transferable tight-binding models: Topics by Science.gov

Sample records for transferable tight-binding models

Transferable tight-binding model for strained group IV and III-V materials and heterostructures

NASA Astrophysics Data System (ADS)

Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2016-07-01

It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.
Transferable tight binding model for strained group IV and III-V heterostructures

NASA Astrophysics Data System (ADS)

Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.
Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.
Density functional tight-binding and infrequent metadynamics can capture entropic effects in intramolecular hydrogen transfer reactions

NASA Astrophysics Data System (ADS)

Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim

2018-04-01

Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).
Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

NASA Astrophysics Data System (ADS)

Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

2013-07-01

We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.
Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

NASA Astrophysics Data System (ADS)

Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

2018-06-01

A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.
An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.
Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

NASA Astrophysics Data System (ADS)

Lei, Jie

2011-03-01

In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.
Proton transfer along water bridges in biological systems with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Reiss, Krystle; Wise, Abigail; Mazzuca, James

2015-03-01

When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.
An Innovative Sensing Approach Using Carbon Nanotube-Based Composites for Structural Health Monitoring of Concrete Structures

NASA Astrophysics Data System (ADS)

Dwivedi, Vatsal

This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.
Structure and Mechanism of Styrene Monooxygenase Reductase: New Insight into the FAD–Transfer Reaction†

PubMed Central

Morrison, Eliot; Kantz, Auric; Gassner, George T.; Sazinsky, Matthew H.

2013-01-01

The two–component flavoprotein styrene monooxygenase (SMO) from Pseudomonas putida S12 catalyzes the NADH– and FAD–dependent epoxidation of styrene to styrene oxide. In this study we investigate the mechanism of flavin reduction and transfer from the reductase (SMOB) to epoxidase (NSMOA) component and report our findings in light of the 2.2–Å crystal structure of SMOB. Upon rapidly mixing with NADH, SMOB forms an NADH→FADox charge–transfer intermediate and catalyzes a hydride–transfer reaction from NADH to FAD, with a rate constant of 49.1 ± 1.4 s−1, in a step that is coupled to the rapid dissociation of NAD+. Electrochemical and equilibrium–binding studies indicate that NSMOA binds FADhq ~13–times more tightly than SMOB, which supports a vectoral transfer of FADhq from the reductase to the epoxidase. After binding to NSMOA, FADhq rapidly reacts with molecular oxygen to form a stable C(4a)–hydroperoxide intermediate. The half–life of apoSMOB generated in the FAD–transfer reaction is increased ~21–fold, supporting the model of a protein–protein interaction between apoSMOB and NSMOA with the peroxide intermediate. The mechanisms of FAD–dissociation and transport from SMOB to NSMOA were probed by monitoring the competitive reduction of cytochrome c in the presence and absence of pyridine nucleotides. Based on these studies, we propose a model in which reduced FAD binds to SMOB in equilibrium between an unreactive, sequestered state (S–state) and more reactive, transfer state (T–state). Dissociation of NAD+ after the hydride transfer–reaction transiently populates the T–state, promoting the transfer of FADhq to NSMOA. The binding of pyridine nucleotides to SMOB–FADhq shifts the FADhq–binding equilibrium from the T–state to the S–state. Additionally, the 2.2–Å crystal structure of SMOB–FADox reported in this work is discussed in light of the pyridine nucleotide–gated flavin–transfer and electron–transfer reactions. PMID:23909369
Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE PAGES

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

2016-09-09

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less
Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less
Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

PubMed

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

2016-10-11

In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.
Dielectric response of molecules in empirical tight-binding theory

NASA Astrophysics Data System (ADS)

Boykin, Timothy B.; Vogl, P.

2002-01-01

In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.
DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

NASA Astrophysics Data System (ADS)

Humeniuk, Alexander; Mitrić, Roland

2017-12-01

A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.
Energy transfer between two vacuum-gapped metal plates: Coulomb fluctuations and electron tunneling

NASA Astrophysics Data System (ADS)

Zhang, Zu-Quan; Lü, Jing-Tao; Wang, Jian-Sheng

2018-05-01

Recent experimental measurements for near-field radiative heat transfer between two bodies have been able to approach the gap distance within 2 nm , where the contributions of Coulomb fluctuation and electron tunneling are comparable. Using the nonequilibrium Green's function method in the G0W0 approximation, based on a tight-binding model, we obtain for the energy current a Caroli formula from the Meir-Wingreen formula in the local equilibrium approximation. Also, the Caroli formula is consistent with the evanescent part of the heat transfer from the theory of fluctuational electrodynamics. We go beyond the local equilibrium approximation to study the energy transfer in the crossover region from electron tunneling to Coulomb fluctuation based on a numerical calculation.
Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less
Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE PAGES

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

2017-10-17

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less
Model construction and superconductivity analysis of organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta) based on first-principles band calculation

NASA Astrophysics Data System (ADS)

Aizawa, H.; Kuroki, K.; Yasuzuka, S.; Yamada, J.

2012-11-01

We perform a first-principles band calculation for a group of quasi-two-dimensional organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta). The ab-initio calculation shows that the density of states is correlated with the bandwidth of the singly occupied (highest) molecular orbital, while it is not necessarily correlated with the unit-cell volume. The direction of the major axis of the cross section of the Fermi surface lies in the Γ-B-direction, which differs from that obtained by the extended Hückel calculation. Then, we construct a tight-binding model which accurately reproduces the ab-initio band structure. The obtained transfer energies give a smaller dimerization than in the extended Hückel band. As to the difference in the anisotropy of the Fermi surface, the transfer energies along the inter-stacking direction are smaller than those obtained in the extended Hückel calculation. Assuming spin-fluctuation-mediated superconductivity, we apply random phase approximation to a two-band Hubbard model. This two-band Hubbard model is composed of the tight-binding model derived from the first-principles band structure and an on-site (intra-molecule) repulsive interaction taken as a variable parameter. The obtained superconducting gap changes sign four times along the Fermi surface like in a d-wave gap, and the nodal direction is different from that obtained in the extended Hückel model. Anion dependence of Tc is qualitatively consistent with the experimental observation.

Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

NASA Astrophysics Data System (ADS)

Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2015-08-01

Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.
Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

PubMed

Glover, N R; Tracey, A S

1999-04-20

The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.
Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.
Schematic baryon models, their tight binding description and their microwave realization

NASA Astrophysics Data System (ADS)

Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-12-01

A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.
Electrical control of spin dynamics in finite one-dimensional systems

NASA Astrophysics Data System (ADS)

Pertsova, A.; Stamenova, M.; Sanvito, S.

2011-10-01

We investigate the possibility of the electrical control of spin transfer in monoatomic chains incorporating spin impurities. Our theoretical framework is the mixed quantum-classical (Ehrenfest) description of the spin dynamics, in the spirit of the s-d model, where the itinerant electrons are described by a tight-binding model while localized spins are treated classically. Our main focus is on the dynamical exchange interaction between two well-separated spins. This can be quantified by the transfer of excitations in the form of transverse spin oscillations. We systematically study the effect of an electrostatic gate bias Vg on the interconnecting channel and we map out the long-range dynamical spin transfer as a function of Vg. We identify regions of Vg giving rise to significant amplification of the spin transmission at low frequencies and relate this to the electronic structure of the channel.
A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.
Mobile spin impurity in an optical lattice

NASA Astrophysics Data System (ADS)

Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

2017-07-01

We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.
Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

NASA Astrophysics Data System (ADS)

Zhang, Shu-Hui; Yang, Wen

2018-01-01

We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.
Tight-Binding study of Boron structures

NASA Astrophysics Data System (ADS)

McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.

2014-10-01

We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.
Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

PubMed

Nagata, Yuki

2010-02-01

A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.
Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

PubMed

Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

2017-02-06

The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.
Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

NASA Astrophysics Data System (ADS)

Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

2018-02-01

A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.
Modeling electron transfer in photosystem I.

PubMed

Makita, Hiroki; Hastings, Gary

2016-06-01

Nanosecond to millisecond time-resolved absorption spectroscopy has been used to study electron transfer processes in photosystem I particles from Synechocystis sp. PCC 6803 with eight different quinones incorporated into the A1 binding site, at both 298 and 77K. A detailed kinetic model was constructed and solved within the context of Marcus electron transfer theory, and it was found that all of the data could be well described only if the in situ midpoint potentials of the quinones fell in a tightly defined range. For photosystem I with phylloquinone incorporated into the A1 binding site all of the time-resolved optical data is best modeled when the in situ midpoint potential of phylloquinone on the A/B branch is -635/-690 mV, respectively. With the midpoint potential of the F(X) iron sulfur cluster set at -680 mV, this indicates that forward electron transfer from A(1)(-) to F(X) is slightly endergonic/exergonic on the A/B branch, respectively. Additionally, for forward electron transfer from A(1)(-) to F(X), on both the A and B branches the reorganization energy is close to 0.7 eV. Reorganization energies of 0.4 or 1.0 eV are not possible. For the eight different quinones incorporated, the same kinetic model was used, allowing us to establish in situ redox potentials for all of the incorporated quinones on both branches. A linear correlation was found between the in situ and in vitro midpoint potentials of the quinones on both branches. Copyright © 2016 Elsevier B.V. All rights reserved.
Interfacial spin-filter assisted spin transfer torque effect in Co/BeO/Co magnetic tunnel junction

NASA Astrophysics Data System (ADS)

Tang, Y.-H.; Chu, F.-C.

2015-03-01

The first-principles calculation is employed to demonstrate the spin-selective transport properties and the non-collinear spin-transfer torque (STT) effect in the newly proposed Co/BeO/Co magnetic tunnel junction. The subtle spin-polarized charge transfer solely at O/Co interface gives rise to the interfacial spin-filter (ISF) effect, which can be simulated within the tight binding model to verify the general expression of STT. This allows us to predict the asymmetric bias behavior of non-collinear STT directly via the interplay between the first-principles calculated spin current densities in collinear magnetic configurations. We believe that the ISF effect, introduced by the combination between wurtzite-BeO barrier and the fcc-Co electrode, may open a new and promising route in semiconductor-based spintronics applications.
Tight-binding calculation of single-band and generalized Wannier functions of graphene

NASA Astrophysics Data System (ADS)

Ribeiro, Allan Victor; Bruno-Alfonso, Alexys

Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.
The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants

PubMed Central

Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba

2003-01-01

The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506
Edge currents in frustrated Josephson junction ladders

NASA Astrophysics Data System (ADS)

Marques, A. M.; Santos, F. D. R.; Dias, R. G.

2016-09-01

We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.
Accurate modeling of defects in graphene transport calculations

NASA Astrophysics Data System (ADS)

Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

2018-01-01

We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.
Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters

DTIC Science & Technology

2016-06-01

simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the
Interface Schottky barrier engineering via strain in metal-semiconductor composites

NASA Astrophysics Data System (ADS)

Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

2016-01-01

The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

NASA Astrophysics Data System (ADS)

Panda, Saswati; Sahoo, D. D.; Rout, G. C.

2018-04-01

We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.
Angular dependence of spin-orbit spin-transfer torques

NASA Astrophysics Data System (ADS)

Lee, Ki-Seung; Go, Dongwook; Manchon, Aurélien; Haney, Paul M.; Stiles, M. D.; Lee, Hyun-Woo; Lee, Kyung-Jin

2015-04-01

In ferromagnet/heavy-metal bilayers, an in-plane current gives rise to spin-orbit spin-transfer torque, which is usually decomposed into fieldlike and dampinglike torques. For two-dimensional free-electron and tight-binding models with Rashba spin-orbit coupling, the fieldlike torque acquires nontrivial dependence on the magnetization direction when the Rashba spin-orbit coupling becomes comparable to the exchange interaction. This nontrivial angular dependence of the fieldlike torque is related to the Fermi surface distortion, determined by the ratio of the Rashba spin-orbit coupling to the exchange interaction. On the other hand, the dampinglike torque acquires nontrivial angular dependence when the Rashba spin-orbit coupling is comparable to or stronger than the exchange interaction. It is related to the combined effects of the Fermi surface distortion and the Fermi sea contribution. The angular dependence is consistent with experimental observations and can be important to understand magnetization dynamics induced by spin-orbit spin-transfer torques.
Electric field control of spin transfer torque in multiferroic tunnel junctions

NASA Astrophysics Data System (ADS)

Useinov, Artur; Kalitsov, Alan; Velev, Julian; Kioussis, Nicholas

2014-03-01

Based on model calculations we predict that the spin transfer torque (STT) in magnetic tunnel junctions with ferroelectric barriers can be strongly influenced by the saturated polarization of the barrier. The STT in such multiferroic tunnel junctions is calculated within the non-equilibrium Keldysh formalism generalized for non-collinear transport and implemented in the framework of a single-band tight-binding (TB) model. We calculate the bias dependence of both the in-plane (T∥) and out-of-plane (T⊥) components of STT as a function of the ferroelectric polarization (P) in the barrier. We find that the components of STT strongly depend on both the magnitude and the direction of the polarization. In particular switching of the polarization direction can dramatically alter the value of the STT and can even lead to a change of sign of T∥ and the voltage-induced part of T⊥. The effect is proportional to the magnitude of the polarization.
Near transferable phenomenological n-body potentials for noble metals

NASA Astrophysics Data System (ADS)

Pontikis, Vassilis; Baldinozzi, Gianguido; Luneville, Laurence; Simeone, David

2017-09-01

We present a semi-empirical model of cohesion in noble metals with suitable parameters reproducing a selected set of experimental properties of perfect and defective lattices in noble metals. It consists of two short-range, n-body terms accounting respectively for attractive and repulsive interactions, the former deriving from the second moment approximation of the tight-binding scheme and the latter from the gas approximation of the kinetic energy of electrons. The stability of the face centred cubic versus the hexagonal compact stacking is obtained via a long-range, pairwise function of customary use with ionic pseudo-potentials. Lattice dynamics, molecular statics, molecular dynamics and nudged elastic band calculations show that, unlike previous potentials, this cohesion model reproduces and predicts quite accurately thermodynamic properties in noble metals. In particular, computed surface energies, largely underestimated by existing empirical cohesion models, compare favourably with measured values, whereas predicted unstable stacking-fault energy profiles fit almost perfectly ab initio evaluations from the literature. All together the results suggest that this semi-empirical model is nearly transferable.
Near transferable phenomenological n-body potentials for noble metals.

PubMed

Pontikis, Vassilis; Baldinozzi, Gianguido; Luneville, Laurence; Simeone, David

2017-09-06

We present a semi-empirical model of cohesion in noble metals with suitable parameters reproducing a selected set of experimental properties of perfect and defective lattices in noble metals. It consists of two short-range, n-body terms accounting respectively for attractive and repulsive interactions, the former deriving from the second moment approximation of the tight-binding scheme and the latter from the gas approximation of the kinetic energy of electrons. The stability of the face centred cubic versus the hexagonal compact stacking is obtained via a long-range, pairwise function of customary use with ionic pseudo-potentials. Lattice dynamics, molecular statics, molecular dynamics and nudged elastic band calculations show that, unlike previous potentials, this cohesion model reproduces and predicts quite accurately thermodynamic properties in noble metals. In particular, computed surface energies, largely underestimated by existing empirical cohesion models, compare favourably with measured values, whereas predicted unstable stacking-fault energy profiles fit almost perfectly ab initio evaluations from the literature. All together the results suggest that this semi-empirical model is nearly transferable.
Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Theory of nanotube faraday cage

NASA Astrophysics Data System (ADS)

Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.

2003-03-01

Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.
Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

PubMed

Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

2017-12-01

Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.
Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

NASA Astrophysics Data System (ADS)

Shen, Ka

2018-04-01

We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.
Conductance of single microRNAs chains related to the autism spectrum disorder

NASA Astrophysics Data System (ADS)

Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

2014-09-01

The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.
Design of graphene nanoparticle undergoing axial compression: quantum study

NASA Astrophysics Data System (ADS)

Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

2011-03-01

We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.
Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

NASA Astrophysics Data System (ADS)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.
The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

NASA Astrophysics Data System (ADS)

Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

2017-05-01

We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.
Tight-binding model for borophene and borophane

NASA Astrophysics Data System (ADS)

Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.

2018-03-01

Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.
Long-range correction for tight-binding TD-DFT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

2015-10-07

We present two improvements to the tight-binding approximation of time-dependent density functional theory (TD-DFTB): First, we add an exact Hartree-Fock exchange term, which is switched on at large distances, to the ground state Hamiltonian and similarly to the coupling matrix that enters the linear response equations for the calculation of excited electronic states. We show that the excitation energies of charge transfer states are improved relative to the standard approach without the long-range correction by testing the method on a set of molecules from the database in Peach et al. [J. Chem. Phys. 128, 044118 (2008)] which are known tomore » exhibit problematic charge transfer states. The degree of spatial overlap between occupied and virtual orbitals indicates where TD-DFTB and long-range corrected TD-DFTB (lc-TD-DFTB) can be expected to produce large errors. Second, we improve the calculation of oscillator strengths. The transition dipoles are obtained from Slater Koster files for the dipole matrix elements between valence orbitals. In particular, excitations localized on a single atom, which appear dark when using Mulliken transition charges, acquire a more realistic oscillator strength in this way. These extensions pave the way for using lc-TD-DFTB to describe the electronic structure of large chromophoric polymers, where uncorrected TD-DFTB fails to describe the high degree of conjugation and produces spurious low-lying charge transfer states.« less
Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies

NASA Astrophysics Data System (ADS)

Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

2017-03-01

An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift ( 10 nm) and smaller Stokes' shift ( 5980 cm- 1) in BSA than HSA (Stokes'shift 6600 cm- 1), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (Ka 5.2 × 106 M- 1) than the DMOBA-HSA complex (Ka 1.0 × 106 M- 1). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5 Å) than HSA (25.4 Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (- 2.09 kcal/mol) compared to BSA (- 0.47 kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA.
Extended synaptotagmins are Ca2+-dependent lipid transfer proteins at membrane contact sites.

PubMed

Yu, Haijia; Liu, Yinghui; Gulbranson, Daniel R; Paine, Alex; Rathore, Shailendra S; Shen, Jingshi

2016-04-19

Organelles are in constant communication with each other through exchange of proteins (mediated by trafficking vesicles) and lipids [mediated by both trafficking vesicles and lipid transfer proteins (LTPs)]. It has long been known that vesicle trafficking can be tightly regulated by the second messenger Ca(2+), allowing membrane protein transport to be adjusted according to physiological demands. However, it remains unclear whether LTP-mediated lipid transport can also be regulated by Ca(2+) In this work, we show that extended synaptotagmins (E-Syts), poorly understood membrane proteins at endoplasmic reticulum-plasma membrane contact sites, are Ca(2+)-dependent LTPs. Using both recombinant and endogenous mammalian proteins, we discovered that E-Syts transfer glycerophospholipids between membrane bilayers in the presence of Ca(2+) E-Syts use their lipid-accommodating synaptotagmin-like mitochondrial lipid binding protein (SMP) domains to transfer lipids. However, the SMP domains themselves cannot transport lipids unless the two membranes are tightly tethered by Ca(2+)-bound C2 domains. Strikingly, the Ca(2+)-regulated lipid transfer activity of E-Syts was fully recapitulated when the SMP domain was fused to the cytosolic domain of synaptotagmin-1, the Ca(2+)sensor in synaptic vesicle fusion, indicating that a common mechanism of membrane tethering governs the Ca(2+)regulation of lipid transfer and vesicle fusion. Finally, we showed that microsomal vesicles isolated from mammalian cells contained robust Ca(2+)-dependent lipid transfer activities, which were mediated by E-Syts. These findings established E-Syts as a novel class of LTPs and showed that LTP-mediated lipid trafficking, like vesicular transport, can be subject to tight Ca(2+)regulation.
Spin Transfer torques in Antiferromagnets

NASA Astrophysics Data System (ADS)

Saidaoui, Hamed; Waintal, Xavier; Manchon, Aurelien; Spsms, Cea, Grenoble France Collaboration

2013-03-01

Spin Transfer Torque (STT) has attracted tremendously growing interest in the past two decades. Consisting on the transfer of spin angular momentum of a spin polarized current to local magnetic moments, the STT gives rise to a complex dynamics of the magnetization. Depending on the the structure, the STT shows a dominated In plane component for spin valves, whereas both components coexist for magnetic tunneling junctions (MTJ). For latter case the symmetry of the structure is considered to be decisive in identifying the nature and behavior of the torque. In the present study we are interested in magnetic structures where we substitute either one or both of the magnetic layers by antiferromagnets (AF). We use Non-equilibrium Green's function formalism applied on a tight-binding model to investigate the nature of the spin torque. We notice the presence of two types of torque exerted on (AF), a torque which tends to rotate the order parameter and another one that competes with the exchange interaction. We conclude by comparison with previous works.
A Model for Predicting Thermoelectric Properties of Bi2Te3

NASA Technical Reports Server (NTRS)

Lee, Seungwon; VonAllmen, Paul

2009-01-01

A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

NASA Astrophysics Data System (ADS)

Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

2018-04-01

Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.
Dynamics of Polarons in Organic Conjugated Polymers with Side Radicals.

