2010-05-11
convective heat transfer , researchers have been drawn to the high heat flux potentials of microfluidic devices. Microchannel flows, with hydraulic...novel heat transfer enhancement technique proven on the conventional scale to the mini and microchannel scales. 1.3 Background: Conventional...S.G., 2004, “Single-Phase Heat Transfer Enhancement Techniques in Microchannel and Minichannel Flows,” International Conference on Microchannels
Reflective Coating on Fibrous Insulation for Reduced Heat Transfer
NASA Technical Reports Server (NTRS)
Hass, Derek D.; Prasad, B. Durga; Glass, David E.; Wiedemann, Karl E.
1997-01-01
Radiative heat transfer through fibrous insulation used in thermal protection systems (TPS) is significant at high temperatures (1200 C). Decreasing the radiative heat transfer through the fibrous insulation can thus have a major impact on the insulating ability of the TPS. Reflective coatings applied directly to the individual fibers in fibrous insulation should decrease the radiative heat transfer leading to an insulation with decreased effective thermal conductivity. Coatings with high infrared reflectance have been developed using sol-gel techniques. Using this technique, uniform coatings can be applied to fibrous insulation without an appreciable increase in insulation weight or density. Scanning electron microscopy, Fourier Transform infrared spectroscopy, and ellipsometry have been performed to evaluate coating performance.
Low Energy Transfer to the Moon
NASA Astrophysics Data System (ADS)
Koon, W. S.; Lo, M. W.; Marsden, J. E.; Ross, S. D.
In 1991, the Japanese Hiten mission used a low energy transfer with a ballistic capture at the Moon which required less Δ V than a standard Hohmann transfer. In this paper, we apply the dynamical systems techniques developed in our earlier work to reproduce systematically a Hiten-like mission. We approximate the Sun-Earth-Moon-spacecraft 4-body system as two 3-body systems. Using the invariant manifold structures of the Lagrange points of the 3-body systems, we are able to construct low energy transfer trajectories from the Earth which execute ballistic capture at the Moon. The techniques used in the design and construction of this trajectory may be applied in many situations.
31 CFR 205.11 - What requirements apply to funding techniques?
Code of Federal Regulations, 2010 CFR
2010-07-01
... techniques? 205.11 Section 205.11 Money and Finance: Treasury Regulations Relating to Money and Finance... EFFICIENT FEDERAL-STATE FUNDS TRANSFERS Rules Applicable to Federal Assistance Programs Included in a Treasury-State Agreement § 205.11 What requirements apply to funding techniques? (a) A State and a Federal...
NASA Technical Reports Server (NTRS)
Porro, A. Robert; Keith, Theo G., Jr.; Hingst, Warren R.; Chriss, Randall M.; Seablom, Kirk D.
1991-01-01
A technique is developed to measure the local convective heat transfer coefficient on a model surface in a supersonic flow field. The technique uses a laser to apply a discrete local heat flux at the model test surface, and an infrared camera system determines the local temperature distribution due to heating. From this temperature distribution and an analysis of the heating process, a local convective heat transfer coefficient is determined. The technique was used to measure the load surface convective heat transfer coefficient distribution on a flat plate at nominal Mach numbers of 2.5, 3.0, 3.5, and 4.0. The flat plate boundary layer initially was laminar and became transitional in the measurement region. The experimental results agreed reasonably well with theoretical predictions of convective heat transfer of flat plate laminar boundary layers. The results indicate that this non-intrusive optical measurement technique has the potential to obtain high quality surface convective heat transfer measurements in high speed flowfields.
A laser-induced heat flux technique for convective heat transfer measurements in high speed flows
NASA Technical Reports Server (NTRS)
Porro, A. R.; Keith, T. G., Jr.; Hingst, W. R.
1991-01-01
A technique is developed to measure the local convective heat transfer coefficient on a model surface in a supersonic flow field. The technique uses a laser to apply a discrete local heat flux at the model test surface, and an infrared camera system determines the local temperature distribution due to the heating. From this temperature distribution and an analysis of the heating process, a local convective heat transfer coefficient is determined. The technique was used to measure the local surface convective heat transfer coefficient distribution on a flat plate at nominal Mach numbers of 2.5, 3.0, 3.5, and 4.0. The flat plate boundary layer initially was laminar and became transitional in the measurement region. The experimentally determined convective heat transfer coefficients were generally higher than the theoretical predictions for flat plate laminar boundary layers. However, the results indicate that this nonintrusive optical measurement technique has the potential to measure surface convective heat transfer coefficients in high speed flow fields.
A laser-induced heat flux technique for convective heat transfer measurements in high speed flows
NASA Technical Reports Server (NTRS)
Porro, A. R.; Keith, T. G., Jr.; Hingst, W. R.
1991-01-01
A technique is developed to measure the local convective heat transfer coefficient on a model surface in a supersonic flow field. The technique uses a laser to apply a discrete local heat flux at the model test surface, and an infrared camera system determines the local temperature distribution due to the heating. From this temperature distribution and an analysis of the heating process, a local convective heat transfer coefficient is determined. The technique was used to measure the local surface convective heat transfer coefficient distribution on a flat plate at nominal Mach numbers of 2.5, 3.0, 3.5, and 4.0. The flat plate boundary layer initially was laminar and became transitional in the measurement region. The experimentally determined convective heat transfer coefficients were generally higher than the theoretical predictions for flat plate laminar boundary layers. However, the results indicate that this nonintrusive optical measurement technique has the potential to measure surface convective heat transfer coefficients in high-speed flowfields.
ERIC Educational Resources Information Center
Weiss, J.; Egea-Cortines, M.
2008-01-01
We have been teaching applied molecular genetics to engineers and adapted the teaching methodology to the European Credit Transfer System. We teach core principles of genetics that are universal and form the conceptual basis of most molecular technologies. The course then teaches widely used techniques and finally shows how different techniques…
31 CFR 205.11 - What requirements apply to funding techniques?
Code of Federal Regulations, 2014 CFR
2014-07-01
... Program Agency must minimize the time elapsing between the transfer of funds from the United States Treasury and the State's payout of funds for Federal assistance program purposes, whether the transfer... EFFICIENT FEDERAL-STATE FUNDS TRANSFERS Rules Applicable to Federal Assistance Programs Included in a...
Reconstruction of mammalian oocytes by germinal vesicle transfer: A systematic review
Darbandi, Sara; Darbandi, Mahsa; Khorram Khorshid, Hamid Reza; Shirazi, Abolfazl; Sadeghi, Mohammad Reza; Agarwal, Ashok; Al-Hasani, Safaa; Naderi, Mohammad Mehdi; Ayaz, Ahmet; Akhondi, Mohammad Mehdi
2017-01-01
Nuclear transfer procedures have been recently applied for clinical and research targets as a novel assisted reproductive technique and were used for increasing the oocyte activity during its growth and maturation. In this review, we summarized the nuclear transfer technique for germinal vesicle stage oocytes to reconstruct the maturation of them. Our study covered publications between 1966 and August 2017. In result utilized germinal vesicle transfer techniques, fusion, and fertilization survival rate on five different mammalian species are discussed, regarding their potential clinical application. It seems that with a study on this method, there is real hope for effective treatments of old oocytes or oocytes containing mitochondrial problems in the near future. PMID:29387825
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakaike, Kohei; Akazawa, Muneki; Nakamura, Shogo
2013-12-02
A low-temperature local-layer technique for transferring a single-crystalline silicon (c-Si) film by using a meniscus force was proposed, and an n-channel metal-oxide-semiconductor field-effect transistor (MOSFET) was fabricated on polyethylene terephthalate (PET) substrate. It was demonstrated that it is possible to transfer and form c-Si films in the required shape at the required position on PET substrates at extremely low temperatures by utilizing a meniscus force. The proposed technique for layer transfer was applied for fabricating high-performance c-Si MOSFETs on a PET substrate. The fabricated MOSFET showed a high on/off ratio of more than 10{sup 8} and a high field-effect mobilitymore » of 609 cm{sup 2} V{sup −1} s{sup −1}.« less
NASA Technical Reports Server (NTRS)
Kutepov, A. A.; Kunze, D.; Hummer, D. G.; Rybicki, G. B.
1991-01-01
An iterative method based on the use of approximate transfer operators, which was designed initially to solve multilevel NLTE line formation problems in stellar atmospheres, is adapted and applied to the solution of the NLTE molecular band radiative transfer in planetary atmospheres. The matrices to be constructed and inverted are much smaller than those used in the traditional Curtis matrix technique, which makes possible the treatment of more realistic problems using relatively small computers. This technique converges much more rapidly than straightforward iteration between the transfer equation and the equations of statistical equilibrium. A test application of this new technique to the solution of NLTE radiative transfer problems for optically thick and thin bands (the 4.3 micron CO2 band in the Venusian atmosphere and the 4.7 and 2.3 micron CO bands in the earth's atmosphere) is described.
NASA Technical Reports Server (NTRS)
Bowley, C. J.; Barnes, J. C.; Rango, A.
1981-01-01
The purpose of the handbook is to update the various snowcover interpretation techniques, document the snow mapping techniques used in the various ASVT study areas, and describe the ways snowcover data have been applied to runoff prediction. Through documentation in handbook form, the methodology developed in the Snow Mapping ASVT can be applied to other areas.
In, Jung Bin; Lee, Daeho; Fornasiero, Francesco; Noy, Aleksandr; Grigoropoulos, Costas P
2012-09-25
We demonstrate a laser-assisted dry transfer technique for assembling patterns of vertically aligned carbon nanotube arrays on a flexible polymeric substrate. A laser beam is applied to the interface of a nanotube array and a polycarbonate sheet in contact with one another. The absorbed laser heat promotes nanotube adhesion to the polymer in the irradiated regions and enables selective pattern transfer. A combination of the thermal transfer mechanism with rapid direct writing capability of focused laser beam irradiation allows us to achieve simultaneous material transfer and direct micropatterning in a single processing step. Furthermore, we demonstrate that malleability of the nanotube arrays transferred onto a flexible substrate enables post-transfer tailoring of electric conductance by collapsing the aligned nanotubes in different directions. This work suggests that the laser-assisted transfer technique provides an efficient route to using vertically aligned nanotubes as conductive elements in flexible device applications.
Van Ngoc, Huynh; Qian, Yongteng; Han, Suk Kil; Kang, Dae Joon
2016-01-01
We have explored a facile technique to transfer large area 2-Dimensional (2D) materials grown by chemical vapor deposition method onto various substrates by adding a water-soluble Polyvinyl Alcohol (PVA) layer between the polymethyl-methacrylate (PMMA) and the 2D material film. This technique not only allows the effective transfer to an arbitrary target substrate with a high degree of freedom, but also avoids PMMA etching thereby maintaining the high quality of the transferred 2D materials with minimum contamination. We applied this method to transfer various 2D materials grown on different rigid substrates of general interest, such as graphene on copper foil, h-BN on platinum and MoS2 on SiO2/Si. This facile transfer technique has great potential for future research towards the application of 2D materials in high performance optical, mechanical and electronic devices. PMID:27616038
NASA Technical Reports Server (NTRS)
Meyer, J. D.
1977-01-01
Space technology transfer is discussed as applied to the field of materials science. Advances made in processing include improved computer techniques, and structural analysis. Technology transfer is shown to have an important impact potential in the overall productivity of the United States.
NASA Astrophysics Data System (ADS)
Leu, Tzong-Shyng; Huang, Hung-Ming; Huang, Ding-Jun
2016-06-01
In this paper, wettability gradient pattern is applied to condensation heat transfer on a copper tube surface. For this application, the vital issue is how to fabricate gradient patterns on a curve tube surface to accelerate the droplet collection efficiently. For this purpose, novel fabrication processes are developed to form wettability gradient patterns on a curve copper tube surface by using roller screen printing surface modification techniques. The roller screen printing surface modification techniques can easily realize wettability gradient surfaces with superhydrophobicity and superhydrophilicity on a copper tube surface. Experimental results show the droplet nucleation sites, movement and coalescence toward the collection areas can be effectively controlled which can assist in removing the condensation water from the surface. The effectiveness of droplet collection is appropriate for being applied to condensation heat transfer in the foreseeable future.
Chirality transfer technique between liquid crystal microdroplets using microfluidic systems
NASA Astrophysics Data System (ADS)
Guo, Jin-kun; Lee, Doyeon; Song, Jang-kun
2018-02-01
Cholesteric liquid crystal (LC) microdroplet is applied in many areas, such as tunable laser, biosensor, information display and security identification, due to its unique optical properties. The topological structure, defects, and photonic crystallinity in the cholesteric liquid crystal (LC) microdroplet can be controlled through the chirality. Here we report an interesting phenomenon that chirality information can be shared among dispersed LC microdroplets in surfactant aqueous solution, which is driven by the transferring of chiral dopant molecules. As a result, we developed an artificial molecule transfer technology which could in situ vary the material composition within the isolated dispersed microdroplets. The molecular transfer is switchable and the transfer speed is controllable by tuning the molecular solubility in continuous phase. Based on this technique, we manipulated, forward and backward, the topological evolution and the photonic crystal band-gap of the dispersed LC droplet. This technique is an easy and powerful experimental tool, and it may be applicable to other fields in optical application, biology, chemistry and material science.
Relativistic theory for picosecond time transfer in the vicinity of Earth
NASA Technical Reports Server (NTRS)
Petit, G.; Wolf, P.
1994-01-01
The problem of light propagation is treated in a geocentric reference system with the goal of ensuring picosecond accuracy for time transfer techniques using electromagnetic signals in the vicinity of the Earth. We give an explicit formula for a one way time transfer, to be applied when the spatial coordinates of the time transfer stations are known in a geocentric reference system rotating with the Earth. This expression is extended, at the same accuracy level of one picosecond, to the special cases of two way and LASSO time transfers via geostationary satellites.
NASA Astrophysics Data System (ADS)
Regnier, David; Lacroix, Denis; Scamps, Guillaume; Hashimoto, Yukio
2018-03-01
In a mean-field description of superfluidity, particle number and gauge angle are treated as quasiclassical conjugated variables. This level of description was recently used to describe nuclear reactions around the Coulomb barrier. Important effects of the relative gauge angle between two identical superfluid nuclei (symmetric collisions) on transfer probabilities and fusion barrier have been uncovered. A theory making contact with experiments should at least average over different initial relative gauge-angles. In the present work, we propose a new approach to obtain the multiple pair transfer probabilities between superfluid systems. This method, called phase-space combinatorial (PSC) technique, relies both on phase-space averaging and combinatorial arguments to infer the full pair transfer probability distribution at the cost of multiple mean-field calculations only. After benchmarking this approach in a schematic model, we apply it to the collision 20O+20O at various energies below the Coulomb barrier. The predictions for one pair transfer are similar to results obtained with an approximated projection method, whereas significant differences are found for two pairs transfer. Finally, we investigated the applicability of the PSC method to the contact between nonidentical superfluid systems. A generalization of the method is proposed and applied to the schematic model showing that the pair transfer probabilities are reasonably reproduced. The applicability of the PSC method to asymmetric nuclear collisions is investigated for the 14O+20O collision and it turns out that unrealistically small single- and multiple pair transfer probabilities are obtained. This is explained by the fact that relative gauge angle play in this case a minor role in the particle transfer process compared to other mechanisms, such as equilibration of the charge/mass ratio. We conclude that the best ground for probing gauge-angle effects in nuclear reaction and/or for applying the proposed PSC approach on pair transfer is the collisions of identical open-shell spherical nuclei.
Applying horizontal gene transfer phenomena to enhance non-viral gene therapy
Elmer, Jacob J.; Christensen, Matthew D.; Rege, Kaushal
2014-01-01
Horizontal gene transfer (HGT) is widespread amongst prokaryotes, but eukaryotes tend to be far less promiscuous with their genetic information. However, several examples of HGT from pathogens into eukaryotic cells have been discovered and mimicked to improve non-viral gene delivery techniques. For example, several viral proteins and DNA sequences have been used to significantly increase cytoplasmic and nuclear gene delivery. Plant genetic engineering is routinely performed with the pathogenic bacterium Agrobacterium tumefaciens and similar pathogens (e.g. Bartonella henselae) may also be able to transform human cells. Intracellular parasites like Trypanosoma cruzi may also provide new insights into overcoming cellular barriers to gene delivery. Finally, intercellular nucleic acid transfer between host cells will also be briefly discussed. This article will review the unique characteristics of several different viruses and microbes and discuss how their traits have been successfully applied to improve non-viral gene delivery techniques. Consequently, pathogenic traits that originally caused diseases may eventually be used to treat many genetic diseases. PMID:23994344
NASA Technical Reports Server (NTRS)
Masiulaniec, K. Cyril; Vanfossen, G. James, Jr.; Dewitt, Kenneth J.; Dukhan, Nihad
1995-01-01
A technique was developed to cast frozen ice shapes that had been grown on a metal surface. This technique was applied to a series of ice shapes that were grown in the NASA Lewis Icing Research Tunnel on flat plates. Nine flat plates, 18 inches square, were obtained from which aluminum castings were made that gave good ice shape characterizations. Test strips taken from these plates were outfitted with heat flux gages, such that when placed in a dry wind tunnel, can be used to experimentally map out the convective heat transfer coefficient in the direction of flow from the roughened surfaces. The effects on the heat transfer coefficient for both parallel and accelerating flow will be studied. The smooth plate model verification baseline data as well as one ice roughened test case are presented.
Transfer printing techniques for materials assembly and micro/nanodevice fabrication.
Carlson, Andrew; Bowen, Audrey M; Huang, Yonggang; Nuzzo, Ralph G; Rogers, John A
2012-10-09
Transfer printing represents a set of techniques for deterministic assembly of micro-and nanomaterials into spatially organized, functional arrangements with two and three-dimensional layouts. Such processes provide versatile routes not only to test structures and vehicles for scientific studies but also to high-performance, heterogeneously integrated functional systems, including those in flexible electronics, three-dimensional and/or curvilinear optoelectronics, and bio-integrated sensing and therapeutic devices. This article summarizes recent advances in a variety of transfer printing techniques, ranging from the mechanics and materials aspects that govern their operation to engineering features of their use in systems with varying levels of complexity. A concluding section presents perspectives on opportunities for basic and applied research, and on emerging use of these methods in high throughput, industrial-scale manufacturing. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mass balance for on-line alphakLa estimation in activated sludge oxidation ditch.
Chatellier, P; Audic, J M
2001-01-01
The capacity of an aeration system to transfer oxygen to a given activated sludge oxidation ditch is characterised by the alphakLa parameter. This parameter is difficult to measure under normal plant working conditions. Usually this measurement involves off-gas techniques or static mass balance. Therefore an on-line technique has been developed and tested in order to evaluate alphakLa. This technique deduces alphakLa from a data analysis of low cost sensor measurement: two flow meters and one oxygen probe. It involves a dynamic mass balance applied to aeration cycles selected according to given criteria. This technique has been applied to a wastewater treatment plant during four years. Significant variations of the alphakLa values have been detected while the number of blowers changes. This technique has been applied to another plant during two months.
Computer assisted analysis of auroral images obtained from high altitude polar satellites
NASA Technical Reports Server (NTRS)
Samadani, Ramin; Flynn, Michael
1993-01-01
Automatic techniques that allow the extraction of physically significant parameters from auroral images were developed. This allows the processing of a much larger number of images than is currently possible with manual techniques. Our techniques were applied to diverse auroral image datasets. These results were made available to geophysicists at NASA and at universities in the form of a software system that performs the analysis. After some feedback from users, an upgraded system was transferred to NASA and to two universities. The feasibility of user-trained search and retrieval of large amounts of data using our automatically derived parameter indices was demonstrated. Techniques based on classification and regression trees (CART) were developed and applied to broaden the types of images to which the automated search and retrieval may be applied. Our techniques were tested with DE-1 auroral images.
Iterative optimization method for design of quantitative magnetization transfer imaging experiments.
Levesque, Ives R; Sled, John G; Pike, G Bruce
2011-09-01
Quantitative magnetization transfer imaging (QMTI) using spoiled gradient echo sequences with pulsed off-resonance saturation can be a time-consuming technique. A method is presented for selection of an optimum experimental design for quantitative magnetization transfer imaging based on the iterative reduction of a discrete sampling of the Z-spectrum. The applicability of the technique is demonstrated for human brain white matter imaging at 1.5 T and 3 T, and optimal designs are produced to target specific model parameters. The optimal number of measurements and the signal-to-noise ratio required for stable parameter estimation are also investigated. In vivo imaging results demonstrate that this optimal design approach substantially improves parameter map quality. The iterative method presented here provides an advantage over free form optimal design methods, in that pragmatic design constraints are readily incorporated. In particular, the presented method avoids clustering and repeated measures in the final experimental design, an attractive feature for the purpose of magnetization transfer model validation. The iterative optimal design technique is general and can be applied to any method of quantitative magnetization transfer imaging. Copyright © 2011 Wiley-Liss, Inc.
Comparison of holographic setups used in heat and mass transfer measurement
NASA Astrophysics Data System (ADS)
Doleček, R.; Psota, P.; Lédl, V.; Vít, T.; Kopecký, V.
2014-03-01
The authors of the paper deal with measurement of heat and mass transfer for several years and they have frequently used few techniqes for measurement of refractive index distribution based on holographic interferometry. Some of the well known techniques have been modified some and some new ones developped. Every technique could be applied with success in different type of meassurement and obviously every one has set of properties making them unique. We decided to digest few different basic techniques and describe its properties in this paper with the aim to help the reader select the proper one for their measurement. The list of techniques and its properties is not comprehensive but schould serve as a basic orientation in the field.
Variationally consistent approximation scheme for charge transfer
NASA Technical Reports Server (NTRS)
Halpern, A. M.
1978-01-01
The author has developed a technique for testing various charge-transfer approximation schemes for consistency with the requirements of the Kohn variational principle for the amplitude to guarantee that the amplitude is correct to second order in the scattering wave functions. Applied to Born-type approximations for charge transfer it allows the selection of particular groups of first-, second-, and higher-Born-type terms that obey the consistency requirement, and hence yield more reliable approximation to the amplitude.
Transfer doping of single isolated nanodiamonds, studied by scanning probe microscopy techniques.
Bolker, Asaf; Saguy, Cecile; Kalish, Rafi
2014-09-26
The transfer doping of diamond surfaces has been applied in various novel two-dimensional electronic devices. Its extension to nanodiamonds (ND) is essential for ND-based applications in many fields. In particular, understanding the influence of the crystallite size on transfer doping is desirable. Here, we report the results of a detailed study of the electronic energetic band structure of single, isolated transfer-doped nanodiamonds with nanometric resolution using a combination of scanning tunneling spectroscopy and Kelvin force microscopy measurements. The results show how the band gap, the valence band maximum, the electron affinity and the work function all depend on the ND's size and nanoparticle surface properties. The present analysis, which combines information from both scanning tunneling spectroscopy and Kelvin force microscopy, should be applicable to any nanoparticle or surface that can be measured with scanning probe techniques.
Robust approximate optimal guidance strategies for aeroassisted orbital transfer missions
NASA Astrophysics Data System (ADS)
Ilgen, Marc R.
This thesis presents the application of game theoretic and regular perturbation methods to the problem of determining robust approximate optimal guidance laws for aeroassisted orbital transfer missions with atmospheric density and navigated state uncertainties. The optimal guidance problem is reformulated as a differential game problem with the guidance law designer and Nature as opposing players. The resulting equations comprise the necessary conditions for the optimal closed loop guidance strategy in the presence of worst case parameter variations. While these equations are nonlinear and cannot be solved analytically, the presence of a small parameter in the equations of motion allows the method of regular perturbations to be used to solve the equations approximately. This thesis is divided into five parts. The first part introduces the class of problems to be considered and presents results of previous research. The second part then presents explicit semianalytical guidance law techniques for the aerodynamically dominated region of flight. These guidance techniques are applied to unconstrained and control constrained aeroassisted plane change missions and Mars aerocapture missions, all subject to significant atmospheric density variations. The third part presents a guidance technique for aeroassisted orbital transfer problems in the gravitationally dominated region of flight. Regular perturbations are used to design an implicit guidance technique similar to the second variation technique but that removes the need for numerically computing an optimal trajectory prior to flight. This methodology is then applied to a set of aeroassisted inclination change missions. In the fourth part, the explicit regular perturbation solution technique is extended to include the class of guidance laws with partial state information. This methodology is then applied to an aeroassisted plane change mission using inertial measurements and subject to uncertainties in the initial value of the flight path angle. A summary of performance results for all these guidance laws is presented in the fifth part of this thesis along with recommendations for further research.
Ion transfer through solvent polymeric membranes driven by an exponential current flux.
Molina, A; Torralba, E; González, J; Serna, C; Ortuño, J A
2011-03-21
General analytical equations which govern ion transfer through liquid membranes with one and two polarized interfaces driven by an exponential current flux are derived. Expressions for the transient and stationary E-t, dt/dE-E and dI/dE-E curves are obtained, and the evolution from transient to steady behaviour has been analyzed in depth. We have also shown mathematically that the voltammetric and stationary chronopotentiometric I(N)-E curves are identical (with E being the applied potential for voltammetric techniques and the measured potential for chronopotentiometric techniques), and hence, their derivatives provide identical information.
Hirayama, H; Sugawara, Y; Miyashita, Y; Mitsuishi, M; Miyashita, T
2013-02-25
We demonstrate a high-sensitive transient absorption technique for detection of excited states in an organic thin film by time-resolved optical waveguide spectroscopy. By using a laser beam as a probe light, we detect small change in the transient absorbance which is equivalent to 10 -7 absorbance unit in a conventional method. This technique was applied to organic thin films of blue phosphorescent materials for organic light emitting diodes. We directly observed the back energy transfer from emitting guest molecules to conductive host molecules.
High-efficiency resonant coupled wireless power transfer via tunable impedance matching
NASA Astrophysics Data System (ADS)
Anowar, Tanbir Ibne; Barman, Surajit Das; Wasif Reza, Ahmed; Kumar, Narendra
2017-10-01
For magnetic resonant coupled wireless power transfer (WPT), the axial movement of near-field coupled coils adversely degrades the power transfer efficiency (PTE) of the system and often creates sub-resonance. This paper presents a tunable impedance matching technique based on optimum coupling tuning to enhance the efficiency of resonant coupled WPT system. The optimum power transfer model is analysed from equivalent circuit model via reflected load principle, and the adequate matching are achieved through the optimum tuning of coupling coefficients at both the transmitting and receiving end of the system. Both simulations and experiments are performed to evaluate the theoretical model of the proposed matching technique, and results in a PTE over 80% at close coil proximity without shifting the original resonant frequency. Compared to the fixed coupled WPT, the extracted efficiency shows 15.1% and 19.9% improvements at the centre-to-centre misalignment of 10 and 70 cm, respectively. Applying this technique, the extracted S21 parameter shows more than 10 dB improvements at both strong and weak couplings. Through the developed model, the optimum coupling tuning also significantly improves the performance over matching techniques using frequency tracking and tunable matching circuits.
Wireless power transfer based on dielectric resonators with colossal permittivity
NASA Astrophysics Data System (ADS)
Song, Mingzhao; Belov, Pavel; Kapitanova, Polina
2016-11-01
Magnetic resonant wireless power transfer system based on dielectric disk resonators made of colossal permittivity (ɛ = 1000) and low loss (tan δ = 2.5 × 10-4) microwave ceramic is experimentally investigated. The system operates at the magnetic dipole mode excited in the resonators providing maximal power transfer efficiency of 90% at the frequency 232 MHz. By applying an impedance matching technique, the efficiency of 50% is achieved within the separation between the resonators d = 16 cm (3.8 radii of the resonator). The separation, misalignment and rotation dependencies of wireless power transfer efficiency are experimentally studied.
Production, Preservation, and Transfer of South American Camelid Embryos
Trasorras, Virginia L.; Carretero, María Ignacia; Neild, Deborah M.; Chaves, Maria Graciela; Giuliano, Susana M.; Miragaya, Marcelo H.
2017-01-01
The current review summarizes progress in the field of in vitro and in vivo production of South American Camelid embryos. Both methods require ovarian superstimulation (with FSH and eCG) to obtain multiple ovulations (in vivo embryo production) or to induce follicle growth for oocyte collection (in vitro embryo production). Moreover, superstimulation entails prior administration of hormones that inhibit follicular growth (progesterone, progestagens, and estrogens). Cumulus-oocyte complexes obtained must mature in vivo (buserelin administration) or in vitro to then be subjected to in vitro fertilization or intracytoplasmic sperm injection. All these techniques also require morphologically normal, motile spermatozoa to achieve fertilization. Methods used to decrease semen viscosity and to select the best spermatozoa (Percoll®; Androcoll-ETM) are described. Additionally, nuclear transfer or cloning has been applied in llamas. Up to now, embryo deep-freezing and vitrification have progressed slowly but are at the height of development. Embryos that are obtained by any of these techniques, either in vivo or in vitro, need to be transferred to synchronized recipient females. The best results are achieved after transfer to the left uterine horn with an ipsilateral ovulation. No live offspring have been obtained after the transfer of cryopreserved embryos. Applying reproductive biotechnologies, such as those described, will permit the expansion of genetically selected animals in the population and also that of wild camelid species, vicunas, and guanacos, whose embryos could then be transferred to the uterus of domestic species. PMID:29181380
Visible spectroscopy calibration transfer model in determining pH of Sala mangoes
NASA Astrophysics Data System (ADS)
Yahaya, O. K. M.; MatJafri, M. Z.; Aziz, A. A.; Omar, A. F.
2015-05-01
The purpose of this study is to compare the efficiency of calibration transfer procedures between three spectrometers involving two Ocean Optics Inc. spectrometers, namely, QE65000 and Jaz, and also, ASD FieldSpec 3 in measuring the pH of Sala mango by visible reflectance spectroscopy. This study evaluates the ability of these spectrometers in measuring the pH of Sala mango by applying similar calibration algorithms through direct calibration transfer. This visible reflectance spectroscopy technique defines a spectrometer as a master instrument and another spectrometer as a slave. The multiple linear regression (MLR) of calibration model generated using the QE65000 spectrometer is transferred to the Jaz spectrometer and vice versa for Set 1. The same technique is applied for Set 2 with QE65000 spectrometer is transferred to the FieldSpec3 spectrometer and vice versa. For Set 1, the result showed that the QE65000 spectrometer established a calibration model with higher accuracy than that of the Jaz spectrometer. In addition, the calibration model developed on Jaz spectrometer successfully predicted the pH of Sala mango, which was measured using QE65000 spectrometer, with a root means square error of prediction RMSEP = 0.092 pH and coefficients of determination R2 = 0.892. Moreover, the best prediction result is obtained for Set 2 when the calibration model developed on QE65000 spectrometer is successfully transferred to FieldSpec 3 with R2 = 0.839 and RMSEP = 0.16 pH.
Transfer doping of single isolated nanodiamonds, studied by scanning probe microscopy techniques
NASA Astrophysics Data System (ADS)
Bolker, Asaf; Saguy, Cecile; Kalish, Rafi
2014-09-01
The transfer doping of diamond surfaces has been applied in various novel two-dimensional electronic devices. Its extension to nanodiamonds (ND) is essential for ND-based applications in many fields. In particular, understanding the influence of the crystallite size on transfer doping is desirable. Here, we report the results of a detailed study of the electronic energetic band structure of single, isolated transfer-doped nanodiamonds with nanometric resolution using a combination of scanning tunneling spectroscopy and Kelvin force microscopy measurements. The results show how the band gap, the valence band maximum, the electron affinity and the work function all depend on the ND’s size and nanoparticle surface properties. The present analysis, which combines information from both scanning tunneling spectroscopy and Kelvin force microscopy, should be applicable to any nanoparticle or surface that can be measured with scanning probe techniques.
Determination of acoustical transfer functions using an impulse method
NASA Astrophysics Data System (ADS)
MacPherson, J.
1985-02-01
The Transfer Function of a system may be defined as the relationship of the output response to the input of a system. Whilst recent advances in digital processing systems have enabled Impulse Transfer Functions to be determined by computation of the Fast Fourier Transform, there has been little work done in applying these techniques to room acoustics. Acoustical Transfer Functions have been determined for auditoria, using an impulse method. The technique is based on the computation of the Fast Fourier Transform (FFT) of a non-ideal impulsive source, both at the source and at the receiver point. The Impulse Transfer Function (ITF) is obtained by dividing the FFT at the receiver position by the FFT of the source. This quantity is presented both as linear frequency scale plots and also as synthesized one-third octave band data. The technique enables a considerable quantity of data to be obtained from a small number of impulsive signals recorded in the field, thereby minimizing the time and effort required on site. As the characteristics of the source are taken into account in the calculation, the choice of impulsive source is non-critical. The digital analysis equipment required for the analysis is readily available commercially.
Retinal blood vessel segmentation using fully convolutional network with transfer learning.
Jiang, Zhexin; Zhang, Hao; Wang, Yi; Ko, Seok-Bum
2018-04-26
Since the retinal blood vessel has been acknowledged as an indispensable element in both ophthalmological and cardiovascular disease diagnosis, the accurate segmentation of the retinal vessel tree has become the prerequisite step for automated or computer-aided diagnosis systems. In this paper, a supervised method is presented based on a pre-trained fully convolutional network through transfer learning. This proposed method has simplified the typical retinal vessel segmentation problem from full-size image segmentation to regional vessel element recognition and result merging. Meanwhile, additional unsupervised image post-processing techniques are applied to this proposed method so as to refine the final result. Extensive experiments have been conducted on DRIVE, STARE, CHASE_DB1 and HRF databases, and the accuracy of the cross-database test on these four databases is state-of-the-art, which also presents the high robustness of the proposed approach. This successful result has not only contributed to the area of automated retinal blood vessel segmentation but also supports the effectiveness of transfer learning when applying deep learning technique to medical imaging. Copyright © 2018 Elsevier Ltd. All rights reserved.
Contextual interference effect on perceptual-cognitive skills training.
Broadbent, David P; Causer, Joe; Ford, Paul R; Williams, A Mark
2015-06-01
Contextual interference (CI) effect predicts that a random order of practice for multiple skills is superior for learning compared to a blocked order. We report a novel attempt to examine the CI effect during acquisition and transfer of anticipatory judgments from simulation training to an applied sport situation. Participants were required to anticipate tennis shots under either a random practice schedule or a blocked practice schedule. Response accuracy was recorded for both groups in pretest, during acquisition, and on a 7-d retention test. Transfer of learning was assessed through a field-based tennis protocol that attempted to assess performance in an applied sport setting. The random practice group had significantly higher response accuracy scores on the 7-d laboratory retention test compared to the blocked group. Moreover, during the transfer of anticipatory judgments to an applied sport situation, the decision times of the random practice group were significantly lower compared to the blocked group. The CI effect extends to the training of anticipatory judgments through simulation techniques. Furthermore, we demonstrate for the first time that the CI effect increases transfer of learning from simulation training to an applied sport task, highlighting the importance of using appropriate practice schedules during simulation training.
Liquid neon heat transfer as applied to a 30 tesla cryomagnet
NASA Technical Reports Server (NTRS)
Papell, S. S.; Hendricks, R. C.
1975-01-01
Since superconducting magnets cooled by liquid helium are limited to magnetic fields of about 18 teslas, the design of a 30 tesla cryomagnet necessitates forced convection liquid neon heat transfer in small coolant channels. As these channels are too small to handle the vapor flow if the coolant were to boil, the design philosophy calls for suppressing boiling by subjecting the fluid to high pressures. Forced convection heat transfer data are obtained by using a blowdown technique to force the fluid vertically through a resistance-heated instrumented tube. The data are obtained at inlet temperatures between 28 and 34 K and system pressures between 28 to 29 bars. Data correlation is limited to a very narrow range of test conditions, since the tests were designed to simulate the heat transfer characteristics in the coolant channels of the 30 tesla cryomagnet concerned. The results can therefore be applied directly to the design of the magnet system.-
NASA Astrophysics Data System (ADS)
Sakaike, Kohei; Akazawa, Muneki; Nakagawa, Akitoshi; Higashi, Seiichiro
2015-04-01
A novel low-temperature technique for transferring a silicon-on-insulator (SOI) layer with a midair cavity (supported by narrow SiO2 columns) by meniscus force has been proposed, and a single-crystalline Si (c-Si) film with a midair cavity formed in dog-bone shape was successfully transferred to a poly(ethylene terephthalate) (PET) substrate at its heatproof temperature or lower. By applying this proposed transfer technique, high-performance c-Si-based complementary metal-oxide-semiconductor (CMOS) transistors were successfully fabricated on the PET substrate. The key processes are the thermal oxidation and subsequent hydrogen annealing of the SOI layer on the midair cavity. These processes ensure a good MOS interface, and the SiO2 layer works as a “blocking” layer that blocks contamination from PET. The fabricated n- and p-channel c-Si thin-film transistors (TFTs) on the PET substrate showed field-effect mobilities of 568 and 103 cm2 V-1 s-1, respectively.
Turbine blade tip durability analysis
NASA Technical Reports Server (NTRS)
Mcknight, R. L.; Laflen, J. H.; Spamer, G. T.
1981-01-01
An air-cooled turbine blade from an aircraft gas turbine engine chosen for its history of cracking was subjected to advanced analytical and life-prediction techniques. The utility of advanced structural analysis techniques and advanced life-prediction techniques in the life assessment of hot section components are verified. Three dimensional heat transfer and stress analyses were applied to the turbine blade mission cycle and the results were input into advanced life-prediction theories. Shortcut analytical techniques were developed. The proposed life-prediction theories are evaluated.
31 CFR 205.13 - How do you determine when State or Federal interest liability accrues?
Code of Federal Regulations, 2010 CFR
2010-07-01
... SERVICE RULES AND PROCEDURES FOR EFFICIENT FEDERAL-STATE FUNDS TRANSFERS Rules Applicable to Federal... mutually agreed to funding techniques are applied, depending on the terms of the Treasury-State agreement...
The ethics of human gene transfer.
Kimmelman, Jonathan
2008-03-01
Almost 20 years since the first gene-transfer trial was carried out in humans, the field has made significant advances towards clinical application. Nevertheless, it continues to face numerous unresolved ethical challenges--among them are the question of when to initiate human testing, the acceptability of germline modification and whether the technique should be applied to the enhancement of traits. Although such issues have precedents in other medical contexts, they take on a different character in gene transfer, in part because of the scientific uncertainty and the social context of innovation.
Valdes, Gilmer; Interian, Yannet
2018-03-15
The application of machine learning (ML) presents tremendous opportunities for the field of oncology, thus we read 'Deep convolutional neural network with transfer learning for rectum toxicity prediction in cervical cancer radiotherapy: a feasibility study' with great interest. In this article, the authors used state of the art techniques: a pre-trained convolutional neural network (VGG-16 CNN), transfer learning, data augmentation, drop out and early stopping, all of which are directly responsible for the success and the excitement that these algorithms have created in other fields. We believe that the use of these techniques can offer tremendous opportunities in the field of Medical Physics and as such we would like to praise the authors for their pioneering application to the field of Radiation Oncology. That being said, given that the field of Medical Physics has unique characteristics that differentiate us from those fields where these techniques have been applied successfully, we would like to raise some points for future discussion and follow up studies that could help the community understand the limitations and nuances of deep learning techniques.
Tendon 'turnover lengthening' technique.
Cerovac, S; Miranda, B H
2013-11-01
Tendon defect reconstruction is amongst the most technically challenging areas in hand surgery. Tendon substance deficiency reconstruction techniques include lengthening, grafting, two-stage reconstruction and tendon transfers, however each is associated with unique challenges over and above direct repair. We describe a novel 'turnover lengthening' technique for hand tendons that has successfully been applied to the repair of several cases, including a case of attritional flexor and traumatic extensor tendon rupture in two presented patients where primary tenorrhaphy was not possible. In both cases a good post-operative outcome was achieved, as the patients were happy having returned back to normal activities of daily living such that they were discharged 12 weeks post-operatively. Our technique avoids the additional morbidity and complications associated with grafting, transfers and two stage reconstructions. It is quick, simple and reproducible for defects not exceeding 3-4 cm, provides a means of immediate one stage reconstruction, no secondary donor site morbidity and does not compromise salvage by tendon transfer and/or two-stage reconstruction in cases of failure. To our knowledge no such technique has been previously been described to reconstruct such hand tendon defects. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Ghisaidoobe, Amar B. T.; Chung, Sang J.
2014-01-01
Förster resonance energy transfer (FRET) occurs when the distance between a donor fluorophore and an acceptor is within 10 nm, and its application often necessitates fluorescent labeling of biological targets. However, covalent modification of biomolecules can inadvertently give rise to conformational and/or functional changes. This review describes the application of intrinsic protein fluorescence, predominantly derived from tryptophan (λEX ∼ 280 nm, λEM ∼ 350 nm), in protein-related research and mainly focuses on label-free FRET techniques. In terms of wavelength and intensity, tryptophan fluorescence is strongly influenced by its (or the protein’s) local environment, which, in addition to fluorescence quenching, has been applied to study protein conformational changes. Intrinsic Förster resonance energy transfer (iFRET), a recently developed technique, utilizes the intrinsic fluorescence of tryptophan in conjunction with target-specific fluorescent probes as FRET donors and acceptors, respectively, for real time detection of native proteins. PMID:25490136
J. M. Roberts; P. Veres; C. Warneke; J. A. Neuman; R. A. Washenfelder; S. S. Brown; M. Baasandorj; J. B. Burkholder; I. R. Burling; T. J. Johnson; R. J. Yokelson; J. de Gouw
2010-01-01
A negative-ion proton transfer chemical ionization mass spectrometric technique (NI-PT-CIMS), using acetate as the reagent ion, was applied to the measurement of volatile inorganic acids of atmospheric interest: hydrochloric (HCl), nitrous (HONO), nitric 5 (HNO3), and isocyanic (HNCO) acids. Gas phase calibrations through the sampling inlet showed the method to be...
Synthetic Graphene Grown by Chemical Vapor Deposition on Copper Foils
2013-04-11
b) Transparent PMMA /graphene membrane floating on copper etchant. (c) Three layers of stacked CVD graphene on a cover glass made by consecutively...insulating substrate is a critical step for fabricating electronic devices. PMMA -assisted transfer techniques are commonly applied because of their...simplicity and repeatability.13 In a typical transfer, a graphene film on Cu substrate was first coated with PMMA (950PMMA-A4, MicroChem)b by spin
A digital computer simulation and study of a direct-energy-transfer power-conditioning system
NASA Technical Reports Server (NTRS)
Burns, W. W., III; Owen, H. A., Jr.; Wilson, T. G.; Rodriguez, G. E.; Paulkovich, J.
1974-01-01
A digital computer simulation technique, which can be used to study such composite power-conditioning systems, was applied to a spacecraft direct-energy-transfer power-processing system. The results obtained duplicate actual system performance with considerable accuracy. The validity of the approach and its usefulness in studying various aspects of system performance such as steady-state characteristics and transient responses to severely varying operating conditions are demonstrated experimentally.
NASA Technical Reports Server (NTRS)
Cheyney, H., III; Arking, A.
1976-01-01
The equations of radiative transfer in anisotropically scattering media are reformulated as linear operator equations in a single independent variable. The resulting equations are suitable for solution by a variety of standard mathematical techniques. The operators appearing in the resulting equations are in general nonsymmetric; however, it is shown that every bounded linear operator equation can be embedded in a symmetric linear operator equation and a variational solution can be obtained in a straightforward way. For purposes of demonstration, a Rayleigh-Ritz variational method is applied to three problems involving simple phase functions. It is to be noted that the variational technique demonstrated is of general applicability and permits simple solutions for a wide range of otherwise difficult mathematical problems in physics.
NASA Astrophysics Data System (ADS)
Polimeridis, Athanasios G.; Reid, M. T. H.; Jin, Weiliang; Johnson, Steven G.; White, Jacob K.; Rodriguez, Alejandro W.
2015-10-01
We describe a fluctuating volume-current formulation of electromagnetic fluctuations that extends our recent work on heat exchange and Casimir interactions between arbitrarily shaped homogeneous bodies [A. W. Rodriguez, M. T. H. Reid, and S. G. Johnson, Phys. Rev. B 88, 054305 (2013), 10.1103/PhysRevB.88.054305] to situations involving incandescence and luminescence problems, including thermal radiation, heat transfer, Casimir forces, spontaneous emission, fluorescence, and Raman scattering, in inhomogeneous media. Unlike previous scattering formulations based on field and/or surface unknowns, our work exploits powerful techniques from the volume-integral equation (VIE) method, in which electromagnetic scattering is described in terms of volumetric, current unknowns throughout the bodies. The resulting trace formulas (boxed equations) involve products of well-studied VIE matrices and describe power and momentum transfer between objects with spatially varying material properties and fluctuation characteristics. We demonstrate that thanks to the low-rank properties of the associated matrices, these formulas are susceptible to fast-trace computations based on iterative methods, making practical calculations tractable. We apply our techniques to study thermal radiation, heat transfer, and fluorescence in complicated geometries, checking our method against established techniques best suited for homogeneous bodies as well as applying it to obtain predictions of radiation from complex bodies with spatially varying permittivities and/or temperature profiles.
Chen, Xing; Lu, Jinlong; Cui, Yifan; Zhang, Jian; Lu, Xing; Tian, Xusheng; Ci, Cheng; Liu, Bo; Wu, Hong; Tang, Tingsong; Shi, Kebin; Zhang, Zhigang
2015-12-22
Precision time synchronization between two remote sites is desired in many applications such as global positioning satellite systems, long-baseline interferometry, coherent radar detection and fundamental physics constant measurements. The recently developed frequency dissemination technologies based on optical fiber link have improved the transfer instability to the level of 10(-19)/day at remote location. Therefore it is possible to keep clock oscillation at remote locations continuously corrected, or to reproduce a "virtual" clock on the remote location. However the initial alignment and the correction of 1 pps timing signal from time to time are still required, besides the highly stabilized clock frequency transfer between distant locations. Here we demonstrate a time synchronization based on an ultra-stable frequency transfer system via 120-km commercial fiber link by transferring an optical frequency comb. Both the phase noise compensation in frequency dissemination and temporal basis alignment in time synchronization were implemented by a feed-forward digital compensation (FFDC) technique. The fractional frequency instability was measured to be 6.18 × 10(-20) at 2000 s. The timing deviation of time synchronization was measured to be 0.6 ps in 1500 s. This technique also can be applied in multi-node fiber network topology.
Chen, Xing; Lu, Jinlong; Cui, Yifan; Zhang, Jian; Lu, Xing; Tian, Xusheng; Ci, Cheng; Liu, Bo; Wu, Hong; Tang, Tingsong; Shi, Kebin; Zhang, Zhigang
2015-01-01
Precision time synchronization between two remote sites is desired in many applications such as global positioning satellite systems, long-baseline interferometry, coherent radar detection and fundamental physics constant measurements. The recently developed frequency dissemination technologies based on optical fiber link have improved the transfer instability to the level of 10−19/day at remote location. Therefore it is possible to keep clock oscillation at remote locations continuously corrected, or to reproduce a “virtual” clock on the remote location. However the initial alignment and the correction of 1 pps timing signal from time to time are still required, besides the highly stabilized clock frequency transfer between distant locations. Here we demonstrate a time synchronization based on an ultra-stable frequency transfer system via 120-km commercial fiber link by transferring an optical frequency comb. Both the phase noise compensation in frequency dissemination and temporal basis alignment in time synchronization were implemented by a feed-forward digital compensation (FFDC) technique. The fractional frequency instability was measured to be 6.18 × 10−20 at 2000 s. The timing deviation of time synchronization was measured to be 0.6 ps in 1500 s. This technique also can be applied in multi-node fiber network topology. PMID:26691731
Nano-ranged low-energy ion-beam-induced DNA transfer in biological cells
NASA Astrophysics Data System (ADS)
Yu, L. D.; Wongkham, W.; Prakrajang, K.; Sangwijit, K.; Inthanon, K.; Thongkumkoon, P.; Wanichapichart, P.; Anuntalabhochai, S.
2013-06-01
Low-energy ion beams at a few tens of keV were demonstrated to be able to induce exogenous macromolecules to transfer into plant and bacterial cells. In the process, the ion beam with well controlled energy and fluence bombarded living cells to cause certain degree damage in the cell envelope in nanoscales to facilitate the macromolecules such as DNA to pass through the cell envelope and enter the cell. Consequently, the technique was applied for manipulating positive improvements in the biological species. This physical DNA transfer method was highly efficient and had less risk of side-effects compared with chemical and biological methods. For better understanding of mechanisms involved in the process, a systematic study on the mechanisms was carried out. Applications of the technique were also expanded from DNA transfer in plant and bacterial cells to DNA transfection in human cancer cells potentially for the stem cell therapy purpose. Low-energy nitrogen and argon ion beams that were applied in our experiments had ranges of 100 nm or less in the cell envelope membrane which was majorly composed of polymeric cellulose. The ion beam bombardment caused chain-scission dominant damage in the polymer and electrical property changes such as increase in the impedance in the envelope membrane. These nano-modifications of the cell envelope eventually enhanced the permeability of the envelope membrane to favor the DNA transfer. The paper reports details of our research in this direction.
NASA Astrophysics Data System (ADS)
Adler, Ronald S.; Swanson, Scott D.; Yeung, Hong N.
1996-01-01
A projection-operator technique is applied to a general three-component model for magnetization transfer, extending our previous two-component model [R. S. Adler and H. N. Yeung,J. Magn. Reson. A104,321 (1993), and H. N. Yeung, R. S. Adler, and S. D. Swanson,J. Magn. Reson. A106,37 (1994)]. The PO technique provides an elegant means of deriving a simple, effective rate equation in which there is natural separation of relaxation and source terms and allows incorporation of Redfield-Provotorov theory without any additional assumptions or restrictive conditions. The PO technique is extended to incorporate more general, multicomponent models. The three-component model is used to fit experimental data from samples of human hyaline cartilage and fibrocartilage. The fits of the three-component model are compared to the fits of the two-component model.
Quantum State Transfer via Noisy Photonic and Phononic Waveguides
NASA Astrophysics Data System (ADS)
Vermersch, B.; Guimond, P.-O.; Pichler, H.; Zoller, P.
2017-03-01
We describe a quantum state transfer protocol, where a quantum state of photons stored in a first cavity can be faithfully transferred to a second distant cavity via an infinite 1D waveguide, while being immune to arbitrary noise (e.g., thermal noise) injected into the waveguide. We extend the model and protocol to a cavity QED setup, where atomic ensembles, or single atoms representing quantum memory, are coupled to a cavity mode. We present a detailed study of sensitivity to imperfections, and apply a quantum error correction protocol to account for random losses (or additions) of photons in the waveguide. Our numerical analysis is enabled by matrix product state techniques to simulate the complete quantum circuit, which we generalize to include thermal input fields. Our discussion applies both to photonic and phononic quantum networks.
Liquid neon heat transfer as applied to a 30 tesla cryomagnet
NASA Technical Reports Server (NTRS)
Papell, S. S.; Hendricks, R. C.
1975-01-01
A 30-tesla magnet design is studied which calls for forced convection liquid neon heat transfer in small coolant channels. The design also requires suppressing boiling by subjecting the fluid to high pressures through use of magnet coils enclosed in a pressure vessel which is maintained at the critical pressure of liquid neon. This high pressure reduces the possibility of the system flow instabilities which may occur at low pressures. The forced convection heat transfer data presented were obtained by using a blowdown technique to force the fluid to flow vertically through a resistance heated, instrumented tube.
Redeckas, Kipras; Voiciuk, Vladislava; Zigmantas, Donatas; Hiller, Roger G; Vengris, Mikas
2017-04-01
Time-resolved multi-pulse methods were applied to investigate the excited state dynamics, the interstate couplings, and the excited state energy transfer pathways between the light-harvesting pigments in peridinin-chlorophyll a-protein (PCP). The utilized pump-dump-probe techniques are based on perturbation of the regular PCP energy transfer pathway. The PCP complexes were initially excited with an ultrashort pulse, resonant to the S 0 →S 2 transition of the carotenoid peridinin. A portion of the peridinin-based emissive intramolecular charge transfer (ICT) state was then depopulated by applying an ultrashort NIR pulse that perturbed the interaction between S 1 and ICT states and the energy flow from the carotenoids to the chlorophylls. The presented data indicate that the peridinin S 1 and ICT states are spectrally distinct and coexist in an excited state equilibrium in the PCP complex. Moreover, numeric analysis of the experimental data asserts ICT→Chl-a as the main energy transfer pathway in the photoexcited PCP systems. Copyright © 2017 Elsevier B.V. All rights reserved.
Predicting vibrational failure of flexible ducting
NASA Technical Reports Server (NTRS)
Henry, R. H.
1971-01-01
Technique applies to liquid or gas transfer through flexible ducting and proves valuable in high velocity fluid flow cases. Fluid mechanism responsible for free bellows vibrational excitation also causes flexible hose oscillation. Static pressure stress influences flexible ducting fatigue life and is considered separately.
The 32nd CDC: System identification using interval dynamic models
NASA Technical Reports Server (NTRS)
Keel, L. H.; Lew, J. S.; Bhattacharyya, S. P.
1992-01-01
Motivated by the recent explosive development of results in the area of parametric robust control, a new technique to identify a family of uncertain systems is identified. The new technique takes the frequency domain input and output data obtained from experimental test signals and produces an 'interval transfer function' that contains the complete frequency domain behavior with respect to the test signals. This interval transfer function is one of the key concepts in the parametric robust control approach and identification with such an interval model allows one to predict the worst case performance and stability margins using recent results on interval systems. The algorithm is illustrated by applying it to an 18 bay Mini-Mast truss structure.
Cortical dipole imaging using truncated total least squares considering transfer matrix error.
Hori, Junichi; Takeuchi, Kosuke
2013-01-01
Cortical dipole imaging has been proposed as a method to visualize electroencephalogram in high spatial resolution. We investigated the inverse technique of cortical dipole imaging using a truncated total least squares (TTLS). The TTLS is a regularization technique to reduce the influence from both the measurement noise and the transfer matrix error caused by the head model distortion. The estimation of the regularization parameter was also investigated based on L-curve. The computer simulation suggested that the estimation accuracy was improved by the TTLS compared with Tikhonov regularization. The proposed method was applied to human experimental data of visual evoked potentials. We confirmed the TTLS provided the high spatial resolution of cortical dipole imaging.
Frank, Joachim; Gonzalez, Ruben L.
2015-01-01
At equilibrium, thermodynamic and kinetic information can be extracted from biomolecular energy landscapes by many techniques. However, while static, ensemble techniques yield thermodynamic data, often only dynamic, single-molecule techniques can yield the kinetic data that describes transition-state energy barriers. Here we present a generalized framework based upon dwell-time distributions that can be used to connect such static, ensemble techniques with dynamic, single-molecule techniques, and thus characterize energy landscapes to greater resolutions. We demonstrate the utility of this framework by applying it to cryogenic electron microscopy and single-molecule fluorescence resonance energy transfer studies of the bacterial ribosomal pretranslocation complex. Among other benefits, application of this framework to these data explains why two transient, intermediate conformations of the pretranslocation complex, which are observed in a cryogenic electron microscopy study, may not be observed in several single-molecule fluorescence resonance energy transfer studies. PMID:25785884
Thompson, Colin D Kinz; Sharma, Ajeet K; Frank, Joachim; Gonzalez, Ruben L; Chowdhury, Debashish
2015-08-27
At equilibrium, thermodynamic and kinetic information can be extracted from biomolecular energy landscapes by many techniques. However, while static, ensemble techniques yield thermodynamic data, often only dynamic, single-molecule techniques can yield the kinetic data that describe transition-state energy barriers. Here we present a generalized framework based upon dwell-time distributions that can be used to connect such static, ensemble techniques with dynamic, single-molecule techniques, and thus characterize energy landscapes to greater resolutions. We demonstrate the utility of this framework by applying it to cryogenic electron microscopy (cryo-EM) and single-molecule fluorescence resonance energy transfer (smFRET) studies of the bacterial ribosomal pre-translocation complex. Among other benefits, application of this framework to these data explains why two transient, intermediate conformations of the pre-translocation complex, which are observed in a cryo-EM study, may not be observed in several smFRET studies.
Orbital trim by velocity factoring with applications to the Viking mission.
NASA Technical Reports Server (NTRS)
Kibler, J. F.; Green, R. N.; Young, G. R.
1972-01-01
An orbital trim technique has been developed to satisfy terminal rendezvous and intermediate timing constraints for planetary missions involving orbital operations. The technique utilizes a time-open two-impulse transfer from a specified initial orbit to a final orbit which satisfies all geometrical constraints. Each of the two impulses may then be factored, or split, into two or more vectorially equivalent impulses. The periods of the resulting intermediate orbits may be varied along with the number of revolutions in each orbit to satisfy the intermediate and final timing constraints. Factors in the range 0 to 1 result in rendezvous at the same cost as that of the two-impulse transfer. The technique is applied to the Viking mission to Mars although a similar procedure could be utilized for rendezvous operations about any planet.
This project will demonstrate transferable modeling techniques and monitoring approaches to enable water resource professionals to make comparisons among nutrient reduction management scenarios across urban and agricultural areas. It will produce the applied science to allow bett...
Societal and economic valuation of technology-transfer deals
NASA Astrophysics Data System (ADS)
Holmes, Joseph S., Jr.
2009-09-01
The industrial adoption of concepts such as open innovation brings new legitimacy to activities technology-transfer professionals have conducted for over 20 years. This movement highlights the need for an increased understanding of the valuation of intellectual property (IP) and technology-transfer deals. Valuation, though a centerpiece of corporate finance, is more challenging when applied to the inherent uncertainty surrounding innovation. Technology-transfer professionals are often overwhelmed by the complexity and data requirements of valuation techniques and skeptical of their applicability to and utility for technology transfer. The market longs for an approach which bridges the gap between valuation fundamentals and technology-transfer realities. This paper presents the foundations of a simple, flexible, precise/accurate, and useful framework for considering the valuation of technology-transfer deals. The approach is predicated on a 12-factor model—a 3×4 value matrix predicated on categories of economic, societal, and strategic value. Each of these three categories consists of three core subcategories followed by a fourth "other" category to facilitate inevitable special considerations. This 12-factor value matrix provides a framework for harvesting data during deals and for the application of best-of-breed valuation techniques which can be employed on a per-factor basis. Future work will include framework implementation within a database platform.
NASA Astrophysics Data System (ADS)
Valdes, Gilmer; Interian, Yannet
2018-03-01
The application of machine learning (ML) presents tremendous opportunities for the field of oncology, thus we read ‘Deep convolutional neural network with transfer learning for rectum toxicity prediction in cervical cancer radiotherapy: a feasibility study’ with great interest. In this article, the authors used state of the art techniques: a pre-trained convolutional neural network (VGG-16 CNN), transfer learning, data augmentation, drop out and early stopping, all of which are directly responsible for the success and the excitement that these algorithms have created in other fields. We believe that the use of these techniques can offer tremendous opportunities in the field of Medical Physics and as such we would like to praise the authors for their pioneering application to the field of Radiation Oncology. That being said, given that the field of Medical Physics has unique characteristics that differentiate us from those fields where these techniques have been applied successfully, we would like to raise some points for future discussion and follow up studies that could help the community understand the limitations and nuances of deep learning techniques.
Full-Scale Turbofan-Engine Turbine-Transfer Function Determination Using Three Internal Sensors
NASA Technical Reports Server (NTRS)
Hultgren, Lennart S.
2012-01-01
Noise-source separation techniques, using three engine-internal sensors, are applied to existing static-engine test data to determine the turbine transfer function for the currently subdominant combustion noise. The results are used to assess the combustion-noise prediction capability of the Aircraft Noise Prediction Program (ANOPP) and an improvement to the combustion-noise module GECOR is suggested. The work was carried out in response to the NASA Fundamental Aeronautics Subsonic Fixed Wing Program s Reduced-Perceived-Noise Technical Challenge.
Review of virtual reality treatment for mental health.
Gourlay, D; Lun, K C; Liya, G
2001-01-01
This paper describes recent research that proposes virtual reality techniques as a therapy for patients with cognitive and psychological problems. Specifically this applies to victims of conditions such as traumatic brain injury, Alzheimers and Parkinsons. Additionally virtual reality therapy offers an alternative to current desensitization techniques for the treatment of phobias Some important issues are examined including means of user interaction, skills transfer to the real world, and side-effects of virtual reality exposure.
Advanced Computational Methods for Thermal Radiative Heat Transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tencer, John; Carlberg, Kevin Thomas; Larsen, Marvin E.
2016-10-01
Participating media radiation (PMR) in weapon safety calculations for abnormal thermal environments are too costly to do routinely. This cost may be s ubstantially reduced by applying reduced order modeling (ROM) techniques. The application of ROM to PMR is a new and unique approach for this class of problems. This approach was investigated by the authors and shown to provide significant reductions in the computational expense associated with typical PMR simulations. Once this technology is migrated into production heat transfer analysis codes this capability will enable the routine use of PMR heat transfer in higher - fidelity simulations of weaponmore » resp onse in fire environments.« less
NASA Astrophysics Data System (ADS)
Namgung, Gitae; Ta, Qui Thanh Hoai; Noh, Jin-Seo
2018-07-01
Stretchable hydrogen sensors were fabricated from Pd nanosheets that were transferred onto a PDMS substrate. To prepare the Pd nanosheets, a Pd thin film on PDMS was first biaxially stretched and then PDMS substrate was etched off. The size of Pd nanosheets decreased as the applied strain increased and the film thickness decreased. A transfer technique was utilized to implement the stretchable hydrogen sensors. The stretchable sensors exhibited negative response behaviors upon the exposure to hydrogen gas. Interestingly, the sensors worked even under large strains up to 30%, demonstrating a potential as a high-strain-tolerable hydrogen sensor for the first time.
A new method for the calculation of the conductivity of inhomogeneous systems
NASA Astrophysics Data System (ADS)
Byshkin, M. S.; Turkin, A. A.
2005-06-01
A new method for computing the conductivity of random irregular resistor networks is developed. This method is a generalization of the transfer-matrix technique, proposed by Derrida and Vannimenus for regular 2D and 3D lattices. At the same time for large systems the method presented in this paper is more efficient than the transfer-matrix technique. To demonstrate the method it is applied to a cubic lattice at the percolation threshold and away from it. The conductivity has been found for lattices with size up to 3243. The ratio between the conductivity exponent t and the correlation length exponent η was estimated to be t/η = 2.315, in good agreement with the literature data.
NASA Astrophysics Data System (ADS)
Banerjee, D.; Mandal, A.; Mukherjee, S.
