), interimplant distances, and angular displacements for the RMs and conventionally fabricated working casts. CATIA 3D evaluation software was used to assess the digital STL files for the same variables as the CMM measurements. CMM measurements made on the RMs and conventionally fabricated working casts were compared with 3D software measurements made on the digitally scanned files. Data were statistically analyzed using the generalized estimating equation (GEE) with an exchangeable correlation matrix and linear method, followed by the Bonferroni method for pairwise comparisons (α = 0.05). The results showed significant differences between the pick-up and digital groups in all of the measured variables (p < 0.001). Concerning the transfer and digital groups, the results were statistically significant in angular displacement (p < 0.001), distance measurements (p = 0.01), and linear displacement (p = 0.03); however, between the pick-up and transfer groups, there was no statistical significance in all of the measured variables (interimplant distance deviation, linear displacement, and angular displacement deviations). According to the results of this study, the digital implant impression technique had the least accuracy. Based on the study outcomes, distance and angulation errors associated with the intraoral digital implant impressions were too large to fabricate well-fitting restorations for partially edentulous patients. The pick-up implant impression technique was the most accurate, and the transfer technique revealed comparable accuracy to it. © 2018 by the American College of Prosthodontists.

Regenerator filled with a matrix of polycrystalline iron whiskers

NASA Astrophysics Data System (ADS)

Eder, F. X.; Appel, H.

1982-08-01

In thermal regenerators, parameters were optimized: convection coefficient, surface of heat accumulating matrix, matrix density and heat capacity, and frequency of cycle inversions. The variation of heat capacity with working temperature was also computed. Polycrystalline iron whiskers prove a good compromise as matrix for heat regenerators at working temperatures ranging from 300 to 80 K. They were compared with wire mesh screens and microspheres of bronze and stainless steel. For theses structures and materials, thermal conductivity, pressure drop, heat transfer and yield were calculated and related to the experimental values. As transport heat gas, helium, argon, and dry nitrogen were applied at pressures up to 20 bar. Experimental and theoretical studies result in a set of formulas for calculating pressure drop, heat capacity, and heat transfer rate for a given thermal regenerator in function of mass flow. It is proved that a whisker matrix has an efficiency that depends strongly on gas pressure and composition. Iron whiskers make a good matrix with heat capacities of kW/cu cm per K, but their relative high pressure drop may, at low pressures, be a limitation. A regenerator expansion machine is described.

A general solution strategy of modified power method for higher mode solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Peng; Lee, Hyunsuk; Lee, Deokjung, E-mail: deokjung@unist.ac.kr

2016-01-15

A general solution strategy of the modified power iteration method for calculating higher eigenmodes has been developed and applied in continuous energy Monte Carlo simulation. The new approach adopts four features: 1) the eigen decomposition of transfer matrix, 2) weight cancellation for higher modes, 3) population control with higher mode weights, and 4) stabilization technique of statistical fluctuations using multi-cycle accumulations. The numerical tests of neutron transport eigenvalue problems successfully demonstrate that the new strategy can significantly accelerate the fission source convergence with stable convergence behavior while obtaining multiple higher eigenmodes at the same time. The advantages of the newmore » strategy can be summarized as 1) the replacement of the cumbersome solution step of high order polynomial equations required by Booth's original method with the simple matrix eigen decomposition, 2) faster fission source convergence in inactive cycles, 3) more stable behaviors in both inactive and active cycles, and 4) smaller variances in active cycles. Advantages 3 and 4 can be attributed to the lower sensitivity of the new strategy to statistical fluctuations due to the multi-cycle accumulations. The application of the modified power method to continuous energy Monte Carlo simulation and the higher eigenmodes up to 4th order are reported for the first time in this paper. -- Graphical abstract: -- Highlights: •Modified power method is applied to continuous energy Monte Carlo simulation. •Transfer matrix is introduced to generalize the modified power method. •All mode based population control is applied to get the higher eigenmodes. •Statistic fluctuation can be greatly reduced using accumulated tally results. •Fission source convergence is accelerated with higher mode solutions.« less

Matrix isolation infrared spectra of O2 and N2 insertion reactions with atomic uranium

NASA Astrophysics Data System (ADS)

Hunt, Rodney D.; Toth, L. Mac; Yustein, Jason T.; Andrews, Lester

1993-10-01

Laser ablation of refractory metals can be an effective source of vapor for matrix isolation IR studies. This combination of techniques was used for the first time to study the mechanisms of U vapor reactions with atmospheric components. U atoms and O2 were codeposited with excess Ar at 12 K. The dominant codeposition products were UO2 and UO3. In contrast, the UO yield was always small because UO2 is formed by an insertion mechanism. This mechanism was verified in the 16O2/18O2 experiments which failed to produce 16OU18O. The effects of UV photolysis and matrix annealings were also examined. The U atoms and O2 reaction requires little or no activation energy since UO2 was formed from cold reagents. New charge-transfer species, (UO2+2)(O2-2) and (UO+2)(O-2), and a weak complex, UO3-O2, were primarily produced under conditions which favored further O2 reactions. Similar U atom and N2 experiments produced only linear NUN which is also produced by an insertion mechanism. This U reaction represents the first time that atom was observed breaking and inserting into the triple bond of N2. Photolysis dramatically increased the NUN yield by 3-fold. Matrix annealings produced weak UN2-N2 and UN2-2N2 complexes.

An effective vacuum assisted extraction method for the optimization of labdane diterpenoids from Andrographis paniculata by response surface methodology.

PubMed

Wang, Ya-Qi; Wu, Zhen-Feng; Ke, Gang; Yang, Ming

2014-12-31

An effective vacuum assisted extraction (VAE) technique was proposed for the first time and applied to extract bioactive components from Andrographis paniculata. The process was carefully optimized by response surface methodology (RSM). Under the optimized experimental conditions, the best results were obtained using a boiling temperature of 65 °C, 50% ethanol concentration, 16 min of extraction time, one extraction cycles and a 12:1 liquid-solid ratio. Compared with conventional ultrasonic assisted extraction and heat reflux extraction, the VAE technique gave shorter extraction times and remarkable higher extraction efficiency, which indicated that a certain degree of vacuum gave the solvent a better penetration of the solvent into the pores and between the matrix particles, and enhanced the process of mass transfer. The present results demonstrated that VAE is an efficient, simple and fast method for extracting bioactive components from A. paniculata, which shows great potential for becoming an alternative technique for industrial scale-up applications.

Steady State Transportation Cooling in Porous Media Under Local, Non-Thermal Equilibrium Fluid Flow

NASA Technical Reports Server (NTRS)

Rodriquez, Alvaro Che

2002-01-01

An analytical solution to the steady-state fluid temperature for 1-D (one dimensional) transpiration cooling has been derived. Transpiration cooling has potential use in the aerospace industry for protection against high heating environments for re-entry vehicles. Literature for analytical treatments of transpiration cooling has been largely confined to the assumption of thermal equilibrium between the porous matrix and fluid. In the present analysis, the fundamental fluid and matrix equations are coupled through a volumetric heat transfer coefficient and investigated in non-thermal equilibrium. The effects of varying the thermal conductivity of the solid matrix and the heat transfer coefficient are investigated. The results are also compared to existing experimental data.

Addressable inverter matrix for process and device characterization

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Sayah, H. R.

1985-01-01

The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold vltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

Addressable inverter matrix for process and device characterization

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Sayah, H. R.

1985-01-01

The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

Water exchange and pressure transfer between conduits and matrix and their influence on hydrodynamics of two karst aquifers with sinking streams

NASA Astrophysics Data System (ADS)

Bailly-Comte, Vincent; Martin, Jonathan B.; Jourde, Hervé; Screaton, Elizabeth J.; Pistre, Séverin; Langston, Abigail

2010-05-01

SummaryKarst aquifers are heterogeneous media where conduits usually drain water from lower permeability volumes (matrix and fractures). For more than a century, various approaches have used flood recession curves, which integrate all hydrodynamic processes in a karst aquifer, to infer physical properties of the movement and storage of groundwater. These investigations typically only consider flow to the conduits and thus have lacked quantitative observations of how pressure transfer and water exchange between matrix and conduit during flooding could influence recession curves. We present analyses of simultaneous discharge and water level time series of two distinctly different karst systems, one with low porosity and permeability matrix rocks in southern France, and one with high porosity and permeability matrix rocks in north-central Florida (USA). We apply simple mathematical models of flood recession using time series representations of recharge, storage, and discharge processes in the karst aquifer. We show that karst spring hydrographs can be interpreted according to pressure transfer between two distinct components of the aquifer, conduit and matrix porosity, which induce two distinct responses at the spring. Water exchange between conduits and matrix porosity successively control the flow regime at the spring. This exchange is governed by hydraulic head differences between conduits and matrix, head gradients within conduits, and the contrast of permeability between conduits and matrix. These observations have consequences for physical interpretations of recession curves and modeling of karst spring flows, particularly for the relative magnitudes of base flow and quick flow from karst springs. Finally, these results suggest that similar analyses of recession curves can be applied to karst aquifers with distinct physical characteristics utilizing well and spring hydrograph data, but information must be known about the hydrodynamics and physical properties of the aquifer before the results can be correctly interpreted.

Numerical Modeling of Fiber-Reinforced Metal Matrix Composite Processing by the Liquid Route: Literature Contribution

NASA Astrophysics Data System (ADS)

Lacoste, Eric; Arvieu, Corinne; Mantaux, Olivier

2018-04-01

One of the technologies used to produce metal matrix composites (MMCs) is liquid route processing. One solution is to inject a liquid metal under pressure or at constant rate through a fibrous preform. This foundry technique overcomes the problem of the wettability of ceramic fibers by liquid metal. The liquid route can also be used to produce semiproducts by coating a filament with a molten metal. These processes involve physical phenomena combined with mass and heat transfer and phase change. The phase change phenomena related to solidification and also to the melting of the metal during the process notably result in modifications to the permeability of porous media, in gaps in impregnation, in the appearance of defects (porosities), and in segregation in the final product. In this article, we provide a state-of-the-art review of numerical models and simulation developed to study these physical phenomena involved in MMC processing by the liquid route.

Intrasystem Analysis Program (IAP) code summaries

NASA Astrophysics Data System (ADS)

Dobmeier, J. J.; Drozd, A. L. S.; Surace, J. A.

1983-05-01

This report contains detailed descriptions and capabilities of the codes that comprise the Intrasystem Analysis Program. The four codes are: Intrasystem Electromagnetic Compatibility Analysis Program (IEMCAP), General Electromagnetic Model for the Analysis of Complex Systems (GEMACS), Nonlinear Circuit Analysis Program (NCAP), and Wire Coupling Prediction Models (WIRE). IEMCAP is used for computer-aided evaluation of electromagnetic compatibility (ECM) at all stages of an Air Force system's life cycle, applicable to aircraft, space/missile, and ground-based systems. GEMACS utilizes a Method of Moments (MOM) formalism with the Electric Field Integral Equation (EFIE) for the solution of electromagnetic radiation and scattering problems. The code employs both full matrix decomposition and Banded Matrix Iteration solution techniques and is expressly designed for large problems. NCAP is a circuit analysis code which uses the Volterra approach to solve for the transfer functions and node voltage of weakly nonlinear circuits. The Wire Programs deal with the Application of Multiconductor Transmission Line Theory to the Prediction of Cable Coupling for specific classes of problems.

Fast matrix treatment of 3-D radiative transfer in vegetation canopies: SPARTACUS-Vegetation 1.1

NASA Astrophysics Data System (ADS)

Hogan, Robin J.; Quaife, Tristan; Braghiere, Renato

2018-01-01

A fast scheme is described to compute the 3-D interaction of solar radiation with vegetation canopies. The canopy is split in the horizontal plane into one clear region and one or more vegetated regions, and the two-stream equations are used for each, but with additional terms representing lateral exchange of radiation between regions that are proportional to the area of the interface between them. The resulting coupled set of ordinary differential equations is solved using the matrix-exponential method. The scheme is compared to solar Monte Carlo calculations for idealized scenes from the RAMI4PILPS intercomparison project, for open forest canopies and shrublands both with and without snow on the ground. Agreement is good in both the visible and infrared: for the cases compared, the root-mean-squared difference in reflectance, transmittance and canopy absorptance is 0.020, 0.038 and 0.033, respectively. The technique has potential application to weather and climate modelling.

Simplified Dynamic Analysis of Grinders Spindle Node

NASA Astrophysics Data System (ADS)

Demec, Peter

2014-12-01

The contribution deals with the simplified dynamic analysis of surface grinding machine spindle node. Dynamic analysis is based on the use of the transfer matrix method, which is essentially a matrix form of method of initial parameters. The advantage of the described method, despite the seemingly complex mathematical apparatus, is primarily, that it does not require for solve the problem of costly commercial software using finite element method. All calculations can be made for example in MS Excel, which is advantageous especially in the initial stages of constructing of spindle node for the rapid assessment of the suitability its design. After detailing the entire structure of spindle node is then also necessary to perform the refined dynamic analysis in the environment of FEM, which it requires the necessary skills and experience and it is therefore economically difficult. This work was developed within grant project KEGA No. 023TUKE-4/2012 Creation of a comprehensive educational - teaching material for the article Production technique using a combination of traditional and modern information technology and e-learning.

Exact solution of a one-dimensional model of strained epitaxy on a periodically modulated substrate

NASA Astrophysics Data System (ADS)

Tokar, V. I.; Dreyssé, H.

2005-03-01

We consider a one-dimensional lattice gas model of strained epitaxy with the elastic strain accounted for through a finite number of cluster interactions comprising contiguous atomic chains. Interactions of this type arise in the models of strained epitaxy based on the Frenkel-Kontorova model. Furthermore, the deposited atoms interact with the substrate via an arbitrary periodic potential of period L . This model is solved exactly with the use of an appropriately adopted technique developed recently in the theory of protein folding. The advantage of the proposed approach over the standard transfer-matrix method is that it reduces the problem to finding the largest eigenvalue of a matrix of size L instead of 2L-1 , which is vital in the case of nanostructures where L may measure in hundreds of interatomic distances. Our major conclusion is that the substrate modulation always facilitates the size calibration of self-assembled nanoparticles in one- and two-dimensional systems.

First pregnancies, live birth, and in vitro fertilization outcomes after transplantation of frozen-banked ovarian tissue with a human extracellular matrix scaffold using robot-assisted minimally invasive surgery.

PubMed

Oktay, Kutluk; Bedoschi, Giuliano; Pacheco, Fernanda; Turan, Volkan; Emirdar, Volkan

2016-01-01

Ovarian tissue cryopreservation is an experimental fertility preservation method and the transplantation techniques are still evolving. We attempted to improve the technique with the utility of a human decellularized extracellular tissue matrix (ECTM) scaffold, robot-assisted minimally invasive surgery, and perioperative pharmacological support. We prospectively studied 2 subjects with hemophagocytic lymphohistiocytosis (patient A) and non-Hodgkin lymphoma (patient B) who underwent ovarian tissue cryopreservation at the age of 23 years, before receiving preconditioning chemotherapy for hematopoietic stem cell transplantation. Both experienced ovarian failure postchemotherapy and we transplanted ovarian cortical tissues to the contralateral menopausal ovary 7 and 12 years later, using a human ECTM scaffold and robotic assistance. The ECTM scaffold tissue compatibility was shown in preclinical studies. Patients also received estrogen supplementation and baby aspirin preoperatively to aid in the revascularization process. Ovarian follicle development was observed approximately 10 (patient A) and 8 (patient B) weeks after ovarian tissue transplantation. Following 8 and 7 cycles of in vitro fertilization, 9 and 10 day-3 embryos were cryopreserved (patients A and B, respectively). While the baseline follicle-stimulating hormone (range 3.6-15.4 mIU/mL) levels near normalized by 7 months and remained steady postovarian transplantation in patient A, patient B showed improved but elevated follicle-stimulating hormone levels throughout (range 21-31 mIU/mL). Highest follicle yield was achieved 14 (8 follicles; patient A) and 11 (6 follicles; patient B) months postintervention. Patient A experienced a chemical pregnancy after the third frozen embryo transfer attempt. She then conceived following her first fresh in vitro fertilization embryo transfer and the pregnancy is currently ongoing. Patient B conceived after the first frozen embryo transfer attempt and delivered a healthy girl at term. We report the first pregnancies after the minimally invasive transplantation of previously cryopreserved ovarian tissue with an ECTM scaffold. This approach seems to be associated with steady ovarian function after a follow-up of up to 2 years. Copyright © 2016 Elsevier Inc. All rights reserved.

Generation of Viable Cell and Biomaterial Patterns by Laser Transfer

NASA Astrophysics Data System (ADS)

Ringeisen, Bradley

2001-03-01

In order to fabricate and interface biological systems for next generation applications such as biosensors, protein recognition microarrays, and engineered tissues, it is imperative to have a method of accurately and rapidly depositing different active biomaterials in patterns or layered structures. Ideally, the biomaterial structures would also be compatible with many different substrates including technologically relevant platforms such as electronic circuits or various detection devices. We have developed a novel laser-based technique, termed matrix assisted pulsed laser evaporation direct write (MAPLE DW), that is able to direct write patterns and three-dimensional structures of numerous biologically active species ranging from proteins and antibodies to living cells. Specifically, we have shown that MAPLE DW is capable of forming mesoscopic patterns of living prokaryotic cells (E. coli bacteria), living mammalian cells (Chinese hamster ovaries), active proteins (biotinylated bovine serum albumin, horse radish peroxidase), and antibodies specific to a variety of classes of cancer related proteins including intracellular and extracellular matrix proteins, signaling proteins, cell cycle proteins, growth factors, and growth factor receptors. In addition, patterns of viable cells and active biomolecules were deposited on different substrates including metals, semiconductors, nutrient agar, and functionalized glass slides. We will present an explanation of the laser-based transfer mechanism as well as results from our recent efforts to fabricate protein recognition microarrays and tissue-based microfluidic networks.

Linearized blade row compression component model. Stability and frequency response analysis of a J85-3 compressor

NASA Technical Reports Server (NTRS)

Tesch, W. A.; Moszee, R. H.; Steenken, W. G.

1976-01-01

NASA developed stability and frequency response analysis techniques were applied to a dynamic blade row compression component stability model to provide a more economic approach to surge line and frequency response determination than that provided by time-dependent methods. This blade row model was linearized and the Jacobian matrix was formed. The clean-inlet-flow stability characteristics of the compressors of two J85-13 engines were predicted by applying the alternate Routh-Hurwitz stability criterion to the Jacobian matrix. The predicted surge line agreed with the clean-inlet-flow surge line predicted by the time-dependent method to a high degree except for one engine at 94% corrected speed. No satisfactory explanation of this discrepancy was found. The frequency response of the linearized system was determined by evaluating its Laplace transfer function. The results of the linearized-frequency-response analysis agree with the time-dependent results when the time-dependent inlet total-pressure and exit-flow function amplitude boundary conditions are less than 1 percent and 3 percent, respectively. The stability analysis technique was extended to a two-sector parallel compressor model with and without interstage crossflow and predictions were carried out for total-pressure distortion extents of 180 deg, 90 deg, 60 deg, and 30 deg.

Precision PEP-II optics measurement with an SVD-enhanced Least-Square fitting

NASA Astrophysics Data System (ADS)

Yan, Y. T.; Cai, Y.

2006-03-01

A singular value decomposition (SVD)-enhanced Least-Square fitting technique is discussed. By automatic identifying, ordering, and selecting dominant SVD modes of the derivative matrix that responds to the variations of the variables, the converging process of the Least-Square fitting is significantly enhanced. Thus the fitting speed can be fast enough for a fairly large system. This technique has been successfully applied to precision PEP-II optics measurement in which we determine all quadrupole strengths (both normal and skew components) and sextupole feed-downs as well as all BPM gains and BPM cross-plane couplings through Least-Square fitting of the phase advances and the Local Green's functions as well as the coupling ellipses among BPMs. The local Green's functions are specified by 4 local transfer matrix components R12, R34, R32, R14. These measurable quantities (the Green's functions, the phase advances and the coupling ellipse tilt angles and axis ratios) are obtained by analyzing turn-by-turn Beam Position Monitor (BPM) data with a high-resolution model-independent analysis (MIA). Once all of the quadrupoles and sextupole feed-downs are determined, we obtain a computer virtual accelerator which matches the real accelerator in linear optics. Thus, beta functions, linear coupling parameters, and interaction point (IP) optics characteristics can be measured and displayed.

Lightning induced currents in aircraft wiring using low level injection techniques

NASA Technical Reports Server (NTRS)

Stevens, E. G.; Jordan, D. T.

1991-01-01

Various techniques were studied to predict the transient current induced into aircraft wiring bundles as a result of an aircraft lightning strike. A series of aircraft measurements were carried out together with a theoretical analysis using computer modeling. These tests were applied to various aircraft and also to specially constructed cylinders installed within coaxial return conductor systems. Low level swept frequency CW (carrier waves), low level transient and high level transient injection tests were applied to the aircraft and cylinders. Measurements were made to determine the transfer function between the aircraft drive current and the resulting skin currents and currents induced on the internal wiring. The full threat lightning induced transient currents were extrapolated from the low level data using Fourier transform techniques. The aircraft and cylinders used were constructed from both metallic and CFC (carbon fiber composite) materials. The results show the pulse stretching phenomenon which occurs for CFC materials due to the diffusion of the lightning current through carbon fiber materials. Transmission Line Matrix modeling techniques were used to compare theoretical and measured currents.

Sharp Estimates in Ruelle Theorems for Matrix Transfer Operators

NASA Astrophysics Data System (ADS)

Campbell, J.; Latushkin, Y.

A matrix coefficient transfer operator , on the space of -sections of an m-dimensional vector bundle over n-dimensional compact manifold is considered. The spectral radius of is estimated bya; and the essential spectral radius by Here is the set of ergodic f-invariant measures, and for is the measure-theoretic entropy of f, is the largest Lyapunov exponent of the cocycle over f generated by , and is the smallest Lyapunov exponent of the differential of f.

Digital techniques for ULF wave polarization analysis

NASA Technical Reports Server (NTRS)

Arthur, C. W.

1979-01-01

Digital power spectral and wave polarization analysis are powerful techniques for studying ULF waves in the earth's magnetosphere. Four different techniques for using the spectral matrix to perform such an analysis have been presented in the literature. Three of these techniques are similar in that they require transformation of the spectral matrix to the principal axis system prior to performing the polarization analysis. The differences in the three techniques lie in the manner in which determine this transformation. A comparative study of these three techniques using both simulated and real data has shown them to be approximately equal in quality of performance. The fourth technique does not require transformation of the spectral matrix. Rather, it uses the measured spectral matrix and state vectors for a desired wave type to design a polarization detector function in the frequency domain. The design of various detector functions and their application to both simulated and real data will be presented.

Study of energy transfer mechanism from ZnO nanocrystals to Eu(3+) ions.

PubMed

Mangalam, Vivek; Pita, Kantisara; Couteau, Christophe

2016-12-01

In this work, we investigate the efficient energy transfer occurring between ZnO nanocrystals (ZnO-nc) and europium (Eu(3+)) ions embedded in a SiO2 matrix prepared using the sol-gel technique. We show that a strong red emission was observed at 614 nm when the ZnO-nc were excited using a continuous optical excitation at 325 nm. This emission is due to the radiative (5)D0 → (7)F2 de-excitation of the Eu(3+) ions and has been conclusively shown to be due to the energy transfer from the excited ZnO-nc to the Eu(3+) ions. The photoluminescence excitation spectra are also examined in this work to confirm the energy transfer from ZnO-nc to the Eu(3+) ions. Furthermore, we study various de-excitation processes from the excited ZnO-nc and their contribution to the energy transfer to Eu(3+) ions. We also report the optimum fabrication process for maximum red emission at 614 nm from the samples where we show a strong dependence on the annealing temperature and the Eu(3+) concentration in the sample. The maximum red emission is observed with 12 mol% Eu(3+) annealed at 450 °C. This work provides a better understanding of the energy transfer mechanism from ZnO-nc to Eu(3+) ions and is important for applications in photonics, especially for light emitting devices.

From dissipative dynamics to studies of heat transfer at the nanoscale: analysis of the spin-boson model.

PubMed

Boudjada, Nazim; Segal, Dvira

2014-11-26

We study in a unified manner the dissipative dynamics and the transfer of heat in the two-bath spin-boson model. We use the Bloch-Redfield (BR) formalism, valid in the very weak system-bath coupling limit, the noninteracting-blip approximation (NIBA), applicable in the nonadiabatic limit, and iterative, numerically exact path integral tools. These methodologies were originally developed for the description of the dissipative dynamics of a quantum system, and here they are applied to explore the problem of quantum energy transport in a nonequilibrium setting. Specifically, we study the weak-to-intermediate system-bath coupling regime at high temperatures kBT/ħ > ε, with ε as the characteristic frequency of the two-state system. The BR formalism and NIBA can lead to close results for the dynamics of the reduced density matrix (RDM) in a certain range of parameters. However, relatively small deviations in the RDM dynamics propagate into significant qualitative discrepancies in the transport behavior. Similarly, beyond the strict nonadiabatic limit NIBA's prediction for the heat current is qualitatively incorrect: It fails to capture the turnover behavior of the current with tunneling energy and temperature. Thus, techniques that proved meaningful for describing the RDM dynamics, to some extent even beyond their rigorous range of validity, should be used with great caution in heat transfer calculations, because qualitative-serious failures develop once parameters are mildly stretched beyond the techniques' working assumptions.

Evaluation of the applicability of the dual‐domain mass transfer model in porous media containing connected high‐conductivity channels

USGS Publications Warehouse

Liu, Gaisheng; Zheng, Chunmiao; Gorelick, Steven M.

2007-01-01

This paper evaluates the dual‐domain mass transfer (DDMT) model to represent transport processes when small‐scale high‐conductivity (K) preferential flow paths (PFPs) are present in a homogenous porous media matrix. The effects of PFPs upon solute transport were examined through detailed numerical experiments involving different realizations of PFP networks, PFP/matrix conductivity contrasts varying from 10:1 to 200:1, different magnitudes of effective conductivities, and a range of molecular diffusion coefficients. Results suggest that the DDMT model can reproduce both the near‐source peak and the downstream low‐concentration spreading observed in the embedded dendritic network when there are large conductivity contrasts between high‐K PFPs and the low‐K matrix. The accuracy of the DDMT model is also affected by the geometry of PFP networks and by the relative significance of the diffusion process in the network‐matrix system.

Time evolution of photon-pulse propagation in scattering and absorbing media: The dynamic radiative transfer system

NASA Astrophysics Data System (ADS)

Georgakopoulos, A.; Politopoulos, K.; Georgiou, E.

2018-03-01

A new dynamic-system approach to the problem of radiative transfer inside scattering and absorbing media is presented, directly based on first-hand physical principles. This method, the Dynamic Radiative Transfer System (DRTS), employs a dynamical system formality using a global sparse matrix, which characterizes the physical, optical and geometrical properties of the material-volume of interest. The new system state is generated by the above time-independent matrix, using simple matrix-vector multiplication for each subsequent time step. DRTS is capable of calculating accurately the time evolution of photon propagation in media of complex structure and shape. The flexibility of DRTS allows the integration of time-dependent sources, boundary conditions, different media and several optical phenomena like reflection and refraction in a unified and consistent way. Various examples of DRTS simulation results are presented for ultra-fast light pulse 3-D propagation, demonstrating greatly reduced computational cost and resource requirements compared to other methods.

First-order transitions and thermodynamic properties in the 2D Blume-Capel model: the transfer-matrix method revisited

NASA Astrophysics Data System (ADS)

Jung, Moonjung; Kim, Dong-Hee

2017-12-01

We investigate the first-order transition in the spin-1 two-dimensional Blume-Capel model in square lattices by revisiting the transfer-matrix method. With large strip widths increased up to the size of 18 sites, we construct the detailed phase coexistence curve which shows excellent quantitative agreement with the recent advanced Monte Carlo results. In the deep first-order area, we observe the exponential system-size scaling of the spectral gap of the transfer matrix from which linearly increasing interfacial tension is deduced with decreasing temperature. We find that the first-order signature at low temperatures is strongly pronounced with much suppressed finite-size influence in the examined thermodynamic properties of entropy, non-zero spin population, and specific heat. It turns out that the jump at the transition becomes increasingly sharp as it goes deep into the first-order area, which is in contrast to the Wang-Landau results where finite-size smoothing gets more severe at lower temperatures.

Real-Time Parameter Estimation Method Applied to a MIMO Process and its Comparison with an Offline Identification Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaplanoglu, Erkan; Safak, Koray K.; Varol, H. Selcuk

2009-01-12

An experiment based method is proposed for parameter estimation of a class of linear multivariable systems. The method was applied to a pressure-level control process. Experimental time domain input/output data was utilized in a gray-box modeling approach. Prior knowledge of the form of the system transfer function matrix elements is assumed to be known. Continuous-time system transfer function matrix parameters were estimated in real-time by the least-squares method. Simulation results of experimentally determined system transfer function matrix compare very well with the experimental results. For comparison and as an alternative to the proposed real-time estimation method, we also implemented anmore » offline identification method using artificial neural networks and obtained fairly good results. The proposed methods can be implemented conveniently on a desktop PC equipped with a data acquisition board for parameter estimation of moderately complex linear multivariable systems.« less

Puzzle Imaging: Using Large-Scale Dimensionality Reduction Algorithms for Localization

PubMed Central

Glaser, Joshua I.; Zamft, Bradley M.; Church, George M.; Kording, Konrad P.

2015-01-01

Current high-resolution imaging techniques require an intact sample that preserves spatial relationships. We here present a novel approach, “puzzle imaging,” that allows imaging a spatially scrambled sample. This technique takes many spatially disordered samples, and then pieces them back together using local properties embedded within the sample. We show that puzzle imaging can efficiently produce high-resolution images using dimensionality reduction algorithms. We demonstrate the theoretical capabilities of puzzle imaging in three biological scenarios, showing that (1) relatively precise 3-dimensional brain imaging is possible; (2) the physical structure of a neural network can often be recovered based only on the neural connectivity matrix; and (3) a chemical map could be reproduced using bacteria with chemosensitive DNA and conjugative transfer. The ability to reconstruct scrambled images promises to enable imaging based on DNA sequencing of homogenized tissue samples. PMID:26192446

Cement line staining in undecalcified thin sections of cortical bone

NASA Technical Reports Server (NTRS)

Bain, S. D.; Impeduglia, T. M.; Rubin, C. T.

1990-01-01

A technique for demonstrating cement lines in thin, undecalcified, transverse sections of cortical bone has been developed. Cortical bone samples are processed and embedded undecalcified in methyl methacrylate plastic. After sectioning at 3-5 microns, cross-sections are transferred to a glass slide and flattened for 10 min. Sections of cortical bone are stained for 20 sec free-floating in a fresh solution of 1% toluidine blue dissolved in 0.1% formic acid. The section is dehydrated in t-butyl alcohol, cleared in xylene, and mounted with Eukitt's medium. Reversal lines appear as thin, scalloped, dark blue lines against a light blue matrix, whereas bone formation arrest lines are thicker with a smooth contour. With this technique cellular detail, osteoid differentiation, and fluorochrome labels are retained. Results demonstrate the applicability of a one-step staining method for cement lines which will facilitate the assessment of bone remodeling activity in thin sections of undecalcified cortical bone.

MAPLE fabrication of thin films based on kanamycin functionalized magnetite nanoparticles with anti-pathogenic properties

NASA Astrophysics Data System (ADS)

Grumezescu, Valentina; Andronescu, Ecaterina; Holban, Alina Maria; Mogoantă, Laurenţiu; Mogoşanu, George Dan; Grumezescu, Alexandru Mihai; Stănculescu, Anca; Socol, Gabriel; Iordache, Florin; Maniu, Horia; Chifiriuc, Mariana Carmen

2015-05-01

In this study we aimed to evaluate the biocompatibility and antimicrobial activity of kanamycin functionalized 5 nm-magnetite (Fe3O4@KAN) nanoparticles thin films deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) technique. A laser deposition regime was established in order to stoichiometrically transfer Fe3O4@KAN thin films on silicone and glass substrates. Morphological and physico-chemical properties of powders and coatings were characterized by XRD, TEM, SEM, AFM and IR microscopy (IRM). Our nanostructured thin films have proved efficiency in the prevention of microbial adhesion and mature biofilms development as a result of antibiotic release in its active form. Furthermore, kanamycin functionalized nanostructures exhibit a good biocompatibility, both in vivo and in vitro, demonstrating their potential for implants application. This is the first study reporting the assessment of the in vivo biocompatibility of a magnetite-antimicrobial thin films produced by MAPLE technique.

Charge-Transfer Complexes and Photochemistry of Ozone with Ferrocene and n-Butylferrocene: A UV-vis Matrix-Isolation Study.

PubMed

Pinelo, Laura F; Kugel, Roger W; Ault, Bruce S

2015-10-15

The reactions of ozone with ferrocene (cp2Fe) and with n-butylferrocene (n-butyl cp2Fe) were studied using matrix isolation, UV-vis spectroscopy, and theoretical calculations. The codeposition of cp2Fe with O3 and of n-butyl cp2Fe with O3 into an argon matrix led to the production of 1:1 charge-transfer complexes with absorptions at 765 and 815 nm, respectively. These absorptions contribute to the green matrix color observed upon initial deposition. The charge-transfer complexes underwent photochemical reactions upon irradiation with red light (λ ≥ 600 nm). Theoretical UV-vis spectra of the charge-transfer complexes and photochemical products were calculated using TD-DFT at the B3LYP/6-311G++(d,2p) level of theory. The calculated UV-vis spectra were in good agreement with the experimental results. MO analysis of these long-wavelength transitions showed them to be n→ π* on the ozone subunit in the complex and indicated that the formation of the charge-transfer complex between ozone and cp2Fe or n-butyl cp2Fe affects how readily the π* orbital on O3 is populated when red light (λ ≥ 600 nm) is absorbed. 1:1 complexes of cp2Fe and n-butyl cp2Fe with O2 were also observed experimentally and calculated theoretically. These results support and enhance previous infrared studies of the mechanism of photooxidation of ferrocene by ozone, a reaction that has considerable significance for the formation of iron oxide thin films for a range of applications.

A Framework for Integrated Component and System Analyses of Instabilities

NASA Technical Reports Server (NTRS)

Ahuja, Vineet; Erwin, James; Arunajatesan, Srinivasan; Cattafesta, Lou; Liu, Fei

2010-01-01

Instabilities associated with fluid handling and operation in liquid rocket propulsion systems and test facilities usually manifest themselves as structural vibrations or some form of structural damage. While the source of the instability is directly related to the performance of a component such as a turbopump, valve or a flow control element, the associated pressure fluctuations as they propagate through the system have the potential to amplify and resonate with natural modes of the structural elements and components of the system. In this paper, the authors have developed an innovative multi-level approach that involves analysis at the component and systems level. The primary source of the unsteadiness is modeled with a high-fidelity hybrid RANS/LES based CFD methodology that has been previously used to study instabilities in feed systems. This high fidelity approach is used to quantify the instability and understand the physics associated with the instability. System response to the driving instability is determined through a transfer matrix approach wherein the incoming and outgoing pressure and velocity fluctuations are related through a transfer (or transmission) matrix. The coefficients of the transfer matrix for each component (i.e. valve, pipe, orifice etc.) are individually derived from the flow physics associated with the component. A demonstration case representing a test loop/test facility comprised of a network of elements is constructed with the transfer matrix approach and the amplification of modes analyzed as the instability propagates through the test loop.

Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

NASA Technical Reports Server (NTRS)

Murthy, V. R.; Shultz, Louis A.

1994-01-01

The goal of this research is to develop the transfer matrix method to treat nonlinear autonomous boundary value problems with multiple branches. The application is the complete nonlinear aeroelastic analysis of multiple-branched rotor blades. Once the development is complete, it can be incorporated into the existing transfer matrix analyses. There are several difficulties to be overcome in reaching this objective. The conventional transfer matrix method is limited in that it is applicable only to linear branch chain-like structures, but consideration of multiple branch modeling is important for bearingless rotors. Also, hingeless and bearingless rotor blade dynamic characteristics (particularly their aeroelasticity problems) are inherently nonlinear. The nonlinear equations of motion and the multiple-branched boundary value problem are treated together using a direct transfer matrix method. First, the formulation is applied to a nonlinear single-branch blade to validate the nonlinear portion of the formulation. The nonlinear system of equations is iteratively solved using a form of Newton-Raphson iteration scheme developed for differential equations of continuous systems. The formulation is then applied to determine the nonlinear steady state trim and aeroelastic stability of a rotor blade in hover with two branches at the root. A comprehensive computer program is developed and is used to obtain numerical results for the (1) free vibration, (2) nonlinearly deformed steady state, (3) free vibration about the nonlinearly deformed steady state, and (4) aeroelastic stability tasks. The numerical results obtained by the present method agree with results from other methods.

On the formulation of a minimal uncertainty model for robust control with structured uncertainty

NASA Technical Reports Server (NTRS)

Belcastro, Christine M.; Chang, B.-C.; Fischl, Robert

1991-01-01

In the design and analysis of robust control systems for uncertain plants, representing the system transfer matrix in the form of what has come to be termed an M-delta model has become widely accepted and applied in the robust control literature. The M represents a transfer function matrix M(s) of the nominal closed loop system, and the delta represents an uncertainty matrix acting on M(s). The nominal closed loop system M(s) results from closing the feedback control system, K(s), around a nominal plant interconnection structure P(s). The uncertainty can arise from various sources, such as structured uncertainty from parameter variations or multiple unsaturated uncertainties from unmodeled dynamics and other neglected phenomena. In general, delta is a block diagonal matrix, but for real parameter variations delta is a diagonal matrix of real elements. Conceptually, the M-delta structure can always be formed for any linear interconnection of inputs, outputs, transfer functions, parameter variations, and perturbations. However, very little of the currently available literature addresses computational methods for obtaining this structure, and none of this literature addresses a general methodology for obtaining a minimal M-delta model for a wide class of uncertainty, where the term minimal refers to the dimension of the delta matrix. Since having a minimally dimensioned delta matrix would improve the efficiency of structured singular value (or multivariable stability margin) computations, a method of obtaining a minimal M-delta would be useful. Hence, a method of obtaining the interconnection system P(s) is required. A generalized procedure for obtaining a minimal P-delta structure for systems with real parameter variations is presented. Using this model, the minimal M-delta model can then be easily obtained by closing the feedback loop. The procedure involves representing the system in a cascade-form state-space realization, determining the minimal uncertainty matrix, delta, and constructing the state-space representation of P(s). Three examples are presented to illustrate the procedure.

Heat transfer and flow friction correlations for perforated plate matrix heat exchangers

NASA Astrophysics Data System (ADS)

Ratna Raju, L.; Kumar, S. Sunil; Chowdhury, K.; Nandi, T. K.

2017-02-01

Perforated plate matrix heat exchangers (MHE) are constructed of high conductivity perforated plates stacked alternately with low conductivity spacers. They are being increasingly used in many cryogenic applications including Claude cycle or Reversed Brayton cycle cryo-refrigerators and liquefiers. Design of high NTU (number of (heat) transfer unit) cryogenic MHEs requires accurate heat transfer coefficient and flow friction factor. Thermo-hydraulic behaviour of perforated plates strongly depends on the geometrical parameters. Existing correlations, however, are mostly expressed as functions of Reynolds number only. This causes, for a given configuration, significant variations in coefficients from one correlation to the other. In this paper we present heat transfer and flow friction correlations as functions of all geometrical and other controlling variables. A FluentTM based numerical model has been developed for heat transfer and pressure drop studies over a stack of alternately arranged perforated plates and spacers. The model is validated with the data from literature. Generalized correlations are obtained through regression analysis over a large number of computed data.

Heat Transfer and Fluid Transport of Supercritical CO 2 in Enhanced Geothermal System with Local Thermal Non-equilibrium Model

DOE PAGES

Zhang, Le; Luo, Feng; Xu, Ruina; ...