PubMed

Liu, J J; Wei, Z J; Zhang, Y L; Meng, Y; Di, B

2017-03-16

Based on the one-dimensional tight-binding Su-Schrieffer-Heeger (SSH) model, and using the molecular dynamics method, we discuss the dynamics of electron and hole polarons propagating along a polymer chain, as a function of the distance between side radicals and the magnitude of the transfer integrals between the main chain and the side radicals. We first discuss the average velocities of electron and hole polarons as a function of the distance between side radicals. It is found that the average velocities of the electron polarons remain almost unchanged, while the average velocities of hole polarons decrease significantly when the radical distance is comparable to the polaron width. Second, we have found that the average velocities of electron polarons decrease with increasing transfer integral, but the average velocities of hole polarons increase. These results may provide a theoretical basis for understanding carriers transport properties in polymers chain with side radicals.
Quantum recurrence and fractional dynamic localization in ac-driven perfect state transfer Hamiltonians

DOE Office of Scientific and Technical Information (OSTI.GOV)

Longhi, Stefano, E-mail: stefano.longhi@fisi.polimi.it

Quantum recurrence and dynamic localization are investigated in a class of ac-driven tight-binding Hamiltonians, the Krawtchouk quantum chain, which in the undriven case provides a paradigmatic Hamiltonian model that realizes perfect quantum state transfer and mirror inversion. The equivalence between the ac-driven single-particle Krawtchouk Hamiltonian H{sup -hat} (t) and the non-interacting ac-driven bosonic junction Hamiltonian enables to determine in a closed form the quasi energy spectrum of H{sup -hat} (t) and the conditions for exact wave packet reconstruction (dynamic localization). In particular, we show that quantum recurrence, which is predicted by the general quantum recurrence theorem, is exact for themore » Krawtchouk quantum chain in a dense range of the driving amplitude. Exact quantum recurrence provides perfect wave packet reconstruction at a frequency which is fractional than the driving frequency, a phenomenon that can be referred to as fractional dynamic localization.« less
Interplay between the spin transfer and spin orbit torques on domain walls at the 5d/3d-alloy interfaces

NASA Astrophysics Data System (ADS)

Kalitsov, Alan; Okatov, Sergey; Zarzhitsky, Pavel; Chshiev, Mairbek; Velev, Julian; Butler, William; Mryasov, Oleg

2014-03-01

The manipulations of domain wall (DW) in thin ferromagnetic layers by current and the spin-orbit coupling (SOC) have attracted significant interest. We report two band model calculations of the spin torque (ST) and the spin current (SC) at 5d/3d interfaces with head-to-head, Bloch and Neel DWs. These calculations are based on the non-equilibrium Green Function formalism and the tight binding Hamiltonian including the s-d exchange interactions and the Rashba SOC parameterized on the basis of ab-initio calculations for Fe/W, FeCo/Ta and Co/Pt interfaces. We find that SOC significantly modifies the ST and violates relations between the spin transfer torque and the divergence of the spin current. This work was supported in part by a Semiconductor Research Corporation program, sponsored by MARCO and DARPA.
Nucleic acid reactivity: challenges for next-generation semiempirical quantum models.

PubMed

Huang, Ming; Giese, Timothy J; York, Darrin M

2015-07-05

Semiempirical quantum models are routinely used to study mechanisms of RNA catalysis and phosphoryl transfer reactions using combined quantum mechanical (QM)/molecular mechanical methods. Herein, we provide a broad assessment of the performance of existing semiempirical quantum models to describe nucleic acid structure and reactivity to quantify their limitations and guide the development of next-generation quantum models with improved accuracy. Neglect of diatomic differential overlap and self-consistent density-functional tight-binding semiempirical models are evaluated against high-level QM benchmark calculations for seven biologically important datasets. The datasets include: proton affinities, polarizabilities, nucleobase dimer interactions, dimethyl phosphate anion, nucleoside sugar and glycosidic torsion conformations, and RNA phosphoryl transfer model reactions. As an additional baseline, comparisons are made with several commonly used density-functional models, including M062X and B3LYP (in some cases with dispersion corrections). The results show that, among the semiempirical models examined, the AM1/d-PhoT model is the most robust at predicting proton affinities. AM1/d-PhoT and DFTB3-3ob/OPhyd reproduce the MP2 potential energy surfaces of 6 associative RNA phosphoryl transfer model reactions reasonably well. Further, a recently developed linear-scaling "modified divide-and-conquer" model exhibits the most accurate results for binding energies of both hydrogen bonded and stacked nucleobase dimers. The semiempirical models considered here are shown to underestimate the isotropic polarizabilities of neutral molecules by approximately 30%. The semiempirical models also fail to adequately describe torsion profiles for the dimethyl phosphate anion, the nucleoside sugar ring puckers, and the rotations about the nucleoside glycosidic bond. The modeling of pentavalent phosphorus, particularly with thio substitutions often used experimentally as mechanistic probes, was problematic for all of the models considered. Analysis of the strengths and weakness of the models suggests that the creation of robust next-generation models should emphasize the improvement of relative conformational energies and barriers, and nonbonded interactions. © 2015 Wiley Periodicals, Inc.
Nucleic acid reactivity : challenges for next-generation semiempirical quantum models

PubMed Central

Huang, Ming; Giese, Timothy J.; York, Darrin M.

2016-01-01

Semiempirical quantum models are routinely used to study mechanisms of RNA catalysis and phosphoryl transfer reactions using combined quantum mechanical/molecular mechanical methods. Herein, we provide a broad assessment of the performance of existing semiempirical quantum models to describe nucleic acid structure and reactivity in order to quantify their limitations and guide the development of next-generation quantum models with improved accuracy. Neglect of diatomic diffierential overlap (NDDO) and self-consistent density-functional tight-binding (SCC-DFTB) semiempirical models are evaluated against high-level quantum mechanical benchmark calculations for seven biologically important data sets. The data sets include: proton affinities, polarizabilities, nucleobase dimer interactions, dimethyl phosphate anion, nucleoside sugar and glycosidic torsion conformations, and RNA phosphoryl transfer model reactions. As an additional baseline, comparisons are made with several commonly used density-functional models, including M062X and B3LYP (in some cases with dispersion corrections). The results show that, among the semiempirical models examined, the AM1/d-PhoT model is the most robust at predicting proton affinities. AM1/d-PhoT and DFTB3-3ob/OPhyd reproduce the MP2 potential energy surfaces of 6 associative RNA phosphoryl transfer model reactions reasonably well. Further, a recently developed linear-scaling “modified divide-and-conquer” model exhibits the most accurate results for binding energies of both hydrogen bonded and stacked nucleobase dimers. The semiempirical models considered here are shown to underestimate the isotropic polarizabilities of neutral molecules by approximately 30%. The semiempirical models also fail to adequately describe torsion profiles within the dimethyl phosphate anion, the nucleoside sugar ring puckers, and the rotations about the nucleoside glycosidic bond. The modeling of pentavalent phosphorus, particularly with thio substitutions often used experimentally as mechanistic probes, was problematic for all of the models considered. Analysis of the strengths and weakness of the models suggest that the creation of robust next-generation models should emphasize the improvement of relative conformational energies and barriers, and nonbond interactions. PMID:25943338
Analytic expression for the giant fieldlike spin torque in spin-filter magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Tang, Y.-H.; Huang, Z.-W.; Huang, B.-H.

2017-08-01

We propose analytic expressions for fieldlike, T⊥, and spin-transfer, T∥, spin torque components in the spin-filter-based magnetic tunnel junction (SFMTJ), by using the single-band tight-binding model with the nonequilibrium Keldysh formalism. In consideration of multireflection processes between noncollinear magnetization of the spin-filter (SF) barrier and the ferromagnetic (FM) electrode, the central spin-selective SF barrier plays an active role in the striking discovery T⊥≫T∥ , which can be further identified by the unusual barrier thickness dependence of giant T⊥. Our general expressions reveal the sinusoidal angular dependence of both spin torque components, even in the presence of the SF barrier.
Spin and charge transport across cobalt/graphene interfaces

NASA Astrophysics Data System (ADS)

Chshiev, Mairbek; Kalitsov, Alan; Mryasov, Oleg

We report ballistic calculations of in-plane and out-of-plane spin and charge transport through graphene attached to the hcp-Co electrodes. Our calculations are based on the Keldysh non-equilibrium Green Function formalism and the tight binding Hamiltonian model tailored to treat both lateral and vertical device configurations. We present results for (i) vertical device that consists of a one-side fluorinated C4F graphene sandwiched between two hcp Co electrodes and (ii) lateral device consisting of pristine graphene/C4F graphene bilayer with two top hcp-Co electrodes Our calculations predict large magnetoresistance with small resistance-area product and significant deviation from sinusoidal behavior of spin transfer torque for the vertical device configuration.
Tight-binding modeling and low-energy behavior of the semi-Dirac point.

PubMed

Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

2009-07-03

We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.
Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

NASA Astrophysics Data System (ADS)

Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

2018-04-01

We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.
The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.
The tightly bound nuclei in the liquid drop model

NASA Astrophysics Data System (ADS)

Sree Harsha, N. R.

2018-05-01

In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.
Pseudo-magnetic fields of strongly-curved graphene nanobubbles

NASA Astrophysics Data System (ADS)

Liu, Li-Chi

2018-04-01

We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.
Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

PubMed

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.
Dpb11 may function with RPA and DNA to initiate DNA replication.

PubMed

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.
Monitoring glycolipid transfer protein activity and membrane interaction with the surface plasmon resonance technique.

PubMed

Ohvo-Rekilä, Henna; Mattjus, Peter

2011-01-01

The glycolipid transfer protein (GLTP) is a protein capable of binding and transferring glycolipids. GLTP is cytosolic and it can interact through its FFAT-like (two phenylalanines in an acidic tract) motif with proteins localized on the surface of the endoplasmic reticulum. Previous in vitro work with GLTP has focused mainly on the complete transfer reaction of the protein, that is, binding and subsequent removal of the glycolipid from the donor membrane, transfer through the aqueous environment, and the final release of the glycolipid to an acceptor membrane. Using bilayer vesicles and surface plasmon resonance spectroscopy, we have now, for the first time, analyzed the binding and lipid removal capacity of GLTP with a completely label-free technique. This technique is focused on the initial steps in GLTP-mediated transfer and the parameters affecting these steps can be more precisely determined. We used the new approach for detailed structure-function studies of GLTP by examining the glycolipid transfer capacity of specific GLTP tryptophan mutants. Tryptophan 96 is crucial for the transfer activity of the protein and tryptophan 142 is an important part of the proteins membrane interacting domain. Further, we varied the composition of the used lipid vesicles and gained information on the effect of membrane properties on GLTP activity. GLTP prefers to interact with more tightly packed membranes, although GLTP-mediated transfer is faster from more fluid membranes. This technique is very useful for the study of membrane-protein interactions and lipid-transfer rates and it can easily be adapted to other membrane-interacting proteins. Copyright © 2010 Elsevier B.V. All rights reserved.
Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

PubMed Central

Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

2012-01-01

Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769
Improving Density Functional Tight Binding Predictions of Free Energy Surfaces for Slow Chemical Reactions in Solution

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew; Goldman, Nir

2017-06-01

First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for reactions that are fast relative to DFT simulation times (<10 ps), but the effects on slow reactions and the free energy surface are not well-known. We present a force matching approach to improve the chemical accuracy of DFTB. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Improving density functional tight binding predictions of free energy surfaces for peptide condensation reactions in solution

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew; Goldman, Nir

First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for chemistry that is fast relative to DFT simulation times (<10 ps), but the effects on slow chemistry and the free energy surface are not well-known. We present a force matching approach to increase the accuracy of DFTB predictions for free energy surfaces. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials without a priori knowledge of transition states. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT results for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Dpb11 may function with RPA and DNA to initiate DNA replication

PubMed Central

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies.

PubMed

Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

2017-03-15

An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift (~10nm) and smaller Stokes' shift (~5980cm -1 ) in BSA than HSA (Stokes'shift~6600cm -1 ), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (K a ~5.2×10 6 M -1 ) than the DMOBA-HSA complex (K a ~1.0×10 6 M -1 ). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5Å) than HSA (25.4Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (-2.09kcal/mol) compared to BSA (-0.47kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA. Copyright © 2016 Elsevier B.V. All rights reserved.
Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

NASA Astrophysics Data System (ADS)

Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

2018-01-01

The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.
Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

PubMed

Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

2014-07-28

A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.
Real-Time Quantum Dynamics of Long-Range Electronic Excitation Transfer in Plasmonic Nanoantennas.

PubMed

Ilawe, Niranjan V; Oviedo, M Belén; Wong, Bryan M

2017-08-08

Using large-scale, real-time, quantum dynamics calculations, we present a detailed analysis of electronic excitation transfer (EET) mechanisms in a multiparticle plasmonic nanoantenna system. Specifically, we utilize real-time, time-dependent, density functional tight binding (RT-TDDFTB) to provide a quantum-mechanical description (at an electronic/atomistic level of detail) for characterizing and analyzing these systems, without recourse to classical approximations. We also demonstrate highly long-range electronic couplings in these complex systems and find that the range of these couplings is more than twice the conventional cutoff limit considered by Förster resonance energy transfer (FRET)-based approaches. Furthermore, we attribute these unusually long-ranged electronic couplings to the coherent oscillations of conduction electrons in plasmonic nanoparticles. This long-range nature of plasmonic interactions has important ramifications for EET; in particular, we show that the commonly used "nearest-neighbor" FRET model is inadequate for accurately characterizing EET even in simple plasmonic antenna systems. These findings provide a real-time, quantum-mechanical perspective for understanding EET mechanisms and provide guidance in enhancing plasmonic properties in artificial light-harvesting systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less
Tight binding simulation study on zigzag single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

2018-01-01

Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.
Spin-transfer torque in spin filter tunnel junctions

NASA Astrophysics Data System (ADS)

Ortiz Pauyac, Christian; Kalitsov, Alan; Manchon, Aurelien; Chshiev, Mairbek

2014-12-01

Spin-transfer torque in a class of magnetic tunnel junctions with noncollinear magnetizations, referred to as spin filter tunnel junctions, is studied within the tight-binding model using the nonequilibrium Green's function technique within Keldysh formalism. These junctions consist of one ferromagnet (FM) adjacent to a magnetic insulator (MI) or two FM separated by a MI. We find that the presence of the magnetic insulator dramatically enhances the magnitude of the spin-torque components compared to conventional magnetic tunnel junctions. The fieldlike torque is driven by the spin-dependent reflection at the MI/FM interface, which results in a small reduction of its amplitude when an insulating spacer (S) is inserted to decouple MI and FM layers. Meanwhile, the dampinglike torque is dominated by the tunneling electrons that experience the lowest barrier height. We propose a device of the form FM/(S)/MI/(S)/FM that takes advantage of these characteristics and allows for tuning the spin-torque magnitudes over a wide range just by rotation of the magnetization of the insulating layer.
Quantum Effects in Cation Interactions with First and Second Coordination Shell Ligands in Metalloproteins

PubMed Central

2015-01-01

Despite decades of investigations, the principal mechanisms responsible for the high affinity and specificity of proteins for key physiological cations K+, Na+, and Ca2+ remain a hotly debated topic. At the core of the debate is an apparent need (or lack thereof) for an accurate description of the electrostatic response of the charge distribution in a protein to the binding of an ion. These effects range from partial electronic polarization of the directly ligating atoms to long-range effects related to partial charge transfer and electronic delocalization effects. While accurate modeling of cation recognition by metalloproteins warrants the use of quantum-mechanics (QM) calculations, the most popular approximations used in major biomolecular simulation packages rely on the implicit modeling of electronic polarization effects. That is, high-level QM computations for ion binding to proteins are desirable, but they are often unfeasible, because of the large size of the reactive-site models and the need to sample conformational space exhaustively at finite temperature. Several solutions to this challenge have been proposed in the field, ranging from the recently developed Drude polarizable force-field for simulations of metalloproteins to approximate tight-binding density functional theory (DFTB). To delineate the usefulness of different approximations, we examined the accuracy of three recent and commonly used theoretical models and numerical algorithms, namely, CHARMM C36, the latest developed Drude polarizable force fields, and DFTB3 with the latest 3OB parameters. We performed MD simulations for 30 cation-selective proteins with high-resolution X-ray structures to create ensembles of structures for analysis with different levels of theory, e.g., additive and polarizable force fields, DFTB3, and DFT. The results from DFT computations were used to benchmark CHARMM C36, Drude, and DFTB3 performance. The explicit modeling of quantum effects unveils the key electrostatic properties of the protein sites and the importance of specific ion-protein interactions. One of the most interesting findings is that secondary coordination shells of proteins are noticeably perturbed in a cation-dependent manner, showing significant delocalization and long-range effects of charge transfer and polarization upon binding Ca2+. PMID:26574284
Realization of a mixed-symmetry superconducting gap in correlated organic metals

NASA Astrophysics Data System (ADS)

Altmeyer, Michaela; Guterding, Daniel; Jeschke, Harald O.; Diehl, Sandra; Methfessel, Torsten; Tutsch, Ulrich; Schubert, Harald; Lang, Michael; Müller, Jens; Huth, Michael; Jourdan, Martin; Elmers, Hans-Joachim; Valenti, Roser

Recent scanning tunneling spectroscopy measurements on the organic charge tranfer salt κ-(BEDT-TTF)2Cu[N(CN)2]Br show clear evidence of a highly anisotropic gap structure. Based on an ab initio derived model Hamiltonian we employ random phase approximation spin fluctuation theory yielding a composite order parameter of (extended) s+dx2-y2 symmetry. Taking explicitly also the shape of the Fermi surface into account we calculate STS spectra that are in excellent agreement to the experimental observations [1]. Moreover we determine the minimal tight binding model to describe the general lattice structure of these compounds accurately and generate a phase diagram for the gap symmetry by varying the hopping parameters. Based on ab initio derived parameter sets we predict the gap symmetry of other superconducting κ charge transfer salts. This work was supported by Deutsche Forschungsgemeinschaft under Grant No. SFB/TR 49.
Magnetic-flux-driven topological quantum phase transition and manipulation of perfect edge states in graphene tube.

PubMed

Lin, S; Zhang, G; Li, C; Song, Z

2016-08-24

We study the tight-binding model for a graphene tube with perimeter N threaded by a magnetic field. We show exactly that this model has different nontrivial topological phases as the flux changes. The winding number, as an indicator of topological quantum phase transition (QPT) fixes at N/3 if N/3 equals to its integer part [N/3], otherwise it jumps between [N/3] and [N/3] + 1 periodically as the flux varies a flux quantum. For an open tube with zigzag boundary condition, exact edge states are obtained. There exist two perfect midgap edge states, in which the particle is completely located at the boundary, even for a tube with finite length. The threading flux can be employed to control the quantum states: transferring the perfect edge state from one end to the other, or generating maximal entanglement between them.
Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure

NASA Astrophysics Data System (ADS)

Brockt, C.; Jeckelmann, E.

2017-02-01

We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.
Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

NASA Astrophysics Data System (ADS)

Ajiki, Hiroshi

2014-07-01

Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.
Gaussian polarizable-ion tight binding.

PubMed

Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

2016-10-14

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).
Gaussian polarizable-ion tight binding

NASA Astrophysics Data System (ADS)

Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

2016-10-01

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).
Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

PubMed

Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

2018-05-08

Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158
Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

NASA Astrophysics Data System (ADS)

Venkataraman, Vijay Shankar

The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.
Excitons in boron nitride single layer

NASA Astrophysics Data System (ADS)

Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

2016-09-01

Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.
III-Nitride, SiC and Diamond Materials for Electronic Devices. Symposium Held April 8-12 1996, San Francisco, California, U.S.A. Volume 423.