2003-01-01
Fluorescence quenching of some important aromatic bio-molecules (ABM) such as 3-aminophthalhydrazide (luminol), tryptophan (Try), phenylalanine and tyrosine (Tyr) by methyl glyoxal (MG) has been studied employing different spectroscopic techniques. The interaction of MG with ABM in the excited state has been analysed using Stern-Volmer (S-V) mechanism. In the case of MG-luminol system time correlated single photon counting (TCSPC) technique has also been applied to explain the S-V mechanism. The bimolecular rate constants obtained are found to be higher than the rate constant for diffusion controlled process. A plausible explanation of the quenching mechanism has been discussed on the basis of hydrogen bonding, charge transfer and energy transfer interaction between the colliding species.
Parameter identification for nonlinear aerodynamic systems
NASA Technical Reports Server (NTRS)
Pearson, Allan E.
1992-01-01
Continuing work on frequency analysis for transfer function identification is discussed. A new study was initiated into a 'weighted' least squares algorithm within the context of the Fourier modulating function approach. The first phase of applying these techniques to the F-18 flight data is nearing completion, and these results are summarized.
Gladden, L F; Alexander, P; Britton, M M; Mantle, M D; Sederman, A J; Yuen, E H L
2003-01-01
In recent years there has been increasing interest in applying magnetic resonance (MR) techniques in areas of engineering and chemical technology. The science that underpins many of these applications is the physics and chemistry of transport and reaction processes in porous materials. Key to the exploitation of MR methods will be our ability to demonstrate that MR yields information that cannot be obtained using conventional measurement techniques in engineering research. This article describes two case studies that highlight the power of MR to give new insights to chemical engineers. First, we demonstrate the application of MR techniques to explore both mass transfer and chemical conversion in situ within a fixed bed of catalyst, and we then use these data to identify the rate-controlling step of the chemical conversion. Second, we implement a rapid imaging technique to study the stability of the gas-liquid distribution in the low- and high-interaction two-phase flow regimes in a trickle-bed reactor.
Condensation enhancement by means of electrohydrodynamic techniques
NASA Astrophysics Data System (ADS)
Butrymowicz, Dariusz; Karwacki, Jarosław; Trela, Marian
2014-12-01
Short state-of-the-art on the enhancement of condensation heat transfer techniques by means of condensate drainage is presented in this paper. The electrohydrodynamic (EHD) technique is suitable for dielectric media used in refrigeration, organic Rankine cycles and heat pump devices. The electric field is commonly generated in the case of horizontal tubes by means of a rod-type electrode or mesh electrodes. Authors proposed two geometries in the presented own experimental investigations. The first one was an electrode placed just beneath the tube bottom and the second one consisted of a horizontal finned tube with a double electrode placed beneath the tube. The experimental investigations of these two configurations for condensation of refrigerant R-123 have been accomplished. The obtained results confirmed that the application of the EHD technique for the investigated tube and electrode arrangement caused significant increase in heat transfer coefficient. The condensation enhancement depends both on the geometry of the electrode system and on the applied voltage.
Evaluation of a transfinite element numerical solution method for nonlinear heat transfer problems
NASA Technical Reports Server (NTRS)
Cerro, J. A.; Scotti, S. J.
1991-01-01
Laplace transform techniques have been widely used to solve linear, transient field problems. A transform-based algorithm enables calculation of the response at selected times of interest without the need for stepping in time as required by conventional time integration schemes. The elimination of time stepping can substantially reduce computer time when transform techniques are implemented in a numerical finite element program. The coupling of transform techniques with spatial discretization techniques such as the finite element method has resulted in what are known as transfinite element methods. Recently attempts have been made to extend the transfinite element method to solve nonlinear, transient field problems. This paper examines the theoretical basis and numerical implementation of one such algorithm, applied to nonlinear heat transfer problems. The problem is linearized and solved by requiring a numerical iteration at selected times of interest. While shown to be acceptable for weakly nonlinear problems, this algorithm is ineffective as a general nonlinear solution method.
NASA Astrophysics Data System (ADS)
Marta, Bogdan; Leordean, Cosmin; Istvan, Todor; Botiz, Ioan; Astilean, Simion
2016-02-01
Graphene transfer is a procedure of paramount importance for the production of graphene-based electronic devices. The transfer procedure can affect the electronic properties of the transferred graphene and can be detrimental for possible applications both due to procedure induced defects which can appear and due to scalability of the method. Hence, it is important to investigate new transfer methods for graphene that are less time consuming and show great promise. In the present study we propose an efficient, etching-free transfer method that consists in applying a thin polyvinyl alcohol layer on top of the CVD grown graphene on Cu and then peeling-off the graphene onto the polyvinyl alcohol film. We investigate the quality of the transferred graphene before and after the transfer, using Raman spectroscopy and imaging as well as optical and atomic force microscopy techniques. This simple transfer method is scalable and can lead to complete transfer of graphene onto flexible and transparent polymer support films without affecting the quality of the graphene during the transfer procedure.
A Review of Calibration Transfer Practices and Instrument Differences in Spectroscopy.
Workman, Jerome J
2018-03-01
Calibration transfer for use with spectroscopic instruments, particularly for near-infrared, infrared, and Raman analysis, has been the subject of multiple articles, research papers, book chapters, and technical reviews. There has been a myriad of approaches published and claims made for resolving the problems associated with transferring calibrations; however, the capability of attaining identical results over time from two or more instruments using an identical calibration still eludes technologists. Calibration transfer, in a precise definition, refers to a series of analytical approaches or chemometric techniques used to attempt to apply a single spectral database, and the calibration model developed using that database, for two or more instruments, with statistically retained accuracy and precision. Ideally, one would develop a single calibration for any particular application, and move it indiscriminately across instruments and achieve identical analysis or prediction results. There are many technical aspects involved in such precision calibration transfer, related to the measuring instrument reproducibility and repeatability, the reference chemical values used for the calibration, the multivariate mathematics used for calibration, and sample presentation repeatability and reproducibility. Ideally, a multivariate model developed on a single instrument would provide a statistically identical analysis when used on other instruments following transfer. This paper reviews common calibration transfer techniques, mostly related to instrument differences, and the mathematics of the uncertainty between instruments when making spectroscopic measurements of identical samples. It does not specifically address calibration maintenance or reference laboratory differences.
Laser induced forward transfer of SnO2 for sensing applications using different precursors systems
NASA Astrophysics Data System (ADS)
Mattle, Thomas; Hintennach, Andreas; Lippert, Thomas; Wokaun, Alexander
2013-02-01
This paper presents the transfer of SnO2 by laser induced forward transfer (LIFT) for gas sensor applications. Different donor substrates of SnO2 with and without triazene polymer (TP) as a dynamic release layer were prepared. Transferring these films under different conditions were evaluated by optical microscopy and functionality. Transfers of sputtered SnO2 films do not lead to satisfactory results and transfers of SnO2 nanoparticles are difficult. Transfers of SnO2 nanoparticles can only be achieved when applying a second laser pulse to the already transferred material, which improves the adhesion resulting in a complete pixel. A new approach of decomposing the transfer material during LIFT transfer was developed. Donor films based on UV absorbing metal complex precursors namely, SnCl2(acac)2 were prepared and transferred using the LIFT technique. Transfer conditions were optimized for the different systems, which were deposited onto sensor-like microstructures. The conductivity of the transferred material at temperatures of about 400 ∘C are in a range usable for SnO2 gas sensors. First sensing tests were carried out and the transferred material proved to change conductivity when exposed to ethanol, acetone, and methane.
Minimum impulse three-body trajectories.
NASA Technical Reports Server (NTRS)
D'Amario, L.; Edelbaum, T. N.
1973-01-01
A rapid and accurate method of calculating optimal impulsive transfers in the restricted problem of three bodies has been developed. The technique combines a multi-conic method of trajectory integration with primer vector theory and an accelerated gradient method of trajectory optimization. A unique feature is that the state transition matrix and the primer vector are found analytical without additional integrations or differentiations. The method has been applied to the determination of optimal two and three impulse transfers between the L2 libration point and circular orbits about both the earth and the moon.
Method for somatic cell nuclear transfer in zebrafish.
Siripattarapravat, Kannika; Cibelli, Jose B
2011-01-01
Somatic cell nuclear transfer (SCNT) has been a well-known technique for decades and widely applied to generate identical animals, including ones with genetic alterations. The system has been demonstrated successfully in zebrafish. The elaborated requirements of SCNT, however, limit reproducibility of the established model to a few groups in zebrafish research community. In this chapter, we meticulously outline each step of the published protocol as well as preparations of equipments and reagents used in zebrafish SCNT. All describable detailed-tips are elaborated in texts and figures. Copyright © 2011 Elsevier Inc. All rights reserved.
Experimental heat transfer distribution on the SNAP 10A reactor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hopenfeld, J.; Toews, R.E.
1965-01-29
Heating distributions have been obtained for the SNAP 10A reactor by means of a thermal paint technique in the Rhodes and Bloxsom 60 in. hypersonic wind tunnel. Data and correlations are presented only for those reactor components where the ratio of the local heat transfer to that on the stagnation point of the calibration sphere was found to be independent of tunnel conditions. It is shown that these heating distributions can be applied directly to reentry conditions provided the thermally painted and the bare reactor surfaces are both catalytic to atom recombination.
Morales, Dinora Araceli; Bengoetxea, Endika; Larrañaga, Pedro; García, Miguel; Franco, Yosu; Fresnada, Mónica; Merino, Marisa
2008-05-01
In vitro fertilization (IVF) is a medically assisted reproduction technique that enables infertile couples to achieve successful pregnancy. Given the uncertainty of the treatment, we propose an intelligent decision support system based on supervised classification by Bayesian classifiers to aid to the selection of the most promising embryos that will form the batch to be transferred to the woman's uterus. The aim of the supervised classification system is to improve overall success rate of each IVF treatment in which a batch of embryos is transferred each time, where the success is achieved when implantation (i.e. pregnancy) is obtained. Due to ethical reasons, different legislative restrictions apply in every country on this technique. In Spain, legislation allows a maximum of three embryos to form each transfer batch. As a result, clinicians prefer to select the embryos by non-invasive embryo examination based on simple methods and observation focused on morphology and dynamics of embryo development after fertilization. This paper proposes the application of Bayesian classifiers to this embryo selection problem in order to provide a decision support system that allows a more accurate selection than with the actual procedures which fully rely on the expertise and experience of embryologists. For this, we propose to take into consideration a reduced subset of feature variables related to embryo morphology and clinical data of patients, and from this data to induce Bayesian classification models. Results obtained applying a filter technique to choose the subset of variables, and the performance of Bayesian classifiers using them, are presented.
Institutional Climate and Student Departure: A Multinomial Multilevel Modeling Approach
ERIC Educational Resources Information Center
Yi, Pyong-sik
2008-01-01
This study applied a multinomial HOLM technique to examine the extent to which the institutional climate for diversity influences the different types of college student withdrawal, such as stop out, drop out, and transfer. Based on a reformulation of Tinto's model along with the conceptualization of institutional climate for diversity by Hurtado…
NASA Technical Reports Server (NTRS)
Donegan, James J; Robinson, Samuel W , Jr; Gates, Ordway, B , jr
1955-01-01
A method is presented for determining the lateral-stability derivatives, transfer-function coefficients, and the modes for lateral motion from frequency-response data for a rigid aircraft. The method is based on the application of the vector technique to the equations of lateral motion, so that the three equations of lateral motion can be separated into six equations. The method of least squares is then applied to the data for each of these equations to yield the coefficients of the equations of lateral motion from which the lateral-stability derivatives and lateral transfer-function coefficients are computed. Two numerical examples are given to demonstrate the use of the method.
Convective Heat Transfer from Castings of Ice Roughened Surfaces in Horizontal Flight
NASA Technical Reports Server (NTRS)
Dukhan, Nihad; Vanfossen, G. James, Jr.; Masiulaniec, K. Cyril; Dewitt, Kenneth J.
1995-01-01
A technique was developed to cast frozen ice shapes that had been grown on a metal surface. This technique was applied to a series of ice shapes that were grown in the NASA Lewis Icing Research Tunnel on flat plates. Eight different types of ice growths, characterizing different types of roughness, were obtained from these plates, from which aluminum castings were made. Test strips taken from these castings were outfitted with heat flux gages, such that when placed in a dry wind tunnel, they could be used to experimentally map out the convective heat transfer coefficient in the direction of flow from the roughened surfaces. The effects on the heat transfer coefficient for parallel flow, which simulates horizontal flight, were studied. The results of this investigation can be used to help size heaters for wings, helicopter rotor blades, jet engine intakes, etc., or de-icing for anti-icing applications where the flow is parallel to the iced surface.
A Dual-Plane PIV Study of Turbulent Heat Transfer Flows
NASA Technical Reports Server (NTRS)
Wernet, Mark P.; Wroblewski, Adam C.; Locke, Randy J.
2016-01-01
Thin film cooling is a widely used technique in turbomachinery and rocket propulsion applications, where cool injection air protects a surface from hot combustion gases. The injected air typically has a different velocity and temperature from the free stream combustion flow, yielding a flow field with high turbulence and large temperature differences. These thin film cooling flows provide a good test case for evaluating computational model prediction capabilities. The goal of this work is to provide a database of flow field measurements for validating computational flow prediction models applied to turbulent heat transfer flows. In this work we describe the application of a Dual-Plane Particle Image Velocimetry (PIV) technique in a thin film cooling wind tunnel facility where the injection air stream velocity and temperatures are varied in order to provide benchmark turbulent heat transfer flow field measurements. The Dual-Plane PIV data collected include all three components of velocity and all three components of vorticity, spanning the width of the tunnel at multiple axial measurement planes.
Expertise transfer for expert system design
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boose, J.H.
This book is about the Expertise Transfer System-a computer program which interviews experts and helps them build expert systems, i.e. computer programs that use knowledge from experts to make decisions and judgements under conditions of uncertainty. The techniques are useful to anyone who uses decision-making information based on the expertise of others. The methods can also be applied to personal decision-making. The interviewing methodology is borrowed from a branch of psychology called Personal Construct Theory. It is not necessary to use a computer to take advantage of the techniques from Personal Construction Theory; the fundamental procedures used by the Expertisemore » Transfer System can be performed using paper and pencil. It is not necessary that the reader understand very much about computers to understand the ideas in this book. The few relevant concepts from computer science and expert systems that are needed are explained in a straightforward manner. Ideas from Personal Construct Psychology are also introduced as needed.« less
Double-Resonance Facilitated Decomposion of Emission Spectra
NASA Astrophysics Data System (ADS)
Kato, Ryota; Ishikawa, Haruki
2016-06-01
Emission spectra provide us with rich information about the excited-state processes such as proton-transfer, charge-transfer and so on. In the cases that more than one excited states are involved, emission spectra from different excited states sometimes overlap and a decomposition of the overlapped spectra is desired. One of the methods to perform a decomposition is a time-resolved fluorescence technique. It uses a difference in time evolutions of components involved. However, in the gas-phase, a concentration of the sample is frequently too small to carry out this method. On the other hand, double-resonance technique is a very powerful tool to discriminate or identify a common species in the spectra in the gas-phase. Thus, in the present study, we applied the double-resonance technique to resolve the overlapped emission spectra. When transient IR absorption spectra of the excited state are available, we can label the population of the certain species by the IR excitation with a proper selection of the IR wavenumbers. Thus, we can obtain the emission spectra of labeled species by subtracting the emission spectra with IR labeling from that without IR. In the present study, we chose the charge-transfer emission spectra of cyanophenyldisilane (CPDS) as a test system. One of us reported that two charge-transfer (CT) states are involved in the intramolecular charge-transfer (ICT) process of CPDS-water cluster and recorded the transient IR spectra. As expected, we have succeeded in resolving the CT emission spectra of CPDS-water cluster by the double resonance facilitated decomposion technique. In the present paper, we will report the details of the experimental scheme and the results of the decomposition of the emission spectra. H. Ishikawa, et al., Chem. Phys. Phys. Chem., 9, 117 (2007).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiss, L.I.; Bui, R.T.; Charette, A.
The flow structure inside round furnaces with various numbers of burners, burner arrangement, and exit conditions has been studied experimentally with the purpose of improving the flow conditions and the resulting heat transfer. Small-scale transparent models were built according to the laws of geometric and dynamic similarity. Various visualization and experimental techniques were applied. The flow pattern in the near-surface regions was visualized by the fluorescent minituft and popcorn techniques; the flow structure in the bulk was analyzed by smoke injection and laser sheet illumination. For the study of the transient effects, high-speed video photography was applied. The effects ofmore » the various flow patterns, like axisymmetric and rotational flow, on the magnitude and uniformity of the residence time, as well as on the formation of stagnation zones, were discussed. Conclusions were drawn and have since been applied for the improvement of furnace performance.« less
Gravimetric capillary method for kinematic viscosity measurements
NASA Technical Reports Server (NTRS)
Rosenberger, Franz; Iwan, J.; Alexander, D.; Jin, Wei-Qing
1992-01-01
A novel version of the capillary method for viscosity measurements of liquids is presented. Viscosity data can be deduced in a straightforward way from mass transfer data obtained by differential weighing during the gravity-induced flow of the liquid between two cylindrical chambers. Tests of this technique with water, carbon tetrachloride, and ethanol suggest that this arrangement provides an accuracy of about +/- 1 percent. The technique facilitates operation under sealed, isothermal conditions and, thus can readily be applied to reactive and/or high vapor pressure liquids.
[Nuclear transfer and therapeutic cloning].
Xu, Xiao-Ming; Lei, An-Min; Hua, Jin-Lian; Dou, Zhong-Ying
2005-03-01
Nuclear transfer and therapeutic cloning have widespread and attractive prospects in animal agriculture and biomedical applications. We reviewed that the quality of oocytes and nuclear reprogramming of somatic donor cells were the main reasons of the common abnormalities in cloned animals and the low efficiency of cloning and showed the problems and outlets in therapeutic cloning, such as some basic problems in nuclear transfer affected clinical applications of therapeutic cloning. Study on isolation and culture of nuclear transfer embryonic stem (ntES) cells and specific differentiation of ntES cells into important functional cells should be emphasized and could enhance the efficiency. Adult stem cells could help to cure some great diseases, but could not replace therapeutic cloning. Ethics also impeded the development of therapeutic cloning. It is necessary to improve many techniques and reinforce the research of some basic theories, then somatic nuclear transfer and therapeutic cloning may apply to agriculture reproduction and benefit to human life better.
NASA Astrophysics Data System (ADS)
Abbasian Arani, Ali Akbar; Aberoumand, Hossein; Jafarimoghaddam, Amin; Aberoumand, Sadegh
2017-09-01
The heat transfer and flow characteristics of Cu-heat transfer oil nanofluid during mixed convection through horizontal annular tubes under uniform heat flux as boundary condition are investigated experimentally. Data were acquired at low Reynolds number ranged from about 26 to 252. The applied nanofluid prepared by Electrical Explosion of Wire technique with no nanoparticles agglomeration during nanofluid preparation process and experiments. Pure heat transfer oil and nanofluids with nanoparticles weight concentrations of 0.12, 0.36 and 0.72% were used as the working fluids. Based on these results, Effects of nanoparticles concentration, heat flux and free convection on the thermal field development are studied under buoyancy assisted flow condition for Grashof number, Richardson number between 2820 and 12,686, and 0.1-10, respectively. Results show that Nusselt number increases with an increase of nanoparticles weight concentrations from 0 to 0.72% under certain Richardson numbers.
Low-energy transfers to cislunar periodic orbits visiting triangular libration points
NASA Astrophysics Data System (ADS)
Lei, Hanlun; Xu, Bo
2018-01-01
This paper investigates the cislunar periodic orbits that pass through triangular libration points of the Earth-Moon system and studies the techniques on design low-energy transfer trajectories. In order to compute periodic orbits, families of impulsive transfers between triangular libration points are taken to generate the initial guesses of periodic orbits, and multiple shooting techniques are applied to solving the problem. Then, varieties of periodic orbits in cislunar space are obtained, and stability analysis shows that the majority of them are unstable. Among these periodic orbits, an unstable periodic orbit in near 3:2 resonance with the Moon is taken as the nominal orbit of an assumed mission. As the stable manifolds of the target orbit could approach the Moon, low-energy transfer trajectories can be designed by combining lunar gravity assist with the invariant manifold structure of the target orbit. In practice, both the natural and perturbed invariant manifolds are considered to obtain the low-energy transfers, which are further refined to the Sun-perturbed Earth-Moon system. Results indicate that (a) compared to the case of natural invariant manifolds, the optimal transfers using perturbed invariant manifolds could reduce flight time at least 50 days, (b) compared to the cheapest direct transfer, the optimal low-energy transfer obtained by combining lunar gravity assist and invariant manifolds could save on-board fuel consumption more than 200 m/s, and (c) by taking advantage of the gravitational perturbation of the Sun, the low-energy transfers could save more fuel consumption than the corresponding ones obtained in the Earth-Moon system.
Kuipers, Derek A; Wartena, Bard O; Dijkstra, Boudewijn H; Terlouw, Gijs; van T Veer, Job T B; van Dijk, Hylke W; Prins, Jelle T; Pierie, Jean Pierre E N
2016-12-01
Lower back problems are a common cause of sick leave of employees in Dutch care homes and hospitals. In the Netherlands over 40% of reported sick leave is due to back problems, mainly caused by carrying out heavy work. The goal of the iLift project was to develop a game for nursing personnel to train them in lifting and transfer techniques. The main focus was not on testing for the effectiveness of the game itself, but rather on the design of the game as an autogenous trigger and its place in a behavioral change support system. In this article, the design and development of such a health behavior change support system is addressed, describing cycles of design and evaluation. (a) To define the problem space, use context and user context, focus group interviews were conducted with Occupational Therapists (n=4), Nurses (n=10) and Caregivers (n=12) and a thematic analysis was performed. We interviewed experts (n=5) on the subject of lifting and transferring techniques. (b) A design science research approach resulted in a playable prototype. An expert panel conducted analysis of video-recorded playing activities. (c) Field experiment: We performed a dynamic analysis in order to investigate the feasibility of the prototype through biometric data from player sessions (n=620) by healthcare professionals (n=37). (a) Occupational Therapists, Nurses and Caregivers did not recognise a lack of knowledge with training in lifting and transferring techniques. All groups considered their workload, time pressure and a culturally determined habit to place the patient's well being above their own as the main reason not to apply appropriate lifting and transferring techniques. This led to a shift in focus from a serious game teaching lifting and transferring techniques to a health behavior change support system containing a game with the intention to influence behavior. (b) Building and testing (subcomponents of) the prototype resulted in design choices regarding players perspective, auditory and visual feedback, overall playability and perceived immersiveness. This design process also addressed the behavior shaping capacities of the game and its place within the health behavior change support system. An expert panel on lifting and transferring techniques validated the provoked in-game activities as being authentic. (c) Regression analysis showed an increase of the game score and dashboard score when more sessions were played, indicating an in-game training effect. A post-hoc test revealed that from an average of 10 playing sessions or more, the dashboard score and the game score align, which indicates behavioral change towards executing appropriate static lifting and transferring techniques. Data gathered in the final field test shows an in-game training effect, causing players to exhibit correct techniques for static lifting and transferring techniques but also revealed the necessity for future social system development and especially regarding intervention acceptance. Social system factors showed a strong impact on the games persuasive capacities and its autogenous intent. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Kumar, Sunil; Karfa, Paramita; Madhuri, Rashmi; Sharma, Prashant K.
2018-05-01
In this work, we report on a dual-behavior electrochemical/optical sensor for sensitive determination of Imidacloprid by fluorescent dye (fluorescein, FL) and imprinted polymer modified europium doped superparamagnetic iron oxide nanoparticles (FL@SPIONs@MIP). The imidacloprid (IMD)-imprinted polymer was directly synthesized on the Eu-SPIONs surface via Activators regenerated by the electron transfer-atom transfer radical polymerization (ARGET-ATRP) technique. Preparation, characterization and application of the prepared FL@SPIONs@MIP were systematically investigated using scanning electron microscopy (SEM), X-ray diffraction (XRD), vibrating sample magnetometer (VSM), fluorescence spectroscopy and electrochemical techniques. The electrochemical experiments exhibited a remarkable selectivity of the prepared sensor towards IMD. Determination of IMD by the square wave stripping voltammetry method represented a wide linear range of 0.059-0.791 μg L-1 with a detection limit of 0.0125 μg L-1. In addition, the fluorescence method shows a linear range of 0.039-0.942 μg L-1 and LOD of 0.0108 μg L-1. The fluorescence property of prepared FL@SPIONs@MIP was used for rapid, on-spot but selective detection of IMD in real samples. The proposed electrode displayed excellent repeatability and long-term stability and was successfully applied for quantitative and trace level determination of IMD in several real samples.
Highly sensitive SnO2 sensor via reactive laser-induced transfer
Palla Papavlu, Alexandra; Mattle, Thomas; Temmel, Sandra; Lehmann, Ulrike; Hintennach, Andreas; Grisel, Alain; Wokaun, Alexander; Lippert, Thomas
2016-01-01
Gas sensors based on tin oxide (SnO2) and palladium doped SnO2 (Pd:SnO2) active materials are fabricated by a laser printing method, i.e. reactive laser-induced forward transfer (rLIFT). Thin films from tin based metal-complex precursors are prepared by spin coating and then laser transferred with high resolution onto sensor structures. The devices fabricated by rLIFT exhibit low ppm sensitivity towards ethanol and methane as well as good stability with respect to air, moisture, and time. Promising results are obtained by applying rLIFT to transfer metal-complex precursors onto uncoated commercial gas sensors. We could show that rLIFT onto commercial sensors is possible if the sensor structures are reinforced prior to printing. The rLIFT fabricated sensors show up to 4 times higher sensitivities then the commercial sensors (with inkjet printed SnO2). In addition, the selectivity towards CH4 of the Pd:SnO2 sensors is significantly enhanced compared to the pure SnO2 sensors. Our results indicate that the reactive laser transfer technique applied here represents an important technical step for the realization of improved gas detection systems with wide-ranging applications in environmental and health monitoring control. PMID:27118531
Optimizing the use of a skin prick test device on children.
Buyuktiryaki, Betul; Sahiner, Umit Murat; Karabulut, Erdem; Cavkaytar, Ozlem; Tuncer, Ayfer; Sekerel, Bulent Enis
2013-01-01
Studies comparing skin prick test (SPT) devices have revealed varying results in performance and there is little known about their use on children. We performed 2 complementary studies to test the sensitivity, reproducibility and acceptability of commercially available SPT devices (Stallerpoint, Antony, France) using different application techniques. In the first part, histamine/saline was put on as a drop by use of a vial (V), and in the second part it was transferred from a well with the aid of the test device (W). The techniques were as follows: apply vertical pressure (Stallerpoint-VP or Stallerpoint-WP), apply vertical pressure with 90° clockwise rotation (Stallerpoint-VC or Stallerpoint-WC) and apply vertical pressure with 90° clockwise and counter-clockwise rotations (Stallerpoint-VCC or Stallerpoint-WCC). For comparison, ALK Lancet was used with a technique of 'drop and apply vertical pressure'. In the first part, sensitivities of the Stallerpoint-VC (96.6%), Stallerpoint-VCC (95.5%) and ALK Lancet (93.2%) techniques were superior (p < 0.001) to the other Stallerpoint-VP and Stallerpoint-WP techniques (76.1 and 46.6%). Intrapatient coefficient of variation (CV) values were 15.0, 18.9, 15.4, 22.4 and 48.5%, respectively. Interpatient CV ranged between 22.8 and 55.1%. In the second part, the Stallerpoint-WC (98.8%), WCC (97.5%) and ALK Lancet (98.8%) techniques yielded high sensitivities, whereas the sensitivity of Stallerpoint-WP (28.7%) was very low. There were false-positive reactions in the Stallerpoint-VCC and WCC techniques. In children, the SPT technique was found to be as important as the testing device. Stallerpoint-VC and WC techniques are reliable, tolerable and comparable with the ALK Lancet technique. Copyright © 2013 S. Karger AG, Basel.
Ivanov, Sergei D; Grant, Ian M; Marx, Dominik
2015-09-28
With the goal of computing quantum free energy landscapes of reactive (bio)chemical systems in multi-dimensional space, we combine the metadynamics technique for sampling potential energy surfaces with the ab initio path integral approach to treating nuclear quantum motion. This unified method is applied to the double proton transfer process in the formic acid dimer (FAD), in order to study the nuclear quantum effects at finite temperatures without imposing a one-dimensional reaction coordinate or reducing the dimensionality. Importantly, the ab initio path integral metadynamics technique allows one to treat the hydrogen bonds and concomitant proton transfers in FAD strictly independently and thus provides direct access to the much discussed issue of whether the double proton transfer proceeds via a stepwise or concerted mechanism. The quantum free energy landscape we compute for this H-bonded molecular complex reveals that the two protons move in a concerted fashion from initial to product state, yet world-line analysis of the quantum correlations demonstrates that the protons are as quantum-uncorrelated at the transition state as they are when close to the equilibrium structure.
NASA Astrophysics Data System (ADS)
Abdelkhalek, M. M.
2009-05-01
Numerical results are presented for heat and mass transfer effect on hydromagnetic flow of a moving permeable vertical surface. An analysis is performed to study the momentum, heat and mass transfer characteristics of MHD natural convection flow over a moving permeable surface. The surface is maintained at linear temperature and concentration variations. The non-linear coupled boundary layer equations were transformed and the resulting ordinary differential equations were solved by perturbation technique [Aziz A, Na TY. Perturbation methods in heat transfer. Berlin: Springer-Verlag; 1984. p. 1-184; Kennet Cramer R, Shih-I Pai. Magneto fluid dynamics for engineers and applied physicists 1973;166-7]. The solution is found to be dependent on several governing parameter, including the magnetic field strength parameter, Prandtl number, Schmidt number, buoyancy ratio and suction/blowing parameter, a parametric study of all the governing parameters is carried out and representative results are illustrated to reveal a typical tendency of the solutions. Numerical results for the dimensionless velocity profiles, the temperature profiles, the concentration profiles, the local friction coefficient and the local Nusselt number are presented for various combinations of parameters.
van Grinsven, Bart; Eersels, Kasper; Peeters, Marloes; Losada-Pérez, Patricia; Vandenryt, Thijs; Cleij, Thomas J; Wagner, Patrick
2014-08-27
In recent years, biosensors have become increasingly important in various scientific domains including medicine, biology, and pharmacology, resulting in an increased demand for fast and effective readout techniques. In this Spotlight on Applications, we report on the recently developed heat-transfer method (HTM) and illustrate the use of the technique by zooming in on four established bio(mimetic) sensor applications: (i) mutation analysis in DNA sequences, (ii) cancer cell identification through surface-imprinted polymers, (iii) detection of neurotransmitters with molecularly imprinted polymers, and (iv) phase-transition analysis in lipid vesicle layers. The methodology is based on changes in heat-transfer resistance at a functionalized solid-liquid interface. To this extent, the device applies a temperature gradient over this interface and monitors the temperature underneath and above the functionalized chip in time. The heat-transfer resistance can be obtained by dividing this temperature gradient by the power needed to achieve a programmed temperature. The low-cost, fast, label-free and user-friendly nature of the technology in combination with a high degree of specificity, selectivity, and sensitivity makes HTM a promising sensor technology.
Hard Copy to Digital Transfer: 3D Models that Match 2D Maps
ERIC Educational Resources Information Center
Kellie, Andrew C.
2011-01-01
This research describes technical drawing techniques applied in a project involving digitizing of existing hard copy subsurface mapping for the preparation of three dimensional graphic and mathematical models. The intent of this research was to identify work flows that would support the project, ensure the accuracy of the digital data obtained,…
ERIC Educational Resources Information Center
Bastürk, Savas
2017-01-01
Selecting and applying appropriate research techniques, analysing data using information and communication technologies, transferring the obtained results of the analysis into tables and interpreting them are the performance indicators evaluated by the Ministry of National Education under teacher competencies. At the beginning of the courses that…
31 CFR 205.12 - What funding techniques may be used?
Code of Federal Regulations, 2011 CFR
2011-07-01
... that the State pays out each day. The projected amount paid out each day is determined by applying a clearance pattern to the total amount the State will disburse. (3) Average clearance means that a Federal Program Agency, on the dollar-weighted average day of clearance of a disbursement, transfers to a State a...
USDA-ARS?s Scientific Manuscript database
The efficacy of the sterile insect technique (SIT) applied as part of area-wide integrated pest management (AW-IPM) programmes depends on the efficient transfer of sperm carrying dominant lethal mutations from sterile males to wild females. The success or failure of this strategy is therefore critic...
ERIC Educational Resources Information Center
Pratt, Justin M.; Yezierski, Ellen J.
2018-01-01
Conducting qualitative research in any discipline warrants two actions: accessing participants and eliciting their ideas. In chemistry education research (CER), survey techniques have been used to increase access to participants and diversify samples. Interview tasks (such as card sorting, using demonstrations, and using simulations) have been…
NASA Astrophysics Data System (ADS)
Van De Ven, C. J. C.; Mumford, Kevin G.
2018-05-01
The study of gas-water mass transfer in porous media is important in many applications, including unconventional resource extraction, carbon storage, deep geological waste storage, and remediation of contaminated groundwater, all of which rely on an understanding of the fate and transport of free and dissolved gas. The novel visual technique developed in this study provided both quantitative and qualitative observations of gas-water mass transfer. Findings included interaction between free gas architecture and dissolved plume migration, plume geometry and longevity. The technique was applied to the injection of CO2 in source patterns expected for stray gas originating from oil and gas operations to measure dissolved phase concentrations of CO2 at high spatial and temporal resolutions. The data set is the first of its kind to provide high resolution quantification of gas-water dissolution, and will facilitate an improved understanding of the fundamental processes of gas movement and fate in these complex systems.
Lunar flyby transfers between libration point orbits
NASA Astrophysics Data System (ADS)
Qi, Yi; Xu, Shijie; Qi, Rui
2017-06-01
Lunar flyby or lunar gravity assist is a classical technique to change the energy and trajectory of space vehicle in space mission. In this paper, lunar flyby transfers between Sun-Earth/Moon libration point orbits with different energies are investigated in the Sun-Earth-Moon restricted four-body problem. Distinguished by behaviours before and after lunar flyby, classification of lunar flyby orbits is defined and studied. Research indicates that junction point of special regions of four types of lunar flyby orbits denotes the perilune of lunar flyby transfer between libration point orbits. Based on those special perilunes, retrograde and prograde lunar flyby transfers are discussed in detail, respectively. The mean energy level transition distribution is proposed and applied to analyse the influence of phase angle and eccentricity on lunar flyby transfers. The phase space is divided into normal and chaotic intervals based on the topology pattern of transfers. A continuation strategy of lunar flyby transfer in the bicircular model is presented. Numerical examples show that compared with the single-impulse transfers based on patched invariant manifolds, lunar flyby transfers are more energy efficient. Finally, lunar flyby transfers are further extended to the realistic models.
NASA Technical Reports Server (NTRS)
Barnett, Alan R.; Widrick, Timothy W.; Ludwiczak, Damian R.
1995-01-01
Solving for the displacements of free-free coupled systems acted upon by static loads is commonly performed throughout the aerospace industry. Many times, these problems are solved using static analysis with inertia relief. This solution technique allows for a free-free static analysis by balancing the applied loads with inertia loads generated by the applied loads. For some engineering applications, the displacements of the free-free coupled system induce additional static loads. Hence, the applied loads are equal to the original loads plus displacement-dependent loads. Solving for the final displacements of such systems is commonly performed using iterative solution techniques. Unfortunately, these techniques can be time-consuming and labor-intensive. Since the coupled system equations for free-free systems with displacement-dependent loads can be written in closed-form, it is advantageous to solve for the displacements in this manner. Implementing closed-form equations in static analysis with inertia relief is analogous to implementing transfer functions in dynamic analysis. Using a MSC/NASTRAN DMAP Alter, displacement-dependent loads have been included in static analysis with inertia relief. Such an Alter has been used successfully to solve efficiently a common aerospace problem typically solved using an iterative technique.
Yanzhen Wu; Hu, A P; Budgett, D; Malpas, S C; Dissanayake, T
2011-06-01
Transcutaneous energy transfer (TET) enables the transfer of power across the skin without direct electrical connection. It is a mechanism for powering implantable devices for the lifetime of a patient. For maximum power transfer, it is essential that TET systems be resonant on both the primary and secondary sides, which requires considerable design effort. Consequently, a strong need exists for an efficient method to aid the design process. This paper presents an analytical technique appropriate to analyze complex TET systems. The system's steady-state solution in closed form with sufficient accuracy is obtained by employing the proposed equivalent small parameter method. It is shown that power-transfer capability can be correctly predicted without tedious iterative simulations or practical measurements. Furthermore, for TET systems utilizing a current-fed push-pull soft switching resonant converter, it is found that the maximum energy transfer does not occur when the primary and secondary resonant tanks are "tuned" to the nominal resonant frequency. An optimal turning point exists, corresponding to the system's maximum power-transfer capability when optimal tuning capacitors are applied.
Voyager image processing at the Image Processing Laboratory
NASA Astrophysics Data System (ADS)
Jepsen, P. L.; Mosher, J. A.; Yagi, G. M.; Avis, C. C.; Lorre, J. J.; Garneau, G. W.
1980-09-01
This paper discusses new digital processing techniques as applied to the Voyager Imaging Subsystem and devised to explore atmospheric dynamics, spectral variations, and the morphology of Jupiter, Saturn and their satellites. Radiometric and geometric decalibration processes, the modulation transfer function, and processes to determine and remove photometric properties of the atmosphere and surface of Jupiter and its satellites are examined. It is exhibited that selected images can be processed into 'approach at constant longitude' time lapse movies which are useful in observing atmospheric changes of Jupiter. Photographs are included to illustrate various image processing techniques.
Voyager image processing at the Image Processing Laboratory
NASA Technical Reports Server (NTRS)
Jepsen, P. L.; Mosher, J. A.; Yagi, G. M.; Avis, C. C.; Lorre, J. J.; Garneau, G. W.
1980-01-01
This paper discusses new digital processing techniques as applied to the Voyager Imaging Subsystem and devised to explore atmospheric dynamics, spectral variations, and the morphology of Jupiter, Saturn and their satellites. Radiometric and geometric decalibration processes, the modulation transfer function, and processes to determine and remove photometric properties of the atmosphere and surface of Jupiter and its satellites are examined. It is exhibited that selected images can be processed into 'approach at constant longitude' time lapse movies which are useful in observing atmospheric changes of Jupiter. Photographs are included to illustrate various image processing techniques.
NASA Technical Reports Server (NTRS)
Adams, J. R.; Hawley, S. W.; Peterson, G. R.; Salinger, S. S.; Workman, R. A.
1971-01-01
A hardware and software specification covering requirements for the computer enhancement of structural weld radiographs was considered. Three scanning systems were used to digitize more than 15 weld radiographs. The performance of these systems was evaluated by determining modulation transfer functions and noise characteristics. Enhancement techniques were developed and applied to the digitized radiographs. The scanning parameters of spot size and spacing and film density were studied to optimize the information content of the digital representation of the image.
ERIC Educational Resources Information Center
Guegan, Jean-Paul; Daniellou, Richard
2012-01-01
NMR spectroscopy is a powerful tool for characterizing and identifying molecules and nowadays is even used to characterize complex systems in biology. In the experiment presented here, students learned how to apply this modern technique to probe interactions between small molecules and proteins. With the use of simple organic synthesis, students…
Diffraction gratings used as identifying markers
Deason, Vance A.; Ward, Michael B.
1991-01-01
A finely detailed defraction grating is applied to an object as an identifier or tag which is unambiguous, difficult to duplicate, or remove and transfer to another item, and can be read and compared with prior readings with relative ease. The exact pattern of the defraction grating is mapped by diffraction moire techniques and recorded for comparison with future readings of the same grating.
Low Energy Transfer to the Moon
NASA Astrophysics Data System (ADS)
Koon, W. S.; Lo, M. W.; Marsden, J. E.; Ross, S. D.
2001-11-01
New space missions are increasingly more complex; demand for exotic orbits to solve engineering problems has grown beyond the existing astrodynamic infrastructure based on two-body interactions. The delicate heteroclinic dynamics used by the Genesis Mission dramatically illustrate the need for a new paradigm: dynamical system study of three-body problem. Furthermore, this dynamics has much to say about the morphology and transport of materials within the Solar System. The cross-fertilization of ideas between the natural dynamics of the Solar System and applications to engineering has produced new techniques for constructing spacecraft trajectories with interesting characteristics. Specifically, these techniques are used here to produce a lunar capture mission which uses less fuel than a Hohmann transfer. We approximate the Sun-Earth-Moon-Spacecraft four-body problem as two three-body problems. Using the invariant manifold structures of the Lagrange points of the three-body systems, we are able to construct low energy transfer trajectories from the Earth which exhibit ballistic capture at the Moon. The techniques used in the design and construction of this trajectory may be applied in many situations. This is joint work with Martin W. Lo, Jerrold E. Marsden and Shane D. Ross and was partially supported by the National Science Foundation Grant No. KFI/ATM-9873133 under a contract with the Jet Propulsion Laboratory, NASA.
Real-time colouring and filtering with graphics shaders
NASA Astrophysics Data System (ADS)
Vohl, D.; Fluke, C. J.; Barnes, D. G.; Hassan, A. H.
2017-11-01
Despite the popularity of the Graphics Processing Unit (GPU) for general purpose computing, one should not forget about the practicality of the GPU for fast scientific visualization. As astronomers have increasing access to three-dimensional (3D) data from instruments and facilities like integral field units and radio interferometers, visualization techniques such as volume rendering offer means to quickly explore spectral cubes as a whole. As most 3D visualization techniques have been developed in fields of research like medical imaging and fluid dynamics, many transfer functions are not optimal for astronomical data. We demonstrate how transfer functions and graphics shaders can be exploited to provide new astronomy-specific explorative colouring methods. We present 12 shaders, including four novel transfer functions specifically designed to produce intuitive and informative 3D visualizations of spectral cube data. We compare their utility to classic colour mapping. The remaining shaders highlight how common computation like filtering, smoothing and line ratio algorithms can be integrated as part of the graphics pipeline. We discuss how this can be achieved by utilizing the parallelism of modern GPUs along with a shading language, letting astronomers apply these new techniques at interactive frame rates. All shaders investigated in this work are included in the open source software shwirl (Vohl 2017).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ivanov, Sergei D., E-mail: sergei.ivanov@unirostock.de; Grant, Ian M.; Marx, Dominik
With the goal of computing quantum free energy landscapes of reactive (bio)chemical systems in multi-dimensional space, we combine the metadynamics technique for sampling potential energy surfaces with the ab initio path integral approach to treating nuclear quantum motion. This unified method is applied to the double proton transfer process in the formic acid dimer (FAD), in order to study the nuclear quantum effects at finite temperatures without imposing a one-dimensional reaction coordinate or reducing the dimensionality. Importantly, the ab initio path integral metadynamics technique allows one to treat the hydrogen bonds and concomitant proton transfers in FAD strictly independently andmore » thus provides direct access to the much discussed issue of whether the double proton transfer proceeds via a stepwise or concerted mechanism. The quantum free energy landscape we compute for this H-bonded molecular complex reveals that the two protons move in a concerted fashion from initial to product state, yet world-line analysis of the quantum correlations demonstrates that the protons are as quantum-uncorrelated at the transition state as they are when close to the equilibrium structure.« less
NASA Technical Reports Server (NTRS)
Jensen, K. A.; Ripoll, J.-F.; Wray, A. A.; Joseph, D.; ElHafi, M.
2004-01-01
Five computational methods for solution of the radiative transfer equation in an absorbing-emitting and non-scattering gray medium were compared on a 2 m JP-8 pool fire. The temperature and absorption coefficient fields were taken from a synthetic fire due to the lack of a complete set of experimental data for fires of this size. These quantities were generated by a code that has been shown to agree well with the limited quantity of relevant data in the literature. Reference solutions to the governing equation were determined using the Monte Carlo method and a ray tracing scheme with high angular resolution. Solutions using the discrete transfer method, the discrete ordinate method (DOM) with both S(sub 4) and LC(sub 11) quadratures, and moment model using the M(sub 1) closure were compared to the reference solutions in both isotropic and anisotropic regions of the computational domain. DOM LC(sub 11) is shown to be the more accurate than the commonly used S(sub 4) quadrature technique, especially in anisotropic regions of the fire domain. This represents the first study where the M(sub 1) method was applied to a combustion problem occurring in a complex three-dimensional geometry. The M(sub 1) results agree well with other solution techniques, which is encouraging for future applications to similar problems since it is computationally the least expensive solution technique. Moreover, M(sub 1) results are comparable to DOM S(sub 4).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giri, Anupam; Goswami, Nirmal; Lemmens, Peter
2012-08-15
Graphical abstract: Förster resonance energy transfer (FRET) studies on the interaction of water soluble arginine-capped CdSe/ZnS QDs with ethidium bromide (EB) labeled synthetic dodecamer DNA. Highlights: ► We have solubilized CdSe/ZnS QD in water replacing their TOPO ligand by L-arginine. ► We have studied arginine@QD–DNA interaction using FRET technique. ► Arginine@QDs act as energy donor and ethidium bromide-DNA acts as energy acceptor. ► We have applied a kinetic model to understand the kinetics of energy transfer. ► Circular dichroism studies revealed negligible perturbation in the DNA B-form in the arg@QD-DNA complex. -- Abstract: We have exchanged TOPO (trioctylphosphine oxide) ligandmore » of CdSe/ZnS core/shell quantum dots (QDs) with an amino acid L-arginine (Arg) at the toluene/water interface and eventually rendered the QDs from toluene to aqueous phase. We have studied the interaction of the water soluble Arg-capped QDs (energy donor) with ethidium (EB) labeled synthetic dodecamer DNA (energy acceptor) using picoseconds resolved Förster resonance energy transfer (FRET) technique. Furthermore, we have applied a model developed by M. Tachiya to understand the kinetics of energy transfer and the distribution of acceptor (EB-DNA) molecules around the donor QDs. Circular dichroism (CD) studies revealed a negligible perturbation in the native B-form structure of the DNA upon interaction with Arg-capped QDs. The melting and the rehybridization pathways of the DNA attached to the QDs have been monitored by the CD which reveals hydrogen bonding is the associative mechanism for interaction between Arg-capped QDs and DNA.« less
Temperature decline thermography for laminar-turbulent transition detection in aerodynamics
NASA Astrophysics Data System (ADS)
von Hoesslin, Stefan; Stadlbauer, Martin; Gruendmayer, Juergen; Kähler, Christian J.
2017-09-01
Detailed knowledge about laminar-turbulent transition and heat transfer distribution of flows around complex aerodynamic components are crucial to achieve highest efficiencies in modern aerodynamical systems. Several measurement techniques have been developed to determine those parameters either quantitatively or qualitatively. Most of them require extensive instrumentation or give unreliable results as the boundary conditions are often not known with the required precision. This work introduces the simple and robust temperature decline method to qualitatively detect the laminar-turbulent transition and the respective heat transfer coefficients on a surface exposed to an air flow, according to patent application Stadlbauer et al. (Patentnr. WO2014198251 A1, 2014). This method provides results which are less sensitive to control parameters such as the heat conduction into the blade material and temperature inhomogeneities in the flow or blade. This method was applied to measurements with NACA0018 airfoils exposed to the flow of a calibration-free jet at various Reynolds numbers and angles of attack. For data analysis, a post-processing method was developed and qualified to determine a quantity proportional to the heat transfer coefficient into the flow. By plotting this quantity for each pixel of the surface, a qualitative, two-dimensional heat transfer map was obtained. The results clearly depicted the areas of onset and end of transition over the full span of the model and agreed with the expected behavior based on the respective flow condition. To validate the approach, surface hotfilm measurements were conducted simultaneously on the same NACA profile. Both techniques showed excellent agreement. The temperature decline method allows to visualize laminar-turbulent transitions on static or moving parts and can be applied on a very broad range of scales—from tiny airfoils up to large airplane wings.
A transfer matrix approach to vibration localization in mistuned blade assemblies
NASA Technical Reports Server (NTRS)
Ottarson, Gisli; Pierre, Chritophe
1993-01-01
A study of mode localization in mistuned bladed disks is performed using transfer matrices. The transfer matrix approach yields the free response of a general, mono-coupled, perfectly cyclic assembly in closed form. A mistuned structure is represented by random transfer matrices, and the expansion of these matrices in terms of the small mistuning parameter leads to the definition of a measure of sensitivity to mistuning. An approximation of the localization factor, the spatially averaged rate of exponential attenuation per blade-disk sector, is obtained through perturbation techniques in the limits of high and low sensitivity. The methodology is applied to a common model of a bladed disk and the results verified by Monte Carlo simulations. The easily calculated sensitivity measure may prove to be a valuable design tool due to its system-independent quantification of mistuning effects such as mode localization.
Financial time series analysis based on effective phase transfer entropy
NASA Astrophysics Data System (ADS)
Yang, Pengbo; Shang, Pengjian; Lin, Aijing
2017-02-01
Transfer entropy is a powerful technique which is able to quantify the impact of one dynamic system on another system. In this paper, we propose the effective phase transfer entropy method based on the transfer entropy method. We use simulated data to test the performance of this method, and the experimental results confirm that the proposed approach is capable of detecting the information transfer between the systems. We also explore the relationship between effective phase transfer entropy and some variables, such as data size, coupling strength and noise. The effective phase transfer entropy is positively correlated with the data size and the coupling strength. Even in the presence of a large amount of noise, it can detect the information transfer between systems, and it is very robust to noise. Moreover, this measure is indeed able to accurately estimate the information flow between systems compared with phase transfer entropy. In order to reflect the application of this method in practice, we apply this method to financial time series and gain new insight into the interactions between systems. It is demonstrated that the effective phase transfer entropy can be used to detect some economic fluctuations in the financial market. To summarize, the effective phase transfer entropy method is a very efficient tool to estimate the information flow between systems.
Energy flow during Olympic weight lifting.
Garhammer, J
1982-01-01
Data obtained from 16-mm film of world caliber Olympic weight lifters performing at major competitions were analyzed to study energy changes during body segment and barbell movements, energy transfer to the barbell, and energy transfer between segments during the lifting movements contested. Determination of barbell and body segment kinematics and use of rigid-link modeling and energy flow techniques permitted the calculation of segment energy content and energy transfer between segments. Energy generation within and transfer to and from segments were determined at 0.04-s intervals by comparing mechanical energy changes of a segment with energy transfer at the joints, calculated from the scalar product of net joint force with absolute joint velocity, and the product of net joint torque due to muscular activity with absolute segment angular velocity. The results provided a detailed understanding of the magnitude and temporal input of energy from dominant muscle groups during a lift. This information also provided a means of quantifying lifting technique. Comparison of segment energy changes determined by the two methods were satisfactory but could likely be improved by employing more sophisticated data smoothing methods. The procedures used in this study could easily be applied to weight training and rehabilitative exercises to help determine their efficacy in producing desired results or to ergonomic situations where a more detailed understanding of the demands made on the body during lifting tasks would be useful.
Musculoskeletal modelling in dogs: challenges and future perspectives.
Dries, Billy; Jonkers, Ilse; Dingemanse, Walter; Vanwanseele, Benedicte; Vander Sloten, Jos; van Bree, Henri; Gielen, Ingrid
2016-05-18
Musculoskeletal models have proven to be a valuable tool in human orthopaedics research. Recently, veterinary research started taking an interest in the computer modelling approach to understand the forces acting upon the canine musculoskeletal system. While many of the methods employed in human musculoskeletal models can applied to canine musculoskeletal models, not all techniques are applicable. This review summarizes the important parameters necessary for modelling, as well as the techniques employed in human musculoskeletal models and the limitations in transferring techniques to canine modelling research. The major challenges in future canine modelling research are likely to centre around devising alternative techniques for obtaining maximal voluntary contractions, as well as finding scaling factors to adapt a generalized canine musculoskeletal model to represent specific breeds and subjects.
Bailey, Tom A.
1983-01-01
The reliability, reproducibility, and usefulness of three screening methods -- the cellophane transfer, the agar plug transfer, and the agar dilution -- to screen aquatic fungicides were evaluated. Achlya flagellata and Saprolegnia hypogyna were exposed to 1, 10, and 100 mg/L of malachite green to test each method. The cellophane transfer and agar plug transfer techniques had similar reliability and reproducibility in rating fungicidal activity, and were both superior to the agar dilution technique. The agar plug transfer and agar dilution techniques adequately projected in vivo activity of malachite green, but the cellophane transfer technique overestimated its activity. Overall, the agar plug transfer technique most accurately rated the activity of malachite green and was the easiest test to perform. It therefore appears to be the method of choice for testing aquatic fungicides.
Atomic force microscopy of model lipid membranes.
Morandat, Sandrine; Azouzi, Slim; Beauvais, Estelle; Mastouri, Amira; El Kirat, Karim
2013-02-01
Supported lipid bilayers (SLBs) are biomimetic model systems that are now widely used to address the biophysical and biochemical properties of biological membranes. Two main methods are usually employed to form SLBs: the transfer of two successive monolayers by Langmuir-Blodgett or Langmuir-Schaefer techniques, and the fusion of preformed lipid vesicles. The transfer of lipid films on flat solid substrates offers the possibility to apply a wide range of surface analytical techniques that are very sensitive. Among them, atomic force microscopy (AFM) has opened new opportunities for determining the nanoscale organization of SLBs under physiological conditions. In this review, we first focus on the different protocols generally employed to prepare SLBs. Then, we describe AFM studies on the nanoscale lateral organization and mechanical properties of SLBs. Lastly, we survey recent developments in the AFM monitoring of bilayer alteration, remodeling, or digestion, by incubation with exogenous agents such as drugs, proteins, peptides, and nanoparticles.
How do laboratory embryo transfer techniques affect IVF outcomes? A review of current literature.
Sigalos, George; Triantafyllidou, Olga; Vlahos, Nikos
2017-04-01
Over the last few years, many studies have focused on embryo selection methods, whereas little attention has been given to the standardization of the procedure of embryo transfer. In this review, several parameters of the embryo transfer procedure are examined, such as the: (i) culture medium volume and loading technique; (ii) syringe and catheters used for embryo transfer; (iii) viscosity and composition of the embryo transfer medium; (iv) environment of embryo culture; (v) timing of embryo transfer; (vi) and standardization of the embryo transfer techniques. The aim of this manuscript is to review these factors and compare the existing embryo transfer techniques and highlight the need for better embryo transfer standardization.
The transient divided bar method for laboratory measurements of thermal properties
NASA Astrophysics Data System (ADS)
Bording, Thue S.; Nielsen, Søren B.; Balling, Niels
2016-12-01
Accurate information on thermal conductivity and thermal diffusivity of materials is of central importance in relation to geoscience and engineering problems involving the transfer of heat. Several methods, including the classical divided bar technique, are available for laboratory measurements of thermal conductivity, but much fewer for thermal diffusivity. We have generalized the divided bar technique to the transient case in which thermal conductivity, volumetric heat capacity and thereby also thermal diffusivity are measured simultaneously. As the density of samples is easily determined independently, specific heat capacity can also be determined. The finite element formulation provides a flexible forward solution for heat transfer across the bar, and thermal properties are estimated by inverse Monte Carlo modelling. This methodology enables a proper quantification of experimental uncertainties on measured thermal properties and information on their origin. The developed methodology was applied to various materials, including a standard ceramic material and different rock samples, and measuring results were compared with results applying traditional steady-state divided bar and an independent line-source method. All measurements show highly consistent results and with excellent reproducibility and high accuracy. For conductivity the obtained uncertainty is typically 1-3 per cent, and for diffusivity uncertainty may be reduced to about 3-5 per cent. The main uncertainty originates from the presence of thermal contact resistance associated with the internal interfaces in the bar. These are not resolved during inversion and it is imperative that they are minimized. The proposed procedure is simple and may quite easily be implemented to the many steady-state divided bar systems in operation. A thermally controlled bath, as applied here, may not be needed. Simpler systems, such as applying temperature-controlled water directly from a tap, may also be applied.
NASA Technical Reports Server (NTRS)
1996-01-01
Solving for the displacements of free-free coupled systems acted upon by static loads is a common task in the aerospace industry. Often, these problems are solved by static analysis with inertia relief. This technique allows for a free-free static analysis by balancing the applied loads with the inertia loads generated by the applied loads. For some engineering applications, the displacements of the free-free coupled system induce additional static loads. Hence, the applied loads are equal to the original loads plus the displacement-dependent loads. A launch vehicle being acted upon by an aerodynamic loading can have such applied loads. The final displacements of such systems are commonly determined with iterative solution techniques. Unfortunately, these techniques can be time consuming and labor intensive. Because the coupled system equations for free-free systems with displacement-dependent loads can be written in closed form, it is advantageous to solve for the displacements in this manner. Implementing closed-form equations in static analysis with inertia relief is analogous to implementing transfer functions in dynamic analysis. An MSC/NASTRAN (MacNeal-Schwendler Corporation/NASA Structural Analysis) DMAP (Direct Matrix Abstraction Program) Alter was used to include displacement-dependent loads in static analysis with inertia relief. It efficiently solved a common aerospace problem that typically has been solved with an iterative technique.
Johnsson, A Christina E; Kjellberg, Anders; Lagerström, Monica I
2006-05-01
The aim of this study was to investigate if nursing students improved their work technique when assisting a simulated patient from bed to wheelchair after proficiency training, and to investigate whether there was a correlation between the nursing students' work technique and the simulated patients' perceptions of the transfer. 71 students participated in the study, 35 in the intervention group and 36 in the comparison group. The students assisted a simulated patient to move from a bed to a wheelchair. In the intervention group the students made one transfer before and one after training, and in the comparison group they made two transfers before training. Six variables were evaluated: work technique score; nursing students' ratings of comfort, work technique and exertion, and the simulated patients' perceptions of comfort and safety during the transfer. The result showed that nursing students improved their work technique, and that there was a correlation between the work technique and the simulated patients' subjective ratings of the transfer. In conclusion, nursing students improved their work technique after training in patient transfer methods, and the work technique affected the simulated patients' perceptions of the transfer.
Locally optimal transfer trajectories between libration point orbits using invariant manifolds
NASA Astrophysics Data System (ADS)
Davis, Kathryn E.
2009-12-01
Techniques from dynamical systems theory and primer vector theory have been applied to the construction of locally optimal transfer trajectories between libration point orbits. When two libration point orbits have different energies, it has been found that the unstable manifold of the first orbit can be connected to the stable manifold of the second orbit with a bridging trajectory. A bounding sphere centered on the secondary, with a radius less than the radius of the sphere of influence of the secondary, was used to study the stable and unstable manifold trajectories. It was numerically demonstrated that within the bounding sphere, the two-body parameters of the unstable and stable manifold trajectories could be analyzed to locate low transfer costs. It was shown that as the two-body parameters of an unstable manifold trajectory more closely matched the two-body parameters of a stable manifold trajectory, the total DeltaV necessary to complete the transfer decreased. Primer vector theory was successfully applied to a transfer to determine the optimal maneuvers required to create the bridging trajectory that connected the unstable manifold of the first orbit to the stable manifold of the second orbit. Transfer trajectories were constructed between halo orbits in the Sun-Earth and Earth-Moon three-body systems. Multiple solutions were found between the same initial and final orbits, where certain solutions retraced interior portions of the trajectory. All of the trajectories created satisfied the conditions for optimality. The costs of transfers constructed using invariant manifolds were compared to the costs of transfers constructed without the use of invariant manifolds, when data was available. In all cases, the total cost of the transfers were significantly lower when invariant manifolds were used in the transfer construction. In many cases, the transfers that employed invariant manifolds were three to four times more efficient, in terms of fuel expenditure, than the transfer that did not. The decrease in transfer cost was accompanied by an increase in transfer time of flight. Transfers constructed in the Earth-Moon system were shown to be particularly viable for lunar navigation and communication constellations, as excellent coverage of the lunar surface can be achieved during the transfer.
NASA Technical Reports Server (NTRS)
Davies, C. B.; Park, C.
1983-01-01
A method was developed to generate the surface coordinates of body shapes suitable for aeroassisted, orbital-transfer vehicles (AOTVs) by extending bent biconic geometries. Lift, drag, and longitudinal moments were calculated for the bodies using Newtonian flow theory. These techniques were applied to symmetric and asymmetric aerobraking vehicles, and to an aeromaneuvering vehicle with high L/D. Results for aerobraking applications indicate that a 70 deg, fore half cone angle with a spherically blunted nose, rounded edges, and a slight asymmetry would be appropriate. Moreover, results show that an aeromaneuvering vehicle with L/D 2.0, and with sufficient stability, is feasible.
Examination of charge transfer in Au/YSZ for high-temperature optical gas sensing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baltrus, John P.; Ohodnicki, Paul R.
2014-01-01
Au-nanoparticle incorporated oxide thin film materials demonstrate significant promise as functionalsensor materials for high temperature optical gas sensing in severe environments relevant for fossil andnuclear based power generation. The Au/yttria-stabilized zirconia (YSZ) system has been extensivelystudied in the literature and serves as a model system for fundamental investigations that seek to betterunderstand the mechanistic origin of the plasmonic gas sensing response. In this work, X-ray photoelec-tron spectroscopy techniques are applied to Au/YSZ films in an attempt to provide further experimentalevidence for a proposed sensing mechanism involving a change in free carrier density of Au nanoparticles due to charge transfer.
Sou, In Mei; Layman, Christopher N.; Ray, Chittaranjan
2013-01-01
Subsurface coherent structures and surface temperatures are investigated using simultaneous measurements of particle image velocimetry (PIV) and infrared (IR) thermography. Results for coherent structures from acoustic streaming and associated heating transfer in a rectangular tank with an acoustic horn mounted horizontally at the sidewall are presented. An observed vortex pair develops and propagates in the direction along the centerline of the horn. From the PIV velocity field data, distinct kinematic regions are found with the Lagrangian coherent structure (LCS) method. The implications of this analysis with respect to heat transfer and related sonochemical applications are discussed. PMID:24347810
Anticoagulative strategies in reconstructive surgery – clinical significance and applicability
Jokuszies, Andreas; Herold, Christian; Niederbichler, Andreas D.; Vogt, Peter M.