2014-12-31

The heat transfer and fluid transport of supercritical CO 2 in enhanced geothermal system (EGS) is studied numerically with local thermal non-equilibrium model, which accounts for the temperature difference between solid matrix and fluid components in porous media and uses two energy equations to describe heat transfer in the solid matrix and in the fluid, respectively. As compared with the previous results of our research group, the effect of local thermal non-equilibrium mainly depends on the volumetric heat transfer coefficient ah, which has a significant effect on the production temperature at reservoir outlet and thermal breakthrough time. The uniformity ofmore » volumetric heat transfer coefficient ah has little influence on the thermal breakthrough time, but the temperature difference become more obvious with time after thermal breakthrough with this simulation model. The thermal breakthrough time reduces and the effect of local thermal non-equilibrium becomes significant with decreasing ah.« less

Integration of living cells into nanostructures using non-conventional self-assembly

NASA Astrophysics Data System (ADS)

Carnes, Eric C.

Patternable cell immobilization is an essential feature of any solid-state device designed for interrogating or exploiting living cells. Immobilized cells must remain viable in a robust matrix that promotes fluidic connectivity between the cells and their environment while retaining the ability to establish and maintain necessary chemical gradients. A suitable inorganic matrix can be constructed via evaporation-induced self-assembly of nanostructured silica, in which phospholipids are used in place of traditional surfactant structure-directing agents in order to enhance cell viability and to create a coherent interface between the cell and the surrounding three-dimensional nanostructure. We have used this technique to develop two distinct cell encapsulation processes: cell-directed assembly and cell-directed integration. Cell-directed assembly is a one-step procedure that provides superior viability of immobilized cells by encouraging cells to interact with the developing host matrix. Limitations of this system include low viability for some cell types due to exposure to solvents and stresses, as well as a lack of control over the developing host nanostructure. Cell-directed integration addresses these shortcomings by introducing a two-step process in which cells become encapsulated in a pre-formed silica matrix. The validity of each encapsulation method has been demonstrated with Gram-positive and Gram-negative bacteria, yeast, and mammalian cells. The ability of the immobilized cells to establish relevant gradients of ions or signaling molecules, a key feature of these systems, has been characterized. Additionally, extension of cell encapsulation to address lingering questions in cell biology is addressed. We have also adapted these immobilization processes to be compatible with a variety of patterning strategies having tailorable properties. Widely available photolithography techniques, as well as direct aerosol deposition, have been adapted to provide methods for obtaining both positive and negative transfer of desired cell patterns. Multi-step lithography is also used to create a highly functional system allowing spatial control of not only cells but also media and other molecules of interest.

Diffusive transfer to membranes as an effective interface between gel electrophoresis and mass spectrometry

NASA Astrophysics Data System (ADS)

Ogorzalek Loo, Rachel R.; Mitchell, Charles; Stevenson, Tracy I.; Loo, Joseph A.; Andrews, Philip C.

1997-12-01

Diffusive transfer was examined as a blotting method to transfer proteins from polyacrylamide gels to membranes for ultraviolet matrix-assisted laser desorption ionization (MALDI) mass spectrometry. The method is well-suited for transfers from isoelectric focusing (IEF) gels. Spectra have been obtained for 11 pmol of 66 kDa albumin loaded onto an IEF gel and subsequently blotted to polyethylene. Similarly, masses of intact carbonic anhydrase and hemoglobin were obtained from 14 and 20 pmol loadings. This methodology is also compatible with blotting high molecular weight proteins, as seen for 6 pmol of the 150 kDa monoclonal antibody anti-[beta]-galactosidase transferred to Goretex. Polypropylene, Teflon, Nafion and polyvinylidene difluoride (PVDF) also produced good spectra following diffusive transfer. Only analysis from PVDF required that the membrane be kept wet prior to application of matrix. Considerations in mass accuracy for analysis from large-area membranes with continuous extraction and delayed extraction were explored, as were remedies for surface charging. Vapor phase CNBr cleavage was applied to membrane-bound samples for peptide mapping.

Optical information processing at NASA Ames Research Center

NASA Technical Reports Server (NTRS)

Reid, Max B.; Bualat, Maria G.; Cho, Young C.; Downie, John D.; Gary, Charles K.; Ma, Paul W.; Ozcan, Meric; Pryor, Anna H.; Spirkovska, Lilly

1993-01-01

The combination of analog optical processors with digital electronic systems offers the potential of tera-OPS computational performance, while often requiring less power and weight relative to all-digital systems. NASA is working to develop and demonstrate optical processing techniques for on-board, real time science and mission applications. Current research areas and applications under investigation include optical matrix processing for space structure vibration control and the analysis of Space Shuttle Main Engine plume spectra, optical correlation-based autonomous vision for robotic vehicles, analog computation for robotic path planning, free-space optical interconnections for information transfer within digital electronic computers, and multiplexed arrays of fiber optic interferometric sensors for acoustic and vibration measurements.

Electron scattering by highly polar molecules. III - CsCl

NASA Technical Reports Server (NTRS)

Vuskovic, L.; Srivastava, S. K.

1981-01-01

Utilizing a crossed electron-beam-molecular-beam scattering geometry, relative values of differential electron scattering cross sections for cesium chloride at 5 and 20 eV electron impact energies and at scattering angles between 10 and 120 deg have been measured. These relative cross sections have been normalized to the cross section at 15 deg scattering angle calculated by the hybrid S-matrix technique. In the angular range between 0 and 10 deg and between 120 and 180 deg extrapolations have been made to obtain integral and momentum transfer cross sections. An energy-loss spectrum is also presented which gives various spectral features lying between the 4 and 10 eV regions in CsCl.

Residual strain gradient determination in metal matrix composites by synchrotron X-ray energy dispersive diffraction

NASA Technical Reports Server (NTRS)

Kuntz, Todd A.; Wadley, Haydn N. G.; Black, David R.

1993-01-01

An X-ray technique for the measurement of internal residual strain gradients near the continuous reinforcements of metal matrix composites has been investigated. The technique utilizes high intensity white X-ray radiation from a synchrotron radiation source to obtain energy spectra from small (0.001 cu mm) volumes deep within composite samples. The viability of the technique was tested using a model system with 800 micron Al203 fibers and a commercial purity titanium matrix. Good agreement was observed between the measured residual radial and hoop strain gradients and those estimated from a simple elastic concentric cylinders model. The technique was then used to assess the strains near (SCS-6) silicon carbide fibers in a Ti-14Al-21Nb matrix after consolidation processing. Reasonable agreement between measured and calculated strains was seen provided the probe volume was located 50 microns or more from the fiber/matrix interface.

Stress transfer around a broken fiber in unidirectional fiber-reinforced composites considering matrix damage evolution and interface slipping

NASA Astrophysics Data System (ADS)

Yang, Zhong; Zhang, BoMing; Zhao, Lin; Sun, XinYang

2011-02-01

A shear-lag model is applied to study the stress transfer around a broken fiber within unidirectional fiber-reinforced composites (FRC) subjected to uniaxial tensile loading along the fiber direction. The matrix damage and interfacial debonding, which are the main failure modes, are considered in the model. The maximum stress criterion with the linear damage evolution theory is used for the matrix. The slipping friction stress is considered in the interfacial debonding region using Coulomb friction theory, in which interfacial clamping stress comes from radial residual stress and mismatch of Poisson's ratios of constituents (fiber and matrix). The stress distributions in the fiber and matrix are obtained by the shear-lag theory added with boundary conditions, which includes force continuity and displacement compatibility constraints in the broken and neighboring intact fibers. The result gives axial stress distribution in fibers and shear stress in the interface and compares the theory reasonably well with the measurement by a polarized light microscope. The relation curves between damage, debonding and ineffective region lengths with external strain loading are obtained.

Exact Dynamics via Poisson Process: a unifying Monte Carlo paradigm

NASA Astrophysics Data System (ADS)

Gubernatis, James

2014-03-01

A common computational task is solving a set of ordinary differential equations (o.d.e.'s). A little known theorem says that the solution of any set of o.d.e.'s is exactly solved by the expectation value over a set of arbitary Poisson processes of a particular function of the elements of the matrix that defines the o.d.e.'s. The theorem thus provides a new starting point to develop real and imaginary-time continous-time solvers for quantum Monte Carlo algorithms, and several simple observations enable various quantum Monte Carlo techniques and variance reduction methods to transfer to a new context. I will state the theorem, note a transformation to a very simple computational scheme, and illustrate the use of some techniques from the directed-loop algorithm in context of the wavefunction Monte Carlo method that is used to solve the Lindblad master equation for the dynamics of open quantum systems. I will end by noting that as the theorem does not depend on the source of the o.d.e.'s coming from quantum mechanics, it also enables the transfer of continuous-time methods from quantum Monte Carlo to the simulation of various classical equations of motion heretofore only solved deterministically.

Investigation of a broadband coherent perfect absorber in a multi-layer structure by using the transfer matrix method

NASA Astrophysics Data System (ADS)

Na, Jihoon; Noh, Heeso

2018-01-01

We investigated a multi-layer structure for a broadband coherent perfect absorber (CPA). The transfer matrix method (TMM) is useful for analyzing the optical properties of structures and optimizing multi-layer structures. The broadband CPA strongly depends on the phase of the light traveling in one direction and the light reflected within the structure. The TMM simulation shows that the absorption bandwidth is increased by 95% in a multi-layer CPA compared to that in a single-layer CPA.

Development of RWHet to Simulate Contaminant Transport in Fractured Porous Media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yong; LaBolle, Eric; Reeves, Donald M

2012-07-01

Accurate simulation of matrix diffusion in regional-scale dual-porosity and dual-permeability media is a critical issue for the DOE Underground Test Area (UGTA) program, given the prevalence of fractured geologic media on the Nevada National Security Site (NNSS). Contaminant transport through regional-scale fractured media is typically quantified by particle-tracking based Lagrangian solvers through the inclusion of dual-domain mass transfer algorithms that probabilistically determine particle transfer between fractures and unfractured matrix blocks. UGTA applications include a wide variety of fracture aperture and spacing, effective diffusion coefficients ranging four orders of magnitude, and extreme end member retardation values. This report incorporates the currentmore » dual-domain mass transfer algorithms into the well-known particle tracking code RWHet [LaBolle, 2006], and then tests and evaluates the updated code. We also develop and test a direct numerical simulation (DNS) approach to replace the classical transfer probability method in characterizing particle dynamics across the fracture/matrix interface. The final goal of this work is to implement the algorithm identified as most efficient and effective into RWHet, so that an accurate and computationally efficient software suite can be built for dual-porosity/dual-permeability applications. RWHet is a mature Lagrangian transport simulator with a substantial user-base that has undergone significant development and model validation. In this report, we also substantially tested the capability of RWHet in simulating passive and reactive tracer transport through regional-scale, heterogeneous media. Four dual-domain mass transfer methodologies were considered in this work. We first developed the empirical transfer probability approach proposed by Liu et al. [2000], and coded it into RWHet. The particle transfer probability from one continuum to the other is proportional to the ratio of the mass entering the other continuum to the mass in the current continuum. Numerical examples show that this method is limited to certain ranges of parameters, due to an intrinsic assumption of an equilibrium concentration profile in the matrix blocks in building the transfer probability. Subsequently, this method fails in describing mass transfer for parameter combinations that violate this assumption, including small diffusion coefficients (i.e., the free-water molecular diffusion coefficient 1×10-11 meter2/second), relatively large fracture spacings (such as meter), and/or relatively large matrix retardation coefficients (i.e., ). These “outliers” in parameter range are common in UGTA applications. To address the above limitations, we then developed a Direct Numerical Simulation (DNS)-Reflective method. The novel DNS-Reflective method can directly track the particle dynamics across the fracture/matrix interface using a random walk, without any empirical assumptions. This advantage should make the DNS-Reflective method feasible for a wide range of parameters. Numerical tests of the DNS-Reflective, however, show that the method is computationally very demanding, since the time step must be very small to resolve particle transfer between fractures and matrix blocks. To improve the computational efficiency of the DNS approach, we then adopted Roubinet et al.’s method [2009], which uses first passage time distributions to simulate dual-domain mass transfer. The DNS-Roubinet method was found to be computationally more efficient than the DNS-Reflective method. It matches the analytical solution for the whole range of major parameters (including diffusion coefficient and fracture aperture values that are considered “outliers” for Liu et al.’s transfer probability method [2000]) for a single fracture system. The DNS-Roubinet method, however, has its own disadvantage: for a parallel fracture system, the truncation of the first passage time distribution creates apparent errors when the fracture spacing is small, and thus it tends to erroneously predict breakthrough curves (BTCs) for the parallel fracture system. Finally, we adopted the transient range approach proposed by Pan and Bodvarsson [2002] in RWHet. In this method, particle transfer between fractures and matrix blocks can be resolved without using very small time steps. It does not use any truncation of the first passage time distribution for particles. Hence it does not have the limitation identified above for the DNS-Reflective method and the DNS-Roubinet method. Numerical results were checked against analytical solutions, and also compared to DCPTV2.0 [Pan, 2002]. This version of RWHet (called RWHet-Pan&Bodvarsson in this report) can accurately capture contaminant transport in fractured porous media for a full range of parameters without any practical or theoretical limitations.« less

Matrix Perturbation Techniques in Structural Dynamics

NASA Technical Reports Server (NTRS)

Caughey, T. K.

1973-01-01

Matrix perturbation are developed techniques which can be used in the dynamical analysis of structures where the range of numerical values in the matrices extreme or where the nature of the damping matrix requires that complex valued eigenvalues and eigenvectors be used. The techniques can be advantageously used in a variety of fields such as earthquake engineering, ocean engineering, aerospace engineering and other fields concerned with the dynamical analysis of large complex structures or systems of second order differential equations. A number of simple examples are included to illustrate the techniques.

Synthesis of capped TiO2 nanocrystals of controlled shape and their use with MEH-PPV conjugated polymer to develop nanocomposite films for photovoltaic applications

NASA Astrophysics Data System (ADS)

Mighri, F.; Duong, Vu Thi Thuy; On, Do Trong; Ajji, A.

2014-05-01

This study presents the synthesis details of titanium dioxide (TiO2) nanoparticles (NPs) of different shapes (nanospheres, nanorods and nanorhombics) using oleic acid (OA) and oleyl amine (OM) as capping agents. In order to develop nanocomposite thin films for photovoltaic cells, these TiO2 NPs were carefully dispersed in 2-methoxy-5-(2'-ethylhexyloxy)-p-phenylene vinylene (MEH-PPV) matrix. The properties of synthesized TiO2 NPs and MEH-PPV/TiO2 nanocomposites were characterized using transmission electron microscopy (TEM), thermogravimetric analysis (TGA), UV-Visible spectroscopy, and Photoluminescence technique. It was found that the shape of NPs and the amount of OA and OM surfactants capped on their surface have an effect on their energy bandgap and also on the dispersion quality of MEH-PPV/TiO2 nanocomposites. Even though there was no evidence of chemical bonding between MEH-PPV matrix and TiO2 dispersed NPs, MEH-PPV/TiO2 nanocomposites showed very promising results for light absorption properties and charge transfer at the interface of the conjugated MEH-PPV matrix and TiO2 dispersed NPs, which are two main characteristics for photovoltaic materials.

Swelling-induced optical anisotropy of thermoresponsive hydrogels based on poly(2-(2-methoxyethoxy)ethyl methacrylate): deswelling kinetics probed by quantitative Mueller matrix polarimetry.

PubMed

Patil, Nagaraj; Soni, Jalpa; Ghosh, Nirmalya; De, Priyadarsi

2012-11-29

Thermodynamically favored polymer-water interactions below the lower critical solution temperature (LCST) caused swelling-induced optical anisotropy (linear retardance) of thermoresponsive hydrogels based on poly(2-(2-methoxyethoxy)ethyl methacrylate). This was exploited to study the macroscopic deswelling kinetics quantitatively by a generalized polarimetry analysis method, based on measurement of the Mueller matrix and its subsequent inverse analysis via the polar decomposition approach. The derived medium polarization parameters, namely, linear retardance (δ), diattenuation (d), and depolarization coefficient (Δ), of the hydrogels showed interesting differences between the gels prepared by conventional free radical polymerization (FRP) and reversible addition-fragmentation chain transfer polymerization (RAFT) and also between dry and swollen state. The effect of temperature, cross-linking density, and polymerization technique employed to synthesize hydrogel on deswelling kinetics was systematically studied via conventional gravimetry and corroborated further with the corresponding Mueller matrix derived quantitative polarimetry characteristics (δ, d, and Δ). The RAFT gels exhibited higher swelling ratio and swelling-induced optical anisotropy compared to FRP gels and also deswelled faster at 30 °C. On the contrary, at 45 °C, deswelling was significantly retarded for the RAFT gels due to formation of a skin layer, which was confirmed and quantified via the enhanced diattenuation and depolarization parameters.

Determination of poles and zeros of transfer functions for flexible spacecraft attitude control

NASA Technical Reports Server (NTRS)

Ohkami, Y.; Likins, P. W.

1976-01-01

The transfer function matrix is obtained for a three-input and three-output model of minimum sensors and actuators for the attitude control system of flexible spacecraft, and a method is described for determining the poles and zeros of this transfer function. Three cases are considered: (1) the actuators and the sensors are all attached to the primary body, (2) the actuators are on the primary body and the sensors are on the sub-body, and (3) the actuators are on the sub-body and the sensors are on the primary body. The zero-determination problem is shown to reduce to eigenvalue calculations of a matrix which is constructed from the inertial and modal matrices in a simple fashion.

Transfer matrix approach for the Kerr and Faraday rotation in layered nanostructures.

PubMed

Széchenyi, Gábor; Vigh, Máté; Kormányos, Andor; Cserti, József

2016-09-21

To study the optical rotation of the polarization of light incident on multilayer systems consisting of atomically thin conductors and dielectric multilayers we present a general method based on transfer matrices. The transfer matrix of the atomically thin conducting layer is obtained using the Maxwell equations. We derive expressions for the Kerr (Faraday) rotation angle and for the ellipticity of the reflected (transmitted) light as a function of the incident angle and polarization of the light. The method is demonstrated by calculating the Kerr (Faraday) angle for bilayer graphene in the quantum anomalous Hall state placed on the top of dielectric multilayers. The optical conductivity of the bilayer graphene is calculated in the framework of a four-band model.

Investigation of interfacial shear strength in a SiC fibre/Ti-24Al-11Nb composite by a fibre push-out technique

NASA Technical Reports Server (NTRS)

Eldridge, J. I.; Brindley, P. K.

1989-01-01

A fiber push-out technique applied at several sample thicknesses was used to determine both the debond shear stress and the frictional shear stress at the fiber-matrix interface at room temperautre for a unidirectional SiC fiber-reinforced T-24Al-11Nb (in at. pct) composite prepared by a powder cloth technique. The push-out technique measures the separate contributions of bond strength and friction to the mechanical shear strength at the fiber-matrix interface. It was found that the fiber-matrix bond shear strength of this material is significantly higher than the fiber-matrix frictional shear stress (119.2 and 47.8 MPa, respectively).

[A cost-benefit analysis of a Mexican food-support program].

PubMed

Ventura-Alfaro, Carmelita E; Gutiérrez-Reyes, Juan P; Bertozzi-Kenefick, Stefano M; Caldés-Gómez, Natalia

2011-06-01

Objective Presenting an estimate of a Mexican food-support program (FSP) program's cost transfer ratio (CTR) from start-up (2003) to May 2005. Methods The program's activities were listed by constructing a time allocation matrix to ascertain how much time was spent on each of the program's activities by the personnel so involved. Another cost matrix was also constructed which was completed with information from the program's accountancy records. The program's total cost, activity cost and the value of given FSP transfers were thus estimated. Results Food delivery CRT for 2003, 2004 and 2005 was 0.150, 0.218, 0.230, respectively; cash CTR was 0.132in 2004 and 0.105 in 2005. Conclusion Comparing CTR values according to transfer type is a good way to promote discussion related to this topic; however, the decision for making a transfer does not depend exclusively on efficiency but on both mechanisms' effectiveness.

The application of nonlinear programming and collocation to optimal aeroassisted orbital transfers

NASA Astrophysics Data System (ADS)

Shi, Y. Y.; Nelson, R. L.; Young, D. H.; Gill, P. E.; Murray, W.; Saunders, M. A.

1992-01-01

Sequential quadratic programming (SQP) and collocation of the differential equations of motion were applied to optimal aeroassisted orbital transfers. The Optimal Trajectory by Implicit Simulation (OTIS) computer program codes with updated nonlinear programming code (NZSOL) were used as a testbed for the SQP nonlinear programming (NLP) algorithms. The state-of-the-art sparse SQP method is considered to be effective for solving large problems with a sparse matrix. Sparse optimizers are characterized in terms of memory requirements and computational efficiency. For the OTIS problems, less than 10 percent of the Jacobian matrix elements are nonzero. The SQP method encompasses two phases: finding an initial feasible point by minimizing the sum of infeasibilities and minimizing the quadratic objective function within the feasible region. The orbital transfer problem under consideration involves the transfer from a high energy orbit to a low energy orbit.

Deformed quantum double realization of the toric code and beyond

NASA Astrophysics Data System (ADS)

Padmanabhan, Pramod; Ibieta-Jimenez, Juan Pablo; Bernabe Ferreira, Miguel Jorge; Teotonio-Sobrinho, Paulo

2016-09-01

Quantum double models, such as the toric code, can be constructed from transfer matrices of lattice gauge theories with discrete gauge groups and parametrized by the center of the gauge group algebra and its dual. For general choices of these parameters the transfer matrix contains operators acting on links which can also be thought of as perturbations to the quantum double model driving it out of its topological phase and destroying the exact solvability of the quantum double model. We modify these transfer matrices with perturbations and extract exactly solvable models which remain in a quantum phase, thus nullifying the effect of the perturbation. The algebra of the modified vertex and plaquette operators now obey a deformed version of the quantum double algebra. The Abelian cases are shown to be in the quantum double phase whereas the non-Abelian phases are shown to be in a modified phase of the corresponding quantum double phase. These are illustrated with the groups Zn and S3. The quantum phases are determined by studying the excitations of these systems namely their fusion rules and the statistics. We then go further to construct a transfer matrix which contains the other Z2 phase namely the double semion phase. More generally for other discrete groups these transfer matrices contain the twisted quantum double models. These transfer matrices can be thought of as being obtained by introducing extra parameters into the transfer matrix of lattice gauge theories. These parameters are central elements belonging to the tensor products of the algebra and its dual and are associated to vertices and volumes of the three dimensional lattice. As in the case of the lattice gauge theories we construct the operators creating the excitations in this case and study their braiding and fusion properties.

Metal Matrix Composites: Fatigue and Fracture Testing. (Latest citations from the Aerospace Database)

NASA Technical Reports Server (NTRS)

1996-01-01

The bibliography contains citations concerning techniques and results of testing metal matrix composites for fatigue and fracture. Methods include non-destructive testing techniques, and static and cyclic techniques for assessing compression, tensile, bending, and impact characteristics.

Experimental estimation of migration and transfer of organic substances from consumer articles to cotton wipes: Evaluation of underlying mechanisms.

PubMed

Clausen, Per Axel; Spaan, Suzanne; Brouwer, Derk H; Marquart, Hans; le Feber, Maaike; Engel, Roel; Geerts, Lieve; Jensen, Keld Alstrup; Kofoed-Sørensen, Vivi; Hansen, Brian; De Brouwere, Katleen

2016-01-01

The aim of this work was to identify the key mechanisms governing transport of organic chemical substances from consumer articles to cotton wipes. The results were used to establish a mechanistic model to improve assessment of dermal contact exposure. Four types of PVC flooring, 10 types of textiles and one type of inkjet printed paper were used to establish the mechanisms and model. Kinetic extraction studies in methanol demonstrated existence of matrix diffusion and indicated the presence of a substance surface layer on some articles. Consequently, the proposed substance transfer model considers mechanical transport from a surface film and matrix diffusion in an article with a known initial total substance concentration. The estimated chemical substance transfer values to cotton wipes were comparable to the literature data (relative transfer ∼ 2%), whereas relative transfer efficiencies from spiked substrates were high (∼ 50%). For consumer articles, high correlation (r(2)=0.92) was observed between predicted and measured transfer efficiencies, but concentrations were overpredicted by a factor of 10. Adjusting the relative transfer from about 50% used in the model to about 2.5% removed overprediction. Further studies are required to confirm the model for generic use.

Frequency domain system identification of helicopter rotor dynamics incorporating models with time periodic coefficients

NASA Astrophysics Data System (ADS)

Hwang, Sunghwan

1997-08-01

One of the most prominent features of helicopter rotor dynamics in forward flight is the periodic coefficients in the equations of motion introduced by the rotor rotation. The frequency response characteristics of such a linear time periodic system exhibits sideband behavior, which is not the case for linear time invariant systems. Therefore, a frequency domain identification methodology for linear systems with time periodic coefficients was developed, because the linear time invariant theory cannot account for sideband behavior. The modulated complex Fourier series was introduced to eliminate the smearing effect of Fourier series expansions of exponentially modulated periodic signals. A system identification theory was then developed using modulated complex Fourier series expansion. Correlation and spectral density functions were derived using the modulated complex Fourier series expansion for linear time periodic systems. Expressions of the identified harmonic transfer function were then formulated using the spectral density functions both with and without additive noise processes at input and/or output. A procedure was developed to identify parameters of a model to match the frequency response characteristics between measured and estimated harmonic transfer functions by minimizing an objective function defined in terms of the trace of the squared frequency response error matrix. Feasibility was demonstrated by the identification of the harmonic transfer function and parameters for helicopter rigid blade flapping dynamics in forward flight. This technique is envisioned to satisfy the needs of system identification in the rotating frame, especially in the context of individual blade control. The technique was applied to the coupled flap-lag-inflow dynamics of a rigid blade excited by an active pitch link. The linear time periodic technique results were compared with the linear time invariant technique results. Also, the effect of noise processes and initial parameter guess on the identification procedure were investigated. To study the effect of elastic modes, a rigid blade with a trailing edge flap excited by a smart actuator was selected and system parameters were successfully identified, but with some expense of computational storage and time. Conclusively, the linear time periodic technique substantially improved the identified parameter accuracy compared to the linear time invariant technique. Also, the linear time periodic technique was robust to noises and initial guess of parameters. However, an elastic mode of higher frequency relative to the system pumping frequency tends to increase the computer storage requirement and computing time.

Transport Phenomena in Fluid Dynamics: Matrix Heat Exchangers and Their Applications in Energy Systems

DTIC Science & Technology

2009-07-01

presented a summary of recent research on boiling in microchannels . He addressed the topics of macro scale versus micro scale heat transfer , two phase...flow regime, flow boiling 14 heat transfer results for microchannels , heat transfer mechanisms in microchannels , and flow boiling models for... Heat Transfer Boiling In Minichannel And Microchannel Flow Passages Of Compact Evaporators, Keynote Lecture Presented at the Engineering Foundation

Dwell time algorithm based on the optimization theory for magnetorheological finishing

NASA Astrophysics Data System (ADS)

Zhang, Yunfei; Wang, Yang; Wang, Yajun; He, Jianguo; Ji, Fang; Huang, Wen

2010-10-01

Magnetorheological finishing (MRF) is an advanced polishing technique capable of rapidly converging to the required surface figure. This process can deterministically control the amount of the material removed by varying a time to dwell at each particular position on the workpiece surface. The dwell time algorithm is one of the most important key techniques of the MRF. A dwell time algorithm based on the1 matrix equation and optimization theory was presented in this paper. The conventional mathematical model of the dwell time was transferred to a matrix equation containing initial surface error, removal function and dwell time function. The dwell time to be calculated was just the solution to the large, sparse matrix equation. A new mathematical model of the dwell time based on the optimization theory was established, which aims to minimize the 2-norm or ∞-norm of the residual surface error. The solution meets almost all the requirements of precise computer numerical control (CNC) without any need for extra data processing, because this optimization model has taken some polishing condition as the constraints. Practical approaches to finding a minimal least-squares solution and a minimal maximum solution are also discussed in this paper. Simulations have shown that the proposed algorithm is numerically robust and reliable. With this algorithm an experiment has been performed on the MRF machine developed by ourselves. After 4.7 minutes' polishing, the figure error of a flat workpiece with a 50 mm diameter is improved by PV from 0.191λ(λ = 632.8 nm) to 0.087λ and RMS 0.041λ to 0.010λ. This algorithm can be constructed to polish workpieces of all shapes including flats, spheres, aspheres, and prisms, and it is capable of improving the polishing figures dramatically.

Wave propagation through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces.

PubMed

Jiao, Fengyu; Wei, Peijun; Li, Yueqiu

2018-01-01

Reflection and transmission of plane waves through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces are studied in this paper. The secular equations in the flexoelectric piezoelectric material are first derived from the general governing equation. Different from the classical piezoelectric medium, there are five kinds of coupled elastic waves in the piezoelectric material with the microstructure effects taken into consideration. The state vectors are obtained by the summation of contributions from all possible partial waves. The state transfer equation of flexoelectric piezoelectric slab is derived from the motion equation by the reduction of order, and the transfer matrix of flexoelectric piezoelectric slab is obtained by solving the state transfer equation. By using the continuous conditions at the interface and the approach of partition matrix, we get the resultant algebraic equations in term of the transfer matrix from which the reflection and transmission coefficients can be calculated. The amplitude ratios and further the energy flux ratios of various waves are evaluated numerically. The numerical results are shown graphically and are validated by the energy conservation law. Based on these numerical results, the influences of two characteristic lengths of microstructure and the flexoelectric coefficients on the wave propagation are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

Multi-GPU implementation of a VMAT treatment plan optimization algorithm.

PubMed

Tian, Zhen; Peng, Fei; Folkerts, Michael; Tan, Jun; Jia, Xun; Jiang, Steve B

2015-06-01

Volumetric modulated arc therapy (VMAT) optimization is a computationally challenging problem due to its large data size, high degrees of freedom, and many hardware constraints. High-performance graphics processing units (GPUs) have been used to speed up the computations. However, GPU's relatively small memory size cannot handle cases with a large dose-deposition coefficient (DDC) matrix in cases of, e.g., those with a large target size, multiple targets, multiple arcs, and/or small beamlet size. The main purpose of this paper is to report an implementation of a column-generation-based VMAT algorithm, previously developed in the authors' group, on a multi-GPU platform to solve the memory limitation problem. While the column-generation-based VMAT algorithm has been previously developed, the GPU implementation details have not been reported. Hence, another purpose is to present detailed techniques employed for GPU implementation. The authors also would like to utilize this particular problem as an example problem to study the feasibility of using a multi-GPU platform to solve large-scale problems in medical physics. The column-generation approach generates VMAT apertures sequentially by solving a pricing problem (PP) and a master problem (MP) iteratively. In the authors' method, the sparse DDC matrix is first stored on a CPU in coordinate list format (COO). On the GPU side, this matrix is split into four submatrices according to beam angles, which are stored on four GPUs in compressed sparse row format. Computation of beamlet price, the first step in PP, is accomplished using multi-GPUs. A fast inter-GPU data transfer scheme is accomplished using peer-to-peer access. The remaining steps of PP and MP problems are implemented on CPU or a single GPU due to their modest problem scale and computational loads. Barzilai and Borwein algorithm with a subspace step scheme is adopted here to solve the MP problem. A head and neck (H&N) cancer case is then used to validate the authors' method. The authors also compare their multi-GPU implementation with three different single GPU implementation strategies, i.e., truncating DDC matrix (S1), repeatedly transferring DDC matrix between CPU and GPU (S2), and porting computations involving DDC matrix to CPU (S3), in terms of both plan quality and computational efficiency. Two more H&N patient cases and three prostate cases are used to demonstrate the advantages of the authors' method. The authors' multi-GPU implementation can finish the optimization process within ∼ 1 min for the H&N patient case. S1 leads to an inferior plan quality although its total time was 10 s shorter than the multi-GPU implementation due to the reduced matrix size. S2 and S3 yield the same plan quality as the multi-GPU implementation but take ∼4 and ∼6 min, respectively. High computational efficiency was consistently achieved for the other five patient cases tested, with VMAT plans of clinically acceptable quality obtained within 23-46 s. Conversely, to obtain clinically comparable or acceptable plans for all six of these VMAT cases that the authors have tested in this paper, the optimization time needed in a commercial TPS system on CPU was found to be in an order of several minutes. The results demonstrate that the multi-GPU implementation of the authors' column-generation-based VMAT optimization can handle the large-scale VMAT optimization problem efficiently without sacrificing plan quality. The authors' study may serve as an example to shed some light on other large-scale medical physics problems that require multi-GPU techniques.

A case study of energy transfer mechanism from uranium to europium in ZnAl2O4 spinel host by photoluminescence spectroscopy

NASA Astrophysics Data System (ADS)

Kumar, Mithlesh; Mohapatra, M.

2016-04-01

Zinc aluminate (ZAO), a member of spinel class of inorganic compounds has been of much interest of late due to its wide range of use in catalysis, optical, electronic and ceramic industries. When doped with several lanthanides, this material has proved to be a potential host matrix for phosphors. As lanthanides suffer from poor (direct) excitation and emission cross sections, the use of a co-dopant ion can help to circumvent this and extract better emission from a lanthanide doped ZAO system. In this connection, energy transfer mechanism from uranium to europium in the ZAO host was investigated by photoluminescence spectroscopic technique. It was seen that uranium gets stabilized in the hexavalent state as UO66 - (octahedral uranate) where as the lanthanide ion, Eu is stabilized in its trivalent state in the ZAO host. In the co-doped system, an efficient energy transfer pathway from the uranate to europium ion was observed. Based upon emission and life time data a suitable mechanism was proposed for the energy transfer (quenching) process. It was proposed that after excitation by photons, the uranate ions transfer their energy to nearby 5D1 level of Eu3 + ions which non-radiatively de-excites to the corresponding lower levels of 5D0. Further this 5D0 level decays in a radiative mode to the 7F manifold giving the characteristic emission profile of trivalent Eu. It was proposed that both static and dynamic types of energy transfer mechanism were responsible for this process.

The influence of electric charge transferred during electro-mechanical reshaping on mechanical behavior of cartilage

NASA Astrophysics Data System (ADS)

Protsenko, Dimitry E.; Lim, Amanda; Wu, Edward C.; Manuel, Cyrus; Wong, Brian J. F.

2011-03-01

Electromechanical reshaping (EMR) of cartilage has been suggested as an alternative to the classical surgical techniques of modifying the shape of facial cartilages. The method is based on exposure of mechanically deformed cartilaginous tissue to a low level electric field. Electro-chemical reactions within the tissue lead to reduction of internal stress, and establishment of a new equilibrium shape. The same reactions offset the electric charge balance between collagen and proteoglycan matrix and interstitial fluid responsible for maintenance of cartilage mechanical properties. The objective of this study was to investigate correlation between the electric charge transferred during EMR and equilibrium elastic modulus. We used a finite element model based on the triphasic theory of cartilage mechanical properties to study how electric charges transferred in the electro-chemical reactions in cartilage can change its mechanical responses to step displacements in unconfined compression. The concentrations of the ions, the strain field and the fluid and ion velocities within the specimen subject to an applied mechanical deformation were estimated and apparent elastic modulus (the ratio of the equilibrium axial stress to the axial strain) was calculated as a function of transferred charge. The results from numerical calculations showed that the apparent elastic modulus decreases with increase in electric charge transfer. To compare numerical model with experimental observation we measured elastic modulus of cartilage as a function of electric charge transferred in electric circuit during EMR. Good correlation between experimental and theoretical data suggests that electric charge disbalance is responsible for alteration of cartilage mechanical properties.

The spectrum of a vertex model and related spin one chain sitting in a genus five curve

NASA Astrophysics Data System (ADS)

Martins, M. J.

2017-11-01

We derive the transfer matrix eigenvalues of a three-state vertex model whose weights are based on a R-matrix not of difference form with spectral parameters lying on a genus five curve. We have shown that the basic building blocks for both the transfer matrix eigenvalues and Bethe equations can be expressed in terms of meromorphic functions on an elliptic curve. We discuss the properties of an underlying spin one chain originated from a particular choice of the R-matrix second spectral parameter. We present numerical and analytical evidences that the respective low-energy excitations can be gapped or massless depending on the strength of the interaction coupling. In the massive phase we provide analytical and numerical evidences in favor of an exact expression for the lowest energy gap. We point out that the critical point separating these two distinct physical regimes coincides with the one in which the weights geometry degenerate into union of genus one curves.

Development of solid-state NMR techniques for the characterisation of pharmaceutical compounds

NASA Astrophysics Data System (ADS)

Tatton, Andrew S.

Structural characterisation in the solid state is an important step in understanding the physical and chemical properties of a material. Solid-state NMR techniques applied to solid delivery forms are presented as an alternative to more established structural characterisation methods. The effect of homonuclear decoupling upon heteronuclear couplings is investigated using a combination of experimental and density-matrix simulation results acquired from a 13C-1H spinecho pulse sequence, modulated by scalar couplings. It is found that third-order cross terms under MAS and homonuclear decoupling contribute to strong dephasing effects in the NMR signal. Density-matrix simulations allow access to parameters currently unattainable in experiment, and demonstrate that higher homonuclear decoupling rf nutation frequencies reduce the magnitude of third-order cross terms. 15N-1H spinecho experiments were applied to pharmaceutically relevant samples to differentiate between the number of directly attached protons. Using this method, proton transfer in an acid-base reaction is proven in pharmaceutical salts. The indirect detection of 14N lineshapes via protons obtained using 2D 14N-1H HMQC experiments is presented, where coherence transfer is achieved via heteronuclear through-space dipolar couplings. The importance of fast MAS frequencies is demonstrated, and it is found that increasing the recoupling duration reveals longer range NH proximities. The 2D 14N-1H HMQC method is used to demonstrate the presence of specific hydrogen bonding interactions, and thus aid in identifying molecular association in a cocrystal and an amorphous dispersion. In addition, hydrogen bonding motifs were identified by observing the changes in the 14N quadrupolar parameters between individual molecular components relative to the respective solid delivery form. First-principles calculations of NMR chemical shifts and quadrupolar parameters using the GIPAW method were combined with 14N-1H experimental results to assist with spectral assignment and the identification of the hydrogen bonding interactions.

Identification and modification of dominant noise sources in diesel engines

NASA Astrophysics Data System (ADS)

Hayward, Michael D.

Determination of dominant noise sources in diesel engines is an integral step in the creation of quiet engines, but is a process which can involve an extensive series of expensive, time-consuming fired and motored tests. The goal of this research is to determine dominant noise source characteristics of a diesel engine in the near and far-fields with data from fewer tests than is currently required. Pre-conditioning and use of numerically robust methods to solve a set of cross-spectral density equations results in accurate calculation of the transfer paths between the near- and far-field measurement points. Application of singular value decomposition to an input cross-spectral matrix determines the spectral characteristics of a set of independent virtual sources, that, when scaled and added, result in the input cross spectral matrix. Each virtual source power spectral density is a singular value resulting from the decomposition performed over a range of frequencies. The complex relationship between virtual and physical sources is estimated through determination of virtual source contributions to each input measurement power spectral density. The method is made more user-friendly through use of a percentage contribution color plotting technique, where different normalizations can be used to help determine the presence of sources and the strengths of their contributions. Convolution of input measurements with the estimated path impulse responses results in a set of far-field components, to which the same singular value contribution plotting technique can be applied, thus allowing dominant noise source characteristics in the far-field to also be examined. Application of the methods presented results in determination of the spectral characteristics of dominant noise sources both in the near- and far-fields from one fired test, which significantly reduces the need for extensive fired and motored testing. Finally, it is shown that the far-field noise time history of a physically altered engine can be simulated through modification of singular values and recalculation of transfer paths between input and output measurements of previously recorded data.

Applying transfer matrix method to the estimation of the modal characteristics of the NASA Mini-Mass Truss

NASA Technical Reports Server (NTRS)

Shen, Ji-Yao; Taylor, Lawrence W., Jr.

1994-01-01

It is beneficial to use a distributed parameter model for large space structures because the approach minimizes the number of model parameters. Holzer's transfer matrix method provides a useful means to simplify and standardize the procedure for solving the system of partial differential equations. Any large space structures can be broken down into sub-structures with simple elastic and dynamical properties. For each single element, such as beam, tether, or rigid body, we can derive the corresponding transfer matrix. Combining these elements' matrices enables the solution of the global system equations. The characteristics equation can then be formed by satisfying the appropriate boundary conditions. Then natural frequencies and mode shapes can be determined by searching the roots of the characteristic equation at frequencies within the range of interest. This paper applies this methodology, and the maximum likelihood estimation method, to refine the modal characteristics of the NASA Mini-Mast Truss by successively matching the theoretical response to the test data of the truss. The method is being applied to more complex configurations.