DTIC Science & Technology

1996-12-01

gallium, nitrogen and gallium nitride structures. Thus it can be shown to be transferable and efficient for predictive molecular -dynamic simulations on...potentials and forces for the molecular dynamics simulations are derived by means of a density-functional based nonorthogonal tight-binding (DF-TB) scheme...LDA). Molecular -dynamics simulations for determining the different reconstructions of the SiC surface use the slab method (two-dimensional periodic
Effects of Molecular Stresses on Energy Transfer Pathways in Opto- and Electro-Excited Conjugated Polymers for High-Efficiency Optoelectronic Devices

DTIC Science & Technology

2014-10-20

unless it hops, and lead to obstructed recombination for PL or charge separation for solar cells and the reduced quantum efficiencies of the...excitons (Fig. 1a and 1b). For the free-moving delocalized states of the Wannier-Mott excitons, the binding energy in silicon , for example, is around...typically encompass many unit cells and typically exist in materials of small bandgap and large dielectric constant. In converse, the the tightly

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Generalized virial theorem for massless electrons in graphene and other Dirac materials

NASA Astrophysics Data System (ADS)

Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

2016-05-01

The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.
Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

NASA Astrophysics Data System (ADS)

Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

2017-03-01

Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.
Modeling Magnetic Properties in EZTB

NASA Technical Reports Server (NTRS)

Lee, Seungwon; vonAllmen, Paul

2007-01-01

A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.
Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

NASA Astrophysics Data System (ADS)

Aizawa, Hirohito; Kuroki, Kazuhiko

2018-03-01

We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.
Formation of the black-hole binary M33 X-7 through mass exchange in a tight massive system.

PubMed

Valsecchi, Francesca; Glebbeek, Evert; Farr, Will M; Fragos, Tassos; Willems, Bart; Orosz, Jerome A; Liu, Jifeng; Kalogera, Vassiliki

2010-11-04

The X-ray source M33 X-7 in the nearby galaxy Messier 33 is among the most massive X-ray binary stellar systems known, hosting a rapidly spinning, 15.65M(⊙) black hole orbiting an underluminous, 70M(⊙) main-sequence companion in a slightly eccentric 3.45-day orbit (M(⊙), solar mass). Although post-main-sequence mass transfer explains the masses and tight orbit, it leaves unexplained the observed X-ray luminosity, the star's underluminosity, the black hole's spin and the orbital eccentricity. A common envelope phase, or rotational mixing, could explain the orbit, but the former would lead to a merger and the latter to an overluminous companion. A merger would also ensue if mass transfer to the black hole were invoked for its spin-up. Here we report simulations of evolutionary tracks which reveal that if M33 X-7 started as a primary body of 85M(⊙)-99M(⊙) and a secondary body of 28M(⊙)-32M(⊙), in a 2.8-3.1-d orbit, its observed properties can be consistently explained. In this model, the main-sequence primary transfers part of its envelope to the secondary and loses the rest in a wind; it ends its life as a ∼16M(⊙) helium star with an iron-nickel core that collapses to a black hole (with or without an accompanying supernova). The release of binding energy, and possibly collapse asymmetries, 'kick' the nascent black hole into an eccentric orbit. Wind accretion explains the X-ray luminosity, and the black-hole spin can be natal.
Tunnel Field-Effect Transistors in 2-D Transition Metal Dichalcogenide Materials

NASA Astrophysics Data System (ADS)

Ilatikhameneh, Hesameddin; Tan, Yaohua; Novakovic, Bozidar; Klimeck, Gerhard; Rahman, Rajib; Appenzeller, Joerg

2015-12-01

In this work, the performance of Tunnel Field-Effect Transistors (TFETs) based on two-dimensional Transition Metal Dichalcogenide (TMD) materials is investigated by atomistic quantum transport simulations. One of the major challenges of TFETs is their low ON-currents. 2D material based TFETs can have tight gate control and high electric fields at the tunnel junction, and can in principle generate high ON-currents along with a sub-threshold swing smaller than 60 mV/dec. Our simulations reveal that high performance TMD TFETs, not only require good gate control, but also rely on the choice of the right channel material with optimum band gap, effective mass and source/drain doping level. Unlike previous works, a full band atomistic tight binding method is used self-consistently with 3D Poisson equation to simulate ballistic quantum transport in these devices. The effect of the choice of TMD material on the performance of the device and its transfer characteristics are discussed. Moreover, the criteria for high ON-currents are explained with a simple analytic model, showing the related fundamental factors. Finally, the subthreshold swing and energy-delay of these TFETs are compared with conventional CMOS devices.
An impurity-induced gap system as a quantum data bus for quantum state transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Bing, E-mail: chenbingphys@gmail.com; Li, Yong; Song, Z.

2014-09-15

We introduce a tight-binding chain with a single impurity to act as a quantum data bus for perfect quantum state transfer. Our proposal is based on the weak coupling limit of the two outermost quantum dots to the data bus, which is a gapped system induced by the impurity. By connecting two quantum dots to two sites of the data bus, the system can accomplish a high-fidelity and long-distance quantum state transfer. Numerical simulations for finite system show that the numerical and analytical results of the effective coupling strength agree well with each other. Moreover, we study the robustness ofmore » this quantum communication protocol in the presence of disorder in the couplings between the nearest-neighbor quantum dots. We find that the gap of the system plays an important role in robust quantum state transfer.« less
FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression

NASA Astrophysics Data System (ADS)

Sha, Xianwei; Cohen, R. E.

2010-09-01

We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.
Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less
Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE PAGES

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...

2016-08-09

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less
Microwave emulations and tight-binding calculations of transport in polyacetylene

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.
The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

PubMed Central

Balda, Maria S.; Matter, Karl

2000-01-01

Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369
Spin diffusion and torques in disordered antiferromagnets

NASA Astrophysics Data System (ADS)

Manchon, Aurelien

2017-03-01

We have developed a drift-diffusion equation of spin transport in collinear bipartite metallic antiferromagnets. Starting from a model tight-binding Hamiltonian, we obtain the quantum kinetic equation within Keldysh formalism and expand it to the lowest order in spatial gradient using Wigner expansion method. In the diffusive limit, these equations track the spatio-temporal evolution of the spin accumulations and spin currents on each sublattice of the antiferromagnet. We use these equations to address the nature of the spin transfer torque in (i) a spin-valve composed of a ferromagnet and an antiferromagnet, (ii) a metallic bilayer consisting of an antiferromagnet adjacent to a heavy metal possessing spin Hall effect, and in (iii) a single antiferromagnet possessing spin Hall effect. We show that the latter can experience a self-torque thanks to the non-vanishing spin Hall effect in the antiferromagnet.
Development of tight-binding based GW algorithm and its computational implementation for graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less
Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

2010-01-01

Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less
In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

PubMed

Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

2013-01-15

Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.
Proton transfer pathways, energy landscape, and kinetics in creatine-water systems.

PubMed

Ivchenko, Olga; Whittleston, Chris S; Carr, Joanne M; Imhof, Petra; Goerke, Steffen; Bachert, Peter; Wales, David J

2014-02-27

We study the exchange processes of the metabolite creatine, which is present in both tumorous and normal tissues and has NH2 and NH groups that can transfer protons to water. Creatine produces chemical exchange saturation transfer (CEST) contrast in magnetic resonance imaging (MRI). The proton transfer pathway from zwitterionic creatine to water is examined using a kinetic transition network constructed from the discrete path sampling approach and an approximate quantum-chemical energy function, employing the self-consistent-charge density-functional tight-binding (SCC-DFTB) method. The resulting potential energy surface is visualized by constructing disconnectivity graphs. The energy landscape consists of two distinct regions corresponding to the zwitterionic creatine structures and deprotonated creatine. The activation energy that characterizes the proton transfer from the creatine NH2 group to water was determined from an Arrhenius fit of rate constants as a function of temperature, obtained from harmonic transition state theory. The result is in reasonable agreement with values obtained in water exchange spectroscopy (WEX) experiments.
Role of spin diffusion in current-induced domain wall motion for disordered ferromagnets

NASA Astrophysics Data System (ADS)

Akosa, Collins Ashu; Kim, Won-Seok; Bisig, André; Kläui, Mathias; Lee, Kyung-Jin; Manchon, Aurélien

2015-03-01

Current-induced spin transfer torque and magnetization dynamics in the presence of spin diffusion in disordered magnetic textures is studied theoretically. We demonstrate using tight-binding calculations that weak, spin-conserving impurity scattering dramatically enhances the nonadiabaticity. To further explore this mechanism, a phenomenological drift-diffusion model for incoherent spin transport is investigated. We show that incoherent spin diffusion indeed produces an additional spatially dependent torque of the form ˜∇2[m ×(u .∇ ) m ] +ξ ∇2[(u .∇ ) m ] , where m is the local magnetization direction, u is the direction of injected current, and ξ is a parameter characterizing the spin dynamics (precession, dephasing, and spin-flip). This torque, which scales as the inverse square of the domain wall width, only weakly enhances the longitudinal velocity of a transverse domain wall but significantly enhances the transverse velocity of vortex walls. The spatial-dependent spin transfer torque uncovered in this study is expected to have significant impact on the current-driven motion of abrupt two-dimensional textures such as vortices, skyrmions, and merons.
The mitochondrial Hsp70 chaperone Ssq1 facilitates Fe/S cluster transfer from Isu1 to Grx5 by complex formation.

PubMed

Uzarska, Marta A; Dutkiewicz, Rafal; Freibert, Sven-Andreas; Lill, Roland; Mühlenhoff, Ulrich

2013-06-01

The mitochondrial Hsp70 chaperone Ssq1 plays a dedicated role in the maturation of iron-sulfur (Fe/S) proteins, an essential process of mitochondria. Similar to its bacterial orthologue HscA, Ssq1 binds to the scaffold protein Isu1, thereby facilitating dissociation of the newly synthesized Fe/S cluster on Isu1 and its transfer to target apoproteins. Here we use in vivo and in vitro approaches to show that Ssq1 also interacts with the monothiol glutaredoxin 5 (Grx5) at a binding site different from that of Isu1. Grx5 binding does not stimulate the ATPase activity of Ssq1 and is most pronounced for the ADP-bound form of Ssq1, which interacts with Isu1 most tightly. The vicinity of Isu1 and Grx5 on the Hsp70 chaperone facilitates rapid Fe/S cluster transfer from Isu1 to Grx5. Grx5 and its bound Fe/S cluster are required for maturation of all cellular Fe/S proteins, regardless of the type of bound Fe/S cofactor and subcellular localization. Hence Grx5 functions as a late-acting component of the core Fe/S cluster (ISC) assembly machinery linking the Fe/S cluster synthesis reaction on Isu1 with late assembly steps involving Fe/S cluster targeting to dedicated apoproteins.

Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

NASA Astrophysics Data System (ADS)

Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

2018-07-01

A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.
An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

2014-03-01

The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.
Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

2016-10-15

Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.
Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

PubMed Central

Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

2001-01-01

The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695
Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desgranges, Caroline; Delhommelle, Jerome

We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less
HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

PubMed

Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

2016-10-28

Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Parameter-free driven Liouville-von Neumann approach for time-dependent electronic transport simulations in open quantum systems

DOE PAGES

Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei; ...

2017-03-02

A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less
Parameter-free driven Liouville-von Neumann approach for time-dependent electronic transport simulations in open quantum systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei

A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less
The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.

PubMed

Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L

2001-04-06

The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.
Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

NASA Astrophysics Data System (ADS)

Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

2018-02-01

We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.
Accelerating atomistic calculations of quantum energy eigenstates on graphic cards

NASA Astrophysics Data System (ADS)

Rodrigues, Walter; Pecchia, A.; Lopez, M.; Auf der Maur, M.; Di Carlo, A.

2014-10-01

Electronic properties of nanoscale materials require the calculation of eigenvalues and eigenvectors of large matrices. This bottleneck can be overcome by parallel computing techniques or the introduction of faster algorithms. In this paper we report a custom implementation of the Lanczos algorithm with simple restart, optimized for graphical processing units (GPUs). The whole algorithm has been developed using CUDA and runs entirely on the GPU, with a specialized implementation that spares memory and reduces at most machine-to-device data transfers. Furthermore parallel distribution over several GPUs has been attained using the standard message passing interface (MPI). Benchmark calculations performed on a GaN/AlGaN wurtzite quantum dot with up to 600,000 atoms are presented. The empirical tight-binding (ETB) model with an sp3d5s∗+spin-orbit parametrization has been used to build the system Hamiltonian (H).
Spin transfer torque in antiferromagnetic spin valves: From clean to disordered regimes

NASA Astrophysics Data System (ADS)

Saidaoui, Hamed Ben Mohamed; Manchon, Aurelien; Waintal, Xavier

2014-05-01

Current-driven spin torques in metallic spin valves composed of antiferromagnets are theoretically studied using the nonequilibrium Green's function method implemented on a tight-binding model. We focus our attention on G-type and L-type antiferromagnets in both clean and disordered regimes. In such structures, spin torques can either rotate the magnetic order parameter coherently (coherent torque) or compete with the internal antiferromagnetic exchange (exchange torque). We show that, depending on the symmetry of the spin valve, the coherent and exchange torques can either be in the plane, ∝n×(q×n) or out of the plane ∝n×q, where q and n are the directions of the order parameter of the polarizer and the free antiferromagnetic layers, respectively. Although disorder conserves the symmetry of the torques, it strongly reduces the torque magnitude, pointing out the need for momentum conservation to ensure strong spin torque in antiferromagnetic spin valves.
Tight-Binding Description of Impurity States in Semiconductors

ERIC Educational Resources Information Center

Dominguez-Adame, F.

2012-01-01

Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…
Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

PubMed

Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

2018-05-08

We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

PubMed

Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

2015-07-14

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.
Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

NASA Astrophysics Data System (ADS)

Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

2018-03-01

It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.
Dynamic docking and electron transfer between Zn-myoglobin and cytochrome b(5).

PubMed

Liang, Zhao-Xun; Nocek, Judith M; Huang, Kai; Hayes, Ryan T; Kurnikov, Igor V; Beratan, David N; Hoffman, Brian M

2002-06-19

We present a broad study of the effect of neutralizing the two negative charges of the Mb propionates on the interaction and electron transfer (ET) between horse Mb and bovine cyt b(5), through use of Zn-substituted Mb (ZnMb, 1) to study the photoinitiated reaction, ((3)ZnP)Mb + Fe(3+)cyt b(5) --> (ZnP)(+)Mb + Fe(2+)cyt b(5). The charge neutralization has been carried out both by replacing the Mb heme with zinc-deuteroporphyrin dimethylester (ZnMb(dme), 2), which replaces the charges by small neutral hydrophobic patches, and also by replacement with the newly prepared zinc-deuteroporphyrin diamide (ZnMb(diamide), 3), which converts the charged groups to neutral, hydrophilic ones. The effect of propionate neutralization on the conformation of the zinc-porphyrin in the Mb heme pocket has been studied by multinuclear NMR with an (15)N labeled zinc porphyrin derivative (ZnMb((15)N-diamide), 4). The rates of photoinitiated ET between the Mb's (1-3) and cyt b(5) have been measured over a range of pH values and ionic strengths. Isothermal titration calorimetry (ITC) and NMR methods have been used to independently investigate the effect of charge neutralization on Mb/b(5) binding. The neutralization of the two heme propionates of ZnMb by formation of the heme diester or, for the first time, the diamide increases the second-order rate constant of the ET reaction between ZnMb and cyt b(5) by as much as several 100-fold, depending on pH and ionic strength, while causing negligible changes in binding affinity. Brownian dynamic (BD) simulations and ET pathway calculations provide insight into the protein docking and ET process. The results support a new "dynamic docking" paradigm for protein-protein reactions in which numerous weakly bound conformations of the docked complex contribute to the binding of cyt b(5) to Mb and Hb, but only a very small subset of these are ET active, and this subset does not include the conformations most favorable for binding; the Mb surface is a large "target" with a small "bullseye" for the cyt b(5) "arrow". This paradigm differs sharply from the more familiar, "simple" docking within a single, or narrow range of conformations, where binding strength and ET reactivity increase in parallel. Likewise, it is distinct from, although complementary to, the well-known picture of conformational control of ET through "gating", or a related picture of "conformational coupling". The new model describes situations in which tight binding does not correlate with efficient ET reactivity, and explains how it is possible to modulate reactivity without changing affinity. Such "decoupling" of reactivity from binding clearly is of physiological relevance for the reduction of met-Mb in muscle and of met-Hb in a red cell, where tight binding of cyt b(5) to the high concentration of ferrous-Mb/Hb would prevent the cytochrome from finding and reducing the oxidized proteins; it likely is of physiological relevance in other situations, as well.
Spin transfer torque in non-collinear magnetic tunnel junctions exhibiting quasiparticle bands: a non-equilibrium Green's function study

NASA Astrophysics Data System (ADS)

Jaya, Selvaraj Mathi

2017-06-01

A non-equilibrium Green's function formulation to study the spin transfer torque (STT) in non-collinear magnetic tunnel junctions (MTJs) exhibiting quasiparticle bands is developed. The formulation can be used to study the magnetoresistance and spin current too. The formulation is used to study the STT in model tunnel junctions exhibiting multiple layers and quasiparticle bands. The many body interaction that gives rise to quasiparticle bands is assumed to be a s - f exchange interaction at the electrode regions of the MTJ. The quasiparticle bands are obtained using a many body procedure and the single particle band structure is obtained using the tight binding model. The bias dependence of the STT as well as the influence of band occupancy and s - f exchange coupling strength on the STT are studied. We find from our studies that the band occupancy plays a significant role in deciding the STT and the s - f interaction strength too influences the STT significantly. Anomalous behavior in both the parallel and perpendicular components of the STT is obtained from our studies. Our results obtained for certain values of the band occupation are found to show the trend observed from the experimental measurements of STT.
Conformation-controlled binding kinetics of antibodies

NASA Astrophysics Data System (ADS)

Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

2016-01-01

Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.
Study on spin filtering and switching action in a double-triangular network chain

NASA Astrophysics Data System (ADS)

Zhang, Yongmei

2018-04-01

Spin transport properties of a double-triangular quantum network with local magnetic moment on backbones and magnetic flux penetrating the network plane are studied. Numerical simulation results show that such a quantum network will be a good candidate for spin filter and spin switch. Local dispersion and density of states are considered in the framework of tight-binding approximation. Transmission coefficients are calculated by the method of transfer matrix. Spin transmission is regulated by substrate magnetic moment and magnetic flux piercing those triangles. Experimental realization of such theoretical research will be conducive to designing of new spintronic devices.

Phosphorene quantum dot-fullerene nanocomposites for solar energy conversion: An unexplored inorganic-organic nanohybrid with novel photovoltaic properties

NASA Astrophysics Data System (ADS)

Rajbanshi, Biplab; Kar, Moumita; Sarkar, Pallavi; Sarkar, Pranab

2017-10-01

Using the self-consistent charge density-functional based tight-binding (SCC-DFTB) method, coupled with time-dependent density functional theory (TDDFT) calculations, for the first time we explore the possibility of use of phosphorene quantum dots in solar energy harvesting devices. The phosphorene quantum dots-fullerene (PQDs-PCBA) nanocomposites show type-II band alignment indicating spatial separation of charge carriers. The TDDFT calculations also show that the PQD-fullerene nanocomposites seem to be exciting material for future generation solar energy harvester, with extremely fast charge transfer and very poor recombination rate.
Tight-binding calculation studies of vacancy and adatom defects in graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

2016-02-19

Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE PAGES

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

2015-06-26

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.
A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Tight-binding model for materials at mesoscale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

2016-12-21

TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less
Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

NASA Astrophysics Data System (ADS)

Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

2018-02-01

Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.
Model many-body Stoner Hamiltonian for binary FeCr alloys

NASA Astrophysics Data System (ADS)

Nguyen-Manh, D.; Dudarev, S. L.

2009-09-01

We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.
Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

NASA Astrophysics Data System (ADS)

Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

2018-02-01

Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.
Peptide Beacons: A New Design for Polypeptide-Based Optical Biosensors

PubMed Central

Oh, Kenneth J.; Cash, Kevin J.; Hugenberg, Verena; Plaxco, Kevin W.