2012-01-01
Advanced strategies in reconstructive microsurgery and especially free tissue transfer with advanced microvascular techniques have been routinely applied and continously refined for more than three decades in day-to-day clinical work. Bearing in mind the success rates of more than 95%, the value of these techniques in patient care and comfort (one-step reconstruction of even the most complex tissue defects) cannot be underestimated. However, anticoagulative protocols and practices are far from general acceptance and – most importantly – lack the benchmark of evidence basis while the reconstructive and microsurgical methods are mostly standardized. Therefore, the aim of our work was to review the actual literature and synoptically lay out the mechanisms of action of the plethora of anticoagulative substances. The pharmacologic prevention and the surgical intervention of thrombembolic events represent an established and essential part of microsurgery. The high success rates of microvascular free tissue transfer as of today are due to treatment of patients in reconstructive centers where proper patient selection, excellent microsurgical technique, tissue transfer to adequate recipient vessels, and early anastomotic revision in case of thrombosis is provided. Whether the choice of antithrombotic agents is a factor of success remains still unclear. Undoubtedly however the lack of microsurgical experience and bad technique can never be compensated by any regimen of antithrombotic therapy. All the more, the development of consistent standards and algorithms in reconstructive microsurgery is absolutely essential to optimize clinical outcomes and increase multicentric and international comparability of postoperative results and complications. PMID:22294976
Pinto, David; Coradin, Thibaud; Laberty-Robert, Christel
2018-04-01
In microbial fuel cells, electricity generation is assumed by bacterial degradation of low-grade organics generating electrons that are transferred to an electrode. The nature and efficiency of the electron transfer from the bacteria to the electrodes are determined by several chemical, physical and biological parameters. Specifically, the application of a specific potential at the bioanode has been shown to stimulate the formation of an electro-active biofilm, but the underlying mechanisms remain poorly understood. In this study, we have investigated the effect of an applied potential on the formation and electroactivity of biofilms established by Shewanella oneidensis bacteria on graphite felt electrodes in single- and double-chamber reactor configurations in oxic conditions. Using amperometry, cyclic voltammetry, and OCP/Power/Polarization curves techniques, we showed that a potential ranging between -0.3V and +0.5V (vs. Ag/AgCl/KCl sat.) and its converse application to a couple of electrodes leads to different electrochemical behaviors, anodic currents and biofilm architectures. For example, when the bacteria were confined in the anodic compartment of a double-chamber cell, a negative applied potential (-0.3V) at the bioanode favors a mediated electron transfer correlated with the progressive formation of a biofilm that fills the felt porosity and bridges the graphite fibers. In contrast, a positive applied potential (+0.3V) at the bioanode stimulates a direct electron transfer resulting in the fast-bacterial colonization of the fibers only. These results provide significant insight for the understanding of the complex bacteria-electrode interactions in microbial fuel cells. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Hussain, Sajid; Aziz, Asim; Khalique, Chaudhry Masood; Aziz, Taha
2017-12-01
In this paper, a numerical investigation is carried out to study the effect of temperature dependent viscosity and thermal conductivity on heat transfer and slip flow of electrically conducting non-Newtonian nanofluids. The power-law model is considered for water based nanofluids and a magnetic field is applied in the transverse direction to the flow. The governing partial differential equations(PDEs) along with the slip boundary conditions are transformed into ordinary differential equations(ODEs) using a similarity technique. The resulting ODEs are numerically solved by using fourth order Runge-Kutta and shooting methods. Numerical computations for the velocity and temperature profiles, the skin friction coefficient and the Nusselt number are presented in the form of graphs and tables. The velocity gradient at the boundary is highest for pseudoplastic fluids followed by Newtonian and then dilatant fluids. Increasing the viscosity of the nanofluid and the volume of nanoparticles reduces the rate of heat transfer and enhances the thickness of the momentum boundary layer. The increase in strength of the applied transverse magnetic field and suction velocity increases fluid motion and decreases the temperature distribution within the boundary layer. Increase in the slip velocity enhances the rate of heat transfer whereas thermal slip reduces the rate of heat transfer.
Identification of human operator performance models utilizing time series analysis
NASA Technical Reports Server (NTRS)
Holden, F. M.; Shinners, S. M.
1973-01-01
The results of an effort performed by Sperry Systems Management Division for AMRL in applying time series analysis as a tool for modeling the human operator are presented. This technique is utilized for determining the variation of the human transfer function under various levels of stress. The human operator's model is determined based on actual input and output data from a tracking experiment.
Diffraction gratings used as identifying markers
Deason, V.A.; Ward, M.B.
1991-03-26
A finely detailed diffraction grating is applied to an object as an identifier or tag which is unambiguous, difficult to duplicate, or remove and transfer to another item, and can be read and compared with prior readings with relative ease. The exact pattern of the diffraction grating is mapped by diffraction moire techniques and recorded for comparison with future readings of the same grating. 7 figures.
Acoustic Liquid Manipulation Used to Enhance Electrochemical Processes
NASA Technical Reports Server (NTRS)
Oeftering, Richard C.
2005-01-01
Working in concert with the NASA Technology Transfer and Partnership Office, the Great Lakes Industrial Technology Center, and Alchemitron Corporation of Elgin, Illinois, the NASA Glenn Research Center has applied nonlinear acoustic principles to industrial applications. High-intensity ultrasonic beam techniques employ the effects of acoustic radiation pressure and acoustic streaming to manipulate the behavior of liquids. This includes propelling liquids, moving bubbles, and ejecting liquids as droplets and fountains. Since these effects can be accomplished without mechanical pumps or moving parts, we are exploring how these techniques could be used to manipulate liquids in space applications. Some of these acoustic techniques could be used both in normal Earth gravity and in the microgravity of space.
Ministerial Directive No. 1072, June 1985.
1988-01-01
This Directive contains nonmandatory guidelines and recommendations for in vitro fertilization and embryo transfer in Chile. The Guidelines are based on the assumption that the constitutional guarantee of the right of the child to be born includes the right to procreate. They set forth the medical reasons for the use of these assisted reproduction techniques, procedures to be followed by institutions applying these techniques, technical facilities, qualifications of medical staff, and the manner in which records are kept. They recommend the mandatory appointment of an Ethics Committee and the obligation to advise couples using these techniques. They also recommend the requirement that all normal and fertilized ovules be returned to the mother and not stored or used for research. full text
Hogaboom, Nathan S; Worobey, Lynn A; Boninger, Michael L
2016-10-01
To evaluate how transfer technique and subject characteristics relate to ultrasound measures of shoulder soft tissue pathology and self-reported shoulder pain during transfers in a sample of wheelchair users with spinal cord injury (SCI). Cross-sectional observational study. Research laboratory, national and local veterans' wheelchair sporting events. A convenience sample of wheelchair users (N=76) with nonprogressive SCI. Participants were aged >18 years, >1 year postinjury, and could complete repeated independent wheelchair transfers without the use of their leg muscles. Not applicable. Transfer pain items from the Wheelchair User's Shoulder Pain Index; transfer technique assessed using the Transfer Assessment Instrument (TAI); and shoulder pathology markers examined using the Ultrasound Shoulder Pathology Rating Scale (USPRS). Better transfer technique (higher TAI) correlated with less injury (lower USPRS) (partial η(2)=.062, P<.05) and less pain during transfers (partial η(2)=.049, P<.10). Greater age was the strongest predictor of greater pathology (USPRS total: partial η(2)=.225, supraspinatus grade: partial η(2)=.174, P<.01). An interaction between technique and weight was found (P<.10): participants with lower body weights showed a decrease in pathology markers with better transfer technique (low weight: R(2)=.422, P<.05; middle weight: R(2)=.200, P<.01), while those with higher weight showed little change with technique (R(2)=.018, P>.05). Participants with better transfer technique exhibited less shoulder pathology and reported less pain during transfers. The relationship between technique and pathology was strongest in lower-weight participants. While causation cannot be proven because of study design, it is possible that using a better transfer technique and optimizing body weight could reduce the incidence of shoulder pathology and pain. Copyright © 2016 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Non-invasive imaging of barriers to drug delivery in tumors.
Hassid, Yaron; Eyal, Erez; Margalit, Raanan; Furman-Haran, Edna; Degani, Hadassa
2008-08-01
Solid tumors often develop high interstitial fluid pressure (IFP) as a result of increased water leakage and impaired lymphatic drainage, as well as changes in the extracellular matrix composition and elasticity. This high fluid pressure forms a barrier to drug delivery and hence, resistance to therapy. We have developed techniques based on contrast enhanced magnetic resonance imaging for mapping in tumors the vascular and transport parameters determining the delivery efficiency of blood borne substances. Sequential images are recorded during continuous infusion of a Gd-based contrast agent and analyzed according to a new physiological model, yielding maps of microvascular transfer constants, as well as outward convective interstitial transfer constants and steady state interstitial contrast agent concentrations both reflecting IFP distribution. We further demonstrated in non small cell human lung cancer xenografts the capability of our techniques to monitor in vivo collagenase induced increase in contrast agent delivery as a result of decreased IFP. These techniques can be applied to test drugs that affect angiogenesis and modulate interstitial fluid pressure and has the potential to be extended to cancer patients for assessing resistance to drug delivery.
Non-Invasive Imaging of Barriers to Drug Delivery in Tumors
Hassid, Yaron; Eyal, Erez; Margalit, Raanan; Furman-Haran, Edna; Degani, Hadassa
2011-01-01
Solid tumors often develop high interstitial fluid pressure (IFP) as a result of increased water leakage and impaired lymphatic drainage, as well as changes in the extracellular matrix composition and elasticity. This high fluid pressure forms a barrier to drug delivery and hence, resistance to therapy. We have developed techniques based on contrast enhanced magnetic resonance imaging for mapping in tumors the vascular and transport parameters determining the delivery efficiency of blood borne substances. Sequential images are recorded during continuous infusion of a Gd-based contrast agent and analyzed according to a new physiological model, yielding maps of microvascular transfer constants, as well as outward convective interstitial transfer constants and steady state interstitial contrast agent concentrations both reflecting IFP distribution. We further demonstrated in non small cell human lung cancer xenografts the capability of our techniques to monitor in vivo collagenase induced increase in contrast agent delivery as a result of decreased IFP. These techniques can be applied to test drugs that affect angiogenesis and modulate interstitial fluid pressure and has the potential to be extended to cancer patients for assessing resistance to drug delivery. PMID:18638494
Lightning induced currents in aircraft wiring using low level injection techniques
NASA Technical Reports Server (NTRS)
Stevens, E. G.; Jordan, D. T.
1991-01-01
Various techniques were studied to predict the transient current induced into aircraft wiring bundles as a result of an aircraft lightning strike. A series of aircraft measurements were carried out together with a theoretical analysis using computer modeling. These tests were applied to various aircraft and also to specially constructed cylinders installed within coaxial return conductor systems. Low level swept frequency CW (carrier waves), low level transient and high level transient injection tests were applied to the aircraft and cylinders. Measurements were made to determine the transfer function between the aircraft drive current and the resulting skin currents and currents induced on the internal wiring. The full threat lightning induced transient currents were extrapolated from the low level data using Fourier transform techniques. The aircraft and cylinders used were constructed from both metallic and CFC (carbon fiber composite) materials. The results show the pulse stretching phenomenon which occurs for CFC materials due to the diffusion of the lightning current through carbon fiber materials. Transmission Line Matrix modeling techniques were used to compare theoretical and measured currents.
The continuous assembly and transfer of nanoelements
NASA Astrophysics Data System (ADS)
Kumar, Arun
Patterned nanoelements on flexible polymeric substrates at micro/nano scale at high rate, low cost, and commercially viable route offer an opportunity for manufacturing devices with micro/nano scale features. These micro/nano scale now made with various nanoelement can enhance the device functionality in sensing and switching due to their improved conductivity and better mechanical properties. In this research the fundamental understanding of high rate assembly and transfer of nanoelements has been developed. To achieve this objective, three sub topics were made. In the first step, the use of electrophoresis for the controlled assembly of CNT's on interdigitated templates has been shown. The time scale of assembly reported is shorter than the previously reported assembly time (60 seconds). The mass deposited was also predicted using the Hamaker's law. It is also shown that pre-patterned CNT's could be transferred from the rigid templates onto flexible polymeric substrates using a thermoforming process. The time scale of transfer is less than one minute (50 seconds) and was found to be dependent on polymer chemistry. It was found that CNT's preferentially transfer from Au electrode to non-polar polymeric substrates (polyurethane and polyethylene terephalathate glycol) in the thermoforming process. In the second step, a novel process (Pulsed Electrophoresis) has been shown for the first time to assist the assembly of conducting polyaniline on gold nanowire interdigitated templates. This technique offers dynamic control over heat build-up, which has been a main drawback in the DC electrophoresis and AC dielectrophoresis as well as the main cause of nanowire template damage. The use of this technique allowed higher voltages to be applied, resulting in shorter assembly times (e.g., 17.4 seconds, assembly resolution of 100 nm). The pre-patterned templates with PANi deposition were subsequently used to transfer the nanoscale assembled PANi from the rigid templates to thermoplastic polyurethane using the thermoforming process. In the third step, a novel integration of high rate pulsed electrophoretic assembly with thermally assisted transfer in a roll-to-roll process has been shown. This technique allowed the whole assembly and transfer process to take place in only 30 seconds. Further, a processing window is developed to control the percent area coverage of PANi with the aid of the belt speed. Also shown is the effect of different types of polymer on the quality of transfer, and it concluded that the transfer is affected by the polymer chemistry.
Effects of False Tilt Cues on the Training of Manual Roll Control Skills
NASA Technical Reports Server (NTRS)
Zaal, Peter M. T.; Popovici, Alexandru; Zavala, Melinda A.
2015-01-01
This paper describes a transfer-of-training study performed in the NASA Ames Vertica lMotion Simulator. The purpose of the study was to investigate the effect of false tilt cues on training and transfer of training of manual roll control skills. Of specific interest were the skills needed to control unstable roll dynamics of a mid-size transport aircraft close to the stall point. Nineteen general aviation pilots trained on a roll control task with one of three motion conditions: no motion, roll motion only, or reduced coordinated roll motion. All pilots transferred to full coordinated roll motion in the transfer session. A novel multimodal pilot model identification technique was successfully applied to characterize how pilots' use of visual and motion cues changed over the course of training and after transfer. Pilots who trained with uncoordinated roll motion had significantly higher performance during training and after transfer, even though they experienced the false tilt cues. Furthermore, pilot control behavior significantly changed during the two sessions, as indicated by increasing visual and motion gains, and decreasing lead time constants. Pilots training without motion showed higher learning rates after transfer to the full coordinated roll motion case.
Zinser, Max J; Sailer, Hermann F; Ritter, Lutz; Braumann, Bert; Maegele, Marc; Zöller, Joachim E
2013-12-01
Advances in computers and imaging have permitted the adoption of 3-dimensional (3D) virtual planning protocols in orthognathic surgery, which may allow a paradigm shift when the virtual planning can be transferred properly. The purpose of this investigation was to compare the versatility and precision of innovative computer-aided designed and computer-aided manufactured (CAD/CAM) surgical splints, intraoperative navigation, and "classic" intermaxillary occlusal splints for surgical transfer of virtual orthognathic planning. The protocols consisted of maxillofacial imaging, diagnosis, virtual orthognathic planning, and surgical planning transfer using newly designed CAD/CAM splints (approach A), navigation (approach B), and intermaxillary occlusal splints (approach C). In this prospective observational study, all patients underwent bimaxillary osteotomy. Eight patients were treated using approach A, 10 using approach B, and 12 using approach C. These techniques were evaluated by applying 13 hard and 7 soft tissue parameters to compare the virtual orthognathic planning (T0) with the postoperative result (T1) using 3D cephalometry and image fusion (ΔT1 vs T0). The highest precision (ΔT1 vs T0) for the maxillary planning transfer was observed with CAD/CAM splints (<0.23 mm; P > .05) followed by surgical "waferless" navigation (<0.61 mm, P < .05) and classic intermaxillary occlusal splints (<1.1 mm; P < .05). Only the innovative CAD/CAM splints kept the condyles in their central position in the temporomandibular joint. However, no technique enables a precise prediction of the mandible and soft tissue. CAD/CAM splints and surgical navigation provide a reliable, innovative, and precise approach for the transfer of virtual orthognathic planning. These computer-assisted techniques may offer an alternate approach to the use of classic intermaxillary occlusal splints. Copyright © 2013 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.
High-speed reference-beam-angle control technique for holographic memory drive
NASA Astrophysics Data System (ADS)
Yamada, Ken-ichiro; Ogata, Takeshi; Hosaka, Makoto; Fujita, Koji; Okuyama, Atsushi
2016-09-01
We developed a holographic memory drive for next-generation optical memory. In this study, we present the key technology for achieving a high-speed transfer rate for reproduction, that is, a high-speed control technique for the reference beam angle. In reproduction in a holographic memory drive, there is the issue that the optimum reference beam angle during reproduction varies owing to distortion of the medium. The distortion is caused by, for example, temperature variation, beam irradiation, and moisture absorption. Therefore, a reference-beam-angle control technique to position the reference beam at the optimum angle is crucial. We developed a new optical system that generates an angle-error-signal to detect the optimum reference beam angle. To achieve the high-speed control technique using the new optical system, we developed a new control technique called adaptive final-state control (AFSC) that adds a second control input to the first one derived from conventional final-state control (FSC) at the time of angle-error-signal detection. We established an actual experimental system employing AFSC to achieve moving control between each page (Page Seek) within 300 µs. In sequential multiple Page Seeks, we were able to realize positioning to the optimum angles of the reference beam that maximize the diffracted beam intensity. We expect that applying the new control technique to the holographic memory drive will enable a giga-bit/s-class transfer rate.
Fire retardancy using applied materials
NASA Technical Reports Server (NTRS)
Feldman, R.
1971-01-01
An example of advanced technology transfer from the Little Joe, Surveyor, Comsat, re-entry and Apollo age to everyday fire protection needs is presented. Utilizing the principle of sublimation cooling for thermostatic temperature control, the material meets a wide range of fire retardancy and heat transmission control requirements. Properties vary from flexible tape for conduits and electrical cables to rigid coatings for column protection, with a broad spectrum of sublimation temperatures available. The material can be applied in the field or in the factory, utilizing mass production techniques, yielding a product that is reliable, effective, widely available and low in cost.
Probing transmembrane mechanical coupling and cytomechanics using magnetic twisting cytometry
NASA Technical Reports Server (NTRS)
Wang, N.; Ingber, D. E.
1995-01-01
We recently developed a magnetic twisting cytometry technique that allows us to apply controlled mechanical stresses to specific cell surface receptors using ligand-coated ferromagnetic microbeads and to simultaneously measure the mechanical response in living cells. Using this technique, we have previously shown the following: (i) beta 1 integrin receptors mediate mechanical force transfer across the cell surface and to the cytoskeleton, whereas other transmembrane receptors (e.g., scavenger receptors) do not; (ii) cytoskeletal stiffness increases in direct proportion to the level of stress applied to integrins; and (iii) the slope of this linear stiffening response differs depending on the shape of the cell. We now show that different integrins (beta 1, alpha V beta 3, alpha V, alpha 5, alpha 2) and other transmembrane receptors (scavenger receptor, platelet endothelial cell adhesion molecule) differ in their ability to mediate force transfer across the cell surface. In addition, the linear stiffening behavior previously observed in endothelial cells was found to be shared by other cell types. Finally, we demonstrate that dynamic changes in cell shape that occur during both cell spreading and retraction are accompanied by coordinate changes in cytoskeletal stiffness. Taken together, these results suggest that the magnetic twisting cytometry technique may be a powerful and versatile tool for studies analyzing the molecular basis of transmembrane mechanical coupling to the cytoskeleton as well as dynamic relations between changes in cytoskeletal structure and alterations in cell form and function.
NASA Technical Reports Server (NTRS)
Merrill, W. C.
1978-01-01
The Routh approximation technique for reducing the complexity of system models was applied in the frequency domain to a 16th order, state variable model of the F100 engine and to a 43d order, transfer function model of a launch vehicle boost pump pressure regulator. The results motivate extending the frequency domain formulation of the Routh method to the time domain in order to handle the state variable formulation directly. The time domain formulation was derived and a characterization that specifies all possible Routh similarity transformations was given. The characterization was computed by solving two eigenvalue-eigenvector problems. The application of the time domain Routh technique to the state variable engine model is described, and some results are given. Additional computational problems are discussed, including an optimization procedure that can improve the approximation accuracy by taking advantage of the transformation characterization.
An overview of remote sensing technology transfer in Canada and the United States
NASA Technical Reports Server (NTRS)
Strome, W. M.; Lauer, D. T.
1977-01-01
To realize the maximum potential benefits of remote sensing, the technology must be applied by personnel responsible for the management of natural resources and the environment. In Canada and the United States, these managers are often in local offices and are not those responsible for the development of systems to acquire, preprocess, and disseminate remotely sensed data, nor those leading the research and development of techniques for analysis of the data. However, the latter organizations have recognized that the technology they develop must be transferred to the management agencies if the technology is to be useful to society. Problems of motivation and communication associated with the technology transfer process, and some of the methods employed by Federal, State, Provincial, and local agencies, academic institutions, and private organizations to overcome these problems are explored.
Influence of current velocity and wind speed on air-water gas exchange in a mangrove estuary
NASA Astrophysics Data System (ADS)
Ho, David T.; Coffineau, Nathalie; Hickman, Benjamin; Chow, Nicholas; Koffman, Tobias; Schlosser, Peter
2016-04-01
Knowledge of air-water gas transfer velocities and water residence times is necessary to study the fate of mangrove derived carbon exported into surrounding estuaries and ultimately to determine carbon balances in mangrove ecosystems. For the first time, the 3He/SF6 dual tracer technique, which has been proven to be a powerful tool to determine gas transfer velocities in the ocean, is applied to Shark River, an estuary situated in the largest contiguous mangrove forest in North America. The mean gas transfer velocity was 3.3 ± 0.2 cm h-1 during the experiment, with a water residence time of 16.5 ± 2.0 days. We propose a gas exchange parameterization that takes into account the major sources of turbulence in the estuary (i.e., bottom generated shear and wind stress).
NASA Technical Reports Server (NTRS)
Mishchenko, Michael I.; Dlugach, Janna M.; Yanovitsku, Edgard G.; Zakharova, Nadia T.
1999-01-01
We describe a simple and highly efficient and accurate radiative transfer technique for computing bidirectional reflectance of a macroscopically flat scattering layer composed of nonabsorbing or weakly absorbing, arbitrarily shaped, randomly oriented and randomly distributed particles. The layer is assumed to be homogeneous and optically semi-infinite, and the bidirectional reflection function (BRF) is found by a simple iterative solution of the Ambartsumian's nonlinear integral equation. As an exact Solution of the radiative transfer equation, the reflection function thus obtained fully obeys the fundamental physical laws of energy conservation and reciprocity. Since this technique bypasses the computation of the internal radiation field, it is by far the fastest numerical approach available and can be used as an ideal input for Monte Carlo procedures calculating BRFs of scattering layers with macroscopically rough surfaces. Although the effects of packing density and coherent backscattering are currently neglected, they can also be incorporated. The FORTRAN implementation of the technique is available on the World Wide Web at http://ww,,v.giss.nasa.gov/-crmim/brf.html and can be applied to a wide range of remote sensing, engineering, and biophysical problems. We also examine the potential effect of ice crystal shape on the bidirectional reflectance of flat snow surfaces and the applicability of the Henyey-Greenstein phase function and the 6-Eddington approximation in calculations for soil surfaces.
Full-Physics Inverse Learning Machine for Satellite Remote Sensing Retrievals
NASA Astrophysics Data System (ADS)
Loyola, D. G.
2017-12-01
The satellite remote sensing retrievals are usually ill-posed inverse problems that are typically solved by finding a state vector that minimizes the residual between simulated data and real measurements. The classical inversion methods are very time-consuming as they require iterative calls to complex radiative-transfer forward models to simulate radiances and Jacobians, and subsequent inversion of relatively large matrices. In this work we present a novel and extremely fast algorithm for solving inverse problems called full-physics inverse learning machine (FP-ILM). The FP-ILM algorithm consists of a training phase in which machine learning techniques are used to derive an inversion operator based on synthetic data generated using a radiative transfer model (which expresses the "full-physics" component) and the smart sampling technique, and an operational phase in which the inversion operator is applied to real measurements. FP-ILM has been successfully applied to the retrieval of the SO2 plume height during volcanic eruptions and to the retrieval of ozone profile shapes from UV/VIS satellite sensors. Furthermore, FP-ILM will be used for the near-real-time processing of the upcoming generation of European Sentinel sensors with their unprecedented spectral and spatial resolution and associated large increases in the amount of data.
NASA Astrophysics Data System (ADS)
El-Wakil, S. A.; Sallah, M.; El-Hanbaly, A. M.
2015-10-01
The stochastic radiative transfer problem is studied in a participating planar finite continuously fluctuating medium. The problem is considered for specular- and diffusly-reflecting boundaries with linear anisotropic scattering. Random variable transformation (RVT) technique is used to get the complete average for the solution functions, that are represented by the probability-density function (PDF) of the solution process. In the RVT algorithm, a simple integral transformation to the input stochastic process (the extinction function of the medium) is applied. This linear transformation enables us to rewrite the stochastic transport equations in terms of the optical random variable (x) and the optical random thickness (L). Then the transport equation is solved deterministically to get a closed form for the solution as a function of x and L. So, the solution is used to obtain the PDF of the solution functions applying the RVT technique among the input random variable (L) and the output process (the solution functions). The obtained averages of the solution functions are used to get the complete analytical averages for some interesting physical quantities, namely, reflectivity and transmissivity at the medium boundaries. In terms of the average reflectivity and transmissivity, the average of the partial heat fluxes for the generalized problem with internal source of radiation are obtained and represented graphically.
Diercks, Michael
2017-07-31
A considerable gap exists between clinical psychoanalytic concepts and psychoanalytic practice. It can be traced back to the early beginnings of psychoanalysis and to Freud's own handling of concepts that he had developed himself. Focusing on the concept of 'transference' that Freud in several steps coined so precisely from his experiences with hysteric patients and especially from his understanding of the 'Dora' case, it can be shown that he - seen from today - could not fully apply the meaning of his own concept in the later treatment of the so-called 'Rat Man'. Freud's 'Original record of the case' is used to scrutinize his way of understanding and handling the transference with this patient. To a substantial extent transference as well as counter-transference was rather enacted than understood in this case, partly due to Freud's own personal and scientific interests and to his ambitions to use this case as a demonstration of his therapeutic approach. In order to show this, it is unavoidable to correct several blurry or even misleading passages of Strachey's translation. Findings from numerous workshops using 'comparative clinical methods' indicate that up till now we analysts - like Freud - have great difficulties in applying Freud's incredible insight that "a whole series of former psychic experiences comes alive not as the past but as the present relationship to the person of the physician" (Freud, 1905c [1901], p. 279/280, my translation). Copyright © 2017 Institute of Psychoanalysis.
NASA Astrophysics Data System (ADS)
Kováts, Péter; Thévenin, Dominique; Zähringer, Katharina
2018-02-01
Bubble column reactors are multiphase reactors that are used in many process engineering applications. In these reactors a gas phase comes into contact with a fluid phase to initiate or support reactions. The transport process from the gas to the liquid phase is often the limiting factor. Characterizing this process is therefore essential for the optimization of multiphase reactors. For a better understanding of the transfer mechanisms and subsequent chemical reactions, a laboratory-scale bubble column reactor was investigated. First, to characterize the flow field in the reactor, two different methods have been applied. The shadowgraphy technique is used for the characterisation of the bubbles (bubble diameter, velocity, shape or position) for various process conditions. This technique is based on particle recognition with backlight illumination, combined with particle tracking velocimetry (PTV). The bubble trajectories in the column can also be obtained in this manner. Secondly, the liquid phase flow has been analysed by particle image velocimetry (PIV). The combination of both methods, delivering relevant information concerning disperse (bubbles) and continuous (liquid) phases, leads to a complete fluid dynamical characterization of the reactor, which is the pre-condition for the analysis of mass transfer between both phases.
NASA Astrophysics Data System (ADS)
Chiong, W. L.; Omar, A. F.
2017-07-01
Non-destructive technique based on visible (VIS) spectroscopy using light emitting diode (LED) as lighting was used for evaluation of the internal quality of mango fruit. The objective of this study was to investigate feasibility of white LED as lighting in spectroscopic instrumentation to predict the acidity and soluble solids content of intact Sala Mango. The reflectance spectra of the mango samples were obtained and measured in the visible range (400-700 nm) using VIS spectroscopy illuminated under different white LEDs and tungsten-halogen lamp (pro lamp). Regression models were developed by multiple linear regression to establish the relationship between spectra and internal quality. Direct calibration transfer procedure was then applied between master and slave lighting to check on the acidity prediction results after transfer. Determination of mango acidity under white LED lighting was successfully performed through VIS spectroscopy using multiple linear regression but otherwise for soluble solids content. Satisfactory results were obtained for calibration transfer between LEDs with different correlated colour temperature indicated this technique was successfully used in spectroscopy measurement between two similar light sources in prediction of internal quality of mango.
NASA Technical Reports Server (NTRS)
Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave
2011-01-01
An advanced methodology for extracting the hydraulic dynamic pump transfer matrix (Yp) for a cavitating liquid rocket engine turbopump inducer+impeller has been developed. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Laboratory pulsed subscale waterflow test of the J-2X oxygen turbo pump is introduced and our new extraction method applied to the data collected. From accurate measures of pump inlet and discharge perturbational mass flows and pressures, and one-dimensional flow models that represents complete waterflow loop physics, we are able to derive Yp and hence extract the characteristic pump parameters: compliance, pump gain, impedance, mass flow gain. Detailed modeling is necessary to accurately translate instrument plane measurements to the pump inlet and discharge and extract Yp. We present the MSFC Dynamic Lump Parameter Fluid Model Framework and describe critical dynamic component details. We report on fit minimization techniques, cost (fitness) function derivation, and resulting model fits to our experimental data are presented. Comparisons are made to alternate techniques for spatially translating measurement stations to actual pump inlet and discharge.
Bibliography on augmentation of convective heat and mass transfer-II
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bergles, A.E.; Nirmalan, V.; Junkhan, G.H.
1983-12-01
Heat transfer augmentation has developed into a major specialty area in heat transfer research and development. This report presents and updated bibliography of world literature on augmentation. The literature is classified into passive augmentation techniques, which require no external power, and active techniques, which do require external power. The fifteen techniques are grouped in terms of their applications to the various modes of heat transfer. Mass transfer is included for completeness. Key words are included with each citation for technique/mode identification. The total number of publications cited is 3045, including 135 surveys of various techniques and 86 papers on performancemore » evaluation of passive techniques. Patents are not included, as they are the subject of a separate bibliographic report.« less
Bibliography on augmentation of convective heat and mass transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bergles, A.E.; Webb, R.L.; Junkhan, G.H.
1979-05-01
Heat transfer augmentation has developed into a major specialty area in heat transfer research and development. A bibliography of world literature on augmentation is presented. The literature is classified into passive augmentation techniques, which require no external power, and active techniques, which do require external power. The fourteen techniques are grouped in terms of their application to the various modes of heat transfer. Mass transfer is included for completeness. Key words are included with each citation for technique/mode identification. The total number of publications cited is 1,967, including 75 surveys of various techniques and 42 papers on performance evaluation ofmore » passive techniques. Patents are not included as they will be the subject of a future topical report.« less
Contemporary solutions for the treatment of facial nerve paralysis.
Garcia, Ryan M; Hadlock, Tessa A; Klebuc, Michael J; Simpson, Roger L; Zenn, Michael R; Marcus, Jeffrey R
2015-06-01
After reviewing this article, the participant should be able to: 1. Understand the most modern indications and technique for neurotization, including masseter-to-facial nerve transfer (fifth-to-seventh cranial nerve transfer). 2. Contrast the advantages and limitations associated with contiguous muscle transfers and free-muscle transfers for facial reanimation. 3. Understand the indications for a two-stage and one-stage free gracilis muscle transfer for facial reanimation. 4. Apply nonsurgical adjuvant treatments for acute facial nerve paralysis. Facial expression is a complex neuromotor and psychomotor process that is disrupted in patients with facial paralysis breaking the link between emotion and physical expression. Contemporary reconstructive options are being implemented in patients with facial paralysis. While static procedures provide facial symmetry at rest, true 'facial reanimation' requires restoration of facial movement. Contemporary treatment options include neurotization procedures (a new motor nerve is used to restore innervation to a viable muscle), contiguous regional muscle transfer (most commonly temporalis muscle transfer), microsurgical free muscle transfer, and nonsurgical adjuvants used to balance facial symmetry. Each approach has advantages and disadvantages along with ongoing controversies and should be individualized for each patient. Treatments for patients with facial paralysis continue to evolve in order to restore the complex psychomotor process of facial expression.
NASA Astrophysics Data System (ADS)
Tirado-Guizar, Antonio; Paraguay-Delgado, Francisco; Pina-Luis, Georgina E.
2016-12-01
A new ‘turn-on’ Förster resonance energy transfer (FRET) nanosensor for l-tryptophan based on molecularly imprinted quantum dots (QDs) is proposed. The approach combines the advantages of the molecular imprinting technique, the fluorescent characteristics of the QDs and the energy transfer process. Silica-coated CdTe QDs were first synthesized and then molecularly imprinted using a sol-gel process without surfactants. The final composite presents stable fluorescence which increases with the addition of l-tryptophan. This ‘turn-on’ response is due to a FRET mechanism from the l-tryptophan as donor to the imprinted QD as acceptor. QDs are rarely applied as acceptors in FRET systems. The nanosensor shows selectivity towards l-tryptophan in the presence of other amino acids and interfering ions. The l-tryptophan nanosensor exhibits a linear range between 0 and 8 µM concentration, a detection limit of 350 nM and high selectivity. The proposed sensor was successfully applied for the detection of l-tryptophan in saliva. This novel sensor may offer an alternative approach to the design of a new generation of imprinted nanomaterials for the recognition of different analytes.
Xiong, Ying-Zi; Zhang, Jun-Yun; Yu, Cong
2016-01-01
Perceptual learning is often orientation and location specific, which may indicate neuronal plasticity in early visual areas. However, learning specificity diminishes with additional exposure of the transfer orientation or location via irrelevant tasks, suggesting that the specificity is related to untrained conditions, likely because neurons representing untrained conditions are neither bottom-up stimulated nor top-down attended during training. To demonstrate these top-down and bottom-up contributions, we applied a “continuous flash suppression” technique to suppress the exposure stimulus into sub-consciousness, and with additional manipulations to achieve pure bottom-up stimulation or top-down attention with the transfer condition. We found that either bottom-up or top-down influences enabled significant transfer of orientation and Vernier discrimination learning. These results suggest that learning specificity may result from under-activations of untrained visual neurons due to insufficient bottom-up stimulation and/or top-down attention during training. High-level perceptual learning thus may not functionally connect to these neurons for learning transfer. DOI: http://dx.doi.org/10.7554/eLife.14614.001 PMID:27377357
A general stagnation-point convective heating equation for arbitrary gas mixtures
NASA Technical Reports Server (NTRS)
Sutton, K.; Graves, R. A., Jr.
1971-01-01
The stagnation-point convective heat transfer to an axisymmetric blunt body for arbitrary gases in chemical equilibrium was investigated. The gases considered were base gases of nitrogen, oxygen, hydrogen, helium, neon, argon, carbon dioxide, ammonia, and methane and 22 gas mixtures composed of the base gases. Enthalpies ranged from 2.3 to 116.2 MJ/kg, pressures ranged from 0.001 to 100 atmospheres, and the wall temperatures were 300 and 1111 K. A general equation for the stagnation-point convective heat transfer in base gases and gas mixtures was derived and is a function of the mass fraction, the molecular weight, and a transport parameter of the base gases. The relation compares well with present boundary-layer computer results and with other analytical and experimental results. In addition, the analysis verified that the convective heat transfer in gas mixtures can be determined from a summation relation involving the heat transfer coefficients of the base gases. The basic technique developed for the prediction of stagnation-point convective heating to an axisymmetric blunt body could be applied to other heat transfer problems.
NASA Astrophysics Data System (ADS)
Liu, L. H.; Tan, J. Y.
2007-02-01
A least-squares collocation meshless method is employed for solving the radiative heat transfer in absorbing, emitting and scattering media. The least-squares collocation meshless method for radiative transfer is based on the discrete ordinates equation. A moving least-squares approximation is applied to construct the trial functions. Except for the collocation points which are used to construct the trial functions, a number of auxiliary points are also adopted to form the total residuals of the problem. The least-squares technique is used to obtain the solution of the problem by minimizing the summation of residuals of all collocation and auxiliary points. Three numerical examples are studied to illustrate the performance of this new solution method. The numerical results are compared with the other benchmark approximate solutions. By comparison, the results show that the least-squares collocation meshless method is efficient, accurate and stable, and can be used for solving the radiative heat transfer in absorbing, emitting and scattering media.
Concepts of nerve regeneration and repair applied to brachial plexus reconstruction.
Bertelli, Jayme Augusto; Ghizoni, Marcos Flávio
2006-01-01
Brachial plexus injury is a serious condition that usually affects young adults. Progress in brachial plexus repair is intimately related to peripheral nerve surgery, and depends on clinical and experimental studies. We review the rat brachial plexus as an experimental model, together with its behavioral evaluation. Techniques to repair nerves, such as neurolysis, nerve coaptation, nerve grafting, nerve transfer, fascicular transfer, direct muscle neurotization, and end-to-side neurorraphy, are discussed in light of the authors' experimental studies. Intradural repair of the brachial plexus by graft implants into the spinal cord and motor rootlet transfer offer new possibilities in brachial plexus reconstruction. The clinical experience of intradural repair is presented. Surgical planning in root rupture or avulsion is proposed. In total avulsion, the authors are in favor of the reconstruction of thoraco-brachial and abdomino-antebrachial grasping, and on the transfer of the brachialis muscle to the wrist extensors if it is reinnervated. Surgical treatment of painful conditions and new drugs are also discussed.
Electrostatic Assist of Liquid Transfer in Printing Processes
NASA Astrophysics Data System (ADS)
Huang, Chung-Hsuan; Kumar, Satish
2016-11-01
Transfer of liquid from one surface to another plays an important role in many printing processes. Incomplete liquid transfer can produce defects that are detrimental to the operation of printed electronic devices, and one strategy for minimizing these defects is to apply an electric field, a technique known as electrostatic assist (ESA). However, the underlying physical mechanisms of ESA remain a mystery. To better understand these mechanisms, slender-jet models for both perfect dielectric and leaky dielectric Newtonian liquid bridges with moving contact lines are developed. Nonlinear partial differential equations describing the time- and axial-evolution of the bridge radius and interfacial charge are derived, and then solved using finite-element methods. For perfect dielectrics, it is found that application of an electric field enhances transfer of liquid to the more wettable surface. For leaky dielectrics, application of an electric field can augment or oppose the influence of wettability differences, depending on the direction of the electric field and the sign of the interfacial charge. The physical mechanisms underlying these observations will be discussed.
NASA Technical Reports Server (NTRS)
Green, R. N.; Kibler, J. F.; Young, G. R.
1974-01-01
A method is presented for factoring a two-impulse orbital transfer into a three- or four-impulse transfer which solves the rendezvous problem and satisfies an intermediate timing constraint. Both the time of rendezvous and the intermediate time of a alinement are formulated as any element of a finite sequence of times. These times are integer multiples of a constant plus an additive constant. The rendezvous condition is an equality constraint, whereas the intermediate alinement is an inequality constraint. The two timing constraints are satisfied by factoring the impulses into collinear parts that vectorially sum to the original impulse and by varying the resultant period differences and the number of revolutions in each orbit. Five different types of solutions arise by considering factoring either or both of the two impulses into two or three parts with a limit for four total impulses. The impulse-factoring technique may be applied to any two-impulse transfer which has distinct orbital periods.
Ham, Byoung S
2010-08-16
Lengthening of photon storage time has been an important issue in quantum memories for long distance quantum communications utilizing quantum repeaters. Atom population transfer into an auxiliary spin state has been adapted to increase photon storage time of photon echoes. In this population transfer process phase shift to the collective atoms is inevitable, where the phase recovery condition must be multiple of 2pi to satisfy rephasing mechanism. Recent adaptation of the population transfer method to atomic frequency comb (AFC) echoes [Afzelius et al., Phys. Rev. Lett. 104, 040503 (2010)], where the population transfer method is originated in a controlled reversible inhomogeneous broadening technique [Moiseev and Kroll, Phys. Rev. Lett. 87, 173601 (2001)], however, shows contradictory phenomenon violating the phase recovery condition. This contradiction in AFC is reviewed as a general case of optical locking applied to a dilute medium for an optical depth-dependent coherence leakage resulting in partial retrieval efficiency.
Enhanced N-Transfer from a Soybean to Maize by Vesicular Arbuscular Mycorrhizal (VAM) Fungi.
van Kessel, C; Singleton, P W; Hoben, H J
1985-10-01
Using a split-root technique, roots of soybean plants were divided between two pots. In one of the two pots, two maize plants were grown and half of those pots were inoculated with the vesicular arbuscular mycorrhizal (VAM) fungus, Glomus fasciculatus. Fifty-two days after planting, (15)N-labeled ammonium sulfate was applied to the pots which contained only soybean roots. Forty-eight hours after application, significantly higher values for atom per cent (15)N excess were found in roots and leaves of VAM-infected maize plants as compared with the non-VAM-infected maize plants. Results indicated that VAM fungi did enhance N transfer from one plant to another.
Radiative transfer in dusty nebulae. III - The effects of dust albedo
NASA Technical Reports Server (NTRS)
Petrosian, V.; Dana, R. A.
1980-01-01
The effects of an albedo of internal dust, such as ionization structure and temperature of dust grain, were studied by the quasi-diffusion method with an iterative technique for solving the radiative heat transfer equations. It was found that the generalized on-the-spot approximation solution is adequate for most astrophysical applications for a zero albedo; for a nonzero albedo, the Eddington approximation is more accurate. The albedo increases the average energy of the diffuse photons, increasing the ionization level of hydrogen and heavy elements if the Eddington approximation is applied; the dust thermal gradient is reduced so that the infrared spectrum approaches blackbody spectrum with an increasing albedo.
Boiling incipience and convective boiling of neon and nitrogen
NASA Technical Reports Server (NTRS)
Papell, S. S.; Hendricks, R. C.
1977-01-01
Forced convection and subcooled boiling heat transfer data for liquid nitrogen and liquid neon were obtained in support of a design study for a 30 tesla cryomagnet cooled by forced convection of liquid neon. The cryogen data obtained over a range of system pressures, fluid flow rates, and applied heat fluxes were used to develop correlations for predicting boiling incipience and convective boiling heat transfer coefficients in uniformly heated flow channels. The accuracy of the correlating equations was then evaluated. A technique was also developed to calculate the position of boiling incipience in a uniformly heated flow channel. Comparisons made with the experimental data showed a prediction accuracy of + or - 15 percent.
Influence of MgO barrier quality on spin-transfer torque in magnetic tunnel junctions
NASA Astrophysics Data System (ADS)
Tiwari, Dhananjay; Sharma, Raghav; Heinonen, O. G.; Åkerman, Johan; Muduli, P. K.
2018-01-01
We studied the bias dependence of spin transfer torque in the MgO-based magnetic tunnel junction using a field-modulated spin torque ferromagnetic resonance measurement technique for three devices with tunneling magnetoresistances (MRs) of 60%, 67%, and 73%, respectively. The devices with a lower MR ratio showed the presence of multiple modes, while the device with higher MR (73%) showed a single resonance mode. We found a lower out-of-plane torkance in our devices compared to the in-plane torkance. The out-of-plane torque is linear with applied bias, while the bias dependence of in-plane torque shows a strong dependence on the MR ratio and hence the barrier quality.
NASA Technical Reports Server (NTRS)
Oaks, J.; Frank, A.; Falvey, S.; Lister, M.; Buisson, J.; Wardrip, C.; Warren, H.
1982-01-01
Time transfer equipment and techniques used with the Navigation Technology Satellites were modified and extended for use with the Global Positioning System (GPS) satellites. A prototype receiver was built and field tested. The receiver uses the GPS L1 link at 1575 MHz with C/A code only to resolve a measured range to the satellite. A theoretical range is computed from the satellite ephemeris transmitted in the data message and the user's coordinates. Results of user offset from GPS time are obtained by differencing the measured and theoretical ranges and applying calibration corrections. Results of the first field test evaluation of the receiver are presented.
NASA Astrophysics Data System (ADS)
Hussin, N. H.; Azizan, M. M.; Ali, A.; Albreem, M. A. M.
2017-09-01
This paper reviews the techniques used in Wireless power transfer (WPT). WPT is one of the most useful ways to transfer power. Based on power transfer distances, the WPT system can be divided into three categories, namely, near, medium, and far fields. Inductive coupling and capacitive coupling contactless techniques are used in the near-field WPT. Magnetic resonant coupling technique is used in the medium-field WPT. Electromagnetic radiation is used in the far-field WPT. In addition, energy encryption plays a major role in ensuring that power is transferred to the true receiver. Therefore, this paper reviews the energy encryption techniques in WPT system. A comparison between different technique shows that the distance, efficiency, and number of receivers are the main factors in selecting the suitable energy encryption technique.
Al Mortadi, Noor; Eggbeer, Dominic; Lewis, Jeffrey; Williams, Robert J
2013-04-01
The aim of this study was to analyze the latest innovations in additive manufacture techniques and uniquely apply them to dentistry, to build a sleep apnea device requiring rotating hinges. Laser scanning was used to capture the three-dimensional topography of an upper and lower dental cast. The data sets were imported into an appropriate computer-aided design software environment, which was used to design a sleep apnea device. This design was then exported as a stereolithography file and transferred for three-dimensional printing by an additive manufacture machine. The results not only revealed that the novel computer-based technique presented provides new design opportunities but also highlighted limitations that must be addressed before the techniques can become clinically viable.
[Progress in transgenic fish techniques and application].
Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying
2011-05-01
Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.
NASA Astrophysics Data System (ADS)
Kleinböhl, Armin; Friedson, A. James; Schofield, John T.
2017-01-01
The remote sounding of infrared emission from planetary atmospheres using limb-viewing geometry is a powerful technique for deriving vertical profiles of structure and composition on a global scale. Compared with nadir viewing, limb geometry provides enhanced vertical resolution and greater sensitivity to atmospheric constituents. However, standard limb profile retrieval techniques assume spherical symmetry and are vulnerable to biases produced by horizontal gradients in atmospheric parameters. We present a scheme for the correction of horizontal gradients in profile retrievals from limb observations of the martian atmosphere. It characterizes horizontal gradients in temperature, pressure, and aerosol extinction along the line-of-sight of a limb view through neighboring measurements, and represents these gradients by means of two-dimensional radiative transfer in the forward model of the retrieval. The scheme is applied to limb emission measurements from the Mars Climate Sounder instrument on Mars Reconnaissance Orbiter. Retrieval simulations using data from numerical models indicate that biases of up to 10 K in the winter polar region, obtained with standard retrievals using spherical symmetry, are reduced to about 2 K in most locations by the retrieval with two-dimensional radiative transfer. Retrievals from Mars atmospheric measurements suggest that the two-dimensional radiative transfer greatly reduces biases in temperature and aerosol opacity caused by observational geometry, predominantly in the polar winter regions.
[Impact of digital technology on clinical practices: perspectives from surgery].
Zhang, Y; Liu, X J
2016-04-09
Digital medical technologies or computer aided medical procedures, refer to imaging, 3D reconstruction, virtual design, 3D printing, navigation guided surgery and robotic assisted surgery techniques. These techniques are integrated into conventional surgical procedures to create new clinical protocols that are known as "digital surgical techniques". Conventional health care is characterized by subjective experiences, while digital medical technologies bring quantifiable information, transferable data, repeatable methods and predictable outcomes into clinical practices. Being integrated into clinical practice, digital techniques facilitate surgical care by improving outcomes and reducing risks. Digital techniques are becoming increasingly popular in trauma surgery, orthopedics, neurosurgery, plastic and reconstructive surgery, imaging and anatomic sciences. Robotic assisted surgery is also evolving and being applied in general surgery, cardiovascular surgery and orthopedic surgery. Rapid development of digital medical technologies is changing healthcare and clinical practices. It is therefore important for all clinicians to purposefully adapt to these technologies and improve their clinical outcomes.
A Technique for Facile and Precise Transfer of Mouse Embryos
Sarvari, Ali; Naderi, Mohammad Mehdi; Sadeghi, Mohammad Reza; Akhondi, Mohammad Mehdi
2013-01-01
Background Successful Embryo Transfer (ET) technique is a fateful step of all efforts to achieve live births from in vitro produced embryos in assisted reproductive techniques or in knockout, transgenic or cloned animal projects. Small reproductive tract of mice and limitation of current techniques may not well satisfy the requirements for mass production of genetically modified mice. Genetic abnormalities of embryos, receptivity and uterine contractions, expulsion of embryos, blood, mucus or bacterial contamination on the transfer pipette tip, technical problems and even animal strain may affect embryo transfer outcome. Methods In this study, two techniques of embryo transfer in mice were compared. In conventional technique the oviduct wall was punctured with a 30-gauge needle and the loaded Pasteur pipette with embryos and medium was inserted into the hole. In new technique, embryos that were loaded in modified micropipette with minimal medium were transferred directly to the oviduct by manual piston micro-pump easily. Embryo viability was evaluated considering the percentage of live healthy newborns. Results Results of the two techniques were compared by t-test within the NPAR1WAY procedure of SAS software (ver. 9.2). The average live birth rates in the novel methods was significantly higher (42.4%) than the conventional method (21.7%, p<0.05). Conclusion In conclusion, using new embryo transfer technique improved birth rate by preventing embryos expulsion from the oviduct, saving time and easy transfer of embryos with minimum volume of medium. PMID:23626878
The relationship between recollection, knowledge transfer, and student attitudes towards chemistry
NASA Astrophysics Data System (ADS)
Odeleye, Oluwatobi Omobonike
Certain foundational concepts, including acid-base theory, chemical bonding and intermolecular forces (IMFs), appear throughout the undergraduate chemistry curriculum. The level of understanding of these foundational concepts influences the ability of students to recognize the relationships between sub-disciplines in chemistry. The purpose of this study was to investigate the relationship between student attitudes towards chemistry and their abilities to recollect and transfer knowledge of IMFs, a foundational concept, to their daily lives as well as to other classes. Data were collected using surveys, interviews and classroom observations, and analyzed using qualitative methods. The data show that while most students were able to function at lower levels of thinking by providing a definition of IMFs, majority were unable to function at higher levels of thinking as evidenced by their inability to apply their knowledge of IMFs to their daily lives and other classes. The results of this study suggest a positive relationship between students' abilities to recollect knowledge and their abilities to transfer that knowledge. The results also suggest positive relationships between recollection abilities of students and their attitudes towards chemistry as well as their transfer abilities and attitudes towards chemistry. Recommendations from this study include modifications of pedagogical techniques in ways that facilitate higher-level thinking and emphasize how chemistry applies not only to daily life, but also to other courses.
Anticipated uncertainty budgets of PRARETIME and T2L2 techniques as applied to ExTRAS
NASA Technical Reports Server (NTRS)
Thomas, Claudine; Wolf, Peter; Uhrich, Pierre J. M.; Schaefer, W.; Nau, H.; Veillet, Christian
1995-01-01
The Experiment on Timing Ranging and Atmospheric Soundings, ExTRAS, was conceived jointly by the European Space Agency, ESA, and the Russian Space Agency, RSA. It is also designated the 'Hydrogen-maser in Space/Meteor-3M project'. The launch of the satellite is scheduled for early 1997. The package, to be flown on board a Russian meteorological satellite includes ultra-stable frequency and time sources, namely two active and auto-tuned hydrogen masers. Communication between the on-board hydrogen masers and the ground station clocks is effected by means of a microwave link using the modified version for time transfer of the Precise Range And Range-rate Equipment, PRARETIME, technique, and an optical link which uses the Time Transfer by Laser Link, T2L2, method. Both the PRARETIME and T2L2 techniques operate in a two-directional mode, which makes it possible to carry out accurate transmissions without precise knowledge of the satellite and station positions. Due to the exceptional quality of the on-board clocks and to the high performance of the communication techniques with the satellite, satellite clock monitoring and ground clocks synchronization are anticipated to be performed with uncertainties below 0.5 ns (1 sigma). Uncertainty budgets and related comments are presented.
NASA Astrophysics Data System (ADS)
Chen, Zhenning; Shao, Xinxing; He, Xiaoyuan; Wu, Jialin; Xu, Xiangyang; Zhang, Jinlin
2017-09-01
Noninvasive, three-dimensional (3-D), full-field surface deformation measurements of the human body are important for biomedical investigations. We proposed a 3-D noninvasive, full-field body sensor based on stereo digital image correlation (stereo-DIC) for surface deformation monitoring of the human body in vivo. First, by applying an improved water-transfer printing (WTP) technique to transfer optimized speckle patterns onto the skin, the body sensor was conveniently and harmlessly fabricated directly onto the human body. Then, stereo-DIC was used to achieve 3-D noncontact and noninvasive surface deformation measurements. The accuracy and efficiency of the proposed body sensor were verified and discussed by considering different complexions. Moreover, the fabrication of speckle patterns on human skin, which has always been considered a challenging problem, was shown to be feasible, effective, and harmless as a result of the improved WTP technique. An application of the proposed stereo-DIC-based body sensor was demonstrated by measuring the pulse wave velocity of human carotid artery.
NASA Astrophysics Data System (ADS)
Sun, Huafei; Darmofal, David L.
2014-12-01
In this paper we propose a new high-order solution framework for interface problems on non-interface-conforming meshes. The framework consists of a discontinuous Galerkin (DG) discretization, a simplex cut-cell technique, and an output-based adaptive scheme. We first present a DG discretization with a dual-consistent output evaluation for elliptic interface problems on interface-conforming meshes, and then extend the method to handle multi-physics interface problems, in particular conjugate heat transfer (CHT) problems. The method is then applied to non-interface-conforming meshes using a cut-cell technique, where the interface definition is completely separate from the mesh generation process. No assumption is made on the interface shape (other than Lipschitz continuity). We then equip our strategy with an output-based adaptive scheme for an accurate output prediction. Through numerical examples, we demonstrate high-order convergence for elliptic interface problems and CHT problems with both smooth and non-smooth interface shapes.
Improvement of finite element meshes - Heat transfer in an infinite cylinder
NASA Technical Reports Server (NTRS)
Kittur, Madan G.; Huston, Ronald L.; Oswald, Fred B.
1989-01-01
An extension of a structural finite element mesh improvement technique to heat conduction analysis is presented. The mesh improvement concept was originally presented by Prager in studying tapered, axially loaded bars. It was further shown that an improved mesh can be obtained by minimizing the trace of the stiffnes matrix. These procedures are extended and applied to the analysis of heat conduction in an infinitely long hollow circular cylinder.
Improvement in finite element meshes: Heat transfer in an infinite cylinder
NASA Technical Reports Server (NTRS)
Kittur, Madan G.; Huston, Ronald L.; Oswald, Fred B.
1988-01-01
An extension of a structural finite element mesh improvement technique to heat conduction analysis is presented. The mesh improvement concept was originally presented by Prager in studying tapered, axially loaded bars. It was further shown that an improved mesh can be obtained by minimizing the trace of the stiffness matrix. These procedures are extended and applied to the analysis of heat conduction in an infinitely long hollow circular cylinder.
Heat Transfer Measurement and Modeling in Rigid High-Temperature Reusable Surface Insulation Tiles
NASA Technical Reports Server (NTRS)
Daryabeigi, Kamran; Knutson, Jeffrey R.; Cunnington, George R.
2011-01-01
Heat transfer in rigid reusable surface insulations was investigated. Steady-state thermal conductivity measurements in a vacuum were used to determine the combined contribution of radiation and solid conduction components of heat transfer. Thermal conductivity measurements at higher pressures were then used to estimate the effective insulation characteristic length for gas conduction modeling. The thermal conductivity of the insulation can then be estimated at any temperature and pressure in any gaseous media. The methodology was validated by comparing estimated thermal conductivities with published data on a rigid high-temperature silica reusable surface insulation tile. The methodology was also applied to the alumina enhanced thermal barrier tiles. Thermal contact resistance for thermal conductivity measurements on rigid tiles was also investigated. A technique was developed to effectively eliminate thermal contact resistance on the rigid tile s cold-side surface for the thermal conductivity measurements.
Practical applications of new research information in the practice of bovine embryo transfer.
Looney, C R; Pryor, J H
2010-01-01
For more than 40 years, practitioners have sought to improve all aspects of commercial bovine embryo transfer. The development of new technologies for this industry has been substantial, with recent focus on cryopreservation techniques and the in vitro production of embryos fertilised with sexed spermatozoa. When these and other new technologies are developed, the following questions remain: (1) is said technology regulated or does it require licensing; and (2) is it applicable and, if so, is it financially feasible? Computer access to published research and the advancement of data software programs conducive to the industry for data procurement have been essential for helping practitioners answer these questions by enhancing their ability to analyse and apply data. The focus of the present paper is to aid commercial embryo transfer practitioners in determining new technologies that are available and whether they can be implemented effectively, benefiting their programs.
Navier-Stokes turbine heat transfer predictions using two-equation turbulence closures
NASA Technical Reports Server (NTRS)
Ameri, Ali A.; Arnone, Andrea
1992-01-01
Navier-Stokes calculations were carried out in order to predict the heat-transfer rates on turbine blades. The calculations were performed using TRAF2D which is a k-epsilon, explicit, finite volume mass-averaged Navier-Stokes solver. Turbulence was modeled using Coakley's q-omega and Chien's k-epsilon two-equation models and the Baldwin-Lomax algebraic model. The model equations along with the flow equations were solved explicitly on a nonperiodic C grid. Implicit residual smoothing (IRS) or a combination of multigrid technique and IRS was applied to enhance convergence rates. Calculations were performed to predict the Stanton number distributions on the first stage vane and blade row as well as the second stage vane row of the SSME high-pressure fuel turbine. The comparison serves to highlight the weaknesses of the turbulence models for use in turbomachinery heat-transfer calculations.
Refat, Moamen S; El-Zayat, Lamia A; Yeşilel, Okan Zafer
2010-02-01
Electron donor-acceptor interaction of morpholine (morp) with chloranilic acid (cla) and picric acid (pa) as pi-acceptors was investigated spectrophotometrically and found to form stable charge-transfer (CT) complexes (n-pi*) of [(Hmorp)(2)(cla)] and [(Hmorp)(pa)](2). The donor site involved in CT interaction is morpholine nitrogen. These complexes are easily synthesized from the reaction of morp with cla and pa within MeOH and CHCl(3) solvents, respectively. (1)HNMR, IR, elemental analyses, and UV-vis techniques characterize the two morpholinium charge-transfer complexes. Benesi-Hildebrand and its modification methods were applied to the determination of association constant (K), molar extinction coefficient (epsilon). The X-ray crystal structure was carried out for the interpretation the predict structure of the [(Hmorp)(pa)](2) complex. Copyright (c) 2009 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Refat, Moamen S.; El-Zayat, Lamia A.; Yeşilel, Okan Zafer
2010-02-01
Electron donor-acceptor interaction of morpholine (morp) with chloranilic acid (cla) and picric acid (pa) as π-acceptors was investigated spectrophotometrically and found to form stable charge-transfer (CT) complexes (n-π*) of [(Hmorp) 2(cla)] and [(Hmorp)(pa)] 2. The donor site involved in CT interaction is morpholine nitrogen. These complexes are easily synthesized from the reaction of morp with cla and pa within MeOH and CHCl 3 solvents, respectively. 1HNMR, IR, elemental analyses, and UV-vis techniques characterize the two morpholinium charge-transfer complexes. Benesi-Hildebrand and its modification methods were applied to the determination of association constant ( K), molar extinction coefficient ( ɛ). The X-ray crystal structure was carried out for the interpretation the predict structure of the [(Hmorp)(pa)] 2 complex.
NASA Technical Reports Server (NTRS)
Bosanac, Natasha; Cox, Andrew; Howell, Kathleen C.; Folta, David C.
2017-01-01
Lunar IceCube is a 6U CubeSat that is designed to detect and observe lunar volatiles from a highly inclined orbit. This spacecraft, equipped with a low-thrust engine, will be deployed from the upcoming Exploration Mission-1 vehicle in late 2018. However, significant uncertainty in the deployment conditions for secondary payloads impacts both the availability and geometry of transfers that deliver the spacecraft to the lunar vicinity. A framework that leverages dynamical systems techniques is applied to a recently updated set of deployment conditions and spacecraft parameter values for the Lunar IceCube mission, demonstrating the capability for rapid trajectory design.
NASA Technical Reports Server (NTRS)
Wing, L. D.
1979-01-01
Simplified analytical techniques of sounding rocket programs are suggested as a means of bringing the cost of thermal analysis of the Get Away Special (GAS) payloads within acceptable bounds. Particular attention is given to two methods adapted from sounding rocket technology - a method in which the container and payload are assumed to be divided in half vertically by a thermal plane of symmetry, and a method which considers the container and its payload to be an analogous one-dimensional unit having the real or correct container top surface area for radiative heat transfer and a fictitious mass and geometry which model the average thermal effects.
NASA Astrophysics Data System (ADS)
Bosanac, Natasha; Cox, Andrew D.; Howell, Kathleen C.; Folta, David C.
2018-03-01
Lunar IceCube is a 6U CubeSat that is designed to detect and observe lunar volatiles from a highly inclined orbit. This spacecraft, equipped with a low-thrust engine, is expected to be deployed from the upcoming Exploration Mission-1 vehicle. However, significant uncertainty in the deployment conditions for secondary payloads impacts both the availability and geometry of transfers that deliver the spacecraft to the lunar vicinity. A framework that leverages dynamical systems techniques is applied to a recently updated set of deployment conditions and spacecraft parameter values for the Lunar IceCube mission, demonstrating the capability for rapid trajectory design.
Promoting Transfer in Memory Training for Older Adults
Cavallini, Elena; Dunlosky, John; Bottiroli, Sara; Hertzog, Christopher; Vecchi, Tomaso
2011-01-01
Background and aims Many studies have focused on memory training in aging showing older adults can improve their performance. Unfortunately the benefits of training rarely generalize to other tasks that were not specifically trained. We investigated the benefits of instruction-based training in promoting transfer effects in older adults. Methods In Experiment 1, we evaluated transfer effects in a training group who practiced using standard mnemonics to learn paired associates and word lists, and this group was provided instructions about how the mnemonics could be used for two of the four transfer tasks (text learning, name-face learning, grocery list learning, place learning). In Experiment 2, we compared transfer effects for two different training groups: one practiced the strategies with the two trained tasks and did not receive instructions and one had the same practice but also received instructions on all the transfer tasks. Results Transfer in text learning occurred in both experiments. Such transfer is particularly interesting considering that text learning was the most dissimilar task in terms of both the nature of the materials and the underlying processes that support performance. Such transfer was reliably greater when training involved instructions about applicability than when it did not. Conclusions Instructions to use practiced strategies on new materials could be a useful technique in promoting transfer in older adults. It seems that the lack of transfer does not necessarily arise from older adults’ inabilities but instead because they do not realize that trained strategies can (or should) be applied to new materials. PMID:19966535
Promoting transfer in memory training for older adults.