Coupled bending-torsion steady-state response of pretwisted, nonuniform rotating beams using a transfer-matrix method

NASA Technical Reports Server (NTRS)

Gray, Carl E., Jr.

1988-01-01

Using the Newtonian method, the equations of motion are developed for the coupled bending-torsion steady-state response of beams rotating at constant angular velocity in a fixed plane. The resulting equations are valid to first order strain-displacement relationships for a long beam with all other nonlinear terms retained. In addition, the equations are valid for beams with the mass centroidal axis offset (eccentric) from the elastic axis, nonuniform mass and section properties, and variable twist. The solution of these coupled, nonlinear, nonhomogeneous, differential equations is obtained by modifying a Hunter linear second-order transfer-matrix solution procedure to solve the nonlinear differential equations and programming the solution for a desk-top personal computer. The modified transfer-matrix method was verified by comparing the solution for a rotating beam with a geometric, nonlinear, finite-element computer code solution; and for a simple rotating beam problem, the modified method demonstrated a significant advantage over the finite-element solution in accuracy, ease of solution, and actual computer processing time required to effect a solution.

Modeling of trim panels in the energy finite element analysis

NASA Astrophysics Data System (ADS)

Moravaeji, Seyed-Javid

Modeling a trim panel is divided into finding the power exchange through two different paths: (i) the connection of the outer and inner panels (ii) through the layers directly. The vibrational power exchanged through the mounts is modeled as the connection of two parallel plates connected via a beam. Wave matrices representing plates and beams are derived separately; then a matrix method is proposed to solve for the wave amplitudes and hence the vibrational power exchange between the plates accordingly. A closed form formula for the case of connection of two identical plates is derived. For the power transmission loss directly through the layers, first transfer matrices representing layers made of different materials is considered. New matrices for a porous layer are derived. A method of finding the layered structure transfer matrix is proposed. It is concluded that in general a single isotropic layer cannot replace a structure accurately. Finally, on the basis of an equivalent transfer matrix, an optimization process for is proposed to replace the panel by a suitable set of layers.

Fluorescence lifetime endoscopy using TCSPC for the measurement of FRET in live cells

PubMed Central

Fruhwirth, Gilbert O.; Ameer-Beg, Simon; Cook, Richard; Watson, Timothy; Ng, Tony; Festy, Frederic

2010-01-01

Development of remote imaging for diagnostic purposes has progressed dramatically since endoscopy began in the 1960’s. The recent advent of a clinically licensed intensity-based fluorescence micro-endoscopic instrument has offered the prospect of real-time cellular resolution imaging. However, interrogating protein-protein interactions deep inside living tissue requires precise fluorescence lifetime measurements to derive the Förster resonance energy transfer between two tagged fluorescent markers. We developed a new instrument combining remote fiber endoscopic cellular-resolution imaging with TCSPC-FLIM technology to interrogate and discriminate mixed fluorochrome labeled beads and expressible GFP/TagRFP tags within live cells. Endoscopic-FLIM (e-FLIM) data was validated by comparison with data acquired via conventional FLIM and e-FLIM was found to be accurate for both bright bead and dim live cell samples. The fiber based micro-endoscope allowed remote imaging of 4 µm and 10 µm beads within a thick Matrigel matrix with confident fluorophore discrimination using lifetime information. More importantly, this new technique enabled us to reliably measure protein-protein interactions in live cells embedded in a 3D matrix, as demonstrated by the dimerization of the fluorescent protein-tagged membrane receptor CXCR4. This cell-based application successfully demonstrated the suitability and great potential of this new technique for in vivo pre-clinical biomedical and possibly human clinical applications. PMID:20588974

Interactive Sound Propagation using Precomputation and Statistical Approximations

NASA Astrophysics Data System (ADS)

Antani, Lakulish

Acoustic phenomena such as early reflections, diffraction, and reverberation have been shown to improve the user experience in interactive virtual environments and video games. These effects arise due to repeated interactions between sound waves and objects in the environment. In interactive applications, these effects must be simulated within a prescribed time budget. We present two complementary approaches for computing such acoustic effects in real time, with plausible variation in the sound field throughout the scene. The first approach, Precomputed Acoustic Radiance Transfer, precomputes a matrix that accounts for multiple acoustic interactions between all scene objects. The matrix is used at run time to provide sound propagation effects that vary smoothly as sources and listeners move. The second approach couples two techniques---Ambient Reverberance, and Aural Proxies---to provide approximate sound propagation effects in real time, based on only the portion of the environment immediately visible to the listener. These approaches lie at different ends of a space of interactive sound propagation techniques for modeling sound propagation effects in interactive applications. The first approach emphasizes accuracy by modeling acoustic interactions between all parts of the scene; the second approach emphasizes efficiency by only taking the local environment of the listener into account. These methods have been used to efficiently generate acoustic walkthroughs of architectural models. They have also been integrated into a modern game engine, and can enable realistic, interactive sound propagation on commodity desktop PCs.

Tunneling dynamics of double proton transfer in formic acid and benzoic acid dimers

NASA Astrophysics Data System (ADS)

Smedarchina, Zorka; Fernández-Ramos, Antonio; Siebrand, Willem

2005-04-01

Direct dynamics calculations based on instanton techniques are reported of tunneling splittings due to double proton transfer in formic and benzoic acid dimers. The results are used to assign the observed splittings to levels for which the authors of the high-resolution spectra could not provide a definitive assignment. In both cases the splitting is shown to be due mainly to the zero-point level rather than to the vibrationally or electronically excited level whose spectrum was investigated. This leads to zero-point splittings of 375MHz for (DCOOH)2 and 1107MHz for the benzoic acid dimer. Thus, contrary to earlier calculations, it is found that the splitting is considerably larger in the benzoic than in the formic acid dimer. The calculations are extended to solid benzoic acid where the asymmetry of the proton-transfer potential induced by the crystal can be overcome by suitable doping. This has allowed direct measurement of the interactions responsible for double proton transfer, which were found to be much larger than those in the isolated dimer. To account for this observation both static and dynamic effects of the crystal forces on the intradimer hydrogen bonds are included in the calculations. The same methodology, extended to higher temperatures, is used to calculate rate constants for HH, HD, and DD transfers in neat benzoic acid crystals. The results are in good agreement with reported experimental rate constants measured by NMR relaxometry and, if allowance is made for small structural changes induced by doping, with the transfer matrix elements observed in doped crystals. Hence the method used allows a unified description of tunneling splittings in the gas phase and in doped crystals as well as of transfer rates in neat crystals.

Screening fungicides for use in fish culture: Evaluation of the agar plug transfer, cellophane transfer, and agar dilution methods

USGS Publications Warehouse

Bailey, Tom A.

1983-01-01

The reliability, reproducibility, and usefulness of three screening methods -- the cellophane transfer, the agar plug transfer, and the agar dilution -- to screen aquatic fungicides were evaluated. Achlya flagellata and Saprolegnia hypogyna were exposed to 1, 10, and 100 mg/L of malachite green to test each method. The cellophane transfer and agar plug transfer techniques had similar reliability and reproducibility in rating fungicidal activity, and were both superior to the agar dilution technique. The agar plug transfer and agar dilution techniques adequately projected in vivo activity of malachite green, but the cellophane transfer technique overestimated its activity. Overall, the agar plug transfer technique most accurately rated the activity of malachite green and was the easiest test to perform. It therefore appears to be the method of choice for testing aquatic fungicides.

Resonance Phenomena in Goupillaud-type Media

DTIC Science & Technology

2010-10-01

time-harmonic forcing function at one end, with the other end fixed. Analytical stress solutions are derived from a global system of recursion...relationships using z-transform methods, where the determinant of the resulting global system matrix |Am| in the z-space is a palindromic polynomial with real...media (35). The present treatment uses a global matrix method that is attributed to Knopoff (36), rather than the Thomsen-Haskell transfer matrix

How do laboratory embryo transfer techniques affect IVF outcomes? A review of current literature.

PubMed

Sigalos, George; Triantafyllidou, Olga; Vlahos, Nikos

2017-04-01

Over the last few years, many studies have focused on embryo selection methods, whereas little attention has been given to the standardization of the procedure of embryo transfer. In this review, several parameters of the embryo transfer procedure are examined, such as the: (i) culture medium volume and loading technique; (ii) syringe and catheters used for embryo transfer; (iii) viscosity and composition of the embryo transfer medium; (iv) environment of embryo culture; (v) timing of embryo transfer; (vi) and standardization of the embryo transfer techniques. The aim of this manuscript is to review these factors and compare the existing embryo transfer techniques and highlight the need for better embryo transfer standardization.

Numerical simulation of tunneling through arbitrary potential barriers applied on MIM and MIIM rectenna diodes

NASA Astrophysics Data System (ADS)

Abdolkader, Tarek M.; Shaker, Ahmed; Alahmadi, A. N. M.

2018-07-01

With the continuous miniaturization of electronic devices, quantum-mechanical effects such as tunneling become more effective in many device applications. In this paper, a numerical simulation tool is developed under a MATLAB environment to calculate the tunneling probability and current through an arbitrary potential barrier comparing three different numerical techniques: the finite difference method, transfer matrix method, and transmission line method. For benchmarking, the tool is applied to many case studies such as the rectangular single barrier, rectangular double barrier, and continuous bell-shaped potential barrier, each compared to analytical solutions and giving the dependence of the error on the number of mesh points. In addition, a thorough study of the J ‑ V characteristics of MIM and MIIM diodes, used as rectifiers for rectenna solar cells, is presented and simulations are compared to experimental results showing satisfactory agreement. On the undergraduate level, the tool provides a deeper insight for students to compare numerical techniques used to solve various tunneling problems and helps students to choose a suitable technique for a certain application.

MALDI-MS and NanoSIMS imaging techniques to study cnidarian-dinoflagellate symbioses.

PubMed

Kopp, C; Wisztorski, M; Revel, J; Mehiri, M; Dani, V; Capron, L; Carette, D; Fournier, I; Massi, L; Mouajjah, D; Pagnotta, S; Priouzeau, F; Salzet, M; Meibom, A; Sabourault, C

2015-04-01

Cnidarian-dinoflagellate photosynthetic symbioses are fundamental to biologically diverse and productive coral reef ecosystems. The hallmark of this symbiotic relationship is the ability of dinoflagellate symbionts to supply their cnidarian host with a wide range of nutrients. Many aspects of this association nevertheless remain poorly characterized, including the exact identity of the transferred metabolic compounds, the mechanisms that control their exchange across the host-symbiont interface, and the precise subcellular fate of the translocated materials in cnidarian tissues. This lack of knowledge is mainly attributed to difficulties in investigating such metabolic interactions both in situ, i.e. on intact symbiotic associations, and at high spatial resolution. To address these issues, we illustrate the application of two in situ and high spatial resolution molecular and ion imaging techniques-matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI-MSI) and the nano-scale secondary-ion mass spectrometry (NanoSIMS) ion microprobe. These imaging techniques provide important new opportunities for the detailed investigation of many aspects of cnidarian-dinoflagellate associations, including the dynamics of cellular interactions. Copyright © 2014 Elsevier GmbH. All rights reserved.

Theory and experimental results of transfer-NOE experiments. 1. The influence of the off rate versus cross-relaxation rates

NASA Astrophysics Data System (ADS)

Lippens, R. M.; Cerf, C.; Hallenga, K.

The theory of the transferred nuclear Overhauser effect is presented in the framework of an extended relaxation matrix representation. This matrix representation allows a coherent description of all one- and two-dimensional experiments. We present analytical solutions for the buildup of magnetization in the 2D transfer-NOE experiment, for all ratios of the off rate k to the cross-relaxation rates R involved. We show that systematic deviations in distance determination occur when the off rate becomes comparable to or smaller than the relaxation rates. Experimental results on the peptide/protein system oxytocin/neurophysin confirming this analysis are presented. The importance of residual mobility in the bound ligand, as demonstrated by the experimental data, is also discussed.

Ion-to-Neutral Ratios and Thermal Proton Transfer in Matrix-Assisted Laser Desorption/Ionization

NASA Astrophysics Data System (ADS)

Lu, I.-Chung; Chu, Kuan Yu; Lin, Chih-Yuan; Wu, Shang-Yun; Dyakov, Yuri A.; Chen, Jien-Lian; Gray-Weale, Angus; Lee, Yuan-Tseh; Ni, Chi-Kung

2015-07-01

The ion-to-neutral ratios of four commonly used solid matrices, α-cyano-4-hydroxycinnamic acid (CHCA), 2,5-dihydroxybenzoic acid (2,5-DHB), sinapinic acid (SA), and ferulic acid (FA) in matrix-assisted laser desorption/ionization (MALDI) at 355 nm are reported. Ions are measured using a time-of-flight mass spectrometer combined with a time-sliced ion imaging detector. Neutrals are measured using a rotatable quadrupole mass spectrometer. The ion-to-neutral ratios of CHCA are three orders of magnitude larger than those of the other matrices at the same laser fluence. The ion-to-neutral ratios predicted using the thermal proton transfer model are similar to the experimental measurements, indicating that thermal proton transfer reactions play a major role in generating ions in ultraviolet-MALDI.

Betatron motion with coupling of horizontal and vertical degrees of freedom

DOE Office of Scientific and Technical Information (OSTI.GOV)

S. A. Bogacz; V. A. Lebedev

2002-11-21

The Courant-Snyder parameterization of one-dimensional linear betatron motion is generalized to two-dimensional coupled linear motion. To represent the 4 x 4 symplectic transfer matrix the following ten parameters were chosen: four beta-functions, four alpha-functions and two betatron phase advances which have a meaning similar to the Courant-Snyder parameterization. Such a parameterization works equally well for weak and strong coupling and can be useful for analysis of coupled betatron motion in circular accelerators as well as in transfer lines. Similarly, the transfer matrix, the bilinear form describing the phase space ellipsoid and the second order moments are related to the eigen-vectors.more » Corresponding equations can be useful in interpreting tracking results and experimental data.« less

Polyaniline-CuO hybrid nanocomposite with enhanced electrical conductivity

NASA Astrophysics Data System (ADS)

de Souza, Vânia S.; da Frota, Hidembergue O.; Sanches, Edgar A.

2018-02-01

A hybrid nanocomposite based on a polymer matrix constituted of Polyaniline Emeraldine-salt form (PANI-ES) reinforced by copper oxide II (CuO) particles was obtained by in situ polymerization. Structural, morphological and electrical properties of the pure materials and nanocomposite form were investigated. The presence of CuO particles in the nanocomposite material affected the natural alignment of the polymer chains. XRD technique allowed the visualization of the polymer amorphization in the nanocomposite form, suggesting an interaction between both phases. The FTIR spectra confirmed this molecular interaction due to the blue shift of the characteristic absorption peaks of PANI-ES in the nanocomposite form. SEM images revealed that the polymer nanofiber morphology was no longer observed in the nanocomposite. The CuO spherical particles are randomly dispersed in the polymer matrix. The density functional theory plus the Coulomb interaction method revealed a charge transfer from PANI to CuO slab. Moreover, the density of states (DOS) has revealed that the nanocomposite behaves as a metal. In agreement, the electrical conductivity showed an increase of 60% in the nanocomposite material.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Evaluation of nursing students' work technique after proficiency training in patient transfer methods during undergraduate education.

PubMed

Johnsson, A Christina E; Kjellberg, Anders; Lagerström, Monica I

2006-05-01

The aim of this study was to investigate if nursing students improved their work technique when assisting a simulated patient from bed to wheelchair after proficiency training, and to investigate whether there was a correlation between the nursing students' work technique and the simulated patients' perceptions of the transfer. 71 students participated in the study, 35 in the intervention group and 36 in the comparison group. The students assisted a simulated patient to move from a bed to a wheelchair. In the intervention group the students made one transfer before and one after training, and in the comparison group they made two transfers before training. Six variables were evaluated: work technique score; nursing students' ratings of comfort, work technique and exertion, and the simulated patients' perceptions of comfort and safety during the transfer. The result showed that nursing students improved their work technique, and that there was a correlation between the work technique and the simulated patients' subjective ratings of the transfer. In conclusion, nursing students improved their work technique after training in patient transfer methods, and the work technique affected the simulated patients' perceptions of the transfer.

Carbon Dots and 9AA as a Binary Matrix for the Detection of Small Molecules by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Chen, Yongli; Gao, Dan; Bai, Hangrui; Liu, Hongxia; Lin, Shuo; Jiang, Yuyang

2016-07-01

Application of matrix-assisted laser-desorption/ionization mass spectrometry (MALDI MS) to analyze small molecules have some limitations, due to the inhomogeneous analyte/matrix co-crystallization and interference of matrix-related peaks in low m/z region. In this work, carbon dots (CDs) were for the first time applied as a binary matrix with 9-Aminoacridine (9AA) in MALDI MS for small molecules analysis. By 9AA/CDs assisted desorption/ionization (D/I) process, a wide range of small molecules, including nucleosides, amino acids, oligosaccharides, peptides, and anticancer drugs with a higher sensitivity were demonstrated in the positive ion mode. A detection limit down to 5 fmol was achieved for cytidine. 9AA/CDs matrix also exhibited excellent reproducibility compared with 9AA matrix. Moreover, by exploring the ionization mechanism of the matrix, the influence factors might be attributed to the four parts: (1) the strong UV absorption of 9AA/CDs due to their π-conjugated network; (2) the carboxyl groups modified on the CDs surface act as protonation sites for proton transfer in positive ion mode; (3) the thin layer crystal of 9AA/CDs could reach a high surface temperature more easily and lower transfer energy for LDI MS; (4) CDs could serve as a matrix additive to suppress 9AA ionization. Furthermore, this matrix was allowed for the analysis of glucose as well as nucleosides in human urine, and the level of cytidine was quantified with a linear range of 0.05-5 mM (R2 > 0.99). Therefore, the 9AA/CDs matrix was proven to be an effective MALDI matrix for the analysis of small molecules with improved sensitivity and reproducibility. This work provides an alternative solution for small molecules detection that can be further used in complex samples analysis.

Analysis and measurement of the transfer matrix of a 9-cell, 1.3-GHz superconducting cavity

DOE PAGES

Halavanau, A.; Eddy, N.; Edstrom, D.; ...

2017-04-13

Superconducting linacs are capable of producing intense, stable, high-quality electron beams that have found widespread applications in science and industry. Here, the 9-cell, 1.3-GHz superconducting standing-wave accelerating rf cavity originally developed for e +/e - linear-collider applications has been broadly employed in various superconducting-linac designs. In this paper we discuss the transfer matrix of such a cavity and present its measurement performed at the Fermilab Accelerator Science and Technology (FAST) facility. Finally, the experimental results are found to be in agreement with analytical calculations and numerical simulations.

Dynamical simulation of electron transfer processes in self-assembled monolayers at metal surfaces using a density matrix approach.

PubMed

Prucker, V; Bockstedte, M; Thoss, M; Coto, P B

2018-03-28

A single-particle density matrix approach is introduced to simulate the dynamics of heterogeneous electron transfer (ET) processes at interfaces. The characterization of the systems is based on a model Hamiltonian parametrized by electronic structure calculations and a partitioning method. The method is applied to investigate ET in a series of nitrile-substituted (poly)(p-phenylene)thiolate self-assembled monolayers adsorbed at the Au(111) surface. The results show a significant dependence of the ET on the orbital symmetry of the donor state and on the molecular and electronic structure of the spacer.

Dehydration reactions, mass transfer and rock deformation relationships during subduction of Alpine metabauxites: insights from LIBS compositional profiles between metamorphic veins

NASA Astrophysics Data System (ADS)

Verlaguet, Anne; Brunet, Fabrice; Goffé, Bruno; Menut, Denis; Findling, Nathaniel; Poinssot, Christophe

2013-04-01

In subduction zones, the significant amounts of aqueous fluid released in the course of the successive dehydration reactions occurring during prograde metamorphism are expected to strongly influence the rock rheology, as well as kinetics of metamorphic reactions and mass transfer efficiency. Mineralized veins, ubiquitous in metamorphic rocks, can be seen as preserved witnesses of fluid and mass redistribution that partly accommodate the rock deformation (lateral segregation). However, the driving forces and mechanisms of mass transfer towards fluid-filled open spaces remain somewhat unclear. The aim of this study is to investigate the vein-forming processes and the modalities of mass transfer during local fluid-rock interactions, and their links with fluid production and rock deformation, with new insights from Laser Induced Breakdown Spectroscopy (LIBS) profiles. This study focuses on karstic pockets (metre scale) of Triassic metabauxites embedded in thick carbonate units, that have been isolated from large-scale fluid flow during HP-LT Alpine metamorphism (W. Vanoise, French Alps). These rocks display several generations of metamorphic veins containing various Al-bearing minerals, which give particular insights into mass transfer processes. It is proposed that the internally-derived fluid (~13 vol% produced by successive dehydration reactions) has promoted the opening of fluid-filled open spaces (euhedral habits of vein minerals) and served as medium for diffusive mass transfer from rock to vein. Based on mineralogical and textural features, two vein types can be distinguished: (1) some veins are filled with newly formed products of either prograde (chloritoid) or retrograde (chlorite) metamorphic reactions; in this case, fluid-filled open spaces seem to offer energetically favourable nucleation/growth sites; (2) the second vein type is filled with cookeite (Li-Al-rich chlorite) or pyrophyllite, that were present in the host rock prior to the vein formation. In this closed chemical system, mass transfer from rock to vein was achieved through the fluid, in a dissolution-transport-precipitation process, possibly stress-assisted. To investigate the modalities of mass transfer towards this second vein type, LIBS profiles were performed in the rock matrix, taking Li concentration as a proxy for cookeite distribution. Cookeite is highly concentrated (40-70 vol%) in regularly spaced veins, and the LIBS profiles show that cookeite is evenly distributed in the rock matrix comprised between two veins. The absence of diffusion profiles suggests that the characteristic diffusion length for Li, Al and Si is greater than or equal to the distance separating two cookeite veins (3-6 cm). This is in agreement with characteristic diffusion lengths calculated from both grain boundary and pore fluid diffusion coefficients, for the estimated duration of the peak of metamorphism. Concerning mass transfer driving forces, phyllosilicates have very different morphologies in the rock matrix (fibers) compared to veins (euhedral crystals): fluid-mineral interfacial energy may be maximal in the small matrix pores, which can maintain higher cookeite solubility than in fluid-filled open spaces. Therefore, as soon as veins open, chemical potential gradients may develop and drive cookeite transfer from rock matrix to veins.

The Role of Initial Learning, Problem Features, Prior Knowledge, and Pattern Recognition on Transfer Success

ERIC Educational Resources Information Center

Dinsmore, Daniel L.; Baggetta, Peter; Doyle, Stephanie; Loughlin, Sandra M.

2014-01-01

The purpose of this study was to demonstrate that transfer ability (positive and negative) varies depending on the nature of the problems, using the knowledge transfer matrix, as well as being dependent on the individual differences of the learner. A total of 178 participants from the United States and New Zealand completed measures of prior…

Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules

NASA Astrophysics Data System (ADS)

Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.

1997-07-01

Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.

Using rapid infrared forming to control interfaces in titanium-matrix composites

NASA Technical Reports Server (NTRS)

Warrier, Sunil G.; Lin, Ray Y.

1993-01-01

Control of the fiber-matrix reaction during composite fabrication is commonly achieved by shortening the processing time, coating the reinforcement with relatively inert materials, or adding alloying elements to retard the reaction. To minimize the processing time, a rapid IR forming (RIF) technique for metal-matrix composite fabrication has been developed. Experiments have shown that the RIF technique is a quick, simple, and low-cost process to fabricate titanium-alloy matrix composites reinforced with either silicon carbide or carbon fibers. Due to short processing times (typically on the order of 1-2 minutes in an inert atmosphere for composites with up to eight-ply reinforcements), the interfacial reaction is limited and well controlled. Composites fabricated by this technique have mechanical properties that are comparable to (in several cases, superior to) those made with conventional diffusion-bonding techniques.

Technique for information retrieval using enhanced latent semantic analysis generating rank approximation matrix by factorizing the weighted morpheme-by-document matrix

DOEpatents

Chew, Peter A; Bader, Brett W

2012-10-16

A technique for information retrieval includes parsing a corpus to identify a number of wordform instances within each document of the corpus. A weighted morpheme-by-document matrix is generated based at least in part on the number of wordform instances within each document of the corpus and based at least in part on a weighting function. The weighted morpheme-by-document matrix separately enumerates instances of stems and affixes. Additionally or alternatively, a term-by-term alignment matrix may be generated based at least in part on the number of wordform instances within each document of the corpus. At least one lower rank approximation matrix is generated by factorizing the weighted morpheme-by-document matrix and/or the term-by-term alignment matrix.

Matrix Organizational Structure and Its Effects Upon Education Organizations.

ERIC Educational Resources Information Center

Yates, James R.

Applying matrix organizational structure to the organization of special education services is the focus of this paper. Beginning with a list of ways in which educational organizations differ from business or military organizations, the author warns that educators must be cautious when transferring organizational structures from other disciplines…

Estimates of electronic coupling for excess electron transfer in DNA

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.

2005-07-01

Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.

Transfer Technique Is Associated With Shoulder Pain and Pathology in People With Spinal Cord Injury: A Cross-Sectional Investigation.

PubMed

Hogaboom, Nathan S; Worobey, Lynn A; Boninger, Michael L

2016-10-01

To evaluate how transfer technique and subject characteristics relate to ultrasound measures of shoulder soft tissue pathology and self-reported shoulder pain during transfers in a sample of wheelchair users with spinal cord injury (SCI). Cross-sectional observational study. Research laboratory, national and local veterans' wheelchair sporting events. A convenience sample of wheelchair users (N=76) with nonprogressive SCI. Participants were aged >18 years, >1 year postinjury, and could complete repeated independent wheelchair transfers without the use of their leg muscles. Not applicable. Transfer pain items from the Wheelchair User's Shoulder Pain Index; transfer technique assessed using the Transfer Assessment Instrument (TAI); and shoulder pathology markers examined using the Ultrasound Shoulder Pathology Rating Scale (USPRS). Better transfer technique (higher TAI) correlated with less injury (lower USPRS) (partial η(2)=.062, P<.05) and less pain during transfers (partial η(2)=.049, P<.10). Greater age was the strongest predictor of greater pathology (USPRS total: partial η(2)=.225, supraspinatus grade: partial η(2)=.174, P<.01). An interaction between technique and weight was found (P<.10): participants with lower body weights showed a decrease in pathology markers with better transfer technique (low weight: R(2)=.422, P<.05; middle weight: R(2)=.200, P<.01), while those with higher weight showed little change with technique (R(2)=.018, P>.05). Participants with better transfer technique exhibited less shoulder pathology and reported less pain during transfers. The relationship between technique and pathology was strongest in lower-weight participants. While causation cannot be proven because of study design, it is possible that using a better transfer technique and optimizing body weight could reduce the incidence of shoulder pathology and pain. Copyright © 2016 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

One- and two-dimensional chemical exchange nuclear magnetic resonance studies of the creatine kinase catalyzed reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gober, J.R.

1988-01-01

The equilibrium chemical exchange dynamics of the creatine kinase enzyme system were studied by one- and two-dimensional {sup 31}P NMR techniques. Pseudo-first-order reaction rate constants were measured by the saturation transfer method under an array of experimental conditions of pH and temperature. Quantitative one-dimensional spectra were collected under the same conditions in order to calculate the forward and reverse reaction rates, the K{sub eq}, the hydrogen ion stoichiometry, and the standard thermodynamic functions. The pure absorption mode in four quadrant two-dimensional chemical exchange experiment was employed so that the complete kinetic matrix showing all of the chemical exchange process couldmore » be realized.« less

Real time estimation of the heaving and pitching motions of a ship, using a Kalman filter

NASA Technical Reports Server (NTRS)

Triantafyllou, M.; Athans, M.

1981-01-01

In the present study the estimation of the heave and pitch motion of a ship is considered, using Kalman filtering techniques. A significant part of the study is devoted to constructing appropriate models for the sea and the ship. The governing equations are obtained from hydrodynamic considerations in the form of linear differential equations with frequency dependent coefficients. In addition, nonminimum phase characteristics are obtained due to the spatial integration of the water wave forces. The resulting transfer matrix function is irrational and nonminimum phase. The conditions for a finite-dimensional approximation are considered and the impact of the various parameters is assessed. A numerical application is considered for a DD-963 destroyer.

Sol-gel derived antireflective structures for applications in silicon solar cells

NASA Astrophysics Data System (ADS)

Karasiński, Paweł; Skolik, Marcin

2016-12-01

This work presents theoretical and experimental results of antireflective coatings (ARCs) obtained for applications in silicon solar cells. ARCs were derived from sol-gel process and dip-coated using silica (SiO2) and titania (TiO2). Theoretical results were obtained using 2×2 transfer matrix calculation method. Technological process of SiO2 and TiO2 thin film fabrication as well as measurement techniques are described in this paper. Strong correlation between theoretical and experimental data is demonstrated. It is shown, that weighted average reflection from a substrate can be reduced ten times with the use of SiO2/TiO2/Si double layer ARCs, when compared to a bare silica substrate.

Problems encountered with conventional fiber-reinforced composites

NASA Technical Reports Server (NTRS)

Landel, R. F.

1981-01-01

Preparational, computational, and operational problems associated with fiber-reinforced composites (FRC) are reviewed. Initial preparation of FRCs is shown to involve consideration of the type of prepreg, the setting time, cure conditions and cycles, and cure temperatures. The effects of the choice of bonding agents, the fiber transfer length, and individual fiber responses to bonding agents are noted to have an impact on fiber strength, moisture uptake, and fatigue resistance. The deformation prior to failure and the failure region are modeled through models of mini-, micro- and macro mechanics formulations employing a stiffness matrix, failure criterion, or fracture mechanics. The detection, evaluation, and repair of defects comprises the operational domain, and it is stressed that no good repair techniques exist for FRCs.

Application of ex situ dynamic nuclear polarization in studying small molecules.

PubMed

Ludwig, Christian; Marin-Montesinos, Ildefonso; Saunders, Martin G; Emwas, Abdul-Hamid; Pikramenou, Zoe; Hammond, Stephen P; Günther, Ulrich L

2010-06-14

Dynamic nuclear polarization (DNP) has become an attractive technique to boost the sensitivity of NMR experiments. In the case of ex situ polarizations two-dimensional (2D) spectra are limited by the short lifetime of the polarization after dissolution and sample transfer to a high field NMR magnet. This limitation can be overcome by various approaches. Here we show how the use of (13)C-labelled acetyl tags can help to obtain 2D-HMQC spectra for many small molecules, owing to a nuclear Overhauser enhancement between (13)C spins originating from the long-lived carbonyl carbon, which extends the lifetimes of other (13)C spins with shorter longitudinal relaxation times. We also show an alternative approach of using an optimized polarization matrix.

Assessment of CO2 Storage Potential in Naturally Fractured Reservoirs With Dual-Porosity Models

NASA Astrophysics Data System (ADS)

March, Rafael; Doster, Florian; Geiger, Sebastian

2018-03-01

Naturally Fractured Reservoirs (NFR's) have received little attention as potential CO2 storage sites. Two main facts deter from storage projects in fractured reservoirs: (1) CO2 tends to be nonwetting in target formations and capillary forces will keep CO2 in the fractures, which typically have low pore volume; and (2) the high conductivity of the fractures may lead to increased spatial spreading of the CO2 plume. Numerical simulations are a powerful tool to understand the physics behind brine-CO2 flow in NFR's. Dual-porosity models are typically used to simulate multiphase flow in fractured formations. However, existing dual-porosity models are based on crude approximations of the matrix-fracture fluid transfer processes and often fail to capture the dynamics of fluid exchange accurately. Therefore, more accurate transfer functions are needed in order to evaluate the CO2 transfer to the matrix. This work presents an assessment of CO2 storage potential in NFR's using dual-porosity models. We investigate the impact of a system of fractures on storage in a saline aquifer, by analyzing the time scales of brine drainage by CO2 in the matrix blocks and the maximum CO2 that can be stored in the rock matrix. A new model to estimate drainage time scales is developed and used in a transfer function for dual-porosity simulations. We then analyze how injection rates should be limited in order to avoid early spill of CO2 (lost control of the plume) on a conceptual anticline model. Numerical simulations on the anticline show that naturally fractured reservoirs may be used to store CO2.

Charge-transfer contributions to the excitonic coupling matrix element in BODIPY-based energy transfer cassettes

NASA Astrophysics Data System (ADS)

Spiegel, J. Dominik; Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M.

2017-01-01

BODIPY-based dyads serve as model systems for the investigation of excitation energy transfer (EET). Through-space EET is brought about by direct and exchange interactions between the transition densities of donor and acceptor localized states. The presence of a molecular linker gives rise to additional charge transfer (CT) contributions. Here, we present a novel approach for the calculation of the excitonic coupling matrix element (ECME) including CT contributions which is based on supermolecular one-electron transition density matrices (STD). The validity of the approach is assessed for a model system of two π -stacked ethylene molecules at varying intermolecular separation. Wave functions and electronic excitation energies of five EET cassettes comprising anthracene as exciton donor and BODIPY as exciton acceptor are obtained by the redesigned combined density functional theory and multireference configuration interaction (DFT/MRCI-R) method. CT contributions to the ECME are shown to be important in the covalently linked EET cassettes.

Organic light-emitting diodes for lighting: High color quality by controlling energy transfer processes in host-guest-systems

NASA Astrophysics Data System (ADS)

Weichsel, Caroline; Reineke, Sebastian; Furno, Mauro; Lüssem, Björn; Leo, Karl

2012-02-01

Exciton generation and transfer processes in a multilayer organic light-emitting diode (OLED) are studied in order to realize OLEDs with warm white color coordinates and high color-rendering index (CRI). We investigate a host-guest-system containing four phosphorescent emitters and two matrix materials with different transport properties. We show, by time-resolved spectroscopy, that an energy back-transfer from the blue emitter to the matrix materials occurs, which can be used to transport excitons to the other emitter molecules. Furthermore, we investigate the excitonic and electronic transfer processes by designing suitable emission layer stacks. As a result, we obtain an OLED with Commission Internationale de lÉclairage (CIE) coordinates of (0.444;0.409), a CRI of 82, and a spectrum independent of the applied current. The OLED shows an external quantum efficiency of 10% and a luminous efficacy of 17.4 lm/W at 1000 cd/m2.

Ultrafast energy transfer with competing channels: Non-equilibrium Förster and Modified Redfield theories

NASA Astrophysics Data System (ADS)

Seibt, Joachim; Mančal, Tomáš

2017-05-01

We derive equations of motion for the reduced density matrix of a molecular system which undergoes energy transfer dynamics competing with fast internal conversion channels. Environmental degrees of freedom of such a system have no time to relax to quasi-equilibrium in the electronic excited state of the donor molecule, and thus the conditions of validity of Förster and Modified Redfield theories in their standard formulations do not apply. We derive non-equilibrium versions of the two well-known rate theories and apply them to the case of carotenoid-chlorophyll energy transfer. Although our reduced density matrix approach does not account for the formation of vibronic excitons, it still confirms the important role of the donor ground-state vibrational states in establishing the resonance energy transfer conditions. We show that it is essential to work with a theory valid in a strong system-bath interaction regime to obtain correct dependence of the rates on donor-acceptor energy gap.

Single and Dual Drug Release Patterns from Shellac Wax-Lutrol Matrix Tablets Fabricated with Fusion and Molding Techniques

PubMed Central

Phaechamud, T.; Choncheewa, C.

2015-01-01

The objective of this investigation was to prepare the shellac wax matrix tablets by fusion and molding technique incorporated with Lutrol in different ratios to modify the hydrophobicity of matrix tablet. The matrix tablets with single drug were loaded either with propranolol hydrochloride or hydrochlorothiazide as hydrophilic and hydrophobic model drugs, and a dual drug formula was also prepared. The single and dual drug release patterns were studied in a dissolution apparatus using distilled water as medium. Propranolol hydrochloride released from matrix was easier than hydrochlorothiazide. Drug release from shellac wax matrix could be enhanced by incorporation of Lutrol. However retardation of drug release from some matrix tablets was evident for the systems that could form dispersion in the dissolution medium. The gel network from high content of Lutrol was hexagonal which was a dense and more compact structure than the other structures found when low amounts of Lutrol were present in the formula. Therefore, the formulae with high content of Lutrol could prolong drug release more efficiently than those containing low content of Lutrol. Hence shellac wax matrix could modulate the drug release with the addition of Lutrol. Sustainable dual drug release was also obtained from these developed matrix tablets. Thus shellac wax-Lutrol component could be used as a potential matrix tablet prepared with fusion and molding technique with excellent controlled drug release. PMID:25767320

Indirect fabrication of multiple post-and-core patterns with a vinyl polysiloxane matrix.

PubMed

Sabbak, Sahar Asaad

2002-11-01

In the described technique, a vinyl polysiloxane material is used as a matrix for the indirect fabrication of multiple custom-cast posts and cores. The matrix technique enables the clinician to fabricate multiple posts and cores in a short period of time. The form, harmony, and common axis of preparation for all cores are well controlled before the definitive crown/fixed partial denture restorations are fabricated. Oral tissues are not exposed to the heat of polymerization or the excess monomer of the resin material when this technique is used.

Algebraic techniques for diagonalization of a split quaternion matrix in split quaternionic mechanics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Tongsong, E-mail: jiangtongsong@sina.com; Department of Mathematics, Heze University, Heze, Shandong 274015; Jiang, Ziwu

In the study of the relation between complexified classical and non-Hermitian quantum mechanics, physicists found that there are links to quaternionic and split quaternionic mechanics, and this leads to the possibility of employing algebraic techniques of split quaternions to tackle some problems in complexified classical and quantum mechanics. This paper, by means of real representation of a split quaternion matrix, studies the problem of diagonalization of a split quaternion matrix and gives algebraic techniques for diagonalization of split quaternion matrices in split quaternionic mechanics.

Drawing a different picture with pencil lead as matrix-assisted laser desorption/ionization matrix for fullerene derivatives.

PubMed

Nye, Leanne C; Hungerbühler, Hartmut; Drewello, Thomas

2018-02-01

Inspired by reports on the use of pencil lead as a matrix-assisted laser desorption/ionization matrix, paving the way towards matrix-free matrix-assisted laser desorption/ionization, the present investigation evaluates its usage with organic fullerene derivatives. Currently, this class of compounds is best analysed using the electron transfer matrix trans-2-[3-(4-tert-butylphenyl)-2-methyl-2-propenylidene] malononitrile (DCTB), which was employed as the standard here. The suitability of pencil lead was additionally compared to direct (i.e. no matrix) laser desorption/ionization-mass spectrometry. The use of (DCTB) was identified as the by far gentler method, producing spectra with abundant molecular ion signals and much reduced fragmentation. Analytically, pencil lead was found to be ineffective as a matrix, however, appears to be an extremely easy and inexpensive method for producing sodium and potassium adducts.

Properties of Zero-Free Transfer Function Matrices

NASA Astrophysics Data System (ADS)

D. O. Anderson, Brian; Deistler, Manfred

Transfer functions of linear, time-invariant finite-dimensional systems with more outputs than inputs, as arise in factor analysis (for example in econometrics), have, for state-variable descriptions with generic entries in the relevant matrices, no finite zeros. This paper gives a number of characterizations of such systems (and indeed square discrete-time systems with no zeros), using state-variable, impulse response, and matrix-fraction descriptions. Key properties include the ability to recover the input values at any time from a bounded interval of output values, without any knowledge of an initial state, and an ability to verify the no-zero property in terms of a property of the impulse response coefficient matrices. Results are particularized to cases where the transfer function matrix in question may or may not have a zero at infinity or a zero at zero.

Collisional Dynamics of the B 3Pi(O+) State of Bromine Monochloride.