2008-01-01

Phage display and other in vitro selection techniques produce short polypeptides that tightly and specifically bind to any of a wide range of macromolecular targets. Here we demonstrate a potentially general means of converting such polypeptides into optical biosensors. The sensing architecture we have developed, termed peptide beacons, is based on the observation that, whereas short peptides are almost invariably unfolded and highly dynamic, they become rigid when complexed to their target. Using this effect to segregate a long-lived fluorophore from an electron transfer-based contact quencher, both covalently attached to the peptide, we have produced a robust optical sensor for anti-HIV antibodies. The binding-induced segregation of the fluorophore-quencher pair produces a six-fold increase in sensor emission, thus allowing us to readily detect as low as ∼250 pM of the target antibody. Because the sensor is based on binding-induced folding and a visible-light fluorophore, it is sufficiently selective to work directly in complex, contaminant-ridden samples such as saliva and blood. PMID:17461545
How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

PubMed Central

1988-01-01

We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099
Elucidation of Lipid Binding Sites on Lung Surfactant Protein A Using X-ray Crystallography, Mutagenesis, and Molecular Dynamics Simulations.

PubMed

Goh, Boon Chong; Wu, Huixing; Rynkiewicz, Michael J; Schulten, Klaus; Seaton, Barbara A; McCormack, Francis X

2016-07-05

Surfactant protein A (SP-A) is a collagenous C-type lectin (collectin) that is critical for pulmonary defense against inhaled microorganisms. Bifunctional avidity of SP-A for pathogen-associated molecular patterns (PAMPs) such as lipid A and for dipalmitoylphosphatidylcholine (DPPC), the major component of surfactant membranes lining the air-liquid interface of the lung, ensures that the protein is poised for first-line interactions with inhaled pathogens. To improve our understanding of the motifs that are required for interactions with microbes and surfactant structures, we explored the role of the tyrosine-rich binding surface on the carbohydrate recognition domain of SP-A in the interaction with DPPC and lipid A using crystallography, site-directed mutagenesis, and molecular dynamics simulations. Critical binding features for DPPC binding include a three-walled tyrosine cage that binds the choline headgroup through cation-π interactions and a positively charged cluster that binds the phosphoryl group. This basic cluster is also critical for binding of lipid A, a bacterial PAMP and target for SP-A. Molecular dynamics simulations further predict that SP-A binds lipid A more tightly than DPPC. These results suggest that the differential binding properties of SP-A favor transfer of the protein from surfactant DPPC to pathogen membranes containing appropriate lipid PAMPs to effect key host defense functions.
Large-Scale Conformational Dynamics Control H5N1 Influenza Polymerase PB2 Binding to Importin α.

PubMed

Delaforge, Elise; Milles, Sigrid; Bouvignies, Guillaume; Bouvier, Denis; Boivin, Stephane; Salvi, Nicola; Maurin, Damien; Martel, Anne; Round, Adam; Lemke, Edward A; Jensen, Malene Ringkjøbing; Hart, Darren J; Blackledge, Martin

2015-12-09

Influenza A RNA polymerase complex is formed from three components, PA, PB1, and PB2. PB2 is independently imported into the nucleus prior to polymerase reconstitution. All crystallographic structures of the PB2 C-terminus (residues 536-759) reveal two globular domains, 627 and NLS, that form a tightly packed heterodimer. The molecular basis of the affinity of 627-NLS for importins remained unclear from these structures, apparently requiring large-scale conformational changes prior to importin binding. Using a combination of solution-state NMR, small-angle neutron scattering, small-angle X-ray scattering (SAXS), and Förster resonance energy transfer (FRET), we show that 627-NLS populates a temperature-dependent dynamic equilibrium between closed and open states. The closed state is stabilized by a tripartite salt bridge involving the 627-NLS interface and the linker, that becomes flexible in the open state, with 627 and NLS dislocating into a highly dynamic ensemble. Activation enthalpies and entropies associated with the rupture of this interface were derived from simultaneous analysis of temperature-dependent chemical exchange saturation transfer measurements, revealing a strong temperature dependence of both open-state population and exchange rate. Single-molecule FRET and SAXS demonstrate that only the open-form is capable of binding to importin α and that, upon binding, the 627 domain samples a dynamic conformational equilibrium in the vicinity of the C-terminus of importin α. This intrinsic large-scale conformational flexibility therefore enables 627-NLS to bind importin through conformational selection from a temperature-dependent equilibrium comprising both functional forms of the protein.
The role of enzyme and substrate concentration in the evaluation of serum angiotensin converting enzyme (ACE) inhibition by enalaprilat in vitro.

PubMed

Weisser, K; Schloos, J

1991-10-09

The relationship between serum angiotensin converting enzyme (ACE) activity and concentration of the ACE inhibitor enalaprilat was determined in vitro in the presence of different concentrations (S = 4-200 mM) of the substrate Hip-Gly-Gly. From Henderson plots, a competitive tight-binding relationship between enalaprilat and serum ACE was found yielding a value of approximately 5 nM for serum ACE concentration (Et) and an inhibition constant (Ki) for enalaprilat of approximately 0.1 nM. A plot of reaction velocity (Vi) versus total inhibitor concentration (It) exhibited a non-parallel shift of the inhibition curve to the right with increasing S. This was reflected by apparent Hill coefficients greater than 1 when the commonly used inhibitory sigmoid concentration-effect model (Emax model) was applied to the data. Slopes greater than 1 were obviously due to discrepancies between the free inhibitor concentration (If) present in the assay and It plotted on the abscissa and could, therefore, be indicators of tight-binding conditions. Thus, the sigmoid Emax model leads to an overestimation of Ki. Therefore, a modification of the inhibitory sigmoid Emax model (called "Emax tight model") was applied, which accounts for the depletion of If by binding, refers to It and allows estimation of the parameters Et and IC50f (free concentration of inhibitor when 50% inhibition occurs) using non-linear regression analysis. This model could describe the non-symmetrical shape of the inhibition curves and the results for Ki and Et correlated very well with those derived from the Henderson plots. The latter findings confirm that the degree of ACE inhibition measured in vitro is, in fact, dependent on the concentration of substrate and enzyme present in the assay. This is of importance not only for the correct evaluation of Ki but also for the interpretation of the time course of serum ACE inhibition measured ex vivo. The non-linear model has some advantages over the linear Henderson equation: it is directly applicable without conversion of the data and avoids the stochastic dependency of the variables, allowing non-linear regression of all data points contributing with the same weight.
Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

DTIC Science & Technology

2010-06-01

for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic
The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.
The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410
Majorana-Hubbard model on the square lattice

NASA Astrophysics Data System (ADS)

Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry

2017-09-01

We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.
Magnetic quantization in monolayer bismuthene

NASA Astrophysics Data System (ADS)

Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.
Quasi one-dimensional band dispersion and surface metallization in long-range ordered polymeric wires

DOE PAGES

Vasseur, Guillaume; Fagot-Revurat, Yannick; Sicot, Muriel; ...

2016-01-04

We study the electronic structure of an ordered array of poly(para-phenylene) chains produced by surface-catalyzed dehalogenative polymerization of 1,4-dibromobenzene on copper (110). The quantization of unoccupied molecular states is measured as a function of oligomer length by scanning tunnelling spectroscopy, with Fermi level crossings observed for chains longer than ten phenyl rings. Angle-resolved photoelectron spectroscopy reveals a quasi-one-dimensional valence band as well as a direct gap of 1.15 eV, as the conduction band is partially filled through adsorption on the surface. Tight-binding modelling and ab initio density functional theory calculations lead to a full description of the organic band-structure, includingmore » the k-dispersion, the gap size and electron charge transfer mechanisms, highlighting a strong substrate-molecule interaction that drives the system into a metallic behaviour. In summary, we have fully characterized the band structure of a carbon-based conducting wire. This model system may be considered as a fingerprint of -conjugation of surface organic frameworks.« less
Spin-dependent transport in antiferromagnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Merodio, P.; Kalitsov, A.; Béa, H.; Baltz, V.; Chshiev, M.

2014-09-01

We investigate the behaviour of spin transfer torque (STT) and tunnelling magnetoresistance (TMR) in epitaxial antiferromagnetic-based tunnel junctions using tight binding calculations in the framework of the Keldysh formalism. We find that the STT out-of-plane component exhibits a staggered spatial distribution similar to its in-plane component. This behaviour is specific to the use of a tunnel barrier and significantly differs from the out-of-plane torques reported in previous works using a metallic spacer. Additionally, we show that unlike conventional ferromagnetic-based tunnel junctions, the TMR can increase with applied bias and reach values comparable to typical magnetoresistances found for usual spin valves.
Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

PubMed

Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

2016-03-14

Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.
Enhancement of electron correlation due to the molecular dimerization in organic superconductors β -(BDA-TTP )2X (X =I3, SbF6)

NASA Astrophysics Data System (ADS)

Aizawa, Hirohito; Kuroki, Kazuhiko; Yamada, Jun-ichi

2015-10-01

We perform a first-principles band calculation for quasi-two-dimensional organic superconductors β -(BDA -TTP) 2I3 and β -(BDA -TTP) 2SbF6. The first-principles band structures between the I3 and SbF6 salts are apparently different. We construct a tight-binding model for each material which accurately reproduces the first-principles band structure. The obtained transfer energies give the differences as follows: (i) larger dimerization in the I3 salt than the SbF6 salt, and (ii) different signs and directions of the interstacking transfer energies. To decompose the origin of the difference into the dimerization and the interstacking transfer energies, we adopt a simplified model by eliminating the dimerization effect and focus only on the difference caused by the interstacking transfer energies. From the analysis using the simplified model, we find that the difference of the band structure comes mainly from the strength of the dimerization. To compare the strength of the electron correlation having roots in the band structure, we calculate the physical properties originating from the effect of the electron correlation such as the spin susceptibility applying the two-particle self-consistent method. We find that the maximum value of the spin susceptibility for the I3 salt is larger than that of the SbF6 salt. Hypothetically decreasing the dimerization within the model of the I3 salt, the spin susceptibility takes almost the same value as that of the SbF6 salt for the same magnitude of the dimerization. We expect that the different ground state between the I3 and SbF6 salt mainly comes from the strength of the dimerization which is apparently masked in the band calculation along a particular k path.
Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

NASA Astrophysics Data System (ADS)

Leleyter, M.; Olivi-Tran, N.

2008-12-01

We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.
The green hemoproteins of bovine erythrocytes. II. Spectral, ligand-binding, and electrochemical properties.

PubMed

DeFilippi, L J; Hultquist, D E

1978-05-10

The two green hemoproteins isolated from bovine erythrocytes (form I and form II) have been characterized as to spectral, electrochemical, and chemical properties. The absorption spectra of the isolated hemoproteins are typical of high spin ferric states. Reduction of the hemoproteins yields high spin ferrohemoproteins. Complexation of the ferrohemoproteins with CO and the ferrihemoproteins with cyanide yields low spin complexes, demonstrating the presence of an exchangeable weak field ligand in both the ferrous and ferric states of the hemoproteins. The differences in position and intensity of the absorption peaks of the visible spectra allow the two forms to be distinguished from one another. The midpoint potential of forms I and II were found to be +0.075 and +0.019 V, respectively, at pH 6.4 and +0.038 and -0.005 V, respectively, at pH 7.0. This is consistent with the gaining of 1 proton/electron during the reduction. The Nernst plot reveals an unusual 0.5-electron transfer, whereas a quantitative titration demonstrates a 1-electron transfer. Form I binds cyanide more tightly than form II (KD of 84 and 252 micrometer, respectively). The observed spectral, electrochemical, and ligand-binding differences between forms I and II can be explained in terms of a greater electron-withdrawing ability of the side chains of the heme of form I relative to the heme of form II.
A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

PubMed

Quan, Yundi; Pickett, Warren E

2018-02-21

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.
A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

NASA Astrophysics Data System (ADS)

Quan, Yundi; Pickett, Warren E.

2018-02-01

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.
Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

NASA Astrophysics Data System (ADS)

Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

2016-02-01

We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.
Electric-field-induced plasmon in AA-stacked bilayer graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

2013-12-15

The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less
Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

NASA Astrophysics Data System (ADS)

Henke, Paul S.; Mak, Chi H.

2014-08-01

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.
Spin textures on general surfaces of the correlated topological insulator SmB6

NASA Astrophysics Data System (ADS)

Baruselli, Pier Paolo; Vojta, Matthias

2016-05-01

Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.
Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

PubMed

Henke, Paul S; Mak, Chi H

2014-08-14

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.
Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

NASA Astrophysics Data System (ADS)

Turek, I.; Kudrnovský, J.; Drchal, V.

2015-12-01

We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.
Electronic Structure and Properties of Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Yang, Liu; Arnold, Jim (Technical Monitor)

2001-01-01

A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.
Strong interlayer coupling in phosphorene/graphene van der Waals heterostructure: A first-principles investigation

NASA Astrophysics Data System (ADS)

Hu, Xue-Rong; Zheng, Ji-Ming; Ren, Zhao-Yu

2018-04-01

Based on first-principles calculations within the framework of density functional theory, we study the electronic properties of phosphorene/graphene heterostructures. Band gaps with different sizes are observed in the heterostructure, and charges transfer from graphene to phosphorene, causing the Fermi level of the heterostructure to shift downward with respect to the Dirac point of graphene. Significantly, strong coupling between two layers is discovered in the band spectrum even though it has a van der Waals heterostructure. A tight-binding Hamiltonian model is used to reveal that the resonance of the Bloch states between the phosphorene and graphene layers in certain K points combines with the symmetry matching between band states, which explains the reason for the strong coupling in such heterostructures. This work may enhance the understanding of interlayer interaction and composition mechanisms in van der Waals heterostructures consisting of two-dimensional layered nanomaterials, and may indicate potential reference information for nanoelectronic and optoelectronic applications.
Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less
Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE PAGES

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian; ...

2017-12-12

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Continuous-time quantum walk on an extended star graph: Trapping and superradiance transition

NASA Astrophysics Data System (ADS)

Yalouz, Saad; Pouthier, Vincent

2018-02-01

A tight-binding model is introduced for describing the dynamics of an exciton on an extended star graph whose central node is occupied by a trap. On this graph, the exciton dynamics is governed by two kinds of eigenstates: many eigenstates are associated with degenerate real eigenvalues insensitive to the trap, whereas three decaying eigenstates characterized by complex energies contribute to the trapping process. It is shown that the excitonic population absorbed by the trap depends on the size of the graph, only. By contrast, both the size parameters and the absorption rate control the dynamics of the trapping. When these parameters are judiciously chosen, the efficiency of the transfer is optimized resulting in the minimization of the absorption time. Analysis of the eigenstates reveals that such a feature arises around the superradiance transition. Moreover, depending on the size of the network, two situations are highlighted where the transport efficiency is either superoptimized or suboptimized.
Bcc and Fcc transition metals and alloys: a central role for the Jahn-Teller effect in explaining their ideal and distorted structures.

PubMed

Lee, Stephen; Hoffmann, Roald

2002-05-01

Transition metal elements, alloys, and intermetallic compounds often adopt the body centered cubic (bcc) and face centered cubic (fcc) structures. By comparing quantitative density functional with qualitative tight-binding calculations, we analyze the electronic factors which make the bcc and fcc structures energetically favorable. To do so, we develop a tight-binding function, DeltaE(star), a function that measures the energetic effects of transferring electrons within wave vector stars. This function allows one to connect distortions in solids to the Jahn-Teller effect in molecules and to provide an orbital perspective on structure determining deformations in alloys. We illustrate its use by considering first a two-dimensional square net. We then turn to three-dimensional fcc and bcc structures, and distortions of these. Using DeltaE(star), we rationalize the differences in energy of these structures. We are able to deduce which orbitals are responsible for instabilities in seven to nine valence electron per atom (e(-)/a) bcc systems and five and six e(-)/a fcc structures. Finally we demonstrate that these results account for the bcc and fcc type structures found in both the elements and binary intermetallic compounds of group 4 through 9 transition metal atoms. The outline of a theory of metal structure deformations based on loss of point group operation rather than translational symmetry is presented.
Structural basis for cellobiose dehydrogenase action during oxidative cellulose degradation

NASA Astrophysics Data System (ADS)

Tan, Tien-Chye; Kracher, Daniel; Gandini, Rosaria; Sygmund, Christoph; Kittl, Roman; Haltrich, Dietmar; Hällberg, B. Martin; Ludwig, Roland; Divne, Christina

2015-07-01

A new paradigm for cellulose depolymerization by fungi focuses on an oxidative mechanism involving cellobiose dehydrogenases (CDH) and copper-dependent lytic polysaccharide monooxygenases (LPMO); however, mechanistic studies have been hampered by the lack of structural information regarding CDH. CDH contains a haem-binding cytochrome (CYT) connected via a flexible linker to a flavin-dependent dehydrogenase (DH). Electrons are generated from cellobiose oxidation catalysed by DH and shuttled via CYT to LPMO. Here we present structural analyses that provide a comprehensive picture of CDH conformers, which govern the electron transfer between redox centres. Using structure-based site-directed mutagenesis, rapid kinetics analysis and molecular docking, we demonstrate that flavin-to-haem interdomain electron transfer (IET) is enabled by a haem propionate group and that rapid IET requires a closed CDH state in which the propionate is tightly enfolded by DH. Following haem reduction, CYT reduces LPMO to initiate oxygen activation at the copper centre and subsequent cellulose depolymerization.
Kinetics and binding sites for interaction of the prefoldin with a group II chaperonin: contiguous non-native substrate and chaperonin binding sites in the archaeal prefoldin.

PubMed

Okochi, Mina; Nomura, Tomoko; Zako, Tamotsu; Arakawa, Takatoshi; Iizuka, Ryo; Ueda, Hiroshi; Funatsu, Takashi; Leroux, Michel; Yohda, Masafumi

2004-07-23

Prefoldin is a jellyfish-shaped hexameric co-chaperone of the group II chaperonins. It captures a protein folding intermediate and transfers it to a group II chaperonin for completion of folding. The manner in which prefoldin interacts with its substrates and cooperates with the chaperonin is poorly understood. In this study, we have examined the interaction between a prefoldin and a chaperonin from hyperthermophilic archaea by immunoprecipitation, single molecule observation, and surface plasmon resonance. We demonstrate that Pyrococcus prefoldin interacts most tightly with its cognate chaperonin, and vice versa, suggesting species specificity in the interaction. Using truncation mutants, we uncovered by kinetic analyses that this interaction is multivalent in nature, consistent with multiple binding sites between the two chaperones. We present evidence that both N- and C-terminal regions of the prefoldin beta sub-unit are important for molecular chaperone activity and for the interaction with a chaperonin. Our data are consistent with substrate and chaperonin binding sites on prefoldin that are different but in close proximity, which suggests a possible handover mechanism of prefoldin substrates to the chaperonin.
Acetyl group coordinated progression through the catalytic cycle of an arylalkylamine N-acetyltransferase.

PubMed

Aboalroub, Adam A; Bachman, Ashleigh B; Zhang, Ziming; Keramisanou, Dimitra; Merkler, David J; Gelis, Ioannis

2017-01-01

The transfer of an acetyl group from acetyl-CoA to an acceptor amine is a ubiquitous biochemical transformation catalyzed by Gcn5-related N-acetyltransferases (GNATs). Although it is established that the reaction proceeds through a sequential ordered mechanism, the role of the acetyl group in driving the ordered formation of binary and ternary complexes remains elusive. Herein, we show that CoA and acetyl-CoA alter the conformation of the substrate binding site of an arylalkylamine N-acetyltransferase (AANAT) to facilitate interaction with acceptor substrates. However, it is the presence of the acetyl group within the catalytic funnel that triggers high affinity binding. Acetyl group occupancy is relayed through a conserved salt bridge between the P-loop and the acceptor binding site, and is manifested as differential dynamics in the CoA and acetyl-CoA-bound states. The capacity of the acetyl group carried by an acceptor to promote its tight binding even in the absence of CoA, but also its mutually exclusive position to the acetyl group of acetyl-CoA underscore its importance in coordinating the progression of the catalytic cycle.
Acetyl group coordinated progression through the catalytic cycle of an arylalkylamine N-acetyltransferase

PubMed Central

Aboalroub, Adam A.; Bachman, Ashleigh B.; Zhang, Ziming; Keramisanou, Dimitra; Merkler, David J.