Cavallini, Elena; Dunlosky, John; Bottiroli, Sara; Hertzog, Christopher; Vecchi, Tomaso
2010-08-01
Many studies have focused on memory training in aging, showing that older adults can improve their performance. Unfortunately, the benefits of training can rarely be generalized to other tasks for which adults were not specifically trained. We investigated the benefits of instruction-based training in promoting transfer effects in older adults. In Experiment 1, we evaluated transfer effects in a training group who practiced using standard mnemonics to learn paired associates and word lists, and this group was given instructions about how the mnemonics could be used for two of the four transfer tasks (text learning, name-face learning, grocery list learning, place learning). In Experiment 2, we compared transfer effects for two different training groups: one practiced the strategies with the two trained tasks and did not receive instructions, and the other had the same practice but also received instructions on all the transfer tasks. Transfer in text learning occurred in both experiments. This transfer is particularly interesting, as text learning was the most dissimilar task in terms of both the nature of the materials and the underlying processes that support performance. The transfer was reliably greater when training involved instructions about applicability than when it did not. Instructions to use practiced strategies on new materials may be a useful technique in promoting transfer in older adults. It seems that the lack of transfer does not necessarily arise from older adults' inabilities, but because they do not realize that trained strategies can (or should) be applied to new materials.
Upper limb kinetic analysis of three sitting pivot wheelchair transfer techniques.
Koontz, Alicia M; Kankipati, Padmaja; Lin, Yen-Sheng; Cooper, Rory A; Boninger, Michael L
2011-11-01
The objective of this study was to investigate differences in shoulder, elbow and hand kinetics while performing three different SPTs that varied in terms of hand and trunk positioning. Fourteen unimpaired individuals (8 male and 6 female) performed three variations of sitting pivot transfers in a random order from a wheelchair to a level tub bench. Two transfers involved a forward flexed trunk (head-hips technique) and the third with the trunk remaining upright. The two transfers involving a head hips technique were performed with two different leading hand initial positions. Motion analysis equipment recorded upper body movements and force sensors recorded hand reaction forces. Shoulder and elbow joint and hand kinetics were computed for the lift phase of the transfer. Transferring using either of the head hips techniques compared to the trunk upright style of transferring resulted in reduced superior forces at the shoulder (P<0.002), elbow (P<0.004) and hand (P<0.013). There was a significant increase in the medial forces in the leading elbow (P=0.049) for both head hip transfers and the trailing hand for the head hip technique with the arm further away from the body (P<0.028). The head hip techniques resulted in higher shoulder external rotation, flexion and extension moments compared to the trunk upright technique (P<0.021). Varying the hand placement and trunk positioning during transfers changes the load distribution across all upper limb joints. The results of this study may be useful for determining a technique that helps preserve upper limb function overtime. Published by Elsevier Ltd.
SAM-based Cell Transfer to Photopatterned Hydrogels for Microengineering Vascular-Like Structures
Sadr, Nasser; Zhu, Mojun; Osaki, Tatsuya; Kakegawa, Takahiro; Yang, Yunzhi; Moretti, Matteo; Fukuda, Junji; Khademhosseini, Ali
2011-01-01
A major challenge in tissue engineering is to reproduce the native 3D microvascular architecture fundamental for in vivo functions. Current approaches still lack a network of perfusable vessels with native 3D structural organization. Here we present a new method combining self-assembled monolayer (SAM)-based cell transfer and gelatin methacrylate hydrogel photopatterning techniques for microengineering vascular structures. Human umbilical vein cell (HUVEC) transfer from oligopeptide SAM-coated surfaces to the hydrogel revealed two SAM desorption mechanisms: photoinduced and electrochemically triggered. The former, occurs concomitantly to hydrogel photocrosslinking, and resulted in efficient (>97%) monolayer transfer. The latter, prompted by additional potential application, preserved cell morphology and maintained high transfer efficiency of VE-cadherin positive monolayers over longer culture periods. This approach was also applied to transfer HUVECs to 3D geometrically defined vascular-like structures in hydrogels, which were then maintained in perfusion culture for 15 days. As a step toward more complex constructs, a cell-laden hydrogel layer was photopatterned around the endothelialized channel to mimic the vascular smooth muscle structure of distal arterioles. This study shows that the coupling of the SAM-based cell transfer and hydrogel photocrosslinking could potentially open up new avenues in engineering more complex, vascularized tissue constructs for regenerative medicine and tissue engineering applications. PMID:21802723
Modified coaxial wire method for measurement of transfer impedance of beam position monitors
NASA Astrophysics Data System (ADS)
Kumar, Mukesh; Babbar, L. K.; Deo, R. K.; Puntambekar, T. A.; Senecha, V. K.
2018-05-01
The transfer impedance is a very important parameter of a beam position monitor (BPM) which relates its output signal with the beam current. The coaxial wire method is a standard technique to measure transfer impedance of the BPM. The conventional coaxial wire method requires impedance matching between coaxial wire and external circuits (vector network analyzer and associated cables). This paper presents a modified coaxial wire method for bench measurement of the transfer impedance of capacitive pickups like button electrodes and shoe box BPMs. Unlike the conventional coaxial wire method, in the modified coaxial wire method no impedance matching elements have been used between the device under test and the external circuit. The effect of impedance mismatch has been solved mathematically and a new expression of transfer impedance has been derived. The proposed method is verified through simulation of a button electrode BPM using cst studio suite. The new method is also applied to measure transfer impedance of a button electrode BPM developed for insertion devices of Indus-2 and the results are also compared with its simulations. Close agreement between measured and simulation results suggests that the modified coaxial wire setup can be exploited for the measurement of transfer impedance of capacitive BPMs like button electrodes and shoe box BPM.
NASA Technical Reports Server (NTRS)
Bi, Lei; Yang, Ping; Liu, Chao; Yi, Bingqi; Baum, Bryan A.; Van Diedenhoven, Bastiaan; Iwabuchi, Hironobu
2014-01-01
A fundamental problem in remote sensing and radiative transfer simulations involving ice clouds is the ability to compute accurate optical properties for individual ice particles. While relatively simple and intuitively appealing, the conventional geometric-optics method (CGOM) is used frequently for the solution of light scattering by ice crystals. Due to the approximations in the ray-tracing technique, the CGOM accuracy is not well quantified. The result is that the uncertainties are introduced that can impact many applications. Improvements in the Invariant Imbedding T-matrix method (II-TM) and the Improved Geometric-Optics Method (IGOM) provide a mechanism to assess the aforementioned uncertainties. The results computed by the II-TMþIGOM are considered as a benchmark because the IITM solves Maxwell's equations from first principles and is applicable to particle size parameters ranging into the domain at which the IGOM has reasonable accuracy. To assess the uncertainties with the CGOM in remote sensing and radiative transfer simulations, two independent optical property datasets of hexagonal columns are developed for sensitivity studies by using the CGOM and the II-TMþIGOM, respectively. Ice cloud bulk optical properties obtained from the two datasets are compared and subsequently applied to retrieve the optical thickness and effective diameter from Moderate Resolution Imaging Spectroradiometer (MODIS) measurements. Additionally, the bulk optical properties are tested in broadband radiative transfer (RT) simulations using the general circulation model (GCM) version of the Rapid Radiative Transfer Model (RRTMG) that is adopted in the National Center for Atmospheric Research (NCAR) Community Atmosphere Model (CAM, version 5.1). For MODIS retrievals, the mean bias of uncertainties of applying the CGOM in shortwave bands (0.86 and 2.13 micrometers) can be up to 5% in the optical thickness and as high as 20% in the effective diameter, depending on cloud optical thickness and effective diameter. In the MODIS infrared window bands centered at 8.5, 11, and 12 micrometers biases in the optical thickness and effective diameter are up to 12% and 10%, respectively. The CGOM-based simulation errors in ice cloud radiative forcing calculations are on the order of 10Wm(exp 2).
Kalman filter estimation of human pilot-model parameters
NASA Technical Reports Server (NTRS)
Schiess, J. R.; Roland, V. R.
1975-01-01
The parameters of a human pilot-model transfer function are estimated by applying the extended Kalman filter to the corresponding retarded differential-difference equations in the time domain. Use of computer-generated data indicates that most of the parameters, including the implicit time delay, may be reasonably estimated in this way. When applied to two sets of experimental data obtained from a closed-loop tracking task performed by a human, the Kalman filter generated diverging residuals for one of the measurement types, apparently because of model assumption errors. Application of a modified adaptive technique was found to overcome the divergence and to produce reasonable estimates of most of the parameters.
Electronic nanobiosensors based on two-dimensional materials
NASA Astrophysics Data System (ADS)
Ping, Jinglei
Atomically-thick two-dimensional (2D) nanomaterials have tremendous potential to be applied as transduction elements in biosensors and bioelectronics. We developed scalable methods for synthesis and large-area transfer of two-dimensional nanomaterials, particularly graphene and metal dichalcogenides (so called ``MX2'' materials). We also developed versatile fabrication methods for large arrays of field-effect transistors (FETs) and micro-electrodes with these nanomaterials based on either conventional photolithography or innovative approaches that minimize contamination of the 2D layer. By functionalizing the FETs with a computationally redesigned water-soluble mu-opioid receptor, we created selective and sensitive biosensors suitable for detection of the drug target naltrexone and the neuropeptide enkephalin at pg/mL concentrations. We also constructed DNA-functionalized biosensors and nano-particle decorated biosensors by applying related bio-nano integration techniques. Our methodology paves the way for multiplexed nanosensor arrays with all-electronic readout suitable for inexpensive point-of-care diagnostics, drug-development and biomedical research. With graphene field-effect transistors, we investigated the graphene/solution interface and developed a quantitative model for the effect of ionic screening on the graphene carrier density based on theories of the electric double layer. Finally, we have developed a technique for measuring low-level Faradaic charge-transfer current (fA) across the graphene/solution interface via real-time charge monitoring of graphene microelectrodes in ionic solution. This technique enables the development of flexible and transparent pH sensors that are promising for in vivo applications. The author acknowledges the support from the Defense Advanced Research Projects Agency (DARPA) and the U. S. Army Research Office under Grant Number W911NF1010093.
Wakayama, Teruhiko
2007-02-01
Although it has now been 10 years since the first cloned mammals were generated from somatic cells using nuclear transfer (NT), most cloned embryos usually undergo developmental arrest prior to or soon after implantation, and the success rate for producing live offspring by cloning remains below 5%. The low success rate is believed to be associated with epigenetic errors, including abnormal DNA hypermethylation, but the mechanism of "reprogramming" is unclear. We have been able to develop a stable NT method in the mouse in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. Especially in the mouse, only a few laboratories can make clones from adult somatic cells, and cloned mice are never successfully produced from most mouse strains. However, this technique promises to be an important tool for future research in basic biology. For example, NT can be used to generate embryonic stem (NT-ES) cell lines from a patient's own somatic cells. We have shown that NT-ES cells are equivalent to ES cells derived from fertilized embryos and that they can be generated relatively easily from a variety of mouse genotypes and cell types of both sexes, even though it may be more difficult to generate clones directly. In general, NT-ES cell techniques are expected to be applied to regenerative medicine; however, this technique can also be applied to the preservation of genetic resources of mouse strain instead of embryos, oocytes and spermatozoa. This review describes how to improve cloning efficiency and NT-ES cell establishment and further applications.
Soranno, Andrea; Holla, Andrea; Dingfelder, Fabian; Nettels, Daniel; Makarov, Dmitrii E.; Schuler, Benjamin
2017-01-01
Internal friction is an important contribution to protein dynamics at all stages along the folding reaction. Even in unfolded and intrinsically disordered proteins, internal friction has a large influence, as demonstrated with several experimental techniques and in simulations. However, these methods probe different facets of internal friction and have been applied to disparate molecular systems, raising questions regarding the compatibility of the results. To obtain an integrated view, we apply here the combination of two complementary experimental techniques, simulations, and theory to the same system: unfolded protein L. We use single-molecule Förster resonance energy transfer (FRET) to measure the global reconfiguration dynamics of the chain, and photoinduced electron transfer (PET), a contact-based method, to quantify the rate of loop formation between two residues. This combination enables us to probe unfolded-state dynamics on different length scales, corresponding to different parts of the intramolecular distance distribution. Both FRET and PET measurements show that internal friction dominates unfolded-state dynamics at low denaturant concentration, and the results are in remarkable agreement with recent large-scale molecular dynamics simulations using a new water model. The simulations indicate that intrachain interactions and dihedral angle rotation correlate with the presence of internal friction, and theoretical models of polymer dynamics provide a framework for interrelating the contribution of internal friction observed in the two types of experiments and in the simulations. The combined results thus provide a coherent and quantitative picture of internal friction in unfolded proteins that could not be attained from the individual techniques. PMID:28223518
Soranno, Andrea; Holla, Andrea; Dingfelder, Fabian; Nettels, Daniel; Makarov, Dmitrii E; Schuler, Benjamin
2017-03-07
Internal friction is an important contribution to protein dynamics at all stages along the folding reaction. Even in unfolded and intrinsically disordered proteins, internal friction has a large influence, as demonstrated with several experimental techniques and in simulations. However, these methods probe different facets of internal friction and have been applied to disparate molecular systems, raising questions regarding the compatibility of the results. To obtain an integrated view, we apply here the combination of two complementary experimental techniques, simulations, and theory to the same system: unfolded protein L. We use single-molecule Förster resonance energy transfer (FRET) to measure the global reconfiguration dynamics of the chain, and photoinduced electron transfer (PET), a contact-based method, to quantify the rate of loop formation between two residues. This combination enables us to probe unfolded-state dynamics on different length scales, corresponding to different parts of the intramolecular distance distribution. Both FRET and PET measurements show that internal friction dominates unfolded-state dynamics at low denaturant concentration, and the results are in remarkable agreement with recent large-scale molecular dynamics simulations using a new water model. The simulations indicate that intrachain interactions and dihedral angle rotation correlate with the presence of internal friction, and theoretical models of polymer dynamics provide a framework for interrelating the contribution of internal friction observed in the two types of experiments and in the simulations. The combined results thus provide a coherent and quantitative picture of internal friction in unfolded proteins that could not be attained from the individual techniques.
NASA Astrophysics Data System (ADS)
Hohenberger, Erik; Freitag, Nathan; Korampally, Venumadhav
2017-07-01
We report on a facile and low cost fabrication approach for structures—gratings and enclosed nanochannels, through simple solution processed chemistries in conjunction with nanotransfer printing techniques. The ink formulation primarily consisting of an organosilicate polymeric network with a small percentage of added 3-aminopropyl triethoxysilane crosslinker allows one to obtain robust structures that are not only stable towards high temperature processing steps as high as 550 °C but also exhibit exceptional stability against a host of organic solvent washes. No discernable structure distortion was observed compared to the as-printed structures (room temperature processed) when printed structures were subjected to temperatures as high as 550 °C. We further demonstrate the applicability of this technique towards the fabrication of more complex nanostructures such as enclosed channels through a double transfer method, leveraging the exceptional room temperature cross-linking ability of the printed structures and their subsequent resistance to dissolution in organic solvent washes. The exceptional temperature and physico-chemical stability of the nanotransfer printed structures makes this a useful fabrication tool that may be applied as is, or integrated with conventional lithographic techniques for the large area fabrication of functional nanostructures and devices.
Wavelet Analyses of F/A-18 Aeroelastic and Aeroservoelastic Flight Test Data
NASA Technical Reports Server (NTRS)
Brenner, Martin J.
1997-01-01
Time-frequency signal representations combined with subspace identification methods were used to analyze aeroelastic flight data from the F/A-18 Systems Research Aircraft (SRA) and aeroservoelastic data from the F/A-18 High Alpha Research Vehicle (HARV). The F/A-18 SRA data were produced from a wingtip excitation system that generated linear frequency chirps and logarithmic sweeps. HARV data were acquired from digital Schroeder-phased and sinc pulse excitation signals to actuator commands. Nondilated continuous Morlet wavelets implemented as a filter bank were chosen for the time-frequency analysis to eliminate phase distortion as it occurs with sliding window discrete Fourier transform techniques. Wavelet coefficients were filtered to reduce effects of noise and nonlinear distortions identically in all inputs and outputs. Cleaned reconstructed time domain signals were used to compute improved transfer functions. Time and frequency domain subspace identification methods were applied to enhanced reconstructed time domain data and improved transfer functions, respectively. Time domain subspace performed poorly, even with the enhanced data, compared with frequency domain techniques. A frequency domain subspace method is shown to produce better results with the data processed using the Morlet time-frequency technique.
Cross-country transferability of multi-variable damage models
NASA Astrophysics Data System (ADS)
Wagenaar, Dennis; Lüdtke, Stefan; Kreibich, Heidi; Bouwer, Laurens
2017-04-01
Flood damage assessment is often done with simple damage curves based only on flood water depth. Additionally, damage models are often transferred in space and time, e.g. from region to region or from one flood event to another. Validation has shown that depth-damage curve estimates are associated with high uncertainties, particularly when applied in regions outside the area where the data for curve development was collected. Recently, progress has been made with multi-variable damage models created with data-mining techniques, i.e. Bayesian Networks and random forest. However, it is still unknown to what extent and under which conditions model transfers are possible and reliable. Model validations in different countries will provide valuable insights into the transferability of multi-variable damage models. In this study we compare multi-variable models developed on basis of flood damage datasets from Germany as well as from The Netherlands. Data from several German floods was collected using computer aided telephone interviews. Data from the 1993 Meuse flood in the Netherlands is available, based on compensations paid by the government. The Bayesian network and random forest based models are applied and validated in both countries on basis of the individual datasets. A major challenge was the harmonization of the variables between both datasets due to factors like differences in variable definitions, and regional and temporal differences in flood hazard and exposure characteristics. Results of model validations and comparisons in both countries are discussed, particularly in respect to encountered challenges and possible solutions for an improvement of model transferability.
NASA Astrophysics Data System (ADS)
Abdolkader, Tarek M.; Shaker, Ahmed; Alahmadi, A. N. M.
2018-07-01
With the continuous miniaturization of electronic devices, quantum-mechanical effects such as tunneling become more effective in many device applications. In this paper, a numerical simulation tool is developed under a MATLAB environment to calculate the tunneling probability and current through an arbitrary potential barrier comparing three different numerical techniques: the finite difference method, transfer matrix method, and transmission line method. For benchmarking, the tool is applied to many case studies such as the rectangular single barrier, rectangular double barrier, and continuous bell-shaped potential barrier, each compared to analytical solutions and giving the dependence of the error on the number of mesh points. In addition, a thorough study of the J ‑ V characteristics of MIM and MIIM diodes, used as rectifiers for rectenna solar cells, is presented and simulations are compared to experimental results showing satisfactory agreement. On the undergraduate level, the tool provides a deeper insight for students to compare numerical techniques used to solve various tunneling problems and helps students to choose a suitable technique for a certain application.
Ash deposits - Initiating the change from empiricism to generic engineering. Part 2: Initial results
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wessel, R.A.; Wagoner, C.L.
1986-01-01
The goal is to develop and use calculations and measurements from several engineering disciplines that exceed the demonstrated limitations of present empirical techniques for predicting slagging/fouling behavior. In Part I of this paper, general relationships were presented for assessing effects of deposits and sootblowing on the real-time performance of heat transfer surfaces in pilot- and commercial-scale steam generators. In Part 2, these concepts are applied to the gas-side fouling of heat exchanger tubes. Deposition and heat transfer are calculated for superheater tubes in laboratory and utility furnaces. Numerical results for deposit thickness and heat flux are presented. Comparisons with datamore » show agreement, demonstrating that the broad-base engineering approach is promising.« less
Unsteady aerodynamic modeling and active aeroelastic control
NASA Technical Reports Server (NTRS)
Edwards, J. W.
1977-01-01
Unsteady aerodynamic modeling techniques are developed and applied to the study of active control of elastic vehicles. The problem of active control of a supercritical flutter mode poses a definite design goal stability, and is treated in detail. The transfer functions relating the arbitrary airfoil motions to the airloads are derived from the Laplace transforms of the linearized airload expressions for incompressible two dimensional flow. The transfer function relating the motions to the circulatory part of these loads is recognized as the Theodorsen function extended to complex values of reduced frequency, and is termed the generalized Theodorsen function. Inversion of the Laplace transforms yields exact transient airloads and airfoil motions. Exact root loci of aeroelastic modes are calculated, providing quantitative information regarding subcritical and supercritical flutter conditions.
Influence of MgO Barrier Quality on Spin-Transfer Torque in Magnetic Tunnel Junctions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tiwari, Dhananjay; Sharma, Raghav; Heinonen, O. G.
Here, we studied the bias dependence of spin transfer torque in the MgO-based magnetic tunnel junction using a field-modulated spin torque ferromagnetic resonance measurement technique for three devices with tunneling magnetoresistances (MRs) of 60%, 67%, and 73%, respectively. The devices with a lower MR ratio showed the presence of multiple modes, while the device with higher MR (73%) showed a single resonance mode. We found a lower out-of-plane torkance in our devices compared to the in-plane torkance. The out-of-plane torque is linear with applied bias, while the bias dependence of in-plane torque shows a strong dependence on the MR ratiomore » and hence the barrier quality.« less
Influence of MgO Barrier Quality on Spin-Transfer Torque in Magnetic Tunnel Junctions
Tiwari, Dhananjay; Sharma, Raghav; Heinonen, O. G.; ...
2018-01-08
Here, we studied the bias dependence of spin transfer torque in the MgO-based magnetic tunnel junction using a field-modulated spin torque ferromagnetic resonance measurement technique for three devices with tunneling magnetoresistances (MRs) of 60%, 67%, and 73%, respectively. The devices with a lower MR ratio showed the presence of multiple modes, while the device with higher MR (73%) showed a single resonance mode. We found a lower out-of-plane torkance in our devices compared to the in-plane torkance. The out-of-plane torque is linear with applied bias, while the bias dependence of in-plane torque shows a strong dependence on the MR ratiomore » and hence the barrier quality.« less
Indium nanowires at the silicon surface
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kozhukhov, A. S., E-mail: antonkozhukhov@yandex.ru; Sheglov, D. V.; Latyshev, A. V.
2016-07-15
Conductive indium nanowires up to 50 nm in width and up to 10 μm in length are fabricated on the surface of silicon by local resputtering from the probe of an atomic-force microscope. The transfer of indium from the probe of the atomic-force microscope onto the silicon surface is initiated by applying a potential between the probe and the surface as they approach each other to spacings, at which the mutual repulsive force is ~10{sup –7} N. The conductivity of the nanowires ranges from 7 × 10{sup –3} to 4 × 10{sup –2} Ω cm, which is several orders ofmore » magnitude lower than that in the case of the alternative technique of heat transfer.« less
NASA Technical Reports Server (NTRS)
Tedesco, Marco; Kim, Edward J.
2005-01-01
In this paper, GA-based techniques are used to invert the equations of an electromagnetic model based on Dense Medium Radiative Transfer Theory (DMRT) under the Quasi Crystalline Approximation with Coherent Potential to retrieve snow depth, mean grain size and fractional volume from microwave brightness temperatures. The technique is initially tested on both noisy and not-noisy simulated data. During this phase, different configurations of genetic algorithm parameters are considered to quantify how their change can affect the algorithm performance. A configuration of GA parameters is then selected and the algorithm is applied to experimental data acquired during the NASA Cold Land Process Experiment. Snow parameters retrieved with the GA-DMRT technique are then compared with snow parameters measured on field.
Recent Advances in Voltammetry
Batchelor-McAuley, Christopher; Kätelhön, Enno; Barnes, Edward O; Compton, Richard G; Laborda, Eduardo; Molina, Angela
2015-01-01
Recent progress in the theory and practice of voltammetry is surveyed and evaluated. The transformation over the last decade of the level of modelling and simulation of experiments has realised major advances such that electrochemical techniques can be fully developed and applied to real chemical problems of distinct complexity. This review focuses on the topic areas of: multistep electrochemical processes, voltammetry in ionic liquids, the development and interpretation of theories of electron transfer (Butler–Volmer and Marcus–Hush), advances in voltammetric pulse techniques, stochastic random walk models of diffusion, the influence of migration under conditions of low support, voltammetry at rough and porous electrodes, and nanoparticle electrochemistry. The review of the latter field encompasses both the study of nanoparticle-modified electrodes, including stripping voltammetry and the new technique of ‘nano-impacts’. PMID:26246984
Vertical Photon Transport in Cloud Remote Sensing Problems
NASA Technical Reports Server (NTRS)
Platnick, S.
1999-01-01
Photon transport in plane-parallel, vertically inhomogeneous clouds is investigated and applied to cloud remote sensing techniques that use solar reflectance or transmittance measurements for retrieving droplet effective radius. Transport is couched in terms of weighting functions which approximate the relative contribution of individual layers to the overall retrieval. Two vertical weightings are investigated, including one based on the average number of scatterings encountered by reflected and transmitted photons in any given layer. A simpler vertical weighting based on the maximum penetration of reflected photons proves useful for solar reflectance measurements. These weighting functions are highly dependent on droplet absorption and solar/viewing geometry. A superposition technique, using adding/doubling radiative transfer procedures, is derived to accurately determine both weightings, avoiding time consuming Monte Carlo methods. Superposition calculations are made for a variety of geometries and cloud models, and selected results are compared with Monte Carlo calculations. Effective radius retrievals from modeled vertically inhomogeneous liquid water clouds are then made using the standard near-infrared bands, and compared with size estimates based on the proposed weighting functions. Agreement between the two methods is generally within several tenths of a micrometer, much better than expected retrieval accuracy. Though the emphasis is on photon transport in clouds, the derived weightings can be applied to any multiple scattering plane-parallel radiative transfer problem, including arbitrary combinations of cloud, aerosol, and gas layers.
Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*
Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.
2009-01-01
Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057
Diagnosing collisionless energy transfer using field-particle correlations: Vlasov-Poisson plasmas
NASA Astrophysics Data System (ADS)
Howes, Gregory G.; Klein, Kristopher G.; Li, Tak Chu
2017-02-01
Turbulence plays a key role in the conversion of the energy of large-scale fields and flows to plasma heat, impacting the macroscopic evolution of the heliosphere and other astrophysical plasma systems. Although we have long been able to make direct spacecraft measurements of all aspects of the electromagnetic field and plasma fluctuations in near-Earth space, our understanding of the physical mechanisms responsible for the damping of the turbulent fluctuations in heliospheric plasmas remains incomplete. Here we propose an innovative field-particle correlation technique that can be used to measure directly the secular energy transfer from fields to particles associated with collisionless damping of the turbulent fluctuations. Furthermore, this novel procedure yields information about the collisionless energy transfer as a function of particle velocity, providing vital new information that can help to identify the dominant collisionless mechanism governing the damping of the turbulent fluctuations. Kinetic plasma theory is used to devise the appropriate correlation to diagnose Landau damping, and the field-particle correlation technique is thoroughly illustrated using the simplified case of the Landau damping of Langmuir waves in a 1D-1V (one dimension in physical space and one dimension in velocity space) Vlasov-Poisson plasma. Generalizations necessary to apply the field-particle correlation technique to diagnose the collisionless damping of turbulent fluctuations in the solar wind are discussed, highlighting several caveats. This novel field-particle correlation technique is intended to be used as a primary analysis tool for measurements from current, upcoming and proposed spacecraft missions that are focused on the kinetic microphysics of weakly collisional heliospheric plasmas, including the Magnetospheric Multiscale (MMS), Solar Probe Plus, Solar Orbiter and Turbulence Heating ObserveR (THOR) missions.
Multidisciplinary System Reliability Analysis
NASA Technical Reports Server (NTRS)
Mahadevan, Sankaran; Han, Song; Chamis, Christos C. (Technical Monitor)
2001-01-01
The objective of this study is to develop a new methodology for estimating the reliability of engineering systems that encompass multiple disciplines. The methodology is formulated in the context of the NESSUS probabilistic structural analysis code, developed under the leadership of NASA Glenn Research Center. The NESSUS code has been successfully applied to the reliability estimation of a variety of structural engineering systems. This study examines whether the features of NESSUS could be used to investigate the reliability of systems in other disciplines such as heat transfer, fluid mechanics, electrical circuits etc., without considerable programming effort specific to each discipline. In this study, the mechanical equivalence between system behavior models in different disciplines are investigated to achieve this objective. A new methodology is presented for the analysis of heat transfer, fluid flow, and electrical circuit problems using the structural analysis routines within NESSUS, by utilizing the equivalence between the computational quantities in different disciplines. This technique is integrated with the fast probability integration and system reliability techniques within the NESSUS code, to successfully compute the system reliability of multidisciplinary systems. Traditional as well as progressive failure analysis methods for system reliability estimation are demonstrated, through a numerical example of a heat exchanger system involving failure modes in structural, heat transfer and fluid flow disciplines.
Tucker, M J; Wright, G; Morton, P C; Mayer, M P; Ingargiola, P E; Jones, A E
1995-04-01
To analyze the introduction of a new assisted fertilization technique for the treatment of severe male factor and idiopathic fertilization failure infertilities. Retrospective analysis of 16-month clinical application of IVF-ET where insemination was performed solely by direct intracytoplasmic sperm injection. Clinical IVF-ET program. Ninety-two couples undergoing 105 cycles of sperm injection. One hundred embryo transfers yielded 28 viable pregnancies (28%) from which eight normal deliveries have occurred to date. Complete cleavage arrest or fertilization failure occurred in four cycles, and one couple had all embryos cryopreserved. One thousand one hundred forty-three eggs were injected of which 173 (15%) degenerated. Four hundred seventy-nine of the surviving 970 eggs became normally fertilized (49%), and 381 of these zygotes (79.5%) developed suitably for cryopreservation or for transfer. Thirty-four of 310 embryos transferred implanted, yielding an implantation rate of 11%. Both testicular and epididymal sperm were used successfully to achieve fertilization and pregnancies, as was sperm retrieved by electroejaculation. Older women and couples suffering from prior idiopathic fertilization failure had a markedly poorer outcome. These results confirm that the intracytoplasmic sperm injection technique is a successful form of assisted fertilization that can be applied to a wide range of couples at significant risk from fertilization failure.
Multi-Disciplinary System Reliability Analysis
NASA Technical Reports Server (NTRS)
Mahadevan, Sankaran; Han, Song
1997-01-01
The objective of this study is to develop a new methodology for estimating the reliability of engineering systems that encompass multiple disciplines. The methodology is formulated in the context of the NESSUS probabilistic structural analysis code developed under the leadership of NASA Lewis Research Center. The NESSUS code has been successfully applied to the reliability estimation of a variety of structural engineering systems. This study examines whether the features of NESSUS could be used to investigate the reliability of systems in other disciplines such as heat transfer, fluid mechanics, electrical circuits etc., without considerable programming effort specific to each discipline. In this study, the mechanical equivalence between system behavior models in different disciplines are investigated to achieve this objective. A new methodology is presented for the analysis of heat transfer, fluid flow, and electrical circuit problems using the structural analysis routines within NESSUS, by utilizing the equivalence between the computational quantities in different disciplines. This technique is integrated with the fast probability integration and system reliability techniques within the NESSUS code, to successfully compute the system reliability of multi-disciplinary systems. Traditional as well as progressive failure analysis methods for system reliability estimation are demonstrated, through a numerical example of a heat exchanger system involving failure modes in structural, heat transfer and fluid flow disciplines.
NASA Astrophysics Data System (ADS)
Robinson, Tyler D.; Crisp, David
2018-05-01
Solar and thermal radiation are critical aspects of planetary climate, with gradients in radiative energy fluxes driving heating and cooling. Climate models require that radiative transfer tools be versatile, computationally efficient, and accurate. Here, we describe a technique that uses an accurate full-physics radiative transfer model to generate a set of atmospheric radiative quantities which can be used to linearly adapt radiative flux profiles to changes in the atmospheric and surface state-the Linearized Flux Evolution (LiFE) approach. These radiative quantities describe how each model layer in a plane-parallel atmosphere reflects and transmits light, as well as how the layer generates diffuse radiation by thermal emission and by scattering light from the direct solar beam. By computing derivatives of these layer radiative properties with respect to dynamic elements of the atmospheric state, we can then efficiently adapt the flux profiles computed by the full-physics model to new atmospheric states. We validate the LiFE approach, and then apply this approach to Mars, Earth, and Venus, demonstrating the information contained in the layer radiative properties and their derivatives, as well as how the LiFE approach can be used to determine the thermal structure of radiative and radiative-convective equilibrium states in one-dimensional atmospheric models.
Controllers, observers, and applications thereof
NASA Technical Reports Server (NTRS)
Gao, Zhiqiang (Inventor); Zhou, Wankun (Inventor); Miklosovic, Robert (Inventor); Radke, Aaron (Inventor); Zheng, Qing (Inventor)
2011-01-01
Controller scaling and parameterization are described. Techniques that can be improved by employing the scaling and parameterization include, but are not limited to, controller design, tuning and optimization. The scaling and parameterization methods described here apply to transfer function based controllers, including PID controllers. The parameterization methods also apply to state feedback and state observer based controllers, as well as linear active disturbance rejection (ADRC) controllers. Parameterization simplifies the use of ADRC. A discrete extended state observer (DESO) and a generalized extended state observer (GESO) are described. They improve the performance of the ESO and therefore ADRC. A tracking control algorithm is also described that improves the performance of the ADRC controller. A general algorithm is described for applying ADRC to multi-input multi-output systems. Several specific applications of the control systems and processes are disclosed.
Upper-limb biomechanical analysis of wheelchair transfer techniques in two toilet configurations.
Tsai, Chung-Ying; Boninger, Michael L; Bass, Sarah R; Koontz, Alicia M
2018-06-01
Using proper technique is important for minimizing upper limb kinetics during wheelchair transfers. The objective of the study was to 1) evaluate the transfer techniques used during toilet transfers and 2) determine the impact of technique on upper limb joint loading for two different toilet configurations. Twenty-six manual wheelchair users (23 men and 3 women) performed transfers in a side and front wheelchair-toilet orientation while their habitual transfer techniques were evaluated using the Transfer Assessment Instrument. A motion analysis system and force sensors were used to record biomechanical data during the transfers. More than 20% of the participants failed to complete five transfer skills in the side setup compared to three skills in the front setup. Higher quality skills overall were associated with lower peak forces and moments in both toilet configurations (-0.68 < r < -0.40, p < 0.05). In the side setup, participants who properly placed their hands in a stable position and used proper leading handgrips had lower shoulder resultant joint forces and moments than participants who did not perform these skills correctly (p ≤ 0.04). In the front setup, positioning the wheelchair within three inches of the transfer target was associated with reduced peak trailing forces and moments across all three upper limb joints (p = 0.02). Transfer skills training, making toilet seats level with the wheelchair seat, positioning the wheelchair closer to the toilet and mounting grab bars in a more ideal location for persons who do sitting pivot transfers may facilitate better quality toilet transfers. Published by Elsevier Ltd.
Process techniques of charge transfer time reduction for high speed CMOS image sensors
NASA Astrophysics Data System (ADS)
Zhongxiang, Cao; Quanliang, Li; Ye, Han; Qi, Qin; Peng, Feng; Liyuan, Liu; Nanjian, Wu
2014-11-01
This paper proposes pixel process techniques to reduce the charge transfer time in high speed CMOS image sensors. These techniques increase the lateral conductivity of the photo-generated carriers in a pinned photodiode (PPD) and the voltage difference between the PPD and the floating diffusion (FD) node by controlling and optimizing the N doping concentration in the PPD and the threshold voltage of the reset transistor, respectively. The techniques shorten the charge transfer time from the PPD diode to the FD node effectively. The proposed process techniques do not need extra masks and do not cause harm to the fill factor. A sub array of 32 × 64 pixels was designed and implemented in the 0.18 μm CIS process with five implantation conditions splitting the N region in the PPD. The simulation and measured results demonstrate that the charge transfer time can be decreased by using the proposed techniques. Comparing the charge transfer time of the pixel with the different implantation conditions of the N region, the charge transfer time of 0.32 μs is achieved and 31% of image lag was reduced by using the proposed process techniques.
Code of Federal Regulations, 2011 CFR
2011-07-01
... transfer of USIA audiovisual records to the National Archives of the United States? 1256.96 Section 1256.96... provisions apply to the transfer of USIA audiovisual records to the National Archives of the United States? The provisions of 44 U.S.C. 2107 and 36 CFR part 1228 apply to the transfer of USIA audiovisual...
Transfer learning for visual categorization: a survey.
Shao, Ling; Zhu, Fan; Li, Xuelong
2015-05-01
Regular machine learning and data mining techniques study the training data for future inferences under a major assumption that the future data are within the same feature space or have the same distribution as the training data. However, due to the limited availability of human labeled training data, training data that stay in the same feature space or have the same distribution as the future data cannot be guaranteed to be sufficient enough to avoid the over-fitting problem. In real-world applications, apart from data in the target domain, related data in a different domain can also be included to expand the availability of our prior knowledge about the target future data. Transfer learning addresses such cross-domain learning problems by extracting useful information from data in a related domain and transferring them for being used in target tasks. In recent years, with transfer learning being applied to visual categorization, some typical problems, e.g., view divergence in action recognition tasks and concept drifting in image classification tasks, can be efficiently solved. In this paper, we survey state-of-the-art transfer learning algorithms in visual categorization applications, such as object recognition, image classification, and human action recognition.
Felicíssimo, V C; Guimarães, F F; Cesar, A; Gel'mukhanov, F; Agren, H
2006-11-30
The theory of IR-X-ray pump-probe spectroscopy beyond the Born-Oppenheimer approximation is developed and applied to the study of the dynamics of intramolecular proton transfer in glyoxalmonoxime leading to the formation of the tautomer 2-nitrosoethenol. Due to the IR pump pulses the molecule gains sufficient energy to promote a proton to a weakly bound well. A femtosecond X-ray pulse snapshots the wave packet route and, hence, the dynamics of the proton transfer. The glyoxalmonoxime molecule contains two chemically nonequivalent oxygen atoms that possess distinct roles in the hydrogen bond, a hydrogen donor and an acceptor. Core ionizations of these form two intersecting core-ionized states, the vibronic coupling between which along the OH stretching mode partially delocalizes the core hole, resulting in a hopping of the core hole from one site to another. This, in turn, affects the dynamics of the proton transfer in the core-ionized state. The quantum dynamical simulations of X-ray photoelectron spectra of glyoxalmonoxime driven by strong IR pulses demonstrate the general applicability of the technique for studies of intramolecular proton transfer in systems with vibronic coupling.
Bhogal, Moninder S; Lanyon-Hogg, Thomas; Johnston, Katherine A; Warriner, Stuart L; Baker, Alison
2016-01-29
Peroxisomes are vital metabolic organelles found in almost all eukaryotic organisms, and they rely exclusively on import of their matrix protein content from the cytosol. In vitro import of proteins into isolated peroxisomal fractions has provided a wealth of knowledge on the import process. However, the common method of protease protection garnered no information on the import of an N-terminally truncated PEX5 (PEX5C) receptor construct or peroxisomal malate dehydrogenase 1 (pMDH1) cargo protein into sunflower peroxisomes because of high degrees of protease susceptibility or resistance, respectively. Here we present a means for analysis of in vitro import through a covalent biotin label transfer and employ this method to the import of PEX5C. Label transfer demonstrates that the PEX5C construct is monomeric under the conditions of the import assay. This technique was capable of identifying the PEX5-PEX14 interaction as the first interaction of the import process through competition experiments. Labeling of the peroxisomal protein import machinery by PEX5C demonstrated that this interaction was independent of added cargo protein, and, strikingly, the interaction between PEX5C and the import machinery was shown to be ATP-dependent. These important mechanistic insights highlight the power of label transfer in studying interactions, rather than proteins, of interest and demonstrate that this technique should be applied to future studies of peroxisomal in vitro import. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sluis, C.
1980-09-01
The economic feasibility of plant tissue culture was demonstrated as applied to two plants: jojoba (Simmondsia chinensis) and Euphorbia spp. The gopher weed (Euphorbia lathyris) was selected as the species of Euphorbia to research due to the interest in this plant as a potential source of hydrocarbon-like compounds. High yield female selections of jojoba were chosen from native stands and were researched to determine the economic feasibility of mass producing these plants via a tissue culture micropropagation program. The female jojoba selection was successfully mass produced through tissue culture. Modifications in initiation techniques, as well as in multiplication media andmore » rooting parameters, were necessary to apply the tissue culture system, which had been developed for juvenile seedling tissue, to mature jojobas. Since prior attempts at transfer of tissue cultured plantlets were unsuccessful, transfer research was a major part of the project and has resulted in a system for transfer of rooted jojoba plantlets to soil. Euphorbia lathyris was successfully cultured using shoot tip cultures. Media and procedures were established for culture initiation, multiplication of shoots, callus induction and growth, and root initiation. Well-developed root systems were not attained and root initiation percentages should be increased if the system is to become commercially feasible.« less
Toe-to-hand transfer: Evolving Indications and Relevant Outcomes
Waljee, Jennifer F.; Chung, Kevin C.
2014-01-01
In the late 19th century, the first toe to hand transfer was performed in Vienna, Switzerland as a staged procedure by Nicolandi.(1) Since that time, the advent of microsurgery has revolutionized toe to hand transfers. In 1966, Buncke performed the first microvascular toe to thumb transfer in a rhesus monkey.(2) The first toe to thumb transfer using microsurgical techniques in humans was performed by Cobbett in 1969, followed shortly thereafter by the first transfer of a second toe to the thumb position.(3,4) Today, due to expanding microsurgical techniques and surgeon innovation, the indications and techniques for toe-to-hand transfer procedures continue to evolve and now encompass patients with a variety of acquired and congenital hand defects.(5) PMID:23790426
Sotomaru, Yusuke; Hirakawa, Reiko; Shimada, Akiko; Shiozawa, Seiji; Sugawara, Ayako; Oiwa, Ryo; Nobukiyo, Asako; Okano, Hideyuki; Tamaoki, Norikazu; Nomura, Tatsuji; Hiyama, Eiso; Sasaki, Erika
2009-12-01
The somatic cell nuclear transfer technique has been applied to various mammals to produce cloned animals; however, a standardized method is not applicable to all species. We aimed here to develop optimum procedures for somatic cell cloning in nonhuman primates, using common marmosets. First, we confirmed that parthenogenetic activation of in vitro matured oocytes was successfully induced by electrical stimulation (three cycles of 150 V/mm, 50 microsec x 2, 20 min intervals), and this condition was applied to the egg activation procedure in the subsequent experiments. Next, nuclear transfer to recipient enucleated oocytes was performed 1 h before, immediately after, or 1 h after egg activation treatment. The highest developmental rate was observed when nuclear transfer was performed 1 h before activation, but none of the cloned embryos developed beyond the eight-cell stage. To investigate the causes of the low developmental potential of cloned embryos, a study was performed to determine whether the presence of metaphase II (MII) chromosome in recipient ooplasm has an effect on developmental potential. As a result, only tetraploid cloned embryos produced by transferring a donor cell into a recipient bearing the MII chromosome developed into blastocysts (66.7%). In contrast, neither parthenogenetic embryos nor cloned embryos (whether diploid or tetraploid) produced using enucleated oocytes developed past the eight-cell stage. These results suggest that MII chromosome, or cytoplasm proximal to the MII chromosome, plays a major role in the development of cloned embryos in common marmosets.
Pamboukian, Marilena Martins; Pereira, Carlos Augusto; Augusto, Elisabeth de Fatima Pires; Tonso, Aldo
2011-12-01
Monitoring the specific respiration rate (Q(O2)) is a valuable tool to evaluate cell growth and physiology. However, for low Q(O2) values the accuracy may depend on the measurement methodology, as it is the case in animal cell culture. The widely used "Dynamic Method" imposes serious difficulties concerning oxygen transfer cancellation, especially through membrane oxygenation. This paper presents an improved procedure to this method, through an automated control of the gas inlet composition that can minimize the residual oxygen transfer driving force during the Q(O2) measurement phase. The improved technique was applied to animal cell cultivation, particularly three recombinant S2 (Drosophila melanogaster) insect cell lines grown in a membrane aeration bioreactor. The average measurements of the proposed method reached 98% of stationary liquid phase balance method, taken as a reference, compared to 21% when the traditional method was used. Furthermore, this methodology does not require knowledge of the volumetric transfer coefficient k(L)a, which may vary during growth. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Techniques for detumbling a disabled space base
NASA Technical Reports Server (NTRS)
Kaplan, M. H.
1973-01-01
Techniques and conceptual devices for carrying out detumbling operations are examined, and progress in the development of these concepts is discussed. Devices which reduce tumble to simple spin through active linear motion of a small mass are described, together with a Module for Automatic Dock and Detumble (MADD) that could perform an orbital transfer from the shuttle in order to track and dock at a preselected point on the distressed craft. Once docked, MADD could apply torques by firing thrustors to detumble the passive vehicle. Optimum combinations of mass-motion and external devices for various situation should be developed. The need for completely formulating the automatic control logic of MADD is also emphasized.
N-S/DSMC hybrid simulation of hypersonic flow over blunt body including wakes
NASA Astrophysics Data System (ADS)
Li, Zhonghua; Li, Zhihui; Li, Haiyan; Yang, Yanguang; Jiang, Xinyu
2014-12-01
A hybrid N-S/DSMC method is presented and applied to solve the three-dimensional hypersonic transitional flows by employing the MPC (modular Particle-Continuum) technique based on the N-S and the DSMC method. A sub-relax technique is adopted to deal with information transfer between the N-S and the DSMC. The hypersonic flows over a 70-deg spherically blunted cone under different Kn numbers are simulated using the CFD, DSMC and hybrid N-S/DSMC method. The present computations are found in good agreement with DSMC and experimental results. The present method provides an efficient way to predict the hypersonic aerodynamics in near-continuum transitional flow regime.
Laser-induced fluorescence spectroscopy for improved chemical analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gelbwachs, J.A.
1983-09-01
This report summarizes the progress achieved over the past five years in the laser-induced fluorescence spectroscopy (LIFS) for improved chemical analysis program. Our initial efforts yielded significantly lower detection limits for trace elemental analysis by the use of both cw and pulsed laser excitations. New methods of LIFS were developed that were shown to overcome many of the traditional limitations to LIFS techniques. LIFS methods have been applied to yield fundamental scientific data that further the understanding of forces between atoms and other atoms and molecules. In recent work, two-photon ionization was combined with LIFS and applied, for the firstmore » time, to the study of energy transfer in ions.« less
Wang, Hongzhi; Yushkevich, Paul A.
2013-01-01
Label fusion based multi-atlas segmentation has proven to be one of the most competitive techniques for medical image segmentation. This technique transfers segmentations from expert-labeled images, called atlases, to a novel image using deformable image registration. Errors produced by label transfer are further reduced by label fusion that combines the results produced by all atlases into a consensus solution. Among the proposed label fusion strategies, weighted voting with spatially varying weight distributions derived from atlas-target intensity similarity is a simple and highly effective label fusion technique. However, one limitation of most weighted voting methods is that the weights are computed independently for each atlas, without taking into account the fact that different atlases may produce similar label errors. To address this problem, we recently developed the joint label fusion technique and the corrective learning technique, which won the first place of the 2012 MICCAI Multi-Atlas Labeling Challenge and was one of the top performers in 2013 MICCAI Segmentation: Algorithms, Theory and Applications (SATA) challenge. To make our techniques more accessible to the scientific research community, we describe an Insight-Toolkit based open source implementation of our label fusion methods. Our implementation extends our methods to work with multi-modality imaging data and is more suitable for segmentation problems with multiple labels. We demonstrate the usage of our tools through applying them to the 2012 MICCAI Multi-Atlas Labeling Challenge brain image dataset and the 2013 SATA challenge canine leg image dataset. We report the best results on these two datasets so far. PMID:24319427
SAM-based cell transfer to photopatterned hydrogels for microengineering vascular-like structures.
Sadr, Nasser; Zhu, Mojun; Osaki, Tatsuya; Kakegawa, Takahiro; Yang, Yunzhi; Moretti, Matteo; Fukuda, Junji; Khademhosseini, Ali
2011-10-01
A major challenge in tissue engineering is to reproduce the native 3D microvascular architecture fundamental for in vivo functions. Current approaches still lack a network of perfusable vessels with native 3D structural organization. Here we present a new method combining self-assembled monolayer (SAM)-based cell transfer and gelatin methacrylate hydrogel photopatterning techniques for microengineering vascular structures. Human umbilical vein cell (HUVEC) transfer from oligopeptide SAM-coated surfaces to the hydrogel revealed two SAM desorption mechanisms: photoinduced and electrochemically triggered. The former, occurs concomitantly to hydrogel photocrosslinking, and resulted in efficient (>97%) monolayer transfer. The latter, prompted by additional potential application, preserved cell morphology and maintained high transfer efficiency of VE-cadherin positive monolayers over longer culture periods. This approach was also applied to transfer HUVECs to 3D geometrically defined vascular-like structures in hydrogels, which were then maintained in perfusion culture for 15 days. As a step toward more complex constructs, a cell-laden hydrogel layer was photopatterned around the endothelialized channel to mimic the vascular smooth muscle structure of distal arterioles. This study shows that the coupling of the SAM-based cell transfer and hydrogel photocrosslinking could potentially open up new avenues in engineering more complex, vascularized tissue constructs for regenerative medicine and tissue engineering applications. Copyright © 2011 Elsevier Ltd. All rights reserved.
A facile alternative technique for large-area graphene transfer via sacrificial polymer
Auchter, Eric; Marquez, Justin; Yarbro, Stephen L.; ...
2017-12-07
A novel method of transferring large-area graphene sheets onto a variety of substrates using Formvar (polyvinyl formal) is presented. Due to the ease at which formvar can be dissolved in chloroform this method allows for a consistent, a clean, and a more rapid transfer than other techniques including the PMMA assisted one. This novel transfer method is demonstrated by transferring large-area graphene onto a range of substrates including commercial TEM grids, silicon dioxide and glass. Raman spectroscopy was used to confirm the presence of graphene and characterize the morphological properties of the large-area sheets. SEM and AFM analyses demonstrated themore » effectiveness of our rapid transfer technique for clean crystalline large-area graphene sheets. The removal of the sacrificial polymer was found to be one to two orders of magnitude faster than PMMA methods. Ultimately this facile transfer technique offers new opportunities for a wide range of applications for large-area graphene through the utilization of a new sacrificial polymer.« less
A facile alternative technique for large-area graphene transfer via sacrificial polymer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auchter, Eric; Marquez, Justin; Yarbro, Stephen L.
A novel method of transferring large-area graphene sheets onto a variety of substrates using Formvar (polyvinyl formal) is presented. Due to the ease at which formvar can be dissolved in chloroform this method allows for a consistent, a clean, and a more rapid transfer than other techniques including the PMMA assisted one. This novel transfer method is demonstrated by transferring large-area graphene onto a range of substrates including commercial TEM grids, silicon dioxide and glass. Raman spectroscopy was used to confirm the presence of graphene and characterize the morphological properties of the large-area sheets. SEM and AFM analyses demonstrated themore » effectiveness of our rapid transfer technique for clean crystalline large-area graphene sheets. The removal of the sacrificial polymer was found to be one to two orders of magnitude faster than PMMA methods. Ultimately this facile transfer technique offers new opportunities for a wide range of applications for large-area graphene through the utilization of a new sacrificial polymer.« less
Apodized coupled resonator waveguides.
Capmany, J; Muñoz, P; Domenech, J D; Muriel, M A
2007-08-06
In this paper we propose analyse the apodisation or windowing of the coupling coefficients in the unit cells of coupled resonator waveguide devices (CROWs) as a means to reduce the level of secondary sidelobes in the bandpass characteristic of their transfer functions. This technique is regularly employed in the design of digital filters and has been applied as well in the design of other photonic devices such as corrugated waveguide filters and fiber Bragg gratings. The apodisation of both Type-I and Type-II structures is discussed for several windowing functions.
Battaglia, Corsin; Söderström, Karin; Escarré, Jordi; Haug, Franz-Josef; Despeisse, Matthieu; Ballif, Christophe
2013-01-01
We describe a nanomoulding technique which allows low-cost nanoscale patterning of functional materials, materials stacks and full devices. Nanomoulding combined with layer transfer enables the replication of arbitrary surface patterns from a master structure onto the functional material. Nanomoulding can be performed on any nanoimprinting setup and can be applied to a wide range of materials and deposition processes. In particular we demonstrate the fabrication of patterned transparent zinc oxide electrodes for light trapping applications in solar cells. PMID:23380874
NASA Astrophysics Data System (ADS)
Orozco Cortés, Luis Fernando; Fernández García, Nicolás
2014-05-01
A method to obtain the general solution of any constant piecewise potential is presented, this is achieved by means of the analysis of the transfer matrices in each cutoff. The resonance phenomenon together with the supersymmetric quantum mechanics technique allow us to construct a wide family of complex potentials which can be used as theoretical models for optical systems. The method is applied to the particular case for which the potential function has six cutoff points.
Invariant-Based Inverse Engineering of Crane Control Parameters
NASA Astrophysics Data System (ADS)
González-Resines, S.; Guéry-Odelin, D.; Tobalina, A.; Lizuain, I.; Torrontegui, E.; Muga, J. G.
2017-11-01
By applying invariant-based inverse engineering in the small-oscillation regime, we design the time dependence of the control parameters of an overhead crane (trolley displacement and rope length) to transport a load between two positions at different heights with minimal final-energy excitation for a microcanonical ensemble of initial conditions. The analogy between ion transport in multisegmented traps or neutral-atom transport in moving optical lattices and load manipulation by cranes opens a route for a useful transfer of techniques among very different fields.
Toxic-Waste Disposal by Combustion in Containers
NASA Technical Reports Server (NTRS)
Houseman, J.; Stephens, J. B.; Moynihan, P. I.; Compton, L. E.; Kalvinskas, J. J.
1986-01-01
Chemical wastes burned with minimal handling in storage containers. Technique for disposing of chemical munitions by burning them inside shells applies to disposal of toxic materials stored in drums. Fast, economical procedure overcomes heat-transfer limitations of conventional furnace designs by providing direct contact of oxygenrich combustion gases with toxic agent. No need to handle waste material, and container also decontaminated in process. Oxygen-rich torch flame cuts burster well and causes vaporization and combustion of toxic agent contained in shell.
CCD research. [design, fabrication, and applications
NASA Technical Reports Server (NTRS)
Gassaway, J. D.
1976-01-01
The fundamental problems encountered in designing, fabricating, and applying CCD's are reviewed. Investigations are described and results and conclusions are given for the following: (1) the development of design analyses employing computer aided techniques and their application to the design of a grapped structure; (2) the role of CCD's in applications to electronic functions, in particular, signal processing; (3) extending the CCD to silicon films on sapphire (SOS); and (4) all aluminum transfer structure with low noise input-output circuits. Related work on CCD imaging devices is summarized.
Convergent spray process for environmentally friendly coatings
NASA Technical Reports Server (NTRS)
Scarpa, Jack
1995-01-01
Conventional spray application processes have poor transfer efficiencies, resulting in an exorbitant loss in materials, solvents, and time. Also, with ever tightening Environmental Protection Agency (EPA) regulations and Occupational Safety and Health Administration requirements, the low transfer efficiencies have a significant impact on the quantities of materials and solvents that are released into the environment. High solids spray processes are also limited by material viscosities, thus requiring many passes over the surface to achieve a thickness in the 0.125 -inch range. This results in high application costs and a negative impact on the environment. Until recently, requirements for a 100 percent solid sprayable, environmentally friendly, lightweight thermal protection system that can be applied in a thick (greater than 0.125 inch) single-pass operation exceeded the capability of existing systems. Such coatings must be applied by hand lay-up techniques, especially for thermal and/or fire protection systems. The current formulation of these coatings has presented many problems such as worker safety, environmental hazards, waste, high cost, and application constraints. A system which can apply coatings without using hazardous materials would alleviate many of these problems. Potential applications include the aerospace thermal protective specialty coatings, chemical and petroleum industries that require fire-protection coatings that resist impact, chemicals, and weather. These markets can be penetrated by offering customized coatings applied by automated processes that are environmentally friendly.
Atmospheric Precorrected Differential Absorption technique to retrieve columnar water vapor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schlaepfer, D.; Itten, K.I.; Borel, C.C.
1998-09-01
Differential absorption techniques are suitable to retrieve the total column water vapor contents from imaging spectroscopy data. A technique called Atmospheric Precorrected Differential Absorption (APDA) is derived directly from simplified radiative transfer equations. It combines a partial atmospheric correction with a differential absorption technique. The atmospheric path radiance term is iteratively corrected during the retrieval of water vapor. This improves the results especially over low background albedos. The error of the method for various ground reflectance spectra is below 7% for most of the spectra. The channel combinations for two test cases are then defined, using a quantitative procedure, whichmore » is based on MODTRAN simulations and the image itself. An error analysis indicates that the influence of aerosols and channel calibration is minimal. The APDA technique is then applied to two AVIRIS images acquired in 1991 and 1995. The accuracy of the measured water vapor columns is within a range of {+-}5% compared to ground truth radiosonde data.« less
Leveraging Experiential Learning Techniques for Transfer
ERIC Educational Resources Information Center
Furman, Nate; Sibthorp, Jim
2013-01-01
Experiential learning techniques can be helpful in fostering learning transfer. Techniques such as project-based learning, reflective learning, and cooperative learning provide authentic platforms for developing rich learning experiences. In contrast to more didactic forms of instruction, experiential learning techniques foster a depth of learning…
Code of Federal Regulations, 2011 CFR
2011-01-01
... for license to apply or initially transfer. 32.14 Section 32.14 Energy NUCLEAR REGULATORY COMMISSION SPECIFIC DOMESTIC LICENSES TO MANUFACTURE OR TRANSFER CERTAIN ITEMS CONTAINING BYPRODUCT MATERIAL Exempt... or initially transfer. An application for a specific license to apply byproduct material to, or to...
NASA Astrophysics Data System (ADS)
M K, Harsha Kumar; P S, Vishweshwara; N, Gnanasekaran; C, Balaji
2018-05-01
The major objectives in the design of thermal systems are obtaining the information about thermophysical, transport and boundary properties. The main purpose of this paper is to estimate the unknown heat flux at the surface of a solid body. A constant area mild steel fin is considered and the base is subjected to constant heat flux. During heating, natural convection heat transfer occurs from the fin to ambient. The direct solution, which is the forward problem, is developed as a conjugate heat transfer problem from the fin and the steady state temperature distribution is recorded for any assumed heat flux. In order to model the natural convection heat transfer from the fin, an extended domain is created near the fin geometry and air is specified as a fluid medium and Navier Stokes equation is solved by incorporating the Boussinesq approximation. The computational time involved in executing the forward model is then reduced by developing a neural network (NN) between heat flux values and temperatures based on back propagation algorithm. The conjugate heat transfer NN model is now coupled with Genetic algorithm (GA) for the solution of the inverse problem. Initially, GA is applied to the pure surrogate data, the results are then used as input to the Levenberg- Marquardt method and such hybridization is proven to result in accurate estimation of the unknown heat flux. The hybrid method is then applied for the experimental temperature to estimate the unknown heat flux. A satisfactory agreement between the estimated and actual heat flux is achieved by incorporating the hybrid method.
Bridging the gap between high and low acceleration for planetary escape
NASA Astrophysics Data System (ADS)
Indrikis, Janis; Preble, Jeffrey C.
With the exception of the often time consuming analysis by numerical optimization, no single orbit transfer analysis technique exists that can be applied over a wide range of accelerations. Using the simple planetary escape (parabolic trajectory) mission some of the more common techniques are considered as the limiting bastions at the high and the extremely low acceleration regimes. The brachistochrone, the minimum time of flight path, is proposed as the technique to bridge the gap between the high and low acceleration regions, providing a smooth bridge over the entire acceleration spectrum. A smooth and continuous velocity requirement is established for the planetary escape mission. By using these results, it becomes possible to determine the effect of finite accelerations on mission performance and target propulsion and power system designs which are consistent with a desired mission objective.
Liquid Crystals, PIV and IR-Photography in Selected Technical and Biomedical Applications
NASA Astrophysics Data System (ADS)
Stasiek, Jan; Jewartowski, Marcin
2017-10-01
Thermochromic liquid crystals (TLC), Particle Image Velocimetry (PIV), Infrared Imaging Themography (IR) and True-Colour Digital Image Processing (TDIP) have been successfully used in non-intrusive technical, industrial and biomedical studies and applications. These four tools (based on the desktop computers) have come together during the past two decades to produce a powerful advanced experimental technique as a judgment of quality of information that cannot be obtained from any other imaging procedure. The brief summary of the history of this technique is reviewed, principal methods and tools are described and some examples are presented. With this objective, a new experimental technique have been developed and applied to the study of heat and mass transfer and for biomedical diagnosis. Automated evaluation allows determining the heat and flow visualisation and locate the area of suspicious tissue of human body.
Toward designing semiconductor-semiconductor heterojunctions for photocatalytic applications
NASA Astrophysics Data System (ADS)
Zhang, Liping; Jaroniec, Mietek
2018-02-01
Semiconductor photocatalysts show a great potential for environmental and energy-related applications, however one of the major disadvantages is their relatively low photocatalytic performance due to the recombination of electron-hole pairs. Therefore, intensive research is being conducted toward design of heterojunctions, which have been shown to be effective for improving the charge-transfer properties and efficiency of photocatalysts. According to the type of band alignment and direction of internal electric field, heterojunctions are categorized into five different types, each of which is associated with its own charge transfer characteristics. Since the design of heterojunctions requires the knowledge of band edge positions of component semiconductors, the commonly used techniques for the assessment of band edge positions are reviewed. Among them the electronegativity-based calculation method is applied for a large number of popular visible-light-active semiconductors, including some widely investigated bismuth-containing semiconductors. On basis of the calculated band edge positions and the type of component semiconductors reported, heterojunctions composed of the selected bismuth-containing semiconductors are proposed. Finally, the most popular synthetic techniques for the fabrication of heterojunctions are briefly discussed.