DTIC Science & Technology

1986-08-01

many useful discussions on energy transfer studies and continual friendship, to Lt. Brian McFeeters for execution of an RKR program, and to AFWL...2 C. The Halogens and Interhalogens.................... 6 D. The Study of Molecular Energy Transfer............ 9 E. Problem...Matrix.............. 137 8. The BrCl(B) Quenching Mechanism................ 144 9. Energy Transfer with Rare Gases................ 145 10. Summary of

Preconditioned conjugate gradient technique for the analysis of symmetric anisotropic structures

NASA Technical Reports Server (NTRS)

Noor, Ahmed K.; Peters, Jeanne M.

1987-01-01

An efficient preconditioned conjugate gradient (PCG) technique and a computational procedure are presented for the analysis of symmetric anisotropic structures. The technique is based on selecting the preconditioning matrix as the orthotropic part of the global stiffness matrix of the structure, with all the nonorthotropic terms set equal to zero. This particular choice of the preconditioning matrix results in reducing the size of the analysis model of the anisotropic structure to that of the corresponding orthotropic structure. The similarities between the proposed PCG technique and a reduction technique previously presented by the authors are identified and exploited to generate from the PCG technique direct measures for the sensitivity of the different response quantities to the nonorthotropic (anisotropic) material coefficients of the structure. The effectiveness of the PCG technique is demonstrated by means of a numerical example of an anisotropic cylindrical panel.

Application of SOJA and InforMatrix in practice: interactive web and workshop tools.

PubMed

Brenninkmeijer, Rob; Janknegt, Robert

2007-10-01

System of Objectified Judgement Analysis (SOJA) and InforMatrix are decision-matrix techniques designed to support a rational selection of drugs. Both SOJA and InforMatrix can be considered as strategic tools in the practical implementation of rational pharmacotherapy. In order to apply the matrix techniques to drug selection, strategic navigation through essential information (with the aim of reaching consensus in pharmacotherapy) is required. The consensus has to be reached in an interactive, communicative, collegial manner, within a professional environment. This environment is realised in the form of interactive applications in workshops and on the internet. Such interactive applications are illustrated and discussed in this article.

Using rapid infrared forming to control interfaces in titanium-matrix composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warrier, S.G.; Lin, R.Y.

1993-03-01

Control of the fiber-matrix reaction during composite fabrication is commonly achieved by shortening the processing time, coating the reinforcement with relatively inert materials, or adding alloying elements to retard the reaction. To minimize the processing time, a rapid IR forming (RIF) technique for metal-matrix composite fabrication has been developed. Experiments have shown that the RIF technique is a quick, simple, and low-cost process to fabricate titanium-alloy matrix composites reinforced with either silicon carbide or carbon fibers. Due to short processing times (typically on the order of 1-2 minutes in an inert atmosphere for composites with up to eight-ply reinforcements), themore » interfacial reaction is limited and well controlled. Composites fabricated by this technique have mechanical properties that are comparable to (in several cases, superior to) those made with conventional diffusion-bonding techniques. 21 refs.« less

Constraining anomalous Higgs boson couplings to the heavy-flavor fermions using matrix element techniques

NASA Astrophysics Data System (ADS)

Gritsan, Andrei V.; Röntsch, Raoul; Schulze, Markus; Xiao, Meng

2016-09-01

In this paper, we investigate anomalous interactions of the Higgs boson with heavy fermions, employing shapes of kinematic distributions. We study the processes p p →t t ¯+H , b b ¯+H , t q +H , and p p →H →τ+τ- and present applications of event generation, reweighting techniques for fast simulation of anomalous couplings, as well as matrix element techniques for optimal sensitivity. We extend the matrix element likelihood approach (MELA) technique, which proved to be a powerful matrix element tool for Higgs boson discovery and characterization during Run I of the LHC, and implement all analysis tools in the JHU generator framework. A next-to-leading-order QCD description of the p p →t t ¯+H process allows us to investigate the performance of the MELA in the presence of extra radiation. Finally, projections for LHC measurements through the end of Run III are presented.

Homogeneous Matrix Deposition on Dried Agar for MALDI Imaging Mass Spectrometry of Microbial Cultures

NASA Astrophysics Data System (ADS)

Hoffmann, Thomas; Dorrestein, Pieter C.

2015-11-01

Matrix deposition on agar-based microbial colonies for MALDI imaging mass spectrometry is often complicated by the complex media on which microbes are grown. This Application Note demonstrates how consecutive short spray pulses of a matrix solution can form an evenly closed matrix layer on dried agar. Compared with sieving dry matrix onto wet agar, this method supports analyte cocrystallization, which results in significantly more signals, higher signal-to-noise ratios, and improved ionization efficiency. The even matrix layer improves spot-to-spot precision of measured m/z values when using TOF mass spectrometers. With this technique, we established reproducible imaging mass spectrometry of myxobacterial cultures on nutrient-rich cultivation media, which was not possible with the sieving technique.

Dry Arthroscopy With a Retraction System for Matrix-Aided Cartilage Repair of Patellar Lesions

PubMed Central

Sadlik, Boguslaw; Wiewiorski, Martin

2014-01-01

Several commercially available cartilage repair techniques use a natural or synthetic matrix to aid cartilage regeneration (e.g., autologous matrix–induced chondrogenesis or matrix-induced cartilage implantation). However, the use of matrix-aided techniques during conventional knee joint arthroscopy under continuous irrigation is challenging. Insertion and fixation of the matrix can be complicated by the presence of fluid and the confined patellofemoral joint space with limited access to the lesion. To overcome these issues, we developed a novel arthroscopic approach for matrix-aided cartilage repair of patellar lesions. This technical note describes the use of dry arthroscopy assisted by a minimally invasive retraction system. An autologous matrix–induced chondrogenesis procedure is used to illustrate this novel approach. PMID:24749035

Empirical State Error Covariance Matrix for Batch Estimation

NASA Technical Reports Server (NTRS)

Frisbee, Joe

2015-01-01

State estimation techniques effectively provide mean state estimates. However, the theoretical state error covariance matrices provided as part of these techniques often suffer from a lack of confidence in their ability to describe the uncertainty in the estimated states. By a reinterpretation of the equations involved in the weighted batch least squares algorithm, it is possible to directly arrive at an empirical state error covariance matrix. The proposed empirical state error covariance matrix will contain the effect of all error sources, known or not. This empirical error covariance matrix may be calculated as a side computation for each unique batch solution. Results based on the proposed technique will be presented for a simple, two observer and measurement error only problem.

An improved ray theory and transfer matrix method-based model for lightning electromagnetic pulses propagating in Earth-ionosphere waveguide and its applications

NASA Astrophysics Data System (ADS)

Qin, Zilong; Chen, Mingli; Zhu, Baoyou; Du, Ya-ping

2017-01-01

An improved ray theory and transfer matrix method-based model for a lightning electromagnetic pulse (LEMP) propagating in Earth-ionosphere waveguide (EIWG) is proposed and tested. The model involves the presentation of a lightning source, parameterization of the lower ionosphere, derivation of a transfer function representing all effects of EIWG on LEMP sky wave, and determination of attenuation mode of the LEMP ground wave. The lightning source is simplified as an electric point dipole standing on Earth surface with finite conductance. The transfer function for the sky wave is derived based on ray theory and transfer matrix method. The attenuation mode for the ground wave is solved from Fock's diffraction equations. The model is then applied to several lightning sferics observed in central China during day and night times within 1000 km. The results show that the model can precisely predict the time domain sky wave for all these observed lightning sferics. Both simulations and observations show that the lightning sferics in nighttime has a more complicated waveform than in daytime. Particularly, when a LEMP propagates from east to west (Φ = 270°) and in nighttime, its sky wave tends to be a double-peak waveform (dispersed sky wave) rather than a single peak one. Such a dispersed sky wave in nighttime may be attributed to the magneto-ionic splitting phenomenon in the lower ionosphere. The model provides us an efficient way for retrieving the electron density profile of the lower ionosphere and hence to monitor its spatial and temporal variations via lightning sferics.

Cutting and drilling of carbon fiber reinforced plastics (CFRP) by 70W short pulse nanosecond laser

NASA Astrophysics Data System (ADS)

Jaeschke, Peter; Stolberg, Klaus; Bastick, Stefan; Ziolkowski, Ewa; Roehner, Markus; Suttmann, Oliver; Overmeyer, Ludger

2014-02-01

Continuous carbon fibre reinforced plastics (CFRP) are recognized as having a significant lightweight construction potential for a wide variety of industrial applications. However, a today`s barrier for a comprehensive dissemination of CFRP structures is the lack of economic, quick and reliable manufacture processes, e.g. the cutting and drilling steps. In this paper, the capability of using pulsed disk lasers in CFRP machining is discussed. In CFRP processing with NIR lasers, carbon fibers show excellent optical absorption and heat dissipation, contrary to the plastics matrix. Therefore heat dissipation away from the laser focus into the material is driven by heat conduction of the fibres. The matrix is heated indirectly by heat transfer from the fibres. To cut CFRP, it is required to reach the melting temperature for thermoplastic matrix materials or the disintegration temperature for thermoset systems as well as the sublimation temperature of the reinforcing fibers simultaneously. One solution for this problem is to use short pulse nanosecond lasers. We have investigated CFRP cutting and drilling with such a laser (max. 7 mJ @ 10 kHz, 30 ns). This laser offers the opportunity of wide range parameter tuning for systematic process optimization. By applying drilling and cutting operations based on galvanometer scanning techniques in multi-cycle mode, excellent surface and edge characteristics in terms of delamination-free and intact fiber-matrix interface were achieved. The results indicate that nanosecond disk laser machining could consequently be a suitable tool for the automotive and aircraft industry for cutting and drilling steps.

Hierarchical analysis of the degradation of fibre-reinforced polymers under the presence of void imperfections

PubMed Central

2016-01-01

The subject of this work is the investigation of the influence of voids on the mechanical properties of fibre-reinforced polymers (FRPs) under compression loading. To specify the damage accumulation of FRPs in the presence of voids, the complex three-dimensional structure of the composite including voids was analysed and a reduced mechanical model composite was derived. The hierarchical analysis of the model composite on a micro-scale level implies the description of the stress and strain behaviour of the matrix using the photoelasticity technique and digital image correlation technology. These studies are presented along with an analytical examination of the stability of a single fibre. As a result of the experimental and analytical studies, the stiffness of the matrix and fibre as well as their bonding, the initial fibre orientation and the fibre diameter have the highest impact on the failure initiation. All these facts lead to a premature fibre–matrix debonding with ongoing loss of stability of the fibre and followed by kink-band formation. Additional studies on the meso-scale of transparent glass FRPs including a unique void showed that the experiments carried out on the model composites could be transferred to real composites. This article is part of the themed issue ‘Multiscale modelling of the structural integrity of composite materials’. PMID:27242296

Gelatin-based laser direct-write technique for the precise spatial patterning of cells.

PubMed

Schiele, Nathan R; Chrisey, Douglas B; Corr, David T

2011-03-01

Laser direct-writing provides a method to pattern living cells in vitro, to study various cell-cell interactions, and to build cellular constructs. However, the materials typically used may limit its long-term application. By utilizing gelatin coatings on the print ribbon and growth surface, we developed a new approach for laser cell printing that overcomes the limitations of Matrigel™. Gelatin is free of growth factors and extraneous matrix components that may interfere with cellular processes under investigation. Gelatin-based laser direct-write was able to successfully pattern human dermal fibroblasts with high post-transfer viability (91% ± 3%) and no observed double-strand DNA damage. As seen with atomic force microscopy, gelatin offers a unique benefit in that it is present temporarily to allow cell transfer, but melts and is removed with incubation to reveal the desired application-specific growth surface. This provides unobstructed cellular growth after printing. Monitoring cell location after transfer, we show that melting and removal of gelatin does not affect cellular placement; cells maintained registry within 5.6 ± 2.5 μm to the initial pattern. This study demonstrates the effectiveness of gelatin in laser direct-writing to create spatially precise cell patterns with the potential for applications in tissue engineering, stem cell, and cancer research.

Comparative absorption, electroabsorption and electrochemical studies of intervalence electron transfer and electronic coupling in cyanide-bridged bimetallic systems: ancillary ligand effects

NASA Astrophysics Data System (ADS)

Vance, Fredrick W.; Slone, Robert V.; Stern, Charlotte L.; Hupp, Joseph T.

2000-03-01

Electroabsorption or Stark spectroscopy has been used to evaluate the systems (NC) 5M II-CN-Ru III(NH 3) 51- and (NC) 5M II-CN-Ru III(NH 3) 4py 1-, where M II=Fe II or Ru II. When a pyridine ligand is present in the axial position on the Ru III acceptor, the effective optical electron transfer distance - as measured by the change in dipole moment, |Δ μ| - is increased by more than 35% relative to the ammine substituted counterpart. Comparison of the charge transfer distances to the crystal structure of Na[(CN) 5Fe-CN-Ru(NH 3) 4py] · 6H 2O reveals that the Stark derived distances are ˜50% to ˜90% of the geometric separation of the metal centers. The differences result in an upward revision in the Hush delocalization parameter, c b2, and of the electronic coupling matrix element, H ab, relative to those parameters obtained exclusively from electronic absorption measurements. The revised parameters are compared to those, which are obtained via electrochemical techniques and found to be in only fair agreement. We conclude that the absorption/electroabsorption analysis likely yields a more reliable set of mixing and coupling parameters.

Micro-oxygenation of red wine: techniques, applications, and outcomes.

PubMed

Schmidtke, Leigh M; Clark, Andrew C; Scollary, Geoff R

2011-02-01

Wine micro-oxygenation (MOX) is the controlled addition of oxygen to wine in a manner designed to ensure that complete mass transfer of molecular oxygen from gaseous to dissolved state occurs. MOX was initially developed to improve the body, structure, and fruitfulness in red wines with high concentrations of tannins and anthocyanins, by replicating the ingress of oxygen thought to arise from barrel maturation, but without the need for putting all wine to barrel. This review describes the operational parameters essential for the effective performance of the micro-oxidation process as well as the chemical and microbiological outcomes. The methodologies for introducing oxygen into the wine, the rates of oxygen addition, and their relationship to oxygen solubility in the wine matrix are examined. The review focuses on the techniques used for monitoring the MOX process, including sensory assessment, physicochemical properties, and the critical balance of the rate of oxygen addition in relation to maintaining the sulfur dioxide concentration. The chemistry of oxygen reactivity with wine components, the changes in wine composition that occur as a consequence of MOX, and the potential for wine spoilage if proper monitoring is not adopted are examined. Gaps in existing knowledge are addressed focusing on the limitations associated with the transfer of concepts from research trials in small volume tanks to commercial practice, and the dearth of kinetic data for the various chemical and physical processes that are claimed to occur during MOX.

A Novel Iterative Scheme for the Very Fast and Accurate Solution of Non-LTE Radiative Transfer Problems

NASA Astrophysics Data System (ADS)

Trujillo Bueno, J.; Fabiani Bendicho, P.

1995-12-01

Iterative schemes based on Gauss-Seidel (G-S) and optimal successive over-relaxation (SOR) iteration are shown to provide a dramatic increase in the speed with which non-LTE radiation transfer (RT) problems can be solved. The convergence rates of these new RT methods are identical to those of upper triangular nonlocal approximate operator splitting techniques, but the computing time per iteration and the memory requirements are similar to those of a local operator splitting method. In addition to these properties, both methods are particularly suitable for multidimensional geometry, since they neither require the actual construction of nonlocal approximate operators nor the application of any matrix inversion procedure. Compared with the currently used Jacobi technique, which is based on the optimal local approximate operator (see Olson, Auer, & Buchler 1986), the G-S method presented here is faster by a factor 2. It gives excellent smoothing of the high-frequency error components, which makes it the iterative scheme of choice for multigrid radiative transfer. This G-S method can also be suitably combined with standard acceleration techniques to achieve even higher performance. Although the convergence rate of the optimal SOR scheme developed here for solving non-LTE RT problems is much higher than G-S, the computing time per iteration is also minimal, i.e., virtually identical to that of a local operator splitting method. While the conventional optimal local operator scheme provides the converged solution after a total CPU time (measured in arbitrary units) approximately equal to the number n of points per decade of optical depth, the time needed by this new method based on the optimal SOR iterations is only √n/2√2. This method is competitive with those that result from combining the above-mentioned Jacobi and G-S schemes with the best acceleration techniques. Contrary to what happens with the local operator splitting strategy currently in use, these novel methods remain effective even under extreme non-LTE conditions in very fine grids.

Aeroelastic analysis of a troposkien-type wind turbine blade

NASA Technical Reports Server (NTRS)

Nitzsche, F.

1981-01-01

The linear aeroelastic equations for one curved blade of a vertical axis wind turbine in state vector form are presented. The method is based on a simple integrating matrix scheme together with the transfer matrix idea. The method is proposed as a convenient way of solving the associated eigenvalue problem for general support conditions.

Spectral analysis of the UFBG-based acousto—optical modulator in V-I transmission matrix formalism

NASA Astrophysics Data System (ADS)

Wu, Liang-Ying; Pei, Li; Liu, Chao; Wang, Yi-Qun; Weng, Si-Jun; Wang, Jian-Shuai

2014-11-01

In this study, the V-I transmission matrix formalism (V-I method) is proposed to analyze the spectrum characteristics of the uniform fiber Bragg grating (FBG)-based acousto—optic modulators (UFBG-AOM). The simulation results demonstrate that both the amplitude of the acoustically induced strain and the frequency of the acoustic wave (AW) have an effect on the spectrum. Additionally, the wavelength spacing between the primary reflectivity peak and the secondary reflectivity peak is proportional to the acoustic frequency with the ratio 0.1425 nm/MHz. Meanwhile, we compare the amount of calculation. For the FBG whose period is M, the calculation of the V-I method is 4 × (2M-1) in addition/subtraction, 8 × (2M - 1) in multiply/division and 2M in exponent arithmetic, which is almost a quarter of the multi-film method and transfer matrix (TM) method. The detailed analysis indicates that, compared with the conventional multi-film method and transfer matrix (TM) method, the V-I method is faster and less complex.

Unveiling the Semicoherent Interface with Definite Orientation Relationships between Reinforcements and Matrix in Novel Al3BC/Al Composites.

PubMed

Zhao, Yongfeng; Qian, Zhao; Ma, Xia; Chen, Houwen; Gao, Tong; Wu, Yuying; Liu, Xiangfa

2016-10-05

High-strength lightweight Al-based composites are promising materials for a wide range of applications. To provide high performance, a strong bonding interface for effective load transfer from the matrix to the reinforcement is essential. In this work, the novel Al 3 BC reinforced Al composites have been in situ fabricated through a liquid-solid reaction method and the bonding interface between Al 3 BC and Al matrix has been unveiled. The HRTEM characterizations on the Al 3 BC/Al interface verify it to be a semicoherent bonding structure with definite orientation relationships: (0001) Al 3 BC //(11̅1) Al ;[112̅0] Al 3 BC //[011] Al . Periodic arrays of geometrical misfit dislocations are also observed along the interface at each (0001) Al 3 BC plane or every five (11̅1) Al planes. This kind of interface between the reinforcement and the matrix is strong enough for effective load transfer, which would lead to the evidently improved strength and stiffness of the introduced new Al 3 BC/Al composites.

FDTD and transfer matrix methods for evaluating the performance of photonic crystal based microcavities for exciton-polaritons

NASA Astrophysics Data System (ADS)

Liu, Yi-Cheng; Byrnes, Tim

2016-11-01

We investigate alternative microcavity structures for exciton-polaritons consisting of photonic crystals instead of distributed Bragg reflectors. Finite-difference time-domain simulations and scattering transfer matrix methods are used to evaluate the cavity performance. The results are compared with conventional distributed Bragg reflectors. We find that in terms of the photon lifetime, the photonic crystal based microcavities are competitive, with typical lifetimes in the region of ∼20 ps being achieved. The photonic crystal microcavities have the advantage that they are compact and are frequency adjustable, showing that they are viable to investigate exciton-polariton condensation physics.

Critical speeds and forced response solutions for active magnetic bearing turbomachinery, part 2

NASA Technical Reports Server (NTRS)

Rawal, D.; Keesee, J.; Kirk, R. Gordon

1991-01-01

The need for better performance of turbomachinery with active magnetic bearings has necessitated a study of such systems for accurate prediction of their vibrational characteristics. A modification of existing transfer matrix methods for rotor analysis is presented to predict the response of rotor systems with active magnetic bearings. The position of the magnetic bearing sensors is taken into account and the effect of changing sensor position on the vibrational characteristics of the rotor system is studied. The modified algorithm is validated using a simpler Jeffcott model described previously. The effect of changing from a rotating unbalance excitation to a constant excitation in a single plane is also studied. A typical eight stage centrifugal compressor rotor is analyzed using the modified transfer matrix code. The results for a two mass Jeffcott model were presented previously. The results obtained by running this model with the transfer matrix method were compared with the results of the Jeffcott analysis for the purposes of verification. Also included are plots of amplitude versus frequency for the eight stage centrifugal compressor rotor. These plots demonstrate the significant influence that sensor location has on the amplitude and critical frequencies of the rotor system.

A hybrid finite element-transfer matrix model for vibroacoustic systems with flat and homogeneous acoustic treatments.

PubMed

Alimonti, Luca; Atalla, Noureddine; Berry, Alain; Sgard, Franck

2015-02-01

Practical vibroacoustic systems involve passive acoustic treatments consisting of highly dissipative media such as poroelastic materials. The numerical modeling of such systems at low to mid frequencies typically relies on substructuring methodologies based on finite element models. Namely, the master subsystems (i.e., structural and acoustic domains) are described by a finite set of uncoupled modes, whereas condensation procedures are typically preferred for the acoustic treatments. However, although accurate, such methodology is computationally expensive when real life applications are considered. A potential reduction of the computational burden could be obtained by approximating the effect of the acoustic treatment on the master subsystems without introducing physical degrees of freedom. To do that, the treatment has to be assumed homogeneous, flat, and of infinite lateral extent. Under these hypotheses, simple analytical tools like the transfer matrix method can be employed. In this paper, a hybrid finite element-transfer matrix methodology is proposed. The impact of the limiting assumptions inherent within the analytical framework are assessed for the case of plate-cavity systems involving flat and homogeneous acoustic treatments. The results prove that the hybrid model can capture the qualitative behavior of the vibroacoustic system while reducing the computational effort.

Method of bonding diamonds in a matrix and articles thus produced

DOEpatents

Taylor, G.W.

1981-01-27

By fluorinating diamond grit, the grit may be readily bonded into a fluorocarbon resin matrix. The matrix is formed by simple hot pressing techniques. Diamond grinding wheels may advantageously be manufactured using such a matrix. Teflon fluorocarbon resins are particularly well suited for using in forming the matrix.

Addressable test matrix for measuring analog transfer characteristics of test elements used for integrated process control and device evaluation

NASA Technical Reports Server (NTRS)

Buehler, Martin G. (Inventor)

1988-01-01

A set of addressable test structures, each of which uses addressing schemes to access individual elements of the structure in a matrix, is used to test the quality of a wafer before integrated circuits produced thereon are diced, packaged and subjected to final testing. The electrical characteristic of each element is checked and compared to the electrical characteristic of all other like elements in the matrix. The effectiveness of the addressable test matrix is in readily analyzing the electrical characteristics of the test elements and in providing diagnostic information.

A matrix equation solution by an optimization technique

NASA Technical Reports Server (NTRS)

Johnson, M. J.; Mittra, R.

1972-01-01

The computer solution of matrix equations is often difficult to accomplish due to an ill-conditioned matrix or high noise levels. Two methods of solution are compared for matrices of various degrees of ill-conditioning and for various noise levels in the right hand side vector. One method employs the usual Gaussian elimination. The other solves the equation by an optimization technique and employs a function minimization subroutine.

Bibliography on augmentation of convective heat and mass transfer-II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bergles, A.E.; Nirmalan, V.; Junkhan, G.H.

1983-12-01

Heat transfer augmentation has developed into a major specialty area in heat transfer research and development. This report presents and updated bibliography of world literature on augmentation. The literature is classified into passive augmentation techniques, which require no external power, and active techniques, which do require external power. The fifteen techniques are grouped in terms of their applications to the various modes of heat transfer. Mass transfer is included for completeness. Key words are included with each citation for technique/mode identification. The total number of publications cited is 3045, including 135 surveys of various techniques and 86 papers on performancemore » evaluation of passive techniques. Patents are not included, as they are the subject of a separate bibliographic report.« less

Bibliography on augmentation of convective heat and mass transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bergles, A.E.; Webb, R.L.; Junkhan, G.H.

1979-05-01

Heat transfer augmentation has developed into a major specialty area in heat transfer research and development. A bibliography of world literature on augmentation is presented. The literature is classified into passive augmentation techniques, which require no external power, and active techniques, which do require external power. The fourteen techniques are grouped in terms of their application to the various modes of heat transfer. Mass transfer is included for completeness. Key words are included with each citation for technique/mode identification. The total number of publications cited is 1,967, including 75 surveys of various techniques and 42 papers on performance evaluation ofmore » passive techniques. Patents are not included as they will be the subject of a future topical report.« less

A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

PubMed

Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

2014-05-15

Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. © 2013 Published by Elsevier B.V.

Effects of fiber/matrix interactions on the interfacial deformation micromechanics of cellulose-fiber/polymer composites

NASA Astrophysics Data System (ADS)

Tze, William Tai-Yin

The overall objective of this dissertation was to gain an understanding of the relationship between interfacial chemistry and the micromechanics of the cellulose-fiber/polymer composites. Regenerated cellulose (lyocell) fibers were treated with amine-, phenylamine-, phenyl-, and octadecyl-silanes, and also styrene-maleic anhydride copolymer. Inverse gas chromatography was conducted to evaluate the modified surfaces and to examine the adsorption behavior of ethylbenzene, a model compound for polystyrene, onto the fibers. Micro-composites were formed by depositing micro-droplets of polystyrene onto single fibers. The fiber was subjected to a tensile strain, and Raman spectroscopy was employed to determine the point-to-point variation of the strain- and stress-sensitive 895 cm-1 band of cellulose along the embedded region. Inverse gas chromatography studies reveal that the Ia-b values, calculated by matching the Lewis acid parameter ( KA) and basic parameter (KB) between polystyrene and different fibers, were closely correlated to the acid-base adsorption enthalpies of ethylbenzene onto the corresponding fibers. Hence, Ia-b was subsequently used as a convenient indicator for fiber/matrix acid-base interaction. The Raman micro-spectroscopic studies demonstrate that the interfacial tensile strain and stress are highest at the edge of the droplet, and these values decline from the edge region to the middle region of the embedment. The maximum of these local strains corresponds to a strain-control fracture of the matrix polymer. The minimum of the local tensile stress corresponds to the extent of fiber-to-matrix load transfer. The slope of the tensile stress profile allows for an estimation of the maximum interfacial shear stress, which is indicative of fiber/polymer (practical) adhesion. As such, a novel micro-Raman tensile technique was established for evaluating the ductile-fiber/brittle-polymer system in this study. The micro-Raman tensile technique provided maximum interfacial shear stress values of 8.0 to 13.8 MPa, ranking functional groups according to their practical adhesion to polystyrene: alkyl < untreated < phenyl = phenylamine = styrene copolymer < amine. Overall, interfacial bonding can be increased by increasing the acid-base interactions (Ia-b) or reducing the chemical incompatibility (Deltadelta) between the fibers and matrix. Therefore, interfacial chemistry can be employed to enhance and predict cellulose-fiber/polymer adhesion to better engineer composite properties and ultimately better utilize bio-resources.

New Factorization Techniques and Fast Serial and Parrallel Algorithms for Operational Space Control of Robot Manipulators

NASA Technical Reports Server (NTRS)

Fijany, Amir; Djouani, Karim; Fried, George; Pontnau, Jean

1997-01-01

In this paper a new factorization technique for computation of inverse of mass matrix, and the operational space mass matrix, as arising in implementation of the operational space control scheme, is presented.

Matrix Synthesis and Characterization

NASA Technical Reports Server (NTRS)

1984-01-01

The role of NASA in the area of composite material synthesis; evaluation techniques; prediction analysis techniques; solvent-resistant tough composite matrix; resistance to paint strippers; acceptable processing temperature and pressure for thermoplastics; and the role of computer modeling and fiber interface improvement were discussed.

Gene transfer device utilizing micron-spiked electrodes produced by the self-organization phenomenon of Fe-alloy.

PubMed

Miyano, Naoki; Inoue, Yuuki; Teramura, Yuji; Fujii, Keisuke; Tsumori, Fujio; Iwata, Hiroo; Kotera, Hidetoshi

2008-07-01

In the diffusional phase transformation of two-phase alloys, the new phase precipitates form the matrix phase at specific temperatures, followed by the formation of a mixed microstructure comprising the precipitate and the matrix. It has been found that by specific chemical-etching treatment, the precipitate in Fe-25Cr-6Ni alloy projects substantially and clusters at the surface. The configuration of the precipitate has an extremely high aspect ratio: it is several microns in width and several tens of microns in length (known as micron-spiked). This study targets the development of a gene transfer device with a micro-spike produced based on the self-organization phenomenon of the Fe-25Cr-6Ni alloy. With this spike-projected device, we tried to efficiently transfer plasmid DNA into adherent cells by electric pulse-triggered gene transfer using a plasmid-loaded electrode (electroporation-based reverse transfection). The spiked structure was applied to a substrate of the device to allow efficient gene transfer into adherent cells, although the general substrate was flat and had a smooth surface. The results suggest that this unique spike-projected device has potential applications in gene transfer devices for the analysis of the human genome in the post-genome period.

Growth factor transgenes interactively regulate articular chondrocytes.

PubMed

Shi, Shuiliang; Mercer, Scott; Eckert, George J; Trippel, Stephen B

2013-04-01

Adult articular chondrocytes lack an effective repair response to correct damage from injury or osteoarthritis. Polypeptide growth factors that stimulate articular chondrocyte proliferation and cartilage matrix synthesis may augment this response. Gene transfer is a promising approach to delivering such factors. Multiple growth factor genes regulate these cell functions, but multiple growth factor gene transfer remains unexplored. We tested the hypothesis that multiple growth factor gene transfer selectively modulates articular chondrocyte proliferation and matrix synthesis. We tested the hypothesis by delivering combinations of the transgenes encoding insulin-like growth factor I (IGF-I), fibroblast growth factor-2 (FGF-2), transforming growth factor beta1 (TGF-β1), bone morphogenetic protein-2 (BMP-2), and bone morphogenetic protien-7 (BMP-7) to articular chondrocytes and measured changes in the production of DNA, glycosaminoglycan, and collagen. The transgenes differentially regulated all these chondrocyte activities. In concert, the transgenes interacted to generate widely divergent responses from the cells. These interactions ranged from inhibitory to synergistic. The transgene pair encoding IGF-I and FGF-2 maximized cell proliferation. The three-transgene group encoding IGF-I, BMP-2, and BMP-7 maximized matrix production and also optimized the balance between cell proliferation and matrix production. These data demonstrate an approach to articular chondrocyte regulation that may be tailored to stimulate specific cell functions, and suggest that certain growth factor gene combinations have potential value for cell-based articular cartilage repair. Copyright © 2012 Wiley Periodicals, Inc.

Analysis of transition-metal acetylacetonate complexes by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

PubMed

Wyatt, Mark F; Havard, Stephen; Stein, Bridget K; Brenton, A Gareth

2008-01-01

Transition-metal acetylacetonate complexes of the form Metal(acac)(2), where Metal = Fe(II), Co(II), Ni(II), Cu(II), and Zn(II), and Metal(acac)(3), where Metal = V(III), Cr(III), Mn(III), Fe(III), and Co(III), were investigated by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS). The data was acquired using the aprotic, electron transfer matrix, 2-[(2E)-3-(4-tert-butylphenyl)-2-methylprop-2-enylidene]malononitrile (DCTB), and the observation of positive radical ions is shown clearly to depend on the metal element and the oxidation state it occupies. The ionization energy of DCTB was calculated to be 8.08 eV by density functional theory methods, which is notably lower than the experimental value, but within the range of other computational values. This value is very close to those of the analytes, so the existing electron transfer mechanism which is based on the ionization energies of the matrix and analyte, cannot be used predictively. Similarly, the data neither proves nor disproves the validity of the existing electron transfer ionization mechanism, with respect to metal coordination complexes without strong chromophores. In this case, periodic trends may be more useful in explaining the observed species and the prediction of species from sets of similar complexes. The addition of a sodium salt benefits the MALDI-TOFMS characterization of certain compounds studied, but the benefit of the addition of ammonium or silver salts is negligible.

Homogeneous matrix deposition on dried agar for MALDI imaging mass spectrometry of microbial cultures.

PubMed

Hoffmann, Thomas; Dorrestein, Pieter C

2015-11-01

Matrix deposition on agar-based microbial colonies for MALDI imaging mass spectrometry is often complicated by the complex media on which microbes are grown. This Application Note demonstrates how consecutive short spray pulses of a matrix solution can form an evenly closed matrix layer on dried agar. Compared with sieving dry matrix onto wet agar, this method supports analyte cocrystallization, which results in significantly more signals, higher signal-to-noise ratios, and improved ionization efficiency. The even matrix layer improves spot-to-spot precision of measured m/z values when using TOF mass spectrometers. With this technique, we established reproducible imaging mass spectrometry of myxobacterial cultures on nutrient-rich cultivation media, which was not possible with the sieving technique. Graphical Abstract ᅟ.

Wear study of Al-SiC metal matrix composites processed through microwave energy

NASA Astrophysics Data System (ADS)

Honnaiah, C.; Srinath, M. S.; Prasad, S. L. Ajit

2018-04-01

Particulate reinforced metal matrix composites are finding wider acceptance in many industrial applications due to their isotropic properties and ease of manufacture. Uniform distribution of reinforcement particulates and good bonding between matrix and reinforcement phases are essential features in order to obtain metal matrix composites with improved properties. Conventional powder metallurgy technique can successfully overcome the limitation of stir casting techniques, but it is time consuming and not cost effective. Use of microwave technology for processing particulate reinforced metal matrix composites through powder metallurgy technique is being increasingly explored in recent times because of its cost effectiveness and speed of processing. The present work is an attempt to process Al-SiC metal matrix composites using microwaves irradiated at 2.45 GHz frequency and 900 W power for 10 minutes. Further, dry sliding wear studies were conducted at different loads at constant velocity of 2 m/s for various sliding distances using pin-on-disc equipment. Analysis of the obtained results show that the microwave processed Al-SiC composite material shows around 34 % of resistance to wear than the aluminium alloy.

Comparison of encryption techniques between chaos theory and password for wireless power transfer system: A review

NASA Astrophysics Data System (ADS)

Hussin, N. H.; Azizan, M. M.; Ali, A.; Albreem, M. A. M.

2017-09-01

This paper reviews the techniques used in Wireless power transfer (WPT). WPT is one of the most useful ways to transfer power. Based on power transfer distances, the WPT system can be divided into three categories, namely, near, medium, and far fields. Inductive coupling and capacitive coupling contactless techniques are used in the near-field WPT. Magnetic resonant coupling technique is used in the medium-field WPT. Electromagnetic radiation is used in the far-field WPT. In addition, energy encryption plays a major role in ensuring that power is transferred to the true receiver. Therefore, this paper reviews the energy encryption techniques in WPT system. A comparison between different technique shows that the distance, efficiency, and number of receivers are the main factors in selecting the suitable energy encryption technique.

Resonant electronic excitation energy transfer by exchange mechanism in the quantum dot system

NASA Astrophysics Data System (ADS)

Chikalova-Luzina, O. P.; Samosvat, D. M.; Vyatkin, V. M.; Zegrya, G. G.

2017-11-01

A microscopic theory of nonradiative resonance energy transfer between spherical A3B5 semiconductor quantum dots by the exchange mechanism is suggested. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same A3B5 compound and are embedded in the matrix of another material that produces potential barriers for electrons and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found in the frame of the Kane model that provides the most adequate description of the real spectra of A3B5 semiconductors. The analytical treatment is carried out with using the density matrix method, which enabled us to perform an energy transfer analysis both in the weak-interaction approximation and in the strong-interaction approximation. The numerical calculations showed the saturation of the energy transfer rate at the distances between the donor and the acceptor approaching the contact one. The contributions of the exchange and direct Coulomb intractions can be of the same order at the small distances and can have the same value in the saturation range.

Heat exchanger and method of making. [bonding rocket chambers with a porous metal matrix

NASA Technical Reports Server (NTRS)

Fortini, A.; Kazaroff, J. M. (Inventor)

1978-01-01

A heat exchanger of increased effectiveness is disclosed. A porous metal matrix is disposed in a metal chamber or between walls through which a heat-transfer fluid is directed. The porous metal matrix has internal bonds and is bonded to the chamber in order to remove all thermal contact resistance within the composite structure. Utilization of the invention in a rocket chamber is disclosed as a specific use. Also disclosed is a method of constructing the heat exchanger.

Enhanced Mechanical Properties of Graphene (Reduced Graphene Oxide)/Aluminum Composites with a Bioinspired Nanolaminated Structure.

PubMed

Li, Zan; Guo, Qiang; Li, Zhiqiang; Fan, Genlian; Xiong, Ding-Bang; Su, Yishi; Zhang, Jie; Zhang, Di

2015-12-09

Bulk graphene (reduced graphene oxide)-reinforced Al matrix composites with a bioinspired nanolaminated microstructure were fabricated via a composite powder assembly approach. Compared with the unreinforced Al matrix, these composites were shown to possess significantly improved stiffness and tensile strength, and a similar or even slightly higher total elongation. These observations were interpreted by the facilitated load transfer between graphene and the Al matrix, and the extrinsic toughening effect as a result of the nanolaminated microstructure.

Solving large-scale PDE-constrained Bayesian inverse problems with Riemann manifold Hamiltonian Monte Carlo

NASA Astrophysics Data System (ADS)

Bui-Thanh, T.; Girolami, M.

2014-11-01

We consider the Riemann manifold Hamiltonian Monte Carlo (RMHMC) method for solving statistical inverse problems governed by partial differential equations (PDEs). The Bayesian framework is employed to cast the inverse problem into the task of statistical inference whose solution is the posterior distribution in infinite dimensional parameter space conditional upon observation data and Gaussian prior measure. We discretize both the likelihood and the prior using the H1-conforming finite element method together with a matrix transfer technique. The power of the RMHMC method is that it exploits the geometric structure induced by the PDE constraints of the underlying inverse problem. Consequently, each RMHMC posterior sample is almost uncorrelated/independent from the others providing statistically efficient Markov chain simulation. However this statistical efficiency comes at a computational cost. This motivates us to consider computationally more efficient strategies for RMHMC. At the heart of our construction is the fact that for Gaussian error structures the Fisher information matrix coincides with the Gauss-Newton Hessian. We exploit this fact in considering a computationally simplified RMHMC method combining state-of-the-art adjoint techniques and the superiority of the RMHMC method. Specifically, we first form the Gauss-Newton Hessian at the maximum a posteriori point and then use it as a fixed constant metric tensor throughout RMHMC simulation. This eliminates the need for the computationally costly differential geometric Christoffel symbols, which in turn greatly reduces computational effort at a corresponding loss of sampling efficiency. We further reduce the cost of forming the Fisher information matrix by using a low rank approximation via a randomized singular value decomposition technique. This is efficient since a small number of Hessian-vector products are required. The Hessian-vector product in turn requires only two extra PDE solves using the adjoint technique. Various numerical results up to 1025 parameters are presented to demonstrate the ability of the RMHMC method in exploring the geometric structure of the problem to propose (almost) uncorrelated/independent samples that are far away from each other, and yet the acceptance rate is almost unity. The results also suggest that for the PDE models considered the proposed fixed metric RMHMC can attain almost as high a quality performance as the original RMHMC, i.e. generating (almost) uncorrelated/independent samples, while being two orders of magnitude less computationally expensive.