2017-01-01

The transfer of an acetyl group from acetyl-CoA to an acceptor amine is a ubiquitous biochemical transformation catalyzed by Gcn5-related N-acetyltransferases (GNATs). Although it is established that the reaction proceeds through a sequential ordered mechanism, the role of the acetyl group in driving the ordered formation of binary and ternary complexes remains elusive. Herein, we show that CoA and acetyl-CoA alter the conformation of the substrate binding site of an arylalkylamine N-acetyltransferase (AANAT) to facilitate interaction with acceptor substrates. However, it is the presence of the acetyl group within the catalytic funnel that triggers high affinity binding. Acetyl group occupancy is relayed through a conserved salt bridge between the P-loop and the acceptor binding site, and is manifested as differential dynamics in the CoA and acetyl-CoA-bound states. The capacity of the acetyl group carried by an acceptor to promote its tight binding even in the absence of CoA, but also its mutually exclusive position to the acetyl group of acetyl-CoA underscore its importance in coordinating the progression of the catalytic cycle. PMID:28486510
Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.
Isomer-Specific Binding Affinity of Perfluorooctanesulfonate (PFOS) and Perfluorooctanoate (PFOA) to Serum Proteins.

PubMed

Beesoon, Sanjay; Martin, Jonathan W

2015-05-05

Perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA) are among the most prominent contaminants in human serum, and these were historically manufactured as technical mixtures of linear and branched isomers. The isomers display unique pharmacokinetics in humans and in animal models, but molecular mechanisms underlying isomer-specific PFOS and PFOA disposition have not previously been studied. Here, ultrafiltration devices were used to examine (i) the dissociation constants (Kd) of individual PFOS and PFOA isomers with human serum albumin (HSA) and (ii) relative binding affinity of isomers in technical mixtures spiked to whole calf serum and human serum. Measurement of HSA Kd's demonstrated that linear PFOS (Kd=8(±4)×10(-8) M) was much more tightly bound than branched PFOS isomers (Kd range from 8(±1)×10(-5) M to 4(±2)×10(-4) M). Similarly, linear PFOA (Kd=1(±0.9)×10(-4) M) was more strongly bound to HSA compared to branched PFOA isomers (Kd range from 4(±2)×10(-4) M to 3(±2)×10(-4) M). The higher binding affinities of linear PFOS and PFOA to total serum protein were confirmed when both calf serum and human serum were spiked with technical mixtures. Overall, these data provide a mechanistic explanation for the longer biological half-life of PFOS in humans, compared to PFOA, and for the higher transplacental transfer efficiencies and renal clearance of branched PFOS and PFOA isomers, compared to the respective linear isomer.
Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis

PubMed Central

Landry, Aaron P.; Cheng, Zishuo; Ding, Huangen

2013-01-01

Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by L-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis. PMID:23258274
Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

PubMed

Landry, Aaron P; Cheng, Zishuo; Ding, Huangen

2013-03-07

Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by l-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.
Time-efficient simulations of tight-binding electronic structures with Intel Xeon PhiTM many-core processors

NASA Astrophysics Data System (ADS)

Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam

2016-12-01

Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.
Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

PubMed

Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

2017-09-30

Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

PubMed Central

Lonberg-Holm, K; Whiteley, N M

1976-01-01

Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301
DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.
Integrated multidisciplinary CAD/CAE environment for micro-electro-mechanical systems (MEMS)

NASA Astrophysics Data System (ADS)

Przekwas, Andrzej J.

1999-03-01

Computational design of MEMS involves several strongly coupled physical disciplines, including fluid mechanics, heat transfer, stress/deformation dynamics, electronics, electro/magneto statics, calorics, biochemistry and others. CFDRC is developing a new generation multi-disciplinary CAD systems for MEMS using high-fidelity field solvers on unstructured, solution-adaptive grids for a full range of disciplines. The software system, ACE + MEMS, includes all essential CAD tools; geometry/grid generation for multi- discipline, multi-equation solvers, GUI, tightly coupled configurable 3D field solvers for FVM, FEM and BEM and a 3D visualization/animation tool. The flow/heat transfer/calorics/chemistry equations are solved with unstructured adaptive FVM solver, stress/deformation are computed with a FEM STRESS solver and a FAST BEM solver is used to solve linear heat transfer, electro/magnetostatics and elastostatics equations on adaptive polygonal surface grids. Tight multidisciplinary coupling and automatic interoperability between the tools was achieved by designing a comprehensive database structure and APIs for complete model definition. The virtual model definition is implemented in data transfer facility, a publicly available tool described in this paper. The paper presents overall description of the software architecture and MEMS design flow in ACE + MEMS. It describes current status, ongoing effort and future plans for the software. The paper also discusses new concepts of mixed-level and mixed- dimensionality capability in which 1D microfluidic networks are simulated concurrently with 3D high-fidelity models of discrete components.
On the self-association potential of transmembrane tight junction proteins.

PubMed

Blasig, I E; Winkler, L; Lassowski, B; Mueller, S L; Zuleger, N; Krause, E; Krause, G; Gast, K; Kolbe, M; Piontek, J

2006-02-01

Tight junctions seal intercellular clefts via membrane-related strands, hence, maintaining important organ functions. We investigated the self-association of strand-forming transmembrane tight junction proteins. The regulatory tight junction protein occludin was differently tagged and cotransfected in eucaryotic cells. These occludins colocalized within the plasma membrane of the same cell, coprecipitated and exhibited fluorescence resonance energy transfer. Differently tagged strand-forming claudin-5 also colocalized in the plasma membrane of the same cell and showed fluorescence resonance energy transfer. This demonstrates self-association in intact cells both of occludin and claudin-5 in one plasma membrane. In search of dimerizing regions of occludin, dimerization of its cytosolic C-terminal coiledcoil domain was identified. In claudin-5, the second extracellular loop was detected as a dimer. Since the transmembrane junctional adhesion molecule also is known to dimerize, the assumption that homodimerization of transmembrane tight junction proteins may serve as a common structural feature in tight junction assembly is supported.
Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

PubMed

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Halorhodopsin pumps Cl– and bacteriorhodopsin pumps protons by a common mechanism that uses conserved electrostatic interactions

PubMed Central

Gunner, M. R.

2014-01-01

Key mutations differentiate the functions of homologous proteins. One example compares the inward ion pump halorhodopsin (HR) and the outward proton pump bacteriorhodopsin (BR). Of the nine essential buried ionizable residues in BR, six are conserved in HR. However, HR changes three BR acids, D85 in a central cluster of ionizable residues, D96, nearer the intracellular, and E204, nearer the extracellular side of the membrane to the small, neutral amino acids T111, V122, and T230, respectively. In BR, acidic amino acids are stationary anions whose proton affinity is modulated by conformational changes, establishing a sequence of directed binding and release of protons. Multiconformation continuum electrostatics calculations of chloride affinity and residue protonation show that, in reaction intermediates where an acid is ionized in BR, a Cl– is bound to HR in a position near the deleted acid. In the HR ground state, Cl– binds tightly to the central cluster T111 site and weakly to the extracellular T230 site, recovering the charges on ionized BR-D85 and neutral E204 in BR. Imposing key conformational changes from the BR M intermediate into the HR structure results in the loss of Cl– from the central T111 site and the tight binding of Cl– to the extracellular T230 site, mirroring the changes that protonate BR-D85 and ionize E204 in BR. The use of a mobile chloride in place of D85 and E204 makes HR more susceptible to the environmental pH and salt concentrations than BR. These studies shed light on how ion transfer mechanisms are controlled through the interplay of protein and ion electrostatics. PMID:25362051
Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

NASA Astrophysics Data System (ADS)

Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

2017-07-01

We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.
Quantitative analysis on electric dipole energy in Rashba band splitting.

PubMed

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-09-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

Quantitative analysis on electric dipole energy in Rashba band splitting

PubMed Central

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-01-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493
Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

PubMed

Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

2018-01-18

Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.
The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

PubMed

Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

2018-03-05

During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.
Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

1988-04-15

We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.
Interfamily Transfer of Dual NB-LRR Genes Confers Resistance to Multiple Pathogens

PubMed Central

Narusaka, Mari; Kubo, Yasuyuki; Hatakeyama, Katsunori; Imamura, Jun; Ezura, Hiroshi; Nanasato, Yoshihiko; Tabei, Yutaka; Takano, Yoshitaka; Shirasu, Ken; Narusaka, Yoshihiro

2013-01-01

A major class of disease resistance (R) genes which encode nucleotide binding and leucine rich repeat (NB-LRR) proteins have been used in traditional breeding programs for crop protection. However, it has been difficult to functionally transfer NB-LRR-type R genes in taxonomically distinct families. Here we demonstrate that a pair of Arabidopsis (Brassicaceae) NB-LRR-type R genes, RPS4 and RRS1, properly function in two other Brassicaceae, Brassica rapa and Brassica napus, but also in two Solanaceae, Nicotiana benthamiana and tomato (Solanum lycopersicum). The solanaceous plants transformed with RPS4/RRS1 confer bacterial effector-specific immunity responses. Furthermore, RPS4 and RRS1, which confer resistance to a fungal pathogen Colletotrichum higginsianum in Brassicaceae, also protect against Colletotrichum orbiculare in cucumber (Cucurbitaceae). Importantly, RPS4/RRS1 transgenic plants show no autoimmune phenotypes, indicating that the NB-LRR proteins are tightly regulated. The successful transfer of two R genes at the family level implies that the downstream components of R genes are highly conserved. The functional interfamily transfer of R genes can be a powerful strategy for providing resistance to a broad range of pathogens. PMID:23437080
Crumbs3 Is Essential for Proper Epithelial Development and Viability

PubMed Central

Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

2014-01-01

First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893
Efficient self-consistency for magnetic tight binding

NASA Astrophysics Data System (ADS)

Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

2011-06-01

Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.
Dirac topological insulator in the dz2 manifold of a honeycomb oxide

NASA Astrophysics Data System (ADS)

Lado, J. L.; Pardo, V.

2016-09-01

We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.
Phononic crystals of spherical particles: A tight binding approach

NASA Astrophysics Data System (ADS)

Mattarelli, M.; Secchi, M.; Montagna, M.

2013-11-01

The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.
Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

NASA Astrophysics Data System (ADS)

Menezes, Marcos; Capaz, Rodrigo

Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.
Specificity in Transition State Binding: The Pauling Model Revisited

PubMed Central

Amyes, Tina L.; Richard, John P.

2013-01-01

Linus Pauling proposed that the large rate accelerations for enzymes are due to the high specificity of the protein catalyst for binding the reaction transition state. The observation that stable analogs of the transition states for enzymatic reactions often act as tight-binding binding inhibitors provided early support for this simple and elegant proposal. We review experimental results which support the proposal that Pauling’s model provides a satisfactory explanation for the rate accelerations for many heterolytic enzymatic reactions through high energy reaction intermediates, such as proton transfer and decarboxylation. Specificity in transition state binding is obtained when the total intrinsic binding energy of the substrate is significantly larger than the binding energy observed at the Michaelis complex. The results of recent studies to characterize the specificity in binding of the enolate oxygen at the transition state for the 1,3-isomerization reaction catalyzed by ketosteroid isomerase are reviewed. Interactions between pig heart succinyl-CoA:3-oxoacid coenzyme A transferase (SCOT) and the nonreacting portions of CoA are responsible for a rate increase of 3 × 1012-fold, which is close to the estimated total 5 × 1013-fold enzymatic rate acceleration. Studies that partition the interactions between SCOT and CoA into their contributing parts are reviewed. Interactions of the protein with the substrate phosphodianion group provide a ca. 12 kcal/mol stabilization of the transition state for the reactions catalyzed by triosephosphate isomerase, orotidine 5′-monophosphate decarboxylase and α-glycerol phosphate dehydrogenase. The interactions of these enzymes with the substrate piece phosphite dianion provide a 6 – 8 kcal/mol stabilization of the transition state for reaction of the appropriate truncated substrate. Enzyme activation by phosphite dianion reflects the higher dianion affinity for binding to the enzyme-transition state complex compared with the free enzyme. Evidence is presented that supports a model in which the binding energy of the phosphite dianion piece, or the phosphodianion group of the whole substrate, is utilized to drive an enzyme conformational change from an inactive open form EO to an active closed form EC, by closure of a phosphodianion gripper loop. Members of the enolase and haloalkanoic acid dehalogenase superfamilies use variable capping domains to interact with nonreacting portions of the substrate and sequester the substrate from interaction with bulk solvent. Interactions of this capping domain with the phenyl group of mandelate have been shown to activate mandelate racemase for catalysis of deprotonation of α-carbonyl carbon. We propose that an important function of these capping domains is to utilize the binding interactions with nonreacting portions of the substrate to activate the enzyme for catalysis. PMID:23327224
DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Ring, D.M.

The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.
Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

PubMed Central

Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

2009-01-01

8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165
Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

2016-07-28

The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.
The Mismetallation of Enzymes during Oxidative Stress*

PubMed Central

Imlay, James A.

2014-01-01

Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623
Key role of hydrazine to the interaction between oxaloacetic against phosphoenolpyruvic carboxykinase (PEPCK): ONIOM calculations.

PubMed

Prajongtat, Pongthep; Phromyothin, Darinee Sae-Tang; Hannongbua, Supa

2013-08-01

The interactions between oxaloacetic (OAA) and phosphoenolpyruvic carboxykinase (PEPCK) binding pocket in the presence and absence of hydrazine were carried out using quantum chemical calculations, based on the two-layered ONIOM (ONIOM2) approach. The complexes were partially optimized by ONIOM2 (B3LYP/6-31G(d):PM6) method while the interaction energies between OAA and individual residues surrounding the pocket were performed at the MP2/6-31G(d,p) level of theory. The calculated interaction energies (INT) indicated that Arg87, Gly237, Ser286, and Arg405 are key residues for binding to OAA with the INT values of -1.93, -2.06, -2.47, and -3.16 kcal mol(-1), respectively. The interactions are mainly due to the formation of hydrogen bonding interactions with OAA. Moreover, using ONIOM2 (B3LYP/6-31G(d):PM6) applied on the PEPCKHS complex, two proton transfers were observed; first, the proton was transferred from the carboxylic group of OAA to hydrazine while the second one was from Asp311 to Lys244. Such reactions cause the generation of binding strength of OAA to the pocket via electrostatic interaction. The orientations of Lys243, Lys244, His264, Asp311, Phe333, and Arg405 were greatly deviated after hydrazine incorporation. These indicate that hydrazine plays an important role in terms of not only changing the conformation of the binding pocket, but is also tightly bound to OAA resulting in its conformation change in the pocket. The understanding of such interaction can be useful for the design of hydrazine-based inhibitor for antichachexia agents.
Lipid-regulated sterol transfer between closely apposed membranes by oxysterol-binding protein homologues.

PubMed

Schulz, Timothy A; Choi, Mal-Gi; Raychaudhuri, Sumana; Mears, Jason A; Ghirlando, Rodolfo; Hinshaw, Jenny E; Prinz, William A

2009-12-14

Sterols are transferred between cellular membranes by vesicular and poorly understood nonvesicular pathways. Oxysterol-binding protein-related proteins (ORPs) have been implicated in sterol sensing and nonvesicular transport. In this study, we show that yeast ORPs use a novel mechanism that allows regulated sterol transfer between closely apposed membranes, such as organelle contact sites. We find that the core lipid-binding domain found in all ORPs can simultaneously bind two membranes. Using Osh4p/Kes1p as a representative ORP, we show that ORPs have at least two membrane-binding surfaces; one near the mouth of the sterol-binding pocket and a distal site that can bind a second membrane. The distal site is required for the protein to function in cells and, remarkably, regulates the rate at which Osh4p extracts and delivers sterols in a phosphoinositide-dependent manner. Together, these findings suggest a new model of how ORPs could sense and regulate the lipid composition of adjacent membranes.
Specificity in transition state binding: the Pauling model revisited.

PubMed

Amyes, Tina L; Richard, John P

2013-03-26

Linus Pauling proposed that the large rate accelerations for enzymes are caused by the high specificity of the protein catalyst for binding the reaction transition state. The observation that stable analogues of the transition states for enzymatic reactions often act as tight-binding inhibitors provided early support for this simple and elegant proposal. We review experimental results that support the proposal that Pauling's model provides a satisfactory explanation for the rate accelerations for many heterolytic enzymatic reactions through high-energy reaction intermediates, such as proton transfer and decarboxylation. Specificity in transition state binding is obtained when the total intrinsic binding energy of the substrate is significantly larger than the binding energy observed at the Michaelis complex. The results of recent studies that aimed to characterize the specificity in binding of the enolate oxygen at the transition state for the 1,3-isomerization reaction catalyzed by ketosteroid isomerase are reviewed. Interactions between pig heart succinyl-coenzyme A:3-oxoacid coenzyme A transferase (SCOT) and the nonreacting portions of coenzyme A (CoA) are responsible for a rate increase of 3 × 10(12)-fold, which is close to the estimated total 5 × 10(13)-fold enzymatic rate acceleration. Studies that partition the interactions between SCOT and CoA into their contributing parts are reviewed. Interactions of the protein with the substrate phosphodianion group provide an ~12 kcal/mol stabilization of the transition state for the reactions catalyzed by triosephosphate isomerase, orotidine 5'-monophosphate decarboxylase, and α-glycerol phosphate dehydrogenase. The interactions of these enzymes with the substrate piece phosphite dianion provide a 6-8 kcal/mol stabilization of the transition state for reaction of the appropriate truncated substrate. Enzyme activation by phosphite dianion reflects the higher dianion affinity for binding to the enzyme-transition state complex compared with that of the free enzyme. Evidence is presented that supports a model in which the binding energy of the phosphite dianion piece, or the phosphodianion group of the whole substrate, is utilized to drive an enzyme conformational change from an inactive open form E(O) to an active closed form E(C), by closure of a phosphodianion gripper loop. Members of the enolase and haloalkanoic acid dehalogenase superfamilies use variable capping domains to interact with nonreacting portions of the substrate and sequester the substrate from interaction with bulk solvent. Interactions of this capping domain with the phenyl group of mandelate have been shown to activate mandelate racemase for catalysis of deprotonation of α-carbonyl carbon. We propose that an important function of these capping domains is to utilize the binding interactions with nonreacting portions of the substrate to activate the enzyme for catalysis.
Tight-binding calculation of radiation loss in photonic crystal CROW.

PubMed

Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

2013-01-28

The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.
OLIFE: Tight Binding Code for Transmission Coefficient Calculation

NASA Astrophysics Data System (ADS)

Mijbil, Zainelabideen Yousif

2018-05-01

A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

DTIC Science & Technology

1977-01-01

An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater
Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

PubMed Central

Meneses, Erick; Mittermaier, Anthony

2014-01-01

Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758
Robust Multiple-Range Coherent Quantum State Transfer.

PubMed

Chen, Bing; Peng, Yan-Dong; Li, Yong; Qian, Xiao-Feng

2016-07-01

We propose a multiple-range quantum communication channel to realize coherent two-way quantum state transport with high fidelity. In our scheme, an information carrier (a qubit) and its remote partner are both adiabatically coupled to the same data bus, i.e., an N-site tight-binding chain that has a single defect at the center. At the weak interaction regime, our system is effectively equivalent to a three level system of which a coherent superposition of the two carrier states constitutes a dark state. The adiabatic coupling allows a well controllable information exchange timing via the dark state between the two carriers. Numerical results show that our scheme is robust and efficient under practically inevitable perturbative defects of the data bus as well as environmental dephasing noise.
Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

PubMed

Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

2018-03-22

The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.
Origin of the Surface-Induced First Hyperpolarizability in the C60/SiO2 System: SCC-DFTB Insight.