Chen, Zhenning; Shao, Xinxing; He, Xiaoyuan; Wu, Jialin; Xu, Xiangyang; Zhang, Jinlin
2017-09-01
Noninvasive, three-dimensional (3-D), full-field surface deformation measurements of the human body are important for biomedical investigations. We proposed a 3-D noninvasive, full-field body sensor based on stereo digital image correlation (stereo-DIC) for surface deformation monitoring of the human body in vivo. First, by applying an improved water-transfer printing (WTP) technique to transfer optimized speckle patterns onto the skin, the body sensor was conveniently and harmlessly fabricated directly onto the human body. Then, stereo-DIC was used to achieve 3-D noncontact and noninvasive surface deformation measurements. The accuracy and efficiency of the proposed body sensor were verified and discussed by considering different complexions. Moreover, the fabrication of speckle patterns on human skin, which has always been considered a challenging problem, was shown to be feasible, effective, and harmless as a result of the improved WTP technique. An application of the proposed stereo-DIC-based body sensor was demonstrated by measuring the pulse wave velocity of human carotid artery. (2017) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dernotte, Jeremie; Dec, John E.; Ji, Chunsheng
A detailed understanding of the various factors affecting the trends in gross-indicated thermal efficiency with changes in key operating parameters has been carried out, applied to a one-liter displacement single-cylinder boosted Low-Temperature Gasoline Combustion (LTGC) engine. This work systematically investigates how the supplied fuel energy splits into the following four energy pathways: gross-indicated thermal efficiency, combustion inefficiency, heat transfer and exhaust losses, and how this split changes with operating conditions. Additional analysis is performed to determine the influence of variations in the ratio of specific heat capacities (γ) and the effective expansion ratio, related to the combustion-phasing retard (CA50), onmore » the energy split. Heat transfer and exhaust losses are computed using multiple standard cycle analysis techniques. Furthermore, the various methods are evaluated in order to validate the trends.« less
A micropatterning and image processing approach to simplify measurement of cellular traction forces
Polio, Samuel R.; Rothenberg, Katheryn E.; Stamenović, Dimitrije; Smith, Michael L.
2012-01-01
Quantification of the traction forces that cells apply to their surroundings has been critical to the advancement of our understanding of cancer, development and basic cell biology. This field was made possible through the development of engineered cell culture systems that permit optical measurement of cell-mediated displacements and computational algorithms that allow conversion of these displacements into stresses and forces. Here, we present a novel advancement of traction force microscopy on polyacrylamide (PAA) gels that addresses limitations of existing technologies. Through an indirect patterning technique, we generated PAA gels with fluorescent 1 μm dot markers in a regularized array. This improves existing traction measurements since (i) multiple fields of view can be measured in one experiment without the need for cell removal; (ii) traction vectors are modeled as discrete point forces, and not as a continuous field, using an extremely simple computational algorithm that we have made available online; and (iii) the pattern transfer technique is amenable to any of the published techniques for producing patterns on glass. In the future, this technique will be used for measuring traction forces on complex patterns with multiple, spatially distinct ligands in systems for applying strain to the substrate, and in sandwich cultures that generate quasi-three-dimensional environments for cells. PMID:21884832
Numerical Analysis of the Heat Transfer Characteristics within an Evaporating Meniscus
NASA Astrophysics Data System (ADS)
Ball, Gregory
A numerical analysis was performed as to investigate the heat transfer characteristics of an evaporating thin-film meniscus. A mathematical model was used in the formulation of a third order ordinary differential equation. This equation governs the evaporating thin-film through use of continuity, momentum, energy equations and the Kelvin-Clapeyron model. This governing equation was treated as an initial value problem and was solved numerically using a Runge-Kutta technique. The numerical model uses varying thermophysical properties and boundary conditions such as channel width, applied superheat, accommodation coefficient and working fluid which can be tailored by the user. This work focused mainly on the effects of altering accommodation coefficient and applied superheat. A unified solution is also presented which models the meniscus to half channel width. The model was validated through comparison to literature values. In varying input values the following was determined; increasing superheat was found to shorten the film thickness and greatly increase the interfacial curvature overshoot values. The effect of decreasing accommodation coefficient lengthened the thin-film and retarded the evaporative effects.
NASA Astrophysics Data System (ADS)
Nava, Andrea; Giuliano, Rosa; Campagnano, Gabriele; Giuliano, Domenico
2016-11-01
Using the properties of the transfer matrix of one-dimensional quantum mechanical systems, we derive an exact formula for the persistent current across a quantum mechanical ring pierced by a magnetic flux Φ as a single integral of a known function of the system's parameters. Our approach provides exact results at zero temperature, which can be readily extended to a finite temperature T . We apply our technique to exactly compute the persistent current through p -wave and s -wave superconducting-normal hybrid rings, deriving full plots of the current as a function of the applied flux at various system's scales. Doing so, we recover at once a number of effects such as the crossover in the current periodicity on increasing the size of the ring and the signature of the topological phase transition in the p -wave case. In the limit of a large ring size, resorting to a systematic expansion in inverse powers of the ring length, we derive exact analytic closed-form formulas, applicable to a number of cases of physical interest.
NASA Astrophysics Data System (ADS)
Zhao, Jing; Chen, Miao; An, Yanqing; Liu, Jianxi; Yan, Fengyuan
2008-12-01
A radical chain-transfer polymerization technique has been applied to graft-polymerize brushes of polystyrene (PSt) on single-crystal silicon substrates. 3-Mercapto-propyltrimethoxysilane (MPTMS), as a chain-transfer agent for grafting, was immobilized on the silicon surface by a self-assembling process. The structure and morphology of the graft-functionalized silicon surfaces were characterized by the means of contact-angle measurement, ellipsometric thickness measurement, Fourier transformation infrared (FTIR) spectroscopy, and atomic force microscopy (AFM). The nanotribological and micromechanical properties of the as-prepared polymer brush films were investigated by frictional force microscopy (FFM), force-volume analysis and scratch test. The results indicate that the friction properties of the grafted polymer films can be improved significantly by the treatment of toluene, and the chemically bonded polystyrene film exhibits superior scratch resistance behavior compared with the spin-coated polystyrene film. The resultant polystyrene brush film is expected to develop as a potential lubrication coating for microelectromechanical systems (MEMS).
A General Approach to the Geostationary Transfer Orbit Mission Recovery
NASA Technical Reports Server (NTRS)
Faber, Nicolas; Aresini, Andrea; Wauthier, Pascal; Francken, Philippe
2007-01-01
This paper discusses recovery scenarios for geosynchronous satellites injected in a non-nominal orbit due to a launcher underperformance. The theory on minimum-fuel orbital transfers is applied to develop an operational tool capable to design a recovery mission. To obtain promising initial guesses for the recovery three complementary techniques are used: p-optimized impulse function contouring, a numerical impulse function minimization and the solutions to the switching equations. The tool evaluates the feasibility of a recovery with the on-board propellant of the spacecraft and performs the complete mission design. This design takes into account for various mission operational constraints such as e.g., the requirement of multiple finite-duration burns, third-body orbital perturbations, spacecraft attitude constraints and ground station visibility. In a final case study, we analyze the consequences of a premature breakdown of an upper rocket stage engine during injection on a geostationary transfer orbit, as well as the possible recovery solution with the satellite on-board propellant.
Computational Fluid Dynamics Uncertainty Analysis Applied to Heat Transfer over a Flat Plate
NASA Technical Reports Server (NTRS)
Groves, Curtis Edward; Ilie, Marcel; Schallhorn, Paul A.
2013-01-01
There have been few discussions on using Computational Fluid Dynamics (CFD) without experimental validation. Pairing experimental data, uncertainty analysis, and analytical predictions provides a comprehensive approach to verification and is the current state of the art. With pressed budgets, collecting experimental data is rare or non-existent. This paper investigates and proposes a method to perform CFD uncertainty analysis only from computational data. The method uses current CFD uncertainty techniques coupled with the Student-T distribution to predict the heat transfer coefficient over a at plate. The inputs to the CFD model are varied from a specified tolerance or bias error and the difference in the results are used to estimate the uncertainty. The variation in each input is ranked from least to greatest to determine the order of importance. The results are compared to heat transfer correlations and conclusions drawn about the feasibility of using CFD without experimental data. The results provide a tactic to analytically estimate the uncertainty in a CFD model when experimental data is unavailable
Charge separation and carrier dynamics in donor-acceptor heterojunction photovoltaic systems.
Teuscher, Joël; Brauer, Jan C; Stepanov, Andrey; Solano, Alicia; Boziki, Ariadni; Chergui, Majed; Wolf, Jean-Pierre; Rothlisberger, Ursula; Banerji, Natalie; Moser, Jacques-E
2017-11-01
Electron transfer and subsequent charge separation across donor-acceptor heterojunctions remain the most important areas of study in the field of third-generation photovoltaics. In this context, it is particularly important to unravel the dynamics of individual ultrafast processes (such as photoinduced electron transfer, carrier trapping and association, and energy transfer and relaxation), which prevail in materials and at their interfaces. In the frame of the National Center of Competence in Research "Molecular Ultrafast Science and Technology," a research instrument of the Swiss National Science Foundation, several groups active in the field of ultrafast science in Switzerland have applied a number of complementary experimental techniques and computational simulation tools to scrutinize these critical photophysical phenomena. Structural, electronic, and transport properties of the materials and the detailed mechanisms of photoinduced charge separation in dye-sensitized solar cells, conjugated polymer- and small molecule-based organic photovoltaics, and high-efficiency lead halide perovskite solar energy converters have been scrutinized. Results yielded more than thirty research articles, an overview of which is provided here.
A simplified method of evaluating the stress wave environment of internal equipment
NASA Technical Reports Server (NTRS)
Colton, J. D.; Desmond, T. P.
1979-01-01
A simplified method called the transfer function technique (TFT) was devised for evaluating the stress wave environment in a structure containing internal equipment. The TFT consists of following the initial in-plane stress wave that propagates through a structure subjected to a dynamic load and characterizing how the wave is altered as it is transmitted through intersections of structural members. As a basis for evaluating the TFT, impact experiments and detailed stress wave analyses were performed for structures with two or three, or more members. Transfer functions that relate the wave transmitted through an intersection to the incident wave were deduced from the predicted wave response. By sequentially applying these transfer functions to a structure with several intersections, it was found that the environment produced by the initial stress wave propagating through the structure can be approximated well. The TFT can be used as a design tool or as an analytical tool to determine whether a more detailed wave analysis is warranted.
Ferrocene pixels by laser-induced forward transfer: towards flexible microelectrode printing
NASA Astrophysics Data System (ADS)
Mitu, B.; Matei, A.; Filipescu, M.; Palla Papavlu, A.; Bercea, A.; Lippert, T.; Dinescu, M.
2017-03-01
The aim of this work is to demonstrate the potential of laser-induced forward transfer (LIFT) as a printing technology, alternative to standard microfabrication techniques, in the area of flexible micro-electrode fabrication. First, ferrocene thin films are deposited onto fused silica and fused silica substrates previously coated with a photodegradable polymer film (triazene polymer) by matrix assisted pulsed laser evaporation (MAPLE). The morphology and chemical structure of the ferrocene thin films deposited by MAPLE has been investigated by atomic force microscopy and Fourier transformed infrared spectroscopy, and no structural damage occurs as a result of the laser deposition. Second, LIFT is applied to print for the first time ferrocene pixels and lines onto flexible polydimethylsiloxane (PDMS) substrates. The ferrocene pixels and lines are flawlessly transferred onto the PDMS substrates in air at room temperature, without the need of additional conventional photolithography processes. We believe that these results are very promising for a variety of applications ranging from flexible electronics to lab-on-a-chip devices, MEMS, and medical implants.
CFD Analysis of Hypersonic Flowfields With Surface Thermochemistry and Ablation
NASA Technical Reports Server (NTRS)
Henline, W. D.
1997-01-01
In the past forty years much progress has been made in computational methods applied to the solution of problems in spacecraft hypervelocity flow and heat transfer. Although the basic thermochemical and physical modeling techniques have changed little in this time, several orders of magnitude increase in the speed of numerically solving the Navier-Stokes and associated energy equations have been achieved. The extent to which this computational power can be applied to the design of spacecraft heat shields is dependent on the proper coupling of the external flow equations to the boundary conditions and governing equations representing the thermal protection system in-depth conduction, pyrolysis and surface ablation phenomena. A discussion of the techniques used to do this in past problems as well as the current state-of-art is provided. Specific examples, including past missions such as Galileo, together with the more recent case studies of ESA/Rosetta Sample Comet Return, Mars Pathfinder and X-33 will be discussed. Modeling assumptions, design approach and computational methods and results are presented.
3D multiscale crack propagation using the XFEM applied to a gas turbine blade
NASA Astrophysics Data System (ADS)
Holl, Matthias; Rogge, Timo; Loehnert, Stefan; Wriggers, Peter; Rolfes, Raimund
2014-01-01
This work presents a new multiscale technique to investigate advancing cracks in three dimensional space. This fully adaptive multiscale technique is designed to take into account cracks of different length scales efficiently, by enabling fine scale domains locally in regions of interest, i.e. where stress concentrations and high stress gradients occur. Due to crack propagation, these regions change during the simulation process. Cracks are modeled using the extended finite element method, such that an accurate and powerful numerical tool is achieved. Restricting ourselves to linear elastic fracture mechanics, the -integral yields an accurate solution of the stress intensity factors, and with the criterion of maximum hoop stress, a precise direction of growth. If necessary, the on the finest scale computed crack surface is finally transferred to the corresponding scale. In a final step, the model is applied to a quadrature point of a gas turbine blade, to compute crack growth on the microscale of a real structure.
Measurement techniques and applications of charge transfer to aerospace research
NASA Technical Reports Server (NTRS)
Smith, A.
1978-01-01
A technique of developing high-velocity low-intensity neutral gas beams for use in aerospace research problems is described. This technique involves ionization of gaseous species with a mass spectrometer and focusing the resulting primary ion beam into a collision chamber containing a static gas at a known pressure and temperature. Equations are given to show how charge-transfer cross sections are obtained from a total-current measurement technique. Important parameters are defined for the charge-transfer process.
NASA Astrophysics Data System (ADS)
Acri, Antonio; Offner, Guenter; Nijman, Eugene; Rejlek, Jan
2016-10-01
Noise legislations and the increasing customer demands determine the Noise Vibration and Harshness (NVH) development of modern commercial vehicles. In order to meet the stringent legislative requirements for the vehicle noise emission, exact knowledge of all vehicle noise sources and their acoustic behavior is required. Transfer path analysis (TPA) is a fairly well established technique for estimating and ranking individual low-frequency noise or vibration contributions via the different transmission paths. Transmission paths from different sources to target points of interest and their contributions can be analyzed by applying TPA. This technique is applied on test measurements, which can only be available on prototypes, at the end of the designing process. In order to overcome the limits of TPA, a numerical transfer path analysis methodology based on the substructuring of a multibody system is proposed in this paper. Being based on numerical simulation, this methodology can be performed starting from the first steps of the designing process. The main target of the proposed methodology is to get information of noise sources contributions of a dynamic system considering the possibility to have multiple forces contemporary acting on the system. The contributions of these forces are investigated with particular focus on distribute or moving forces. In this paper, the mathematical basics of the proposed methodology and its advantages in comparison with TPA will be discussed. Then, a dynamic system is investigated with a combination of two methods. Being based on the dynamic substructuring (DS) of the investigated model, the methodology proposed requires the evaluation of the contact forces at interfaces, which are computed with a flexible multi-body dynamic (FMBD) simulation. Then, the structure-borne noise paths are computed with the wave based method (WBM). As an example application a 4-cylinder engine is investigated and the proposed methodology is applied on the engine block. The aim is to get accurate and clear relationships between excitations and responses of the simulated dynamic system, analyzing the noise and vibrational sources inside a car engine, showing the main advantages of a numerical methodology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Shanlin
2014-11-16
Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest thatmore » the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an electrochemical cell. For example, we are able to use this technique to track electroluminescence of single Au NPs, and the electrodeposition of individual Ag NPs in-situ. These metallic NPs are useful to enhance light harvesting in organic photovoltaic systems. The scattering at the surface of an indium tin oxide (ITO) working electrode was measured during a potential sweep. Utilizing Mie scattering theory and high resolution scanning electron microscopy (SEM), the scattering data were used to calculate current-potential curves depicting the electrodeposition of individual Ag NPs. The oxidation of individual presynthesized and electrodeposited Ag NPs was also investigated using fluorescence and DFS microscopies. Our work has produced 1 US provisional patent, 15 published manuscripts, 1 submitted and two additional in-writing manuscripts. 5 graduate students, 1 postdoctoral student, 1 visiting professor, and two undergraduate students have received research training in the area of electrochemistry and optical spectroscopy under support of this award.« less
State of the art in treatment of facial paralysis with temporalis tendon transfer.
Sidle, Douglas M; Simon, Patrick
2013-08-01
Temporalis tendon transfer is a technique for dynamic facial reanimation. Since its inception, nearly 80 years ago, it has undergone a wealth of innovation to produce the modern operation. The purpose of this review is to update the literature as to the current techniques and perioperative management of patients undergoing temporalis tendon transfer. The modern technique focuses on the minimally invasive approaches and aesthetic refinements to enhance the final product of the operation. The newest techniques as well as preoperative assessment and postoperative rehabilitation are discussed. When temporalis tendon transfer is indicated for facial reanimation, the modern operation offers a refined technique that produces an aesthetically acceptable outcome. Preoperative smile assessment and postoperative smile rehabilitation are necessary and are important adjuncts to a successful operation.
Sun-Earth L1 Region Halo-To-Halo Orbit and Halo-To-LisaJous Orbit Transfers
NASA Technical Reports Server (NTRS)
Roberts, Craig E.; DeFazio, Robert
2004-01-01
Practical techniques for designing transfer trajectories between Libration Point Orbits (LPOs) are presented. Motivation for development of these techniques was provided by a hardware contingency experienced by the Solar Heliospheric Observatory (SOHO), a joint mission of the European Space Agency (ESA) and the National Aeronautics and Space Administration (NASA) orbiting the L1 point of the Sun-Earth system. A potential solution to the problem involved a transfer from SOHO s periodic halo orbit to a new LPO of substantially different dimensions. Assuming the SOHO halo orbit as the departure orbit, several practical LPO transfer techniques were developed to obtain new Lissajous or periodic halo orbits that satisfy mission requirements and constraints. While not implemented for the SOHO mission, practical LPO transfer techniques were devised that are generally applicable to current and future LPO missions.
Non-contact thrust stand calibration method for repetitively pulsed electric thrusters.
Wong, Andrea R; Toftul, Alexandra; Polzin, Kurt A; Pearson, J Boise
2012-02-01
A thrust stand calibration technique for use in testing repetitively pulsed electric thrusters for in-space propulsion has been developed and tested using a modified hanging pendulum thrust stand. In the implementation of this technique, current pulses are applied to a solenoid to produce a pulsed magnetic field that acts against a permanent magnet mounted to the thrust stand pendulum arm. The force on the magnet is applied in this non-contact manner, with the entire pulsed force transferred to the pendulum arm through a piezoelectric force transducer to provide a time-accurate force measurement. Modeling of the pendulum arm dynamics reveals that after an initial transient in thrust stand motion the quasi-steady average deflection of the thrust stand arm away from the unforced or "zero" position can be related to the average applied force through a simple linear Hooke's law relationship. Modeling demonstrates that this technique is universally applicable except when the pulsing period is increased to the point where it approaches the period of natural thrust stand motion. Calibration data were obtained using a modified hanging pendulum thrust stand previously used for steady-state thrust measurements. Data were obtained for varying impulse bit at constant pulse frequency and for varying pulse frequency. The two data sets exhibit excellent quantitative agreement with each other. The overall error on the linear regression fit used to determine the calibration coefficient was roughly 1%.
Quick-start of full-scale anaerobic digestion (AD) using aeration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagerkvist, Anders, E-mail: al@ltu.se; Pelkonen, Markku; Wikström, Tommy
Highlights: • A fast, and original, start up procedure for anaerobic digestors has been applied at full scale. • The development of a methanogenic culture has been documented using fluorescent in situ hybridization. • The technique can be widely applied. - Abstract: A conventional 1300 m{sup 3} continuously stirred anaerobic tank reactor at the city of Boden, north Sweden, which was receiving a feed of both sewage sludge and food waste, was put out of operation due to the build-up of a float phase. The reactor was emptied and cleaned. At start-up there was no methanogenic sludge available, so anmore » unconventional start-up procedure was applied: The reactor was rapidly (8 days with 1200 kg of total solids (TS) added daily) filled with thickened, and slightly acidic sewage sludge, showing only slight methane generation, which was subsequently heated to 55 °C. Then compressed air was blown into the digester and within a month a fully functional methanogenic culture was established. The transfer from acidogenic to methanogenic conditions happened in about one week. As a start-up technique this is fast and cost efficient, it only requires the access of a compressor, electricity and a source of air. In total, about 16 tonnes of oxygen were used. It is proposed that this method may also be used as an operational amendment technique, should a reactor tend to acidify.« less
NASA Astrophysics Data System (ADS)
Reckfort, Julia; Wiese, Hendrik; Dohmen, Melanie; Grässel, David; Pietrzyk, Uwe; Zilles, Karl; Amunts, Katrin; Axer, Markus
2013-09-01
The neuroimaging technique 3D-polarized light imaging (3D-PLI) has opened up new avenues to study the complex nerve fiber architecture of the human brain at sub-millimeter spatial resolution. This polarimetry technique is applicable to histological sections of postmortem brains utilizing the birefringence of nerve fibers caused by the regular arrangement of lipids and proteins in the myelin sheaths surrounding axons. 3D-PLI provides a three-dimensional description of the anatomical wiring scheme defined by the in-section direction angle and the out-of-section inclination angle. To date, 3D-PLI is the only available method that allows bridging the microscopic and the macroscopic description of the fiber architecture of the human brain. Here we introduce a new approach to retrieve the inclination angle of the fibers independently of the properties of the used polarimeters. This is relevant because the image resolution and the signal transmission inuence the measured birefringent signal (retardation) significantly. The image resolution was determined using the USAF- 1951 testchart applying the Rayleigh criterion. The signal transmission was measured by elliptical polarizers applying the Michelson contrast and histological slices of the optic tract of a postmortem brain. Based on these results, a modified retardation-inclination transfer function was proposed to extract the fiber inclination. The comparison of the actual and the inclination angles calculated with the theoretically proposed and the modified transfer function revealed a significant improvement in the extraction of the fiber inclinations.
NASA Astrophysics Data System (ADS)
Guidi, G.; Casado, J.; Ascasibar, Y.; García-Benito, R.; Galbany, L.; Sánchez-Blázquez, P.; Sánchez, S. F.; Rosales-Ortega, F. F.; Scannapieco, C.
2018-06-01
In this work we present a set of synthetic observations that mimic the properties of the Integral Field Spectroscopy (IFS) survey CALIFA, generated using radiative transfer techniques applied to hydrodynamical simulations of galaxies in a cosmological context. The simulated spatially-resolved spectra include stellar and nebular emission, kinematic broadening of the lines, and dust extinction and scattering. The results of the radiative transfer simulations have been post-processed to reproduce the main properties of the CALIFA V500 and V1200 observational setups. The data has been further formatted to mimic the CALIFA survey in terms of field of view size, spectral range and sampling. We have included the effect of the spatial and spectral Point Spread Functions affecting CALIFA observations, and added detector noise after characterizing it on a sample of 367 galaxies. The simulated datacubes are suited to be analysed by the same algorithms used on real IFS data. In order to provide a benchmark to compare the results obtained applying IFS observational techniques to our synthetic datacubes, and test the calibration and accuracy of the analysis tools, we have computed the spatially-resolved properties of the simulations. Hence, we provide maps derived directly from the hydrodynamical snapshots or the noiseless spectra, in a way that is consistent with the values recovered by the observational analysis algorithms. Both the synthetic observations and the product datacubes are public and can be found in the collaboration website http://astro.ft.uam.es/selgifs/data_challenge/.
Privacy-protected biometric templates: acoustic ear identification
NASA Astrophysics Data System (ADS)
Tuyls, Pim T.; Verbitskiy, Evgeny; Ignatenko, Tanya; Schobben, Daniel; Akkermans, Ton H.
2004-08-01
Unique Biometric Identifiers offer a very convenient way for human identification and authentication. In contrast to passwords they have hence the advantage that they can not be forgotten or lost. In order to set-up a biometric identification/authentication system, reference data have to be stored in a central database. As biometric identifiers are unique for a human being, the derived templates comprise unique, sensitive and therefore private information about a person. This is why many people are reluctant to accept a system based on biometric identification. Consequently, the stored templates have to be handled with care and protected against misuse [1, 2, 3, 4, 5, 6]. It is clear that techniques from cryptography can be used to achieve privacy. However, as biometric data are noisy, and cryptographic functions are by construction very sensitive to small changes in their input, and hence one can not apply those crypto techniques straightforwardly. In this paper we show the feasibility of the techniques developed in [5], [6] by applying them to experimental biometric data. As biometric identifier we have choosen the shape of the inner ear-canal, which is obtained by measuring the headphone-to-ear-canal Transfer Functions (HpTFs) which are known to be person dependent [7].
Fast alternative Monte Carlo formalism for a class of problems in biophotonics
NASA Astrophysics Data System (ADS)
Miller, Steven D.
1997-12-01
A practical and effective, alternative Monte Carlo formalism is presented that rapidly finds flux solutions to the radiative transport equation for a class of problems in biophotonics; namely, wide-beam irradiance of finite, optically anisotropic homogeneous or heterogeneous biomedias, which both strongly scatter and absorb light. Such biomedias include liver, tumors, blood, or highly blood perfused tissues. As Fermat rays comprising a wide coherent (laser) beam enter the tissue, they evolve into a bundle of random optical paths or trajectories due to scattering. Overall, this can be physically interpreted as a bundle of Markov trajectories traced out by a 'gas' of Brownian-like point photons being successively scattered and absorbed. By considering the cumulative flow of a statistical bundle of trajectories through interior data planes, the effective equivalent information of the (generally unknown) analytical flux solutions of the transfer equation rapidly emerges. Unlike the standard Monte Carlo techniques, which evaluate scalar fluence, this technique is faster, more efficient, and simpler to apply for this specific class of optical situations. Other analytical or numerical techniques can either become unwieldy or lack viability or are simply more difficult to apply. Illustrative flux calculations are presented for liver, blood, and tissue-tumor-tissue systems.
Kankipati, Padmaja; Boninger, Michael L; Gagnon, Dany; Cooper, Rory A; Koontz, Alicia M
2015-07-01
Repeated measures design. This study compared the upper extremity (UE) joint kinetics between three transfer techniques. Research laboratory. Twenty individuals with spinal cord injury performed three transfer techniques from their wheelchair to a level tub bench. Two of the techniques involved a head-hips method with leading hand position close (HH-I) and far (HH-A) from the body, and the third technique with the trunk upright (TU) and hand far from body. Motion analysis equipment recorded upper body movements and force sensors recorded their hand and feet reaction forces during the transfers. Several significant differences were found between HH-A and HH-I and TU and HH-I transfers indicating that hand placement was a key factor influencing the UE joint kinetics. Peak resultant hand, elbow, and shoulder joint forces were significantly higher for the HH-A and TU techniques at the trailing arm (P < 0.036) and lower at the leading arm (P < 0.021), compared to the HH-I technique. Always trailing with the same arm if using HH-A or TU could predispose that arm to overuse related pain and injuries. Technique training should focus on initial hand placement close to the body followed by the amount of trunk flexion needed to facilitate movement.
Single-Molecule Interfacial Electron Transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, H. Peter
This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static andmore » dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO 2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO 2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO 2 nanoparticle surfaces by using ultrafast single-molecule spectroscopy and electrochemical AFM metal tip scanning microscopy, focusing on understanding the interfacial electron transfer dynamics at specific nanoscale electron transfer sites with high-spatially and temporally resolved topographic-and-spectroscopic characterization at individual molecule basis, characterizing single-molecule rate processes, reaction driving force, and molecule-substrate electronic coupling. One of the most significant characteristics of our new approach is that we are able to interrogate the complex interfacial electron transfer dynamics by actively pin-point energetic manipulation of the surface interaction and electronic couplings, beyond the conventional excitation and observation.« less
NASA Astrophysics Data System (ADS)
Laramie, Sydney M.; Milshtein, Jarrod D.; Breault, Tanya M.; Brushett, Fikile R.; Thompson, Levi T.
2016-09-01
Non-aqueous redox flow batteries (NAqRFBs) have recently received considerable attention as promising high energy density, low cost grid-level energy storage technologies. Despite these attractive features, NAqRFBs are still at an early stage of development and innovative design techniques are necessary to improve performance and decrease costs. In this work, we investigate multi-electron transfer, common ion exchange NAqRFBs. Common ion systems decrease the supporting electrolyte requirement, which subsequently improves active material solubility and decreases electrolyte cost. Voltammetric and electrolytic techniques are used to study the electrochemical performance and chemical compatibility of model redox active materials, iron (II) tris(2,2‧-bipyridine) tetrafluoroborate (Fe(bpy)3(BF4)2) and ferrocenylmethyl dimethyl ethyl ammonium tetrafluoroborate (Fc1N112-BF4). These results help disentangle complex cycling behavior observed in flow cell experiments. Further, a simple techno-economic model demonstrates the cost benefits of employing common ion exchange NAqRFBs, afforded by decreasing the salt and solvent contributions to total chemical cost. This study highlights two new concepts, common ion exchange and multi-electron transfer, for NAqRFBs through a demonstration flow cell employing model active species. In addition, the compatibility analysis developed for asymmetric chemistries can apply to other promising species, including organics, metal coordination complexes (MCCs) and mixed MCC/organic systems, enabling the design of low cost NAqRFBs.
Electro-magneto interaction in fractional Green-Naghdi thermoelastic solid with a cylindrical cavity
NASA Astrophysics Data System (ADS)
Ezzat, M. A.; El-Bary, A. A.
2018-01-01
A unified mathematical model of Green-Naghdi's thermoelasticty theories (GN), based on fractional time-derivative of heat transfer is constructed. The model is applied to solve a one-dimensional problem of a perfect conducting unbounded body with a cylindrical cavity subjected to sinusoidal pulse heating in the presence of an axial uniform magnetic field. Laplace transform techniques are used to get the general analytical solutions in Laplace domain, and the inverse Laplace transforms based on Fourier expansion techniques are numerically implemented to obtain the numerical solutions in time domain. Comparisons are made with the results predicted by the two theories. The effects of the fractional derivative parameter on thermoelastic fields for different theories are discussed.
Brandão, Eric; Flesch, Rodolfo C C; Lenzi, Arcanjo; Flesch, Carlos A
2011-07-01
The pressure-particle velocity (PU) impedance measurement technique is an experimental method used to measure the surface impedance and the absorption coefficient of acoustic samples in situ or under free-field conditions. In this paper, the measurement uncertainty of the the absorption coefficient determined using the PU technique is explored applying the Monte Carlo method. It is shown that because of the uncertainty, it is particularly difficult to measure samples with low absorption and that difficulties associated with the localization of the acoustic centers of the sound source and the PU sensor affect the quality of the measurement roughly to the same extent as the errors in the transfer function between pressure and particle velocity do. © 2011 Acoustical Society of America
NASA Astrophysics Data System (ADS)
Wei, Shiqing; Castleman, A. W., Jr.
1994-02-01
Lase based time-of-flight mass spectrometer systems affixed with reflectrons are valuable tools for investigating cluster dynamics and reactions, spectroscopy and structures. Utilizing the reflectron time-of-flight mass spectrometer techniques, both decay fractions and kinetic energy releases of metastable cluster ions can be measured with high precision. By applying related theoretical models, the desired thermochemical values of metastable species can be deduced, which are otherwise very difficult to obtain. Several examples are discussed with attention focused on ammonia as a test case for hydrogen bond systems, and xenon for weaker van der Waals clusters. A brief overview of applications to investigating solvation effects on reactions and structures, delayed electron transfer and ionization through intracluster Penning ionization is also given.
Infrared Database for Process Support Materials
NASA Technical Reports Server (NTRS)
Bennett, K. E.; Boothe, R. E.; Burns, H. D.
2003-01-01
Process support materials' compatibility with cleaning processes is critical to ensure final hardware cleanliness and that performance requirements are met. Previous discovery of potential contaminants in process materials shows the need for incoming materials testing and establishment of a process materials database. The Contamination Control Team of the Materials, Processes, and Manufacturing (MP&M) Department at Marshall Space Flight Center (MSFC) has initiated the development of such an infrared (IR) database, called the MSFC Process Materials IR database, of the common process support materials used at MSFC. These process support materials include solvents, wiper cloths, gloves, bagging materials, etc. Testing includes evaluation of the potential of gloves, wiper cloths, and other items to transfer contamination to handled articles in the absence of solvent exposure, and the potential for solvent exposure to induce material degradation. This Technical Memorandum (TM) summarizes the initial testing completed through December 2002. It is anticipated that additional testing will be conducted with updates provided in future TMs.Materials were analyzed using two different IR techniques: (1) Dry transference and (2) liquid extraction testing. The first of these techniques utilized the Nicolet Magna 750 IR spectrometer outfitted with a horizontal attenuated total reflectance (HATR) crystal accessory. The region from 650 to 4,000 wave numbers was analyzed, and 50 scans were performed per IR spectrum. A dry transference test was conducted by applying each sample with hand pressure to the HATR crystal to first obtain a spectrum of the parent material. The material was then removed from the HATR crystal and analyzed to determine the presence of any residues. If volatile, liquid samples were examined both prior to and following evaporation.The second technique was to perform an extraction test with each sample in five different solvents.Once the scans were complete for both the dry transference and the extraction tests, the residue from each scan was interpreted.
Engel, Hamutal; Doron, Dvir; Kohen, Amnon; Major, Dan Thomas
2012-04-10
The inclusion of nuclear quantum effects such as zero-point energy and tunneling is of great importance in studying condensed phase chemical reactions involving the transfer of protons, hydrogen atoms, and hydride ions. In the current work, we derive an efficient quantum simulation approach for the computation of the momentum distribution in condensed phase chemical reactions. The method is based on a quantum-classical approach wherein quantum and classical simulations are performed separately. The classical simulations use standard sampling techniques, whereas the quantum simulations employ an open polymer chain path integral formulation which is computed using an efficient Monte Carlo staging algorithm. The approach is validated by applying it to a one-dimensional harmonic oscillator and symmetric double-well potential. Subsequently, the method is applied to the dihydrofolate reductase (DHFR) catalyzed reduction of 7,8-dihydrofolate by nicotinamide adenine dinucleotide phosphate hydride (NADPH) to yield S-5,6,7,8-tetrahydrofolate and NADP(+). The key chemical step in the catalytic cycle of DHFR involves a stereospecific hydride transfer. In order to estimate the amount of quantum delocalization, we compute the position and momentum distributions for the transferring hydride ion in the reactant state (RS) and transition state (TS) using a recently developed hybrid semiempirical quantum mechanics-molecular mechanics potential energy surface. Additionally, we examine the effect of compression of the donor-acceptor distance (DAD) in the TS on the momentum distribution. The present results suggest differential quantum delocalization in the RS and TS, as well as reduced tunneling upon DAD compression.
Tests of Exoplanet Atmospheric Radiative Transfer Codes
NASA Astrophysics Data System (ADS)
Harrington, Joseph; Challener, Ryan; DeLarme, Emerson; Cubillos, Patricio; Blecic, Jasmina; Foster, Austin; Garland, Justin
2016-10-01
Atmospheric radiative transfer codes are used both to predict planetary spectra and in retrieval algorithms to interpret data. Observational plans, theoretical models, and scientific results thus depend on the correctness of these calculations. Yet, the calculations are complex and the codes implementing them are often written without modern software-verification techniques. In the process of writing our own code, we became aware of several others with artifacts of unknown origin and even outright errors in their spectra. We present a series of tests to verify atmospheric radiative-transfer codes. These include: simple, single-line line lists that, when combined with delta-function abundance profiles, should produce a broadened line that can be verified easily; isothermal atmospheres that should produce analytically-verifiable blackbody spectra at the input temperatures; and model atmospheres with a range of complexities that can be compared to the output of other codes. We apply the tests to our own code, Bayesian Atmospheric Radiative Transfer (BART) and to several other codes. The test suite is open-source software. We propose this test suite as a standard for verifying current and future radiative transfer codes, analogous to the Held-Suarez test for general circulation models. This work was supported by NASA Planetary Atmospheres grant NX12AI69G and NASA Astrophysics Data Analysis Program grant NNX13AF38G.
Xu, Jiadi; Yadav, Nirbhay N.; Bar-Shir, Amnon; Jones, Craig K.; Chan, Kannie W. Y.; Zhang, Jiangyang; Walczak, P.; McMahon, Michael T.; van Zijl, Peter C. M.
2013-01-01
Purpose Chemical exchange saturation transfer (CEST) imaging is a new MRI technology allowing the detection of low concentration endogenous cellular proteins and metabolites indirectly through their exchangeable protons. A new technique, variable delay multi-pulse CEST (VDMP-CEST), is proposed to eliminate the need for recording full Z-spectra and performing asymmetry analysis to obtain CEST contrast. Methods The VDMP-CEST scheme involves acquiring images with two (or more) delays between radiofrequency saturation pulses in pulsed CEST, producing a series of CEST images sensitive to the speed of saturation transfer. Subtracting two images or fitting a time series produces CEST and relayed-nuclear Overhauser enhancement CEST maps without effects of direct water saturation and, when using low radiofrequency power, minimal magnetization transfer contrast interference. Results When applied to several model systems (bovine serum albumin, crosslinked bovine serum albumin, l-glutamic acid) and in vivo on healthy rat brain, VDMP-CEST showed sensitivity to slow to intermediate range magnetization transfer processes (rate < 100–150 Hz), such as amide proton transfer and relayed nuclear Overhauser enhancement-CEST. Images for these contrasts could be acquired in short scan times by using a single radiofrequency frequency. Conclusions VDMP-CEST provides an approach to detect CEST effect by sensitizing saturation experiments to slower exchange processes without interference of direct water saturation and without need to acquire Z-spectra and perform asymmetry analysis. PMID:23813483
Design and implementation of robust controllers for a gait trainer.
Wang, F C; Yu, C H; Chou, T Y
2009-08-01
This paper applies robust algorithms to control an active gait trainer for children with walking disabilities. Compared with traditional rehabilitation procedures, in which two or three trainers are required to assist the patient, a motor-driven mechanism was constructed to improve the efficiency of the procedures. First, a six-bar mechanism was designed and constructed to mimic the trajectory of children's ankles in walking. Second, system identification techniques were applied to obtain system transfer functions at different operating points by experiments. Third, robust control algorithms were used to design Hinfinity robust controllers for the system. Finally, the designed controllers were implemented to verify experimentally the system performance. From the results, the proposed robust control strategies are shown to be effective.
Laser-induced-fluorescence spectroscopy for improved chemical analysis. Progress report, 1978-1983
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gelbwachs, J.A.
1983-09-01
This report summarizes the progress achieved over the past five years in the laser-induced fluorescence spectroscopy (LIFS) for improved chemical analysis program. Our initial efforts yielded significantly lower detection limits for trace elemental analysis by the use of both cw and pulsed laser excitations. New methods of LIFS were developed that were shown to overcome many of the traditional limitations to LIFS techniques. LIFS methods have been applied to yield fundamental scientific data that further the understanding of forces between atoms and other atoms and molecules. In recent work, two-photon ionization was combined with LIFS and applied, for the firstmore » time, to the study of energy transfer in ions.« less
Laser-induced-fluorescence spectroscopy for improved chemical analysis. Progress report, 1978-1983
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gelbwachs, J.A.
1983-09-01
This report summarizes the progress achieved over the past five years in the laser-induced-fluorescence spectroscopy (LIFS) for improved chemical-analysis program. Our initial efforts yielded significantly lower detection limits for trace elemental analysis by the use of both cw and pulsed-laser excitations. New methods of LIFS were developed that were shown to overcome many of the traditional limitations to LIFS techniques. LIFS methods have been applied to yield fundamental scientific data that further the understanding of forces between atoms and other atoms and molecules. In recent work, two-photon ionization was combined with LIFS and applied, for the first time, to themore » study of energy transfer in ions.« less
McLaskey, Gregory C.; Lockner, David A.; Kilgore, Brian D.; Beeler, Nicholas M.
2015-01-01
We describe a technique to estimate the seismic moment of acoustic emissions and other extremely small seismic events. Unlike previous calibration techniques, it does not require modeling of the wave propagation, sensor response, or signal conditioning. Rather, this technique calibrates the recording system as a whole and uses a ball impact as a reference source or empirical Green’s function. To correctly apply this technique, we develop mathematical expressions that link the seismic moment $M_{0}$ of internal seismic sources (i.e., earthquakes and acoustic emissions) to the impulse, or change in momentum $\\Delta p $, of externally applied seismic sources (i.e., meteor impacts or, in this case, ball impact). We find that, at low frequencies, moment and impulse are linked by a constant, which we call the force‐moment‐rate scale factor $C_{F\\dot{M}} = M_{0}/\\Delta p$. This constant is equal to twice the speed of sound in the material from which the seismic sources were generated. Next, we demonstrate the calibration technique on two different experimental rock mechanics facilities. The first example is a saw‐cut cylindrical granite sample that is loaded in a triaxial apparatus at 40 MPa confining pressure. The second example is a 2 m long fault cut in a granite sample and deformed in a large biaxial apparatus at lower stress levels. Using the empirical calibration technique, we are able to determine absolute source parameters including the seismic moment, corner frequency, stress drop, and radiated energy of these magnitude −2.5 to −7 seismic events.
Assessment of knowledge transfer in the context of biomechanics
NASA Astrophysics Data System (ADS)
Hutchison, Randolph E.
The dynamic act of knowledge transfer, or the connection of a student's prior knowledge to features of a new problem, could be considered one of the primary goals of education. Yet studies highlight more instances of failure than success. This dissertation focuses on how knowledge transfer takes place during individual problem solving, in classroom settings and during group work. Through the lens of dynamic transfer, or how students connect prior knowledge to problem features, this qualitative study focuses on a methodology to assess transfer in the context of biomechanics. The first phase of this work investigates how a pedagogical technique based on situated cognition theory affects students' ability to transfer knowledge gained in a biomechanics class to later experiences both in and out of the classroom. A post-class focus group examined events the students remembered from the class, what they learned from them, and how they connected them to later relevant experiences inside and outside the classroom. These results were triangulated with conceptual gains evaluated through concept inventories and pre- and post- content tests. Based on these results, the next two phases of the project take a more in-depth look at dynamic knowledge transfer during independent problem-solving and group project interactions, respectively. By categorizing prior knowledge (Source Tools), problem features (Target Tools) and the connections between them, results from the second phase of this study showed that within individual problem solving, source tools were almost exclusively derived from "propagated sources," i.e. those based on an authoritative source. This differs from findings in the third phase of the project, in which a mixture of "propagated" sources and "fabricated" sources, i.e. those based on student experiences, were identified within the group project work. This methodology is effective at assessing knowledge transfer in the context of biomechanics through evidence of the ability to identify differing patterns of how different students apply prior knowledge and make new connections between prior knowledge and current problem features in different learning situations. Implications for the use of this methodology include providing insight into not only students' prior knowledge, but also how they connect this prior knowledge to problem features (i.e. dynamic knowledge transfer). It also allows the identification of instances in which external input from other students or the instructor prompted knowledge transfer to take place. The use of this dynamic knowledge transfer lens allows the addressing of gaps in student understanding, and permits further investigations of techniques that increase instances of successful knowledge transfer.
Feasibility of ballistic strengthening exercises in neurologic rehabilitation.
Williams, Gavin; Clark, Ross A; Hansson, Jessica; Paterson, Kade
2014-09-01
Conventional methods for strength training in neurologic rehabilitation are not task specific for walking. Ballistic strength training was developed to improve the functional transfer of strength training; however, no research has investigated this in neurologic populations. The aim of this pilot study was to evaluate the feasibility of applying ballistic principles to conventional leg strengthening exercises in individuals with mobility limitations as a result of neurologic injuries. Eleven individuals with neurologic injuries completed seated and reclined leg press using conventional and ballistic techniques. A 2 × 2 repeated-measures analysis of variance was used to compare power measures (peak movement height and peak velocity) between exercises and conditions. Peak jump velocity and peak jump height were greater when using the ballistic jump technique rather than the conventional concentric technique (P < 0.01). These findings suggest that when compared with conventional strengthening exercises, the incorporation of ballistic principles was associated with increased peak height and peak velocities.
NASA Astrophysics Data System (ADS)
Beaumont, Fabien; Liger-Belair, Gérard; Bailly, Yannick; Polidori, Guillaume
2016-05-01
In champagne glasses, it was recently suggested that ascending bubble-driven flow patterns should be involved in the release of gaseous carbon dioxide (CO2) and volatile organic compounds. A key assumption was that the higher the velocity of the upward bubble-driven flow patterns in the liquid phase, the higher the volume fluxes of gaseous CO2 desorbing from the supersaturated liquid phase. In the present work, simultaneous monitoring of bubble-driven flow patterns within champagne glasses and gaseous CO2 escaping above the champagne surface was performed, through particle image velocimetry and infrared thermography techniques. Two quite emblematic types of champagne drinking vessels were investigated, namely a long-stemmed flute and a wide coupe. The synchronized use of both techniques proved that the cloud of gaseous CO2 escaping above champagne glasses strongly depends on the mixing flow patterns found in the liquid phase below.
Determining the Size of Pores in a Partially Transparent Ceramics from Total-Reflection Spectra
NASA Astrophysics Data System (ADS)
Mironov, R. A.; Zabezhailov, M. O.; Georgiu, I. F.; Cherepanov, V. V.; Rusin, M. Yu.
2018-03-01
A technique is proposed for determining the pore-size distribution based on measuring the dependence of total reflectance in the domain of partial transparency of a material. An assumption about equality of scattering-coefficient spectra determined by solving the inverse radiation transfer problem and by theoretical calculation with the Mie theory is used. The technique is applied to studying a quartz ceramics. The poresize distribution is also determined using mercury and gas porosimetry. All three methods are shown to produce close results for pores with diameters of <180 nm, which occupy 90% of the void volume. In the domain of pore dimensions of >180 nm, the methods show differences that might be related to both specific procedural features and the structural properties of ceramics. The spectral-scattering method has a number of advantages over traditional porosimetry, and it can be viewed as a routine industrial technique.
Application of an enriched FEM technique in thermo-mechanical contact problems
NASA Astrophysics Data System (ADS)
Khoei, A. R.; Bahmani, B.
2018-02-01
In this paper, an enriched FEM technique is employed for thermo-mechanical contact problem based on the extended finite element method. A fully coupled thermo-mechanical contact formulation is presented in the framework of X-FEM technique that takes into account the deformable continuum mechanics and the transient heat transfer analysis. The Coulomb frictional law is applied for the mechanical contact problem and a pressure dependent thermal contact model is employed through an explicit formulation in the weak form of X-FEM method. The equilibrium equations are discretized by the Newmark time splitting method and the final set of non-linear equations are solved based on the Newton-Raphson method using a staggered algorithm. Finally, in order to illustrate the capability of the proposed computational model several numerical examples are solved and the results are compared with those reported in literature.
Optimizing physicians' instruction of PACS through e-learning: cognitive load theory applied.
Devolder, P; Pynoo, B; Voet, T; Adang, L; Vercruysse, J; Duyck, P
2009-03-01
This article outlines the strategy used by our hospital to maximize the knowledge transfer to referring physicians on using a picture archiving and communication system (PACS). We developed an e-learning platform underpinned by the cognitive load theory (CLT) so that in depth knowledge of PACS' abilities becomes attainable regardless of the user's prior experience with computers. The application of the techniques proposed by CLT optimizes the learning of the new actions necessary to obtain and manipulate radiological images. The application of cognitive load reducing techniques is explained with several examples. We discuss the need to safeguard the physicians' main mental processes to keep the patient's interests in focus. A holistic adoption of CLT techniques both in teaching and in configuration of information systems could be adopted to attain this goal. An overview of the advantages of this instruction method is given both on the individual and organizational level.
On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-01-01
Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.
Sander, Michael; Hofstetter, Thomas B; Gorski, Christopher A
2015-05-19
Redox-active minerals are ubiquitous in the environment and are involved in numerous electron transfer reactions that significantly affect biogeochemical processes and cycles as well as pollutant dynamics. As a consequence, research in different scientific disciplines is devoted to elucidating the redox properties and reactivities of minerals. This review focuses on the characterization of mineral redox properties using electrochemical approaches from an applied (bio)geochemical and environmental analytical chemistry perspective. Establishing redox equilibria between the minerals and working electrodes is a major challenge in electrochemical measurements, which we discuss in an overview of traditional electrochemical techniques. These issues can be overcome with mediated electrochemical analyses in which dissolved redox mediators are used to increase the rate of electron transfer and to facilitate redox equilibration between working electrodes and minerals in both amperometric and potentiometric measurements. Using experimental data on an iron-bearing clay mineral, we illustrate how mediated electrochemical analyses can be employed to derive important thermodynamic and kinetic data on electron transfer to and from structural iron. We summarize anticipated methodological advancements that will further contribute to advance an improved understanding of electron transfer to and from minerals in environmentally relevant redox processes.
Classification of Two Class Motor Imagery Tasks Using Hybrid GA-PSO Based K-Means Clustering.
Suraj; Tiwari, Purnendu; Ghosh, Subhojit; Sinha, Rakesh Kumar
2015-01-01
Transferring the brain computer interface (BCI) from laboratory condition to meet the real world application needs BCI to be applied asynchronously without any time constraint. High level of dynamism in the electroencephalogram (EEG) signal reasons us to look toward evolutionary algorithm (EA). Motivated by these two facts, in this work a hybrid GA-PSO based K-means clustering technique has been used to distinguish two class motor imagery (MI) tasks. The proposed hybrid GA-PSO based K-means clustering is found to outperform genetic algorithm (GA) and particle swarm optimization (PSO) based K-means clustering techniques in terms of both accuracy and execution time. The lesser execution time of hybrid GA-PSO technique makes it suitable for real time BCI application. Time frequency representation (TFR) techniques have been used to extract the feature of the signal under investigation. TFRs based features are extracted and relying on the concept of event related synchronization (ERD) and desynchronization (ERD) feature vector is formed.
Classification of Two Class Motor Imagery Tasks Using Hybrid GA-PSO Based K-Means Clustering
Suraj; Tiwari, Purnendu; Ghosh, Subhojit; Sinha, Rakesh Kumar
2015-01-01
Transferring the brain computer interface (BCI) from laboratory condition to meet the real world application needs BCI to be applied asynchronously without any time constraint. High level of dynamism in the electroencephalogram (EEG) signal reasons us to look toward evolutionary algorithm (EA). Motivated by these two facts, in this work a hybrid GA-PSO based K-means clustering technique has been used to distinguish two class motor imagery (MI) tasks. The proposed hybrid GA-PSO based K-means clustering is found to outperform genetic algorithm (GA) and particle swarm optimization (PSO) based K-means clustering techniques in terms of both accuracy and execution time. The lesser execution time of hybrid GA-PSO technique makes it suitable for real time BCI application. Time frequency representation (TFR) techniques have been used to extract the feature of the signal under investigation. TFRs based features are extracted and relying on the concept of event related synchronization (ERD) and desynchronization (ERD) feature vector is formed. PMID:25972896
Multi-Tasking Non-Destructive Laser Technology in Conservation Diagnostic Procedures
NASA Astrophysics Data System (ADS)
Tornari, V.; Tsiranidou, E.; Orphanos, Y.; Falldorf, C.; Klattenhof, R.; Esposito, E.; Agnani, A.; Dabu, R.; Stratan, A.; Anastassopoulos, A.; Schipper, D.; Hasperhoven, J.; Stefanaggi, M.; Bonnici, H.; Ursu, D.
Laser metrology provides techniques that have been successfully applied in industrial structural diagnostic fields but have not yet been refined and optimised for the special investigative requirements found in cultural heritage applications. A major impediment is the partial applicability of various optical coherent techniques, each one narrowing its use down to a specific application. This characteristic is not well suited for a field that encounters a great variety of diagnostic problems ranging from movable, multiple-composition museum objects, to immovable multi-layered wall paintings, statues and wood carvings, to monumental constructions and outdoor cultural heritage sites. Various diagnostic techniques have been suggested and are uniquely suited for each of the mentioned problems but it is this fragmented suitability that obstructs the technology transfer. Since optical coherent techniques for metrology are based on fundamental principles and take advantage of similar procedures for generation of informative signals for data collection, then the imposed limits elevate our aim to identify complementary capabilities to accomplish the needed functionality.
NASA Astrophysics Data System (ADS)
Lukin, Leonid V.
2009-06-01
A new approach to determination of the recombination rate of radical ion pairs in moderately polar solvents is presented. It is based on an investigation of transient photocurrents caused by dissociation of exciplexes generated in photoinduced electron transfer reactions. It has been shown that the recombination rate of geminate ion pairs can be found from the photocurrent rise time. We have applied such an approach to transient photocurrents observed by Hirata et al. [Y. Hirata, Y. Kanda, N. Mataga, J. Phys. Chem. 87 (1983) 1659] for the pyrene/dicyanobenzene system in solvents of moderate polarity. The increase of the obtained recombination rate of photogenerated ions with increasing polarity of solvent testifies that ions recombine mainly by the backward electron transfer from the dicyanobenzene anions to solvent-separated cations of pyrene.
Numerical investigation of MHD flow with Soret and Dufour effect
NASA Astrophysics Data System (ADS)
Hayat, Tasawar; Nasir, Tehreem; Khan, Muhammad Ijaz; Alsaedi, Ahmed
2018-03-01
This paper describes the flow due to an exponentially curved surface subject to Soret and Dufour effects. Nonlinear velocity is considered. Exponentially curved stretchable sheet induced the flow. Fluid is electrical conducting through constant applied magnetic field. The governing flow expressions are reduced to ordinary ones and then tackled by numerical technique (Built-in-Shooting). Impacts of various flow variables on the dimensionless velocity, concentration and temperature fields are graphically presented and discussed in detail. Skin friction coefficient and Sherwood and Nusselt numbers are studied through graphs. Furthermore it is observed that Soret and Dufour variables regulate heat and mass transfer rates. It is also noteworthy that velocity decays for higher magnetic variable. Skin friction magnitude decays via curvature and magnetic variables. Also mass transfer gradient or rate of mass transport enhances for higher estimations of curvature parameter and Schmidt number.
NASA Astrophysics Data System (ADS)
Reznicek, R.
The present conference on flow visualization encompasses methods exploiting tracing particles, surface tracing methods, methods exploiting the effects of streaming fluid on passing radiation/field, computer-aided flow visualization, and applications to fluid mechanics, aerodynamics, flow devices, shock tubes, and heat/mass transfer. Specific issues include visualizing velocity distribution by stereo photography, dark-field Fourier quasiinterferometry, speckle tomography of an open flame, a fast eye for real-time image analysis, and velocity-field determination based on flow-image analysis. Also addressed are flows around rectangular prisms with oscillating flaps at the leading edges, the tomography of aerodynamic objects, the vapor-screen technique applied to a delta-wing aircraft, flash-lamp planar imaging, IR-thermography applications in convective heat transfer, and the visualization of marangoni effects in evaporating sessile drops.
A FRET-Based Ratiometric Chemosensor for in Vitro Cellular Fluorescence Analyses of pH
Zhou, Xianfeng; Su, Fengyu; Lu, Hongguang; Senechal-Willis, Patti; Tian, Yanqing; Johnson, Roger H.; Meldrum, Deirdre R.
2011-01-01
Ratiometric fluorescence sensing is an important technique for precise and quantitative analysis of biological events occurring under complex conditions by simultaneously recording fluorescence intensities at two wavelengths and calculating their ratios. Herein, we design a ratiometric chemosensor for pH that is based on photo-induced electron transfer (PET) and binding-induced modulation of fluorescence resonance energy transfer (FRET) mechanisms. This ratiometric chemosensor was constructed by introduction of a pH-insensitive coumarin fluorophore as a FRET donor into a pH-sensitive amino-naphthalimide derivative as the FRET acceptor. The sensor exhibited clear dual-mission signal changes in blue and green spectral windows upon pH changes. The pH sensor was applied for not only measuring cellular pH, but also for visualizing stimulus-responsive changes of intracellular pH values. PMID:21982292
Project Integration Architecture: Inter-Application Propagation of Information
NASA Technical Reports Server (NTRS)
Jones, William Henry
2005-01-01
A principal goal of the Project Integration Architecture (PIA) is to facilitate the meaningful inter-application transfer of application-value-added information. Such exchanging applications may be largely unrelated to each other except through their applicability to an overall project; however, the PIA effort recognizes as fundamental the need to make such applications cooperate despite wide disparaties either in the fidelity of the analyses carried out, or even the disciplines of the analysis. This paper discusses the approach and techniques applied and anticipated by the PIA project in treating this need.
Laser Propulsion for LOTV Space Missions
NASA Astrophysics Data System (ADS)
Rezunkov, Yuri A.
2004-03-01
Advanced Space Propulsion-Investigation Committee (ASPIC) of the Japan Society for Aeronautics and Space Sciences (JSASS) selected the Laser Orbital Transfer Vehicle (LOTV) project for development of non-chemical space propulsion systems that have a capability to sustain expanded human space activities in the 21st century. This talk is presenting an analysis of the laser propulsion researches made within the frames of the ISTC Project 1801 as applied to the LOTV Project. The study includes the development of techniques for low-thrust maneuvers of the spacecraft to achieve geostationary orbits.
Entanglement of atomic qubits using an optical frequency comb.
Hayes, D; Matsukevich, D N; Maunz, P; Hucul, D; Quraishi, Q; Olmschenk, S; Campbell, W; Mizrahi, J; Senko, C; Monroe, C
2010-04-09
We demonstrate the use of an optical frequency comb to coherently control and entangle atomic qubits. A train of off-resonant ultrafast laser pulses is used to efficiently and coherently transfer population between electronic and vibrational states of trapped atomic ions and implement an entangling quantum logic gate with high fidelity. This technique can be extended to the high field regime where operations can be performed faster than the trap frequency. This general approach can be applied to more complex quantum systems, such as large collections of interacting atoms or molecules.
Identifying research needs for wheelchair transfers in the built environment.
Crytzer, Theresa Marie; Cooper, Rory; Jerome, Genevieve; Koontz, Alicia
2017-02-01
The purpose of this study is to describe the results of focus groups held during the Independent Wheelchair Transfer (IWT) Workgroup. The aims were to facilitate exchange of ideas on (1) the impact of the built environment on the wheelchair transfer process within the community (i.e. moving from wheelchair to and from other surfaces (e.g. furniture, toilet seat, bath bench, car seat) to participate in daily activities), (2) wheelchair users' needs during transfers in the built environment, and (3) future research directions. Live web-based conferencing using Adobe Connect technology (Clarix Technologies, Inc., Pittsford, NY) was utilized to conduct three focus groups composed of experts in the field of assistive technology. Investigators independently reviewed focus group meeting transcripts and used qualitative methods to identify main themes. Thirty-one experts in assistive technology and related fields participated in focus groups. Nine main themes were found including the effect of transfer skills training, space considerations in the built environment, wheelchair configuration, and the interaction between the built environment, user preferences, and transfer techniques. All groups raised issues about the transfer process in areas of the built environment with limited access, the effect of wheelchair users' transfer techniques, and user preferences during transfers. The area of independent transfers is multi-faceted and several factors require consideration when contemplating environmental changes to improve accessibility for wheelchair users. Obvious opportunity exists for research which could lead to advances in transfer technology, environments, and techniques for wheelchair users. Implications for Rehabilitation Tremendous opportunities for research collaborations in the field of assistive technology: To develop new terminology to describe wheelchair transfers. To improve the design of the built environment for wheelchair users. To investigate wheelchair transfer training techniques.
Kankipati, Padmaja; Boninger, Michael L.; Gagnon, Dany; Cooper, Rory A.; Koontz, Alicia M.
2015-01-01
Study design Repeated measures design. Objective This study compared the upper extremity (UE) joint kinetics between three transfer techniques. Setting Research laboratory. Methods Twenty individuals with spinal cord injury performed three transfer techniques from their wheelchair to a level tub bench. Two of the techniques involved a head–hips method with leading hand position close (HH-I) and far (HH-A) from the body, and the third technique with the trunk upright (TU) and hand far from body. Motion analysis equipment recorded upper body movements and force sensors recorded their hand and feet reaction forces during the transfers. Results Several significant differences were found between HH-A and HH-I and TU and HH-I transfers indicating that hand placement was a key factor influencing the UE joint kinetics. Peak resultant hand, elbow, and shoulder joint forces were significantly higher for the HH-A and TU techniques at the trailing arm (P < 0.036) and lower at the leading arm (P < 0.021), compared to the HH-I technique. Conclusion Always trailing with the same arm if using HH-A or TU could predispose that arm to overuse related pain and injuries. Technique training should focus on initial hand placement close to the body followed by the amount of trunk flexion needed to facilitate movement. PMID:25130053
Code of Federal Regulations, 2010 CFR
2010-07-01
... of this subpart apply to Group 2A process vents. (c) Transfer rack requirements. The owner or... route transfer rack emissions through a closed vent system to a flare shall meet the applicable... requirements referenced therein. No other provisions of this subpart apply to transfer rack emissions routed...
Inter-satellite time transfer: Techniques and applications
NASA Technical Reports Server (NTRS)
Detoma, Edoardo; Wardrip, S. Clark
1990-01-01
A brief review is presented of the well known time transfer techniques that have been studied and tested throughout the years. The applicability of time transfer techniques to a timing service as provided through a TDRS/DRS System, the problems related to the choice of the timing signal within the constraints imposed by the existing systems, and the possible practical implementations, including a description of the time synchronization support via TDRSS to the Gamma Ray Observatory (GRO) are discussed.
Visual air quality simulation techniques
NASA Astrophysics Data System (ADS)
Molenar, John V.; Malm, William C.; Johnson, Christopher E.
Visual air quality is primarily a human perceptual phenomenon beginning with the transfer of image-forming information through an illuminated, scattering and absorbing atmosphere. Visibility, especially the visual appearance of industrial emissions or the degradation of a scenic view, is the principal atmospheric characteristic through which humans perceive air pollution, and is more sensitive to changing pollution levels than any other air pollution effect. Every attempt to quantify economic costs and benefits of air pollution has indicated that good visibility is a highly valued and desired environmental condition. Measurement programs can at best approximate the state of the ambient atmosphere at a few points in a scenic vista viewed by an observer. To fully understand the visual effect of various changes in the concentration and distribution of optically important atmospheric pollutants requires the use of aerosol and radiative transfer models. Communication of the output of these models to scientists, decision makers and the public is best done by applying modern image-processing systems to generate synthetic images representing the modeled air quality conditions. This combination of modeling techniques has been under development for the past 15 yr. Initially, visual air quality simulations were limited by a lack of computational power to simplified models depicting Gaussian plumes or uniform haze conditions. Recent explosive growth in low cost, high powered computer technology has allowed the development of sophisticated aerosol and radiative transfer models that incorporate realistic terrain, multiple scattering, non-uniform illumination, varying spatial distribution, concentration and optical properties of atmospheric constituents, and relative humidity effects on aerosol scattering properties. This paper discusses these improved models and image-processing techniques in detail. Results addressing uniform and non-uniform layered haze conditions in both urban and remote pristine areas will be presented.