Liquid-Crystal Thermosets, a New Generation of High-Performance Liquid-Crystal Polymers

NASA Technical Reports Server (NTRS)

Dingemans, Theo; Weiser, Erik; Hou, Tan; Jensen, Brian; St. Clair, Terry

2004-01-01

One of the major challenges for NASA's next-generation reusable-launch-vehicle (RLV) program is the design of a cryogenic lightweight composite fuel tank. Potential matrix resin systems need to exhibit a low coefficient of thermal expansion (CTE), good mechanical strength, and excellent barrier properties at cryogenic temperatures under load. In addition, the resin system needs to be processable by a variety of non-autoclavable techniques, such as vacuum-bag curing, resin-transfer molding (RTM), vacuum-assisted resin-transfer molding (VaRTM), resin-film infusion (RFI), pultrusion, and advanced tow placement (ATP). To meet these requirements, the Advanced Materials and Processing Branch (AMPB) at NASA Langley Research Center developed a new family of wholly aromatic liquid-crystal oligomers that can be processed and thermally cross-linked while maintaining their liquid-crystal order. All the monomers were polymerized in the presence of a cross-linkable unit by use of an environmentally benign melt-condensation technique. This method does not require hazardous solvents, and the only side product is acetic acid. The final product can be obtained as a powder or granulate and has an infinite shelf life. The obtained oligomers melt into a nematic phase and do not exhibit isotropization temperatures greater than the temperatures of decomposition (Ti > T(sub dec)). Three aromatic formulations were designed and tested and included esters, ester-amides, and ester-imides. One of the major advantages of this invention, named LaRC-LCR or Langley Research Center-Liquid Crystal Resin, is the ability to control a variety of resin characteristics, such as melting temperature, viscosity, and the cross-link density of the final part. Depending on the formulation, oligomers can be prepared with melt viscosities in the range of 10-10,000 poise (100 rad/s), which can easily be melt-processed using a variety of composite-processing techniques. This capability provides NASA with custom-made matrix resins that meet the required processing conditions for the fabrication of textile composites. Once the resin is in place, the temperature is raised to 375 C and the oligomers are cross-linked into a high-glass-transition-temperature (Tg) nematic network without releasing volatiles. The mechanical properties of the fully crosslinked, composite articles are comparable to typical composites based on commercially available epoxy resins.

Transfer matrix method for dynamics modeling and independent modal space vibration control design of linear hybrid multibody system

NASA Astrophysics Data System (ADS)

Rong, Bao; Rui, Xiaoting; Lu, Kun; Tao, Ling; Wang, Guoping; Ni, Xiaojun

2018-05-01

In this paper, an efficient method of dynamics modeling and vibration control design of a linear hybrid multibody system (MS) is studied based on the transfer matrix method. The natural vibration characteristics of a linear hybrid MS are solved by using low-order transfer equations. Then, by constructing the brand-new body dynamics equation, augmented operator and augmented eigenvector, the orthogonality of augmented eigenvector of a linear hybrid MS is satisfied, and its state space model expressed in each independent model space is obtained easily. According to this dynamics model, a robust independent modal space-fuzzy controller is designed for vibration control of a general MS, and the genetic optimization of some critical control parameters of fuzzy tuners is also presented. Two illustrative examples are performed, which results show that this method is computationally efficient and with perfect control performance.

Tablet potency of Tianeptine in coated tablets by near infrared spectroscopy: model optimisation, calibration transfer and confidence intervals.

PubMed

Boiret, Mathieu; Meunier, Loïc; Ginot, Yves-Michel

2011-02-20

A near infrared (NIR) method was developed for determination of tablet potency of active pharmaceutical ingredient (API) in a complex coated tablet matrix. The calibration set contained samples from laboratory and production scale batches. The reference values were obtained by high performance liquid chromatography (HPLC) and partial least squares (PLS) regression was used to establish a model. The model was challenged by calculating tablet potency of two external test sets. Root mean square errors of prediction were respectively equal to 2.0% and 2.7%. To use this model with a second spectrometer from the production field, a calibration transfer method called piecewise direct standardisation (PDS) was used. After the transfer, the root mean square error of prediction of the first test set was 2.4% compared to 4.0% without transferring the spectra. A statistical technique using bootstrap of PLS residuals was used to estimate confidence intervals of tablet potency calculations. This method requires an optimised PLS model, selection of the bootstrap number and determination of the risk. In the case of a chemical analysis, the tablet potency value will be included within the confidence interval calculated by the bootstrap method. An easy to use graphical interface was developed to easily determine if the predictions, surrounded by minimum and maximum values, are within the specifications defined by the regulatory organisation. Copyright © 2010 Elsevier B.V. All rights reserved.

Assessment of the Accuracy of the Conventional Ray-Tracing Technique: Implications in Remote Sensing and Radiative Transfer Involving Ice Clouds.

NASA Technical Reports Server (NTRS)

Bi, Lei; Yang, Ping; Liu, Chao; Yi, Bingqi; Baum, Bryan A.; Van Diedenhoven, Bastiaan; Iwabuchi, Hironobu

2014-01-01

A fundamental problem in remote sensing and radiative transfer simulations involving ice clouds is the ability to compute accurate optical properties for individual ice particles. While relatively simple and intuitively appealing, the conventional geometric-optics method (CGOM) is used frequently for the solution of light scattering by ice crystals. Due to the approximations in the ray-tracing technique, the CGOM accuracy is not well quantified. The result is that the uncertainties are introduced that can impact many applications. Improvements in the Invariant Imbedding T-matrix method (II-TM) and the Improved Geometric-Optics Method (IGOM) provide a mechanism to assess the aforementioned uncertainties. The results computed by the II-TMþIGOM are considered as a benchmark because the IITM solves Maxwell's equations from first principles and is applicable to particle size parameters ranging into the domain at which the IGOM has reasonable accuracy. To assess the uncertainties with the CGOM in remote sensing and radiative transfer simulations, two independent optical property datasets of hexagonal columns are developed for sensitivity studies by using the CGOM and the II-TMþIGOM, respectively. Ice cloud bulk optical properties obtained from the two datasets are compared and subsequently applied to retrieve the optical thickness and effective diameter from Moderate Resolution Imaging Spectroradiometer (MODIS) measurements. Additionally, the bulk optical properties are tested in broadband radiative transfer (RT) simulations using the general circulation model (GCM) version of the Rapid Radiative Transfer Model (RRTMG) that is adopted in the National Center for Atmospheric Research (NCAR) Community Atmosphere Model (CAM, version 5.1). For MODIS retrievals, the mean bias of uncertainties of applying the CGOM in shortwave bands (0.86 and 2.13 micrometers) can be up to 5% in the optical thickness and as high as 20% in the effective diameter, depending on cloud optical thickness and effective diameter. In the MODIS infrared window bands centered at 8.5, 11, and 12 micrometers biases in the optical thickness and effective diameter are up to 12% and 10%, respectively. The CGOM-based simulation errors in ice cloud radiative forcing calculations are on the order of 10Wm(exp 2).

A real time spectrum to dose conversion system

NASA Technical Reports Server (NTRS)

Farmer, B. J.; Johnson, J. H.; Bagwell, R. G.

1972-01-01

A system has been developed which permits the determination of dose in real time or near real time directly from the pulse-height output of a radiation spectrometer. The technique involves the use of the resolution matrix of a spectrometer, the radiation energy-to-dose conversion function, and the geometrical factors, although the order of matrix operations is reversed. The new technique yields a result which is mathematically identical to the standard method while requiring no matrix manipulations or resolution matrix storage in the remote computer. It utilizes only a single function for each type dose required and each geometric factor involved.

A Technique for Facile and Precise Transfer of Mouse Embryos

PubMed Central

Sarvari, Ali; Naderi, Mohammad Mehdi; Sadeghi, Mohammad Reza; Akhondi, Mohammad Mehdi

2013-01-01

Background Successful Embryo Transfer (ET) technique is a fateful step of all efforts to achieve live births from in vitro produced embryos in assisted reproductive techniques or in knockout, transgenic or cloned animal projects. Small reproductive tract of mice and limitation of current techniques may not well satisfy the requirements for mass production of genetically modified mice. Genetic abnormalities of embryos, receptivity and uterine contractions, expulsion of embryos, blood, mucus or bacterial contamination on the transfer pipette tip, technical problems and even animal strain may affect embryo transfer outcome. Methods In this study, two techniques of embryo transfer in mice were compared. In conventional technique the oviduct wall was punctured with a 30-gauge needle and the loaded Pasteur pipette with embryos and medium was inserted into the hole. In new technique, embryos that were loaded in modified micropipette with minimal medium were transferred directly to the oviduct by manual piston micro-pump easily. Embryo viability was evaluated considering the percentage of live healthy newborns. Results Results of the two techniques were compared by t-test within the NPAR1WAY procedure of SAS software (ver. 9.2). The average live birth rates in the novel methods was significantly higher (42.4%) than the conventional method (21.7%, p<0.05). Conclusion In conclusion, using new embryo transfer technique improved birth rate by preventing embryos expulsion from the oviduct, saving time and easy transfer of embryos with minimum volume of medium. PMID:23626878

Combinatorial techniques to efficiently investigate and optimize organic thin film processing and properties.

PubMed

Wieberger, Florian; Kolb, Tristan; Neuber, Christian; Ober, Christopher K; Schmidt, Hans-Werner

2013-04-08

In this article we present several developed and improved combinatorial techniques to optimize processing conditions and material properties of organic thin films. The combinatorial approach allows investigations of multi-variable dependencies and is the perfect tool to investigate organic thin films regarding their high performance purposes. In this context we develop and establish the reliable preparation of gradients of material composition, temperature, exposure, and immersion time. Furthermore we demonstrate the smart application of combinations of composition and processing gradients to create combinatorial libraries. First a binary combinatorial library is created by applying two gradients perpendicular to each other. A third gradient is carried out in very small areas and arranged matrix-like over the entire binary combinatorial library resulting in a ternary combinatorial library. Ternary combinatorial libraries allow identifying precise trends for the optimization of multi-variable dependent processes which is demonstrated on the lithographic patterning process. Here we verify conclusively the strong interaction and thus the interdependency of variables in the preparation and properties of complex organic thin film systems. The established gradient preparation techniques are not limited to lithographic patterning. It is possible to utilize and transfer the reported combinatorial techniques to other multi-variable dependent processes and to investigate and optimize thin film layers and devices for optical, electro-optical, and electronic applications.

Auto-Bäcklund transformations for a matrix partial differential equation

NASA Astrophysics Data System (ADS)

Gordoa, P. R.; Pickering, A.

2018-07-01

We derive auto-Bäcklund transformations, analogous to those of the matrix second Painlevé equation, for a matrix partial differential equation. We also then use these auto-Bäcklund transformations to derive matrix equations involving shifts in a discrete variable, a process analogous to the use of the auto-Bäcklund transformations of the matrix second Painlevé equation to derive a discrete matrix first Painlevé equation. The equations thus derived then include amongst other examples a semidiscrete matrix equation which can be considered to be an extension of this discrete matrix first Painlevé equation. The application of this technique to the auto-Bäcklund transformations of the scalar case of our partial differential equation has not been considered before, and so the results obtained here in this scalar case are also new. Other equations obtained here using this technique include a scalar semidiscrete equation which arises in the case of the second Painlevé equation, and which does not seem to have been thus derived previously.

Ash deposits - Initiating the change from empiricism to generic engineering. Part 1: The generic approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagoner, C.L.; Wessel, R.A.

1986-01-01

Empiricism has traditionally been used to relate laboratory and pilot-scale measurements of fuel characteristics with the design, performance, and the slagging and fouling behavior of steam generators. Currently, a new engineering approach is being evaluated. The goal is to develop and use calculations and measurements from several engineering disciplines that exceed the demonstrated limitations of present empirical techniques for predicting slagging/fouling behavior. In Part I of this paper, the generic approach to deposits and boiler performance is defined and a matrix of engineering concepts is described. General relationships are presented for assessing the effects of deposits and sootblowing on themore » real-time performance of heat transfer surfaces in pilot- and commercial-scale steam generators.« less

FAST TRACK COMMUNICATION Critical exponents of domain walls in the two-dimensional Potts model

NASA Astrophysics Data System (ADS)

Dubail, Jérôme; Lykke Jacobsen, Jesper; Saleur, Hubert

2010-12-01

We address the geometrical critical behavior of the two-dimensional Q-state Potts model in terms of the spin clusters (i.e. connected domains where the spin takes a constant value). These clusters are different from the usual Fortuin-Kasteleyn clusters, and are separated by domain walls that can cross and branch. We develop a transfer matrix technique enabling the formulation and numerical study of spin clusters even when Q is not an integer. We further identify geometrically the crossing events which give rise to conformal correlation functions. This leads to an infinite series of fundamental critical exponents h_{\\ell _1-\\ell _2,2\\ell _1}, valid for 0 <= Q <= 4, that describe the insertion of ell1 thin and ell2 thick domain walls.

Lattice modeling and calibration with turn-by-turn orbit data

NASA Astrophysics Data System (ADS)

Huang, Xiaobiao; Sebek, Jim; Martin, Don

2010-11-01

A new method that explores turn-by-turn beam position monitor (BPM) data to calibrate lattice models of accelerators is proposed. The turn-by-turn phase space coordinates at one location of the ring are first established using data from two BPMs separated by a simple section with a known transfer matrix, such as a drift space. The phase space coordinates are then tracked with the model to predict positions at other BPMs, which can be compared to measurements. The model is adjusted to minimize the difference between the measured and predicted orbit data. BPM gains and rolls are included as fitting variables. This technique can be applied to either the entire or a section of the ring. We have tested the method experimentally on a part of the SPEAR3 ring.

Octonacci photonic crystals with negative refraction index materials

NASA Astrophysics Data System (ADS)

Brandão, E. R.; Vasconcelos, M. S.; Anselmo, D. H. A. L.

2016-12-01

We investigate the optical transmission spectra for s-polarized (TE) and p-polarized (TM) waves in one-dimensional photonic quasicrystals on a quasiperiodic multilayer structure made up by alternate layers of SiO2 and metamaterials, organized by following the Octonacci sequence. Maxwell's equations and the transfer-matrix technique are used to derive the transmission spectra for the propagation of normally and obliquely incident optical fields. We assume Drude-Lorentz-type dispersive response for the dielectric permittivity and magnetic permeability of the metamaterials. For normally incident waves, we observe that the spectra does not have self-similar behavior or mirror symmetry and it also features the absence of optical band gap. Also for normally incident waves, we show regions of full transmittance when the incident angle θC = 0° in a particular frequency range.

A multi-state fragment charge difference approach for diabatic states in electron transfer: Extension and automation

NASA Astrophysics Data System (ADS)

Yang, Chou-Hsun; Hsu, Chao-Ping

2013-10-01

The electron transfer (ET) rate prediction requires the electronic coupling values. The Generalized Mulliken-Hush (GMH) and Fragment Charge Difference (FCD) schemes have been useful approaches to calculate ET coupling from an excited state calculation. In their typical form, both methods use two eigenstates in forming the target charge-localized diabatic states. For problems involve three or four states, a direct generalization is possible, but it is necessary to pick and assign the locally excited or charge-transfer states involved. In this work, we generalize the 3-state scheme for a multi-state FCD without the need of manual pick or assignment for the states. In this scheme, the diabatic states are obtained separately in the charge-transfer or neutral excited subspaces, defined by their eigenvalues in the fragment charge-difference matrix. In each subspace, the Hamiltonians are diagonalized, and there exist off-diagonal Hamiltonian matrix elements between different subspaces, particularly the charge-transfer and neutral excited diabatic states. The ET coupling values are obtained as the corresponding off-diagonal Hamiltonian matrix elements. A similar multi-state GMH scheme can also be developed. We test the new multi-state schemes for the performance in systems that have been studied using more than two states with FCD or GMH. We found that the multi-state approach yields much better charge-localized states in these systems. We further test for the dependence on the number of state included in the calculation of ET couplings. The final coupling values are converged when the number of state included is increased. In one system where experimental value is available, the multi-state FCD coupling value agrees better with the previous experimental result. We found that the multi-state GMH and FCD are useful when the original two-state approach fails.

Numerical simulations of electromagnetic scattering by Solar system objects

NASA Astrophysics Data System (ADS)

Dlugach, Janna M.

2016-11-01

Having been profoundly stimulated by the seminal work of Viktor V. Sobolev, I have been involved in multi-decadal research in the fields of radiative transfer, electromagnetic scattering by morphologically complex particles and particulate media, and planetary remote sensing. Much of this research has been done in close collaboration with other "descendants" of Academician Sobolev. This tutorial paper gives a representative overview of the results of extensive numerical simulations (in the vast majority carried out in collaboration with Michael Mishchenko) used to analyze remote-sensing observations of Solar system objects and based on highly accurate methods of the radiative transfer theory and direct computer solvers of the Maxwell equations. Using the atmosphere of Jupiter as a proving ground and performing T-matrix and radiative-transfer calculations helps demonstrate the strong effect of aerosol-particle shapes on the accuracy of remote-sensing retrievals. I then discuss the application of the T-matrix method, a numerically exact solution of the vector radiative transfer equation, and the theory of coherent backscattering to an analysis of polarimetric radar observations of Saturn's rings. Numerical modeling performed by using the superposition T-matrix method in application to cometary dust in the form of aggregates serves to reproduce the results of polarimetric observations of the distant comet C/2010 S1. On the basis of direct computer solutions of the Maxwell equations, it is demonstrated that all backscattering effects predicted by the low-density theories of radiative transfer and coherent backscattering can also be identified for media with volume packing densities typically encountered in natural and artificial environments. This result implies that spectacular opposition effects observed for some high-albedo atmoshereless Solar system bodies can be attributed to coherent backscattering of sunlight by regolith layers composed of microscopic particles.

Boundary transfer matrices and boundary quantum KZ equations

NASA Astrophysics Data System (ADS)

Vlaar, Bart

2015-07-01

A simple relation between inhomogeneous transfer matrices and boundary quantum Knizhnik-Zamolodchikov (KZ) equations is exhibited for quantum integrable systems with reflecting boundary conditions, analogous to an observation by Gaudin for periodic systems. Thus, the boundary quantum KZ equations receive a new motivation. We also derive the commutativity of Sklyanin's boundary transfer matrices by merely imposing appropriate reflection equations, in particular without using the conditions of crossing symmetry and unitarity of the R-matrix.

Novel Architectures for Achieving Direct Electron Transfer in Enzymatic Biofuel Cells

NASA Astrophysics Data System (ADS)

Blaik, Rita A.

Enzymatic biofuel cells are a promising source of alternative energy for small device applications, but still face the challenge of achieving direct electron transfer with high enzyme concentrations in a simple system. In this dissertation, methods of constructing electrodes consisting of enzymes attached to nanoparticle-enhanced substrates that serve as high surface area templates are evaluated. In the first method described, glucose oxidase is covalently attached to gold nanoparticles that are assembled onto genetically engineered M13 bacteriophage. The resulting anodes achieve a high peak current per area and a significant improvement in enzyme surface coverage. In the second system, fructose dehydrogenase, a membrane-bound enzyme that has the natural ability to achieve direct electron transfer, is immobilized into a matrix consisting of binders and carbon nanotubes to extend the lifetime of the anode. For the cathode, bilirubin oxidase is immobilized in a carbon nanotube and sol-gel matrix to achieve direct electron transfer. Finally, a full fuel cell consisting of both an anode and cathode is constructed and evaluated with each system described.

Transfer-matrices for series-type microwave antenna circuits. [L-band radiometer

NASA Technical Reports Server (NTRS)

Schmidt, R. F.

1981-01-01

Transfer matrices are developed which permit analysis and computer evaluation of certain series type microwave antenna circuits associated with an L-Band microwave radiometer (LBMR) under investigation at Goddard Space Flight Center. This radiometer is one of several diverse instrument designs to be used for the determination of soil moisture, sea state, salinity, and temperature data. Four port matrix notation is used throughout for the evaluation of LBMR circuits with mismatched couplers and lossy transmission lines. Matrix parameters in examples are predicted on an impedance analysis and an assumption of an array aperture distribution. The notation presented is easily adapted to longer and more varied chains of matrices, and to matrices of larger dimension.

Systems identification technology development for large space systems

NASA Technical Reports Server (NTRS)

Armstrong, E. S.

1982-01-01

A methodology for synthesizinng systems identification, both parameter and state, estimation and related control schemes for flexible aerospace structures is developed with emphasis on the Maypole hoop column antenna as a real world application. Modeling studies of the Maypole cable hoop membrane type antenna are conducted using a transfer matrix numerical analysis approach. This methodology was chosen as particularly well suited for handling a large number of antenna configurations of a generic type. A dedicated transfer matrix analysis, both by virtue of its specialization and the inherently easy compartmentalization of the formulation and numerical procedures, is significantly more efficient not only in computer time required but, more importantly, in the time needed to review and interpret the results.

Matrix resin effects in composite delamination - Mode I fracture aspects

NASA Technical Reports Server (NTRS)

Hunston, Donald L.; Moulton, Richard J.; Johnston, Norman J.; Bascom, Willard D.

1987-01-01

A number of thermoset, toughened thermoset, and thermoplastic resin matrix systems were characterized for Mode I critical strain energy release rates, and their composites were tested for interlaminar critical strain energy release rates using the double cantilever beam method. A clear correlation is found between the two sets of data. With brittle resins, the interlaminar critical strain energy release rates are somewhat larger than the neat resin values due to a full transfer of the neat resin toughness to the composite and toughening mechanisms associated with crack growth. With tougher matrices, the higher critical strain energy release rates are only partially transferred to the composites, presumably because the fibers restrict the crack-tip deformation zones.

Temperature distribution of thick thermoset composites

NASA Astrophysics Data System (ADS)

Guo, Zhan-Sheng; Du, Shanyi; Zhang, Boming

2004-05-01

The development of temperature distribution of thick polymeric matrix laminates during an autoclave vacuum bag process was measured and compared with numerically calculated results. The finite element formulation of the transient heat transfer problem was carried out for polymeric matrix composite materials from the heat transfer differential equations including internal heat generation produced by exothermic chemical reactions. Software based on the general finite element software package was developed for numerical simulation of the entire composite process. From the experimental and numerical results, it was found that the measured temperature profiles were in good agreement with the numerical ones, and conventional cure cycles recommended by prepreg manufacturers for thin laminates should be modified to prevent temperature overshoot.

Fluorinated diamond bonded in fluorocarbon resin

DOEpatents

Taylor, Gene W.

1982-01-01

By fluorinating diamond grit, the grit may be readily bonded into a fluorocarbon resin matrix. The matrix is formed by simple hot pressing techniques. Diamond grinding wheels may advantageously be manufactured using such a matrix. Teflon fluorocarbon resins are particularly well suited for using in forming the matrix.

An Empirical State Error Covariance Matrix for the Weighted Least Squares Estimation Method

NASA Technical Reports Server (NTRS)

Frisbee, Joseph H., Jr.

2011-01-01

State estimation techniques effectively provide mean state estimates. However, the theoretical state error covariance matrices provided as part of these techniques often suffer from a lack of confidence in their ability to describe the un-certainty in the estimated states. By a reinterpretation of the equations involved in the weighted least squares algorithm, it is possible to directly arrive at an empirical state error covariance matrix. This proposed empirical state error covariance matrix will contain the effect of all error sources, known or not. Results based on the proposed technique will be presented for a simple, two observer, measurement error only problem.

Convergence of Chahine's nonlinear relaxation inversion method used for limb viewing remote sensing

NASA Technical Reports Server (NTRS)

Chu, W. P.

1985-01-01

The application of Chahine's (1970) inversion technique to remote sensing problems utilizing the limb viewing geometry is discussed. The problem considered here involves occultation-type measurements and limb radiance-type measurements from either spacecraft or balloon platforms. The kernel matrix of the inversion problem is either an upper or lower triangular matrix. It is demonstrated that the Chahine inversion technique always converges, provided the diagonal elements of the kernel matrix are nonzero.

Matrix form of Legendre polynomials for solving linear integro-differential equations of high order

NASA Astrophysics Data System (ADS)

Kammuji, M.; Eshkuvatov, Z. K.; Yunus, Arif A. M.

2017-04-01

This paper presents an effective approximate solution of high order of Fredholm-Volterra integro-differential equations (FVIDEs) with boundary condition. Legendre truncated series is used as a basis functions to estimate the unknown function. Matrix operation of Legendre polynomials is used to transform FVIDEs with boundary conditions into matrix equation of Fredholm-Volterra type. Gauss Legendre quadrature formula and collocation method are applied to transfer the matrix equation into system of linear algebraic equations. The latter equation is solved by Gauss elimination method. The accuracy and validity of this method are discussed by solving two numerical examples and comparisons with wavelet and methods.

Theoretical study of solvent effects on the electronic coupling matrix elements in rigidly linked donor-acceptor systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cave, R.J.; Newton, M.D.; Kumar, K.

1995-12-07

The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.

Upper limb kinetic analysis of three sitting pivot wheelchair transfer techniques.

PubMed

Koontz, Alicia M; Kankipati, Padmaja; Lin, Yen-Sheng; Cooper, Rory A; Boninger, Michael L

2011-11-01

The objective of this study was to investigate differences in shoulder, elbow and hand kinetics while performing three different SPTs that varied in terms of hand and trunk positioning. Fourteen unimpaired individuals (8 male and 6 female) performed three variations of sitting pivot transfers in a random order from a wheelchair to a level tub bench. Two transfers involved a forward flexed trunk (head-hips technique) and the third with the trunk remaining upright. The two transfers involving a head hips technique were performed with two different leading hand initial positions. Motion analysis equipment recorded upper body movements and force sensors recorded hand reaction forces. Shoulder and elbow joint and hand kinetics were computed for the lift phase of the transfer. Transferring using either of the head hips techniques compared to the trunk upright style of transferring resulted in reduced superior forces at the shoulder (P<0.002), elbow (P<0.004) and hand (P<0.013). There was a significant increase in the medial forces in the leading elbow (P=0.049) for both head hip transfers and the trailing hand for the head hip technique with the arm further away from the body (P<0.028). The head hip techniques resulted in higher shoulder external rotation, flexion and extension moments compared to the trunk upright technique (P<0.021). Varying the hand placement and trunk positioning during transfers changes the load distribution across all upper limb joints. The results of this study may be useful for determining a technique that helps preserve upper limb function overtime. Published by Elsevier Ltd.

Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

PubMed Central

Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

2006-01-01

Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to evaluate the quality and performance on different matrixes and extraction techniques. The effect of PCR efficiency on the resulting GMO content is demonstrated. Conclusion The crucial influence of extraction technique and sample matrix properties on the results of GMO quantification is demonstrated. Appropriate extraction techniques for each matrix need to be determined to achieve accurate DNA quantification. Nevertheless, as it is shown that in the area of food and feed testing matrix with certain specificities is impossible to define strict quality controls need to be introduced to monitor PCR. The results of our study are also applicable to other fields of quantitative testing by real-time PCR. PMID:16907967

Matrix-assisted laser desorption-ionization mass spectrometry peptide mass fingerprinting for proteome analysis: identification efficiency after on-blot or in-gel digestion with and without desalting procedures.

PubMed

Lamer, S; Jungblut, P R

2001-03-10

In theory, peptide mass fingerprinting by matrix assisted laser desorption-ionization mass spectrometry (MALDI-MS) has the potential to identify all of the proteins detected by silver staining on gels. In practice, if the genome of the organism investigated is completely sequenced, using current techniques, all proteins stained by Coomassie Brilliant Blue can be identified. This loss of identification sensitivity of ten to hundred-fold is caused by loss of peptides by surface contacts. Therefore, we performed digestion and transfer of peptides in the lower microl range and reduced the number of steps. The peptide mix obtained from in-gel or on-blot digestion was analyzed directly after digestion or after concentration on POROS R2 beads. Eight protein spots of a 2-DE gel from Mycobacterium bovis BCG were identified using these four preparation procedures for MALDI-MS. Overall, on-blot digestion was as effective as in-gel digestion. Whereas higher signal intensities resulted after concentration, hydrophilic peptides are better detected by direct measurement of the peptide mix without POROS R2 concentration.

Heat exchanger development at Reaction Engines Ltd.

NASA Astrophysics Data System (ADS)

Varvill, Richard

2010-05-01

The SABRE engine for SKYLON has a sophisticated thermodynamic cycle with heat transfer between the fluid streams. The intake airflow is cooled in an efficient counterflow precooler, consisting of many thousand small bore thin wall tubes. Precooler manufacturing technology has been under investigation at REL for a number of years with the result that flightweight matrix modules can now be produced. A major difficulty with cooling the airflow to sub-zero temperatures at low altitude is the problem of frost formation. Frost control technology has been developed which enables steady state operation. The helium loop requires a top cycle heat exchanger (HX3) to deliver a constant inlet temperature to the main turbine. This is constructed in silicon carbide and the feasibility of manufacturing various matrix geometries has been investigated along with suitable joining techniques. A demonstration precooler will be made to run in front of a Viper jet engine at REL's B9 test facility in 2011. This precooler will incorporate full frost control and be built from full size SABRE engine modules. The facility will incorporate a high pressure helium loop that rejects the absorbed heat to a bath of liquid nitrogen.

Immunochemical-based method for detection of hazelnut proteins in processed foods.

PubMed

Ben Rejeb, Samuel; Abbott, Michael; Davies, David; Querry, Jessica; Cléroux, Chantal; Streng, Christine; Delahaut, Philippe; Yeung, Jupiter M

2003-01-01

A competitive enzyme-linked immunosorbent assay (ELISA) was developed to detect hazelnut by using polyclonal antibodies generated against a protein extract of roasted hazelnut. No cross-reactivity was observed in tests against 39 commodities, including many common allergens, tree nuts, and legumes. Hazelnut protein standard solutions at 0.45 ng/mL [inhibition concentration (IC80) of the competitive test] were clearly identified by the ELISA. An extraction and quantification method was developed and optimized for chocolate, cookies, breakfast cereals, and ice cream, major food commodities likely to be cross-contaminated with undeclared hazelnut during food processing. No sample cleanup was required when extracts were diluted 10-fold. Recovery results were generated with blank matrixes spiked at 4 levels from 1 to 10 microg/g hazelnut protein. With the developed extraction and sample handling procedure, hazelnut proteins were recovered at 64-83% from chocolate and at 78-97% from other matrixes. A confirmatory technique was developed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer. The developed methods were applied to a small market survey of chocolate products and allowed the identification of undeclared hazelnut in these products.

Formation of Ag nanoparticles and enhancement of Tb3+ luminescence in Tb and Ag co-doped lithium-lanthanum-aluminosilicate glass

NASA Astrophysics Data System (ADS)

Piasecki, Patryk; Piasecki, Ashley; Pan, Zhengda; Mu, Richard; Morgan, Steven H.

2010-12-01

Tb3+ and Ag co-doped glass nano-composites were synthesized in a glass matrix Li2O-LaF3-Al2O3-SiO2 (LLAS) by a melt-quench technique. The growth of Ag nanoparticles (NPs) was controlled by a thermal annealing process. A broad absorption band peaking at about 420 nm was observed due to surface plasmon resonance (SPR) of Ag NPs. The intensity of this band grows with increasing annealing time. The transmission electron microscopic image (TEM) reveals the formation of Ag NPs in glass matrix. Photoluminescence (PL) emission and excitation spectra were measured for glass samples with different Ag concentrations and different annealing times. Plasmon enhanced Tb3+ luminescence was observed at certain excitation wavelength regions. Luminescence quenching was also observed for samples with high Ag concentration and longer annealing time. Our luminescence results suggest that there are two competitive effects, enhancement and quenching, acting on Tb3+ luminescence in the presence of Ag NPs. The enhancement of Tb3+ luminescence is mainly attributed to local field effects due to SPR. The quenching of luminescence suggests an energy transfer from Tb3+ ions to Ag NPs.

Matrix differentiation formulas

NASA Technical Reports Server (NTRS)

Usikov, D. A.; Tkhabisimov, D. K.

1983-01-01

A compact differentiation technique (without using indexes) is developed for scalar functions that depend on complex matrix arguments which are combined by operations of complex conjugation, transposition, addition, multiplication, matrix inversion and taking the direct product. The differentiation apparatus is developed in order to simplify the solution of extremum problems of scalar functions of matrix arguments.

Assessment of the antireflection property of moth wings by three-dimensional transfer-matrix optical simulations

NASA Astrophysics Data System (ADS)

Deparis, Olivier; Khuzayim, Nadia; Parker, Andrew; Vigneron, Jean Pol

2009-04-01

The wings of the moth Cacostatia ossa (Ctenuchinae) are covered on both sides by non-close-packed nipple arrays which are known to act as broadband antireflection coatings. Experimental evaluation of the antireflection property of these biological structures is problematic because of the lack of a proper reference for reflectance measurements, i.e., a smooth surface made of the same material as the wing. Theoretical evaluation, on the other hand, is much more reliable provided that optical simulations are carried out on a realistic structural model of the wing. Based on detailed morphological characterizations, we established a three-dimensional (3D) model of the wing and used 3D transfer-matrix optical simulations in order to demonstrate the broadband antireflection property of the wings of Cacostatia ossa. Differences between hemispherical and specular reflectance spectra revealed that diffraction effects were not negligible for this structure although they did not jeopardize the antireflection efficiency. The influences of the backside corrugation and of the material’s absorption on the reflectance spectrum were also studied. In addition, simulations based on an effective-medium model of the wing were carried out using a multilayer thin-film code. In comparison with the latter simulations, the 3D transfer-matrix simulations were found to be more accurate for evaluating the antireflection property.

From the quantum transfer matrix to the quench action: the Loschmidt echo in XXZ Heisenberg spin chains

NASA Astrophysics Data System (ADS)

Piroli, Lorenzo; Pozsgay, Balázs; Vernier, Eric

2017-02-01

We consider the computation of the Loschmidt echo after quantum quenches in the interacting XXZ Heisenberg spin chain both for real and imaginary times. We study two-site product initial states, focusing in particular on the Néel and tilted Néel states. We apply the quantum transfer matrix (QTM) approach to derive generalized TBA equations, which follow from the fusion hierarchy of the appropriate QTM’s. Our formulas are valid for arbitrary imaginary time and for real times at least up to a time t 0, after which the integral equations have to be modified. In some regimes, t 0 is seen to be either very large or infinite, allowing to explore in detail the post-quench dynamics of the system. As an important part of our work, we show that for the Néel state our imaginary time results can be recovered by means of the quench action approach, unveiling a direct connection with the quantum transfer matrix formalism. In particular, we show that in the zero-time limit, the study of our TBA equations allows for a simple alternative derivation of the recently obtained Bethe ansatz distribution functions for the Néel, tilted Néel and tilted ferromagnet states.

Heat transfer enhancement of PCM melting in 2D horizontal elliptical tube using metallic porous matrix

NASA Astrophysics Data System (ADS)

Jourabian, Mahmoud; Farhadi, Mousa; Rabienataj Darzi, Ahmad Ali

2016-12-01

In this study, the melting process of ice as a phase-change material (PCM) saturated with a nickel-steel porous matrix inside a horizontal elliptical tube is investigated. Due to the low thermal conductivity of the PCM, it is motivated to augment the heat transfer performance of the system simultaneously by finding an optimum value of the aspect ratio and impregnating a metallic porous matrix into the base PCM. The lattice Boltzmann method with a double distribution function formulated based on the enthalpy method, is applied at the representative elementary volume scale under the local thermal equilibrium assumption between the PCM and porous matrix in the composite. While reducing or increasing the aspect ratio of the circular tubes leads to the expedited melting, the 90° inclination of each elliptical tube in the case of the pure PCM melting does not affect the melting rate. With the reduction in the porosity, the effective thermal conductivity and melting rate in all tubes promoted. Although the natural convection is fully suppressed due to the significant flow blockage in the porous structure, the melting rates are generally increased in all cases.

Dehydration reactions, mass transfer and rock deformation relationships during subduction of Alpine metabauxites: insights from LIBS compositional profiles between metamorphic veins

NASA Astrophysics Data System (ADS)

Verlaguet, A.; Brunet, F.; Goffe, B.; Menut, D.; Findling, N.; Poinssot, C.

2011-12-01

In subduction zones, the significant amounts of aqueous fluid released in the course of the successive dehydration reactions occurring during prograde metamorphism are expected to strongly influence the rock rheology, as well as kinetics of metamorphic reactions and mass transfer efficiency. Mineralized veins, ubiquitous in metamorphic rocks, can be seen as preserved witnesses of fluid and mass redistribution that partly accommodate the rock deformation (lateral segregation). However, the driving forces and mechanisms of mass transfer towards fluid-filled open spaces remain somewhat unclear. The aim of this study is to investigate the modalities of mass transfer during local fluid-rock interactions, and their links with fluid production and rock deformation. This study focuses on karstic pockets (metre scale) of Triassic metabauxites embedded in thick carbonate units, that have been isolated from large-scale fluid flow during HP-LT Alpine metamorphism (W. Vanoise, French Alps). These rocks display several generations of metamorphic veins containing various Al-bearing minerals, which give particular insights into mass transfer processes. It is proposed that the internally-derived fluid (~13 vol% produced by successive dehydration reactions) has promoted the opening of fluid-filled open spaces (euhedral habits of vein minerals) and served as medium for diffusive mass transfer from rock to vein. Based on mineralogical and textural features, two vein types can be distinguished: (1) some veins are filled with newly formed products of either prograde (chloritoid) or retrograde (chlorite) metamorphic reactions; in this case, fluid-filled open spaces seem to offer energetically favourable nucleation/growth sites; (2) the second vein type is filled with cookeite (Li-Al-rich chlorite) or pyrophyllite, that were present in the host rock prior to the vein formation. In this closed chemical system, mass transfer from rock to vein was achieved through the fluid, in a dissolution-transport-precipitation process, possibly stress-assisted. Cookeite is highly concentrated (40-70 vol%) in regularly spaced veins. Laser Induced Breakdown Spectroscopy profiles show that cookeite is evenly distributed in the rock matrix comprised between two veins. The absence of diffusion profiles suggests that the characteristic diffusion length for Li, Al and Si is greater than or equal to the distance separating two cookeite veins (3-6 cm). This is in agreement with characteristic diffusion lengths calculated from both grain boundary and pore fluid diffusion coefficients, for the estimated duration of the peak of metamorphism. Phyllosilicates have very different morphologies in the rock matrix (fibers) compared to veins (euhedral crystals): fluid-mineral interfacial energy may be maximal in the small matrix pores, which can maintain higher cookeite solubility than in fluid-filled open spaces. Therefore, as soon as veins open, chemical potential gradients may develop and drive cookeite transfer from rock matrix to veins.

Deformation behavior of Nb nanowires in TiNiCu shape memory alloy matrix

DOE PAGES

Jiang, Daqiang; Liu, Yinong; Yu, Cun; ...

2015-08-18

An in-situ nanowire Nb/TiNiCu composite is fabricated based on the concept of strain under-matching between a phase transforming matrix and high strength nanomaterials. The deformation behavior of the Nb nanowire was investigated by means of in-situ synchrotron X-ray diffraction when the TiNiCu matrix underwent different deformation modes. The maximum lattice strain of the Nb nanowires was about 5% when the matrix deformed via martensitic transformation or 1% when deforming plastically by dislocation slip. As a result, the Nb nanowires showed a lattice strain of 3.5% when the matrix deformed in the mixed mode of plastic deformation and martensitic transformation, whichmore » means that the occurrence of plastic deformation does not impede load transfer from the matrix to the nanowires.« less

Electronic and chemical structure of an organic light emitter embedded in an inorganic wide-bandgap semiconductor: Photoelectron spectroscopy of layered and composite structures of Ir(BPA) and ZnSe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dimamay, Mariel; Laboratoire de Chimie des Polymères Organiques, CNRS, Université de Bordeaux, UMR 5629-16 Avenue Pey-Berland, 33607 Pessac; Mayer, Thomas

Luminescent organic phases embedded in conductive inorganic matrices are proposed for hybrid organic-inorganic light-emitting diodes. In this configuration, the organic dye acts as the radiative recombination site for charge carriers injected into the inorganic matrix. Our investigation is aimed at finding a material combination where the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of the organic dye are situated in between the valence and conduction bands of the inorganic matrix in order to promote electron and hole transfer from the matrix to the dye. Bilayer and composite thin films of zinc selenide (ZnSe) and a redmore » iridium complex (Ir(BPA)) organic light emitter were prepared in situ via UHV thermal evaporation technique. The electronic and atomic structures were studied applying X-ray and ultraviolet photoelectron spectroscopies. The measured energy band alignments for the ZnSe/Ir(BPA) bilayer and ZnSe+Ir(BPA) composite reveal that the HOMO and LUMO of the organic dye are positioned in the ZnSe bandgap. For the initial steps of ZnSe deposition on a dye film to form Ir(BPA)/ZnSe bilayers, zinc atoms intercalate into the dye film leaving behind an excess of selenium at the interface that partly reacts with dye molecules. Photoelectron spectroscopy of the composites shows the same species suggesting a similar mechanism. This mechanism leads to composite films with increased content of amorphous phases in the inorganic matrix, thereby affecting its conductivity, as well as to the presence of nonradiative recombination sites provided by the intercalated Zn atoms.« less

Reducing the orientation influence of Mueller matrix measurements for anisotropic scattering media

NASA Astrophysics Data System (ADS)

Sun, Minghao; He, Honghui; Zeng, Nan; Du, E.; He, Yonghong; Ma, Hui

2014-09-01

Mueller matrix polarimetry techniques contain rich micro-structural information of samples, such as the sizes and refractive indices of scatterers. Recently, Mueller matrix imaging methods have shown great potentials as powerful tools for biomedical diagnosis. However, the orientations of anisotropic fibrous structures in tissues have prominent influence on Mueller matrix measurements, resulting in difficulties for extracting micro-structural information effectively. In this paper, we apply the backscattering Mueller matrix imaging technique to biological samples with different microstructures, such as chicken heart muscle, bovine skeletal muscle, porcine liver and fat tissues. Experimental results show that the directions of the muscle fibers have prominent influence on the Mueller matrix elements. In order to reduce the orientation influence, we adopt the rotation-independent MMT and RLPI parameters, which were proposed in our previous studies, to the tissue samples. Preliminary results in this paper show that the orientation-independent parameters and their statistic features are helpful for analyzing the tissues to obtain their micro-structural properties. Since the micro-structure variations are often related to the pathological changes, the method can be applied to microscope imaging techniques and used to detect abnormal tissues such as cancer and other lesions for diagnosis purposes.