PubMed

Nénon, Sébastien; Champagne, Benoît

2014-01-02

Using the self-consistent charge density functional tight binding (SCC-DFTB) method, C60 molecules physisorbed on an α-quartz slab are shown to display a first hyperpolarizability, whereas, owing to their symmetry, both the α-quartz slab and C60 molecule have no first hyperpolarizabilities. A larger first hyperpolarizability is achieved when the lowest-lying (five- or six-membered) ring is situated in between two hydroxyl rows, rather than on top, because this situation favors orbital overlaps and charge transfer. Further analysis has demonstrated that (i) the first hyperpolarizability originates from the MO overlap and field-induced charge transfers from the neighboring substrate/adsorbate moieties but not to geometric relaxation of the C60 molecules at the interface and that (ii) larger first hyperpolarizabilities are associated with low surface coverage and with small distances between C60 and the surface. This contribution is a clear illustration of the emergence of second-order nonlinear optical responses (first hyperpolarizability) as a result of breaking the centrosymmetry.
First-principles simulations of doping-dependent mesoscale screening of adatoms in graphene

NASA Astrophysics Data System (ADS)

Mostofi, Arash; Corsetti, Fabiano; Wong, Dillon; Crommie, Michael; Lischner, Johannes

Adsorbed atoms and molecules play an important role in controlling and tuning the functional properties of 2D materials. Understanding and predicting this phenomenon from theory is challenging because of the need to capture both the local chemistry of the adsorbate-substrate interaction and its complex interplay with the long-range screening response of the substrate. To address this challenge, we have developed a first-principles multi-scale approach that combines linear-scaling density-functional theory, continuum screening theory and large-scale tight-binding simulations. Focussing on the case of a calcium adatom on graphene, we draw comparison between the effect of (i) non-linearity, (ii) intraband and interband transitions, and (iii) the exchange-correlation potential, thus providing insight into the relative importance of these different factors on the screening response. We also determine the charge transfer from the adatom to the graphene substrate (the key parameter used in continuum screening models), showing it to be significantly larger than previous estimates. AM and FC acknowledge support of the EPSRC under Grant EP/J015059/1, and JL under Grant EP/N005244/1.
Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Multiphonon contribution to the polaron formation in cuprates with strong electron correlations and strong electron-phonon interaction

NASA Astrophysics Data System (ADS)

Ovchinnikov, Sergey G.; Makarov, Ilya A.; Kozlov, Peter A.

2017-03-01

In this work dependences of the electron band structure and spectral function in the HTSC cuprates on magnitude of electron-phonon interaction (EPI) and temperature are investigated. We use three-band p-d model with diagonal and offdiagonal EPI with breathing and buckling phonon mode in the frameworks of polaronic version of the generalized tight binding (GTB) method. The polaronic quasiparticle excitation in the system with EPI within this approach is formed by a hybridization of the local multiphonon Franck-Condon excitations with lower and upper Hubbard bands. Increasing EPI leads to transfer of spectral weight to high-energy multiphonon excitations and broadening of the spectral function. Temperature effects are taken into account by occupation numbers of local excited polaronic states and variations in the magnitude of spin-spin correlation functions. Increasing the temperature results in band structure reconstruction, spectral weight redistribution, broadening of the spectral function peak at the top of the valence band and the decreasing of the peak intensity. The effect of EPI with two phonon modes on the polaron spectral function is discussed.
Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

PubMed Central

Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

2012-01-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177
Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

PubMed

Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

2012-12-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.
Quantum simulation of disordered systems with cold atoms

NASA Astrophysics Data System (ADS)

Garreau, Jean-Claude

2017-01-01

This paper reviews the physics of quantum disorder in relation with a series of experiments using laser-cooled atoms exposed to "kicks" of a standing wave, realizing a paradigmatic model of quantum chaos, the kicked rotor. This dynamical system can be mapped onto a tight-binding Hamiltonian with pseudo-disorder, formally equivalent to the Anderson model of quantum disorder, with quantum chaos playing the role of disorder. This provides a very good quantum simulator for the Anderson physics. xml:lang="fr"
Model of gas adsorption on magnetic surfaces

NASA Astrophysics Data System (ADS)

Pick, S.˛te˛´n.; D´, Hugues

1997-12-01

The semi-empirical self-consistent tight-binding model of gas (C, N, O) chemisorption is suggested to study its influence on surface magnetism. For the strongly ferromagnetic Fe(001), we find that the adsorbates are not effective in magnetism reduction. For the hypothetical magnetic V(001) surface, the magnetization is very sensitive to the vanadium d-band occupation used in the calculation. Supposing that the magnetization is weak, it can be essentially suppressed by the gas contamination. The effect is explained by the Stoner criterion.
Correspondence between a shaken honeycomb lattice and the Haldane model

NASA Astrophysics Data System (ADS)

Modugno, Michele; Pettini, Giulio

2017-11-01

We investigate the correspondence between the tight-binding Floquet Hamiltonian of a periodically modulated honeycomb lattice and the Haldane model. We show that—though the two systems share the same topological phase diagram, as reported in a breakthrough experiment with ultracold atoms in a stretched honeycomb lattice [G. Jotzu et al., Nature (London) 515, 237 (2014), 10.1038/nature13915]—the corresponding Hamiltonians are not equivalent, the one of the shaken lattice presenting a much richer structure.
Dynamics simulations for engineering macromolecular interactions

NASA Astrophysics Data System (ADS)

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.
Dynamics simulations for engineering macromolecular interactions.

PubMed

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20,000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.
A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548
Tight-binding tunneling amplitude of an optical lattice

NASA Astrophysics Data System (ADS)

Arzamasovs, Maksims; Liu, Bo

2017-11-01

The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.
Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

PubMed

Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

2018-04-11

We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.
Landau level splitting due to graphene superlattices

NASA Astrophysics Data System (ADS)

Pal, G.; Apel, W.; Schweitzer, L.

2012-06-01

The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.
Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

NASA Astrophysics Data System (ADS)

Reijnders, K. J. A.; Katsnelson, M. I.

2017-07-01

We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

Band gap engineering in finite elongated graphene nanoribbon heterojunctions: Tight-binding model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tayo, Benjamin O.

2015-08-15

A simple model based on the divide and conquer rule and tight-binding (TB) approximation is employed for studying the role of finite size effect on the electronic properties of elongated graphene nanoribbon (GNR) heterojunctions. In our model, the GNR heterojunction is divided into three parts: a left (L) part, middle (M) part, and right (R) part. The left part is a GNR of width W{sub L}, the middle part is a GNR of width W{sub M}, and the right part is a GNR of width W{sub R}. We assume that the left and right parts of the GNR heterojunction interactmore » with the middle part only. Under this approximation, the Hamiltonian of the system can be expressed as a block tridiagonal matrix. The matrix elements of the tridiagonal matrix are computed using real space nearest neighbor orthogonal TB approximation. The electronic structure of the GNR heterojunction is analyzed by computing the density of states. We demonstrate that for heterojunctions for which W{sub L} = W{sub R}, the band gap of the system can be tuned continuously by varying the length of the middle part, thus providing a new approach to band gap engineering in GNRs. Our TB results were compared with calculations employing divide and conquer rule in combination with density functional theory (DFT) and were found to agree nicely.« less
First-principles simulation and low-energy effective modeling of three-dimensional skyrmion in MnGe

NASA Astrophysics Data System (ADS)

Choi, Hongchul; Tai, Yuan-Yen; Zhu, Jian-Xin; T-4 Team

The skyrmion spin textures are mostly observed in two-dimensional (2D) space, which can be topologically mapped onto the surface of the sphere with an integer multiple of topological winding number. Recently, MnGe has been reported as a candidate of 3D skyrmion crystal, showing the variation of the skyrmion size along the z-direction. We have performed the first-principles simulation and constructed a tight-binding model with calculated electronic-structure information to investigate the 3D skyrmion phase in MnGe. Our first-principles study within density functional theory shows that the calculated magnetic moment is larger than that for MnSi (with different lattice constant), implying the possibility of a multiple magnetic transition under pressure. We have also found that the small-sized skyrmion could be stabilized in a 2D structure. Such a high density of the skyrmion is in good agreement with the experimental finding of large topological Hall effect. Finally, we will extend our study to consider the 3D skyrmion structure based on the constructed tight-binding model. This work was carried out under the auspices of the National Nuclear Security Administration of the U.S. Department of Energy at Los Alamos National Laboratory (LANL) under Contract No. DE-AC52-06NA25396, and was supported by the LANL LDRD Program.
A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

USDA-ARS?s Scientific Manuscript database

The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...
Bond-order potential for magnetic body-centered-cubic iron and its transferability

NASA Astrophysics Data System (ADS)

Lin, Yi-Shen; Mrovec, M.; Vitek, V.

2016-06-01

We derived and thoroughly tested a bond-order potential (BOP) for body-centered-cubic (bcc) magnetic iron that can be employed in atomistic calculations of a broad variety of crystal defects that control structural, mechanical, and thermodynamic properties of this technologically important metal. The constructed BOP reflects correctly the mixed nearly free electron and covalent bonding arising from the partially filled d band as well as the ferromagnetism that is actually responsible for the stability of the bcc structure of iron at low temperatures. The covalent part of the cohesive energy is determined within the tight-binding bond model with the Green's function of the Schrödinger equation determined using the method of continued fractions terminated at a sufficient level of the moments of the density of states. This makes the BOP an O (N ) method usable for very large numbers of particles. Only d d bonds are included explicitly, but the effect of s electrons on the covalent energy is included via their screening of the corresponding d d bonds. The magnetic part of the cohesive energy is included using the Stoner model of itinerant magnetism. The repulsive part of the cohesive energy is represented, as in any tight-binding scheme, by an empirical formula. Its functional form is physically justified by studies of the repulsion in face-centered-cubic (fcc) solid argon under very high pressure where the repulsion originates from overlapping s and p closed-shell electrons just as it does from closed-shell s electrons in transition metals squeezed into the ion core under the influence of the large covalent d bonding. Testing of the transferability of the developed BOP to environments significantly different from those of the ideal bcc lattice was carried out by studying crystal structures and magnetic states alternative to the ferromagnetic bcc lattice, vacancies, divacancies, self-interstitial atoms (SIAs), paths continuously transforming the bcc structure to different less symmetric structures and phonons. The results of these calculations are compared with either experiments or calculations based on the density functional theory (DFT), and they all show very good agreement. Importantly, the lowest energy configuration of SIAs agrees with DFT calculations that show that it is an exception within bcc transition metals controlled by magnetism. Moreover, the migration energy of interstitials is significantly lower than that of vacancies, which is essential for correct analysis of the effects of irradiation. Finally, the core structure and glide of ½ <111 > screw dislocations that control the plastic flow in single crystals of bcc metals was explored. The results fully agree with available DFT based studies and with experimental observations of the slip geometry of bcc iron at low temperatures.
Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

PubMed Central

2011-01-01

Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588
First Experimental Realization of the Dirac Oscillator

NASA Astrophysics Data System (ADS)

Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-10-01

We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.
DFTB+ and lanthanides

NASA Astrophysics Data System (ADS)

Hourahine, B.; Aradi, B.; Frauenheim, T.

2010-07-01

DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.
Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.
Scattering matrix of arbitrary tight-binding Hamiltonians

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

2017-03-15

A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.
Homology modeling and prediction of the amino acid residues participating in the transfer of acetyl-CoA to arylalkylamine by the N-acetyltransferase from Chryseobacterium sp.

PubMed

Takenaka, Shinji; Ozeki, Takahiro; Tanaka, Kosei; Yoshida, Ken-Ichi

2017-11-01

To predict the amino acid residues playing important roles in acetyl-CoA and substrate binding and to study the acetyl group transfer mechanism of Chryseobacterium sp. 5-3B N-acetyltransferase (5-3B NatA). A 3-dimensional homology model of 5-3B NatA was constructed to compare the theoretical structure of this compound with the structures of previously reported proteins belonging to the bacterial GCN5 N-acetyltransferase family. Homology modeling of the 5-3B NatA structure and a characterization of the enzyme's kinetic parameters identified the essential amino acid residues involved in binding and acetyl-group transfer. 126 Leu, 132 Leu, and 135 Lys were implicated in the binding of phosphopantothenic acid, and 100 Tyr and 131 Lys in that of adenosyl biphosphate. The data supported the participation of 83 Glu and 133 Tyr in catalyzing acetyl-group transfer to L-2-phenylglycine. 5-3B NatA catalyzes the enantioselective N-acetylation of L-2-phenylglycine via a ternary complex comprising the enzyme, acetyl-CoA, and the substrate.
Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

PubMed Central

Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

2008-01-01

Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368
Carbon Nanotube Field Emission Arrays

DTIC Science & Technology

2011-06-01

K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density
Various Stone-Wales defects in phagraphene

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2016-08-01

Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.
Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

PubMed

Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

2012-06-13

Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.
Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621
Effect of the reflectional symmetry on the coherent hole transport across DNA hairpins

NASA Astrophysics Data System (ADS)

Zarea, Mehdi; Berlin, Yuri; Ratner, Mark A.

2017-03-01

The coherent hole transfer in three types of DNA hairpins containing strands with adenine (A) and guanine (G) nucleobases has been studied. The investigated hairpins involve An+1GGAn, AnGAGAn, or (AG)2nA strands that connect the hole donor and hole acceptor located on opposite ends of hairpins. The positive charge transfer from the photo-excited donor to the acceptor is shown to be slower for An+1GGAn in comparison with AnGAGAn and (AG)2nA sequences. We have revealed that this is due to the reflectional symmetry of the last two sequences with respect to the axis passing through the middle base. As has been demonstrated, the symmetry of the sequence structure manifests itself in the reflectional symmetry of the energy eigenstates. In addition, it has been shown that (AG)2nA is the only symmetric sequence with a zero energy state in the middle of the LUMO tight-binding energy band. Based on our theoretical findings, we predict that the hairpin with this sequence should have the fastest coherent hole transfer rate among the class of base sequences studied.
Fast Litho-Panspermia in Tightly-Packed Systems Around M Dwarfs

NASA Astrophysics Data System (ADS)

Krijt, S.; Bowling, T. J.; Lyons, R. J.; Ciesla, F. J.

2017-11-01

We investigate the fate of impact ejecta in tightly-packed planetary architectures like the TRAPPIST-1 system, finding that material transfer in such configurations is many orders of magnitude faster compared to the inner solar system.
The Cysteine-rich Domain of the DHHC3 Palmitoyltransferase Is Palmitoylated and Contains Tightly Bound Zinc*

PubMed Central

Gottlieb, Colin D.; Zhang, Sheng; Linder, Maurine E.

2015-01-01

DHHC palmitoyltransferases catalyze the addition of the fatty acid palmitate to proteins on the cytoplasmic leaflet of cell membranes. There are 23 members of the highly diverse mammalian DHHC protein family, all of which contain a conserved catalytic domain called the cysteine-rich domain (CRD). DHHC proteins transfer palmitate via a two-step catalytic mechanism in which the enzyme first modifies itself with palmitate in a process termed autoacylation. The enzyme then transfers palmitate from itself onto substrate proteins. The number and location of palmitoylated cysteines in the autoacylated intermediate is unknown. In this study, we present evidence using mass spectrometry that DHHC3 is palmitoylated at the cysteine in the DHHC motif. Mutation of highly conserved CRD cysteines outside the DHHC motif resulted in activity deficits and a structural perturbation revealed by limited proteolysis. Treatment of DHHC3 with chelating agents in vitro replicated both the specific structural perturbations and activity deficits observed in conserved cysteine mutants, suggesting metal ion-binding in the CRD. Using the fluorescent indicator mag-fura-2, the metal released from DHHC3 was identified as zinc. The stoichiometry of zinc binding was measured as 2 mol of zinc/mol of DHHC3 protein. Taken together, our data demonstrate that coordination of zinc ions by cysteine residues within the CRD is required for the structural integrity of DHHC proteins. PMID:26487721
Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

PubMed

Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

2005-08-05

The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.
Gene Duplication and Transference of Function in the paleoAP3 Lineage of Floral Organ Identity Genes

PubMed Central

Galimba, Kelsey D.; Martínez-Gómez, Jesús; Di Stilio, Verónica S.

2018-01-01

The floral organ identity gene APETALA3 (AP3) is a MADS-box transcription factor involved in stamen and petal identity that belongs to the B-class of the ABC model of flower development. Thalictrum (Ranunculaceae), an emerging model in the non-core eudicots, has AP3 homologs derived from both ancient and recent gene duplications. Prior work has shown that petals have been lost repeatedly and independently in Ranunculaceae in correlation with the loss of a specific AP3 paralog, and Thalictrum represents one of these instances. The main goal of this study was to conduct a functional analysis of the three AP3 orthologs present in Thalictrum thalictroides, representing the paleoAP3 gene lineage, to determine the degree of redundancy versus divergence after gene duplication. Because Thalictrum lacks petals, and has lost the petal-specific AP3, we also asked whether heterotopic expression of the remaining AP3 genes contributes to the partial transference of petal function to the first whorl found in insect-pollinated species. To address these questions, we undertook functional characterization by virus-induced gene silencing (VIGS), protein–protein interaction and binding site analyses. Our results illustrate partial redundancy among Thalictrum AP3s, with deep conservation of B-class function in stamen identity and a novel role in ectopic petaloidy of sepals. Certain aspects of petal function of the lost AP3 locus have apparently been transferred to the other paralogs. A novel result is that the protein products interact not only with each other, but also as homodimers. Evidence presented here also suggests that expression of the different ThtAP3 paralogs is tightly integrated, with an apparent disruption of B function homeostasis upon silencing of one of the paralogs that codes for a truncated protein. To explain this result, we propose two testable alternative scenarios: that the truncated protein is a dominant negative mutant or that there is a compensational response as part of a back-up circuit. The evidence for promiscuous protein–protein interactions via yeast two-hybrid combined with the detection of AP3 specific binding motifs in all B-class gene promoters provide partial support for these hypotheses. PMID:29628932

Robust Multiple-Range Coherent Quantum State Transfer

PubMed Central

Chen, Bing; Peng, Yan-Dong; Li, Yong; Qian, Xiao-Feng

2016-01-01

We propose a multiple-range quantum communication channel to realize coherent two-way quantum state transport with high fidelity. In our scheme, an information carrier (a qubit) and its remote partner are both adiabatically coupled to the same data bus, i.e., an N-site tight-binding chain that has a single defect at the center. At the weak interaction regime, our system is effectively equivalent to a three level system of which a coherent superposition of the two carrier states constitutes a dark state. The adiabatic coupling allows a well controllable information exchange timing via the dark state between the two carriers. Numerical results show that our scheme is robust and efficient under practically inevitable perturbative defects of the data bus as well as environmental dephasing noise. PMID:27364891
Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.

PubMed

Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho

2017-08-16

Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.
Ultrafast Charge Transfer and Hybrid Exciton Formation in 2D/0D Heterostructures

DOE PAGES

Boulesbaa, Abdelaziz; Wang, Kai; Mahjouri-Samani, Masoud; ...

2016-10-18

We report that photoinduced interfacial charge transfer is at the heart of many applications, including photovoltaics, photocatalysis, and photodetection. With the emergence of a new class of semiconductors such as monolayer two-dimensional transition metal dichalcogenides (2D-TMDs), charge transfer at the 2D/2D heterojunctions attracted several efforts due to the remarkable optical and electrical properties of 2D-TMDs. Unfortunately, in 2D/2D heterojunctions, for a given combination of two materials, the relative energy band alignment and the charge transfer efficiency are locked. Due to their large variety and broad size tunability, semiconductor quantum dots (0D-QDs) interfaced with 2D-TMDs may become an attractive heterostructure formore » optoelectronic applications. Here, we incorporate femtosecond pump-probe spectroscopy to reveal the sub-45 fs charge transfer at a 2D/0D heterostructure composed of tungsten disulfide monolayers (2D-WS 2) and a single layer of cadmium selenide (CdSe)/zinc sulfide (ZnS) core/shell 0D-QDs. Furthermore, ultrafast dynamics and steady-state measurements suggested that following electron transfer from the 2D to the 0D, hybrid excitons (HXs), wherein the electron resides in the 0D and hole resides in the 2D-TMD monolayer, are formed with a binding energy on the order of ~140 meV, which is several times lower than that of tightly bound excitons in 2D-TMDs.« less
Ultrafast Charge Transfer and Hybrid Exciton Formation in 2D/0D Heterostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boulesbaa, Abdelaziz; Wang, Kai; Mahjouri-Samani, Masoud

We report that photoinduced interfacial charge transfer is at the heart of many applications, including photovoltaics, photocatalysis, and photodetection. With the emergence of a new class of semiconductors such as monolayer two-dimensional transition metal dichalcogenides (2D-TMDs), charge transfer at the 2D/2D heterojunctions attracted several efforts due to the remarkable optical and electrical properties of 2D-TMDs. Unfortunately, in 2D/2D heterojunctions, for a given combination of two materials, the relative energy band alignment and the charge transfer efficiency are locked. Due to their large variety and broad size tunability, semiconductor quantum dots (0D-QDs) interfaced with 2D-TMDs may become an attractive heterostructure formore » optoelectronic applications. Here, we incorporate femtosecond pump-probe spectroscopy to reveal the sub-45 fs charge transfer at a 2D/0D heterostructure composed of tungsten disulfide monolayers (2D-WS 2) and a single layer of cadmium selenide (CdSe)/zinc sulfide (ZnS) core/shell 0D-QDs. Furthermore, ultrafast dynamics and steady-state measurements suggested that following electron transfer from the 2D to the 0D, hybrid excitons (HXs), wherein the electron resides in the 0D and hole resides in the 2D-TMD monolayer, are formed with a binding energy on the order of ~140 meV, which is several times lower than that of tightly bound excitons in 2D-TMDs.« less
Loose coupling in the bacterial flagellar motor

PubMed Central

Boschert, Ryan; Adler, Frederick R.; Blair, David F.