2012-01-01
Background The metals bioavailability in soils is commonly assessed by chemical extractions; however a generally accepted method is not yet established. In this study, the effectiveness of Diffusive Gradients in Thin-films (DGT) technique and single extractions in the assessment of metals bioaccumulation in vegetables, and the influence of soil parameters on phytoavailability were evaluated using multivariate statistics. Soil and plants grown in vegetable gardens from mining-affected rural areas, NW Romania, were collected and analysed. Results Pseudo-total metal content of Cu, Zn and Cd in soil ranged between 17.3-146 mg kg-1, 141–833 mg kg-1 and 0.15-2.05 mg kg-1, respectively, showing enriched contents of these elements. High degrees of metals extractability in 1M HCl and even in 1M NH4Cl were observed. Despite the relatively high total metal concentrations in soil, those found in vegetables were comparable to values typically reported for agricultural crops, probably due to the low concentrations of metals in soil solution (Csoln) and low effective concentrations (CE), assessed by DGT technique. Among the analysed vegetables, the highest metal concentrations were found in carrots roots. By applying multivariate statistics, it was found that CE, Csoln and extraction in 1M NH4Cl, were better predictors for metals bioavailability than the acid extractions applied in this study. Copper transfer to vegetables was strongly influenced by soil organic carbon (OC) and cation exchange capacity (CEC), while pH had a higher influence on Cd transfer from soil to plants. Conclusions The results showed that DGT can be used for general evaluation of the risks associated to soil contamination with Cu, Zn and Cd in field conditions. Although quantitative information on metals transfer from soil to vegetables was not observed. PMID:23079133
Delaminated Transfer of CVD Graphene
NASA Astrophysics Data System (ADS)
Clavijo, Alexis; Mao, Jinhai; Tilak, Nikhil; Altvater, Michael; Andrei, Eva
Single layer graphene is commonly synthesized by dissociation of a carbonaceous gas at high temperatures in the presence of a metallic catalyst in a process known as Chemical Vapor Deposition or CVD. Although it is possible to achieve high quality graphene by CVD, the standard transfer technique of etching away the metallic catalyst is wasteful and jeopardizes the quality of the graphene film by contamination from etchants. Thus, development of a clean transfer technique and preservation of the parent substrate remain prominent hurdles to overcome. In this study, we employ a copper pretreatment technique and optimized parameters for growth of high quality single layer graphene at atmospheric pressure. We address the transfer challenge by utilizing the adhesive properties between a polymer film and graphene to achieve etchant-free transfer of graphene films from a copper substrate. Based on this concept we developed a technique for dry delamination and transferring of graphene to hexagonal boron nitride substrates, which produced high quality graphene films while at the same time preserving the integrity of the copper catalyst for reuse. DOE-FG02-99ER45742, Ronald E. McNair Postbaccalaureate Achievement Program.
NASA Technical Reports Server (NTRS)
Yelle, Roger V.; Wallace, Lloyd
1989-01-01
A versatile and efficient technique for the solution of the resonance line scattering problem with frequency redistribution in planetary atmospheres is introduced. Similar to the doubling approach commonly used in monochromatic scattering problems, the technique has been extended to include the frequency dependence of the radiation field. Methods for solving problems with external or internal sources and coupled spectral lines are presented, along with comparison of some sample calculations with results from Monte Carlo and Feautrier techniques. The doubling technique has also been applied to the solution of resonance line scattering problems where the R-parallel redistribution function is appropriate, both neglecting and including polarization as developed by Yelle and Wallace (1989). With the constraint that the atmosphere is illuminated from the zenith, the only difficulty of consequence is that of performing precise frequency integrations over the line profiles. With that problem solved, it is no longer necessary to use the Monte Carlo method to solve this class of problem.
NASA Technical Reports Server (NTRS)
Kibler, J. F.; Green, R. N.; Young, G. R.; Kelly, M. G.
1974-01-01
A method has previously been developed to satisfy terminal rendezvous and intermediate timing constraints for planetary missions involving orbital operations. The method uses impulse factoring in which a two-impulse transfer is divided into three or four impulses which add one or two intermediate orbits. The periods of the intermediate orbits and the number of revolutions in each orbit are varied to satisfy timing constraints. Techniques are developed to retarget the orbital transfer in the presence of orbit-determination and maneuver-execution errors. Sample results indicate that the nominal transfer can be retargeted with little change in either the magnitude (Delta V) or location of the individual impulses. Additonally, the total Delta V required for the retargeted transfer is little different from that required for the nominal transfer. A digital computer program developed to implement the techniques is described.
The measurement of the heat-transfer coefficient between high-temperature liquids and solid surfaces
NASA Astrophysics Data System (ADS)
Utigard, T. A.; Warczok, A.; Desclaux, P.
1994-01-01
Two experimental techniques were developed for the purpose of measuring the heat-transfer coefficient between liquid slags/salts and solid surfaces. This was carried out because the heat-transfer coefficient is important for the design and operation of metallurgical reactors. A “cold-finger” technique was developed for the purpose of carrying out heat-transfer measurements during steady-state conditions simulating heat fluxes through furnace sidewalls. A lump capacitance method was developed and tested for the purpose of simulating transient conditions. To determine the effect of fluid flow on the heat-transfer coefficient, nitrogen gas stirring was used. The two techniques were tested in molten (1) and NaNO3, (2) NaCl, (3) Na3AlF6, and (4) 2FeO·SiO2, giving consistent results. It was found that the heat-transfer coefficient increases with increasing bath superheat and stirring.
Techniques for on-orbit cryogenic servicing
NASA Astrophysics Data System (ADS)
DeLee, C. H.; Barfknecht, P.; Breon, S.; Boyle, R.; DiPirro, M.; Francis, J.; Huynh, J.; Li, X.; McGuire, J.; Mustafi, S.; Tuttle, J.; Wegel, D.
2014-11-01
NASA (National Aeronautics and Space Administration) has a renewed interest in on-orbit cryogen storage and transfer to support its mission to explore near-earth objects such as asteroids and comets. The Cryogenic Propellant Storage and Transfer Technology Demonstration Mission (CPST-TDM), managed by the NASA Glenn Research Center (GRC) and scheduled for launch in 2018, will demonstrate numerous key technologies applicable to a cryopropellant fuel depot. As an adjunct to the CPST-TDM work, experiments at NASA Goddard Space Flight Center (GSFC) will support the development of techniques to manage and transfer cryogens on-orbit and expand these techniques as they may be applicable to servicing science missions using solid cryogens such as the Wide-field Infrared Survey Explorer (WISE). The results of several ground experiments are described, including autogenous pressurization used for transfer of liquid nitrogen and argon, characterization of the transfer and solidification of argon, and development of robotic tools for cryogen transfer.
Comparison of VLBI, TV and traveling clock techniques for time transfer
NASA Technical Reports Server (NTRS)
Spencer, J. H.; Waltman, E. B.; Johnston, K. J.; Santini, N. J.; Klepczynski, W. J.; Matsakis, D. N.; Angerhofer, P. E.; Kaplan, G. M.
1982-01-01
A three part experiment was conducted to develop and compare time transfer techniques. The experiment consisted of (1) a very long baseline interferometer (VLBI), (2) a high precision portable clock time transfer system between the two sites, and (3) a television time transfer. A comparison of the VLBI and traveling clock shows each technique can perform satisfactorily at the five nsec level. There was a systematic offset of 59 nsec between the two methods, which we attributed to a difference in epochs between VLBI formatter and station clock. The VLBI method had an internal random error of one nsec at the three sigma level for a two day period. Thus, the Mark II system performed well, and VLBI shows promise of being an accurate method of time transfer. The TV system, which had technical problems during the experiment, transferred time with a random error of about 50 nsec.
NASA Technical Reports Server (NTRS)
Smith, Damon C. (Inventor)
2005-01-01
An exercise device 10 is particularly well suited for use in low gravity environments, and includes a frame 12 with plurality of resistance elements 30,82 supported in parallel on the frame. A load transfer member 20 is moveable relative to the frame for transferring the applied force to the free end of each captured resistance element. Load selection template 14 is removably secured both to the load transfer member, and a plurality of capture mechanisms engage the free end of corresponding resistance elements. The force applying mechanism 53 may be a handle, harness or other user interface for applying a force to move the load transfer member.
NASA Astrophysics Data System (ADS)
Hwang, Sunghwan
1997-08-01
One of the most prominent features of helicopter rotor dynamics in forward flight is the periodic coefficients in the equations of motion introduced by the rotor rotation. The frequency response characteristics of such a linear time periodic system exhibits sideband behavior, which is not the case for linear time invariant systems. Therefore, a frequency domain identification methodology for linear systems with time periodic coefficients was developed, because the linear time invariant theory cannot account for sideband behavior. The modulated complex Fourier series was introduced to eliminate the smearing effect of Fourier series expansions of exponentially modulated periodic signals. A system identification theory was then developed using modulated complex Fourier series expansion. Correlation and spectral density functions were derived using the modulated complex Fourier series expansion for linear time periodic systems. Expressions of the identified harmonic transfer function were then formulated using the spectral density functions both with and without additive noise processes at input and/or output. A procedure was developed to identify parameters of a model to match the frequency response characteristics between measured and estimated harmonic transfer functions by minimizing an objective function defined in terms of the trace of the squared frequency response error matrix. Feasibility was demonstrated by the identification of the harmonic transfer function and parameters for helicopter rigid blade flapping dynamics in forward flight. This technique is envisioned to satisfy the needs of system identification in the rotating frame, especially in the context of individual blade control. The technique was applied to the coupled flap-lag-inflow dynamics of a rigid blade excited by an active pitch link. The linear time periodic technique results were compared with the linear time invariant technique results. Also, the effect of noise processes and initial parameter guess on the identification procedure were investigated. To study the effect of elastic modes, a rigid blade with a trailing edge flap excited by a smart actuator was selected and system parameters were successfully identified, but with some expense of computational storage and time. Conclusively, the linear time periodic technique substantially improved the identified parameter accuracy compared to the linear time invariant technique. Also, the linear time periodic technique was robust to noises and initial guess of parameters. However, an elastic mode of higher frequency relative to the system pumping frequency tends to increase the computer storage requirement and computing time.
Code for Multiblock CFD and Heat-Transfer Computations
NASA Technical Reports Server (NTRS)
Fabian, John C.; Heidmann, James D.; Lucci, Barbara L.; Ameri, Ali A.; Rigby, David L.; Steinthorsson, Erlendur
2006-01-01
The NASA Glenn Research Center General Multi-Block Navier-Stokes Convective Heat Transfer Code, Glenn-HT, has been used extensively to predict heat transfer and fluid flow for a variety of steady gas turbine engine problems. Recently, the Glenn-HT code has been completely rewritten in Fortran 90/95, a more object-oriented language that allows programmers to create code that is more modular and makes more efficient use of data structures. The new implementation takes full advantage of the capabilities of the Fortran 90/95 programming language. As a result, the Glenn-HT code now provides dynamic memory allocation, modular design, and unsteady flow capability. This allows for the heat-transfer analysis of a full turbine stage. The code has been demonstrated for an unsteady inflow condition, and gridding efforts have been initiated for a full turbine stage unsteady calculation. This analysis will be the first to simultaneously include the effects of rotation, blade interaction, film cooling, and tip clearance with recessed tip on turbine heat transfer and cooling performance. Future plans call for the application of the new Glenn-HT code to a range of gas turbine engine problems of current interest to the heat-transfer community. The new unsteady flow capability will allow researchers to predict the effect of unsteady flow phenomena upon the convective heat transfer of turbine blades and vanes. Work will also continue on the development of conjugate heat-transfer capability in the code, where simultaneous solution of convective and conductive heat-transfer domains is accomplished. Finally, advanced turbulence and fluid flow models and automatic gridding techniques are being developed that will be applied to the Glenn-HT code and solution process.
NASA Astrophysics Data System (ADS)
Choi, Ho-Gil; Shim, Moonsoo; Lee, Jong-Hyeon; Yi, Kyung-Woo
2017-09-01
The waste salt treatment process is required for the reuse of purified salts, and for the disposal of the fission products contained in waste salt during pyroprocessing. As an alternative to existing fission product separation methods, the horizontal zone refining process is used in this study for the purification of waste salt. In order to evaluate the purification ability of the process, three-dimensional simulation is conducted, considering heat transfer, melt flow, and mass transfer. Impurity distributions and decontamination factors are calculated as a function of the heater traverse rate, by applying a subroutine and the equilibrium segregation coefficient derived from the effective segregation coefficients. For multipass cases, 1d solutions and the effective segregation coefficient obtained from three-dimensional simulation are used. In the present study, the topic is not dealing with crystal growth, but the numerical technique used is nearly the same since the zone refining technique was just introduced in the treatment of waste salt from nuclear power industry because of its merit of simplicity and refining ability. So this study can show a new application of single crystal growth techniques to other fields, by taking advantage of the zone refining multipass possibility. The final goal is to achieve the same high degree of decontamination in the waste salt as in zone freezing (or reverse Bridgman) method.
NASA Technical Reports Server (NTRS)
Yoshikawa, H. H.; Madison, I. B.
1971-01-01
This study was performed in support of the NASA Task B-2 Study Plan for Space Basing. The nature of space-based operations implies that orbital transfer of propellant is a prime consideration. The intent of this report is (1) to report on the findings and recommendations of existing literature on space-based propellant transfer techniques, and (2) to determine possible alternatives to the recommended methods. The reviewed literature recommends, in general, the use of conventional liquid transfer techniques (i.e., pumping) in conjunction with an artificially induced gravitational field. An alternate concept that was studied, the Thermal Bootstrap Transfer Process, is based on the compression of a two-phase fluid with subsequent condensation to a liquid (vapor compression/condensation). This concept utilizes the intrinsic energy capacities of the tanks and propellant by exploiting temperature differentials and available energy differences. The results indicate the thermodynamic feasibility of the Thermal Bootstrap Transfer Process for a specific range of tank sizes, temperatures, fill-factors and receiver tank heat transfer coefficients.
Power cepstrum technique with application to model helicopter acoustic data
NASA Technical Reports Server (NTRS)
Martin, R. M.; Burley, C. L.
1986-01-01
The application of the power cepstrum to measured helicopter-rotor acoustic data is investigated. A previously applied correction to the reconstructed spectrum is shown to be incorrect. For an exact echoed signal, the amplitude of the cepstrum echo spike at the delay time is linearly related to the echo relative amplitude in the time domain. If the measured spectrum is not entirely from the source signal, the cepstrum will not yield the desired echo characteristics and a cepstral aliasing may occur because of the effective sample rate in the frequency domain. The spectral analysis bandwidth must be less than one-half the echo ripple frequency or cepstral aliasing can occur. The power cepstrum editing technique is a useful tool for removing some of the contamination because of acoustic reflections from measured rotor acoustic spectra. The cepstrum editing yields an improved estimate of the free field spectrum, but the correction process is limited by the lack of accurate knowledge of the echo transfer function. An alternate procedure, which does not require cepstral editing, is proposed which allows the complete correction of a contaminated spectrum through use of both the transfer function and delay time of the echo process.
Zhang, Ming; He, Juan; Shen, Yanzheng; He, Weiye; Li, Yuanyuan; Zhao, Dongxin; Zhang, Shusheng
2018-02-01
A polymer-based adsorption medium with molecular recognition ability for homologs of pyrethroids was prepared by atom transfer radical polymer iration using a fragment imprinting technique. Phenyl ether-biphenyl eutectic was utilized as a pseudo-template molecule, and the adsorption medium prepared was evaluated by solid-phase extraction and gas chromatography. Selectivity of the medium for pyrethroids was evaluated using it as solid phase extraction packing by Gas Chromatography. The results demonstrated that the absorption amount of bifenthrin, fenpropathrin, permethrin, cypermethrin, fenvalerate, Dursban and pentachloronitrobenzene for molecularly imprinted polymers were 2.32, 2.12, 2.18, 2.20, 2.30, 1.30 and 1.40mgg -1 , respectively, while the non-imprinted polymers were 1.20, 1.13, 1.25, 1.05, 1.20, 1.23 and 1.32mgg -1 , respectively. The rebinding test based on the molecularly imprinted solid phase extraction column technique showed the recoveries of honey sample spiked with seven insecticides within 88.5-106.2%, with relative standard deviations of 2.38-5.63%. Finally, the method was successfully applied to the analysis of pyrethroids in a honey sample. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lazzi Gazzini, S.; Schädler, R.; Kalfas, A. I.; Abhari, R. S.
2017-02-01
It is technically challenging to measure heat fluxes on the rotating components of gas turbines, yet accurate knowledge of local heat loads under engine-representative conditions is crucial for ensuring the reliability of the designs. In this work, quantitative image processing tools were developed to perform fast and accurate infrared thermography measurements on 3D-shaped film-heaters directly deposited on the turbine endwalls. The newly developed image processing method and instrumentation were used to measure the heat load on the rotor endwalls of an axial turbine. A step-transient heat flux calibration technique is applied to measure the heat flux generated locally by the film heater, thus eliminating the need for a rigorously iso-energetic boundary condition. On-board electronics installed on the rotor record the temperature readings of RTDs installed in the substrate below the heaters in order to evaluate the conductive losses in the solid. Full maps of heat transfer coefficient and adiabatic wall temperature are produced for two different operating conditions, demonstrating the sensitivity of the technique to local flow features and variations in heat transfer due to Reynolds number effect.
Test load verification through strain data analysis
NASA Technical Reports Server (NTRS)
Verderaime, V.; Harrington, F.
1995-01-01
A traditional binding acceptance criterion on polycrystalline structures is the experimental verification of the ultimate factor of safety. At fracture, the induced strain is inelastic and about an order-of-magnitude greater than designed for maximum expected operational limit. At this extreme strained condition, the structure may rotate and displace at the applied verification load such as to unknowingly distort the load transfer into the static test article. Test may result in erroneously accepting a submarginal design or rejecting a reliable one. A technique was developed to identify, monitor, and assess the load transmission error through two back-to-back surface-measured strain data. The technique is programmed for expediency and convenience. Though the method was developed to support affordable aerostructures, the method is also applicable for most high-performance air and surface transportation structural systems.
Anode power deposition in applied-field MPD thrusters
NASA Technical Reports Server (NTRS)
Myers, Roger M.; Soulas, George C.
1992-01-01
Anode power deposition is the principle performance limiter of magnetoplasmadynamic (MPD) thrusters. Current thrusters lose between 50 and 70 percent of the input power to the anode. In this work, anode power deposition was studied for three cylindrical applied magnetic field thrusters for a range of argon propellant flow rates, discharge currents, and applied-field strengths. Between 60 and 95 percent of the anode power deposition resulted from electron current conduction into the anode, with cathode radiation depositing between 5 and 35 percent of the anode power, and convective heat transfer from the hot plasma accounting for less than 5 percent. While the fractional anode power loss decreased with increasing applied-field strength and anode size, the magnitude of the anode power increased. The rise in anode power resulted from a linear rise in the anode fall voltage with applied-field strength and anode radius. The anode fall voltage also rose with decreasing propellant flow rate. The trends indicate that the anode fall region is magnetized, and suggest techniques for reducing the anode power loss in MPD thrusters.
Gan, Cheng; Fan, Jincai; Liu, Liqiang; Tian, Jia; Jiao, Hu; Chen, Wenlin; Fu, Siqi; Feng, Suyun
2013-11-01
The expanded forehead flap, using temporal pedicles, has been employed extensively in facial reconstruction. To overcome the disadvantages of the traditional dual temporal pedicles, such as the limited transfer range and the short length of the flap, the distal supercharging technique can be applied to lengthen the flap and extend the transfer range, especially in the cases with a past temporal burn injury. This article aims to present an application of the distal supercharged expanded forehead flap procedure for hemi-facial reconstruction and discuss the haemodynamics of the expanded forehead flap. The tissue expander implantation and the following forehead tissue expansion were performed regularly. When the forehead skin expansion was completed, an expanded forehead flap was created and transferred to the damaged facial area with one distal temporal vessel pedicle that was anastomosed with facial vessels in a supercharged way. All patients were analysed retrospectively. From September 2009 to September 2011, eight male patients and one female patient were treated using this method. Their flaps size ranged from 20 cm × 8 cm to 30 cm × 11 cm and no flap loss occurred. Patients came in for follow-ups 9-16 months after the procedures. All the patients were satisfied with the results. The supercharging expanded forehead flap procedure can provide reliable flap vascularity due to its elastic transferring abilities. By using a distal supercharging technique, we can lengthen and widen the flap to tailor it to the defect, while also minimising the donor defect in the patients with a past temporal injury. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Project SOS: The Science of Sustainability
NASA Astrophysics Data System (ADS)
Berven, Christine; Dawes, Kathy; Kern, Anne; Ryan, Kathleen; McNamara, Patricia
2014-03-01
Project SOS: Making Connections Using The Science Of Sustainability is an Informal Science Education Pathways Project designed to teach the science of sustainability to middle-school aged youth in rural communities of northern ID and eastern WA. The educational focus is the physics of convection, conduction and radiation and how these exist in nature and specifically in the home of the youth. Our goal is to explore the implementation of a cooperative-learning model in which youth become experts in their area of heat transfer using portable exhibits, teach their fellow team-members about those mechanisms, and apply this knowledge as a team to improve the energy efficiency of a model house. We provide simple tools and instructions so that they may apply their new knowledge to their own homes. We analyze audio and video of the interactions of our facilitators with the youth and among the youth, and use pre- and post-surveys to document the increase in understanding of energy transfer mechanisms in their homes and the environment. The tools and techniques developed to accomplish our goals and our current findings regarding the effectiveness of this approach will be discussed. Work supported by National Science Foundation Award DRL-1223290.
2009-11-01
metrology, different techniques are used for time and frequency transfer, basically TWSTFT (Two-Way Satellite Time and Frequency Transfer), GPS CV (Common...traditional GPS/GLONASS CV/AV receivers and TWSTFT equipment. Time and frequency transfer using GPS code and carrier-phase is an important...or mixing GPS geodetic results with other independent techniques, such as the TWSTFT . 41 st Annual Precise Time and Time Interval (PTTI
Influence of different materials and techniques to transfer molding in multiple implants.
Faria, Júlio C B; Cruz, Fernando L G; Silva-Concílio, Laís R; Neves, Ana C C
2012-01-01
The aim of this study was to compare different materials and techniques used in transfer molding of multiple implants, by evaluating the space between implants and superstructure. Four external hexagon implants were fixed in a master template and the same on a superstructure. Transfer molding of implants were done using the direct and indirect techniques, with transfers united or not, using the union chemically activated acrylic resin (QA) and other groups polymerized acrylic resin (FT), and sectioned and not split. The casts were made with polyether and models divided into 8 groups (n = 5). The space between the superstructure and the master implants was measured with a microscope and the data was analyzed statistically by Student's t test (p < 0.05). For the material of union there was no significant difference, except when the groups were compared with the resin Duralay QA (G4) and the resin Duolay FT (G8) and groups using resins Duolay QA (G5) and Duolay FT (G7) for the union of the transfers. When comparing the groups who had the union between the transfers and sectioned again united with those in which the union was not severed there was no statistically significant difference. QA resin was superior to the FT with respect to the union of transfers. Techniques with united transfers or not were similar.
Applying UV cameras for SO2 detection to distant or optically thick volcanic plumes
Kern, Christoph; Werner, Cynthia; Elias, Tamar; Sutton, A. Jeff; Lübcke, Peter
2013-01-01
Ultraviolet (UV) camera systems represent an exciting new technology for measuring two dimensional sulfur dioxide (SO2) distributions in volcanic plumes. The high frame rate of the cameras allows the retrieval of SO2 emission rates at time scales of 1 Hz or higher, thus allowing the investigation of high-frequency signals and making integrated and comparative studies with other high-data-rate volcano monitoring techniques possible. One drawback of the technique, however, is the limited spectral information recorded by the imaging systems. Here, a framework for simulating the sensitivity of UV cameras to various SO2 distributions is introduced. Both the wavelength-dependent transmittance of the optical imaging system and the radiative transfer in the atmosphere are modeled. The framework is then applied to study the behavior of different optical setups and used to simulate the response of these instruments to volcanic plumes containing varying SO2 and aerosol abundances located at various distances from the sensor. Results show that UV radiative transfer in and around distant and/or optically thick plumes typically leads to a lower sensitivity to SO2 than expected when assuming a standard Beer–Lambert absorption model. Furthermore, camera response is often non-linear in SO2 and dependent on distance to the plume and plume aerosol optical thickness and single scatter albedo. The model results are compared with camera measurements made at Kilauea Volcano (Hawaii) and a method for integrating moderate resolution differential optical absorption spectroscopy data with UV imagery to retrieve improved SO2 column densities is discussed.
Simulation analysis of air flow and turbulence statistics in a rib grit roughened duct.
Vogiatzis, I I; Denizopoulou, A C; Ntinas, G K; Fragos, V P
2014-01-01
The implementation of variable artificial roughness patterns on a surface is an effective technique to enhance the rate of heat transfer to fluid flow in the ducts of solar air heaters. Different geometries of roughness elements investigated have demonstrated the pivotal role that vortices and associated turbulence have on the heat transfer characteristics of solar air heater ducts by increasing the convective heat transfer coefficient. In this paper we investigate the two-dimensional, turbulent, unsteady flow around rectangular ribs of variable aspect ratios by directly solving the transient Navier-Stokes and continuity equations using the finite elements method. Flow characteristics and several aspects of turbulent flow are presented and discussed including velocity components and statistics of turbulence. The results reveal the impact that different rib lengths have on the computed mean quantities and turbulence statistics of the flow. The computed turbulence parameters show a clear tendency to diminish downstream with increasing rib length. Furthermore, the applied numerical method is capable of capturing small-scale flow structures resulting from the direct solution of Navier-Stokes and continuity equations.
Charge separation and carrier dynamics in donor-acceptor heterojunction photovoltaic systems
Teuscher, Joël; Brauer, Jan C.; Stepanov, Andrey; Solano, Alicia; Boziki, Ariadni; Chergui, Majed; Wolf, Jean-Pierre; Rothlisberger, Ursula; Banerji, Natalie; Moser, Jacques-E.
2017-01-01
Electron transfer and subsequent charge separation across donor-acceptor heterojunctions remain the most important areas of study in the field of third-generation photovoltaics. In this context, it is particularly important to unravel the dynamics of individual ultrafast processes (such as photoinduced electron transfer, carrier trapping and association, and energy transfer and relaxation), which prevail in materials and at their interfaces. In the frame of the National Center of Competence in Research “Molecular Ultrafast Science and Technology,” a research instrument of the Swiss National Science Foundation, several groups active in the field of ultrafast science in Switzerland have applied a number of complementary experimental techniques and computational simulation tools to scrutinize these critical photophysical phenomena. Structural, electronic, and transport properties of the materials and the detailed mechanisms of photoinduced charge separation in dye-sensitized solar cells, conjugated polymer- and small molecule-based organic photovoltaics, and high-efficiency lead halide perovskite solar energy converters have been scrutinized. Results yielded more than thirty research articles, an overview of which is provided here. PMID:29308415
Hooley, E N; Tilley, A J; White, J M; Ghiggino, K P; Bell, T D M
2014-04-21
Both pendant and main chain conjugated MEH-PPV based polymers have been studied at the level of single chains using confocal and widefield fluorescence microscopy techniques. In particular, defocused widefield fluorescence is applied to reveal the extent of energy transfer in these polymers by identifying whether they act as single emitters. For main chain conjugated MEH-PPV, molecular weight and the surrounding matrix play a primary role in determining energy transport processes and whether single emitter behaviour is observed. Surprisingly in polymers with a saturated backbone but containing the same pendant MEH-PPV oligomer on each repeating unit, intra-chain energy transfer to a single emitter is also apparent. The results imply there is chromophore heterogeneity that can facilitate energy funneling to the emitting site. Both main chain conjugated and pendant MEH-PPV polymers exhibit changes in orientation of the emission dipole during a fluorescence trajectory of many seconds, whereas a model MEH-PPV oligomer does not. The results suggest that, in the polymers, the nature of the emitting chromophores can change during the time trajectory.
Study of the Charge Transfer Process of LaNi5 Type Electrodes in Ni-MH Batteries
NASA Astrophysics Data System (ADS)
Le, Xuan Que; Nguyen, Phu Thuy
2002-12-01
As a result of the charge process of LaNi5 type electrode, hydrogen is reversibly absorbed on the electrode surface. The process consists two principal steps. During the both processes, the first reaction step occurs in the interface solid/liquid, negatively charged, with high static electric field, where the double layer structure became more compact. The transfer of charge under high electric field depends on many factors, principally on compositions of the electrode materials. Effects on that of Co, Fe, Mn substitutes, with different concentrations, have been comparatively studied using electrochemical technique. The analyse of interface C -.V study results has been realised, respecting Mott-Schottky relation. Optimal contents of some additives have been discussed. Some advantages of the applied electrochemical methods have been confirmed. The mechanism of the charges transfer and of the hydrogen reversible storage in the crystal structure in the batteries has been discussed. With the proposed mechanism, one can more explicitly understand the difference of the magnetic effect of the electrode materials before and after charge-discharge process can be explained.
Condensation Behavior in a Microchannel Heat Exchanger
NASA Astrophysics Data System (ADS)
Kaneko, Akiko; Takeuchi, Genki; Abe, Yutaka; Suzuki, Yutaka
A small and high performance heat exchanger for small size energy equipments such as fuel cells and CO2 heat pumps is required in these days. In author's previous studies, the heat exchanger consisted of microchannels stacked in layers has been developed. It has resistance to pressure of larger than 15 MPa since it is manufactured by diffusion bond technique. Thus this device can be applied for high flow rate and pressure fluctuation conditions as boiling and condensation. The objectives of the present study are to clarify the heat transfer performance of the prototype heat exchanger and to investigate the thermal hydraulic behavior in the microchannel for design optimization of the device. As the results, it is clarified that the present device attained high heat transfer as 7 kW at the steam condensation, despite its weight of only 230 g. Furthermore, steam condensation behavior in a glass capillary tube, as a simulated microchannel, in a cooling water pool was observed with various inlet pressure and temperature of surrounding water. Relation between steam-water two-phase flow structure and the overall heat transfer coefficient is discussed.
NASA Technical Reports Server (NTRS)
Chen, George T.
1987-01-01
An automatic control scheme for spacecraft proximity operations is presented. The controller is capable of holding the vehicle at a prescribed location relative to a target, or maneuvering it to a different relative position using straight line-of-sight translations. The autopilot uses a feedforward loop to initiate and terminate maneuvers, and for operations at nonequilibrium set-points. A multivariate feedback loop facilitates precise position and velocity control in the presence of sensor noise. The feedback loop is formulated using the Linear Quadratic Gaussian (LQG) with Loop Transfer Recovery (LTR) design procedure. Linear models of spacecraft dynamics, adapted from Clohessey-Wiltshire Equations, are augmented and loop shaping techniques are applied to design a target feedback loop. The loop transfer recovery procedure is used to recover the frequency domain properties of the target feedback loop. The resulting compensator is integrated into an autopilot which is tested in a high fidelity Space Shuttle Simulator. The autopilot performance is evaluated for a variety of proximity operations tasks envisioned for future Shuttle flights.
Ohvo-Rekilä, Henna; Mattjus, Peter
2011-01-01
The glycolipid transfer protein (GLTP) is a protein capable of binding and transferring glycolipids. GLTP is cytosolic and it can interact through its FFAT-like (two phenylalanines in an acidic tract) motif with proteins localized on the surface of the endoplasmic reticulum. Previous in vitro work with GLTP has focused mainly on the complete transfer reaction of the protein, that is, binding and subsequent removal of the glycolipid from the donor membrane, transfer through the aqueous environment, and the final release of the glycolipid to an acceptor membrane. Using bilayer vesicles and surface plasmon resonance spectroscopy, we have now, for the first time, analyzed the binding and lipid removal capacity of GLTP with a completely label-free technique. This technique is focused on the initial steps in GLTP-mediated transfer and the parameters affecting these steps can be more precisely determined. We used the new approach for detailed structure-function studies of GLTP by examining the glycolipid transfer capacity of specific GLTP tryptophan mutants. Tryptophan 96 is crucial for the transfer activity of the protein and tryptophan 142 is an important part of the proteins membrane interacting domain. Further, we varied the composition of the used lipid vesicles and gained information on the effect of membrane properties on GLTP activity. GLTP prefers to interact with more tightly packed membranes, although GLTP-mediated transfer is faster from more fluid membranes. This technique is very useful for the study of membrane-protein interactions and lipid-transfer rates and it can easily be adapted to other membrane-interacting proteins. Copyright © 2010 Elsevier B.V. All rights reserved.
Physical processes in the strong magnetic fields of accreting neutron stars
NASA Technical Reports Server (NTRS)
Meszaros, P.
1984-01-01
Analytical formulae are fitted to observational data on physical processes occurring in strong magnetic fields surrounding accreting neutron stars. The propagation of normal modes in the presence of a quantizing magnetic field is discussed in terms of a wave equation in Fourier space, quantum electrodynamic effects, polarization and mode ellipticity. The results are applied to calculating the Thomson scattering, bremsstrahlung and Compton scattering cross-sections, which are a function of the frequency, angle and polarization of the magnetic field. Numerical procedures are explored for solving the radiative transfer equations. When applied to modeling X ray pulsars, a problem arises in the necessity to couple the magnetic angle and frequency dependence of the cross-sections with the hydrodynamic equations. The use of time-dependent averaging and approximation techniques is indicated.
Beltrán-Leiva, María J; Páez-Hernández, Dayán; Arratia-Pérez, Ramiro
2018-05-07
This work presents a theoretical protocol to analyze the symmetry effect on the allowed character of the transitions and to estimate the probability of energy transfer in lanthanide(III) complexes. For this purpose, a complete study was performed based on the multireference CASSCF/PT2 technique along with TDDFT, to build the energy level diagrams and determine the spectral overlap integrals, respectively. This approach was applied on a series of LnIII complexes, viz. [LnCl 3 (DMF) 2 (Dpq)]/[Ln(NO 3 ) 3 (DMF) 2 (Dpq)], where Ln = Sm III , Tb III , Er III /Eu III , Nd III and dpq = dipyridoquinoxaline, synthesized and characterized by Patra et al. ( Dalton Trans. 2015 , 44 ( 46 ), 19844 - 19855 ; CrystEngComm 2016 , 18 ( 23 ), 4313 - 4322 ; Inorg. Chim. Acta 2016 , 451 , 73 - 81 ). A fragmentation scheme was applied where both the ligand and the lanthanide fragments were treated separately but at the same level of theory. The symmetry analysis only partially reproduced the expected results, and a more detailed analysis of the crystal field became necessary. On the other hand, the most probable energy transfer pathways that take place in the complexes were elucidated from the energy gaps between the ligand-localized triplet state and the emitting levels of the lanthanide fragments. These gaps, which are related to the energy transfer rate, properly reproduced the trend reported experimentally for the best and worst yields. Finally, the spectral overlap integral was calculated from the emission spectra of the dpq ligand and the absorption spectra of the lanthanide fragment. The obtained values are in good agreement with the quantum yields calculated for the systems. The most remarkable aspect of this protocol was its ability to explain the emission and nonemission of the studied compounds.
Mechanism of thermal decomposition of K2FeO4 and BaFeO4: A review
NASA Astrophysics Data System (ADS)
Sharma, Virender K.; Machala, Libor
2016-12-01
This paper presents thermal decomposition of potassium ferrate(VI) (K2FeO4) and barium ferrate(VI) (BaFeO4) in air and nitrogen atmosphere. Mössbauer spectroscopy and nuclear forward scattering (NFS) synchrotron radiation approaches are reviewed to advance understanding of electron-transfer processes involved in reduction of ferrate(VI) to Fe(III) phases. Direct evidences of Fe V and Fe IV as intermediate iron species using the applied techniques are given. Thermal decomposition of K2FeO4 involved Fe V, Fe IV, and K3FeO3 as intermediate species while BaFeO3 (i.e. Fe IV) was the only intermediate species during the decomposition of BaFeO4. Nature of ferrite species, formed as final Fe(III) species, of thermal decomposition of K2FeO4 and BaFeO4 under different conditions are evaluated. Steps of the mechanisms of thermal decomposition of ferrate(VI), which reasonably explained experimental observations of applied approaches in conjunction with thermal and surface techniques, are summarized.
Modeling habitat for Marbled Murrelets on the Siuslaw National Forest, Oregon, using lidar data
Hagar, Joan C.; Aragon, Ramiro; Haggerty, Patricia; Hollenbeck, Jeff P.
2018-03-28
Habitat models using lidar-derived variables that quantify fine-scale variation in vegetation structure can improve the accuracy of occupancy estimates for canopy-dwelling species over models that use variables derived from other remote sensing techniques. However, the ability of models developed at such a fine spatial scale to maintain accuracy at regional or larger spatial scales has not been tested. We tested the transferability of a lidar-based habitat model for the threatened Marbled Murrelet (Brachyramphus marmoratus) between two management districts within a larger regional conservation zone in coastal western Oregon. We compared the performance of the transferred model against models developed with data from the application location. The transferred model had good discrimination (AUC = 0.73) at the application location, and model performance was further improved by fitting the original model with coefficients from the application location dataset (AUC = 0.79). However, the model selection procedure indicated that neither of these transferred models were considered competitive with a model trained on local data. The new model trained on data from the application location resulted in the selection of a slightly different set of lidar metrics from the original model, but both transferred and locally trained models consistently indicated positive relationships between the probability of occupancy and lidar measures of canopy structural complexity. We conclude that while the locally trained model had superior performance for local application, the transferred model could reasonably be applied to the entire conservation zone.
Boudjada, Nazim; Segal, Dvira
2014-11-26
We study in a unified manner the dissipative dynamics and the transfer of heat in the two-bath spin-boson model. We use the Bloch-Redfield (BR) formalism, valid in the very weak system-bath coupling limit, the noninteracting-blip approximation (NIBA), applicable in the nonadiabatic limit, and iterative, numerically exact path integral tools. These methodologies were originally developed for the description of the dissipative dynamics of a quantum system, and here they are applied to explore the problem of quantum energy transport in a nonequilibrium setting. Specifically, we study the weak-to-intermediate system-bath coupling regime at high temperatures kBT/ħ > ε, with ε as the characteristic frequency of the two-state system. The BR formalism and NIBA can lead to close results for the dynamics of the reduced density matrix (RDM) in a certain range of parameters. However, relatively small deviations in the RDM dynamics propagate into significant qualitative discrepancies in the transport behavior. Similarly, beyond the strict nonadiabatic limit NIBA's prediction for the heat current is qualitatively incorrect: It fails to capture the turnover behavior of the current with tunneling energy and temperature. Thus, techniques that proved meaningful for describing the RDM dynamics, to some extent even beyond their rigorous range of validity, should be used with great caution in heat transfer calculations, because qualitative-serious failures develop once parameters are mildly stretched beyond the techniques' working assumptions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buongiorno, J; Cahill, DG; Hidrovo, CH
2014-07-23
In this opinion piece, we discuss recent advances in experimental methods for characterizing phase change heat transfer. We begin with a survey of techniques for high-resolution measurements of temperature and heat flux at the solid surface and in the working fluid. Next, we focus on diagnostic tools for boiling heat transfer and describe techniques for visualizing the temperature and velocity fields, as well as measurements at the single bubble level. Finally, we discuss techniques to probe the kinetics of vapor formation within a few molecular layers of the interface. We conclude with our outlook for future progress in experimental methodsmore » for phase change heat transfer.« less
NASA Astrophysics Data System (ADS)
Limbach, Hans-Heinrich; Meschede, Ludger; Scherer, Gerd
1989-05-01
Stratagems are presented for the determination of kinetic isotope effects of proton exchange reactions by dynamic NMR spectroscopy. In such experiments, lineshape analyses and/or polarization transfer experiments are performed on the exchanging protons or deuterons as well as on remote spins, as a function of the deuterium fraction in the mobile proton sites. These methods are NMR analogs of previous proton inventory techniques involving classical kinetic methods. A theory is developed in order to derive the kinetic isotope effects as well as the number of transferred protons from the experimental NMR spectra. The technique is then applied to the problem of proton exchange in the system 15N,15N'-di-p-fluorophenylibrmamidine, a nitrogen analog of formic acid, dissolved in tetrahydrofuran-d8 (THF). DFFA forms two conformers in THF to which s-trans and s-cis structures have been assigned. Only the s-trans conformer is able to dimerize and exchange protons. Lineshape simulations and magnetization transfer experiments were carried out at 189,2 K, at a concentration of 0.02 mol l-1, as a function of the deuterium fraction D in the 1H-15N sites. Using 1H NMR spectroscopy, a linear dependence of the inverse proton lifetimes on D was observed. From this it was concluded that two protons are transported in the rate limiting step of the proton exchange. This result is expected for a double proton transfer in an s-trans dimer with a cyclic structure. The full kinetic HH/HD/DD isotope effects of 233:11:1 at 189 K were determined through 19F NMR experiments on the same samples. The deviation from the rule of geometric mean, although substantial, is much smaller than found in previous studies of intramolecular HH transfer reactions. Possible causes of this effect are discussed.
A molecularly based theory for electron transfer reorganization energy.
Zhuang, Bilin; Wang, Zhen-Gang
2015-12-14
Using field-theoretic techniques, we develop a molecularly based dipolar self-consistent-field theory (DSCFT) for charge solvation in pure solvents under equilibrium and nonequilibrium conditions and apply it to the reorganization energy of electron transfer reactions. The DSCFT uses a set of molecular parameters, such as the solvent molecule's permanent dipole moment and polarizability, thus avoiding approximations that are inherent in treating the solvent as a linear dielectric medium. A simple, analytical expression for the free energy is obtained in terms of the equilibrium and nonequilibrium electrostatic potential profiles and electric susceptibilities, which are obtained by solving a set of self-consistent equations. With no adjustable parameters, the DSCFT predicts activation energies and reorganization energies in good agreement with previous experiments and calculations for the electron transfer between metallic ions. Because the DSCFT is able to describe the properties of the solvent in the immediate vicinity of the charges, it is unnecessary to distinguish between the inner-sphere and outer-sphere solvent molecules in the calculation of the reorganization energy as in previous work. Furthermore, examining the nonequilibrium free energy surfaces of electron transfer, we find that the nonequilibrium free energy is well approximated by a double parabola for self-exchange reactions, but the curvature of the nonequilibrium free energy surface depends on the charges of the electron-transferring species, contrary to the prediction by the linear dielectric theory.
Sogutmaz Ozdemir, Bahar; Budak, Hikmet
2018-01-01
Brachypodium distachyon has recently emerged as a model plant species for the grass family (Poaceae) that includes major cereal crops and forage grasses. One of the important traits of a model species is its capacity to be transformed and ease of growing both in tissue culture and in greenhouse conditions. Hence, plant transformation technology is crucial for improvements in agricultural studies, both for the study of new genes and in the production of new transgenic plant species. In this chapter, we review an efficient tissue culture and two different transformation systems for Brachypodium using most commonly preferred gene transfer techniques in plant species, microprojectile bombardment method (biolistics) and Agrobacterium-mediated transformation.In plant transformation studies, frequently used explant materials are immature embryos due to their higher transformation efficiencies and regeneration capacity. However, mature embryos are available throughout the year in contrast to immature embryos. We explain a tissue culture protocol for Brachypodium using mature embryos with the selected inbred lines from our collection. Embryogenic calluses obtained from mature embryos are used to transform Brachypodium with both plant transformation techniques that are revised according to previously studied protocols applied in the grasses, such as applying vacuum infiltration, different wounding effects, modification in inoculation and cocultivation steps or optimization of bombardment parameters.
NASA Astrophysics Data System (ADS)
Hashizume, H.; Ito, S.; Yanagi, N.; Tamura, H.; Sagara, A.
2018-02-01
Segment fabrication is now a candidate for the design of superconducting helical magnets in the helical fusion reactor FFHR-d1, which adopts the joint winding of high-temperature superconducting (HTS) helical coils as a primary option and the ‘remountable’ HTS helical coil as an advanced option. This paper reports on recent progress in two key technologies: the mechanical joints (remountable joints) of the HTS conductors and the metal porous media inserted into the cooling channel for segment fabrication. Through our research activities it has been revealed that heat treatment during fabrication of the joint can reduce joint resistance and its dispersion, which can shorten the fabrication process and be applied to bent conductor joints. Also, heat transfer correlations of the cooling channel were established to evaluate heat transfer performance with various cryogenic coolants based on the correlations to analyze the thermal stability of the joint.
Stimulated Raman adiabatic passage in a three-level superconducting circuit
Kumar, K. S.; Vepsäläinen, A.; Danilin, S.; Paraoanu, G. S.
2016-01-01
The adiabatic manipulation of quantum states is a powerful technique that opened up new directions in quantum engineering—enabling tests of fundamental concepts such as geometrical phases and topological transitions, and holding the promise of alternative models of quantum computation. Here we benchmark the stimulated Raman adiabatic passage for circuit quantum electrodynamics by employing the first three levels of a transmon qubit. In this ladder configuration, we demonstrate a population transfer efficiency >80% between the ground state and the second excited state using two adiabatic Gaussian-shaped control microwave pulses. By doing quantum tomography at successive moments during the Raman pulses, we investigate the transfer of the population in time domain. Furthermore, we show that this protocol can be reversed by applying a third adiabatic pulse, we study a hybrid nondiabatic–adiabatic sequence, and we present experimental results for a quasi-degenerate intermediate level. PMID:26902454
Stimulated Raman adiabatic passage in a three-level superconducting circuit.
Kumar, K S; Vepsäläinen, A; Danilin, S; Paraoanu, G S
2016-02-23
The adiabatic manipulation of quantum states is a powerful technique that opened up new directions in quantum engineering--enabling tests of fundamental concepts such as geometrical phases and topological transitions, and holding the promise of alternative models of quantum computation. Here we benchmark the stimulated Raman adiabatic passage for circuit quantum electrodynamics by employing the first three levels of a transmon qubit. In this ladder configuration, we demonstrate a population transfer efficiency >80% between the ground state and the second excited state using two adiabatic Gaussian-shaped control microwave pulses. By doing quantum tomography at successive moments during the Raman pulses, we investigate the transfer of the population in time domain. Furthermore, we show that this protocol can be reversed by applying a third adiabatic pulse, we study a hybrid nondiabatic-adiabatic sequence, and we present experimental results for a quasi-degenerate intermediate level.
Effect of pole zero location on system dynamics of boost converter for micro grid
NASA Astrophysics Data System (ADS)
Lavanya, A.; Vijayakumar, K.; Navamani, J. D.; Jayaseelan, N.
2018-04-01
Green clean energy like photo voltaic, wind energy, fuel cell can be brought together by microgrid.For low voltage sources like photovoltaic cell boost converter is very much essential. This paper explores the dynamic analysis of boost converter in a continuous conduction mode (CCM). The transient performance and stability analysis is carried out in this paper using time domain analysis and frequency domain analysis techniques. Boost converter is simulated using both PSIM and MATLAB software. Furthermore, state space model obtained and the transfer function is derived. The converter behaviour when a step input is applied is analyzed and stability of the converter is analyzed from bode plot frequency for open loop. Effect of the locations of poles and zeros in the transfer function of boost converter and how the performance parameters are affected is discussed in this paper. Closed loop performance with PI controller is also analyzed for boost converter.
NASA Astrophysics Data System (ADS)
Cheng, Heming; Huang, Xieqing; Fan, Jiang; Wang, Honggang
1999-10-01
The calculation of a temperature field has a great influence upon the analysis of thermal stresses and stains during quenching. In this paper, a 42CrMo steel cylinder was used an example for investigation. From the TTT diagram of the 42CrMo steel, the CCT diagram was simulated by mathematical transformation, and the volume fraction of phase constituents was calculated. The thermal physical properties were treated as functions of temperature and the volume fraction of phase constituents. The rational approximation was applied to the finite element method. The temperature field with phase transformation and non-linear surface heat-transfer coefficients was calculated using this technique, which can effectively avoid oscillationin the numerical solution for a small time step. The experimental results of the temperature field calculation coincide with the numerical solutions.
Boiling incipience and convective boiling of neon and nitrogen
NASA Technical Reports Server (NTRS)
Papell, S. S.; Hendricks, R. C.
1977-01-01
Forced convection and subcooled boiling heat transfer data for liquid nitrogen and liquid neon were obtained in support of a design study for a 30 tesla cryomagnet cooled by forced convection of liquid neon. This design precludes nucleate boiling in the flow channels as they are too small to handle vapor flow. Consequently, it was necessary to determine boiling incipience under the operating conditions of the magnet system. The cryogen data obtained over a range of system pressures, fluid flow rates, and applied heat fluxes were used to develop correlations for predicting boiling incipience and convective boiling heat transfer coefficients in uniformly heated flow channels. The accuracy of the correlating equations was then evaluated. A technique was also developed to calculate the position of boiling incipience in a uniformly heated flow channel. Comparisons made with the experimental data showed a prediction accuracy of plus or minus 15 percent
[Product safety analysis of somatic cell cloned bovine].
Hua, Song; Lan, Jie; Song, Yongli; Lu, Chenglong; Zhang, Yong
2010-05-01
Somatic cell cloning (nuclear transfer) is a technique through which the nucleus (DNA) of a somatic cell is transferred into an enucleated oocyte for the generation of a new individual, genetically identical to the somatic cell donor. It could be applied for the enhancement of reproduction rate and the improvement of food products involving quality, yield and nutrition. In recent years, the United States, Japan and Europe as well as other countries announced that meat and milk products made from cloned cattle are safe for human consumption. Yet, cloned animals are faced with a wide range of health problems, with a high death rate and a high incidence of disease. The precise causal mechanisms for the low efficiency of cloning remain unclear. Is it safe that any products from cloned animals were allowed into the food supply? This review focuses on the security of meat, milk and products from cloned cattle based on the available data.
Dernotte, Jeremie; Dec, John E.; Ji, Chunsheng
2015-04-14
A detailed understanding of the various factors affecting the trends in gross-indicated thermal efficiency with changes in key operating parameters has been carried out, applied to a one-liter displacement single-cylinder boosted Low-Temperature Gasoline Combustion (LTGC) engine. This work systematically investigates how the supplied fuel energy splits into the following four energy pathways: gross-indicated thermal efficiency, combustion inefficiency, heat transfer and exhaust losses, and how this split changes with operating conditions. Additional analysis is performed to determine the influence of variations in the ratio of specific heat capacities (γ) and the effective expansion ratio, related to the combustion-phasing retard (CA50), onmore » the energy split. Heat transfer and exhaust losses are computed using multiple standard cycle analysis techniques. Furthermore, the various methods are evaluated in order to validate the trends.« less
Photographic Image Restoration
NASA Technical Reports Server (NTRS)
Hite, Gerald E.
1991-01-01
Deblurring capabilities would significantly improve the Flight Science Support Office's ability to monitor the effects of lift-off on the shuttle and landing on the orbiter. A deblurring program was written and implemented to extract information from blurred images containing a straight line or edge and to use that information to deblur the image. The program was successfully applied to an image blurred by improper focussing and two blurred by different amounts of blurring. In all cases, the reconstructed modulation transfer function not only had the same zero contours as the Fourier transform of the blurred image but the associated point spread function also had structure not easily described by simple parameterizations. The difficulties posed by the presence of noise in the blurred image necessitated special consideration. An amplitude modification technique was developed for the zero contours of the modulation transfer function at low to moderate frequencies and a smooth filter was used to suppress high frequency noise.
Characterisation of gene delivery using liposomal bubbles and ultrasound
NASA Astrophysics Data System (ADS)
Koshima, Risa; Suzuki, Ryo; Oda, Yusuke; Hirata, Keiichi; Nomura, Tetsuya; Negishi, Yoichi; Utoguchi, Naoki; Kudo, Nobuki; Maruyama, Kazuo
2011-09-01
The combination of nano/microbubbles and ultrasound is a novel technique for a non-viral gene deliver. We have previously developed novel ultrasound sensitive liposomes (Bubble liposomes) which contain the ultrasound imaging gas perfluoropropane. In this study, Bubble liposomes were compared with cationic lipid (CL)-DNA complexes as potential gene delivery carriers into tumors in vivo. The delivery of genes by bubble liposomes depended on the intensity of the applied ultrasound. The transfection efficiency plateaued at 0.7 W/cm2 ultrasound intensity. Bubble liposomes efficiently transferred genes into cultured cells even when the cells were exposed to ultrasound for only 1 s. In addition, bubble liposomes were able to introduce the luciferase gene more effectively than CL-DNA complexes into mouse ascites tumor cells. We conclude that the combination of Bubble liposomes and ultrasound is a good method for gene transfer in vivo.
NASA Astrophysics Data System (ADS)
Nabil, Mahdi; Rattner, Alexander S.
The volume-of-fluid (VOF) approach is a mature technique for simulating two-phase flows. However, VOF simulation of phase-change heat transfer is still in its infancy. Multiple closure formulations have been proposed in the literature, each suited to different applications. While these have enabled significant research advances, few implementations are publicly available, actively maintained, or inter-operable. Here, a VOF solver is presented (interThermalPhaseChangeFoam), which incorporates an extensible framework for phase-change heat transfer modeling, enabling simulation of diverse phenomena in a single environment. The solver employs object oriented OpenFOAM library features, including Run-Time-Type-Identification to enable rapid implementation and run-time selection of phase change and surface tension force models. The solver is packaged with multiple phase change and surface tension closure models, adapted and refined from earlier studies. This code has previously been applied to study wavy film condensation, Taylor flow evaporation, nucleate boiling, and dropwise condensation. Tutorial cases are provided for simulation of horizontal film condensation, smooth and wavy falling film condensation, nucleate boiling, and bubble condensation. Validation and grid sensitivity studies, interfacial transport models, effects of spurious currents from surface tension models, effects of artificial heat transfer due to numerical factors, and parallel scaling performance are described in detail in the Supplemental Material (see Appendix A). By incorporating the framework and demonstration cases into a single environment, users can rapidly apply the solver to study phase-change processes of interest.
Improved specimen reconstruction by Hilbert phase contrast tomography.
Barton, Bastian; Joos, Friederike; Schröder, Rasmus R
2008-11-01
The low signal-to-noise ratio (SNR) in images of unstained specimens recorded with conventional defocus phase contrast makes it difficult to interpret 3D volumes obtained by electron tomography (ET). The high defocus applied for conventional tilt series generates some phase contrast but leads to an incomplete transfer of object information. For tomography of biological weak-phase objects, optimal image contrast and subsequently an optimized SNR are essential for the reconstruction of details such as macromolecular assemblies at molecular resolution. The problem of low contrast can be partially solved by applying a Hilbert phase plate positioned in the back focal plane (BFP) of the objective lens while recording images in Gaussian focus. Images recorded with the Hilbert phase plate provide optimized positive phase contrast at low spatial frequencies, and the contrast transfer in principle extends to the information limit of the microscope. The antisymmetric Hilbert phase contrast (HPC) can be numerically converted into isotropic contrast, which is equivalent to the contrast obtained by a Zernike phase plate. Thus, in-focus HPC provides optimal structure factor information without limiting effects of the transfer function. In this article, we present the first electron tomograms of biological specimens reconstructed from Hilbert phase plate image series. We outline the technical implementation of the phase plate and demonstrate that the technique is routinely applicable for tomography. A comparison between conventional defocus tomograms and in-focus HPC volumes shows an enhanced SNR and an improved specimen visibility for in-focus Hilbert tomography.
NASA Technical Reports Server (NTRS)
Kim, K.; Wiedner, B.; Camci, C.
1993-01-01
A combined convective heat transfer and fluid dynamics investigation in a turbulent round jet impinging on a flat surface is presented. The experimental study uses a high resolution liquid crystal technique for the determination of the convective heat transfer coefficients on the impingement plate. The heat transfer experiments are performed using a transient heat transfer method. The mean flow and the character of turbulent flow in the free jet is presented through five hole probe and hot wire measurements, respectively. The flow field character of the region near the impingement plate plays an important role in the amount of convective heat transfer. Detailed surveys obtained from five hole probe and hot wire measurements are provided. An extensive validation of the liquid crystal based heat transfer method against a conventional technique is also presented. After a complete documentation of the mean and turbulent flow field, the convective heat transfer coefficient distributions on the impingement plate are presented. The near wall of the impingement plate and the free jet region is treated separately. The current heat transfer distributions are compared to other studies available from the literature. The present paper contains complete sets of information on the three dimensional mean flow, turbulent velocity fluctuations, and convective heat transfer to the plate. The experiments also prove that the present nonintrusive heat transfer method is highly effective in obtaining high resolution heat transfer maps with a heat transfer coefficient uncertainty of 5.7 percent.
Heat Transfer Search Algorithm for Non-convex Economic Dispatch Problems
NASA Astrophysics Data System (ADS)
Hazra, Abhik; Das, Saborni; Basu, Mousumi
2018-06-01
This paper presents Heat Transfer Search (HTS) algorithm for the non-linear economic dispatch problem. HTS algorithm is based on the law of thermodynamics and heat transfer. The proficiency of the suggested technique has been disclosed on three dissimilar complicated economic dispatch problems with valve point effect; prohibited operating zone; and multiple fuels with valve point effect. Test results acquired from the suggested technique for the economic dispatch problem have been fitted to that acquired from other stated evolutionary techniques. It has been observed that the suggested HTS carry out superior solutions.
Heat Transfer Search Algorithm for Non-convex Economic Dispatch Problems
NASA Astrophysics Data System (ADS)
Hazra, Abhik; Das, Saborni; Basu, Mousumi
2018-03-01
This paper presents Heat Transfer Search (HTS) algorithm for the non-linear economic dispatch problem. HTS algorithm is based on the law of thermodynamics and heat transfer. The proficiency of the suggested technique has been disclosed on three dissimilar complicated economic dispatch problems with valve point effect; prohibited operating zone; and multiple fuels with valve point effect. Test results acquired from the suggested technique for the economic dispatch problem have been fitted to that acquired from other stated evolutionary techniques. It has been observed that the suggested HTS carry out superior solutions.
Irreparable Rotator Cuff Tears: Restoring Joint Kinematics by Tendon Transfers
Greenspoon, Joshua A.; Millett, Peter J.; Moulton, Samuel G.; Petri, Maximilian
2016-01-01
Background: Tendon transfers can be a surgical treatment option in managing younger, active patients with massive irreparable rotator cuff tears. The purpose of this article is to provide an overview of the use of tendon transfers to treat massive irreparable rotator cuff tears and to summarize clinical outcomes. Methods: A selective literature search was performed and personal surgical experiences are reported. Results: Latissimus dorsi transfers have been used for many years in the management of posterosuperior rotator cuff tears with good reported clinical outcomes. It can be transferred without or with the teres major (L’Episcopo technique). Many surgical techniques have been described for latissimus dorsi transfer including single incision, double incision, and arthroscopically assisted transfer. Transfer of the pectoralis major tendon is the most common tendon transfer procedure performed for anterosuperior rotator cuff deficiencies. Several surgical techniques have been described, however transfer of the pectoralis major beneath the coracoid process has been found to most closely replicate the force vector that is normally provided by the intact subscapularis. Conclusion: Tendon transfers can be used successfully in the management of younger patients with massive irreparable rotator cuff tears and minimal glenohumeral arthritis. Improvements in clinical outcomes scores and range of motion have been demonstrated. This can delay arthroplasty, which is of particular importance for younger patients with high functional demands. PMID:27708730
Comparative evaluation of three heat transfer enhancement strategies in a grooved channel
NASA Astrophysics Data System (ADS)
Herman, C.; Kang, E.
Results of a comparative evaluation of three heat transfer enhancement strategies for forced convection cooling of a parallel plate channel populated with heated blocks, representing electronic components mounted on printed circuit boards, are reported. Heat transfer in the reference geometry, the asymmetrically heated parallel plate channel, is compared with that for the basic grooved channel, and the same geometry enhanced by cylinders and vanes placed above the downstream edge of each heated block. In addition to conventional heat transfer and pressure drop measurements, holographic interferometry combined with high-speed cinematography was used to visualize the unsteady temperature fields in the self-sustained oscillatory flow. The locations of increased heat transfer within one channel periodicity depend on the enhancement technique applied, and were identified by analyzing the unsteady temperature distributions visualized by holographic interferometry. This approach allowed gaining insight into the mechanisms responsible for heat transfer enhancement. Experiments were conducted at moderate flow velocities in the laminar, transitional and turbulent flow regimes. Reynolds numbers were varied in the range Re=200-6500, corresponding to flow velocities from 0.076 to 2.36m/s. Flow oscillations were first observed between Re=1050 and 1320 for the basic grooved channel, and around Re=350 and 450 for the grooved channels equipped with cylinders and vanes, respectively. At Reynolds numbers above the onset of oscillations and in the transitional flow regime, heat transfer rates in the investigated grooved channels exceeded the performance of the reference geometry, the asymmetrically heated parallel plate channel. Heat transfer in the grooved channels enhanced with cylinders and vanes showed an increase by a factor of 1.2-1.8 and 1.5-3.5, respectively, when compared to data obtained for the basic grooved channel; however, the accompanying pressure drop penalties also increased significantly.
[Biomechanical testing of the new torque-segmented arch (TSA)].
Wichelhaus, A; Sander, F G
1995-07-01
New torque-segmented arch wires are presented which consist of a superelastic anterior component with 30 degrees or 45 degrees torque and which are connected to 2 steel lateral components by means of a crimped connector. When using such torque-segmented arch wires, the crimped connector rests mesially to the canine bracket and the lateral components exhibit a torque of 0 degree. The use of the torque-segmented arch wires requires the practitioner to adjust the anterior tooth segment, to bend in first order bends in the steel lateral portion as well as to bend in a sweep to avoid an anterior tooth extrusion, and, if desired, to bend in third order bends to influence premolars and molars. In some cases the simultaneous application of palatal arches can become necessary, because each torque transfer results in a transversal enlargement in the molar area. Compared to conventional steel wires with dimensions of 0.016 x 0.022 in which an anterior tooth torque is bent, the torque segmented arch wires exhibit considerably fewer side effects, but there is a larger distally rotating moment for the molars. 1. When applying torque-segmented arch wires, the extrusive force transferred to the anterior teeth is considerably smaller. 2. The protrusive force acting on the anterior teeth is also considerably smaller, which results in a reduced demand being placed on the anchorage of the molars. 3. The torque transfer to the incisors rests in a quite moderate range, even in the case of a 50 degrees torque. For this reason, the practitioner can expect diminished or no resorptions at all compared to the aforementioned steel wires. 4. The Martensite plateau of the torque-segmented arch wires exhibit constant moments in large areas so that such arch wires can be used in almost every anterior tooth position. 5. The segmented wires presented here can be applied not only in the case of the standard edgewise technique but also in each case of the straight-wire technique. 6. These new arch wires require no readjustment of torque values. 7. To control the transferred torque values it is recommended that the already transferred torque values be monitored during each check-up with the help of the described torque key. 8. When the torque values of the brackets are known, the torque key renders frequent patient X-rays superfluous. 9. When the desired torque values are attained, treatment can proceed using conventional arch wires.