Electrical Resistance as a NDE Technique to Monitor Processing and Damage Accumulation in SiC/SiC Composites

NASA Technical Reports Server (NTRS)

Smith, Craig; Morscher, Gregory N.; Xia, Zhenhai

2008-01-01

Ceramic matrix composites are suitable for high temperature structural applications such as turbine airfoils and hypersonic thermal protection systems. The employment of these materials in such applications is limited by the ability to process components reliable and to accurately monitor and predict damage evolution that leads to failure under stressed-oxidation conditions. Current nondestructive methods such as ultrasound, x-ray, and thermal imaging are limited in their ability to quantify small scale, transverse, in-plane, matrix cracks developed over long-time creep and fatigue conditions. Electrical resistance of SiC/SiC composites is one technique that shows special promise towards this end. Since both the matrix and the fibers are conductive, changes in matrix or fiber properties should relate to changes in electrical conductivity along the length of a specimen or part. Initial efforts to quantify the electrical resistance of different fiber and different matrix SiC/SiC composites will be presented. Also, the effect of matrix cracking on electrical resistivity for several composite systems will be presented. The implications towards electrical resistance as a technique applied to composite processing, damage detection, and life-modeling will be discussed.

Minimal Model of Quantum Kinetic Clusters for the Energy-Transfer Network of a Light-Harvesting Protein Complex.

PubMed

Wu, Jianlan; Tang, Zhoufei; Gong, Zhihao; Cao, Jianshu; Mukamel, Shaul

2015-04-02

The energy absorbed in a light-harvesting protein complex is often transferred collectively through aggregated chromophore clusters. For population evolution of chromophores, the time-integrated effective rate matrix allows us to construct quantum kinetic clusters quantitatively and determine the reduced cluster-cluster transfer rates systematically, thus defining a minimal model of energy-transfer kinetics. For Fenna-Matthews-Olson (FMO) and light-havrvesting complex II (LCHII) monomers, quantum Markovian kinetics of clusters can accurately reproduce the overall energy-transfer process in the long-time scale. The dominant energy-transfer pathways are identified in the picture of aggregated clusters. The chromophores distributed extensively in various clusters can assist a fast and long-range energy transfer.

Three-Dimensional Graphene Foam Induces Multifunctionality in Epoxy Nanocomposites by Simultaneous Improvement in Mechanical, Thermal, and Electrical Properties.

PubMed

Embrey, Leslie; Nautiyal, Pranjal; Loganathan, Archana; Idowu, Adeyinka; Boesl, Benjamin; Agarwal, Arvind

2017-11-15

Three-dimensional (3D) macroporous graphene foam based multifunctional epoxy composites are developed in this study. Facile dip-coating and mold-casting techniques are employed to engineer microstructures with tailorable thermal, mechanical, and electrical properties. These processing techniques allow capillarity-induced equilibrium filling of graphene foam branches, creating epoxy/graphene interfaces with minimal separation. Addition of 2 wt % graphene foam enhances the glass transition temperature of epoxy from 106 to 162 °C, improving the thermal stability of the polymer composite. Graphene foam aids in load-bearing, increasing the ultimate tensile strength by 12% by merely 0.13 wt % graphene foam in an epoxy matrix. Digital image correlation (DIC) analysis revealed that the graphene foam cells restrict and confine the deformation of the polymer matrix, thereby enhancing the load-bearing capability of the composite. Addition of 0.6 wt % graphene foam also enhances the flexural strength of the pure epoxy by 10%. A 3D network of graphene branches is found to suppress and deflect the cracks, arresting mechanical failure. Dynamic mechanical analysis (DMA) of the composites demonstrated their vibration damping capability, as the loss tangent (tan δ) jumps from 0.1 for the pure epoxy to 0.24 for ∼2 wt % graphene foam-epoxy composite. Graphene foam branches also provide seamless pathways for electron transfer, which induces electrical conductivity exceeding 450 S/m in an otherwise insulator epoxy matrix. The epoxy-graphene foam composite exhibits a gauge factor as high as 4.1, which is twice the typical gauge factor for the most common metals. Simultaneous improvement in thermal, mechanical, and electrical properties of epoxy due to 3D graphene foam makes epoxy-graphene foam composite a promising lightweight and multifunctional material for aiding load-bearing, electrical transport, and motion sensing in aerospace, automotive, robotics, and smart device structures.

Radiative-Transfer Modeling of Spectra of Densely Packed Particulate Media

NASA Astrophysics Data System (ADS)

Ito, G.; Mishchenko, M. I.; Glotch, T. D.

2017-12-01

Remote sensing measurements over a wide range of wavelengths from both ground- and space-based platforms have provided a wealth of data regarding the surfaces and atmospheres of various solar system bodies. With proper interpretations, important properties, such as composition and particle size, can be inferred. However, proper interpretation of such datasets can often be difficult, especially for densely packed particulate media with particle sizes on the order of wavelength of light being used for remote sensing. Radiative transfer theory has often been applied to the study of densely packed particulate media like planetary regoliths and snow, but with difficulty, and here we continue to investigate radiative transfer modeling of spectra of densely packed media. We use the superposition T-matrix method to compute scattering properties of clusters of particles and capture the near-field effects important for dense packing. Then, the scattering parameters from the T-matrix computations are modified with the static structure factor correction, accounting for the dense packing of the clusters themselves. Using these corrected scattering parameters, reflectance (or emissivity via Kirchhoff's Law) is computed with the method of invariance imbedding solution to the radiative transfer equation. For this work we modeled the emissivity spectrum of the 3.3 µm particle size fraction of enstatite, representing some common mineralogical and particle size components of regoliths, in the mid-infrared wavelengths (5 - 50 µm). The modeled spectrum from the T-matrix method with static structure factor correction using moderate packing densities (filling factors of 0.1 - 0.2) produced better fits to the laboratory measurement of corresponding spectrum than the spectrum modeled by the equivalent method without static structure factor correction. Future work will test the method of the superposition T-matrix and static structure factor correction combination for larger particles sizes and polydispersed clusters in search for the most effective modeling of spectra of densely packed particulate media.

Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

NASA Astrophysics Data System (ADS)

Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

2007-12-01

This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

Theoretical models for supercritical fluid extraction.

PubMed

Huang, Zhen; Shi, Xiao-Han; Jiang, Wei-Juan

2012-08-10

For the proper design of supercritical fluid extraction processes, it is essential to have a sound knowledge of the mass transfer mechanism of the extraction process and the appropriate mathematical representation. In this paper, the advances and applications of kinetic models for describing supercritical fluid extraction from various solid matrices have been presented. The theoretical models overviewed here include the hot ball diffusion, broken and intact cell, shrinking core and some relatively simple models. Mathematical representations of these models have been in detail interpreted as well as their assumptions, parameter identifications and application examples. Extraction process of the analyte solute from the solid matrix by means of supercritical fluid includes the dissolution of the analyte from the solid, the analyte diffusion in the matrix and its transport to the bulk supercritical fluid. Mechanisms involved in a mass transfer model are discussed in terms of external mass transfer resistance, internal mass transfer resistance, solute-solid interactions and axial dispersion. The correlations of the external mass transfer coefficient and axial dispersion coefficient with certain dimensionless numbers are also discussed. Among these models, the broken and intact cell model seems to be the most relevant mathematical model as it is able to provide realistic description of the plant material structure for better understanding the mass-transfer kinetics and thus it has been widely employed for modeling supercritical fluid extraction of natural matters. Copyright © 2012 Elsevier B.V. All rights reserved.

Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

NASA Technical Reports Server (NTRS)

Murthy, V. R.

1985-01-01

The bearingless rotorcraft offers reduced weight, less complexity and superior flying qualities. Almost all the current industrial structural dynamic programs of conventional rotors which consist of single load path rotor blades employ the transfer matrix method to determine natural vibration characteristics because this method is ideally suited for one dimensional chain like structures. This method is extended to multiple load path rotor blades without resorting to an equivalent single load path approximation. Unlike the conventional blades, it isk necessary to introduce the axial-degree-of-freedom into the solution process to account for the differential axial displacements in the different load paths. With the present extension, the current rotor dynamic programs can be modified with relative ease to account for the multiple load paths without resorting to the equivalent single load path modeling. The results obtained by the transfer matrix method are validated by comparing with the finite element solutions. A differential stiffness matrix due to blade rotation is derived to facilitate the finite element solutions.

Stress transfer and matrix-cohesive fracture mechanism in microfibrillated cellulose-gelatin nanocomposite films.

PubMed

Quero, Franck; Padilla, Cristina; Campos, Vanessa; Luengo, Jorge; Caballero, Leonardo; Melo, Francisco; Li, Qiang; Eichhorn, Stephen J; Enrione, Javier

2018-09-01

Microfibrillated cellulose (MFC) obtained from eucalyptus was embedded in gelatin from two sources; namely bovine and salmon gelatin. Raman spectroscopy revealed that stress is transferred more efficiently from bovine gelatin to the MFC when compared to salmon gelatin. Young's modulus, tensile strength, strain at failure and work of fracture of the nanocomposite films were improved by ∼67, 131, 43 y 243% respectively when using salmon gelatin as matrix material instead of bovine gelatin. Imaging of the tensile fracture surface of the MFC-gelatin nanocomposites revealed that crack formation occurs predominantly within bovine and salmon gelatin matrices rather than within the MFC or at the MFC/gelatin interface. This suggests that the mechanical failure mechanism in these nanocomposite materials is predominantly governed by a matrix-cohesive fracture mechanism. Both strength and flexibility are desirable properties for composite coatings made from gelatin-based materials, and so the findings of this study could assist in their utilization in the food and pharmaceutical industry. Copyright © 2018 Elsevier Ltd. All rights reserved.

Fatigue 󈨛. Papers presented at the International Conference on Fatigue and Fatigue Threshold (3rd) Held in Charlottesville, Virginia on June 28-July 3, 1987. Volume 3.

DTIC Science & Technology

1987-10-15

cracks and loss of fiber-matrix bond, leadin, to nonuniform loading (tensile overload) of composite structure. Figures 13 through 15 show the micro...propagation within the matrix, and alon- the interface, leading to a nonuniform load transfer from matrix to fibers, and causing tensile overload failure...long cracks, were attributed to high cyclic strains at crack tips within grains of maximum crystallographic orientation. Ma and Laire (4) studying the

Water-polysaccharide interactions in the primary cell wall of Arabidopsis thaliana from polarization transfer solid-state NMR.

PubMed

White, Paul B; Wang, Tuo; Park, Yong Bum; Cosgrove, Daniel J; Hong, Mei

2014-07-23

Polysaccharide-rich plant cell walls are hydrated under functional conditions, but the molecular interactions between water and polysaccharides in the wall have not been investigated. In this work, we employ polarization transfer solid-state NMR techniques to study the hydration of primary-wall polysaccharides of the model plant, Arabidopsis thaliana. By transferring water (1)H polarization to polysaccharides through distance- and mobility-dependent (1)H-(1)H dipolar couplings and detecting it through polysaccharide (13)C signals, we obtain information about water proximity to cellulose, hemicellulose, and pectins as well as water mobility. Both intact and partially extracted cell wall samples are studied. Our results show that water-pectin polarization transfer is much faster than water-cellulose polarization transfer in all samples, but the extent of extraction has a profound impact on the water-polysaccharide spin diffusion. Removal of calcium ions and the consequent extraction of homogalacturonan (HG) significantly slowed down spin diffusion, while further extraction of matrix polysaccharides restored the spin diffusion rate. These trends are observed in cell walls with similar water content, thus they reflect inherent differences in the mobility and spatial distribution of water. Combined with quantitative analysis of the polysaccharide contents, our results indicate that calcium ions and HG gelation increase the amount of bound water, which facilitates spin diffusion, while calcium removal disrupts the gel and gives rise to highly dynamic water, which slows down spin diffusion. The recovery of spin diffusion rates after more extensive extraction is attributed to increased water-exposed surface areas of the polysaccharides. Water-pectin spin diffusion precedes water-cellulose spin diffusion, lending support to the single-network model of plant primary walls in which a substantial fraction of the cellulose surface is surrounded by pectins.

Arabidopsis thalianafrom Polarization Transfer Solid-State NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Paul B; Wang, Tuo; Park, Yong Bum

2014-07-23

Polysaccharide-rich plant cell walls are hydrated under functional conditions, but the molecular interactions between water and polysaccharides in the wall have not been investigated. In this work, we employ polarization transfer solid-state NMR techniques to study the hydration of primary-wall polysaccharides of the model plant, Arabidopsis thaliana. By transferring water 1H polarization to polysaccharides through distance- and mobility-dependent 1H–1H dipolar couplings and detecting it through polysaccharide 13C signals, we obtain information about water proximity to cellulose, hemicellulose, and pectins as well as water mobility. Both intact and partially extracted cell wall samples are studied. Our results show that water–pectin polarizationmore » transfer is much faster than water–cellulose polarization transfer in all samples, but the extent of extraction has a profound impact on the water–polysaccharide spin diffusion. Removal of calcium ions and the consequent extraction of homogalacturonan (HG) significantly slowed down spin diffusion, while further extraction of matrix polysaccharides restored the spin diffusion rate. These trends are observed in cell walls with similar water content, thus they reflect inherent differences in the mobility and spatial distribution of water. Combined with quantitative analysis of the polysaccharide contents, our results indicate that calcium ions and HG gelation increase the amount of bound water, which facilitates spin diffusion, while calcium removal disrupts the gel and gives rise to highly dynamic water, which slows down spin diffusion. The recovery of spin diffusion rates after more extensive extraction is attributed to increased water-exposed surface areas of the polysaccharides. Water–pectin spin diffusion precedes water–cellulose spin diffusion, lending support to the single-network model of plant primary walls in which a substantial fraction of the cellulose surface is surrounded by pectins.« less

Detection of extracellular matrix modification in cancer models with inverse spectroscopic optical coherence tomography

NASA Astrophysics Data System (ADS)

Spicer, Graham L. C.; Azarin, Samira M.; Yi, Ji; Young, Scott T.; Ellis, Ronald; Bauer, Greta M.; Shea, Lonnie D.; Backman, Vadim

2016-10-01

In cancer biology, there has been a recent effort to understand tumor formation in the context of the tissue microenvironment. In particular, recent progress has explored the mechanisms behind how changes in the cell-extracellular matrix ensemble influence progression of the disease. The extensive use of in vitro tissue culture models in simulant matrix has proven effective at studying such interactions, but modalities for non-invasively quantifying aspects of these systems are scant. We present the novel application of an imaging technique, Inverse Spectroscopic Optical Coherence Tomography, for the non-destructive measurement of in vitro biological samples during matrix remodeling. Our findings indicate that the nanoscale-sensitive mass density correlation shape factor D of cancer cells increases in response to a more crosslinked matrix. We present a facile technique for the non-invasive, quantitative study of the micro- and nano-scale structure of the extracellular matrix and its host cells.

General Matrix Inversion Technique for the Calibration of Electric Field Sensor Arrays on Aircraft Platforms

NASA Technical Reports Server (NTRS)

Mach, D. M.; Koshak, W. J.

2007-01-01

A matrix calibration procedure has been developed that uniquely relates the electric fields measured at the aircraft with the external vector electric field and net aircraft charge. The calibration method can be generalized to any reasonable combination of electric field measurements and aircraft. A calibration matrix is determined for each aircraft that represents the individual instrument responses to the external electric field. The aircraft geometry and configuration of field mills (FMs) uniquely define the matrix. The matrix can then be inverted to determine the external electric field and net aircraft charge from the FM outputs. A distinct advantage of the method is that if one or more FMs need to be eliminated or deemphasized [e.g., due to a malfunction), it is a simple matter to reinvert the matrix without the malfunctioning FMs. To demonstrate the calibration technique, data are presented from several aircraft programs (ER-2, DC-8, Altus, and Citation).

High Temperature Deformation Mechanism in Hierarchical and Single Precipitate Strengthened Ferritic Alloys by In Situ Neutron Diffraction Studies.

PubMed

Song, Gian; Sun, Zhiqian; Li, Lin; Clausen, Bjørn; Zhang, Shu Yan; Gao, Yanfei; Liaw, Peter K

2017-04-07

The ferritic Fe-Cr-Ni-Al-Ti alloys strengthened by hierarchical-Ni 2 TiAl/NiAl or single-Ni 2 TiAl precipitates have been developed and received great attentions due to their superior creep resistance, as compared to conventional ferritic steels. Although the significant improvement of the creep resistance is achieved in the hierarchical-precipitate-strengthened ferritic alloy, the in-depth understanding of its high-temperature deformation mechanisms is essential to further optimize the microstructure and mechanical properties, and advance the development of the creep resistant materials. In the present study, in-situ neutron diffraction has been used to investigate the evolution of elastic strain of constitutive phases and their interactions, such as load-transfer/load-relaxation behavior between the precipitate and matrix, during tensile deformation and stress relaxation at 973 K, which provide the key features in understanding the governing deformation mechanisms. Crystal-plasticity finite-element simulations were employed to qualitatively compare the experimental evolution of the elastic strain during tensile deformation at 973 K. It was found that the coherent elastic strain field in the matrix, created by the lattice misfit between the matrix and precipitate phases for the hierarchical-precipitate-strengthened ferritic alloy, is effective in reducing the diffusional relaxation along the interface between the precipitate and matrix phases, which leads to the strong load-transfer capability from the matrix to precipitate.

Quantum Stochastic Trajectories: The Fokker-Planck-Bohm Equation Driven by the Reduced Density Matrix.

PubMed

Avanzini, Francesco; Moro, Giorgio J

2018-03-15

The quantum molecular trajectory is the deterministic trajectory, arising from the Bohm theory, that describes the instantaneous positions of the nuclei of molecules by assuring the agreement with the predictions of quantum mechanics. Therefore, it provides the suitable framework for representing the geometry and the motions of molecules without neglecting their quantum nature. However, the quantum molecular trajectory is extremely demanding from the computational point of view, and this strongly limits its applications. To overcome such a drawback, we derive a stochastic representation of the quantum molecular trajectory, through projection operator techniques, for the degrees of freedom of an open quantum system. The resulting Fokker-Planck operator is parametrically dependent upon the reduced density matrix of the open system. Because of the pilot role played by the reduced density matrix, this stochastic approach is able to represent accurately the main features of the open system motions both at equilibrium and out of equilibrium with the environment. To verify this procedure, the predictions of the stochastic and deterministic representation are compared for a model system of six interacting harmonic oscillators, where one oscillator is taken as the open quantum system of interest. The undeniable advantage of the stochastic approach is that of providing a simplified and self-contained representation of the dynamics of the open system coordinates. Furthermore, it can be employed to study the out of equilibrium dynamics and the relaxation of quantum molecular motions during photoinduced processes, like photoinduced conformational changes and proton transfers.

Effect of thermal interface on heat flow in carbon nanofiber composites.

PubMed

Gardea, F; Naraghi, M; Lagoudas, D

2014-01-22

The thermal transport process in carbon nanofiber (CNF)/epoxy composites is addressed through combined micromechanics and finite element modeling, guided by experiments. The heat exchange between CNF constituents and matrix is studied by explicitly accounting for interface thermal resistance between the CNFs and the epoxy matrix. The effects of nanofiber orientation and discontinuity on heat flow and thermal conductivity of nanocomposites are investigated through simulation of the laser flash experiment technique and Fourier's model of heat conduction. Our results indicate that when continuous CNFs are misoriented with respect to the average temperature gradient, the presence of interfacial resistance does not affect the thermal conductivity of the nanocomposites, as most of the heat flow will be through CNFs; however, interface thermal resistance can significantly alter the patterns of heat flow within the nanocomposite. It was found that very high interface resistance leads to heat entrapment at the interface near to the heat source, which can promote interface thermal degradation. The magnitude of heat entrapment, quantified via the peak transient temperature rise at the interface, in the case of high thermal resistance interfaces becomes an order of magnitude more intense as compared to the case of low thermal resistance interfaces. Moreover, high interface thermal resistance in the case of discontinuous fibers leads to a nearly complete thermal isolation of the fibers from the matrix, which will marginalize the contribution of the CNF thermal conductivity to the heat transfer in the composite.

Distribution of lactate dehydrogenase in healthy and degenerative canine stifle joint cartilage.

PubMed

Walter, Eveline L C; Spreng, David; Schmöckel, Hugo; Schawalder, Peter; Tschudi, Peter; Friess, Armin E; Stoffel, Michael H

2007-07-01

In dogs, degenerative joint diseases (DJD) have been shown to be associated with increased lactate dehydrogenase (LDH) activity in the synovial fluid. The goal of this study was to examine healthy and degenerative stifle joints in order to clarify the origin of LDH in synovial fluid. In order to assess the distribution of LDH, cartilage samples from healthy and degenerative knee joints were investigated by means of light and transmission electron microscopy in conjunction with immunolabeling and enzyme cytochemistry. Morphological analysis confirmed DJD. All techniques used corroborated the presence of LDH in chondrocytes and in the interterritorial matrix of healthy and degenerative stifle joints. Although enzymatic activity of LDH was clearly demonstrated in the territorial matrix by means of the tetrazolium-formazan reaction, immunolabeling for LDH was missing in this region. With respect to the distribution of LDH in the interterritorial matrix, a striking decrease from superficial to deeper layers was present in healthy dogs but was missing in affected joints. These results support the contention that LDH in synovial fluid of degenerative joints originates from cartilage. Therefore, we suggest that (1) LDH is transferred from chondrocytes to ECM in both healthy dogs and dogs with degenerative joint disease and that (2) in degenerative joints, LDH is released from chondrocytes and the ECM into synovial fluid through abrasion of cartilage as well as through enhanced diffusion as a result of increased water content and degradation of collagen.

Laser desorption ionization mass spectrometry: Recent progress in matrix-free and label-assisted techniques.

PubMed

Mandal, Arundhoti; Singha, Monisha; Addy, Partha Sarathi; Basak, Amit

2017-10-13

The MALDI-based mass spectrometry, over the last three decades, has become an important analytical tool. It is a gentle ionization technique, usually applicable to detect and characterize analytes with high molecular weights like proteins and other macromolecules. The earlier difficulty of detection of analytes with low molecular weights like small organic molecules and metal ion complexes with this technique arose due to the cluster of peaks in the low molecular weight region generated from the matrix. To detect such molecules and metal ion complexes, a four-prong strategy has been developed. These include use of alternate matrix materials, employment of new surface materials that require no matrix, use of metabolites that directly absorb the laser light, and the laser-absorbing label-assisted LDI-MS (popularly known as LALDI-MS). This review will highlight the developments with all these strategies with a special emphasis on LALDI-MS. © 2017 Wiley Periodicals, Inc.

Effect of friction on electron transfer: The two reaction coordinate case

NASA Astrophysics Data System (ADS)

Onuchic, José Nelson

1987-04-01

Electron transfer is a very important reaction in many biological processes such as photosynthesis and oxidative phosphorylation. In many of these reactions, most of the interesting dynamics can be included by using two reaction coordinates: one fast (local high frequency vibration modes) and one slow (outersphere modes such as solvent polarization). We report a model to describe this problem, which uses path integral techniques to calculate electron transfer rates, and also to obtain the Fokker-Planck equations associated with this model. Different limiting cases lead to qualitatively different results such as exponential or nonexponential time decay for the donor survival probability. Conditions for the validity of the adiabatic or the nonadiabatic limits will be discussed. Application of this model to real systems is proposed, in particular for a porphyrin rigidly linked to a quinone, which is a very interesting model compound for primary events of photosynthesis. This model can also be used for other multicoordinate biological reactions such as ligand binding to heme proteins. Also, in the concluding part of Sec. III, we discuss the important limit where the fast vibronic mode is much faster than all the other nuclear modes coupled to the problem. In this limit the fast mode ``renormalizes'' the electronic matrix element, and this considerably simplifies the treatment of the problem, reducing it to coupling only to the slow modes.

Lipid Encapsulation Provides Insufficient Total-Tract Digestibility to Achieve an Optimal Transfer Efficiency of Fatty Acids to Milk Fat

PubMed Central

Bainbridge, Melissa; Kraft, Jana

2016-01-01

Transfer efficiencies of rumen-protected n-3 fatty acids (FA) to milk are low, thus we hypothesized that rumen-protection technologies allow for biohydrogenation and excretion of n-3 FA. The objectives of this study were to i) investigate the ruminal protection and post-ruminal release of the FA derived from the lipid-encapsulated echium oil (EEO), and ii) assess the bioavailability and metabolism of the EEO-derived FA through measuring the FA content in plasma lipid fractions, feces, and milk. The EEO was tested for rumen stability using the in situ nylon bag technique, then the apparent total-tract digestibility was assessed in vivo using six Holstein dairy cattle. Diets consisted of a control (no EEO); 1.5% of dry matter (DM) as EEO and 1.5% DM as encapsulation matrix; and 3% DM as EEO. The EEO was rumen-stable and had no effect on animal production. EEO-derived FA were incorporated into all plasma lipid fractions, with the highest proportion of n-3 FA observed in cholesterol esters. Fecal excretion of EEO-derived FA ranged from 7–14%. Biohydrogenation products increased in milk, plasma, and feces with EEO supplementation. In conclusion, lipid-encapsulation provides inadequate digestibility to achieve an optimal transfer efficiency of n-3 FA to milk. PMID:27741299

Gelatin-Based Laser Direct-Write Technique for the Precise Spatial Patterning of Cells

PubMed Central

Schiele, Nathan R.; Chrisey, Douglas B.

2011-01-01

Laser direct-writing provides a method to pattern living cells in vitro, to study various cell–cell interactions, and to build cellular constructs. However, the materials typically used may limit its long-term application. By utilizing gelatin coatings on the print ribbon and growth surface, we developed a new approach for laser cell printing that overcomes the limitations of Matrigel™. Gelatin is free of growth factors and extraneous matrix components that may interfere with cellular processes under investigation. Gelatin-based laser direct-write was able to successfully pattern human dermal fibroblasts with high post-transfer viability (91% ± 3%) and no observed double-strand DNA damage. As seen with atomic force microscopy, gelatin offers a unique benefit in that it is present temporarily to allow cell transfer, but melts and is removed with incubation to reveal the desired application-specific growth surface. This provides unobstructed cellular growth after printing. Monitoring cell location after transfer, we show that melting and removal of gelatin does not affect cellular placement; cells maintained registry within 5.6 ± 2.5 μm to the initial pattern. This study demonstrates the effectiveness of gelatin in laser direct-writing to create spatially precise cell patterns with the potential for applications in tissue engineering, stem cell, and cancer research. PMID:20849381

Silver nanoparticles-incorporated Nb2O5 surface passivation layer for efficiency enhancement in dye-sensitized solar cells.

PubMed

Suresh, S; Unni, Gautam E; Satyanarayana, M; Sreekumaran Nair, A; Mahadevan Pillai, V P

2018-08-15

Guiding and capturing photons at the nanoscale by means of metal nanoparticles and interfacial engineering for preventing back-electron transfer are well documented techniques for performance enhancement in excitonic solar cells. Drifting from the conventional route, we propose a simple one-step process to integrate both metal nanoparticles and surface passivation layer in the porous photoanode matrix of a dye-sensitized solar cell. Silver nanoparticles and Nb 2 O 5 surface passivation layer are simultaneously deposited on the surface of a highly porous nanocrystalline TiO 2 photoanode, facilitating an absorption enhancement in the 465 nm and 570 nm wavelength region and a reduction in back-electron transfer in the fabricated dye-sensitized solar cells together. The TiO 2 photoanodes were prepared by spray pyrolysis deposition method from a colloidal solution of TiO 2 nanoparticles. An impressive 43% enhancement in device performance was accomplished in photoanodes having an Ag-incorporated Nb 2 O 5 passivation layer as against a cell without Ag nanoparticles. By introducing this idea, we were able to record two benefits - the metal nanoparticles function as the absorption enhancement agent, and the Nb 2 O 5 layer as surface passivation for TiO 2 nanoparticles and as an energy barrier layer for preventing back-electron transfer - in a single step. Copyright © 2018 Elsevier Inc. All rights reserved.

The local pathology of interstitial edema: surface tension increases hydration potential in heat-damaged skin.

PubMed

McGee, Maria P; Morykwas, Michael J; Argenta, Louis C

2011-01-01

The local pathogenesis of interstitial edema in burns is incompletely understood. This ex vivo study investigates the forces mediating water-transfer in and out of heat-denatured interstitial matrix. Experimentally, full-thickness dermal samples are heated progressively to disrupt glycosaminoglycans, kill cells, and denature collagen under conditions that prevent water loss/gain; subsequently, a battery of complementary techniques including among others, high-resolution magnetic resonance imaging, equilibrium vapor pressure and osmotic stress are used to compare water-potential parameters of nonheated and heated dermis. The hydration potential (HP) determined by osmotic stress is a measure of the total water-potential defined empirically as the pressure at which no net water influx/efflux into/from the dermis is detected. Results show that after heat denaturation, the HP, the intensity of T2-weighed magnetic resonance images, and the vapor pressure increase indicating higher water activity and necessarily, smaller contributions from colloidosmotic forces to fluid influx in burned relative to healthy dermis. Concomitant increases in HP and in water activity implicate local changes in interfacial and metabolic energy as the source of excess fluid-transfer potential. These ex vivo findings also show that these additional forces contributing to abnormal fluid-transfer in burned skin develop independently of inflammatory and systemic hydrodynamic responses. © 2011 by the Wound Healing Society.

Resonance Energy Transfer Studies from Derivatives of Thiophene Substituted 1,3,4-Oxadiazoles to Coumarin-334 Dye in Liquid and Dye-Doped Polymer Media

NASA Astrophysics Data System (ADS)

Naik, Lohit; Deshapande, Narahari; Khazi, Imtiyaz Ahamed M.; Malimath, G. H.

2018-02-01

In the present work, we have carried out energy transfer studies using newly synthesised derivatives of thiophene substituted 1,3,4-oxadiazoles namely, 2-(-4-(thiophene-3-yl)phenyl)-5-(5-(thiophene-3-yl)thiophene-2-yl)-1,3,4-oxadiazole [TTO], 2-(-4-(benzo[b]thiophene-2-yl)phenyl)-5-(5-(benzo[b]thiophene-2-yl)-1,3,4-oxadiozole [TBO] and 2-(4-(4-(trifluoromethyl)phenyl)phenyl)-5-(5-(4-(trifluoromethyl)phenyl)thiophen-2-yl)-1,3,4-oxadiazole [TMO] as donors and laser dye coumarin-334 as acceptor in ethanol and dye-doped polymer (poly(methyl methacrylate) (PMMA)) media following steady-state and time-resolved fluorescence methods. Bimolecular quenching constant ( k q), translation diffusion rate parameter ( k d), diffusion length ( D l), critical transfer distance ( R 0), donor- acceptor distance ( r) and energy transfer efficiency ( E T) are calculated. It is observed that, critical transfer distance is more than the diffusion length for all the pairs. Further, bimolecular quenching constant is also more than the translation diffusion rate parameter. Hence, our experimental findings suggest that overall energy transfer is due to Förster resonance energy transfer (FRET) between donor and acceptor in both the media and for all the pairs. In addition, considerable increase in fluorescence intensity and energy transfer efficiency is observed in dye-doped polymer matrix systems as compared to liquid media. This suggests that, these donor-acceptor pairs doped in PMMA matrix may be used for applications such as energy transfer dye lasers (ETDL) to improve the efficiency and photostability, to enhance tunability and for plastic scintillation detectors.

Multi-GPU implementation of a VMAT treatment plan optimization algorithm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Zhen, E-mail: Zhen.Tian@UTSouthwestern.edu, E-mail: Xun.Jia@UTSouthwestern.edu, E-mail: Steve.Jiang@UTSouthwestern.edu; Folkerts, Michael; Tan, Jun

Purpose: Volumetric modulated arc therapy (VMAT) optimization is a computationally challenging problem due to its large data size, high degrees of freedom, and many hardware constraints. High-performance graphics processing units (GPUs) have been used to speed up the computations. However, GPU’s relatively small memory size cannot handle cases with a large dose-deposition coefficient (DDC) matrix in cases of, e.g., those with a large target size, multiple targets, multiple arcs, and/or small beamlet size. The main purpose of this paper is to report an implementation of a column-generation-based VMAT algorithm, previously developed in the authors’ group, on a multi-GPU platform tomore » solve the memory limitation problem. While the column-generation-based VMAT algorithm has been previously developed, the GPU implementation details have not been reported. Hence, another purpose is to present detailed techniques employed for GPU implementation. The authors also would like to utilize this particular problem as an example problem to study the feasibility of using a multi-GPU platform to solve large-scale problems in medical physics. Methods: The column-generation approach generates VMAT apertures sequentially by solving a pricing problem (PP) and a master problem (MP) iteratively. In the authors’ method, the sparse DDC matrix is first stored on a CPU in coordinate list format (COO). On the GPU side, this matrix is split into four submatrices according to beam angles, which are stored on four GPUs in compressed sparse row format. Computation of beamlet price, the first step in PP, is accomplished using multi-GPUs. A fast inter-GPU data transfer scheme is accomplished using peer-to-peer access. The remaining steps of PP and MP problems are implemented on CPU or a single GPU due to their modest problem scale and computational loads. Barzilai and Borwein algorithm with a subspace step scheme is adopted here to solve the MP problem. A head and neck (H and N) cancer case is then used to validate the authors’ method. The authors also compare their multi-GPU implementation with three different single GPU implementation strategies, i.e., truncating DDC matrix (S1), repeatedly transferring DDC matrix between CPU and GPU (S2), and porting computations involving DDC matrix to CPU (S3), in terms of both plan quality and computational efficiency. Two more H and N patient cases and three prostate cases are used to demonstrate the advantages of the authors’ method. Results: The authors’ multi-GPU implementation can finish the optimization process within ∼1 min for the H and N patient case. S1 leads to an inferior plan quality although its total time was 10 s shorter than the multi-GPU implementation due to the reduced matrix size. S2 and S3 yield the same plan quality as the multi-GPU implementation but take ∼4 and ∼6 min, respectively. High computational efficiency was consistently achieved for the other five patient cases tested, with VMAT plans of clinically acceptable quality obtained within 23–46 s. Conversely, to obtain clinically comparable or acceptable plans for all six of these VMAT cases that the authors have tested in this paper, the optimization time needed in a commercial TPS system on CPU was found to be in an order of several minutes. Conclusions: The results demonstrate that the multi-GPU implementation of the authors’ column-generation-based VMAT optimization can handle the large-scale VMAT optimization problem efficiently without sacrificing plan quality. The authors’ study may serve as an example to shed some light on other large-scale medical physics problems that require multi-GPU techniques.« less

A quantitative and non-contact technique to characterise microstructural variations of skin tissues during photo-damaging process based on Mueller matrix polarimetry.

PubMed

Dong, Yang; He, Honghui; Sheng, Wei; Wu, Jian; Ma, Hui

2017-10-31

Skin tissue consists of collagen and elastic fibres, which are highly susceptible to damage when exposed to ultraviolet radiation (UVR), leading to skin aging and cancer. However, a lack of non-invasive detection methods makes determining the degree of UVR damage to skin in real time difficult. As one of the fundamental features of light, polarization can be used to develop imaging techniques capable of providing structural information about tissues. In particular, Mueller matrix polarimetry is suitable for detecting changes in collagen and elastic fibres. Here, we demonstrate a novel, quantitative, non-contact and in situ technique based on Mueller matrix polarimetry for monitoring the microstructural changes of skin tissues during UVR-induced photo-damaging. We measured the Mueller matrices of nude mouse skin samples, then analysed the transformed parameters to characterise microstructural changes during the skin photo-damaging and self-repairing processes. Comparisons between samples with and without the application of a sunscreen showed that the Mueller matrix-derived parameters are potential indicators for fibrous microstructure in skin tissues. Histological examination and Monte Carlo simulations confirmed the relationship between the Mueller matrix parameters and changes to fibrous structures. This technique paves the way for non-contact evaluation of skin structure in cosmetics and dermatological health.

Low-rank matrix decomposition and spatio-temporal sparse recovery for STAP radar

DOE PAGES

Sen, Satyabrata

2015-08-04

We develop space-time adaptive processing (STAP) methods by leveraging the advantages of sparse signal processing techniques in order to detect a slowly-moving target. We observe that the inherent sparse characteristics of a STAP problem can be formulated as the low-rankness of clutter covariance matrix when compared to the total adaptive degrees-of-freedom, and also as the sparse interference spectrum on the spatio-temporal domain. By exploiting these sparse properties, we propose two approaches for estimating the interference covariance matrix. In the first approach, we consider a constrained matrix rank minimization problem (RMP) to decompose the sample covariance matrix into a low-rank positivemore » semidefinite and a diagonal matrix. The solution of RMP is obtained by applying the trace minimization technique and the singular value decomposition with matrix shrinkage operator. Our second approach deals with the atomic norm minimization problem to recover the clutter response-vector that has a sparse support on the spatio-temporal plane. We use convex relaxation based standard sparse-recovery techniques to find the solutions. With extensive numerical examples, we demonstrate the performances of proposed STAP approaches with respect to both the ideal and practical scenarios, involving Doppler-ambiguous clutter ridges, spatial and temporal decorrelation effects. As a result, the low-rank matrix decomposition based solution requires secondary measurements as many as twice the clutter rank to attain a near-ideal STAP performance; whereas the spatio-temporal sparsity based approach needs a considerably small number of secondary data.« less

Revealing Slip Bands In A Metal-Matrix/Fiber Composite

NASA Technical Reports Server (NTRS)

Lerch, Bradley A.

1995-01-01

Experimental procedure includes heat treatments and metallographic techniques developed to facilitate studies of deformation of metal-matrix/fiber composite under stress. Reveals slip bands, indicative of plastic flow occurring in matrix during mechanical tests of specimens of composite.

Upper-limb biomechanical analysis of wheelchair transfer techniques in two toilet configurations.