2015-01-01

Physiological properties of the flagellar rotary motor have been taken to indicate a tightly coupled mechanism in which each revolution is driven by a fixed number of energizing ions. Measurements that would directly test the tight-coupling hypothesis have not been made. Energizing ions flow through membrane-bound complexes formed from the proteins MotA and MotB, which are anchored to the cell wall and constitute the stator. Genetic and biochemical evidence points to a “power stroke” mechanism in which the ions interact with an aspartate residue of MotB to drive conformational changes in MotA that are transmitted to the rotor protein FliG. Each stator complex contains two separate ion-binding sites, raising the question of whether the power stroke is driven by one, two, or either number of ions. Here, we describe simulations of a model in which the conformational change can be driven by either one or two ions. This loosely coupled model can account for the observed physiological properties of the motor, including those that have been taken to indicate tight coupling; it also accords with recent measurements of motor torque at high load that are harder to explain in tight-coupling models. Under loads relevant to a swimming cell, the loosely coupled motor would perform about as well as a two-proton motor and significantly better than a one-proton motor. The loosely coupled motor is predicted to be especially advantageous under conditions of diminished energy supply, or of reduced temperature, turning faster than an obligatorily two-proton motor while using fewer ions. PMID:25825730
Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Trans-polyacetylene within the extended tight-binding picture and evidence for next-nearest neighbour hopping from the dispersion of interband transition edges

NASA Astrophysics Data System (ADS)

Drechsler, S. L.; Heiner, E.; Osipov, V. A.

1986-11-01

The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.
Electronic transport in methylated fragments of DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

2015-11-16

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA

NASA Astrophysics Data System (ADS)

de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

2015-11-01

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix

PubMed Central

Barneda, David; Planas-Iglesias, Joan; Gaspar, Maria L; Mohammadyani, Dariush; Prasannan, Sunil; Dormann, Dirk; Han, Gil-Soo; Jesch, Stephen A; Carman, George M; Kagan, Valerian; Parker, Malcolm G; Ktistakis, Nicholas T; Klein-Seetharaman, Judith; Dixon, Ann M; Henry, Susan A; Christian, Mark

2015-01-01

Maintenance of energy homeostasis depends on the highly regulated storage and release of triacylglycerol primarily in adipose tissue, and excessive storage is a feature of common metabolic disorders. CIDEA is a lipid droplet (LD)-protein enriched in brown adipocytes promoting the enlargement of LDs, which are dynamic, ubiquitous organelles specialized for storing neutral lipids. We demonstrate an essential role in this process for an amphipathic helix in CIDEA, which facilitates embedding in the LD phospholipid monolayer and binds phosphatidic acid (PA). LD pairs are docked by CIDEA trans-complexes through contributions of the N-terminal domain and a C-terminal dimerization region. These complexes, enriched at the LD–LD contact site, interact with the cone-shaped phospholipid PA and likely increase phospholipid barrier permeability, promoting LD fusion by transference of lipids. This physiological process is essential in adipocyte differentiation as well as serving to facilitate the tight coupling of lipolysis and lipogenesis in activated brown fat. DOI: http://dx.doi.org/10.7554/eLife.07485.001 PMID:26609809
The molecular basis of the specificity of action of KATP channel openers

PubMed Central

Moreau, Christophe; Jacquet, Hélène; Prost, Anne-Lise; D’hahan, Nathalie; Vivaudou, Michel

2000-01-01

KATP channels incorporate a regulatory subunit of the ATP-binding cassette (ABC) transporter family, the sulfonylurea receptor (SUR), which defines their pharmacology. The therapeutically important K+ channel openers (e.g. pinacidil, cromakalim, nicorandil) act specifically on the SUR2 muscle isoforms but, except for diazoxide, remain ineffective on the SUR1 neuronal/pancreatic isoform. This SUR1/2 dichotomy underpinned a chimeric strategy designed to identify the structural determinants of opener action, which led to a minimal set of two residues within the last transmembrane helix of SUR. Transfer of either residue from SUR2A to SUR1 conferred opener sensitivity to SUR1, while the reverse operation abolished SUR2A sensitivity. It is therefore likely that these residues form part of the site of interaction of openers with the channel. Thus, openers would target a region that, in other ABC transporters, is known to be tightly involved with the binding of substrates and other ligands. This first glimpse of the site of action of pharmacological openers should permit rapid progress towards understanding the structural determinants of their affinity and specificity. PMID:11118199
Dynamical Reduction of the Dimensionality of Exchange Interactions and the "Spin-Liquid" Phase of κ-(BEDT-TTF)_{2}X.

PubMed

Powell, B J; Kenny, E P; Merino, J

2017-08-25

We show that the anisotropy of the effective spin model for the dimer Mott insulator phase of κ-(BEDT-TTF)_{2}X salts is dramatically different from that of the underlying tight-binding model. Intradimer quantum interference results in a model of coupled spin chains, where frustrated interchain interactions suppress long-range magnetic order. Thus, we argue, the "spin liquid" phase observed in some of these materials is a remnant of the Tomonaga-Luttinger physics of a single chain. This is consistent with previous experiments and resolves some outstanding puzzles.
Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

PubMed

Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.
Dissecting the Catalytic Mechanism of Betaine-Homocysteine S-Methyltransferase Using Intrinsic Tryptophan Fluorescence and Site-Directed Mutagenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castro, C.; Gratson, A.A.; Evans, J.C.

2010-03-05

Betaine-homocysteine S-methyltransferase (BHMT) is a zinc-dependent enzyme that catalyzes the transfer of a methyl group from glycine betaine (Bet) to homocysteine (Hcy) to form dimethylglycine (DMG) and methionine (Met). Previous studies in other laboratories have indicated that catalysis proceeds through the formation of a ternary complex, with a transition state mimicked by the inhibitor S-({delta}-carboxybutyl)-l-homocysteine (CBHcy). Using changes in intrinsic tryptophan fluorescence to determine the affinity of human BHMT for substrates, products, or CBHcy, we now demonstrate that the enzyme-substrate complex reaches its transition state through an ordered bi-bi mechanism in which Hcy is the first substrate to bind andmore » Met is the last product released. Hcy, Met, and CBHcy bind to the enzyme to form binary complexes with K{sub d} values of 7.9, 6.9, and 0.28 {micro}M, respectively. Binary complexes with Bet and DMG cannot be detected with fluorescence as a probe, but Bet and DMG bind tightly to BHMT-Hcy to form ternary complexes with K{sub d} values of 1.1 and 0.73 {micro}M, respectively. Mutation of each of the seven tryptophan residues in human BHMT provides evidence that the enzyme undergoes two distinct conformational changes that are reflected in the fluorescence of the enzyme. The first is induced when Hcy binds, and the second, when Bet binds. As predicted by the crystal structure of BHMT, the amino acids Trp44 and Tyr160 are involved in binding Bet, and Glu159 in binding Hcy. Replacing these residues by site-directed mutagenesis significantly reduces the catalytic efficiency (V{sub max}/K{sub m}) of the enzyme. Replacing Tyr77 with Phe abolishes enzyme activity.« less
DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).

PubMed

Gaus, Michael; Cui, Qiang; Elstner, Marcus

2012-04-10

The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.
Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

NASA Astrophysics Data System (ADS)

Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

2018-02-01

In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.
Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

PubMed

Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

2011-05-03

DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.
Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.
Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

2011-01-01

We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.
Lipid-Coated Gold Nanoparticles and FRET Allow Sensitive Monitoring of Liposome Clustering Mediated by the Synaptotagmin-7 C2A Domain.

PubMed

Hamilton, Desmond J; Coffman, Matthew D; Knight, Jefferson D; Reed, Scott M

2017-09-12

Synaptotagmin (Syt) family proteins contain tandem C2 domains, C2A and C2B, which insert into anionic membranes in response to increased cytosolic Ca 2+ concentration and facilitate exocytosis in neuronal and endocrine cells. The C2A domain from Syt7 binds lipid membranes much more tightly than the corresponding domain from Syt1, but the implications of this difference for protein function are not yet clear. In particular, the ability of the isolated Syt7 C2A domain to initiate membrane apposition and/or aggregation has been previously unexplored. Here, we demonstrate that Syt7 C2A induces apposition and aggregation of liposomes using Förster resonance energy transfer (FRET) assays, dynamic light scattering, and spectroscopic techniques involving lipid-coated gold nanoparticles (LCAuNPs). Protein-membrane binding, membrane apposition, and macroscopic aggregation are three separate phenomena with distinct Ca 2+ requirements: the threshold Ca 2+ concentration for membrane binding is lowest, followed by apposition and aggregation. However, aggregation is highly sensitive to protein concentration and can occur even at submicromolar Syt7 C2A; thus, highly sensitive assays are needed for measuring apposition without complications arising from aggregation. Notably, the localized surface plasmon resonance of the LCAuNP is sensitive to ≤10 nM Syt7 C2A concentrations. Furthermore, when the LCAuNPs were added into a FRET-based liposome apposition assay, the resultant energy transfer increased; possible explanations are discussed. Overall, LCAuNP-based methods allow for highly sensitive detection of protein-induced membrane apposition under conditions that miminize large-scale aggregation.

Tight-binding chains with off-diagonal disorder: Bands of extended electronic states induced by minimal quasi-one-dimensionality

NASA Astrophysics Data System (ADS)

Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava

2016-08-01

It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).
Band nesting, massive Dirac fermions, and valley Landé and Zeeman effects in transition metal dichalcogenides: A tight-binding model

NASA Astrophysics Data System (ADS)

Bieniek, Maciej; Korkusiński, Marek; Szulakowska, Ludmiła; Potasz, Paweł; Ozfidan, Isil; Hawrylak, Paweł

2018-02-01

We present here the minimal tight-binding model for a single layer of transition metal dichalcogenides (TMDCs) MX 2(M , metal; X , chalcogen) which illuminates the physics and captures band nesting, massive Dirac fermions, and valley Landé and Zeeman magnetic field effects. TMDCs share the hexagonal lattice with graphene but their electronic bands require much more complex atomic orbitals. Using symmetry arguments, a minimal basis consisting of three metal d orbitals and three chalcogen dimer p orbitals is constructed. The tunneling matrix elements between nearest-neighbor metal and chalcogen orbitals are explicitly derived at K ,-K , and Γ points of the Brillouin zone. The nearest-neighbor tunneling matrix elements connect specific metal and sulfur orbitals yielding an effective 6 ×6 Hamiltonian giving correct composition of metal and chalcogen orbitals but not the direct gap at K points. The direct gap at K , correct masses, and conduction band minima at Q points responsible for band nesting are obtained by inclusion of next-neighbor Mo-Mo tunneling. The parameters of the next-nearest-neighbor model are successfully fitted to MX 2(M =Mo ; X =S ) density functional ab initio calculations of the highest valence and lowest conduction band dispersion along K -Γ line in the Brillouin zone. The effective two-band massive Dirac Hamiltonian for MoS2, Landé g factors, and valley Zeeman splitting are obtained.
Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

2016-04-13

We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less
Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

NASA Astrophysics Data System (ADS)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.
Electronic couplings for molecular charge transfer: Benchmarking CDFT, FODFT, and FODFTB against high-level ab initio calculations

NASA Astrophysics Data System (ADS)

Kubas, Adam; Hoffmann, Felix; Heck, Alexander; Oberhofer, Harald; Elstner, Marcus; Blumberger, Jochen

2014-03-01

We introduce a database (HAB11) of electronic coupling matrix elements (Hab) for electron transfer in 11 π-conjugated organic homo-dimer cations. High-level ab inito calculations at the multireference configuration interaction MRCI+Q level of theory, n-electron valence state perturbation theory NEVPT2, and (spin-component scaled) approximate coupled cluster model (SCS)-CC2 are reported for this database to assess the performance of three DFT methods of decreasing computational cost, including constrained density functional theory (CDFT), fragment-orbital DFT (FODFT), and self-consistent charge density functional tight-binding (FODFTB). We find that the CDFT approach in combination with a modified PBE functional containing 50% Hartree-Fock exchange gives best results for absolute Hab values (mean relative unsigned error = 5.3%) and exponential distance decay constants β (4.3%). CDFT in combination with pure PBE overestimates couplings by 38.7% due to a too diffuse excess charge distribution, whereas the economic FODFT and highly cost-effective FODFTB methods underestimate couplings by 37.6% and 42.4%, respectively, due to neglect of interaction between donor and acceptor. The errors are systematic, however, and can be significantly reduced by applying a uniform scaling factor for each method. Applications to dimers outside the database, specifically rotated thiophene dimers and larger acenes up to pentacene, suggests that the same scaling procedure significantly improves the FODFT and FODFTB results for larger π-conjugated systems relevant to organic semiconductors and DNA.
Electronic excitations in electron-doped cuprate superconductors

NASA Astrophysics Data System (ADS)

Unger, P.; Fulde, P.

1995-04-01

We calculate the electronic single-particle spectrum of an electron-doped cuprate superconductor such as Nd2-xCexCuO4-y. The dynamics of holes in the Cu-O planes is described by the extended Hubbard or Emery model. We consider the system at half-filling (one hole per unit cell, nh=1) and in the case of electron doping where the ground state is paramagnetic. The projection technique of Mori and Zwanzig is applied to derive the equations of motion for the Green's functions of Cu and O holes. These equations are solved self-consistently as in a previous calculation, where we considered the case of hole doping. At half-filling the system exhibits a charge-transfer gap bounded by Zhang-Rice singlet states and the upper Hubbard band. Upon electron doping the upper Hubbard band crosses the Fermi level and the system becomes metallic. With increasing electron doping the singlet band loses intensity and finally vanishes for nh=0. The corresponding spectral weight is transferred to the upper Hubbard band, which becomes a usual tight-binding band for zero hole concentration. The shape of the flat band crossing the Fermi level fits well to angle-resolved photoemission spectra of Nd2-xCexCuO4-y for x=0.15 and 0.22. Furthermore, our findings are in excellent agreement with exact diagonalization studies of 2×2 CuO2 cluster with periodic boundary conditions.
Effect of disorder on the optical properties of short period superlattices

NASA Technical Reports Server (NTRS)

Strozier, J. A.; Zhang, Y. A.; Horton, C.; Ignatiev, A.; Shih, H. D.

1993-01-01

The optical properties of disordered short period superlattices are studied using a one-dimensional tight-binding model. A difference vector and disorder structure factor are proposed to characterize the disordered superlattice. The density of states, participation number, and optical absorption coefficients for both ordered and disordered superlattices are calculated as a function of energy. The results show that introduction of disorder into an indirect band gap material enhances the optical transition near the indirect band edge.
Quasi-bound states in strained graphene

NASA Astrophysics Data System (ADS)

Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David

In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.
Electron doping effects on the electrical conductivity of zigzag carbon nanotubes and corresponding unzipped armchair graphene nanoribbons

NASA Astrophysics Data System (ADS)

Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek

2017-10-01

The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.
Atomic scale simulations of pyrochlore oxides with a tight-binding variable-charge model: implications for radiation tolerance.

PubMed

Sattonnay, G; Tétot, R

2014-02-05

Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.
Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Spin Transfer Torque in Spin Filter Tunnel Junctions

NASA Astrophysics Data System (ADS)

Ortiz Pauyac, Christian; Kalitsov, Alan; Manchon, Aurelien; Chshiev, Mair

2014-03-01

STT in MTJs is well known for its potential spin electronic applications. However, recently a new class of MTJs based on spin filtering across magnetic insulators (SFTJ) has been attracting much attention since in such MTJs electrons with a certain spin orientation tunnel much more efficiently. In this structure, STT remains to be addressed and clarified. Here we present a systematic study of its angular and voltage bias dependences consisting of one or two FM layers separated by a magnetic insulator (MI). The calculations were performed within the tight-binding model using NEGF technique in the framework of Keldysh formalism. We predict that STT is higher in magnitude compared to regular MTJs, which strongly depends in the relative directions of the magnetic states of the free layer (FM2) and MI. Namely, in case of parallel orientation of MI and FM2 moments in a FM1|MI|FM2 structure, the system behaves as a regular MTJ with a modest increase of STT magnitude. However, as the angle between MI and FM2 moments increases, the field-like torque becomes three orders of magnitude higher than the Slonczewski component and oscillates with bias as band-filling increases. This may have practical implications.
Rashba spin-orbit coupling and orbital chirality in magnetic bilayers

NASA Astrophysics Data System (ADS)

Lee, Hyun-Woo

2013-03-01

The phenomenon of the Rashba spin-orbit coupling is examined theoretically for an ultrathin magnetic layer in contact with a non-magnetic heavy metal layer. From first-principles calculation, large Rashba parameter of order 1 eV .Å is obtained, which is strong enough to generate large spin transfer torque of spin-orbit coupling origin. Large Rashba parameter is attributed to the orbital mixing of 3 d magnetic atoms and non-magnetic heavy elements with significant atomic spin-orbit coupling. Interestingly the magnitude and sign of the parameter vary from energy bands to bands, which we attribute to band-specific chiral ordering of orbital angular momentum. Through a simple tight-binding model analysis, we demonstrate that d-orbital hybridization allowed by the breaking of structural inversion symmetry generates band-specific chiral ordering of orbital angular momentum, which combines with atomic spin-orbit coupling to give rise to band-specific Rashba parameter. The band-dependence of the Rashba parameter is discussed in connection with recent experiments and we argue that the dependence may be utilized to enhance device application potentials. This work is supported by NRF grant (2010-0008529, 2011-0015631, 2010-0014109, 2011-0030789).
Modification of quinone electrochemistry by the proteins in the biological electron transfer chains: examples from photosynthetic reaction centers

PubMed Central

Gunner, M. R.; Madeo, Jennifer; Zhu, Zhenyu

2009-01-01

Quinones such as ubiquinone are the lipid soluble electron and proton carriers in the membranes of mitochondria, chloroplasts and oxygenic bacteria. Quinones undergo controlled redox reactions bound to specific sites in integral membrane proteins such as the cytochrome bc1 oxidoreductase. The quinone reactions in bacterial photosynthesis are amongst the best characterized, presenting a model to understand how proteins modulate cofactor chemistry. The free energy of ubiquinone redox reactions in aqueous solution and in the QA and QB sites of the bacterial photosynthetic reaction centers (RCs) are compared. In the primary QA site ubiquinone is reduced only to the anionic semiquinone (Q•−) while in the secondary QB site the product is the doubly reduced, doubly protonated quinol (QH2). The ways in which the protein modifies the relative energy of each reduced and protonated intermediate are described. For example, the protein stabilizes Q•− while destabilizing Q= relative to aqueous solution through electrostatic interactions. In addition, kinetic and thermodynamic mechanisms for stabilizing the intermediate semiquinones are compared. Evidence for the protein sequestering anionic compounds by slowing both on and off rates as well as by binding the anion more tightly is reviewed. PMID:18979192
Dynamics simulations for engineering macromolecular interactions

PubMed Central

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-01-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions. PMID:23822508
The relationship between water binding and desiccation tolerance in tissues

NASA Technical Reports Server (NTRS)

Vertucci, C. W.; Leopold, A. C.

1987-01-01

In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.
Molecular dynamics simulations of the amino acid-ZnO (10-10) interface: a comparison between density functional theory and density functional tight binding results.