USDA-ARS?s Scientific Manuscript database
The ultimate goal of applied research of phosphorus (P) transfer from agricultural fields to surface waters should arguably be to develop and apply mathematical models. There are two primary reasons for this assertion: 1) models formalize our understanding of P transfer and force us to test that und...
Versatile transfer of aligned carbon nanotubes with polydimethylsiloxane as the intermediate
NASA Astrophysics Data System (ADS)
Zhu, Yanwu; Lim, Xiaodai; Chea Sim, Mong; Teck Lim, Chwee; Haur Sow, Chorng
2008-08-01
A simple technique to transfer aligned multi-walled carbon nanotubes (MWCNTs) is demonstrated in this work. With polydimethylsiloxane (PDMS) as the transfer medium, as-grown or patterned MWCNT arrays are directly transferred onto a wide variety of Pt-coated substrates such as glossy paper, cloth, polymers, glass slides, and metal foils at low temperatures. The surface of the transferred CNTs is cleaner with better alignment, compared with the as-grown one. Furthermore, the transferred CNTs show strong adhesion and good electric contact with the target substrates. A maximal current density of ~104 A cm-2 has been achieved from the CNT interconnects prepared with this technique. Because of the lower density and open-ended structures, improved field emission performance has been obtained from CNTs transferred on polymers, based on which flexible emitter devices can be fabricated. In addition, the surface of transferred CNTs becomes more hydrophilic, with an averaged contact angle of 93.4 ± 5.8°, in contrast to the super-hydrophobic as-grown CNT surface (contact angle 151.6 ± 5.5°). With versatile properties and flexible applications, the technique provides a simple and cost-effective way towards future nanodevices based on CNTs.
NASA Astrophysics Data System (ADS)
Pagliarini, G.; Vocale, P.; Mocerino, A.; Rainieri, S.
2017-01-01
Passive convective heat transfer enhancement techniques are well known and widespread tool for increasing the efficiency of heat transfer equipment. In spite of the ability of the first principle approach to forecast the macroscopic effects of the passive techniques for heat transfer enhancement, namely the increase of both the overall heat exchanged and the head losses, a first principle analysis based on energy, momentum and mass local conservation equations is hardly able to give a comprehensive explanation of how local modifications in the boundary layers contribute to the overall effect. A deeper insight on the heat transfer enhancement mechanisms can be instead obtained within a second principle approach, through the analysis of the local exergy dissipation phenomena which are related to heat transfer and fluid flow. To this aim, the analysis based on the second principle approach implemented through a careful consideration of the local entropy generation rate seems the most suitable, since it allows to identify more precisely the cause of the loss of efficiency in the heat transfer process, thus providing a useful guide in the choice of the most suitable heat transfer enhancement techniques.
Artificial Mitochondria Transfer: Current Challenges, Advances, and Future Applications
Aponte, Pedro M.
2017-01-01
The objective of this review is to outline existing artificial mitochondria transfer techniques and to describe the future steps necessary to develop new therapeutic applications in medicine. Inspired by the symbiotic origin of mitochondria and by the cell's capacity to transfer these organelles to damaged neighbors, many researchers have developed procedures to artificially transfer mitochondria from one cell to another. The techniques currently in use today range from simple coincubations of isolated mitochondria and recipient cells to the use of physical approaches to induce integration. These methods mimic natural mitochondria transfer. In order to use mitochondrial transfer in medicine, we must answer key questions about how to replicate aspects of natural transport processes to improve current artificial transfer methods. Another priority is to determine the optimum quantity and cell/tissue source of the mitochondria in order to induce cell reprogramming or tissue repair, in both in vitro and in vivo applications. Additionally, it is important that the field explores how artificial mitochondria transfer techniques can be used to treat different diseases and how to navigate the ethical issues in such procedures. Without a doubt, mitochondria are more than mere cell power plants, as we continue to discover their potential to be used in medicine. PMID:28751917
NASA Astrophysics Data System (ADS)
Kumaresan, E.; Vijaya Kumar, A. G.; Rushi Kumar, B.
2017-11-01
This article studies, an exact solution of unsteady MHD free convection boundary-layer flow of a silver nanofluid past an exponentially accelerated moving vertical plate through aporous medium in the presence of thermal radiation, transverse applied amagnetic field, radiation absorption and Heat generation or absorption with chemical reaction are investigated theoretically. We consider nanofluids contain spherical shaped nanoparticle of silverwith a nanoparticle volume concentration range smaller than or equal to 0.04. This phenomenon is modeled in the form of partial differential equations with initial boundary conditions. Some suitable dimensional variables are introduced. The corresponding dimensionless equations with boundary conditions are solved by using Laplace transform technique. The exact solutions for velocity, energy, and species are obtained, also the corresponding numerical values of nanofluid velocity, temperature and concentration profiles are represented graphically. The expressions for skin friction coefficient, the rate of heat transfer and mass transfer are derived. The present study finds applications involving heat transfer, enhancement of thermal conductivity and other applications like transportation, industrial cooling applications, heating buildings and reducing pollution, energy applications and solar absorption. The effect of heat transfer is found to be more pronounced in a silver-water nanofluid than in the other nanofluids.
Estimating the decomposition of predictive information in multivariate systems
NASA Astrophysics Data System (ADS)
Faes, Luca; Kugiumtzis, Dimitris; Nollo, Giandomenico; Jurysta, Fabrice; Marinazzo, Daniele
2015-03-01
In the study of complex systems from observed multivariate time series, insight into the evolution of one system may be under investigation, which can be explained by the information storage of the system and the information transfer from other interacting systems. We present a framework for the model-free estimation of information storage and information transfer computed as the terms composing the predictive information about the target of a multivariate dynamical process. The approach tackles the curse of dimensionality employing a nonuniform embedding scheme that selects progressively, among the past components of the multivariate process, only those that contribute most, in terms of conditional mutual information, to the present target process. Moreover, it computes all information-theoretic quantities using a nearest-neighbor technique designed to compensate the bias due to the different dimensionality of individual entropy terms. The resulting estimators of prediction entropy, storage entropy, transfer entropy, and partial transfer entropy are tested on simulations of coupled linear stochastic and nonlinear deterministic dynamic processes, demonstrating the superiority of the proposed approach over the traditional estimators based on uniform embedding. The framework is then applied to multivariate physiologic time series, resulting in physiologically well-interpretable information decompositions of cardiovascular and cardiorespiratory interactions during head-up tilt and of joint brain-heart dynamics during sleep.
Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-06-01
Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.
Optimal transfers between libration-point orbits in the elliptic restricted three-body problem
NASA Astrophysics Data System (ADS)
Hiday, Lisa Ann
1992-09-01
A strategy is formulated to design optimal impulsive transfers between three-dimensional libration-point orbits in the vicinity of the interior L(1) libration point of the Sun-Earth/Moon barycenter system. Two methods of constructing nominal transfers, for which the fuel cost is to be minimized, are developed; both inferior and superior transfers between two halo orbits are considered. The necessary conditions for an optimal transfer trajectory are stated in terms of the primer vector. The adjoint equation relating reference and perturbed trajectories in this formulation of the elliptic restricted three-body problem is shown to be distinctly different from that obtained in the analysis of trajectories in the two-body problem. Criteria are established whereby the cost on a nominal transfer can be improved by the addition of an interior impulse or by the implementation of coastal arcs in the initial and final orbits. The necessary conditions for the local optimality of a time-fixed transfer trajectory possessing additional impulses are satisfied by requiring continuity of the Hamiltonian and the derivative of the primer vector at all interior impulses. The optimality of a time-free transfer containing coastal arcs is surmised by examination of the slopes at the endpoints of a plot of the magnitude of the primer vector over the duration of the transfer path. If the initial and final slopes of the primer magnitude are zero, the transfer trajectory is optimal; otherwise, the execution of coasts is warranted. The position and timing of each interior impulse applied to a time-fixed transfer as well as the direction and length of coastal periods implemented on a time-free transfer are specified by the unconstrained minimization of the appropriate variation in cost utilizing a multivariable search technique. Although optimal solutions in some instances are elusive, the time-fixed and time-free optimization algorithms prove to be very successful in diminishing costs on nominal transfer trajectories. The inclusion of coastal arcs on time-free superior and inferior transfers results in significant modification of the transfer time of flight caused by shifts in departure and arrival locations on the halo orbits.
Kemmerich, Felix E; Swoboda, Marko; Kauert, Dominik J; Grieb, M Svea; Hahn, Steffen; Schwarz, Friedrich W; Seidel, Ralf; Schlierf, Michael
2016-01-13
We present a hybrid single-molecule technique combining magnetic tweezers and Förster resonance energy transfer (FRET) measurements. Through applying external forces to a paramagnetic sphere, we induce conformational changes in DNA nanostructures, which are detected in two output channels simultaneously. First, by tracking a magnetic bead with high spatial and temporal resolution, we observe overall DNA length changes along the force axis. Second, the measured FRET efficiency between two fluorescent probes monitors local conformational changes. The synchronized orthogonal readout in different observation channels will facilitate deciphering the complex mechanisms of biomolecular machines.
NASA Technical Reports Server (NTRS)
Botkin, Daniel B.
1987-01-01
The analysis of ground-truth data from the boreal forest plots in the Superior National Forest, Minnesota, was completed. Development of statistical methods was completed for dimension analysis (equations to estimate the biomass of trees from measurements of diameter and height). The dimension-analysis equations were applied to the data obtained from ground-truth plots, to estimate the biomass. Classification and analyses of remote sensing images of the Superior National Forest were done as a test of the technique to determine forest biomass and ecological state by remote sensing. Data was archived on diskette and tape and transferred to UCSB to be used in subsequent research.
In vivo fluorescence lifetime optical projection tomography
McGinty, James; Taylor, Harriet B.; Chen, Lingling; Bugeon, Laurence; Lamb, Jonathan R.; Dallman, Margaret J.; French, Paul M. W.
2011-01-01
We demonstrate the application of fluorescence lifetime optical projection tomography (FLIM-OPT) to in vivo imaging of lysC:GFP transgenic zebrafish embryos (Danio rerio). This method has been applied to unambiguously distinguish between the fluorescent protein (GFP) signal in myeloid cells from background autofluorescence based on the fluorescence lifetime. The combination of FLIM, an inherently ratiometric method, in conjunction with OPT results in a quantitative 3-D tomographic technique that could be used as a robust method for in vivo biological and pharmaceutical research, for example as a readout of Förster resonance energy transfer based interactions. PMID:21559145
NASA Technical Reports Server (NTRS)
Baumeister, K. J.; Papell, S. S.
1973-01-01
General formulas are derived for determining gage averaging errors of strip-type heat flux meters used in the measurement of one-dimensional heat flux distributions. In addition, a correction procedure is presented which allows a better estimate for the true value of the local heat flux. As an example of the technique, the formulas are applied to the cases of heat transfer to air slot jets impinging on flat and concave surfaces. It is shown that for many practical problems, the use of very small heat flux gages is often unnecessary.
Research and design on system of asset management based on RFID
NASA Astrophysics Data System (ADS)
Guan, Peng; Du, HuaiChang; Jing, Hua; Zhang, MengYue; Zhang, Meng; Xu, GuiXian
2011-10-01
By analyzing the problems in the current assets management, this thesis proposing RFID technology will be applied to asset management in order to improve the management level of automation and information. This paper designed the equipment identification based on 433MHz RFID tag and reader which was deeply studied on the basis of RFID tag and card reader circuits, and this paper also illustrates the system of asset management. The RS232 converts Ethernet is a innovative technology to transfer data to PC monitor software, and implement system of asset management based on WEB techniques (PHP and MySQL).
A scattering model for defoliated vegetation
NASA Technical Reports Server (NTRS)
Karam, M. A.; Fung, A. K.
1986-01-01
A scattering model for defoliated vegetation is conceived as a layer of dielectric, finite-length cylinders with specified size and orientation distributions above an irregular ground surface. The scattering phase matrix of a single cylinder is computed, then the radiative transfer technique is applied to link volume scattering from vegetation to surface scattering from the soil surface. Polarized and depolarized scattering are computed and the effects of the cylinder size and orientation distributions are illustrated. It is found that size and orientation distributions have significant effects on the backscattered signal. The model is compared with scattering from defoliated trees and agricultural crops.
Blumthaler, Ingrid; Oberst, Ulrich
2012-03-01
Control design belongs to the most important and difficult tasks of control engineering and has therefore been treated by many prominent researchers and in many textbooks, the systems being generally described by their transfer matrices or by Rosenbrock equations and more recently also as behaviors. Our approach to controller design uses, in addition to the ideas of our predecessors on coprime factorizations of transfer matrices and on the parametrization of stabilizing compensators, a new mathematical technique which enables simpler design and also new theorems in spite of the many outstanding results of the literature: (1) We use an injective cogenerator signal module ℱ over the polynomial algebra [Formula: see text] (F an infinite field), a saturated multiplicatively closed set T of stable polynomials and its quotient ring [Formula: see text] of stable rational functions. This enables the simultaneous treatment of continuous and discrete systems and of all notions of stability, called T-stability. We investigate stabilizing control design by output feedback of input/output (IO) behaviors and study the full feedback IO behavior, especially its autonomous part and not only its transfer matrix. (2) The new technique is characterized by the permanent application of the injective cogenerator quotient signal module [Formula: see text] and of quotient behaviors [Formula: see text] of [Formula: see text]-behaviors B. (3) For the control tasks of tracking, disturbance rejection, model matching, and decoupling and not necessarily proper plants we derive necessary and sufficient conditions for the existence of proper stabilizing compensators with proper and stable closed loop behaviors, parametrize all such compensators as IO behaviors and not only their transfer matrices and give new algorithms for their construction. Moreover we solve the problem of pole placement or spectral assignability for the complete feedback behavior. The properness of the full feedback behavior ensures the absence of impulsive solutions in the continuous case, and that of the compensator enables its realization by Kalman state space equations or elementary building blocks. We note that every behavior admits an IO decomposition with proper transfer matrix, but that most of these decompositions do not have this property, and therefore we do not assume the properness of the plant. (4) The new technique can also be applied to more general control interconnections according to Willems, in particular to two-parameter feedback compensators and to the recent tracking framework of Fiaz/Takaba/Trentelman. In contrast to these authors, however, we pay special attention to the properness of all constructed transfer matrices which requires more subtle algorithms.
Ma, Ryewon; Jung, Dukyoo
2016-02-01
This study was done to develop a postural-stability patient transfer technique for care helpers in nursing homes and to evaluate its effectiveness. Four types of patient transfer techniques (Lifting towards the head board of the bed, turning to the lateral position, sitting upright on the bed, transferring from wheel chair to bed) were practiced in accordance with the following three methods; Care helpers habitually used transfer methods (Method 1), patient transfer methods according to care helper standard textbooks (Method 2), and a method developed by the author ensuring postural-stability (Method 3). The care helpers' muscle activity and four joint angles were measured. The collected data were analyzed using the program SPSS Statistic 21.0. To differentiate the muscle activity and joint angle, the Friedman test was executed and the post-hoc analysis was conducted using the Wilcoxon Signed Rank test. Muscle activity was significantly lower during Method 3 compared to Methods 1 and 2. In addition, the joint angle was significantly lower for the knee and shoulder joint angle while performing Method 3 compared to Methods 1 and 2. Findings indicate that using postural-stability patient transfer techniques can contribute to the prevention of musculoskeletal disease which care helpers suffer from due to physically demanding patient care in nursing homes.
Margin and sensitivity methods for security analysis of electric power systems
NASA Astrophysics Data System (ADS)
Greene, Scott L.
Reliable operation of large scale electric power networks requires that system voltages and currents stay within design limits. Operation beyond those limits can lead to equipment failures and blackouts. Security margins measure the amount by which system loads or power transfers can change before a security violation, such as an overloaded transmission line, is encountered. This thesis shows how to efficiently compute security margins defined by limiting events and instabilities, and the sensitivity of those margins with respect to assumptions, system parameters, operating policy, and transactions. Security margins to voltage collapse blackouts, oscillatory instability, generator limits, voltage constraints and line overloads are considered. The usefulness of computing the sensitivities of these margins with respect to interarea transfers, loading parameters, generator dispatch, transmission line parameters, and VAR support is established for networks as large as 1500 buses. The sensitivity formulas presented apply to a range of power system models. Conventional sensitivity formulas such as line distribution factors, outage distribution factors, participation factors and penalty factors are shown to be special cases of the general sensitivity formulas derived in this thesis. The sensitivity formulas readily accommodate sparse matrix techniques. Margin sensitivity methods are shown to work effectively for avoiding voltage collapse blackouts caused by either saddle node bifurcation of equilibria or immediate instability due to generator reactive power limits. Extremely fast contingency analysis for voltage collapse can be implemented with margin sensitivity based rankings. Interarea transfer can be limited by voltage limits, line limits, or voltage stability. The sensitivity formulas presented in this thesis apply to security margins defined by any limit criteria. A method to compute transfer margins by directly locating intermediate events reduces the total number of loadflow iterations required by each margin computation and provides sensitivity information at minimal additional cost. Estimates of the effect of simultaneous transfers on the transfer margins agree well with the exact computations for a network model derived from a portion of the U.S grid. The accuracy of the estimates over a useful range of conditions and the ease of obtaining the estimates suggest that the sensitivity computations will be of practical value.
36 CFR § 1235.44 - What general transfer requirements apply to electronic records?
Code of Federal Regulations, 2013 CFR
2013-07-01
... requirements apply to electronic records? § 1235.44 Section § 1235.44 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF RECORDS TO THE NATIONAL... requirements apply to electronic records? (a) Each agency must retain a copy of permanent electronic records...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Manohar S. Sohal
2005-09-01
This report summarizes work at the Idaho National Laboratory to develop strategies to enhance air-side heat transfer in geothermal air-cooled condensers such that it should not significantly increase pressure drop and parasitic fan pumping power. The work was sponsored by the U.S. Department of Energy, NEDO (New Energy and Industrial Technology Development Organization) of Japan, Yokohama National University, and the Indian Institute of Technology, Kanpur, India. A combined experimental and numerical investigation was performed to investigate heat transfer enhancement techniques that may be applicable to largescale air-cooled condensers such as those used in geothermal power applications. A transient heat transfermore » visualization and measurement technique was employed in order to obtain detailed distributions of local heat transfer coefficients on model fin surfaces. Pressure drop measurements were obtained for a variety of tube and winglet configurations using a single-channel flow apparatus that included four tube rows in a staggered array. Heat transfer and pressure drop measurements were also acquired in a separate multiple-tube row apparatus in the Single Blow Test Facility. In addition, a numerical modeling technique was developed to predict local and average heat transfer for these low-Reynolds number flows, with and without winglets. Representative experimental and numerical results were obtained that reveal quantitative details of local finsurface heat transfer in the vicinity of a circular tube with a single delta winglet pair downstream of the cylinder. Heat transfer and pressure-drop results were obtained for flow Reynolds numbers based on channel height and mean flow velocity ranging from 700 to 6500. The winglets were of triangular (delta) shape with a 1:2 or 1:3 height/length aspect ratio and a height equal to 90% of the channel height. Overall mean fin-surface heat transfer results indicate a significant level of heat transfer enhancement (in terms of Colburn j-factor) associated with deployment of the winglets with circular as well as oval tubes. In general, toe-in (common flow up) type winglets appear to have better performance than the toe-out (common flow down) type winglets. Comparisons of heat transfer and pressure drop results for the elliptical tube versus a circular tube with and without winglets are provided. During the course of their independent research, all of the researchers have established that about 10 to 30% enhancement in Colburn j-factor is expected. However, actual increase in heat transfer rate from a heat exchanger employing finned tubes with winglets may be smaller, perhaps on the order of 2 to 5%. It is also concluded that for any specific application, more full-size experimentation is needed to optimize the winglet design for a specific heat exchanger application. If in place of a circular tube, an oval tube can be economically used in a bundle, it is expected that the pressure drop across the tube bundle with the application of vortex generators (winglets) will be similar to that in a conventional circular tube bundle. It is hoped that the results of this research will demonstrate the benefits of applying vortex generators (winglets) on the fins to improve the heat transfer from the air-side of the tube bundle.« less
The security energy encryption in wireless power transfer
NASA Astrophysics Data System (ADS)
Sadzali, M. N.; Ali, A.; Azizan, M. M.; Albreem, M. A. M.
2017-09-01
This paper presents a concept of security in wireless power transfer (WPT) by applying chaos theory. Chaos theory is applied as a security system in order to safeguard the transfer of energy from a transmitter to the intended receiver. The energy encryption of the wireless power transfer utilizes chaos theory to generate the possibility of a logistic map for the chaotic security key. The simulation for energy encryption wireless power transfer system was conducted by using MATLAB and Simulink. By employing chaos theory, the chaotic key ensures the transmission of energy from transmitter to its intended receiver.
Electroless-plating technique for fabricating thin-wall convective heat-transfer models
NASA Technical Reports Server (NTRS)
Avery, D. E.; Ballard, G. K.; Wilson, M. L.
1984-01-01
A technique for fabricating uniform thin-wall metallic heat-transfer models and which simulates a Shuttle thermal protection system tile is described. Two 6- by 6- by 2.5-in. tiles were fabricated to obtain local heat transfer rates. The fabrication process is not limited to any particular geometry and results in a seamless thin-wall heat-transfer model which uses a one-wire thermocouple to obtain local cold-wall heat-transfer rates. The tile is relatively fragile because of the brittle nature of the material and the structural weakness of the flat-sided configuration; however, a method was developed and used for repairing a cracked tile.
Technique for rapid establishment of American lotus in remediation efforts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ryon, M. G.; Jett, R. T.; McCracken, M. K.
A technique for increasing the establishment rate of American lotus (Nelumbo lutea) and simplifying planting was developed as part of a pond remediation project. Lotus propagation techniques typically require scarification of the seed, germination in heated water, and planting in nursery containers. Then mature (~ 1 yr) nursery-grown stock is transferred to planting site or scarified seed are broadcast applied. Mature plants should grow more quickly, but can be sensitive to handling, require more time to plant, and cost more. Scarified seeds are easier to plant and inexpensive, but have a lag time in growth, can fail to germinate, andmore » can be difficult to site precisely. We developed an intermediate technique using small burlap bags that makes planting easier, provides greater germination success, and avoids lag time in growth. Data on survival and growth from experiments using mature stock, scarified seeds, and bag lotus demonstrate that bag lotus grow rapidly in a variety of conditions, have a high survival rate, can be processed and planted easily and quickly, and are very suitable for a variety of remediation projects« less
Code of Federal Regulations, 2010 CFR
2010-07-01
... transfer of USIA audiovisual records to the National Archives of the United States? 1256.96 Section 1256.96... Information Agency Audiovisual Materials in the National Archives of the United States § 1256.96 What provisions apply to the transfer of USIA audiovisual records to the National Archives of the United States...
ERIC Educational Resources Information Center
Thomas, John Phillip
2012-01-01
In this study academic outcomes for Associate of Applied Science and Associate of Applied Arts degree students who transferred to a large public midwestern research university were examined. A group with transcripted technical credits of 16 hours at transfer were compared and contrasted with a peer group of college-parallel associate's degree…
Koch, Christian
2010-05-01
A technique for the calibration of photodiodes in ultrasonic measurement systems using standard and cost-effective optical and electronic components is presented. A heterodyne system was realized using two commercially available distributed feedback lasers, and the required frequency stability and resolution were ensured by a difference-frequency servo control scheme. The frequency-sensitive element generating the error signal for the servo loop comprised a delay-line discriminator constructed from electronic elements. Measurements were carried out at up to 450 MHz, and the uncertainties of about 5% (k = 2) can be further reduced by improved radio frequency power measurement without losing the feature of using only simple elements. The technique initially dedicated to the determination of the frequency response of photodetectors applied in ultrasonic applications can be transferred to other application fields of optical measurements.
Development of a HIV-1 Virus Detection System Based on Nanotechnology.
Lee, Jin-Ho; Oh, Byung-Keun; Choi, Jeong-Woo
2015-04-27
Development of a sensitive and selective detection system for pathogenic viral agents is essential for medical healthcare from diagnostics to therapeutics. However, conventional detection systems are time consuming, resource-intensive and tedious to perform. Hence, the demand for sensitive and selective detection system for virus are highly increasing. To attain this aim, different aspects and techniques have been applied to develop virus sensor with improved sensitivity and selectivity. Here, among those aspects and techniques, this article reviews HIV virus particle detection systems incorporated with nanotechnology to enhance the sensitivity. This review mainly focused on four different detection system including vertically configured electrical detection based on scanning tunneling microscopy (STM), electrochemical detection based on direct electron transfer in virus, optical detection system based on localized surface plasmon resonance (LSPR) and surface enhanced Raman spectroscopy (SERS) using plasmonic nanoparticle.
Effects of ultrasonic energy on dyeing of polyamide (microfibre)/Lycra blends.
Merdan, Nigar; Akalin, Mehmet; Kocak, Dilara; Usta, Ismail
2004-04-01
Although ultrasonic energy is widely used cleaning and degreasing of parts and assemblies in automotive and other industries, the use of ultrasonic energy in an industrial scale for textile washing is very new. This is due to the complexity of controlling the combination of chemical and mechanical effects, whereas with degreasing of machine parts only the mechanical effects is applied. The use of ultrasonic energy in dyeing PA/Lycra fabrics with reactive dyes has been studied spectrophotometrically in this work. PA/Lycra (85/15) blends have been dyed using conventional and ultrasonic dyeing techniques with three reactive dyes containing different chromophore and reactive groups. The dyeing carried out conventionally and by the use of ultrasonic techniques. The results were compared in terms of percentage exhaustion; total dye transferred to the washing bath after dyeing and the fastness properties.
Templeton, Allen C; Placek, Jiri; Xu, Hui; Mahajan, Rajiv; Hunke, William A; Reed, Robert A
2003-01-01
The purpose of the present study is to apply and contrast several analytical techniques to understand the change in moisture content of 20 mm diameter bromobutyl rubber stoppers as a function of typical stopper processing conditions. Three separate methods were examined and Karl-Fischer titration and techniques based on capacitance measurements at a thin-film sensor were found to provide comparable results. Stopper moisture levels were examined in stoppers: (i) as received from the manufacturer, (ii) following steam sterilization, (iii) as a function of various drying cycles, and (iv) during simulated hold conditions prior to use. Finally, the transfer of moisture from stopper to an actual product is examined on storage and general agreement observed between stopper drying conditions and cake moisture levels.
Design for active and passive flutter suppression and gust alleviation. Ph.D. Thesis
NASA Technical Reports Server (NTRS)
Karpel, M.
1981-01-01
Analytical design techniques for active and passive control of aeroelastic systems are based on a rational approximation of the unsteady aerodynamic loads in the entire Laplace domain, which yields matrix equations of motion with constant coefficients. Some existing schemes are reviewed, the matrix Pade approximant is modified, and a technique which yields a minimal number of augmented states for a desired accuracy is presented. The state-space aeroelastic model is used to design an active control system for simultaneous flutter suppression and gust alleviation. The design target is for a continuous controller which transfers some measurements taken on the vehicle to a control command applied to a control surface. Structural modifications are formulated in a way which enables the treatment of passive flutter suppression system with the same procedures by which active control systems are designed.
NASA Astrophysics Data System (ADS)
Alyassin, Abdal M.
2002-05-01
3D Digital mammography (3DDM) is a new technology that provides high resolution X-ray breast tomographic data. Like any other tomographic medical imaging modalities, viewing a stack of tomographic images may require time especially if the images are of large matrix size. In addition, it may cause difficulty to conceptually construct 3D breast structures. Therefore, there is a need to readily visualize the data in 3D. However, one of the issues that hinder the usage of volume rendering (VR) is finding an automatic way to generate transfer functions that efficiently map the important diagnostic information in the data. We have developed a method that randomly samples the volume. Based on the mean and the standard deviation of these samples, the technique determines the lower limit and upper limit of a piecewise linear ramp transfer function. We have volume rendered several 3DDM data using this technique and compared visually the outcome with the result from a conventional automatic technique. The transfer function generated through the proposed technique provided superior VR images over the conventional technique. Furthermore, the improvement in the reproducibility of the transfer function correlated with the number of samples taken from the volume at the expense of the processing time.
Ojeda, Jesús J; Romero-González, María E; Banwart, Steven A
2009-08-01
Reflectance micro-Fourier transform infrared (FT-IR) analysis has been applied to characterize biofilm formation of Aquabacterium commune, a common microorganism present on drinking water distribution systems, onto the increasingly popular pipe material stainless steel EN1.4307. The applicability of the reflectance micro-FT-IR technique for analyzing the bacterial functional groups is discussed, and the results are compared to spectra obtained using more conventional FT-IR techniques: transmission micro-FT-IR, attenuated transmitted reflectance (ATR), and KBr pellets. The differences between the infrared spectra of wet and dried bacteria, as well as free versus attached bacteria, are also discussed. The spectra obtained using reflectance micro-FT-IR spectroscopy were comparable to those obtained using other FT-IR techniques. The absence of sample preparation, the potential to analyze intact samples, and the ability to characterize opaque and thick samples without the need to transfer the bacterial samples to an infrared transparent medium or produce a pure culture were the main advantages of reflectance micro-FT-IR spectroscopy.
Numerical Modeling of Inclusion Behavior in Liquid Metal Processing
NASA Astrophysics Data System (ADS)
Bellot, Jean-Pierre; Descotes, Vincent; Jardy, Alain
2013-09-01
Thermomechanical performance of metallic alloys is directly related to the metal cleanliness that has always been a challenge for metallurgists. During liquid metal processing, particles can grow or decrease in size either by mass transfer with the liquid phase or by agglomeration/fragmentation mechanisms. As a function of numerical density of inclusions and of the hydrodynamics of the reactor, different numerical modeling approaches are proposed; in the case of an isolated particle, the Lagrangian technique coupled with a dissolution model is applied, whereas in the opposite case of large inclusion phase concentration, the population balance equation must be solved. Three examples of numerical modeling studies achieved at Institut Jean Lamour are discussed. They illustrate the application of the Lagrangian technique (for isolated exogenous inclusion in titanium bath) and the Eulerian technique without or with the aggregation process: for precipitation and growing of inclusions at the solidification front of a Maraging steel, and for endogenous inclusions in the molten steel bath of a gas-stirred ladle, respectively.
Wang, Ya-Qi; Wu, Zhen-Feng; Ke, Gang; Yang, Ming
2014-12-31
An effective vacuum assisted extraction (VAE) technique was proposed for the first time and applied to extract bioactive components from Andrographis paniculata. The process was carefully optimized by response surface methodology (RSM). Under the optimized experimental conditions, the best results were obtained using a boiling temperature of 65 °C, 50% ethanol concentration, 16 min of extraction time, one extraction cycles and a 12:1 liquid-solid ratio. Compared with conventional ultrasonic assisted extraction and heat reflux extraction, the VAE technique gave shorter extraction times and remarkable higher extraction efficiency, which indicated that a certain degree of vacuum gave the solvent a better penetration of the solvent into the pores and between the matrix particles, and enhanced the process of mass transfer. The present results demonstrated that VAE is an efficient, simple and fast method for extracting bioactive components from A. paniculata, which shows great potential for becoming an alternative technique for industrial scale-up applications.
Khadria, Ambalika S; Senes, Alessandro
2015-07-01
Förster resonance energy transfer (FRET) has been widely used as a spectroscopic tool in vitro to study the interactions between transmembrane (TM) helices in detergent and lipid environments. This technique has been instrumental to many studies that have greatly contributed to quantitative understanding of the physical principles that govern helix-helix interactions in the membrane. These studies have also improved our understanding of the biological role of oligomerization in membrane proteins. In this review, we focus on the combinations of fluorophores used, the membrane mimetic environments, and measurement techniques that have been applied to study model systems as well as biological oligomeric complexes in vitro. We highlight the different formalisms used to calculate FRET efficiency and the challenges associated with accurate quantification. The goal is to provide the reader with a comparative summary of the relevant literature for planning and designing FRET experiments aimed at measuring TM helix-helix associations. © 2015 Wiley Periodicals, Inc.
µ-XRF Studies on the Colour Brilliance in Ancient Wool Carpets
Meyer, Markus; Borca, Camelia N.; Huthwelker, Thomas; Bieber, Manfred; Meßlinger, Karl; Fink, Rainer H.
2017-01-01
Many handmade ancient and recent oriental wool carpets show outstanding brilliance and persistence of colour that is not achieved by common industrial dyeing procedures. Anthropologists have suggested the influence of wool fermentation prior to dyeing as key technique to achieve the high dyeing quality. By means of μ-XRF elemental mapping of mordant metals we corroborate this view and show a deep and homogenous penetration of colourants into fermented wool fibres. Furthermore we are able to apply this technique and prove that the fermentation process for ancient specimens cannot be investigated by standard methods due to the lack of intact cuticle layers. This finding suggests a broad range of further investigations that will contribute to a deeper understanding of the development of traditional dyeing techniques. Spectroscopic studies add information on the oxidation states of the metal ions within the respective mordant-dye-complexes and suggest a partial charge transfer as basis for a significant colour change when Fe mordants are used. PMID:29109824
Corrosion anisotropy of titanium deformed by the hydrostatic extrusion
NASA Astrophysics Data System (ADS)
Chojnacka, A.; Kawalko, J.; Koscielny, H.; Guspiel, J.; Drewienkiewicz, A.; Bieda, M.; Pachla, W.; Kulczyk, M.; Sztwiertnia, K.; Beltowska-Lehman, E.
2017-12-01
The corrosion behaviour of titanium rods deformed by hydrostatic extrusion (HE) in artificial saliva (Carter-Brugirard's solution of pH 7.6) was investigated using open-circuit potentials (OCPs), (DC) potentiodynamic polarisation curves and (AC) electrochemical impedance spectroscopy (EIS) techniques. Various electrochemical parameters (corrosion potential Ecorr, corrosion current (icorr), polarisation resistance Rp, charge transfer resistance Rct and oxide film resistance Rf) were analysed. Significant coherence was observed between results achieved from these procedures, i.e., all applied techniques showed the same trend for corrosion resistance. The obtained electrochemical data were then related to the microstructure parameters (crystallographic texture, grain size, grain boundary distribution and density) determined using the EBSD/SEM technique. It was found that the corrosion behaviour of titanium processed by the HE method was superior compared to the unprocessed Ti, and this was clearly dependent on the extrusion direction. The highest corrosion resistance was revealed for the HE-deformed Ti rod of the surface oriented longitudinal (parallel) to the extrusion direction.
Ladner, Tobias; Held, Markus; Flitsch, David; Beckers, Mario; Büchs, Jochen
2016-12-03
Microtiter plates (MTP) are often applied as culture vessels in high-throughput screening programs. If online measuring techniques are available, MTPs can also be applied in the first steps of process development. For such small-scale bioreactors dipping probes are usually too large; therefore, optical measurements are often used. For example, the BioLector technology allows for the online monitoring of scattered light and fluorescence in each well of a continuously orbitally shaken MTP. Although this system provides valuable data, these measurements are mainly of a semi-quantitative nature. Therefore, signal calibration is required to obtain absolute values. With the µRAMOS technology it became possible for the first time to quantify the oxygen transfer rate (OTR) separately in each well of an MTP. In this work, a device is presented that combines both techniques, to provide a hitherto unparalleled high amount of information from each single well. Because both systems (BioLector and µRAMOS) are based on optical measurements, the measurements need to be synchronized to avoid interferences with the optical signals. The new experimental setup was applied for online monitoring in cultures of Escherichia coli and Hansenula polymorpha. It has been demonstrated that the well-to-well reproducibility is very high, and that the monitored signals provide reliable and valuable information about the process. With varying filling volumes, different maximum oxygen transfer capacities (OTR max ) were adjusted in oxygen-limited cultures. The different degrees of stress during the culture due to oxygen limitation affected microbial growth and also impacted reproducibility from culture to culture. Furthermore, it was demonstrated that this new device significantly simplifies the experimental efforts: instead of parallel cultures in a shake flask and MTP, just one single experiment in MTP needs to be conducted to measure the OTR, dissolved oxygen tension (DOT), scattered light and fluorescence. The new device is a very suitable system for the online monitoring of cultures in continuously orbitally shaken MTPs. Due to the high number of parameters that can simultaneously be measured with this small-scale device, deeper insight into the investigated microbial system can be achieved. Furthermore, the experimental efforts to obtain OTR, DOT, scattered light and fluorescence signals during a culture are decreased. Ultimately, this new technology and the resulting high amount of collected data will eliminate the currently existing separation between screening and process development. Graphical abstract Picture of the combined μRAMOS and BioLector setup which allows for measurements of the oxygen transfer rate (OTR), dissolved oxygen tension (DOT), scattered light and fluorescence in each single well of an orbitally shaken microtiter plate.
A review of acoustic power transfer for bio-medical implants
NASA Astrophysics Data System (ADS)
Basaeri, Hamid; Christensen, David B.; Roundy, Shad
2016-12-01
Bio-implantable devices have been used to perform therapeutic functions such as drug delivery or diagnostic monitoring of physiological parameters. Proper operation of these devices depends on the continuous reliable supply of power. A battery, which is the conventional method to supply energy, is problematic in many of these devices as it limits the lifetime of the implant or dominates the size. In order to power implantable devices, power transfer techniques have been implemented as an attractive alternative to batteries and have received significant research interest in recent years. Acoustic waves are increasingly being investigated as a method for delivering power through human skin and the human body. Acoustic power transfer (APT) has some advantages over other powering techniques such as inductive power transfer and mid range RF power transmission. These advantages include lower absorption in tissue, shorter wavelength enabling smaller transducers, and higher power intensity threshold for safe operation. This paper will cover the basic physics and modeling of APT and will review the current state of acoustic (or ultrasonic) power transfer for biomedical implants. As the sensing and computational elements for biomedical implants are becoming very small, we devote particular attention to the scaling of acoustic and alternative power transfer techniques. Finally, we present current issues and challenges related to the implementation of this technique for powering implantable devices.
Ice-assisted transfer of carbon nanotube arrays.
Wei, Haoming; Wei, Yang; Lin, Xiaoyang; Liu, Peng; Fan, Shoushan; Jiang, Kaili
2015-03-11
Decoupling the growth and the application of nanomaterials by transfer is an important issue in nanotechnology. Here, we developed an efficient transfer technique for carbon nanotube (CNT) arrays by using ice as a binder to temporarily bond the CNT array and the target substrate. Ice makes it an ultraclean transfer because the evaporation of ice ensures that no contaminants are introduced. The transferred superaligned carbon nanotube (SACNT) arrays not only keep their original appearance and initial alignment but also inherit their spinnability, which is the most desirable feature. The transfer-then-spin strategy can be employed to fabricate patterned CNT arrays, which can act as 3-dimensional electrodes in CNT thermoacoustic chips. Besides, the flip-chipped CNTs are promising field electron emitters. Furthermore, the ice-assisted transfer technique provides a cost-effective solution for mass production of SACNTs, giving CNT technologies a competitive edge, and this method may inspire new ways to transfer other nanomaterials.
Robust spin-current injection in lateral spin valves with two-terminal Co2FeSi spin injectors
NASA Astrophysics Data System (ADS)
Oki, S.; Kurokawa, T.; Honda, S.; Yamada, S.; Kanashima, T.; Itoh, H.; Hamaya, K.
2017-05-01
We demonstrate generation and detection of pure spin currents by combining a two-terminal spin-injection technique and Co2FeSi (CFS) spin injectors in lateral spin valves (LSVs). We find that the two-terminal spin injection with CFS has the robust dependence of the nonlocal spin signals on the applied bias currents, markedly superior to the four-terminal spin injection with permalloy reported previously. In our LSVs, since the spin transfer torque from one CFS injector to another CFS one is large, the nonlocal magnetoresistance with respect to applied magnetic fields shows large asymmetry in high bias-current conditions. For utilizing multi-terminal spin injection with CFS as a method for magnetization reversals, the terminal arrangement of CFS spin injectors should be taken into account.
Spinoff from a Mooncraft Technology
NASA Technical Reports Server (NTRS)
1988-01-01
Avco Specialty Materials' Chartek III fireproofing provides longterm fire protection for structural steel in high risk industrial applications such as structural conduits, pipes and valves of offshore platforms, and storage tanks used in hydrocarbon processing industry. In the presence of fire, Chartek III fire-proofing provides two kinds of protection. One of them is ablation, technique used on Apollo involving dissipation of heat by burnoff. The other is called intumescence or swelling. Heat causes the Chartek coating to swell to a thickness six times greater than when it was applied forming a protective blanket of char that retards transfer of heat to the steel structure. Mesh reinforcement keeps the char intact and reduces metal fatigue. Chartek provides fire protection for as much as two or three hours depending on the type of fire and the thickness of the coating applied.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Brouckaert, D; Uyttersprot, J-S; Broeckx, W; De Beer, T
2018-03-01
Calibration transfer or standardisation aims at creating a uniform spectral response on different spectroscopic instruments or under varying conditions, without requiring a full recalibration for each situation. In the current study, this strategy is applied to construct at-line multivariate calibration models and consequently employ them in-line in a continuous industrial production line, using the same spectrometer. Firstly, quantitative multivariate models are constructed at-line at laboratory scale for predicting the concentration of two main ingredients in hard surface cleaners. By regressing the Raman spectra of a set of small-scale calibration samples against their reference concentration values, partial least squares (PLS) models are developed to quantify the surfactant levels in the liquid detergent compositions under investigation. After evaluating the models performance with a set of independent validation samples, a univariate slope/bias correction is applied in view of transporting these at-line calibration models to an in-line manufacturing set-up. This standardisation technique allows a fast and easy transfer of the PLS regression models, by simply correcting the model predictions on the in-line set-up, without adjusting anything to the original multivariate calibration models. An extensive statistical analysis is performed in order to assess the predictive quality of the transferred regression models. Before and after transfer, the R 2 and RMSEP of both models is compared for evaluating if their magnitude is similar. T-tests are then performed to investigate whether the slope and intercept of the transferred regression line are not statistically different from 1 and 0, respectively. Furthermore, it is inspected whether no significant bias can be noted. F-tests are executed as well, for assessing the linearity of the transfer regression line and for investigating the statistical coincidence of the transfer and validation regression line. Finally, a paired t-test is performed to compare the original at-line model to the slope/bias corrected in-line model, using interval hypotheses. It is shown that the calibration models of Surfactant 1 and Surfactant 2 yield satisfactory in-line predictions after slope/bias correction. While Surfactant 1 passes seven out of eight statistical tests, the recommended validation parameters are 100% successful for Surfactant 2. It is hence concluded that the proposed strategy for transferring at-line calibration models to an in-line industrial environment via a univariate slope/bias correction of the predicted values offers a successful standardisation approach. Copyright © 2017 Elsevier B.V. All rights reserved.
Improved piston ring materials for 650 deg C service
NASA Technical Reports Server (NTRS)
Bjorndahl, W. D.
1986-01-01
A program to develop piston ring material systems which will operate at 650C was performed. In this program, two candidate high temperature piston ring substrate materials, Carpenter 709-2 and 440B, were hot formed into the piston ring shape and subsequently evaluated. In a parallel development effort ceramic and metallic piston ring coating materials were applied to cast iron rings by various processing techniques and then subjected to thermal shock and wear evaluation. Finally, promising candidate coatings were applied to the most thermally stable hot formed substrate. The results of evaluation tests of the hot formed substrate show that Carpenter 709-2 has greater thermal stability than 440B. Of the candidate coatings, plasma transferred arc (PTA) applied tungsten carbide and molybdenum based systems exhibit the greatest resistance to thermal shock. For the ceramic based systems, thermal shock resistance was improved by bond coat grading. Wear testing was conducted to 650C (1202F). For ceramic systems, the alumina/titania/zirconia/yttria composition showed highest wear resistance. For the PTA applied systems, the tungsten carbide based system showed highest wear resistance.
Exploring hurdles to transfer : student experiences of applying knowledge across disciplines
NASA Astrophysics Data System (ADS)
Lappalainen, Jouni; Rosqvist, Juho
2015-04-01
This paper explores the ways students perceive the transfer of learned knowledge to new situations - often a surprisingly difficult prospect. The novel aspect compared to the traditional transfer studies is that the learning phase is not a part of the experiment itself. The intention was only to activate acquired knowledge relevant to the transfer target using a short primer immediately prior to the situation where the knowledge was to be applied. Eight volunteer students from either mathematics or computer science curricula were given a task of designing an adder circuit using logic gates: a new context in which to apply knowledge of binary arithmetic and Boolean algebra. The results of a phenomenographic classification of the views presented by the students in their post-experiment interviews are reported. The degree to which the students were conscious of the acquired knowledge they employed and how they applied it in a new context emerged as the differentiating factors.
NASA Technical Reports Server (NTRS)
Matthews, R. K.; Martindale, W. R.; Warmbrod, J. D.
1972-01-01
The results of a wind tunnel test program to determine aerodynamic heat transfer distributions on the McDonnell Douglas Booster configuration are presented. Heat-transfer rates were determined by the phase-change paint technique on 0.009-scale Stycast models using Tempilaq as the surface temperature indicator. The nominal test conditions were; Mach 8, length Reynolds numbers 5 million and 7.3 million, and angles of attack of 40, 50, and 60 deg. At the higher Reynolds number, data were obtained with and without boundary layer trips. Model details, test conditions, and reduced heat-transfer data are presented. Data reduction of the phase-change paint photographs was performed by utilizing a new technique which is described.
Non-Contact Thrust Stand Calibration Method for Repetitively-Pulsed Electric Thrusters
NASA Technical Reports Server (NTRS)
Wong, Andrea R.; Toftul, Alexandra; Polzin, Kurt A.; Pearson, J. Boise
2011-01-01
A thrust stand calibration technique for use in testing repetitively-pulsed electric thrusters for in-space propulsion has been developed and tested using a modified hanging pendulum thrust stand. In the implementation of this technique, current pulses are applied to a solenoidal coil to produce a pulsed magnetic field that acts against the magnetic field produced by a permanent magnet mounted to the thrust stand pendulum arm. The force on the magnet is applied in this non-contact manner, with the entire pulsed force transferred to the pendulum arm through a piezoelectric force transducer to provide a time-accurate force measurement. Modeling of the pendulum arm dynamics reveals that after an initial transient in thrust stand motion the quasisteady average deflection of the thrust stand arm away from the unforced or zero position can be related to the average applied force through a simple linear Hooke s law relationship. Modeling demonstrates that this technique is universally applicable except when the pulsing period is increased to the point where it approaches the period of natural thrust stand motion. Calibration data were obtained using a modified hanging pendulum thrust stand previously used for steady-state thrust measurements. Data were obtained for varying impulse bit at constant pulse frequency and for varying pulse frequency. The two data sets exhibit excellent quantitative agreement with each other as the constant relating average deflection and average thrust match within the errors on the linear regression curve fit of the data. Quantitatively, the error on the calibration coefficient is roughly 1% of the coefficient value.
NASA Astrophysics Data System (ADS)
Protsenko, Dimitry E.; Lim, Amanda; Wu, Edward C.; Manuel, Cyrus; Wong, Brian J. F.
2011-03-01
Electromechanical reshaping (EMR) of cartilage has been suggested as an alternative to the classical surgical techniques of modifying the shape of facial cartilages. The method is based on exposure of mechanically deformed cartilaginous tissue to a low level electric field. Electro-chemical reactions within the tissue lead to reduction of internal stress, and establishment of a new equilibrium shape. The same reactions offset the electric charge balance between collagen and proteoglycan matrix and interstitial fluid responsible for maintenance of cartilage mechanical properties. The objective of this study was to investigate correlation between the electric charge transferred during EMR and equilibrium elastic modulus. We used a finite element model based on the triphasic theory of cartilage mechanical properties to study how electric charges transferred in the electro-chemical reactions in cartilage can change its mechanical responses to step displacements in unconfined compression. The concentrations of the ions, the strain field and the fluid and ion velocities within the specimen subject to an applied mechanical deformation were estimated and apparent elastic modulus (the ratio of the equilibrium axial stress to the axial strain) was calculated as a function of transferred charge. The results from numerical calculations showed that the apparent elastic modulus decreases with increase in electric charge transfer. To compare numerical model with experimental observation we measured elastic modulus of cartilage as a function of electric charge transferred in electric circuit during EMR. Good correlation between experimental and theoretical data suggests that electric charge disbalance is responsible for alteration of cartilage mechanical properties.
Design and Construction of a Thermal Contact Resistance and Thermal Conductivity Measurement System
2015-09-01
plate interface resistance control. Numerical heat transfer and uncertainty analyses with applied engineering judgement were extensively used to come... heat transfer issues facing the Department of Defense. 14. SUBJECT TERMS Thermal contact resistance, thermal conductivity, measurement system 15... heat transfer and uncertainty analyses with applied engineering judgement were extensively used to come up with an optimized design and construction
Bai, Yan; Lin, Yusong; Zhang, Wei; Kong, Lingfei; Wang, Lifu; Zuo, Panli; Vallines, Ignacio; Schmitt, Benjamin; Tian, Jie; Song, Xiaolei; Zhou, Jinyuan; Wang, Meiyun
2017-01-24
Using noninvasive magnetic resonance imaging techniques to accurately evaluate the grading and cellularity of gliomas is beneficial for improving the patient outcomes. Amide proton transfer imaging is a noninvasive molecular magnetic resonance imaging technique based on chemical exchange saturation transfer mechanism that detects endogenous mobile proteins and peptides in biological tissues. Between August 2012 and November 2015, a total number of 44 patients with pathologically proven gliomas were included in this study. We compared the capability of amide proton transfer magnetic resonance imaging with that of noninvasive diffusion-weighted imaging and noninvasive 3-dimensional pseudo-continuous arterial spin imaging in evaluating the grading and cellularity of gliomas. Our results reveal that amide proton transfer magnetic resonance imaging is a superior imaging technique to diffusion-weighted imaging and 3-dimensional pseudo-continuous arterial spin imaging in the grading of gliomas. In addition, our results showed that the Ki-67 index correlated better with the amide proton transfer-weighted signal intensity than with the apparent diffusion coefficient value or the cerebral blood flow value in the gliomas. Amide proton transfer magnetic resonance imaging is a promising method for predicting the grading and cellularity of gliomas.
Li, Han; Zheng, Xin; Liu, Yu; Zhang, Zhepeng; Jiang, Tian
2018-01-25
The idea of fabricating artificial solids with band structures tailored to particular applications has long fascinated condensed matter physicists. Heterostructure (HS) construction is viewed as an effective and appealing approach to engineer novel electronic properties in two dimensional (2D) materials. Different from common 2D/2D heterojunctions where energy transfer is rarely observed, CsPbBr 3 quantum dots (0D-QDs) interfaced with 2D materials have become attractive HSs for exploring the physics of charge transfer and energy transfer, due to their superior optical properties. In this paper, a new 0D/2D HS is proposed and experimentally studied, making it possible to investigate both light utilization and energy transfer. Specifically, this HS is constructed between monolayer WS 2 and CsPbBr 3 QDs, and exhibits a hybrid band alignment. The dynamics of energy transfer within the investigated 0D/2D HS is characterized by femtosecond transient absorption spectrum (TAS) measurements. The TAS results reveal that ultrafast energy transfer caused by optical excitation is observed from CsPbBr 3 QDs to the WS 2 layer, which can increase the exciton fluence within the WS 2 layer up to 69% when compared with pristine ML WS 2 under the same excitation fluence. Moreover, the formation and dynamics of interlayer excitons have also been investigated and confirmed in the HS, with a calculated recombination time of 36.6 ps. Finally, the overall phenomenological dynamical scenario for the 0D/2D HS is established within the 100 ps time region after excitation. The techniques introduced in this work can also be applied to versatile optoelectronic devices based on low dimensional materials.
Atta, Khan Rashid; Gavril, Dimitrios; Loukopoulos, Vassilios; Karaiskakis, George
2004-01-16
The experimental technique of the reversed-flow version of inverse gas chromatography was applied for the study of effects of surfactants in reducing air-water exchange rates. The vinyl chloride (VC)-water system was used as a model, which is of great importance in environmental chemistry. Using suitable mathematical analysis, various physicochemical quantities were calculated, among which the most significant are: Partition coefficients of the VC gas between the surfactant interface and the carrier gas nitrogen, as well as between the bulk of the water + surfactant solution and the carrier gas nitrogen, overall mass transfer coefficients of VC in the liquid (water + surfactant) and the gas (nitrogen) phases, water and surfactant film transfer coefficients, nitrogen, water and surfactant phase resistances for the transfer of VC into the water solution, relative resistance of surfactant in the transfer of VC into the bulk of solution, exchange velocity of VC between nitrogen and the liquid solution, and finally the thickness of the surfactant stagnant film in the liquid phase, according to the three phase resistance model. From the variation of the above parameters with the surfactant's concentration, important conclusions concerning the effects of surfactants on the transfer of a gas at the air-liquid interface, as well as to the bulk of the liquid were extracted. An interesting finding of this work was also that by successive addition of surfactant, the critical micelle concentration of surfactant was obtained, after which follows a steady-state for the transfer of the gas into the water body, which could be attributed to the transition from mono- to multi-layer state.
Simulating GPS radio signal to synchronize network--a new technique for redundant timing.
Shan, Qingxiao; Jun, Yang; Le Floch, Jean-Michel; Fan, Yaohui; Ivanov, Eugene N; Tobar, Michael E
2014-07-01
Currently, many distributed systems such as 3G mobile communications and power systems are time synchronized with a Global Positioning System (GPS) signal. If there is a GPS failure, it is difficult to realize redundant timing, and thus time-synchronized devices may fail. In this work, we develop time transfer by simulating GPS signals, which promises no extra modification to original GPS-synchronized devices. This is achieved by applying a simplified GPS simulator for synchronization purposes only. Navigation data are calculated based on a pre-assigned time at a fixed position. Pseudo-range data which describes the distance change between the space vehicle (SV) and users are calculated. Because real-time simulation requires heavy-duty computations, we use self-developed software optimized on a PC to generate data, and save the data onto memory disks while the simulator is operating. The radio signal generation is similar to the SV at an initial position, and the frequency synthesis of the simulator is locked to a pre-assigned time. A filtering group technique is used to simulate the signal transmission delay corresponding to the SV displacement. Each SV generates a digital baseband signal, where a unique identifying code is added to the signal and up-converted to generate the output radio signal at the centered frequency of 1575.42 MHz (L1 band). A prototype with a field-programmable gate array (FPGA) has been built and experiments have been conducted to prove that we can realize time transfer. The prototype has been applied to the CDMA network for a three-month long experiment. Its precision has been verified and can meet the requirements of most telecommunication systems.
NASA Astrophysics Data System (ADS)
Mashayekhi, Mohammad Jalali; Behdinan, Kamran
2017-10-01
The increasing demand to minimize undesired vibration and noise levels in several high-tech industries has generated a renewed interest in vibration transfer path analysis. Analyzing vibration transfer paths within a system is of crucial importance in designing an effective vibration isolation strategy. Most of the existing vibration transfer path analysis techniques are empirical which are suitable for diagnosis and troubleshooting purpose. The lack of an analytical transfer path analysis to be used in the design stage is the main motivation behind this research. In this paper an analytical transfer path analysis based on the four-pole theory is proposed for multi-energy-domain systems. Bond graph modeling technique which is an effective approach to model multi-energy-domain systems is used to develop the system model. In this paper an electro-mechanical system is used as a benchmark example to elucidate the effectiveness of the proposed technique. An algorithm to obtain the equivalent four-pole representation of a dynamical systems based on the corresponding bond graph model is also presented in this paper.
Promoting Transfer of Learning: Connecting General Education Courses
ERIC Educational Resources Information Center
Benander, Ruth; Lightner, Robin
2005-01-01
General education programs rely on students transferring learning from one context to another. This transfer cannot be taken for granted. Faculty must see individual courses as elements of a larger experience and focus on specific techniques promoting transfer. Classroom experiences serve to illustrate the elements of transfer that require…
Implant Impression Techniques for the Edentulous Jaw: A Summary of Three Studies.
Stimmelmayr, Michael; Beuer, Florian; Edelhoff, Daniel; Güth, Jan-Frederik
2016-02-01
Precise implant-supported restorations require accurate impressions. Transfer, pick-up, and splinted pick-up are commonly used techniques. Several in vitro studies have compared these impression techniques; however, all studies used mechanical evaluation methods. The purpose of this study was to compare the discrepancies of these impression techniques digitally in vitro and in vivo. Four dental implants were inserted in ten polymer mandibular models bilaterally in the regions of the first molars and canines. Three different impressions were made of each model and the models (original and stone casts) were scanned and digitized. Clinically, four implants were inserted in ten edentulous jaws; transfer and splinted pick-up impressions were made. With inspection software, discrepancies between the different impressions were calculated. The mean discrepancies in the in vitro study of the original polymer model to stone casts were 124 ± 34 μm for the transfer type, 116 ± 46 μm for the pick-up type, and 80 ± 25 μm for the splinted pick-up type, resulting in a mean discrepancy between the transfer and splinted pick-up type of 44 μm (124 - 80 μm). Clinically, the mean discrepancy between these two impression techniques was 280 μm. The differing results between the transfer and splinted pick-up techniques of in vitro and in vivo data showed the need for clinical data; however, splinted pick-up impressions seemed to produce the most precise results. © 2015 by the American College of Prosthodontists.
Graphic design of pinhole cameras
NASA Technical Reports Server (NTRS)
Edwards, H. B.; Chu, W. P.
1979-01-01
The paper describes a graphic technique for the analysis and optimization of pinhole size and focal length. The technique is based on the use of the transfer function of optical elements described by Scott (1959) to construct the transfer function of a circular pinhole camera. This transfer function is the response of a component or system to a pattern of lines having a sinusoidally varying radiance at varying spatial frequencies. Some specific examples of graphic design are presented.
Transfer of micro and nano-photonic silicon nanomembrane waveguide devices on flexible substrates.
Ghaffari, Afshin; Hosseini, Amir; Xu, Xiaochuan; Kwong, David; Subbaraman, Harish; Chen, Ray T
2010-09-13
This paper demonstrates transfer of optical devices without extra un-patterned silicon onto low-cost, flexible plastic substrates using single-crystal silicon nanomembranes. Employing this transfer technique, stacking two layers of silicon nanomembranes with photonic crystal waveguide in the first layer and multi mode interference couplers in the second layer is shown, respectively. This technique is promising to realize high density integration of multilayer hybrid structures on flexible substrates.
Space Instrument Optimization by Implementing of Generic Three Bodies Circular Restricted Problem
NASA Astrophysics Data System (ADS)
Nejat, Cyrus
2011-01-01
In this study, the main discussion emphasizes on the spacecraft operation with a concentration on stationary points in space. To achieve these objectives, the circular restricted problem was solved for selected approaches. The equations of motion of three body restricted problem was demonstrated to apply in cases other than Lagrange's (1736-1813 A.D.) achievements, by means of the purposed CN (Cyrus Nejat) theorem along with appropriate comments. In addition to five Lagrange, two other points, CN1 and CN2 were found to be in unstable equilibrium points in a very large distance respect to Lagrange points, but stable at infinity. A very interesting simulation of Milky Way Galaxy and Andromeda Galaxy were created to find the Lagrange points, CN points (Cyrus Nejat Points), and CN lines (Cyrus Nejat Lines). The equations of motion were rearranged such a way that the transfer trajectory would be conical, by means of decoupling concept. The main objective was to make a halo orbit transfer about CN lines. The author purposes therefore that all of the corresponding sizing design that they must be developed by optimization techniques would be considered in future approaches. The optimization techniques are sufficient procedures to search for the most ideal response of a system.
Honda, Michitaka
2014-04-01
Several improvements were implemented in the edge method of presampled modulation transfer function measurements (MTFs). The estimation technique for edge angle was newly developed by applying an algorithm for principal components analysis. The error in the estimation was statistically confirmed to be less than 0.01 even in the presence of quantum noise. Secondly, the geometrical edge slope was approximated using a rationalized number, making it possible to obtain an oversampled edge response function (ESF) with equal intervals. Thirdly, the final MTFs were estimated using the average of multiple MTFs calculated for local areas. This averaging operation eliminates the errors caused by the rationalized approximation. Computer-simulated images were used to evaluate the accuracy of our method. The relative error between the estimated MTF and the theoretical MTF at the Nyquist frequency was less than 0.5% when the MTF was expressed as a sinc function. For MTFs representing an indirect detector and phase-contrast detector, good agreement was also observed for the estimated MTFs for each. The high accuracy of the MTF estimation was also confirmed, even for edge angles of around 10 degrees, which suggests the potential for simplification of the measurement conditions. The proposed method could be incorporated into an automated measurement technique using a software application.
Mihelcic, James R; Zimmerman, Julie B; Ramaswami, Anu
2007-05-15
Sustainable development in both the developed and developing world has the common fundamental themes of advancing economic and social prosperity while protecting and restoring natural systems. While many recent efforts have been undertaken to transfer knowledge from the developed to the developing world to achieve a more sustainable future, indigenous knowledge that often originates in developing nations also can contribute significantly to this global dialogue. Selected case studies are presented to describe important knowledge, methodologies, techniques, principles, and practices for sustainable development emerging from developing countries in two critical challenge areas to sustainability: water and energy. These, with additional analysis and quantification, can be adapted and expanded for transfer throughout the developed and developing world in advancing sustainability. A common theme in all of the case studies presented is the integration of natural processes and material flows into the anthropogenic system. Some of these techniques, originating in rural settings, have recently been adapted for use in cities, which is especially important as the global trend of urban population growth accelerates. Innovations in science and technology, specifically applied to two critical issues of today, water and energy, are expected to fundamentally shift the type and efficiency of energy and materials utilized to advance prosperity while protecting and restoring natural systems.