PubMed

Tsai, Chung-Ying; Boninger, Michael L; Bass, Sarah R; Koontz, Alicia M

2018-06-01

Using proper technique is important for minimizing upper limb kinetics during wheelchair transfers. The objective of the study was to 1) evaluate the transfer techniques used during toilet transfers and 2) determine the impact of technique on upper limb joint loading for two different toilet configurations. Twenty-six manual wheelchair users (23 men and 3 women) performed transfers in a side and front wheelchair-toilet orientation while their habitual transfer techniques were evaluated using the Transfer Assessment Instrument. A motion analysis system and force sensors were used to record biomechanical data during the transfers. More than 20% of the participants failed to complete five transfer skills in the side setup compared to three skills in the front setup. Higher quality skills overall were associated with lower peak forces and moments in both toilet configurations (-0.68 < r < -0.40, p < 0.05). In the side setup, participants who properly placed their hands in a stable position and used proper leading handgrips had lower shoulder resultant joint forces and moments than participants who did not perform these skills correctly (p ≤ 0.04). In the front setup, positioning the wheelchair within three inches of the transfer target was associated with reduced peak trailing forces and moments across all three upper limb joints (p = 0.02). Transfer skills training, making toilet seats level with the wheelchair seat, positioning the wheelchair closer to the toilet and mounting grab bars in a more ideal location for persons who do sitting pivot transfers may facilitate better quality toilet transfers. Published by Elsevier Ltd.

Process techniques of charge transfer time reduction for high speed CMOS image sensors

NASA Astrophysics Data System (ADS)

Zhongxiang, Cao; Quanliang, Li; Ye, Han; Qi, Qin; Peng, Feng; Liyuan, Liu; Nanjian, Wu

2014-11-01

This paper proposes pixel process techniques to reduce the charge transfer time in high speed CMOS image sensors. These techniques increase the lateral conductivity of the photo-generated carriers in a pinned photodiode (PPD) and the voltage difference between the PPD and the floating diffusion (FD) node by controlling and optimizing the N doping concentration in the PPD and the threshold voltage of the reset transistor, respectively. The techniques shorten the charge transfer time from the PPD diode to the FD node effectively. The proposed process techniques do not need extra masks and do not cause harm to the fill factor. A sub array of 32 × 64 pixels was designed and implemented in the 0.18 μm CIS process with five implantation conditions splitting the N region in the PPD. The simulation and measured results demonstrate that the charge transfer time can be decreased by using the proposed techniques. Comparing the charge transfer time of the pixel with the different implantation conditions of the N region, the charge transfer time of 0.32 μs is achieved and 31% of image lag was reduced by using the proposed process techniques.

Treatment of multiple adjacent Miller Class I and II gingival recessions with collagen matrix and the modified coronally advanced tunnel technique.

PubMed

Molnár, Bálint; Aroca, Sofia; Keglevich, Tibor; Gera, István; Windisch, Péter; Stavropoulos, Andreas; Sculean, Anton

2013-01-01

To clinically evaluate the treatment of Miller Class I and II multiple adjacent gingival recessions using the modified coronally advanced tunnel technique combined with a newly developed bioresorbable collagen matrix of porcine origin. Eight healthy patients exhibiting at least three multiple Miller Class I and II multiple adjacent gingival recessions (a total of 42 recessions) were consecutively treated by means of the modified coronally advanced tunnel technique and collagen matrix. The following clinical parameters were assessed at baseline and 12 months postoperatively: full mouth plaque score (FMPS), full mouth bleeding score (FMBS), probing depth (PD), recession depth (RD), recession width (RW), keratinized tissue thickness (KTT), and keratinized tissue width (KTW). The primary outcome variable was complete root coverage. Neither allergic reactions nor soft tissue irritations or matrix exfoliations occurred. Postoperative pain and discomfort were reported to be low, and patient acceptance was generally high. At 12 months, complete root coverage was obtained in 2 out of the 8 patients and 30 of the 42 recessions (71%). Within their limits, the present results indicate that treatment of Miller Class I and II multiple adjacent gingival recessions by means of the modified coronally advanced tunnel technique and collagen matrix may result in statistically and clinically significant complete root coverage. Further studies are warranted to evaluate the performance of collagen matrix compared with connective tissue grafts and other soft tissue grafts.

Acoustic resonance scattering from a multilayered cylindrical shell with imperfect bonding.

PubMed

Rajabi, M; Hasheminejad, Seyyed M

2009-12-01

The method of wave function expansion is adopted to study the three dimensional scattering of a time-harmonic plane progressive sound field obliquely incident upon a multi-layered hollow cylinder with interlaminar bonding imperfection. For the generality of solution, each layer is assumed to be cylindrically orthotropic. An approximate laminate model in the context of the modal state equations with variable coefficients along with the classical T-matrix solution technique is set up for each layer to solve for the unknown modal scattering and transmission coefficients. A linear spring model is used to describe the interlaminar adhesive bonding whose effects are incorporated into the global transfer matrix by introduction of proper interfacial transfer matrices. Following the classic acoustic resonance scattering theory (RST), the scattered field and response to surface waves are determined by constructing the partial waves and obtaining the non-resonance (backgrounds) and resonance components. The solution is first used to investigate the effect of interlayer imperfection of an air-filled and water submerged bilaminate aluminium cylindrical shell on the resonances associated with various modes of wave propagation (i.e., symmetric/asymmetric Lamb waves, fluid-borne A-type waves, Rayleigh and Whispering Gallery waves) appearing in the backscattered spectrum, according to their polarization and state of stress. An illustrative numerical example is also given for a multi-layered (five-layered) cylindrical shell for which the stiffness of the adhesive interlayers is artificially varied. The sensitivity of resonance frequencies associated with higher mode numbers to the stiffness coefficients is demonstrated to be a good measure of the bonding strength. Limiting cases are considered and fair agreements with solutions available in the literature are established.

Electrical Resistance Technique to Monitor SiC Composite Detection

NASA Technical Reports Server (NTRS)

Smith, Craig; Morscher, Gregory; Xia, Zhenhai

2008-01-01

Ceramic matrix composites are suitable for high temperature structural applications such as turbine airfoils and hypersonic thermal protection systems. The employment of these materials in such applications is limited by the ability to process components reliable and to accurately monitor and predict damage evolution that leads to failure under stressed-oxidation conditions. Current nondestructive methods such as ultrasound, x-ray, and thermal imaging are limited in their ability to quantify small scale, transverse, in-plane, matrix cracks developed over long-time creep and fatigue conditions. Electrical resistance of SiC/SiC composites is one technique that shows special promise towards this end. Since both the matrix and the fibers are conductive, changes in matrix or fiber properties should relate to changes in electrical conductivity along the length of a specimen or part. The effect of matrix cracking on electrical resistivity for several composite systems will be presented and some initial measurements performed at elevated temperatures under stress-rupture conditions. The implications towards electrical resistance as a technique applied to composite processing, damage detection (health monitoring), and life-modeling will be discussed.

Coupled near-field and far-field exposure assessment framework for chemicals in consumer products.

PubMed

Fantke, Peter; Ernstoff, Alexi S; Huang, Lei; Csiszar, Susan A; Jolliet, Olivier

2016-09-01

Humans can be exposed to chemicals in consumer products through product use and environmental emissions over the product life cycle. Exposure pathways are often complex, where chemicals can transfer directly from products to humans during use or exchange between various indoor and outdoor compartments until sub-fractions reach humans. To consistently evaluate exposure pathways along product life cycles, a flexible mass balance-based assessment framework is presented structuring multimedia chemical transfers in a matrix of direct inter-compartmental transfer fractions. By matrix inversion, we quantify cumulative multimedia transfer fractions and exposure pathway-specific product intake fractions defined as chemical mass taken in by humans per unit mass of chemical in a product. Combining product intake fractions with chemical mass in the product yields intake estimates for use in life cycle impact assessment and chemical alternatives assessment, or daily intake doses for use in risk-based assessment and high-throughput screening. Two illustrative examples of chemicals used in personal care products and flooring materials demonstrate how this matrix-based framework offers a consistent and efficient way to rapidly compare exposure pathways for adult and child users and for the general population. This framework constitutes a user-friendly approach to develop, compare and interpret multiple human exposure scenarios in a coupled system of near-field ('user' environment), far-field and human intake compartments, and helps understand the contribution of individual pathways to overall human exposure in various product application contexts to inform decisions in different science-policy fields for which exposure quantification is relevant. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

NASA Astrophysics Data System (ADS)

Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

2018-03-01

We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

Thermal Energy Transfer Through All Ceramic Restorations

DTIC Science & Technology

2016-06-01

particles, but newer generations have reduced the size and narrowed the range of particles in the matrix . This evolution in ceramics improved the...crystalline second phase. These ceramics have a lithium silicate glass matrix with approximately 70% lithium-disilicate crystal fill. The micron size and... composition category described by Giordano and McLaren are the Interpenetrating Phase Ceramics . These ceramics were developed as an alternative to the

Automatic computation of transfer functions

DOEpatents

Atcitty, Stanley; Watson, Luke Dale

2015-04-14

Technologies pertaining to the automatic computation of transfer functions for a physical system are described herein. The physical system is one of an electrical system, a mechanical system, an electromechanical system, an electrochemical system, or an electromagnetic system. A netlist in the form of a matrix comprises data that is indicative of elements in the physical system, values for the elements in the physical system, and structure of the physical system. Transfer functions for the physical system are computed based upon the netlist.

Development of a laser-induced heat flux technique for measurement of convective heat transfer coefficients in a supersonic flowfield

NASA Technical Reports Server (NTRS)

Porro, A. Robert; Keith, Theo G., Jr.; Hingst, Warren R.; Chriss, Randall M.; Seablom, Kirk D.

1991-01-01

A technique is developed to measure the local convective heat transfer coefficient on a model surface in a supersonic flow field. The technique uses a laser to apply a discrete local heat flux at the model test surface, and an infrared camera system determines the local temperature distribution due to heating. From this temperature distribution and an analysis of the heating process, a local convective heat transfer coefficient is determined. The technique was used to measure the load surface convective heat transfer coefficient distribution on a flat plate at nominal Mach numbers of 2.5, 3.0, 3.5, and 4.0. The flat plate boundary layer initially was laminar and became transitional in the measurement region. The experimental results agreed reasonably well with theoretical predictions of convective heat transfer of flat plate laminar boundary layers. The results indicate that this non-intrusive optical measurement technique has the potential to obtain high quality surface convective heat transfer measurements in high speed flowfields.

A laser-induced heat flux technique for convective heat transfer measurements in high speed flows

NASA Technical Reports Server (NTRS)

Porro, A. R.; Keith, T. G., Jr.; Hingst, W. R.

1991-01-01

A technique is developed to measure the local convective heat transfer coefficient on a model surface in a supersonic flow field. The technique uses a laser to apply a discrete local heat flux at the model test surface, and an infrared camera system determines the local temperature distribution due to the heating. From this temperature distribution and an analysis of the heating process, a local convective heat transfer coefficient is determined. The technique was used to measure the local surface convective heat transfer coefficient distribution on a flat plate at nominal Mach numbers of 2.5, 3.0, 3.5, and 4.0. The flat plate boundary layer initially was laminar and became transitional in the measurement region. The experimentally determined convective heat transfer coefficients were generally higher than the theoretical predictions for flat plate laminar boundary layers. However, the results indicate that this nonintrusive optical measurement technique has the potential to measure surface convective heat transfer coefficients in high speed flow fields.

A laser-induced heat flux technique for convective heat transfer measurements in high speed flows

NASA Technical Reports Server (NTRS)

Porro, A. R.; Keith, T. G., Jr.; Hingst, W. R.

1991-01-01

A technique is developed to measure the local convective heat transfer coefficient on a model surface in a supersonic flow field. The technique uses a laser to apply a discrete local heat flux at the model test surface, and an infrared camera system determines the local temperature distribution due to the heating. From this temperature distribution and an analysis of the heating process, a local convective heat transfer coefficient is determined. The technique was used to measure the local surface convective heat transfer coefficient distribution on a flat plate at nominal Mach numbers of 2.5, 3.0, 3.5, and 4.0. The flat plate boundary layer initially was laminar and became transitional in the measurement region. The experimentally determined convective heat transfer coefficients were generally higher than the theoretical predictions for flat plate laminar boundary layers. However, the results indicate that this nonintrusive optical measurement technique has the potential to measure surface convective heat transfer coefficients in high-speed flowfields.

Effective load transfer by a chromium carbide nanostructure in a multi-walled carbon nanotube/copper matrix composite

NASA Astrophysics Data System (ADS)

Cho, Seungchan; Kikuchi, Keiko; Kawasaki, Akira; Kwon, Hansang; Kim, Yangdo

2012-08-01

Multi-walled carbon nanotube (MWCNT) reinforced copper (Cu) matrix composites, which exhibit chromium (Cr) carbide nanostructures at the MWCNT/Cu interface, were prepared through a carbide formation using CuCr alloy powder. The fully densified and oriented MWCNTs dispersed throughout the composites were prepared using spark plasma sintering (SPS) followed by hot extrusion. The tensile strengths of the MWCNT/CuCr composites increased with increasing MWCNTs content, while the tensile strength of MWCNT/Cu composite decreased from that of monolithic Cu. The enhanced tensile strength of the MWCNT/CuCr composites is a result of possible load-transfer mechanisms of the interfacial Cr carbide nanostructures. The multi-wall failure of MWCNTs observed in the fracture surface of the MWCNT/CuCr composites indicates an improvement in the load-bearing capacity of the MWCNTs. This result shows that the Cr carbide nanostructures effectively transferred the tensile load to the MWCNTs during fracture through carbide nanostructure formation in the MWCNT/Cu composite.

Toe-to-hand transfer: Evolving Indications and Relevant Outcomes

PubMed Central

Waljee, Jennifer F.; Chung, Kevin C.

2014-01-01

In the late 19th century, the first toe to hand transfer was performed in Vienna, Switzerland as a staged procedure by Nicolandi.(1) Since that time, the advent of microsurgery has revolutionized toe to hand transfers. In 1966, Buncke performed the first microvascular toe to thumb transfer in a rhesus monkey.(2) The first toe to thumb transfer using microsurgical techniques in humans was performed by Cobbett in 1969, followed shortly thereafter by the first transfer of a second toe to the thumb position.(3,4) Today, due to expanding microsurgical techniques and surgeon innovation, the indications and techniques for toe-to-hand transfer procedures continue to evolve and now encompass patients with a variety of acquired and congenital hand defects.(5) PMID:23790426

MAPLE deposition of nanomaterials

NASA Astrophysics Data System (ADS)

Caricato, A. P.; Arima, V.; Catalano, M.; Cesaria, M.; Cozzoli, P. D.; Martino, M.; Taurino, A.; Rella, R.; Scarfiello, R.; Tunno, T.; Zacheo, A.

2014-05-01

The matrix-assisted pulsed laser evaporation (MAPLE) has been recently exploited for depositing films of nanomaterials by combining the advantages of colloidal inorganic nanoparticles and laser-based techniques. MAPLE-deposition of nanomaterials meeting applicative purposes demands their peculiar properties to be taken into account while planning depositions to guarantee a congruent transfer (in terms of crystal structure and geometric features) and explain the deposition outcome. In particular, since nanofluids can enhance thermal conductivity with respect to conventional fluids, laser-induced heating can induce different ablation thermal regimes as compared to the MAPLE-treatment of soft materials. Moreover, nanoparticles exhibit lower melting temperatures and can experience pre-melting phenomena as compared to their bulk counterparts, which could easily induce shape and or crystal phase modification of the material to be deposited even at very low fluences. In this complex scenario, this review paper focuses on examples of MAPLE-depositions of size and shape controlled nanoparticles for different applications highlights advantages and challenges of the MAPLE-technique. The influence of the deposition parameters on the physical mechanisms which govern the deposition process is discussed.

Bisphenol A, 4-t-octylphenol, and 4-nonylphenol determination in serum by Hybrid Solid Phase Extraction-Precipitation Technology technique tailored to liquid chromatography-tandem mass spectrometry.

PubMed

Asimakopoulos, Alexandros G; Thomaidis, Nikolaos S

2015-04-01

A rapid liquid chromatography-tandem mass spectrometry (LC-MS/MS) method was developed and optimized for the simultaneous determination of bisphenol A, 4-t-octylphenol and 4-nonylphenol in human blood serum. For the first time, the electrospray ionization (ESI) parameters of probe position, voltage potential, sheath gas flow rate, auxiliary gas flow rate, and ion transfer tube temperature were thoroughly studied and optimized for each phenol by a univariate approach. As a consequence, low instrumental limits of detection were reported, demonstrating at 0.2 ng/mL (in solvent matrix) excellent injection repeatability (RSD<14.5%) and a confirmation peak for all target phenols. Extraction and purification of serum was performed by the novel Hybrid Solid Phase Extraction-Precipitation Technology technique (Hybrid SPE-PPT). The limits of detection in human blood serum were 0.80, 1.3 and 1.4 ng/mL for BPA, 4-t-OP and 4-NP, respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

Multimodal approach to seismic pavement testing

USGS Publications Warehouse

Ryden, N.; Park, C.B.; Ulriksen, P.; Miller, R.D.

2004-01-01

A multimodal approach to nondestructive seismic pavement testing is described. The presented approach is based on multichannel analysis of all types of seismic waves propagating along the surface of the pavement. The multichannel data acquisition method is replaced by multichannel simulation with one receiver. This method uses only one accelerometer-receiver and a light hammer-source, to generate a synthetic receiver array. This data acquisition technique is made possible through careful triggering of the source and results in such simplification of the technique that it is made generally available. Multiple dispersion curves are automatically and objectively extracted using the multichannel analysis of surface waves processing scheme, which is described. Resulting dispersion curves in the high frequency range match with theoretical Lamb waves in a free plate. At lower frequencies there are several branches of dispersion curves corresponding to the lower layers of different stiffness in the pavement system. The observed behavior of multimodal dispersion curves is in agreement with theory, which has been validated through both numerical modeling and the transfer matrix method, by solving for complex wave numbers. ?? ASCE / JUNE 2004.

Simultaneous determination of nandrolone, testosterone, and methyltestosterone by multi-immunoaffinity column and capillary electrophoresis.

PubMed

Qi, Xiao-Hua; Zhang, Li-Wei; Zhang, Xin-Xiang

2008-08-01

A multitarget antibody immunoaffinity column was proposed for the purification and enrichment of nandrolone, testosterone, and methyltestosterone from urine. Nandrolone-3-site substituted antigen was designed and synthesized and the polyclonal antibody was prepared with immunizing rabbits. The stationary phase of the immunoaffinity column was synthesized by covalently bonding the antibodies specific to nandrolone, testosterone, and methyltestosterone onto CNBr-actived Sepharose 4B. The analytes of interest were extracted with a methanol/water mixture in one step. The immunoaffinity column showed high affinity and high selectivity to a class of structurally related compounds. The elution was then transferred to a micellar electrokinetic CE system with a running buffer of sodium borate and sodium cholate for separation and determination. Recoveries of the three steroids from complex matrix were 88-94% with RSD values less than 5.2%. Optimization of the immunoaffinity column purification was achieved and the feasibility of the technique for the analysis of steroid hormone was discussed. The results indicated that the combination of multi-immunoaffinity column and CE was an effective technique, which was rapid, simple, and sensitive for the assay of steroids.

Measurement of laser activated electron tunneling from semiconductor zinc oxide to adsorbed organic molecules by a matrix assisted laser desorption ionization mass spectrometer.

PubMed

Zhong, Hongying; Fu, Jieying; Wang, Xiaoli; Zheng, Shi

2012-06-04

Measurement of light induced heterogeneous electron transfer is important for understanding of fundamental processes involved in chemistry, physics and biology, which is still challenging by current techniques. Laser activated electron tunneling (LAET) from semiconductor metal oxides was observed and characterized by a MALDI (matrix assisted laser desorption ionization) mass spectrometer in this work. Nanoparticles of ZnO were placed on a MALDI sample plate. Free fatty acids and derivatives were used as models of organic compounds and directly deposited on the surface of ZnO nanoparticles. Irradiation of UV laser (λ=355 nm) with energy more than the band gap of ZnO produces ions that can be detected in negative mode. When TiO(2) nanoparticles with similar band gap but much lower electron mobility were used, these ions were not observed unless the voltage on the sample plate was increased. The experimental results indicate that laser induced electron tunneling is dependent on the electron mobility and the strength of the electric field. Capture of low energy electrons by charge-deficient atoms of adsorbed organic molecules causes unpaired electron-directed cleavages of chemical bonds in a nonergodic pathway. In positive detection mode, electron tunneling cannot be observed due to the reverse moving direction of electrons. It should be able to expect that laser desorption ionization mass spectrometry is a new technique capable of probing the dynamics of electron tunneling. LAET offers advantages as a new ionization dissociation method for mass spectrometry. Copyright © 2012 Elsevier B.V. All rights reserved.

Generalized Bloch theorem for complex periodic potentials: A powerful application to quantum transport calculations

NASA Astrophysics Data System (ADS)

Zhang, X.-G.; Varga, Kalman; Pantelides, Sokrates T.

2007-07-01

Band-theoretic methods with periodically repeated supercells have been a powerful approach for ground-state electronic structure calculations but have not so far been adapted for quantum transport problems with open boundary conditions. Here, we introduce a generalized Bloch theorem for complex periodic potentials and use a transfer-matrix formulation to cast the transmission probability in a scattering problem with open boundary conditions in terms of the complex wave vectors of a periodic system with absorbing layers, allowing a band technique for quantum transport calculations. The accuracy and utility of the method are demonstrated by the model problems of the transmission of an electron over a square barrier and the scattering of a phonon in an inhomogeneous nanowire. Application to the resistance of a twin boundary in nanocrystalline copper yields excellent agreement with recent experimental data.

Thermodynamics of alternating spin chains with competing nearest- and next-nearest-neighbor interactions: Ising model

NASA Astrophysics Data System (ADS)

Pini, Maria Gloria; Rettori, Angelo

1993-08-01

The thermodynamical properties of an alternating spin (S,s) one-dimensional (1D) Ising model with competing nearest- and next-nearest-neighbor interactions are exactly calculated using a transfer-matrix technique. In contrast to the case S=s=1/2, previously investigated by Harada, the alternation of different spins (S≠s) along the chain is found to give rise to two-peaked static structure factors, signaling the coexistence of different short-range-order configurations. The relevance of our calculations with regard to recent experimental data by Gatteschi et al. in quasi-1D molecular magnetic materials, R (hfac)3 NITEt (R=Gd, Tb, Dy, Ho, Er, . . .), is discussed; hfac is hexafluoro-acetylacetonate and NlTEt is 2-Ethyl-4,4,5,5-tetramethyl-4,5-dihydro-1H-imidazolyl-1-oxyl-3-oxide.

Application of mass spectrometry based electronic nose and chemometrics for fingerprinting radiation treatment

NASA Astrophysics Data System (ADS)

Gupta, Sumit; Variyar, Prasad S.; Sharma, Arun

2015-01-01

Volatile compounds were isolated from apples and grapes employing solid phase micro extraction (SPME) and subsequently analyzed by GC/MS equipped with a transfer line without stationary phase. Single peak obtained was integrated to obtain total mass spectrum of the volatile fraction of samples. A data matrix having relative abundance of all mass-to-charge ratios was subjected to principal component analysis (PCA) and linear discriminant analysis (LDA) to identify radiation treatment. PCA results suggested that there is sufficient variability between control and irradiated samples to build classification models based on supervised techniques. LDA successfully aided in segregating control from irradiated samples at all doses (0.1, 0.25, 0.5, 1.0, 1.5, 2.0 kGy). SPME-MS with chemometrics was successfully demonstrated as simple screening method for radiation treatment.

Modulation of the malignant phenotype with the urokinase-type plasminogen activator and the type I plasminogen activator inhibitor.

PubMed

Sordat, B; Reiter, L; Cajot, J F

1990-12-02

Gene transfer techniques were utilized to evaluate the role of urokinase-type plasminogen activator (uPA) and plasminogen activator inhibitor type 1 (PAI-1) in enhancing or preventing the expression of the invasive malignant phenotype, respectively. Mouse L-cell transfectants expressing human uPA or human PAI-1 as well as mouse B16 transfectants expressing mouse uPA or human PAI-1 were generated. These transfectants were tested using a variety of experimental methods including smooth muscle cell matrix solubilization in vitro, lung colony formation in vivo and co-cultures of antagonist-expressing cells in vitro. Results from these studies provide direct evidence for an enhancing role of uPA in malignant invasion and experimental metastasis and for a modulatory role of PAI-1 in tumor cell-mediated breakdown of extracellular matrices.

Bioreactors for Tissue Engineering of Cartilage

NASA Astrophysics Data System (ADS)

Concaro, S.; Gustavson, F.; Gatenholm, P.

The cartilage regenerative medicine field has evolved during the last decades. The first-generation technology, autologous chondrocyte transplantation (ACT) involved the transplantation of in vitro expanded chondrocytes to cartilage defects. The second generation involves the seeding of chondrocytes in a three-dimensional scaffold. The technique has several potential advantages such as the ability of arthroscopic implantation, in vitro pre-differentiation of cells and implant stability among others (Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L, N Engl J Med 331(14):889-895, 1994; Henderson I, Francisco R, Oakes B, Cameron J, Knee 12(3):209-216, 2005; Peterson L, Minas T, Brittberg M, Nilsson A, Sjogren-Jansson E, Lindahl A, Clin Orthop (374):212-234, 2000; Nagel-Heyer S, Goepfert C, Feyerabend F, Petersen JP, Adamietz P, Meenen NM, et al. Bioprocess Biosyst Eng 27(4):273-280, 2005; Portner R, Nagel-Heyer S, Goepfert C, Adamietz P, Meenen NM, J Biosci Bioeng 100(3):235-245, 2005; Nagel-Heyer S, Goepfert C, Adamietz P, Meenen NM, Portner R, J Biotechnol 121(4):486-497, 2006; Heyland J, Wiegandt K, Goepfert C, Nagel-Heyer S, Ilinich E, Schumacher U, et al. Biotechnol Lett 28(20):1641-1648, 2006). The nutritional requirements of cells that are synthesizing extra-cellular matrix increase along the differentiation process. The mass transfer must be increased according to the tissue properties. Bioreactors represent an attractive tool to accelerate the biochemical and mechanical properties of the engineered tissues providing adequate mass transfer and physical stimuli. Different reactor systems have been [5] developed during the last decades based on different physical stimulation concepts. Static and dynamic compression, confined and nonconfined compression-based reactors have been described in this review. Perfusion systems represent an attractive way of culturing constructs under dynamic conditions. Several groups showed increased matrix production using confined and unconfined systems. Development of automatic culture systems and noninvasive monitoring of matrix production will take place during the next few years in order to improve the cost affectivity of tissue-engineered products.

Post-processing of metal matrix composites by friction stir processing

NASA Astrophysics Data System (ADS)

Sharma, Vipin; Singla, Yogesh; Gupta, Yashpal; Raghuwanshi, Jitendra

2018-05-01

In metal matrix composites non-uniform distribution of reinforcement particles resulted in adverse affect on the mechanical properties. It is of great interest to explore post-processing techniques that can eliminate particle distribution heterogeneity. Friction stir processing is a relatively newer technique used for post-processing of metal matrix composites to improve homogeneity in particles distribution. In friction stir processing, synergistic effect of stirring, extrusion and forging resulted in refinement of grains, reduction of reinforcement particles size, uniformity in particles distribution, reduction in microstructural heterogeneity and elimination of defects.

New method for propagating the square root covariance matrix in triangular form. [using Kalman-Bucy filter

NASA Technical Reports Server (NTRS)

Choe, C. Y.; Tapley, B. D.

1975-01-01

A method proposed by Potter of applying the Kalman-Bucy filter to the problem of estimating the state of a dynamic system is described, in which the square root of the state error covariance matrix is used to process the observations. A new technique which propagates the covariance square root matrix in lower triangular form is given for the discrete observation case. The technique is faster than previously proposed algorithms and is well-adapted for use with the Carlson square root measurement algorithm.

Periodontal plastic surgery of gingival recessions at single and multiple teeth.

PubMed

Cairo, Francesco

2017-10-01

This manuscript aims to review periodontal plastic surgery for root coverage at single and multiple gingival recessions. Techniques are assessed based on biological principles, surgical procedures, prognosticative factors and expected clinical and esthetic outcomes. The use of coronally advanced flap, laterally sliding flap, free gingival graft, the tunnel grafting technique, barrier membranes, enamel matrix derivative, collagen matrix and acellular dermal matrix are evaluated. The clinical scenario and practical implications are analyzed according to a modern evidence-based approach. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

On the Equivalence of the Summation and Transfer-Matrix Methods in Wave Propagation through Multilayers of Lossless and Lossy Media

ERIC Educational Resources Information Center

Pereyra, Pedro; Robledo-Martinez, Arturo

2009-01-01

We explicitly show that the well-known transmission and reflection amplitudes of planar slabs, obtained via an algebraic summation of Fresnel amplitudes, are completely equivalent to those obtained from transfer matrices in the scattering approach. This equivalence makes the finite periodic systems theory a powerful alternative to the cumbersome…

Real-time observation of intramolecular proton transfer in the electronic ground state of chloromalonaldehyde: an ab initio study of time-resolved photoelectron spectra.

PubMed

do N Varella, Márcio T; Arasaki, Yasuki; Ushiyama, Hiroshi; Takatsuka, Kazuo; Wang, Kwanghsi; McKoy, Vincent

2007-02-07

The authors report on studies of time-resolved photoelectron spectra of intramolecular proton transfer in the ground state of chloromalonaldehyde, employing ab initio photoionization matrix elements and effective potential surfaces of reduced dimensionality, wherein the couplings of proton motion to the other molecular vibrational modes are embedded by averaging over classical trajectories. In the simulations, population is transferred from the vibrational ground state to vibrationally hot wave packets by pumping to an excited electronic state and dumping with a time-delayed pulse. These pump-dump-probe simulations demonstrate that the time-resolved photoelectron spectra track proton transfer in the electronic ground state well and, furthermore, that the geometry dependence of the matrix elements enhances the tracking compared with signals obtained with the Condon approximation. Photoelectron kinetic energy distributions arising from wave packets localized in different basins are also distinguishable and could be understood, as expected, on the basis of the strength of the optical couplings in different regions of the ground state potential surface and the Franck-Condon overlaps of the ground state wave packets with the vibrational eigenstates of the ion potential surface.

Water-soluble, neutral 3,5-diformyl-BODIPY with extended fluorescence lifetime in a self-healable chitosan hydrogel.

PubMed

Belali, Simin; Emandi, Ganapathi; Cafolla, Atillio A; O'Connell, Barry; Haffner, Benjamin; Möbius, Matthias E; Karimi, Alireza; Senge, Mathias O

2017-11-08

3,5-Diformyl-4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (3,5-diformyl-BODIPY) can be used as an efficient biofunctional cross-linker to generate a new class of chitosan-based hydrogels with fluorescence resonance energy transfer (FRET) dynamics and good solubility in water. The hydrogel was fully characterized by FT-IR, UV-vis, fluorescence, FE-SEM, AFM, rheology and picosecond time-resolved spectroscopic techniques. The self-healing ability was demonstrated by rheological recovery and macroscopic and microscopic observations. The fluorescence lifetime was found to increase in aqueous solution of the BODIPY-chitosan hydrogel compared to the 3,5-diformyl-BODIPY monomer. Calculations based on experimental results such as red-shift and decreased intensity of the emission spectrum of highly dye-concentrated hydrogel in comparison to dilute hydrogels, together with changes in the fluorescence lifetime of the hydrogel at different concentration of dyes, suggest that the BDP-CS hydrogels fluorescence dynamics obey the Förster resonance energy transfer (FRET). Improvements in mechanical and photochemical properties and the acceptable values of BODIPY fluorescence lifetime in the hydrogel matrix indicate the utility of the newly synthesized hydrogels for biomedical applications.

Calculation of Transfer Functions of Multilayer Biotissues in the Problems of Correction of Their Fluorescence Spectra

NASA Astrophysics Data System (ADS)

Lysenko, S. A.

2018-01-01

A method for rapid calculation of a flux of stimulated fluorescence of a multilayer optically dense medium with inhomogeneous distribution of the fluorophore has been developed. The light field in the medium at the excitation wavelength of fluorescence is represented by a superposition of incident collimated, incident diffuse, and reflected diffuse fluxes. A two-stream approximation is used to describe the light field in the medium at the wavelength of emission of the fluorescence. Fluxes in adjacent elementary layers of the medium and on its surface are connected by simple matrix operators that are obtained using a combination of engineering approaches of radiation-transfer theory and single-scattering approximation. The calculations of fluorescence fluxes of a four-layer biotissue that are excited and recorded at 400-800 nm are compared with their Monte Carlo simulation with a discrepancy of 1%. The effect of the propagation medium on the fluorescence spectra of 5-ALA-induced protoporphyrin IX that are recorded from human skin was studied, and a technique for their correction that is based on measurements and quantitative analysis of the diffuse reflectance spectrum of skin was proposed.

Genetic Relationships Between Chondrules, Rims and Matrix

NASA Technical Reports Server (NTRS)

Huss, G. R.; Alexander, C. M. OD.; Palme, H.; Bland, P. A.; Wasson, J. T.

2004-01-01

The most primitive chondrites are composed of chondrules and chondrule fragments, various types of inclusions, discrete mineral grains, metal, sulfides, and fine-grained materials that occur as interchondrule matrix and as chondrule/inclusion rims. Understanding how these components are related is essential for understanding how chondrites and their constituents formed and were processed in the solar nebula. For example, were the first generations of chondrules formed by melting of matrix or matrix precursors? Did chondrule formation result in appreciable transfer of chondrule material into the matrix? Here, we consider three types of data: 1) compositional data for bulk chondrites and matrix, 2) mineralogical and textural information, and 3) the abundances and characteristics of presolar materials that reside in the matrix and rims. We use these data to evaluate the roles of evaporation and condensation, chondrule formation, mixing of different nebular components, and secondary processing both in the nebula and on the parent bodies. Our goal is to identify the things that are reasonably well established and to point out the areas that need additional work.

A Partitioning Algorithm for Block-Diagonal Matrices With Overlap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guy Antoine Atenekeng Kahou; Laura Grigori; Masha Sosonkina

2008-02-02

We present a graph partitioning algorithm that aims at partitioning a sparse matrix into a block-diagonal form, such that any two consecutive blocks overlap. We denote this form of the matrix as the overlapped block-diagonal matrix. The partitioned matrix is suitable for applying the explicit formulation of Multiplicative Schwarz preconditioner (EFMS) described in [3]. The graph partitioning algorithm partitions the graph of the input matrix into K partitions, such that every partition {Omega}{sub i} has at most two neighbors {Omega}{sub i-1} and {Omega}{sub i+1}. First, an ordering algorithm, such as the reverse Cuthill-McKee algorithm, that reduces the matrix profile ismore » performed. An initial overlapped block-diagonal partition is obtained from the profile of the matrix. An iterative strategy is then used to further refine the partitioning by allowing nodes to be transferred between neighboring partitions. Experiments are performed on matrices arising from real-world applications to show the feasibility and usefulness of this approach.« less

A Strassen-Newton algorithm for high-speed parallelizable matrix inversion

NASA Technical Reports Server (NTRS)

Bailey, David H.; Ferguson, Helaman R. P.

1988-01-01

Techniques are described for computing matrix inverses by algorithms that are highly suited to massively parallel computation. The techniques are based on an algorithm suggested by Strassen (1969). Variations of this scheme use matrix Newton iterations and other methods to improve the numerical stability while at the same time preserving a very high level of parallelism. One-processor Cray-2 implementations of these schemes range from one that is up to 55 percent faster than a conventional library routine to one that is slower than a library routine but achieves excellent numerical stability. The problem of computing the solution to a single set of linear equations is discussed, and it is shown that this problem can also be solved efficiently using these techniques.

Plastic scintillator enhancement through Quantum Dot

NASA Astrophysics Data System (ADS)

Tam, Alan; Boyraz, Ozdal; Nilsson, Mikael

2017-08-01

Plastic scintillators such as Polyvinyl Toluene (PVT) are used for radiation detection but due to their poor performance they are not widely implemented. In order to circumnavigate this, dopants are added to enhance scintillation by energy transfer otherwise lost through non-radiative processes. In this work, we exploit the effects of energy transfer through the use of short wavelength emission Cadmium Sulfide Quantum Dots (QD) as the transfer stimulant. Scintillation enhancement was observed as Cadmium Sulfide QD with scintillating dyes are embedded in PVT polymer matrix for beta and gamma radiation. Energy transfer was observed between Quantum Dots, scintillating dye, and the host polymer. Different concentrations of QD and 2,5-diphenyloxazole (PPO) dye are investigated to characterize the energy transfer.

A facile alternative technique for large-area graphene transfer via sacrificial polymer

DOE PAGES

Auchter, Eric; Marquez, Justin; Yarbro, Stephen L.; ...

2017-12-07

A novel method of transferring large-area graphene sheets onto a variety of substrates using Formvar (polyvinyl formal) is presented. Due to the ease at which formvar can be dissolved in chloroform this method allows for a consistent, a clean, and a more rapid transfer than other techniques including the PMMA assisted one. This novel transfer method is demonstrated by transferring large-area graphene onto a range of substrates including commercial TEM grids, silicon dioxide and glass. Raman spectroscopy was used to confirm the presence of graphene and characterize the morphological properties of the large-area sheets. SEM and AFM analyses demonstrated themore » effectiveness of our rapid transfer technique for clean crystalline large-area graphene sheets. The removal of the sacrificial polymer was found to be one to two orders of magnitude faster than PMMA methods. Ultimately this facile transfer technique offers new opportunities for a wide range of applications for large-area graphene through the utilization of a new sacrificial polymer.« less

A facile alternative technique for large-area graphene transfer via sacrificial polymer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auchter, Eric; Marquez, Justin; Yarbro, Stephen L.

A novel method of transferring large-area graphene sheets onto a variety of substrates using Formvar (polyvinyl formal) is presented. Due to the ease at which formvar can be dissolved in chloroform this method allows for a consistent, a clean, and a more rapid transfer than other techniques including the PMMA assisted one. This novel transfer method is demonstrated by transferring large-area graphene onto a range of substrates including commercial TEM grids, silicon dioxide and glass. Raman spectroscopy was used to confirm the presence of graphene and characterize the morphological properties of the large-area sheets. SEM and AFM analyses demonstrated themore » effectiveness of our rapid transfer technique for clean crystalline large-area graphene sheets. The removal of the sacrificial polymer was found to be one to two orders of magnitude faster than PMMA methods. Ultimately this facile transfer technique offers new opportunities for a wide range of applications for large-area graphene through the utilization of a new sacrificial polymer.« less

Modeling cometary photopolarimetric characteristics with Sh-matrix method

NASA Astrophysics Data System (ADS)

Kolokolova, L.; Petrov, D.

2017-12-01

Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

Comparison of Five System Identification Algorithms for Rotorcraft Higher Harmonic Control

NASA Technical Reports Server (NTRS)

Jacklin, Stephen A.

1998-01-01

This report presents an analysis and performance comparison of five system identification algorithms. The methods are presented in the context of identifying a frequency-domain transfer matrix for the higher harmonic control (HHC) of helicopter vibration. The five system identification algorithms include three previously proposed methods: (1) the weighted-least- squares-error approach (in moving-block format), (2) the Kalman filter method, and (3) the least-mean-squares (LMS) filter method. In addition there are two new ones: (4) a generalized Kalman filter method and (5) a generalized LMS filter method. The generalized Kalman filter method and the generalized LMS filter method were derived as extensions of the classic methods to permit identification by using more than one measurement per identification cycle. Simulation results are presented for conditions ranging from the ideal case of a stationary transfer matrix and no measurement noise to the more complex cases involving both measurement noise and transfer-matrix variation. Both open-loop identification and closed- loop identification were simulated. Closed-loop mode identification was more challenging than open-loop identification because of the decreasing signal-to-noise ratio as the vibration became reduced. The closed-loop simulation considered both local-model identification, with measured vibration feedback and global-model identification with feedback of the identified uncontrolled vibration. The algorithms were evaluated in terms of their accuracy, stability, convergence properties, computation speeds, and relative ease of implementation.

Spontaneous transfer of stearic acids between human serum albumin and PEG:2000-grafted DPPC membranes.

PubMed

Pantusa, Manuela; Stirpe, Andrea; Sportelli, Luigi; Bartucci, Rosa

2010-05-01

Electron spin resonance (ESR) spectroscopy is used to study the transfer of stearic acids between human serum albumin (HSA) and sterically stabilized liposomes (SSL) composed of dipalmitoylphosphatidylcholine (DPPC) and of submicellar content of poly(ethylene glycol:2000)-dipalmitoylphosphatidylethanolamine (PEG:2000-DPPE). Protein/lipid dispersions are considered in which spin-labelled stearic acids at the 16th carbon atom along the acyl chain (16-SASL) are inserted either in the protein or in the SSL. Two component ESR spectra with different rotational mobility are obtained over a broad range of temperature and membrane composition. Indeed, superimposed to an anisotropic protein-signal, appears a more isotropic lipid-signal. Since in the samples only one matrix (protein or membranes) is spin-labelled, the other component accounts for the transfer of 16-SASL between albumin and membranes. The two components have been resolved and quantified by spectral subtractions, and the fraction, f (p) (16-SASL), of spin labels bound non-covalently to the protein has been used to monitor the transfer. It is found that it depends on the type of donor and acceptor matrix, on the physical state of the membranes and on the grafting density of the polymer-lipids. Indeed, it is favoured from SSL to HSA and the fraction of stearic acids transferred increases with temperature in both directions of transfer. Moreover, in the presence of polymer-lipids, the transfer from HSA to SSL is slightly attenuated, especially in the brush regime of the polymer-chains. Instead, the transfer from SSL to HSA is favoured by the polymer-lipids much more in the mushroom than in the brush regime.

Murt user`s guide: A hybrid Lagrangian-Eulerian finite element model of multiple-pore-region solute transport through subsurface media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gwo, J.P.; Jardine, P.M.; Yeh, G.T.

Matrix diffusion, a diffusive mass transfer process,in the structured soils and geologic units at ORNL, is believe to be an important subsurface mass transfer mechanism; it may affect off-site movement of radioactive wastes and remediation of waste disposal sites by locally exchanging wastes between soil/rock matrix and macropores/fractures. Advective mass transfer also contributes to waste movement but is largely neglected by researchers. This report presents the first documented 2-D multiregion solute transport code (MURT) that incorporates not only diffusive but also advective mass transfer and can be applied to heterogeneous porous media under transient flow conditions. In this report, theoreticalmore » background is reviewed and the derivation of multiregion solute transport equations is presented. Similar to MURF (Gwo et al. 1994), a multiregion subsurface flow code, multiplepore domains as suggested by previous investigators (eg, Wilson and Luxmoore 1988) can be implemented in MURT. Transient or steady-state flow fields of the pore domains can be either calculated by MURF or by modelers. The mass transfer process is briefly discussed through a three-pore-region multiregion solute transport mechanism. Mass transfer equations that describe mass flux across pore region interfaces are also presented and parameters needed to calculate mass transfer coefficients detailed. Three applications of MURT (tracer injection problem, sensitivity analysis of advective and diffusive mass transfer, hillslope ponding infiltration and secondary source problem) were simulated and results discussed. Program structure of MURT and functions of MURT subroutiness are discussed so that users can adapt the code; guides for input data preparation are provided in appendices.« less

Low-Cost Resin Transfer Molding Process Developed for High-Temperature Polyimide Matrix Composites

NASA Technical Reports Server (NTRS)

1996-01-01

The use of high-temperature polymer matrix composites (PMC's) in aircraft engine applications can significantly reduce engine weight and improve performance and fuel efficiency. High-temperature PMC's, such as those based on the PMR-15 polyimide matrix resin developed by the NASA Lewis Research Center, have been used extensively in military applications where performance improvements have justified their use regardless of the cost involved in producing the component. However, in commercial engines cost is a primary driver, and PMC components must be produced at costs comparable to those of the metal components that they will replace.

MSC/NASTRAN DMAP Alter Used for Closed-Form Static Analysis With Inertia Relief and Displacement-Dependent Loads

NASA Technical Reports Server (NTRS)

1996-01-01

Solving for the displacements of free-free coupled systems acted upon by static loads is a common task in the aerospace industry. Often, these problems are solved by static analysis with inertia relief. This technique allows for a free-free static analysis by balancing the applied loads with the inertia loads generated by the applied loads. For some engineering applications, the displacements of the free-free coupled system induce additional static loads. Hence, the applied loads are equal to the original loads plus the displacement-dependent loads. A launch vehicle being acted upon by an aerodynamic loading can have such applied loads. The final displacements of such systems are commonly determined with iterative solution techniques. Unfortunately, these techniques can be time consuming and labor intensive. Because the coupled system equations for free-free systems with displacement-dependent loads can be written in closed form, it is advantageous to solve for the displacements in this manner. Implementing closed-form equations in static analysis with inertia relief is analogous to implementing transfer functions in dynamic analysis. An MSC/NASTRAN (MacNeal-Schwendler Corporation/NASA Structural Analysis) DMAP (Direct Matrix Abstraction Program) Alter was used to include displacement-dependent loads in static analysis with inertia relief. It efficiently solved a common aerospace problem that typically has been solved with an iterative technique.

Confocal ultrafast pump-probe spectroscopy: a new technique to explore nanoscale composites.

PubMed

Virgili, Tersilla; Grancini, Giulia; Molotokaite, Egle; Suarez-Lopez, Inma; Rajendran, Sai Kiran; Liscio, Andrea; Palermo, Vincenzo; Lanzani, Guglielmo; Polli, Dario; Cerullo, Giulio

2012-04-07

This article is devoted to the exploration of the benefits of a new ultrafast confocal pump-probe technique, able to study the photophysics of different structured materials with nanoscale resolution. This tool offers many advantages over standard stationary microscopy techniques because it directly interrogates excited state dynamics in molecules, providing access to both radiative and non-radiative deactivation processes at a local scale. In this paper we present a few different examples of its application to organic semiconductor systems. The first two are focussed on the study of the photophysics of phase-separated polymer blends: (i) a blue-emitting polyfluorene (PFO) in an inert matrix of PMMA and (ii) an electron donor polythiophene (P3HT) mixed with an electron acceptor fullerene derivative (PCBM). The experimental results on these samples demonstrate the capability of the technique to unveil peculiar interfacial dynamics at the border region between phase-segregated domains, which would be otherwise averaged out using conventional pump-probe spectroscopy. The third example is the study of the photophysics of isolated mesoscopic crystals of the PCBM molecule. Our ultrafast microscope could evidence the presence of two distinctive regions within the crystals. In particular, we could pinpoint for the first time areas within the crystals showing photobleaching/stimulated emission signals from a charge-transfer state. This journal is © The Royal Society of Chemistry 2012

Nacre-mimetic bulk lamellar composites reinforced with high aspect ratio glass flakes.

PubMed

Guner, Selen N Gurbuz; Dericioglu, Arcan F

2016-12-05

Nacre-mimetic epoxy matrix composites reinforced with readily available micron-sized high aspect ratio C-glass flakes were fabricated by a relatively simple, single-step, scalable, time, cost and man-power effective processing strategy: hot-press assisted slip casting (HASC). HASC enables the fabrication of preferentially oriented two-dimensional inorganic reinforcement-polymer matrix bulk lamellar composites with a micro-scale structure resembling the brick-and-mortar architecture of nacre. By applying the micro-scale design guideline found in nacre and optimizing the relative volume fractions of the reinforcement and the matrix as well as by anchoring the brick-and-mortar architecture, and tailoring the interface between reinforcements and the matrix via silane coupling agents, strong, stiff and tough bio-inspired nacre-mimetic bulk composites were fabricated. As a result of high shear stress transfer lengths and effective stress transfer at the interface achieved through surface functionalization of the reinforcements, fabricated bulk composites exhibited enhanced mechanical performance as compared to neat epoxy. Furthermore, governed flake pull-out mode along with a highly torturous crack path, which resulted from extensive deflection and meandering of the advancing crack around well-aligned high aspect ratio C-glass flakes, have led to high work-of-fracture values similar to nacre.

Leveraging Experiential Learning Techniques for Transfer

ERIC Educational Resources Information Center

Furman, Nate; Sibthorp, Jim

2013-01-01

Experiential learning techniques can be helpful in fostering learning transfer. Techniques such as project-based learning, reflective learning, and cooperative learning provide authentic platforms for developing rich learning experiences. In contrast to more didactic forms of instruction, experiential learning techniques foster a depth of learning…

3D ToF-SIMS Analysis of Peptide Incorporation into MALDI Matrix Crystals with Sub-micrometer Resolution.

PubMed

Körsgen, Martin; Pelster, Andreas; Dreisewerd, Klaus; Arlinghaus, Heinrich F

2016-02-01

The analytical sensitivity in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is largely affected by the specific analyte-matrix interaction, in particular by the possible incorporation of the analytes into crystalline MALDI matrices. Here we used time-of-flight secondary ion mass spectrometry (ToF-SIMS) to visualize the incorporation of three peptides with different hydrophobicities, bradykinin, Substance P, and vasopressin, into two classic MALDI matrices, 2,5-dihydroxybenzoic acid (DHB) and α-cyano-4-hydroxycinnamic acid (HCCA). For depth profiling, an Ar cluster ion beam was used to gradually sputter through the matrix crystals without causing significant degradation of matrix or biomolecules. A pulsed Bi3 ion cluster beam was used to image the lateral analyte distribution in the center of the sputter crater. Using this dual beam technique, the 3D distribution of the analytes and spatial segregation effects within the matrix crystals were imaged with sub-μm resolution. The technique could in the future enable matrix-enhanced (ME)-ToF-SIMS imaging of peptides in tissue slices at ultra-high resolution. Graphical Abstract ᅟ.

Fatigue testing and damage development in continuous fiber reinforced metal matrix composites

NASA Technical Reports Server (NTRS)

Johnson, W. S.

1988-01-01

A general overview of the fatigue behavior of metal matrix composites (MMC) is presented. The first objective is to present experimental procedures and techniques for conducting a meaningful fatigue test to detect and quantify fatigue damage in MMC. These techniques include interpretation of stress-strain responses, acid etching of the matrix, edge replicas of the specimen under load, radiography, and micrographs of the failure surfaces. In addition, the paper will show how stiffness loss in continuous fiber reinforced metal matrix composites can be a useful parameter for detecting fatigue damage initiation and accumulation. Second, numerous examples of how fatigue damage can initiate and grow in various MMC are given. Depending on the relative fatigue behavior of the fiber and matrix, and the interface properties, the failure modes of MMC can be grouped into four categories: (1) matrix dominated, (2) fiber dominated, (3) self-similar damage growth, and (4) fiber/matrix interfacial failures. These four types of damage will be discussed and illustrated by examples with the emphasis on the fatigue of unnotched laminates.

Fatigue testing and damage development in continuous fiber reinforced metal matrix composites

NASA Technical Reports Server (NTRS)

Johnson, W. S.

1989-01-01

A general overview of the fatigue behavior of metal matrix composites (MMC) is presented. The first objective is to present experimental procedures and techniques for conducting a meaningful fatigue test to detect and quantify fatigue damage in MMC. These techniques include interpretation of stress-strain responses, acid etching of the matrix, edge replicas of the specimen under load, radiography, and micrographs of the failure surfaces. In addition, the paper will show how stiffness loss in continuous fiber reinforced metal matrix composites can be a useful parameter for detecting fatigue damage initiation and accumulation. Second, numerous examples of how fatigue damage can initiate and grow in various MMC are given. Depending on the relative fatigue behavior of the fiber and matrix, and the interface properties, the failure modes of MMC can be grouped into four categories: (1) matrix dominated, (2) fiber dominated, (3) self-similar damage growth, and (4) fiber/matrix interfacial failures. These four types of damage will be discussed and illustrated by examples with the emphasis on the fatigue of unnotched laminates.

3D ToF-SIMS Analysis of Peptide Incorporation into MALDI Matrix Crystals with Sub-micrometer Resolution

NASA Astrophysics Data System (ADS)

Körsgen, Martin; Pelster, Andreas; Dreisewerd, Klaus; Arlinghaus, Heinrich F.

2016-02-01

The analytical sensitivity in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is largely affected by the specific analyte-matrix interaction, in particular by the possible incorporation of the analytes into crystalline MALDI matrices. Here we used time-of-flight secondary ion mass spectrometry (ToF-SIMS) to visualize the incorporation of three peptides with different hydrophobicities, bradykinin, Substance P, and vasopressin, into two classic MALDI matrices, 2,5-dihydroxybenzoic acid (DHB) and α-cyano-4-hydroxycinnamic acid (HCCA). For depth profiling, an Ar cluster ion beam was used to gradually sputter through the matrix crystals without causing significant degradation of matrix or biomolecules. A pulsed Bi3 ion cluster beam was used to image the lateral analyte distribution in the center of the sputter crater. Using this dual beam technique, the 3D distribution of the analytes and spatial segregation effects within the matrix crystals were imaged with sub-μm resolution. The technique could in the future enable matrix-enhanced (ME)-ToF-SIMS imaging of peptides in tissue slices at ultra-high resolution.

Ceramic matrix and resin matrix composites: A comparison

NASA Technical Reports Server (NTRS)

Hurwitz, Frances I.

1987-01-01

The underlying theory of continuous fiber reinforcement of ceramic matrix and resin matrix composites, their fabrication, microstructure, physical and mechanical properties are contrasted. The growing use of organometallic polymers as precursors to ceramic matrices is discussed as a means of providing low temperature processing capability without the fiber degradation encountered with more conventional ceramic processing techniques. Examples of ceramic matrix composites derived from particulate-filled, high char yield polymers and silsesquioxane precursors are provided.

Ceramic matrix and resin matrix composites - A comparison

NASA Technical Reports Server (NTRS)

Hurwitz, Frances I.

1987-01-01

The underlying theory of continuous fiber reinforcement of ceramic matrix and resin matrix composites, their fabrication, microstructure, physical and mechanical properties are contrasted. The growing use of organometallic polymers as precursors to ceramic matrices is discussed as a means of providing low temperature processing capability without the fiber degradation encountered with more conventional ceramic processing techniques. Examples of ceramic matrix composites derived from particulate-filled, high char yield polymers and silsesquioxane precursors are provided.

Energy transfer and reaction dynamics of matrix-isolated 1,2-difluoroethane-d4

NASA Astrophysics Data System (ADS)

Raff, Lionel M.

1990-09-01

The molecular dynamics of vibrationally excited 1,2-difluoroethane-d4 isolated in Ar, Kr, and Xe matrices at 12 K are investigated using trajectory methods. The matrix model is an fcc crystal containing 125 unit cells with 666 atoms in a cubic (5×5×5) arrangement. It is assumed that 1,2-difluoroethane-d4 is held interstitially within the volume bounded by the innermost unit cell of the crystal. The transport effects of the bulk are simulated using the velocity reset method introduced by Riley, Coltrin, and Diestler [J. Chem. Phys. 88, 5934 (1988)]. The system potential is written as the separable sum of a lattice potential, a lattice-molecule interaction and a gas-phase potential for 1,2-difluoroethane. The first two of these are assumed to have pairwise form while the molecular potential is a modified form of the global potential previously developed for 1,2-difluoroethane [J. Phys. Chem. 91, 3266 (1987)]. Calculated sublimation energies for the pure crystals are in good accord with the experimental data. The distribution of metastable-state energies for matrix-isolated 1,2-difluoroethane-d4 is Gaussian in form. In krypton, the full width at half maximum for the distribution is 0.37 eV. For a total excitation energy of 6.314 eV, the observed dynamic processes are vibrational relaxation, orientational exchange, and four-center DF elimination reactions. The first of these processes is characterized by a near linear, first-order decay curve with rate coefficients in the range 1.30-1.48×1011 s-1. The average rates in krypton and xenon are nearly equal. The process is slightly slower in argon. The decay curves exhibit characteristic high-frequency oscillations that are generally seen in energy transfer studies. It is demonstrated that these oscillations are associated with the frequencies for intramolecular energy transfer so that the entire frequency spectrum for such transfer processes can be obtained from the Fourier transform of the decay curve. Orientational exchange is shown to occur with much greater frequency as the unit cell spacing decreases. The occurrence of orientational exchange generally results in a very rapid dissipation of molecular rotational energy to the lattice which causes a characteristic break to occur in the decay curve. It is shown that 16% of the total energy transfer to the lattice in argon is a result of such rotational energy transfer. The propensity for four-center DF elimination is found to be greater in argon than in either krypton or xenon. The relaxation data show that this effect is not the result of different energy transfer rates but is probably associated with steric effects resulting from the smaller lattice dimensions in argon. Isotope effects upon the energy partitioning in unimolecular reactions of 1,2-difluoroethane and upon the energy transfer dynamics under matrix-isolation conditions are also reported.

Formation of Metal-Related Ions in Matrix-Assisted Laser Desorption Ionization.

PubMed

Lee, Chuping; Lu, I-Chung; Hsu, Hsu Chen; Lin, Hou-Yu; Liang, Sheng-Ping; Lee, Yuan-Tseh; Ni, Chi-Kung

2016-09-01

In a study of the metal-related ion generation mechanism in matrix-assisted laser desorption ionization (MALDI), crystals of matrix used in MALDI were grown from matrix- and salt-containing solutions. The intensities of metal ion and metal adducts of the matrix ion obtained from unwashed crystals were higher than those from crystals washed with deionized water, indicating that metal ions and metal adducts of the matrix ions are mainly generated from the surface of crystals. The contributions of preformed metal ions and metal adducts of the matrix ions inside the matrix crystals were minor. Metal adducts of the matrix and analyte ion intensities generated from a mixture of dried matrix, salt, and analyte powders were similar to or higher than those generated from the powder of dried droplet crystals, indicating that the contributions of the preformed metal adducts of the matrix and analyte ions were insignificant. Correlation between metal-related ion intensity fluctuation and protonated ion intensity fluctuation was observed, indicating that the generation mechanism of the metal-related ions is similar to that of the protonated ions. Because the thermally induced proton transfer model effectively describes the generation of the protonated ions, we suggest that metal-related ions are mainly generated from the salt dissolution in the matrix melted by the laser. Graphical Abstract ᅟ.

The role of rapid solidification processing in the fabrication of fiber reinforced metal matrix composites

NASA Technical Reports Server (NTRS)

Locci, Ivan E.; Noebe, Ronald D.

1989-01-01

Advanced composite processing techniques for fiber reinforced metal matrix composites require the flexibility to meet several widespread objectives. The development of uniquely desired matrix microstructures and uniformly arrayed fiber spacing with sufficient bonding between fiber and matrix to transmit load between them without degradation to the fiber or matrix are the minimum requirements necessary of any fabrication process. For most applications these criteria can be met by fabricating composite monotapes which are then consolidated into composite panels or more complicated components such as fiber reinforced turbine blades. Regardless of the end component, composite monotapes are the building blocks from which near net shape composite structures can be formed. The most common methods for forming composite monotapes are the powder cloth, foil/fiber, plasma spray, and arc spray processes. These practices, however, employ rapid solidification techniques in processing of the composite matrix phase. Consequently, rapid solidification processes play a vital and yet generally overlooked role in composite fabrication. The future potential of rapid solidification processing is discussed.

High temperature deformation mechanism in hierarchical and single precipitate strengthened ferritic alloys by in situ neutron diffraction studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Gian; Sun, Zhiqian; Li, Lin

Here, the ferritic Fe-Cr-Ni-Al-Ti alloys strengthened by hierarchical-Ni 2TiAl/NiAl or single-Ni 2TiAl precipitates have been developed and received great attentions due to their superior creep resistance, as compared to conventional ferritic steels. Although the significant improvement of the creep resistance is achieved in the hierarchical-precipitate-strengthened ferritic alloy, the in-depth understanding of its high-temperature deformation mechanisms is essential to further optimize the microstructure and mechanical properties, and advance the development of the creep resistant materials. In the present study, in-situ neutron diffraction has been used to investigate the evolution of elastic strain of constitutive phases and their interactions, such as load-transfer/load-relaxationmore » behavior between the precipitate and matrix, during tensile deformation and stress relaxation at 973 K, which provide the key features in understanding the governing deformation mechanisms. Crystal-plasticity finite-element simulations were employed to qualitatively compare the experimental evolution of the elastic strain during tensile deformation at 973 K. It was found that the coherent elastic strain field in the matrix, created by the lattice misfit between the matrix and precipitate phases for the hierarchical-precipitate-strengthened ferritic alloy, is effective in reducing the diffusional relaxation along the interface between the precipitate and matrix phases, which leads to the strong load-transfer capability from the matrix to precipitate.« less

Finite element analysis of stress transfer mechanism from matrix to the fiber in SWCN reinforced nanocomposites

NASA Astrophysics Data System (ADS)

Günay, E.

2017-02-01

This study defined as micromechanical finite element (FE) approach examining the stress transfer mechanism in single-walled carbon nanotube (SWCN) reinforced composites. In the modeling, 3D unit-cell method was evaluated. Carbon nanotube reinforced composites were modeled as three layers which comprises CNT, interface and matrix material. Firstly; matrix, fiber and interfacial materials all together considered as three layered cylindrical nanocomposite. Secondly, the cylindrical matrix material was assumed to be isotropic and also considered as a continuous medium. Then, fiber material was represented with zigzag type SWCNs. Finally, SWCN was combined with the elastic medium by using springs with different constants. In the FE modeling of SWCN reinforced composite model springs were modeled by using ANSYS spring damper element COMBIN14. The developed interfacial van der Waals interaction effects between the continuous matrix layer and the carbon nanotube fiber layer were simulated by applying these various spring stiffness values. In this study, the layered composite cylindrical FE model was presented as the equivalent mechanical properties of SWCN structures in terms of Young's modulus. The obtained results and literature values were presented and discussed. Figures, 16, 17, and 18 of the original article PDF file, as supplied to AIP Publishing, were affected by a PDF-processing error. Consequently, a solid diamond symbol appeared instead of a Greek tau on the y axis labels for these three figures. This article was updated on 17 March 2017 to correct the PDF-processing error, with the scientific content remaining unchanged.

High Temperature Deformation Mechanism in Hierarchical and Single Precipitate Strengthened Ferritic Alloys by In Situ Neutron Diffraction Studies

PubMed Central

Song, Gian; Sun, Zhiqian; Li, Lin; Clausen, Bjørn; Zhang, Shu Yan; Gao, Yanfei; Liaw, Peter K.

2017-01-01

The ferritic Fe-Cr-Ni-Al-Ti alloys strengthened by hierarchical-Ni2TiAl/NiAl or single-Ni2TiAl precipitates have been developed and received great attentions due to their superior creep resistance, as compared to conventional ferritic steels. Although the significant improvement of the creep resistance is achieved in the hierarchical-precipitate-strengthened ferritic alloy, the in-depth understanding of its high-temperature deformation mechanisms is essential to further optimize the microstructure and mechanical properties, and advance the development of the creep resistant materials. In the present study, in-situ neutron diffraction has been used to investigate the evolution of elastic strain of constitutive phases and their interactions, such as load-transfer/load-relaxation behavior between the precipitate and matrix, during tensile deformation and stress relaxation at 973 K, which provide the key features in understanding the governing deformation mechanisms. Crystal-plasticity finite-element simulations were employed to qualitatively compare the experimental evolution of the elastic strain during tensile deformation at 973 K. It was found that the coherent elastic strain field in the matrix, created by the lattice misfit between the matrix and precipitate phases for the hierarchical-precipitate-strengthened ferritic alloy, is effective in reducing the diffusional relaxation along the interface between the precipitate and matrix phases, which leads to the strong load-transfer capability from the matrix to precipitate. PMID:28387230

High temperature deformation mechanism in hierarchical and single precipitate strengthened ferritic alloys by in situ neutron diffraction studies

DOE PAGES

Song, Gian; Sun, Zhiqian; Li, Lin; ...

2017-04-07

Here, the ferritic Fe-Cr-Ni-Al-Ti alloys strengthened by hierarchical-Ni 2TiAl/NiAl or single-Ni 2TiAl precipitates have been developed and received great attentions due to their superior creep resistance, as compared to conventional ferritic steels. Although the significant improvement of the creep resistance is achieved in the hierarchical-precipitate-strengthened ferritic alloy, the in-depth understanding of its high-temperature deformation mechanisms is essential to further optimize the microstructure and mechanical properties, and advance the development of the creep resistant materials. In the present study, in-situ neutron diffraction has been used to investigate the evolution of elastic strain of constitutive phases and their interactions, such as load-transfer/load-relaxationmore » behavior between the precipitate and matrix, during tensile deformation and stress relaxation at 973 K, which provide the key features in understanding the governing deformation mechanisms. Crystal-plasticity finite-element simulations were employed to qualitatively compare the experimental evolution of the elastic strain during tensile deformation at 973 K. It was found that the coherent elastic strain field in the matrix, created by the lattice misfit between the matrix and precipitate phases for the hierarchical-precipitate-strengthened ferritic alloy, is effective in reducing the diffusional relaxation along the interface between the precipitate and matrix phases, which leads to the strong load-transfer capability from the matrix to precipitate.« less

Stochastic noise characteristics in matrix inversion tomosynthesis (MITS).

PubMed

Godfrey, Devon J; McAdams, H P; Dobbins, James T Third

2009-05-01

Matrix inversion tomosynthesis (MITS) uses known imaging geometry and linear systems theory to deterministically separate in-plane detail from residual tomographic blur in a set of conventional tomosynthesis ("shift-and-add") planes. A previous investigation explored the effect of scan angle (ANG), number of projections (N), and number of reconstructed planes (NP) on the MITS impulse response and modulation transfer function characteristics, and concluded that ANG = 20 degrees, N = 71, and NP = 69 is the optimal MITS imaging technique for chest imaging on our prototype tomosynthesis system. This article examines the effect of ANG, N, and NP on the MITS exposure-normalized noise power spectra (ENNPS) and seeks to confirm that the imaging parameters selected previously by an analysis of the MITS impulse response also yield reasonable stochastic properties in MITS reconstructed planes. ENNPS curves were generated for experimentally acquired mean-subtracted projection images, conventional tomosynthesis planes, and MITS planes with varying combinations of the parameters ANG, N, and NP. Image data were collected using a prototype tomosynthesis system, with 11.4 cm acrylic placed near the image receptor to produce lung-equivalent beam hardening and scattered radiation. Ten identically acquired tomosynthesis data sets (realizations) were collected for each selected technique and used to generate ensemble mean images that were subtracted from individual image realizations prior to noise power spectra (NPS) estimation. NPS curves were normalized to account for differences in entrance exposure (as measured with an ion chamber), yielding estimates of the ENNPS for each technique. Results suggest that mid- and high-frequency noise in MITS planes is fairly equivalent in magnitude to noise in conventional tomosynthesis planes, but low-frequency noise is amplified in the most anterior and posterior reconstruction planes. Selecting the largest available number of projections (N = 71) does not incur any appreciable additive electronic noise penalty compared to using fewer projections for roughly equivalent cumulative exposure. Stochastic noise is minimized by maximizing N and NP but increases with increasing ANG. The noise trend results for NP and ANG are contrary to what would be predicted by simply considering the MITS matrix conditioning and likely result from the interplay between noise correlation and the polarity of the MITS filters. From this study, the authors conclude that the previously determined optimal MITS imaging strategy based on impulse response considerations produces somewhat suboptimal stochastic noise characteristics, but is probably still the best technique for MITS imaging of the chest.

Density-matrix-based algorithm for solving eigenvalue problems

NASA Astrophysics Data System (ADS)

Polizzi, Eric

2009-03-01

A fast and stable numerical algorithm for solving the symmetric eigenvalue problem is presented. The technique deviates fundamentally from the traditional Krylov subspace iteration based techniques (Arnoldi and Lanczos algorithms) or other Davidson-Jacobi techniques and takes its inspiration from the contour integration and density-matrix representation in quantum mechanics. It will be shown that this algorithm—named FEAST—exhibits high efficiency, robustness, accuracy, and scalability on parallel architectures. Examples from electronic structure calculations of carbon nanotubes are presented, and numerical performances and capabilities are discussed.

Iterative approach as alternative to S-matrix in modal methods

NASA Astrophysics Data System (ADS)

Semenikhin, Igor; Zanuccoli, Mauro

2014-12-01

The continuously increasing complexity of opto-electronic devices and the rising demands of simulation accuracy lead to the need of solving very large systems of linear equations making iterative methods promising and attractive from the computational point of view with respect to direct methods. In particular, iterative approach potentially enables the reduction of required computational time to solve Maxwell's equations by Eigenmode Expansion algorithms. Regardless of the particular eigenmodes finding method used, the expansion coefficients are computed as a rule by scattering matrix (S-matrix) approach or similar techniques requiring order of M3 operations. In this work we consider alternatives to the S-matrix technique which are based on pure iterative or mixed direct-iterative approaches. The possibility to diminish the impact of M3 -order calculations to overall time and in some cases even to reduce the number of arithmetic operations to M2 by applying iterative techniques are discussed. Numerical results are illustrated to discuss validity and potentiality of the proposed approaches.

A numerical model for predicting crack path and modes of damage in unidirectional metal matrix composites

NASA Technical Reports Server (NTRS)

Bakuckas, J. G.; Tan, T. M.; Lau, A. C. W.; Awerbuch, J.

1993-01-01

A finite element-based numerical technique has been developed to simulate damage growth in unidirectional composites. This technique incorporates elastic-plastic analysis, micromechanics analysis, failure criteria, and a node splitting and node force relaxation algorithm to create crack surfaces. Any combination of fiber and matrix properties can be used. One of the salient features of this technique is that damage growth can be simulated without pre-specifying a crack path. In addition, multiple damage mechanisms in the forms of matrix cracking, fiber breakage, fiber-matrix debonding and plastic deformation are capable of occurring simultaneously. The prevailing failure mechanism and the damage (crack) growth direction are dictated by the instantaneous near-tip stress and strain fields. Once the failure mechanism and crack direction are determined, the crack is advanced via the node splitting and node force relaxation algorithm. Simulations of the damage growth process in center-slit boron/aluminum and silicon carbide/titanium unidirectional specimens were performed. The simulation results agreed quite well with the experimental observations.

NASA Glenn Research Center UEET (Ultra-Efficient Engine Technology) Program: Agenda and Abstracts

NASA Technical Reports Server (NTRS)

Manthey, Lri

2001-01-01

Topics discussed include: UEET Overview; Technology Benefits; Emissions Overview; P&W Low Emissions Combustor Development; GE Low Emissions Combustor Development; Rolls-Royce Low Emissions Combustor Development; Honeywell Low Emissions Combustor Development; NASA Multipoint LDI Development; Stanford Activities In Concepts for Advanced Gas Turbine Combustors; Large Eddy Simulation (LES) of Gas Turbine Combustion; NASA National Combustion Code Simulations; Materials Overview; Thermal Barrier Coatings for Airfoil Applications; Disk Alloy Development; Turbine Blade Alloy; Ceramic Matrix Composite (CMC) Materials Development; Ceramic Matrix Composite (CMC) Materials Characterization; Environmental Barrier Coatings (EBC) for Ceramic Matrix Composite (CMC) Materials; Ceramic Matrix Composite Vane Rig Testing and Design; Ultra-High Temperature Ceramic (UHTC) Development; Lightweight Structures; NPARC Alliance; Technology Transfer and Commercialization; and Turbomachinery Overview; etc.

A Two-Time Scale Decentralized Model Predictive Controller Based on Input and Output Model

PubMed Central

Niu, Jian; Zhao, Jun; Xu, Zuhua; Qian, Jixin

2009-01-01

A decentralized model predictive controller applicable for some systems which exhibit different dynamic characteristics in different channels was presented in this paper. These systems can be regarded as combinations of a fast model and a slow model, the response speeds of which are in two-time scale. Because most practical models used for control are obtained in the form of transfer function matrix by plant tests, a singular perturbation method was firstly used to separate the original transfer function matrix into two models in two-time scale. Then a decentralized model predictive controller was designed based on the two models derived from the original system. And the stability of the control method was proved. Simulations showed that the method was effective. PMID:19834542

Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

NASA Astrophysics Data System (ADS)

Li, Yonghui; Ullrich, Carsten

2013-03-01

The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

Lattice Methods and the Nuclear Few- and Many-Body Problem

NASA Astrophysics Data System (ADS)

Lee, Dean

This chapter builds upon the review of lattice methods and effective field theory of the previous chapter. We begin with a brief overview of lattice calculations using chiral effective field theory and some recent applications. We then describe several methods for computing scattering on the lattice. After that we focus on the main goal, explaining the theory and algorithms relevant to lattice simulations of nuclear few- and many-body systems. We discuss the exact equivalence of four different lattice formalisms, the Grassmann path integral, transfer matrix operator, Grassmann path integral with auxiliary fields, and transfer matrix operator with auxiliary fields. Along with our analysis we include several coding examples and a number of exercises for the calculations of few- and many-body systems at leading order in chiral effective field theory.

Performance analysis of cross-seeding WDM-PON system using transfer matrix method

NASA Astrophysics Data System (ADS)

Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

2016-12-01

In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

Engineering high charge transfer n-doping of graphene electrodes and its application to organic electronics.

PubMed

Sanders, Simon; Cabrero-Vilatela, Andrea; Kidambi, Piran R; Alexander-Webber, Jack A; Weijtens, Christ; Braeuninger-Weimer, Philipp; Aria, Adrianus I; Qasim, Malik M; Wilkinson, Timothy D; Robertson, John; Hofmann, Stephan; Meyer, Jens

2015-08-14

Using thermally evaporated cesium carbonate (Cs2CO3) in an organic matrix, we present a novel strategy for efficient n-doping of monolayer graphene and a ∼90% reduction in its sheet resistance to ∼250 Ohm sq(-1). Photoemission spectroscopy confirms the presence of a large interface dipole of ∼0.9 eV between graphene and the Cs2CO3/organic matrix. This leads to a strong charge transfer based doping of graphene with a Fermi level shift of ∼1.0 eV. Using this approach we demonstrate efficient, standard industrial manufacturing process compatible graphene-based inverted organic light emitting diodes on glass and flexible substrates with efficiencies comparable to those of state-of-the-art ITO based devices.

A reduced-order integral formulation to account for the finite size effect of isotropic square panels using the transfer matrix method.

PubMed

Bonfiglio, Paolo; Pompoli, Francesco; Lionti, Riccardo

2016-04-01

The transfer matrix method is a well-established prediction tool for the simulation of sound transmission loss and the sound absorption coefficient of flat multilayer systems. Much research has been dedicated to enhancing the accuracy of the method by introducing a finite size effect of the structure to be simulated. The aim of this paper is to present a reduced-order integral formulation to predict radiation efficiency and radiation impedance for a panel with equal lateral dimensions. The results are presented and discussed for different materials in terms of radiation efficiency, sound transmission loss, and the sound absorption coefficient. Finally, the application of the proposed methodology for rectangular multilayer systems is also investigated and validated against experimental data.

Algebraic Bethe ansatz for the XXZ Heisenberg spin chain with triangular boundaries and the corresponding Gaudin model

NASA Astrophysics Data System (ADS)

Manojlović, N.; Salom, I.

2017-10-01

The implementation of the algebraic Bethe ansatz for the XXZ Heisenberg spin chain in the case, when both reflection matrices have the upper-triangular form is analyzed. The general form of the Bethe vectors is studied. In the particular form, Bethe vectors admit the recurrent procedure, with an appropriate modification, used previously in the case of the XXX Heisenberg chain. As expected, these Bethe vectors yield the strikingly simple expression for the off-shell action of the transfer matrix of the chain as well as the spectrum of the transfer matrix and the corresponding Bethe equations. As in the XXX case, the so-called quasi-classical limit gives the off-shell action of the generating function of the corresponding trigonometric Gaudin Hamiltonians with boundary terms.

Quantum propagation and confinement in 1D systems using the transfer-matrix method

NASA Astrophysics Data System (ADS)

Pujol, Olivier; Carles, Robert; Pérez, José-Philippe

2014-05-01

The aim of this article is to provide some Matlab scripts to the teaching community in quantum physics. The scripts are based on the transfer-matrix formalism and offer a very efficient and versatile tool to solve problems of a physical object (electron, proton, neutron, etc) with one-dimensional (1D) stationary potential energy. Resonant tunnelling through a multiple-barrier or confinement in wells of various shapes is particularly analysed. The results are quantitatively discussed with semiconductor heterostructures, harmonic and anharmonic molecular vibrations, or neutrons in a gravity field. Scripts and other examples (hydrogen-like ions and transmission by a smooth variation of potential energy) are available freely at http://www-loa.univ-lille1.fr/˜pujol in three languages: English, French and Spanish.

GRAY: a program to calculate gray-body radiation heat-transfer view factors from black-body view factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, R. L.

1976-06-14

Program GRAY is written to perform the matrix manipulations necessary to convert black-body radiation heat-transfer view factors to gray-body view factors as required by thermal analyzer codes. The black-body view factors contain only geometric relationships. Program GRAY allows the effects of multiple gray-body reflections to be included. The resulting effective gray-body factors can then be used with the corresponding fourth-power temperature differences to obtain the net radiative heat flux. The program is written to accept a matrix input or the card image output generated by the black-body view factor program CNVUFAC. The resulting card image output generated by GRAY ismore » in a form usable by the TRUMP thermal analyzer.« less

Range and stability of structural colors generated by Morpho-inspired color reflectors.

PubMed

Chung, Kyungjae; Shin, Jung H

2013-05-01

The range and stability of structural colors generated by Morpho-inspired color reflectors are investigated. We find that despite the internal randomness of such structures that gives rise to their Morpho-like angle-independent iridescence, their colors under ambient lighting condition can be predicted by simple transfer-matrix calculations of corresponding planar multilayer structures. By calculating the possible range of colors generated by multilayers of different structures and material combinations using such transfer-matrix methods, we find that low-refractive index multilayers with intrastructure absorption, such as the melanin-containing chitin/air multilayer structure from the Morpho butterflies, can provide not only the most pure structural colors with the largest color gamut, but also the highest stability of color against variations in multilayer structure.

A modified tensionless gingival grafting technique using acellular dermal matrix.

PubMed

Taylor, John B; Gerlach, Robert C; Herold, Robert W; Bisch, Frederick C; Dixon, Douglas R

2010-10-01

Conventional surgical procedures designed for autogenous tissue material may not be appropriate when using acellular dermal matrix (ADM) for the treatment of gingival recessions. This article describes a new surgical technique that addresses the unique and sensitive aspects of ADM specifically to improve esthetic outcomes and gain increased clinical predictability when treating Miller Class I and II gingival recession defects. In this paper, a root coverage case is described and the specific steps and rationale for this new technique are explained. This technique has been predictable clinically, with results comparable to those achieved using autogenous tissue.

Analysis of structural response data using discrete modal filters. M.S. Thesis

NASA Technical Reports Server (NTRS)

Freudinger, Lawrence C.

1991-01-01

The application of reciprocal modal vectors to the analysis of structural response data is described. Reciprocal modal vectors are constructed using an existing experimental modal model and an existing frequency response matrix of a structure, and can be assembled into a matrix that effectively transforms the data from the physical space to a modal space within a particular frequency range. In other words, the weighting matrix necessary for modal vector orthogonality (typically the mass matrix) is contained within the reciprocal model matrix. The underlying goal of this work is mostly directed toward observing the modal state responses in the presence of unknown, possibly closed loop forcing functions, thus having an impact on both operating data analysis techniques and independent modal space control techniques. This study investigates the behavior of reciprocol modal vectors as modal filters with respect to certain calculation parameters and their performance with perturbed system frequency response data.

Robust Stability Analysis of the Space Launch System Control Design: A Singular Value Approach

NASA Technical Reports Server (NTRS)

Pei, Jing; Newsome, Jerry R.

2015-01-01

Classical stability analysis consists of breaking the feedback loops one at a time and determining separately how much gain or phase variations would destabilize the stable nominal feedback system. For typical launch vehicle control design, classical control techniques are generally employed. In addition to stability margins, frequency domain Monte Carlo methods are used to evaluate the robustness of the design. However, such techniques were developed for Single-Input-Single-Output (SISO) systems and do not take into consideration the off-diagonal terms in the transfer function matrix of Multi-Input-Multi-Output (MIMO) systems. Robust stability analysis techniques such as H(sub infinity) and mu are applicable to MIMO systems but have not been adopted as standard practices within the launch vehicle controls community. This paper took advantage of a simple singular-value-based MIMO stability margin evaluation method based on work done by Mukhopadhyay and Newsom and applied it to the SLS high-fidelity dynamics model. The method computes a simultaneous multi-loop gain and phase margin that could be related back to classical margins. The results presented in this paper suggest that for the SLS system, traditional SISO stability margins are similar to the MIMO margins. This additional level of verification provides confidence in the robustness of the control design.