Yang, Jiaheng; He, Xiaodong; Guo, Ruijun; Xu, Peng; Wang, Kunpeng; Sheng, Cheng; Liu, Min; Wang, Jin; Derevianko, Andrei; Zhan, Mingsheng
2016-09-16
We demonstrate that the coherence of a single mobile atomic qubit can be well preserved during a transfer process among different optical dipole traps (ODTs). This is a prerequisite step in realizing a large-scale neutral atom quantum information processing platform. A qubit encoded in the hyperfine manifold of an ^{87}Rb atom is dynamically extracted from the static quantum register by an auxiliary moving ODT and reinserted into the static ODT. Previous experiments were limited by decoherences induced by the differential light shifts of qubit states. Here, we apply a magic-intensity trapping technique which mitigates the detrimental effects of light shifts and substantially enhances the coherence time to 225±21 ms. The experimentally demonstrated magic trapping technique relies on the previously neglected hyperpolarizability contribution to the light shifts, which makes the light shift dependence on the trapping laser intensity parabolic. Because of the parabolic dependence, at a certain "magic" intensity, the first order sensitivity to trapping light-intensity variations over ODT volume is eliminated. We experimentally demonstrate the utility of this approach and measure hyperpolarizability for the first time. Our results pave the way for constructing scalable quantum-computing architectures with single atoms trapped in an array of magic ODTs.
NASA Technical Reports Server (NTRS)
Guarnieri, Fernando L.; Tsurutani, Bruce T.; Hajra, Rajkumar; Echer, Ezequiel; Gonzalez, Walter D.; Mannucci, Anthony J.
2014-01-01
High speed solar wind streams cause geomagnetic activity at Earth. In this study we have applied a wavelet interactive filtering and reconstruction technique on the solar wind magnetic field components and AE index series to allowed us to investigate the relationship between the two. The IMF Bz component was found as the most significant solar wind parameter responsible by the control of the AE activity. Assuming magnetic reconnection associated to southward directed Bz is the main mechanism transferring energy into the magnetosphere, we adjust parameters to forecast the AE index. The adjusted routine is able to forecast AE, based only on the Bz measured at the L1 Lagrangian point. This gives a prediction approximately 30-70 minutes in advance of the actual geomagnetic activity. The correlation coefficient between the observed AE data and the forecasted series reached values higher than 0.90. In some cases the forecast reproduced particularities observed in the signal very well.The high correlation values observed and the high efficacy of the forecasting can be taken as a confirmation that reconnection is the main physical mechanism responsible for the energy transfer during HILDCAAs. The study also shows that the IMF Bz component low frequencies are most important for AE prediction.
Time transfer techniques: Historical overview, current practices and future capabilities
NASA Technical Reports Server (NTRS)
Klepczynski, W. J.
1984-01-01
A brief historical review of time transfer techniques used during the last twenty years is presented. Methods currently used are discussed in terms of cost effectiveness as a function of accuracy achievable. Future trends are also discussed in terms of projected timekeeping capabilities.
An improved data transfer and storage technique for hybrid computation
NASA Technical Reports Server (NTRS)
Hansing, A. M.
1972-01-01
Improved technique was developed for transferring and storing data at faster than real time speeds on hybrid computer. Predominant advantage is combined use of electronic relays, track and store units, and analog-to-digital and digital-to-analog conversion units of hybrid computer.
Santos-Cancel, Mirelis; Lazenby, Robert A; White, Ryan J
2018-06-22
In this manuscript, we employ the technique intermittent pulse amperometry (IPA) to interrogate equilibrium and kinetic target binding to the surface of electrochemical, aptamer-based (E-AB) sensors, achieving as fast as 2 ms time resolution. E-AB sensors comprise an electrode surface modified with a flexible nucleic acid aptamer tethered at the 3'-terminus with a redox-active molecule. The introduction of a target changes the conformation and flexibility of the nucleic acid, which alters the charge transfer rate of the appended redox molecule. Typically, changes in charge transfer rate within this class of sensor are monitored via voltammetric methods. Here, we demonstrate that the use of IPA enables the detection of changes in charge transfer rates (i.e., current) at times <100 μs after the application of a potential pulse. Changes in sensor current are quantitatively related to target analyte concentration and can be used to create binding isotherms. Furthermore, the application of IPA enables rapid probing of the electrochemical surface with a time resolution equivalent to as low as twice the applied potential pulse width, not previously demonstrated with traditional voltammetric techniques employed with E-AB sensors (alternating current, square wave, cyclic). To visualize binding, we developed false-color plots analogous to those used in the field of fast-scan cyclic voltammetry. The use of IPA is universal, as demonstrated with two representative small molecule E-AB sensors directed against the aminoglycoside antibiotic tobramycin and adenosine triphosphate (ATP). Intermittent pulse amperometry exhibits an unprecedented sub-microsecond temporal response and is a general method for measuring rapid sensor performance.
NASA Astrophysics Data System (ADS)
De Geyter, G.; Baes, M.; Fritz, J.; Camps, P.
2013-02-01
We present FitSKIRT, a method to efficiently fit radiative transfer models to UV/optical images of dusty galaxies. These images have the advantage that they have better spatial resolution compared to FIR/submm data. FitSKIRT uses the GAlib genetic algorithm library to optimize the output of the SKIRT Monte Carlo radiative transfer code. Genetic algorithms prove to be a valuable tool in handling the multi- dimensional search space as well as the noise induced by the random nature of the Monte Carlo radiative transfer code. FitSKIRT is tested on artificial images of a simulated edge-on spiral galaxy, where we gradually increase the number of fitted parameters. We find that we can recover all model parameters, even if all 11 model parameters are left unconstrained. Finally, we apply the FitSKIRT code to a V-band image of the edge-on spiral galaxy NGC 4013. This galaxy has been modeled previously by other authors using different combinations of radiative transfer codes and optimization methods. Given the different models and techniques and the complexity and degeneracies in the parameter space, we find reasonable agreement between the different models. We conclude that the FitSKIRT method allows comparison between different models and geometries in a quantitative manner and minimizes the need of human intervention and biasing. The high level of automation makes it an ideal tool to use on larger sets of observed data.
NASA Astrophysics Data System (ADS)
Azimi, Neda; Rahimi, Masoud
2017-01-01
Rotating magnetic field (RMF) was applied on a micromixer to break the laminar flow and induce chaotic flow to enhance mass transfer between two-immiscible organic and aqueous phases. The results of RMF were compared to those of static magnetic field (SMF). For this purpose, experiments were carried out in a T-micromixer at equal volumetric flow rates of organic and aqueous phases. Fe3O4 nanoparticles were synthesized by co-precipitation technique and they were dissolved in organic phase. Results obtained from RMF and SMF were compared in terms of overall volumetric mass transfer coefficient (KLa) and extraction efficiency (E) at various Reynolds numbers. Generally, RMF showed higher effect in mass transfer characteristics enhancement compared with SMF. The influence of rotational speeds of magnets (ω) in RMF was investigated, and measurable enhancements of KLa and E were observed. In RMF, the effect of magnetic field induction (B) was investigated. The results reveal that at constant concentration of nanoparticles, by increasing of B, mass transfer characteristics will be enhanced. The effect of various nanoparticles concentrations (ϕ) within 0.002-0.01 (w/v) on KLa and E at maximum induction of RMF (B=76 mT) was evaluated. Maximum values of KLa (2.1±0.001) and E (0.884±0.001) were achieved for the layout of RMF (B=76 mT), ω=16 rad/s and MNPs concentration of 0.008-0.01 (w/v).
Ecological niche transferability using invasive species as a case study.
Fernández, Miguel; Hamilton, Healy
2015-01-01
Species distribution modeling is widely applied to predict invasive species distributions and species range shifts under climate change. Accurate predictions depend upon meeting the assumption that ecological niches are conserved, i.e., spatially or temporally transferable. Here we present a multi-taxon comparative analysis of niche conservatism using biological invasion events well documented in natural history museum collections. Our goal is to assess spatial transferability of the climatic niche of a range of noxious terrestrial invasive species using two complementary approaches. First we compare species' native versus invasive ranges in environmental space using two distinct methods, Principal Components Analysis and Mahalanobis distance. Second we compare species' native versus invaded ranges in geographic space as estimated using the species distribution modeling technique Maxent and the comparative index Hellinger's I. We find that species exhibit a range of responses, from almost complete transferability, in which the invaded niches completely overlap with the native niches, to a complete dissociation between native and invaded ranges. Intermediate responses included expansion of dimension attributable to either temperature or precipitation derived variables, as well as niche expansion in multiple dimensions. We conclude that the ecological niche in the native range is generally a poor predictor of invaded range and, by analogy, the ecological niche may be a poor predictor of range shifts under climate change. We suggest that assessing dimensions of niche transferability prior to standard species distribution modeling may improve the understanding of species' dynamics in the invaded range.
NASA Astrophysics Data System (ADS)
Zhu, Zhengfan; Gan, Qingbo; Yang, Xin; Gao, Yang
2017-08-01
We have developed a novel continuation technique to solve optimal bang-bang control for low-thrust orbital transfers considering the first-order necessary optimality conditions derived from Lawden's primer vector theory. Continuation on the thrust amplitude is mainly described in this paper. Firstly, a finite-thrust transfer with an ;On-Off-On; thrusting sequence is modeled using a two-impulse transfer as initial solution, and then the thrust amplitude is decreased gradually to find an optimal solution with minimum thrust. Secondly, the thrust amplitude is continued from its minimum value to positive infinity to find the optimal bang-bang control, and a thrust switching principle is employed to determine the control structure by monitoring the variation of the switching function. In the continuation process, a bifurcation of bang-bang control is revealed and the concept of critical thrust is proposed to illustrate this phenomenon. The same thrust switching principle is also applicable to the continuation on other parameters, such as transfer time, orbital phase angle, etc. By this continuation technique, fuel-optimal orbital transfers with variable mission parameters can be found via an automated algorithm, and there is no need to provide an initial guess for the costate variables. Moreover, continuation is implemented in the solution space of bang-bang control that is either optimal or non-optimal, which shows that a desired solution of bang-bang control is obtained via continuation on a single parameter starting from an existing solution of bang-bang control. Finally, numerical examples are presented to demonstrate the effectiveness of the proposed continuation technique. Specifically, this continuation technique provides an approach to find multiple solutions satisfying the first-order necessary optimality conditions to the same orbital transfer problem, and a continuation strategy is presented as a preliminary approach for solving the bang-bang control of many-revolution orbital transfers.
Ihme, Matthias; Marsden, Alison L; Pitsch, Heinz
2008-02-01
A pattern search optimization method is applied to the generation of optimal artificial neural networks (ANNs). Optimization is performed using a mixed variable extension to the generalized pattern search method. This method offers the advantage that categorical variables, such as neural transfer functions and nodal connectivities, can be used as parameters in optimization. When used together with a surrogate, the resulting algorithm is highly efficient for expensive objective functions. Results demonstrate the effectiveness of this method in optimizing an ANN for the number of neurons, the type of transfer function, and the connectivity among neurons. The optimization method is applied to a chemistry approximation of practical relevance. In this application, temperature and a chemical source term are approximated as functions of two independent parameters using optimal ANNs. Comparison of the performance of optimal ANNs with conventional tabulation methods demonstrates equivalent accuracy by considerable savings in memory storage. The architecture of the optimal ANN for the approximation of the chemical source term consists of a fully connected feedforward network having four nonlinear hidden layers and 117 synaptic weights. An equivalent representation of the chemical source term using tabulation techniques would require a 500 x 500 grid point discretization of the parameter space.
Selvakumar, G; Shagol, C C; Kang, Y; Chung, B N; Han, S G; Sa, T M
2018-06-01
The propagation of pure cultures of arbuscular mycorrhizal fungal (AMF) is an essential requirement for their large-scale agricultural application and commercialization as biofertilizers. The present study aimed to propagate AMF using the single-spore inoculation technique and compare their propagation ability with the known reference spores. Arbuscular mycorrhizal fungal spores were collected from salt-affected Saemangeum reclaimed soil in South Korea. The technique involved inoculation of sorghum-sudangrass (Sorghum bicolor L.) seedlings with single, healthy spores on filter paper followed by the transfer of successfully colonized seedlings to 1-kg capacity pots containing sterilized soil. After the first plant cycle, the contents were transferred to 2·5-kg capacity pots containing sterilized soil. Among the 150 inoculated seedlings, only 27 seedlings were colonized by AMF spores. After 240 days, among the 27 seedlings, five inoculants resulted in the production of over 500 spores. The 18S rDNA sequencing of spores revealed that the spores produced through single-spore inoculation method belonged to Gigaspora margarita, Claroideoglomus lamellosum and Funneliformis mosseae. Furthermore, indigenous spore F. mosseae M-1 reported a higher spore count than the reference spores. The AMF spores produced using the single-spore inoculation technique may serve as potential bio-inoculants with an advantage of being more readily adopted by farmers due to the lack of requirement of a skilled technique in spore propagation. The results of the current study describe the feasible and cost-effective method to mass produce AMF spores for large-scale application. The AMF spores obtained from this method can effectively colonize plant roots and may be easily introduced to the new environment. © 2018 The Society for Applied Microbiology.
Nonlinear Spectral Mixture Modeling to Estimate Water-Ice Abundance of Martian Regolith
NASA Astrophysics Data System (ADS)
Gyalay, Szilard; Chu, Kathryn; Zeev Noe Dobrea, Eldar
2017-10-01
We present a novel technique to estimate the abundance of water-ice in the Martian permafrost using Phoenix Surface Stereo Imager multispectral data. In previous work, Cull et al. (2010) estimated the abundance of water-ice in trenches dug by the Mars Phoenix lander by modeling the spectra of the icy regolith using the radiative transfer methods described in Hapke (2008) with optical constants for Mauna Kea palagonite (Clancy et al., 1995) as a substitute for unknown Martian regolith optical constants. Our technique, which uses the radiative transfer methods described in Shkuratov et al. (1999), seeks to eliminate the uncertainty that stems from not knowing the composition of the Martian regolith by using observations of the Martian soil before and after the water-ice has sublimated away. We use observations of the desiccated regolith sample to estimate its complex index of refraction from its spectrum. This removes any a priori assumptions of Martian regolith composition, limiting our free parameters to the estimated real index of refraction of the dry regolith at one specific wavelength, ice grain size, and regolith porosity. We can then model mixtures of regolith and water-ice, fitting to the original icy spectrum to estimate the ice abundance. To constrain the uncertainties in this technique, we performed laboratory measurements of the spectra of known mixtures of water-ice and dry soils as well as those of soils after desiccation with controlled viewing geometries. Finally, we applied the technique to Phoenix Surface Stereo Imager observations and estimated water-ice abundances consistent with pore-fill in the near-surface ice. This abundance is consistent with atmospheric diffusion, which has implications to our understanding of the history of water-ice on Mars and the role of the regolith at high latitudes as a reservoir of atmospheric H2O.
Lokesh, N; Seegerer, Andreas; Hioe, Johnny; Gschwind, Ruth M
2018-02-07
The low sensitivity of NMR and transient key intermediates below detection limit are the central problems studying reaction mechanisms by NMR. Sensitivity can be enhanced by hyperpolarization techniques such as dynamic nuclear polarization or the incorporation/interaction of special hyperpolarized molecules. However, all of these techniques require special equipment, are restricted to selective reactions, or undesirably influence the reaction pathways. Here, we apply the chemical exchange saturation transfer (CEST) technique for the first time to NMR detect and characterize previously unobserved transient reaction intermediates in organocatalysis. The higher sensitivity of CEST and chemical equilibria present in the reaction pathway are exploited to access population and kinetics information on low populated intermediates. The potential of the method is demonstrated on the proline-catalyzed enamine formation for unprecedented in situ detection of a DPU stabilized zwitterionic iminium species, the elusive key intermediate between enamine and oxazolidinones. The quantitative analysis of CEST data at 250 K revealed the population ratio of [Z-iminium]/[exo-oxazolidinone] 0.02, relative free energy +8.1 kJ/mol (calculated +7.3 kJ/mol), and free energy barrier of +45.9 kJ/mol (ΔG ⧧ calc. (268 K) = +42.2 kJ/mol) for Z-iminium → exo-oxazolidinone. The findings underpin the iminium ion participation in enamine formation pathway corroborating our earlier theoretical prediction and help in better understanding. The reliability of CEST is validated using 1D EXSY-build-up techniques at low temperature (213 K). The CEST method thus serves as a new tool for mechanistic investigations in organocatalysis to access key information, such as chemical shifts, populations, and reaction kinetics of intermediates below the standard NMR detection limit.
Membrane technology for treating of waste nanofluids coolant: A review
NASA Astrophysics Data System (ADS)
Mohruni, Amrifan Saladin; Yuliwati, Erna; Sharif, Safian; Ismail, Ahmad Fauzi
2017-09-01
The treatment of cutting fluids wastes concerns a big number of industries, especially from the machining operations to foster environmental sustainability. Discharging cutting fluids, waste through separation technique could protect the environment and also human health in general. Several methods for the separation emulsified oils or oily wastewater have been proposed as three common methods, namely chemical, physicochemical and mechanical and membrane technology application. Membranes are used into separate and concentrate the pollutants in oily wastewater through its perm-selectivity. Meanwhile, the desire to compensate for the shortcomings of the cutting fluid media in a metal cutting operation led to introduce the using of nanofluids (NFs) in the minimum quantity lubricant (MQL) technique. NFs are prepared based on nanofluids technology by dispersing nanoparticles (NPs) in liquids. These fluids have potentially played to enhance the performance of traditional heat transfer fluids. Few researchers have studied investigation of the physical-chemical, thermo-physical and heat transfer characteristics of NFs for heat transfer applications. The use of minimum quantity lubrication (MQL) technique by NFs application is developed in many metal cutting operations. MQL did not only serve as a better alternative to flood cooling during machining operation and also increases better-finished surface, reduces impact loads on the environment and fosters environmental sustainability. Waste coolant filtration from cutting tools using membrane was treated by the pretreated process, coagulation technique and membrane filtration. Nanomaterials are also applied to modify the membrane structure and morphology. Polyvinylidene fluoride (PVDF) is the better choice in coolant wastewater treatment due to its hydrophobicity. Using of polyamide nanofiltration membranes BM-20D and UF-PS-100-100, 000, it resulted in the increase of permeability of waste coolant filtration. Titanium dioxide is nanomaterials additive to modify the Nanopores of the surface membrane. Contact angle and average pore size were used in the investigation of the surface morphology of membranes. An adequate choice in modifying the membrane surface in waste coolant filtration may bring a promised alternative as a solution in waste coolant remediation.
Wafer-Level Membrane-Transfer Process for Fabricating MEMS
NASA Technical Reports Server (NTRS)
Yang, Eui-Hyeok; Wiberg, Dean
2003-01-01
A process for transferring an entire wafer-level micromachined silicon structure for mating with and bonding to another such structure has been devised. This process is intended especially for use in wafer-level integration of microelectromechanical systems (MEMS) that have been fabricated on dissimilar substrates. Unlike in some older membrane-transfer processes, there is no use of wax or epoxy during transfer. In this process, the substrate of a wafer-level structure to be transferred serves as a carrier, and is etched away once the transfer has been completed. Another important feature of this process is that two electrodes constitutes an electrostatic actuator array. An SOI wafer and a silicon wafer (see Figure 1) are used as the carrier and electrode wafers, respectively. After oxidation, both wafers are patterned and etched to define a corrugation profile and electrode array, respectively. The polysilicon layer is deposited on the SOI wafer. The carrier wafer is bonded to the electrode wafer by using evaporated indium bumps. The piston pressure of 4 kPa is applied at 156 C in a vacuum chamber to provide hermetic sealing. The substrate of the SOI wafer is etched in a 25 weight percent TMAH bath at 80 C. The exposed buried oxide is then removed by using 49 percent HF droplets after an oxygen plasma ashing. The SOI top silicon layer is etched away by using an SF6 plasma to define the corrugation profile, followed by the HF droplet etching of the remaining oxide. The SF6 plasma with a shadow mask selectively etches the polysilicon membrane, if the transferred membrane structure needs to be patterned. Electrostatic actuators with various electrode gaps have been fabricated by this transfer technique. The gap between the transferred membrane and electrode substrate is very uniform ( 0.1 m across a wafer diameter of 100 mm, provided by optimizing the bonding control). Figure 2 depicts the finished product.
Transfer Learning with Convolutional Neural Networks for SAR Ship Recognition
NASA Astrophysics Data System (ADS)
Zhang, Di; Liu, Jia; Heng, Wang; Ren, Kaijun; Song, Junqiang
2018-03-01
Ship recognition is the backbone of marine surveillance systems. Recent deep learning methods, e.g. Convolutional Neural Networks (CNNs), have shown high performance for optical images. Learning CNNs, however, requires a number of annotated samples to estimate numerous model parameters, which prevents its application to Synthetic Aperture Radar (SAR) images due to the limited annotated training samples. Transfer learning has been a promising technique for applications with limited data. To this end, a novel SAR ship recognition method based on CNNs with transfer learning has been developed. In this work, we firstly start with a CNNs model that has been trained in advance on Moving and Stationary Target Acquisition and Recognition (MSTAR) database. Next, based on the knowledge gained from this image recognition task, we fine-tune the CNNs on a new task to recognize three types of ships in the OpenSARShip database. The experimental results show that our proposed approach can obviously increase the recognition rate comparing with the result of merely applying CNNs. In addition, compared to existing methods, the proposed method proves to be very competitive and can learn discriminative features directly from training data instead of requiring pre-specification or pre-selection manually.
NASA Astrophysics Data System (ADS)
Chow, L. C.; Hahn, O. J.; Nguyen, H. X.
1992-08-01
This report presents the description of a liquid sodium heat transfer facility (sodium loop) constructed to support the study of transient response of heat pipes. The facility, consisting of the loop itself, a safety system, and a data acquisition system, can be safely operated over a wide range of temperature and sodium flow rate. The transient response of a heat pipe to pulse heat load at the condenser section was experimentally investigated. A 0.457 m screen wick, sodium heat pipe with an outer diameter of 0.127 m was tested under different heat loading conditions. A major finding was that the heat pipe reversed under a pulse heat load applied at the condenser. The time of reversal was approximately 15 to 25 seconds. The startup of the heat pipe from frozen state was also studied. It was found that during the startup process, at least part of the heat pipe was active. The active region extended gradually down to the end of the condenser until all of the working fluid in the heat pipe was molten.
Acoustic Streaming and Heat and Mass Transfer Enhancement
NASA Technical Reports Server (NTRS)
Trinh, E. H.; Gopinath, A.
1996-01-01
A second order effect associated with high intensity sound field, acoustic streaming has been historically investigated to gain a fundamental understanding of its controlling mechanisms and to apply it to practical aspects of heat and mass transfer enhancement. The objectives of this new research project are to utilize a unique experimental technique implementing ultrasonic standing waves in closed cavities to study the details of the generation of the steady-state convective streaming flows and of their interaction with the boundary of ultrasonically levitated near-spherical solid objects. The goals are to further extend the existing theoretical studies of streaming flows and sample interactions to higher streaming Reynolds number values, for larger sample size relative to the wavelength, and for a Prandtl and Nusselt numbers parameter range characteristic of both gaseous and liquid host media. Experimental studies will be conducted in support to the theoretical developments, and the crucial impact of microgravity will be to allow the neglect of natural thermal buoyancy. The direct application to heat and mass transfer in the absence of gravity will be emphasized in order to investigate a space-based experiment, but both existing and novel ground-based scientific and technological relevance will also be pursued.
Code of Federal Regulations, 2010 CFR
2010-10-01
... transferred to a Self-Governance Tribe in a compact or funding agreement? 137.96 Section 137.96 Public Health... HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Funding Prompt Payment Act § 137.96 Does the Prompt Payment Act apply to funds transferred to a Self-Governance Tribe in a compact or funding agreement? Yes...
Maeda, Kiminori; Neil, Simon R T; Henbest, Kevin B; Weber, Stefan; Schleicher, Erik; Hore, P J; Mackenzie, Stuart R; Timmel, Christiane R
2011-11-09
The study of radical pair intermediates in biological systems has been hampered by the low sensitivity of the optical techniques usually employed to investigate these highly reactive species. Understanding the physical principles governing the spin-selective and magneto-sensitive yields and kinetics of their reactions is essential in identifying the mechanism governing bird migration, and might have significance in the discussion of potential health hazards of electromagnetic radiation. Here, we demonstrate the powerful capabilities of optical cavity-enhanced techniques, such as cavity ring-down spectroscopy (CRDS) in monitoring radical recombination reactions and associated magnetic field effects (MFEs). These include submicrosecond time-resolution, high sensitivity (baseline noise on the order of 10(-6) absorbance units) and small (μL) sample volumes. Combined, we show that these represent significant advantages over the single-pass flash-photolysis techniques conventionally applied. The studies described here focus on photoinduced radical pair reactions involving the protein lysozyme and one of two possible photosensitizers: anthraquinone-2,6-disulphonate and flavin mononucleotide. CRDS-measured MFEs are observed in pump-probe experiments and discussed in terms of the sensitivity gains and sample-volume minimization afforded by CRDS when compared with flash photolysis methods. Finally, CRDS is applied to an in vitro MFE study of intramolecular electron transfer in the DNA-repair enzyme, Escherichia coli photolyase, a protein closely related to cryptochrome which has been proposed to mediate animal magnetoreception.
A novel biomechanical model assessing continuous orthodontic archwire activation
Canales, Christopher; Larson, Matthew; Grauer, Dan; Sheats, Rose; Stevens, Clarke; Ko, Ching-Chang
2013-01-01
Objective The biomechanics of a continuous archwire inserted into multiple orthodontic brackets is poorly understood. The purpose of this research was to apply the birth-death technique to simulate insertion of an orthodontic wire and consequent transfer of forces to the dentition in an anatomically accurate model. Methods A digital model containing the maxillary dentition, periodontal ligament (PDL), and surrounding bone was constructed from human computerized tomography data. Virtual brackets were placed on four teeth (central and lateral incisors, canine and first premolar), and a steel archwire (0.019″ × 0.025″) with a 0.5 mm step bend to intrude the lateral incisor was virtually inserted into the bracket slots. Forces applied to the dentition and surrounding structures were simulated utilizing the birth-death technique. Results The goal of simulating a complete bracket-wire system on accurate anatomy including multiple teeth was achieved. Orthodontic force delivered by the wire-bracket interaction was: central incisor 19.1 N, lateral incisor 21.9 N, and canine 19.9 N. Loading the model with equivalent point forces showed a different stress distribution in the PDL. Conclusions The birth-death technique proved to be a useful biomechanical simulation method for placement of a continuous archwire in orthodontic brackets. The ability to view the stress distribution throughout proper anatomy and appliances advances understanding of orthodontic biomechanics. PMID:23374936
Analysis and modification of blue sapphires from Rwanda by ion beam techniques
NASA Astrophysics Data System (ADS)
Bootkul, D.; Chaiwai, C.; Tippawan, U.; Wanthanachaisaeng, B.; Intarasiri, S.
2015-12-01
Blue sapphire is categorised in a corundum (Al2O3) group. The gems of this group are always amazed by their beauties and thus having high value. In this study, blue sapphires from Rwanda, recently came to Thai gemstone industry, are chosen for investigations. On one hand, we have applied Particle Induced X-ray Emission (PIXE), which is a highly sensitive and precise analytical technique that can be used to identify and quantify trace elements, for chemical analysis of the sapphires. Here we have found that the major element of blue sapphires from Rwanda is Al with trace elements such as Fe, Ti, Cr, Ga and Mg as are commonly found in normal blue sapphire. On the other hand, we have applied low and medium ion implantations for color improvement of the sapphire. It seems that a high amount of energy transferring during cascade collisions have altered the gems properties. We have clearly seen that the blue color of the sapphires have been intensified after nitrogen ion bombardment. In addition, the gems were also having more transparent and luster. The UV-Vis-NIR measurement detected the modification of their absorption properties, implying of the blue color increasing. Here the mechanism of these modifications is postulated and reported. In any point of view, the bombardment by using nitrogen ion beam is a promising technique for quality improvement of the blue sapphire from Rwanda.
Ultrasonic Fingerprinting of Structural Materials: Spent Nuclear Fuel Containers Case-Study
NASA Astrophysics Data System (ADS)
Sednev, D.; Lider, A.; Demyanuk, D.; Kroening, M.; Salchak, Y.
Nowadays, NDT is mainly focused on safety purposes, but it seems possible to apply those methods to provide national and IAEA safeguards. The containment of spent fuel in storage casks could be dramatically improved in case of development of so-called "smart" spent fuel storage and transfer casks. Such casks would have tamper indicating and monitoring/tracking features integrated directly into the cask design. The microstructure of the containers material as well as of the dedicated weld seam is applied to the lid and the cask body and provides a unique fingerprint of the full container, which can be reproducibly scanned by using an appropriate technique. The echo-sounder technique, which is the most commonly used method for material inspection, was chosen for this project. The main measuring parameter is acoustic noise, reflected from material's artefacts. The purpose is to obtain structural fingerprinting. Reference measurement and additional measurement results were compared. Obtained results have verified the appliance of structural fingerprint and the chosen control method. The successful authentication demonstrates the levels of the feature points' compliance exceeding the given threshold which differs considerably from the percentage of the concurrent points during authentication from other points. Since reproduction or doubling of the proposed unique identification characteristics is impossible at the current state science and technology, application of this technique is considered to identify the interference into the nuclear materials displacement with high accuracy.
Wafer-scale layer transfer of GaAs and Ge onto Si wafers using patterned epitaxial lift-off
NASA Astrophysics Data System (ADS)
Mieda, Eiko; Maeda, Tatsuro; Miyata, Noriyuki; Yasuda, Tetsuji; Kurashima, Yuichi; Maeda, Atsuhiko; Takagi, Hideki; Aoki, Takeshi; Yamamoto, Taketsugu; Ichikawa, Osamu; Osada, Takenori; Hata, Masahiko; Ogawa, Arito; Kikuchi, Toshiyuki; Kunii, Yasuo
2015-03-01
We have developed a wafer-scale layer-transfer technique for transferring GaAs and Ge onto Si wafers of up to 300 mm in diameter. Lattice-matched GaAs or Ge layers were epitaxially grown on GaAs wafers using an AlAs release layer, which can subsequently be transferred onto a Si handle wafer via direct wafer bonding and patterned epitaxial lift-off (ELO). The crystal properties of the transferred GaAs layers were characterized by X-ray diffraction (XRD), photoluminescence, and the quality of the transferred Ge layers was characterized using Raman spectroscopy. We find that, after bonding and the wet ELO processes, the quality of the transferred GaAs and Ge layers remained the same compared to that of the as-grown epitaxial layers. Furthermore, we realized Ge-on-insulator and GaAs-on-insulator wafers by wafer-scale pattern ELO technique.
Sich, D; Saïdi, Y; Egloff, M; Giral, P; Gautier, V; Federspiel, M C; Turpin, G; Beucler, I
1997-10-31
The measurement of the activity of cholesteryl ester transfer protein (CETP), is of high clinical interest and this study reports the use of a direct LDL isolation (d-LDL) technique to determine in one step the amount of radiolabeled cholesteryls esters ([3H]-CE) transferred from exogenous HDL3 to LDL, avoiding the conveniences of the usually used ultracentrifugation or precipitation of apo-B containing lipoproteins in the CETP methodologies. The d-LDL technique providing a specific immunoprecipitation of VLDL, IDL and HDL allowed to directly determine the [3H]-CE transferred on LDL (d-[3H]-CE-LDL). Two methodologies were assayed for the CETP activity using either exogenous or endogenous lipoproteins, and the results with the d-LDL technique were compared with those obtained using the ultracentrifugation (u-[3H]-CE-LDL) considered as the reference method. The intra- and inter-assays were similar in both techniques for the two CETP activity assays. Strong positive correlations were established between values obtained with d-[3H]-CE-LDL and u-[3H]-CE-LDL isolation procedures for CETP activities with exogenous or endogenous lipoproteins (r = 0.972; p = 0.0001 and r = 0.965; p = 0.0001 respectively). In conclusion, the d-LDL technique represents an easy and accurate procedure to measure directly, in normotriglyceridemic plasmas, the amount of [3H]-CE transferred from HDL to LDL by the CETP.
NASA Astrophysics Data System (ADS)
Maldonado, Jaime J.
1994-04-01
Hypersonic vehicles are exposed to extreme thermal conditions compared to subsonic aircraft; therefore, some level of thermal management is required to protect the materials used. Normally, hypersonic vehicles experience the highest temperatures in the nozzle throat, and aircraft and propulsion system leading edges. Convective heat transfer augmentation techniques can be used in the thermal management system to increase heat transfer of the cooling channels in those areas. The techniques studied in this report are pin-fin, offset-fin, ribbed and straight roughened channel. A smooth straight channel is used as the baseline for comparing the techniques. SINDA '85, a lumped parameter finite difference thermal analyzer, is used to model the channels. Subroutines are added to model the fluid flow assuming steady one dimensional compressible flow with heat addition and friction. Correlations for convective heat transfer and friction are used in conjunction with the fluid flow analysis mentioned. As expected, the pin-fin arrangement has the highest heat transfer coefficient and the largest pressure drop. All the other devices fall in between the pin-fin and smooth straight channel. The selection of the best heat augmentation method depends on the design requirements. A good approach may be a channel using a combination of the techniques. For instance, several rows of pin-fins may be located at the region of highest heat flux, surrounded by some of the other techniques. Thus, the heat transfer coefficient is maximized at the region of highest heat flux while the pressure drop is not excessive.
NASA Technical Reports Server (NTRS)
Maldonado, Jaime J.
1994-01-01
Hypersonic vehicles are exposed to extreme thermal conditions compared to subsonic aircraft; therefore, some level of thermal management is required to protect the materials used. Normally, hypersonic vehicles experience the highest temperatures in the nozzle throat, and aircraft and propulsion system leading edges. Convective heat transfer augmentation techniques can be used in the thermal management system to increase heat transfer of the cooling channels in those areas. The techniques studied in this report are pin-fin, offset-fin, ribbed and straight roughened channel. A smooth straight channel is used as the baseline for comparing the techniques. SINDA '85, a lumped parameter finite difference thermal analyzer, is used to model the channels. Subroutines are added to model the fluid flow assuming steady one dimensional compressible flow with heat addition and friction. Correlations for convective heat transfer and friction are used in conjunction with the fluid flow analysis mentioned. As expected, the pin-fin arrangement has the highest heat transfer coefficient and the largest pressure drop. All the other devices fall in between the pin-fin and smooth straight channel. The selection of the best heat augmentation method depends on the design requirements. A good approach may be a channel using a combination of the techniques. For instance, several rows of pin-fins may be located at the region of highest heat flux, surrounded by some of the other techniques. Thus, the heat transfer coefficient is maximized at the region of highest heat flux while the pressure drop is not excessive.
Film-Cooling Heat-Transfer Measurements Using Liquid Crystals
NASA Technical Reports Server (NTRS)
Hippensteele, Steven A.
1997-01-01
The following topics are discussed: (1) The Transient Liquid-Crystal Heat-Transfer Technique; (2) 2-D Film-Cooling Heat-Transfer on an AlliedSignal Vane; and (3) Effects of Tab Vortex Generators on Surface Heat Transfer. Downstream of a Jet in Crossflow.
NASA Technical Reports Server (NTRS)
Schacht, R. L.; Quentmeyer, R. J.
1973-01-01
An experimental investigation was conducted to determine the coolant-side, heat transfer coefficients for a liquid cooled, hydrogen-oxygen rocket thrust chamber. Heat transfer rates were determined from measurements of local hot gas wall temperature, local coolant temperature, and local coolant pressure. A correlation incorporating an integration technique for the transport properties needed near the pseudocritical temperature of liquid hydrogen gives a satisfactory prediction of hot gas wall temperatures.
Rotation covariant image processing for biomedical applications.
Skibbe, Henrik; Reisert, Marco
2013-01-01
With the advent of novel biomedical 3D image acquisition techniques, the efficient and reliable analysis of volumetric images has become more and more important. The amount of data is enormous and demands an automated processing. The applications are manifold, ranging from image enhancement, image reconstruction, and image description to object/feature detection and high-level contextual feature extraction. In most scenarios, it is expected that geometric transformations alter the output in a mathematically well-defined manner. In this paper we emphasis on 3D translations and rotations. Many algorithms rely on intensity or low-order tensorial-like descriptions to fulfill this demand. This paper proposes a general mathematical framework based on mathematical concepts and theories transferred from mathematical physics and harmonic analysis into the domain of image analysis and pattern recognition. Based on two basic operations, spherical tensor differentiation and spherical tensor multiplication, we show how to design a variety of 3D image processing methods in an efficient way. The framework has already been applied to several biomedical applications ranging from feature and object detection tasks to image enhancement and image restoration techniques. In this paper, the proposed methods are applied on a variety of different 3D data modalities stemming from medical and biological sciences.
Determining biosonar images using sparse representations.
Fontaine, Bertrand; Peremans, Herbert
2009-05-01
Echolocating bats are thought to be able to create an image of their environment by emitting pulses and analyzing the reflected echoes. In this paper, the theory of sparse representations and its more recent further development into compressed sensing are applied to this biosonar image formation task. Considering the target image representation as sparse allows formulation of this inverse problem as a convex optimization problem for which well defined and efficient solution methods have been established. The resulting technique, referred to as L1-minimization, is applied to simulated data to analyze its performance relative to delay accuracy and delay resolution experiments. This method performs comparably to the coherent receiver for the delay accuracy experiments, is quite robust to noise, and can reconstruct complex target impulse responses as generated by many closely spaced reflectors with different reflection strengths. This same technique, in addition to reconstructing biosonar target images, can be used to simultaneously localize these complex targets by interpreting location cues induced by the bat's head related transfer function. Finally, a tentative explanation is proposed for specific bat behavioral experiments in terms of the properties of target images as reconstructed by the L1-minimization method.
Application of Six Sigma towards improving surgical outcomes.
Shukla, P J; Barreto, S G; Nadkarni, M S
2008-01-01
Six Sigma is a 'process excellence' tool targeting continuous improvement achieved by providing a methodology for improving key steps of a process. It is ripe for application into health care since almost all health care processes require a near-zero tolerance for mistakes. The aim of this study is to apply the Six Sigma methodology into a clinical surgical process and to assess the improvement (if any) in the outcomes and patient care. The guiding principles of Six Sigma, namely DMAIC (Define, Measure, Analyze, Improve, Control), were used to analyze the impact of double stapling technique (DST) towards improving sphincter preservation rates for rectal cancer. The analysis using the Six Sigma methodology revealed a Sigma score of 2.10 in relation to successful sphincter preservation. This score demonstrates an improvement over the previous technique (73% over previous 54%). This study represents one of the first clinical applications of Six Sigma in the surgical field. By understanding, accepting, and applying the principles of Six Sigma, we have an opportunity to transfer a very successful management philosophy to facilitate the identification of key steps that can improve outcomes and ultimately patient safety and the quality of surgical care provided.
Reasons Non-Faculty Staff Apply (and Don't Apply) for Transfers and Promotions.
ERIC Educational Resources Information Center
Wheeless, Virginia; And Others
1982-01-01
A survey of one institution's nonfaculty employees suggests that although salary is a primary motivation for job changes, other extrinsic and intrinsic motivators are also important. Periodic institutional analysis of transfer and promotion requests is recommended. (MSE)
Color transfer between high-dynamic-range images
NASA Astrophysics Data System (ADS)
Hristova, Hristina; Cozot, Rémi; Le Meur, Olivier; Bouatouch, Kadi
2015-09-01
Color transfer methods alter the look of a source image with regards to a reference image. So far, the proposed color transfer methods have been limited to low-dynamic-range (LDR) images. Unlike LDR images, which are display-dependent, high-dynamic-range (HDR) images contain real physical values of the world luminance and are able to capture high luminance variations and finest details of real world scenes. Therefore, there exists a strong discrepancy between the two types of images. In this paper, we bridge the gap between the color transfer domain and the HDR imagery by introducing HDR extensions to LDR color transfer methods. We tackle the main issues of applying a color transfer between two HDR images. First, to address the nature of light and color distributions in the context of HDR imagery, we carry out modifications of traditional color spaces. Furthermore, we ensure high precision in the quantization of the dynamic range for histogram computations. As image clustering (based on light and colors) proved to be an important aspect of color transfer, we analyze it and adapt it to the HDR domain. Our framework has been applied to several state-of-the-art color transfer methods. Qualitative experiments have shown that results obtained with the proposed adaptation approach exhibit less artifacts and are visually more pleasing than results obtained when straightforwardly applying existing color transfer methods to HDR images.
ERIC Educational Resources Information Center
Kaminski, Karen; Foley, Jeffrey M.; Kaiser, Leann M. R.
2013-01-01
Throughout the chapters in this issue, the authors have cited various definitions for learning transfer. For educators, in its simplest form, transfer of learning occurs when students put to practical use the knowledge and skills they gained in the classroom (near transfer). Chapter 1 defines near transfer and then goes into detail on the levels…
Xia, Jixiang; Martinez, Angela; Daniell, Henry; Ebert, Steven N
2011-06-02
Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun") delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI) methods. Plasmid DNA carrying the firefly luciferase (LUC) reporter gene under the control of the human Cytomegalovirus (CMV) promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter) using different DNA Loading Ratios (DLRs), and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50) at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results demonstrate that different tissues show different expression kinetics following gene transfer of the same reporter plasmid to different mouse tissues in vivo. We evaluated superficial (skin) and abdominal organ (liver) targets, and found that reporter gene expression peaked within the first two days post-transfer in each case, but declined most rapidly in the skin (3-4 days) compared to liver (10-14 days). This information is essential for designing effective gene therapy strategies in different target tissues.
CHARACTERIZING TRANSFER OF SURFACE RESIDUES TO SKIN USING A VIDEO-FLUORESCENT IMAGING TECHNIQUE
Surface-to-skin transfer of contaminants is a complex process. For children's residential exposure, transfer of chemicals from contaminated surfaces such as floors and furniture is potentially significant. Once on the skin, residues and contaminated particles can be transferred b...
NASA Technical Reports Server (NTRS)
Davis, John A.; Lewandowski, W.; DeYoung, James A.; Kirchner, Dieter; Hetzel, Peter; deJong, Gerrit; Soering, A.; Baumont, F.; Klepczynski, William; McKinley, Angela Davis;
1996-01-01
For a decade and a half Global Positioning System (GPS) common-view time transfer has greatly served the needs of primary timing laboratories for regular intercomparisons of remote atomic clocks. However, GPS as a one-way technique has natural limits and may not meet all challenges of the comparison of the coming new generation of atomic clocks. Two-way satellite time and frequency transfer (TWSTFT) is a promising technique which may successfully complement GPS. For two years, regular TWSTFT's have been performed between eight laboratories situated in both Europe and North America, using INTELSAT satellites. This has enabled an extensive direct comparison to be made between these two high performance time transfer methods. The performance of the TWSTFT and GPS common view methods are compared over a number of time-transfer links. These links use a variety of time-transfer hardware and atomic clocks and have baselines of substantially different lengths. The relative merits of the two time-transfer systems are discussed.
Creating Fidelitious Climate Data Records from Meteosat First Generation Observations
NASA Astrophysics Data System (ADS)
Quast, Ralf; Govaerts, Yves; Ruthrich, Frank; Giering, Ralf; Roebeling, Rob
2016-08-01
A novel method for reconstructing the spectral response function of the Meteosat visible (VIS) channels is presented and applied to the Meteosat-10 Spinning Enhanced Visible and Infrared Imager (SEVIRI) high-resolution visible (HRV) channel as the first real-world benchmark. The method incorporates advanced radiative transfer modelling and inverse modelling techniques. Once established, EUMETSAT will use the reconstructed spectral response and uncertainty information to increase the calibration accuracy of Meteosat First Generation VIS observations, which will provide the basis for the Fidelity and Uncertainty in Climate data records from Earth Observations (FIDUCEO) Horizon 2020 project to produce new fundamental (reflectance) and thematic (albedo and aerosol) climate data records.
Time-resolved fluorescence spectroscopy for chemical sensors
NASA Astrophysics Data System (ADS)
Draxler, Sonja; Lippitsch, Max E.
1996-07-01
A family of sensors is presented with fluorescence decay-time measurements used as the sensing technique. The concept is to take a single fluorophore with a suitably long fluorescence decay time as the basic building block for numerous different sensors. Analyte recognition can be performed by different functional groups that are necessary for selective interaction with the analyte. To achieve this, the principle of excited-state electron transfer is applied with pyrene as the fluorophore. Therefore the same instrumentation based on a small, ambient air-nitrogen laser and solid-state electronics can be used to measure different analytes, for example, oxygen, pH, carbon dioxide, potassium, ammonium, lead, cadmium, zinc, and phosphate.
Group rational-emotive and cognitive-behavioral therapy.
Ellis, A
1992-01-01
The theory of rational-emotive therapy (RET) and of cognitive-behavioral therapy (CBT) is briefly explained and is applied to group therapy. It is shown how RET and CBT therapy groups deal with transference, countertransference, levels of group intervention, process versus content orientation, identifying underlying group process themes, here-and-now activation, working with difficult group members, activity levels of therapist and group members, and other group problems. Although they particularly concentrate on people's tendencies to construct and create their own "emotional" difficulties, RET and CBT group procedures fully acknowledge the interactions of human thoughts, feelings, and actions and active-directively employ a variety of cognitive, emotive, and behavioral group therapy techniques.
A modeling technique for STOVL ejector and volume dynamics
NASA Technical Reports Server (NTRS)
Drummond, C. K.; Barankiewicz, W. S.
1990-01-01
New models for thrust augmenting ejector performance prediction and feeder duct dynamic analysis are presented and applied to a proposed Short Take Off and Vertical Landing (STOVL) aircraft configuration. Central to the analysis is the nontraditional treatment of the time-dependent volume integrals in the otherwise conventional control-volume approach. In the case of the thrust augmenting ejector, the analysis required a new relationship for transfer of kinetic energy from the primary flow to the secondary flow. Extraction of the required empirical corrections from current steady-state experimental data is discussed; a possible approach for modeling insight through Computational Fluid Dynamics (CFD) is presented.
Elastic electron scattering from formamide
NASA Astrophysics Data System (ADS)
Buk, M. V.; Bardela, F. P.; da Silva, L. A.; Iga, I.; Homem, M. G. P.
2018-05-01
Differential cross sections for elastic electron scattering by formamide (NH2CHO) were measured in the 30–800 eV and 10°–120° ranges. The angular distribution of scattered electrons was obtained using a crossed electron beam-molecular beam geometry. The relative flow technique was applied to normalize our data. Integral and momentum-transfer cross sections were derived from the measured differential cross sections. Theoretical results in the framework of the independent-atom model at the static-exchange-polarization plus absorption level of approximation are also given. The present measured and calculated results are compared with those available in the literature showing a generally good agreement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Won-Seok; Nam, Seongsik; Chang, Seeun
Decontamination techniques proposed and used to remove Chalk River unidentified deposit (CRUD) in radioactive waste management. In cases of huge volumes of metal or radionuclides contaminated by CRUD, removal of CRUD by mechanical or chemical decontamination is difficult. An advanced electrokinetic process combined with chemical decontamination was applied to remove CRUD and experimentally evaluated. We used oxalic acid for CRUD removal, and cobalt (Co) released from the CRUD was transferred to the cathode in an electrokinetic reactor. Our results indicate that the combined system is efficient for CRUD removal with enhanced, efficiency by use of the cation exchange membrane andmore » zeolite.« less
Kim, Won-Seok; Nam, Seongsik; Chang, Seeun; ...
2017-08-13
Decontamination techniques proposed and used to remove Chalk River unidentified deposit (CRUD) in radioactive waste management. In cases of huge volumes of metal or radionuclides contaminated by CRUD, removal of CRUD by mechanical or chemical decontamination is difficult. An advanced electrokinetic process combined with chemical decontamination was applied to remove CRUD and experimentally evaluated. We used oxalic acid for CRUD removal, and cobalt (Co) released from the CRUD was transferred to the cathode in an electrokinetic reactor. Our results indicate that the combined system is efficient for CRUD removal with enhanced, efficiency by use of the cation exchange membrane andmore » zeolite.« less
Measurement of Charged Pions from Neutrino-produced Nuclear Resonance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simon, Clifford N.
2014-01-01
A method for identifying stopped pions in a high-resolution scintillator bar detector is presented. I apply my technique to measure the axial mass M Δ Afor production of the Δ(1232) resonance by neutrino, with the result M Δ A = 1.16±0.20 GeV (68% CL) (limited by statistics). The result is produced from the measured spectrum of reconstructed momentum-transfer Q 2. I proceed by varying the value of M Δ A in a Rein-Sehgal-based Monte Carlo to produce the best agreement, using shape only (not normalization). The consistency of this result with recent reanalyses of previous bubble-chamber experiments is discussed.
Teaching professional boundaries to psychiatric residents.
Gabbard, Glen O; Crisp-Han, Holly
2010-01-01
The authors demonstrate that the teaching of professional boundaries in psychiatry is an essential component of training to prevent harm to patients and to the profession. The authors illustrate overarching principles that apply to didactic teaching in seminars and to psychotherapy supervision. The teaching of boundaries must be based in sound clinical theory and technique so that transference, countertransference, and frame theory are seen as interwoven with the concept of boundaries and must use case-based learning so that a "one-size-fits-all" approach is avoided. The emphasis in teaching should be on both the clinician's temptations and the management of the patient's wish to transgress therapeutic boundaries.
Finite-size effects on the static properties of a single-chain magnet
NASA Astrophysics Data System (ADS)
Bogani, L.; Sessoli, R.; Pini, M. G.; Rettori, A.; Novak, M. A.; Rosa, P.; Massi, M.; Fedi, M. E.; Giuntini, L.; Caneschi, A.; Gatteschi, D.
2005-08-01
We study the role of defects in the “single-chain magnet” CoPhOMe by inserting a controlled number of diamagnetic impurities. The samples are analyzed with unprecedented accuracy with the particle induced x-ray emission technique, and with ac and dc magnetic measurements. In an external applied field the system shows an unexpected behavior, giving rise to a double peak in the susceptibility. The static thermodynamic properties of the randomly diluted Ising chain with alternating g values are then exactly obtained via a transfer matrix approach. These results are compared to the experimental behavior of CoPhOMe, showing qualitative agreement.
Probing conformational dynamics by photoinduced electron transfer
NASA Astrophysics Data System (ADS)
Neuweiler, Hannes; Herten, Dirk P.; Marme, N.; Knemeyer, J. P.; Piestert, Oliver; Tinnefeld, Philip; Sauer, Marcus
2004-07-01
We demonstrate how photoinduced electron transfer (PET) reactions can be successfully applied to monitor conformational dynamics in individual biopolymers. Single-pair fluorescence resonance energy transfer (FRET) experiments are ideally suited to study conformational dynamics occurring on the nanometer scale, e.g. during protein folding or unfolding. In contrast, conformational dynamics with functional significance, for example occurring in enzymes at work, often appear on much smaller spatial scales of up to several Angströms. Our results demonstrate that selective PET-reactions between fluorophores and amino acids or DNA nucleotides represent a versatile tool to measure small-scale conformational dynamics in biopolymers on a wide range of time scales, extending from nanoseconds to seconds, at the single-molecule level under equilibrium conditions. That is, the monitoring of conformational dynamics of biopolymers with temporal resolutions comparable to those within reach using new techniques of molecular dynamic simulations. We present data about structural changes of single biomolecules like DNA hairpins and peptides by using quenching electron transfer reactions between guanosine or tryptophan residues in close proximity to fluorescent dyes. Furthermore, we demonstrate that the strong distance dependence of charge separation reactions on the sub-nanometer scale can be used to develop conformationally flexible PET-biosensors. These sensors enable the detection of specific target molecules in the sub-picomolar range and allow one to follow their molecular binding dynamics with temporal resolution.
Olmos, José Manuel; Molina, Ángela; Laborda, Eduardo; Millán-Barrios, Enrique; Ortuño, Joaquín Ángel
2018-02-06
A new theory is presented to tackle the study of transfer processes of hydrophilic ions in two polarizable interface systems when the analyte is initially present in both aqueous phases. The treatment is applied to macrointerfaces (linear diffusion) and microholes (highly convergent diffusion), obtaining analytical equations for the current response in any voltammetric technique. The novel equations predict two signals in the current-potential curves that are symmetric when the compositions of the aqueous phases are identical while asymmetries appear otherwise. The theoretical results show good agreement with the experimental behavior of the "double transfer voltammograms" reported by Dryfe et al. in cyclic voltammetry (CV) ( Anal. Chem. 2014 , 86 , 435 - 442 ) as well as with cyclic square wave voltammetry (cSWV) experiments performed in the current work. The theoretical treatment is also extended to the situation where the target ion is lipophilic and initially present in the organic phase. The theory predicts an opposite effect of the lipophilicity of the ion on the shape of the voltammograms, which is validated experimentally via both CV and cSWV. For the above two cases, simple and manageable expressions and diagnosis criteria are derived for the qualitative and quantitative study of ion lipophilicity. The ion-transfer potentials can be easily quantified from the separation between the two signals making use of explicit analytical equations.
Juhas, Mario; Ajioka, James W
2017-11-01
The majority of the good DNA editing techniques have been developed in Escherichia coli; however, Bacillus subtilis is better host for a plethora of synthetic biology and biotechnology applications. Reliable and efficient systems for the transfer of synthetic DNA between E. coli and B. subtilis are therefore of the highest importance. Using synthetic biology approaches, such as streamlined lambda Red recombineering and Gibson Isothermal Assembly, we integrated genetic circuits pT7L123, Repr-ts-1 and pLT7pol encoding the lysis genes of bacteriophages MS2, ΦX174 and lambda, the thermosensitive repressor and the T7 RNA polymerase into the E. coli chromosome. In this system, T7 RNA polymerase regulated by the thermosensitive repressor drives the expression of the phage lysis genes. We showed that T7 RNA polymerase significantly increases efficiency of cell lysis and transfer of the plasmid and bacterial artificial chromosome-encoded DNA from the lysed E. coli into B. subtilis. The T7 RNA polymerase-driven inducible cell lysis system is suitable for the efficient cell lysis and transfer of the DNA engineered in E. coli to other naturally competent hosts, such as B. subtilis. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Recent progress in plasma-assisted synthesis and modification of 2D materials
NASA Astrophysics Data System (ADS)
Han, Zhao Jun; Murdock, Adrian T.; Seo, Dong Han; Bendavid, Avi
2018-07-01
Plasma represents an important technique for both the synthesis and modification of two-dimensional (2D) materials, owing to the unique plasma-material interactions which can enable effective energy transfer at the nanoscale. Non-equilibrium and non-thermal plasma techniques have been widely applied on various 2D materials, including graphene, silicene, germanene, phosphorene, hexagonal boron nitride (h-BN), and transition metal dichalcogenides such as MoS2 and WS2. Here, we review the recent progress in plasma-assisted synthesis and modification (e.g. functionalisation, doping and etching) of 2D materials and discuss the potential applications of this unique branch of 2D materials. Challenges and future research opportunities in the relevant research field are also discussed. The primary aim of this Review is to provide a better understanding of the plasma-assisted processes and to promote the utilization of 2D materials for advanced electronic, optoelectronic, sensing and energy storage applications.
Prakash, Punit; Salgaonkar, Vasant A.; Diederich, Chris J.
2014-01-01
Endoluminal and catheter-based ultrasound applicators are currently under development and are in clinical use for minimally invasive hyperthermia and thermal ablation of various tissue targets. Computational models play a critical role in in device design and optimization, assessment of therapeutic feasibility and safety, devising treatment monitoring and feedback control strategies, and performing patient-specific treatment planning with this technology. The critical aspects of theoretical modeling, applied specifically to endoluminal and interstitial ultrasound thermotherapy, are reviewed. Principles and practical techniques for modeling acoustic energy deposition, bioheat transfer, thermal tissue damage, and dynamic changes in the physical and physiological state of tissue are reviewed. The integration of these models and applications of simulation techniques in identification of device design parameters, development of real time feedback-control platforms, assessing the quality and safety of treatment delivery strategies, and optimization of inverse treatment plans are presented. PMID:23738697
Non-destructive testing of ceramic materials using mid-infrared ultrashort-pulse laser
NASA Astrophysics Data System (ADS)
Sun, S. C.; Qi, Hong; An, X. Y.; Ren, Y. T.; Qiao, Y. B.; Ruan, Liming M.
2018-04-01
The non-destructive testing (NDT) of ceramic materials using mid-infrared ultrashort-pulse laser is investigated in this study. The discrete ordinate method is applied to solve the transient radiative transfer equation in 2D semitransparent medium and the emerging radiative intensity on boundary serves as input for the inverse analysis. The sequential quadratic programming algorithm is employed as the inverse technique to optimize objective function, in which the gradient of objective function with respect to reconstruction parameters is calculated using the adjoint model. Two reticulated porous ceramics including partially stabilized zirconia and oxide-bonded silicon carbide are tested. The retrieval results show that the main characteristics of defects such as optical properties, geometric shapes and positions can be accurately reconstructed by the present model. The proposed technique is effective and robust in NDT of ceramics even with measurement errors.
A Computer Program for the Computation of Running Gear Temperatures Using Green's Function
NASA Technical Reports Server (NTRS)
Koshigoe, S.; Murdock, J. W.; Akin, L. S.; Townsend, D. P.
1996-01-01
A new technique has been developed to study two dimensional heat transfer problems in gears. This technique consists of transforming the heat equation into a line integral equation with the use of Green's theorem. The equation is then expressed in terms of eigenfunctions that satisfy the Helmholtz equation, and their corresponding eigenvalues for an arbitrarily shaped region of interest. The eigenfunction are obtalned by solving an intergral equation. Once the eigenfunctions are found, the temperature is expanded in terms of the eigenfunctions with unknown time dependent coefficients that can be solved by using Runge Kutta methods. The time integration is extremely efficient. Therefore, any changes in the time dependent coefficients or source terms in the boundary conditions do not impose a great computational burden on the user. The method is demonstrated by applying it to a sample gear tooth. Temperature histories at representative surface locatons are given.
Toward nanomolar detection by NMR through SABRE hyperpolarization.
Eshuis, Nan; Hermkens, Niels; van Weerdenburg, Bram J A; Feiters, Martin C; Rutjes, Floris P J T; Wijmenga, Sybren S; Tessari, Marco
2014-02-19
SABRE is a nuclear spin hyperpolarization technique based on the reversible association of a substrate molecule and para-hydrogen (p-H2) to a metal complex. During the lifetime of such a complex, generally fractions of a second, the spin order of p-H2 is transferred to the nuclear spins of the substrate molecule via a transient scalar coupling network, resulting in strongly enhanced NMR signals. This technique is generally applied at relatively high concentrations (mM), in large excess of substrate with respect to metal complex. Dilution of substrate ligands below stoichiometry results in progressive decrease of signal enhancement, which precludes the direct application of SABRE to the NMR analysis of low concentration (μM) solutions. Here, we show that the efficiency of SABRE at low substrate concentrations can be restored by addition of a suitable coordinating ligand to the solution. The proposed method allowed NMR detection below 1 μM in a single scan.
Frequency shifting approach towards textual transcription of heartbeat sounds.
Arvin, Farshad; Doraisamy, Shyamala; Safar Khorasani, Ehsan
2011-10-04
Auscultation is an approach for diagnosing many cardiovascular problems. Automatic analysis of heartbeat sounds and extraction of its audio features can assist physicians towards diagnosing diseases. Textual transcription allows recording a continuous heart sound stream using a text format which can be stored in very small memory in comparison with other audio formats. In addition, a text-based data allows applying indexing and searching techniques to access to the critical events. Hence, the transcribed heartbeat sounds provides useful information to monitor the behavior of a patient for the long duration of time. This paper proposes a frequency shifting method in order to improve the performance of the transcription. The main objective of this study is to transfer the heartbeat sounds to the music domain. The proposed technique is tested with 100 samples which were recorded from different heart diseases categories. The observed results show that, the proposed shifting method significantly improves the performance of the transcription.
Transfer of task-switching training in older age: the role of verbal processes.
Karbach, Julia; Mang, Sandra; Kray, Jutta
2010-09-01
This study investigated the influence of verbal self-instructions (VSI) on the transfer of task-switching training in older adults (56-78 years). We applied an internally cued switching paradigm in a pretest-training-posttest design. Training-related improvements were not modulated by VSI. Transfer (the pretest-posttest reduction of switch costs) was most pronounced when participants applied the VSI at posttest after practicing the switching task without VSI. The results indicate that in contrast to transfer of executive control training, transfer of (verbal) strategy training seems to be limited and that VSI is most beneficial when the task-switching abilities are already well practiced. (c) 2010 APA, all rights reserved.
NASA Technical Reports Server (NTRS)
Folta, David C.; Bosanac, Natasha; Cox, Andrew; Howell, Kathleen C.
2016-01-01
Lunar IceCube, a 6U CubeSat, will prospect for water and other volatiles from a low-periapsis, highly inclined elliptical lunar orbit. Injected from Exploration Mission-1, a lunar gravity assisted multi-body transfer trajectory will capture into a lunar science orbit. The constrained departure asymptote and value of trans-lunar energy limit transfer trajectory types that re-encounter the Moon with the necessary energy and flight duration. Purdue University and Goddard Space Flight Center's Adaptive Trajectory Design tool and dynamical system research is applied to uncover cislunar spatial regions permitting viable transfer arcs. Numerically integrated transfer designs applying low-thrust and a design framework are described.
[Total and unicompartmental knee replacement. Patient-specific Instrumentation].
Köster, G; Biró, C
2016-04-01
The objective of patient-specific instrumentation (PSI Zimmer®) technology is to optimize positioning and selection of components as well as surgical procedure in uni- and bicompartimental knee replacement. The article contains a description of the planning and surgical technique and evaluates the method based on own results and literature. Using MRI or CT scans a virtual 3D model of the joint is created in order to simulate and plan the implant positioning. According to these data, pin placement and/or cutting guides are produced, which enable the surgeon to transfer the planning to the surgical procedure. In a prospective comparative study 88 patients (44 per each of the two techniques) were operated by one surgeon receiving the same TKA using either MRI-based PSI or a conventional technique. The number of surgical trays, operating time, intraoperative changes and frontal alignment using a full leg x‑ray (70 cases) were compared. In 17 patients the method was applied with unicondylar knee replacement. Anatomical abnormalities could be detected preoperatively and considered during the operation. With PSI the number of trays could be reduced and predictability of the component size was more precise. Intraoperative changes became necessary only for distal femoral (25 %) and proximal tibial (36 %) resection and tibial rotation (40 %). Alignment was more precise in the PSI cases PSI using the applied technique proved to be practicable and reliable. The advantages of precise planning became obvious. Results concerning alignment are inconsistent in the literature. Soft tissue balancing has only been included in the technique to a limited degree so far. PSI is still in an early stage of development and further development opportunities should be exploited before final assessment.