PubMed

grosse Holthaus, Svea; Köppen, Susan; Frauenheim, Thomas; Ciacchi, Lucio Colombi

2014-06-21

We investigate the adsorption behavior of four different amino acids (glutamine, glutamate, serine, cysteine) on the zinc oxide (101̄0) surface, comparing the geometry and energy associated with a number of different adsorption configurations. In doing this, we highlight the benefits and limits of using density-functional tight-binding (DFTB) with respect to standard density functional theory (DFT). The DFTB method is found to reliably reproduce the DFT adsorption geometries. Analysis of the adsorption configurations emphasizes the fundamental role of the first hydration layer in mediating the interactions between the amino acids and the surface. Direct surface-molecule bonds are found to form predominantly via the carboxylate groups of the studied amino acids. No surface-mediated chemical reactions are observed, with the notable exception of a proton transfer from the thiol group of cysteine to a hydroxyl group of the surface hydration layer. The adsorption energies are found to be dominated both by the formation of direct or indirect surface-molecule hydrogen bonds, but also by the rearrangement of the hydrogen-bond network in surface proximity in a non-intuitive way. Energetic comparisons between DFTB and DFT are made difficult on one side by the long time necessary to achieve convergence of potential energy values in MD simulations and on the other side by the necessity of including higher-order corrections to DFTB to obtain a good description of the hydrogen bond energetics. Overall, our results suggest that DFTB is a good reference method to set the correct chemical states and the initial geometries of hybrid biomolecule/ZnO systems to be simulated with non-reactive force fields.
Molecular dynamics simulations of the amino acid-ZnO (10-10) interface: A comparison between density functional theory and density functional tight binding results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holthaus, Svea große; Köppen, Susan, E-mail: koeppen@hmi.uni-bremen.de; Frauenheim, Thomas

2014-06-21

We investigate the adsorption behavior of four different amino acids (glutamine, glutamate, serine, cysteine) on the zinc oxide (101{sup ¯}0) surface, comparing the geometry and energy associated with a number of different adsorption configurations. In doing this, we highlight the benefits and limits of using density-functional tight-binding (DFTB) with respect to standard density functional theory (DFT). The DFTB method is found to reliably reproduce the DFT adsorption geometries. Analysis of the adsorption configurations emphasizes the fundamental role of the first hydration layer in mediating the interactions between the amino acids and the surface. Direct surface-molecule bonds are found to formmore » predominantly via the carboxylate groups of the studied amino acids. No surface-mediated chemical reactions are observed, with the notable exception of a proton transfer from the thiol group of cysteine to a hydroxyl group of the surface hydration layer. The adsorption energies are found to be dominated both by the formation of direct or indirect surface-molecule hydrogen bonds, but also by the rearrangement of the hydrogen-bond network in surface proximity in a non-intuitive way. Energetic comparisons between DFTB and DFT are made difficult on one side by the long time necessary to achieve convergence of potential energy values in MD simulations and on the other side by the necessity of including higher-order corrections to DFTB to obtain a good description of the hydrogen bond energetics. Overall, our results suggest that DFTB is a good reference method to set the correct chemical states and the initial geometries of hybrid biomolecule/ZnO systems to be simulated with non-reactive force fields.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less
Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

PubMed

Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

Understanding the length dependence of molecular junction thermopower.

PubMed

Karlström, Olov; Strange, Mikkel; Solomon, Gemma C

2014-01-28

Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.
The behavior of exciplex decay processes and interplay of radiationless transition and preliminary reorganization mechanisms of electron transfer in loose and tight pairs of reactants.

PubMed

Kuzmin, Michael G; Soboleva, Irina V; Dolotova, Elena V

2007-01-18

Exciplex emission spectra and rate constants of their decay via internal conversion and intersystem crossing are studied and discussed in terms of conventional radiationless transition approach. Exciplexes of 9-cyanophenanthrene with 1,2,3-trimethoxybenzene and 1,3,5-trimethoxybenzene were studied in heptane, toluene, butyl acetate, dichloromethane, butyronitrile, and acetonitrile. A better description of spectra and rate constants is obtained using 0-0 transition energy and Gauss broadening of vibrational bands rather than the free energy of electron transfer and reorganization energy. The coincidence of parameters describing exciplex emission spectra and dependence of exciplex decay rate constants on energy gap gives the evidence of radiationless quantum transition mechanism rather than thermally activated medium reorganization mechanism of charge recombination in exciplexes and excited charge transfer complexes (contact radical ion pairs) as well as in solvent separated radical ion pairs. Radiationless quantum transition mechanism is shown to provide an appropriate description also for the main features of exergonic excited-state charge separation reactions if fast mutual transformations of loose and tight pairs of reactants are considered. In particular, very fast electron transfer (ET) in tight pairs of reactants with strong electronic coupling of locally excited and charge transfer states can prevent the observation of an inverted region in bimolecular excited-state charge separation even for highly exergonic reactions.
Structural insights into the methyl donor recognition model of a novel membrane-binding protein UbiG.

PubMed

Zhu, Yuwei; Jiang, Xuguang; Wang, Chongyuan; Liu, Yang; Fan, Xiaojiao; Zhang, Linjuan; Niu, Liwen; Teng, Maikun; Li, Xu

2016-03-15

UbiG is a SAM-dependent O-methyltransferase, catalyzing two O-methyl transfer steps for ubiquinone biosynthesis in Escherichia coli. UbiG possesses a unique sequence insertion between β4 and α10, which is used for membrane lipid interaction. Interestingly, this sequence insertion also covers the methyl donor binding pocket. Thus, the relationship between membrane binding and entrance of the methyl donor of UbiG during the O-methyl transfer process is a question that deserves further exploration. In this study, we reveal that the membrane-binding region of UbiG gates the entrance of methyl donor. When bound with liposome, UbiG displays an enhanced binding ability toward the methyl donor product S-adenosylhomocysteine. We further employ protein engineering strategies to design UbiG mutants by truncating the membrane interacting region or making it more flexible. The ITC results show that the binding affinity of these mutants to SAH increases significantly compared with that of the wild-type UbiG. Moreover, we determine the structure of UbiG∆(165-187) in complex with SAH. Collectively, our results provide a new angle to cognize the relationship between membrane binding and entrance of the methyl donor of UbiG, which is of benefit for better understanding the O-methyl transfer process for ubiquinone biosynthesis.
Using FRET to Measure the Angle at Which a Protein Bends DNA: TBP Binding a TATA Box as a Model System

ERIC Educational Resources Information Center

Kugel, Jennifer F.

2008-01-01

An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…
Time-dependent density-functional tight-binding method with the third-order expansion of electron density

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less
Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

PubMed

Nishimoto, Yoshio

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.
Investigating molecule-semiconductor interfaces with nonlinear spectroscopies

NASA Astrophysics Data System (ADS)

Giokas, Paul George

Knowledge of electronic structures and transport mechanisms at molecule-semiconductor interfaces is motivated by their ubiquity in photoelectrochemical cells. In this dissertation, optical spectroscopies are used uncover the influence of electronic coupling, coherent vibrational motion, and molecular geometry, and other factors on dynamics initiated by light absorption at such interfaces. These are explored for a family of ruthenium bipyridyl chromophores bound to titanium dioxide. Transient absorption measurements show molecular singlet state electron injection in 100 fs or less. Resonance Raman intensity analysis suggests the electronic excitations possess very little charge transfer character. The connections drawn in this work between molecular structure and photophysical behavior contribute to the general understanding of photoelectrochemical cells. Knowledge of binding geometry in nanocrystalline films is challenged by heterogeneity of semiconductor surfaces. Polarized resonance Raman spectroscopy is used to characterize the ruthenium chromophore family on single crystal titanium dioxide . Chromophores display a broad distribution of molecular geometries at the interface, with increased variation in binding angle due to the presence of a methylene bridge, as well as additional phosphonate anchors. This result implies multiple binding configurations for chromophores which incorporate multiple phosphonate ligands, and indicates the need for careful consideration when developing surface-assembled chromophore-catalyst cells. Electron transfer transitions occurring on the 100 fs time scale challenge conventional second-order approximations made when modeling these reactions. A fourth-order perturbative model which includes the relationship between coincident electron transfer and nuclear relaxation processes is presented. Insights provided by the model are illustrated for a two-level donor molecule. The presented fourth-order rate formula constitutes a rigorous and intuitive framework for understanding sub-picosecond photoinduced electron transfer dynamics. Charge transfer systems fit by this model include catechol-sensitized titanium dioxide nanoparticles and a closely-related molecular complex. These systems exhibit vibrational coherence coincident with back-electron transfer in the first picosecond after excitation, which suggests that intramolecular nuclear motion strongly influences the electronic transfer process and plays an important role in the dynamics of interfacial systems following light absorption.
Numerical modelling of heat transfer in a cavity due to liquid jet impingement for liquid supported stretch blow moulding

NASA Astrophysics Data System (ADS)

Smyth, Trevor; Menary, Gary; Geron, Marco

2018-05-01

Impingement of a liquid jet in a polymer cavity has been modelled numerically in this study. Liquid supported stretch blow moulding is a nascent polymer forming process using liquid as the forming medium to produce plastic bottles. The process derives from the conventional stretch blow moulding process which uses compressed air to deform the preform. Heat transfer away from the preform greatly increases when a liquid instead of a gas is flowing over a solid; in the blow moulding process the temperature of the preform is tightly controlled to achieve optimum forming conditions. A model was developed with Computational Fluid Dynamics code ANSYS Fluent which allows the extent of heat transfer between the incoming liquid and the solid preform to be determined in the initial transient stage, where a liquid jet enters an air filled preform. With this data, an approximation of the extent of cooling through the preform wall can be determined.
Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

PubMed

Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

2008-10-15

Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.
Deuterium isotope effects on methyl transfer to alcohols. Possible asynchronous solvent repolarization and internal structural changes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, J.L.; Lee, J.; Rhodes, S.

1981-12-16

Alkyl substitution on nucleophilic oxygen causes large changes in the H/sub 2/O/D/sub 2/O kinetic isotope effect (KIE) on methyl transfers to water: ROL + CH/sub 3/X..-->.. RLO/sup +/ CH/sub 3/ + X/sup -/ with L=H,D; R=L. For both Meth/sup +/ and MeOClO/sub 3/, KIE for CH/sub 3/OL is greater than KIE for L/sub 2/O. When the methyl transfer is to L/sub 2/O, the small, strongly hydrogen-bonding L/sub 2/O/sup +/ moiety in the product will be very tightly solvated, and such tight solvation implies a strong coupling force between solvent polarization and internal charge distribution. (MWF)
Modeling direct interband tunneling. II. Lower-dimensional structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Andrew, E-mail: pandrew@ucla.edu; Chui, Chi On; California NanoSystems Institute, University of California, Los Angeles, Los Angeles, California 90095

We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.
Superresolution imaging of transcription units on newt lampbrush chromosomes

PubMed Central

Kaufmann, Rainer; Cremer, Christoph; Gall, Joseph G.

2013-01-01

We have examined transcription loops on lampbrush chromosomes of the newt Notophthalmus by superresolution microscopy. Because of the favorable, essentially two-dimensional morphology of these loops, an average optical resolution in the x-y plane of about 50 nm was achieved. We analyzed the distribution of the multifunctional RNA-binding protein CELF1 on specific loops. CELF1 distribution is consistent with a model in which individual transcripts are tightly folded and hence closely packed against the loop axis. PMID:22892678
Chemically Doped Double-Walled Carbon Nanotubes: Cylindrical Molecular Capacitors

NASA Astrophysics Data System (ADS)

Chen, Gugang; Bandow, S.; Margine, E. R.; Nisoli, C.; Kolmogorov, A. N.; Crespi, Vincent H.; Gupta, R.; Sumanasekera, G. U.; Iijima, S.; Eklund, P. C.

2003-06-01

A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.
Chemically doped double-walled carbon nanotubes: cylindrical molecular capacitors.

PubMed

Chen, Gugang; Bandow, S; Margine, E R; Nisoli, C; Kolmogorov, A N; Crespi, Vincent H; Gupta, R; Sumanasekera, G U; Iijima, S; Eklund, P C

2003-06-27

A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.
Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.
Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

NASA Astrophysics Data System (ADS)

de Moura, F. A. B. F.; Lyra, M. L.; de Almeida, M. L.; Ourique, G. S.; Fulco, U. L.; Albuquerque, E. L.

2016-10-01

We determine, by using a tight-binding model Hamiltonian, the characteristic current-voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation.
Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

PubMed Central

Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682
Tricellulin, occludin and claudin-3 expression in salmon intestine and kidney during salinity adaptation.

PubMed

Tipsmark, C K; Madsen, S S

2012-08-01

Molecular regulation of tight junctions in osmoregulatory epithelia of euryhaline fishes must be extensive during ontogeny and acclimation to salinity changes. In this study, five tight junction proteins were examined in Atlantic salmon (Salmo salar): tight junction associated tricellulin, occludin and claudin-3 isoforms (a, b, c). A survey of tissue distribution in freshwater (FW) salmon showed that tricellulin expression was highest in the intestine. Occludin was detected in tissues with importance for epithelial transport and the order of expression was gill>intestine>kidney. The three claudin-3 isoforms were expressed at highest level in kidney tissue. Transfer of juvenile FW salmon to seawater (SW) elevated intestinal tricellulin and occludin mRNA, and these transcripts were also elevated at the time of best SW-tolerance during the course of smoltification. In the kidney, expression of tricellulin and claudin-3 isoforms was elevated after SW-transfer and tricellulin, occludin, claudin-3a and -3b increased in March before the peak smolt stage. In the gill, none of the examined tight junction proteins were impacted by SW-transfer. The data suggest that expression of tricellulin and occludin is dynamically involved in reorganization of intestinal epithelium and possibly changed paracellular permeability during SW-acclimation. The increased renal tricellulin and claudin-3 expression in SW suggests a role in remodeling of the kidney during SW-acclimation. Copyright © 2012 Elsevier Inc. All rights reserved.
Direct detection of ligand binding to Sepharose-immobilised protein using saturation transfer double difference (STDD) NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haselhorst, Thomas; Muenster-Kuehnel, Anja K.; Oschlies, Melanie

2007-08-10

We report an easy and direct application of 'Saturation Transfer Double Difference' (STDD) NMR spectroscopy to identify ligands that bind to a Sepharose-immobilised target protein. The model protein, cytidine 5'-monophosphate sialic acid (CMP-Sia) synthetase, was expressed as a Strep-Tag II fusion protein and immobilised on Strep-Tactin Sepharose. STD NMR experiments of the protein-enriched Sepharose matrix in the presence of a binding ligand (cytidine 5'-triphosphate, CTP) and a non-binding ligand ({alpha}/{beta}-glucose) clearly show that CTP binds to the immobilised enzyme, whereas glucose has no affinity. This approach has three major advantages: (a) only low quantities of protein are required, (b) nomore » specialised NMR technology or the application of additional data analysis by non-routine methods is required, and (c) easy multiple use of the immobilised protein is available.« less
Modeling chain folding in protein-constrained circular DNA.

PubMed Central

Martino, J A; Olson, W K

1998-01-01

An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

PubMed Central

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-01-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042
Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

PubMed

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.
Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

PubMed

Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

2016-10-01

During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Predicting permanent and transient protein-protein interfaces.

PubMed

La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke

2013-05-01

Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.
Comparative Analysis of the Flax Immune Receptors L6 and L7 Suggests an Equilibrium-Based Switch Activation Model

PubMed Central

Chen, Chunhong; Newell, Kim; Lawrence, Gregory J.; Ellis, Jeffrey G.; Anderson, Peter A.; Dodds, Peter N.

2016-01-01

NOD-like receptors (NLRs) are central components of the plant immune system. L6 is a Toll/interleukin-1 receptor (TIR) domain-containing NLR from flax (Linum usitatissimum) conferring immunity to the flax rust fungus. Comparison of L6 to the weaker allele L7 identified two polymorphic regions in the TIR and the nucleotide binding (NB) domains that regulate both effector ligand-dependent and -independent cell death signaling as well as nucleotide binding to the receptor. This suggests that a negative functional interaction between the TIR and NB domains holds L7 in an inactive/ADP-bound state more tightly than L6, hence decreasing its capacity to adopt the active/ATP-bound state and explaining its weaker activity in planta. L6 and L7 variants with a more stable ADP-bound state failed to bind to AvrL567 in yeast two-hybrid assays, while binding was detected to the signaling active variants. This contrasts with current models predicting that effectors bind to inactive receptors to trigger activation. Based on the correlation between nucleotide binding, effector interaction, and immune signaling properties of L6/L7 variants, we propose that NLRs exist in an equilibrium between ON and OFF states and that effector binding to the ON state stabilizes this conformation, thereby shifting the equilibrium toward the active form of the receptor to trigger defense signaling. PMID:26744216
Universal Sign Control of Coupling in Tight-Binding Lattices

NASA Astrophysics Data System (ADS)

Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

2016-05-01

We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.
Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids

PubMed Central

2015-01-01

Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497
Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl

NASA Astrophysics Data System (ADS)

Azhar, A.; Majidi, M. A.; Nanto, D.

2017-07-01

Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.
Experimentally biased model structure of the Hsc70/auxilin complex: Substrate transfer and interdomain structural change

PubMed Central

Gruschus, James M.; Greene, Lois E.; Eisenberg, Evan; Ferretti, James A.

2004-01-01

A model structure of the Hsc70/auxilin complex has been constructed to gain insight into interprotein substrate transfer and ATP hydrolysis induced conformational changes in the multidomain Hsc70 structure. The Hsc70/auxilin system, which is a member of the Hsp70/Hsp40 chaperone system family, uncoats clathrin-coated vesicles in an ATP hydrolysis-driven process. Incorporating previous results from NMR and mutant binding studies, the auxilin J-domain was docked into the Hsc70 ATPase domain lower cleft using rigid backbone/flexible side chain molecular dynamics, and the Hsc70 substrate binding domain was docked by a similar procedure. For comparison, J-domain and substrate binding domain docking sites were obtained by the rigid-body docking programs DOT and ZDOCK, filtered and ranked by the program ClusPro, and relaxed using the same rigid backbone/flexible side chain dynamics. The substrate binding domain sites were assessed in terms of conserved surface complementarity and feasibility in the context of substrate transfer, both for auxilin and another Hsp40 protein, Hsc20. This assessment favors placement of the substrate binding domain near D152 on the ATPase domain surface adjacent to the J-domain invariant HPD segment, with the Hsc70 interdomain linker in the lower cleft. Examining Hsc70 interdomain energetics, we propose that long-range electrostatic interactions, perhaps due to a difference in the pKa values of bound ATP and ADP, could play a major role in the structural change induced by ATP hydrolysis. Interdomain electrostatic interactions also appear to play a role in stimulation of ATPase activity due to J-domain binding and substrate binding by Hsc70. PMID:15273304
Is DNA a metal, semiconductor or insulator? A theoretical approach

NASA Astrophysics Data System (ADS)

Rey-Gonzalez, Rafael; Fonseca-Romero, Karen; Plazas, Carlos; Grupo de Óptica e Información Cuántica Team

Over the last years, scientific interest for designing and making low dimensional electronic devices with traditional or novel materials has been increased. These experimental and theoretical researches in electronic properties at molecular scale are looking for developing efficient devices able to carry out tasks which are currently done by silicon transistors and devices. Among the new materials DNA strands are highlighted, but the experimental results have been contradictories pointing to behaviors as conductor, semiconductor or insulator. To contribute to the understanding of the origin of the disparity of the measurements, we perform a numerical calculation of the electrical conductance of DNA segments, modeled as 1D disordered finite chains. The system is described into a Tight binding model with nearest neighbor interactions and a s orbital per site. Hydration effects are included as random variations of self-energies. The electronic current as a function of applied bias is calculated using Launder formalism, where the transmission probability is determined into the transfer matrix formalism. We find a conductor-to-semiconductor-to-insulator transition as a function of the three effects taken into account: chain size, intrinsic disorder, and hydration We thank Fundación para la Promoción de la Investigación y la Tecnología, Colombia, and Dirección de Investigación de Bogotá, Universidad Nacional de Colombia, for partial financial support.
Modeling Tight Junction Dynamics and Oscillations

PubMed Central

Kassab, Fuad; Marques, Ricardo Paulino; Lacaz-Vieira, Francisco

2002-01-01

Tight junction (TJ) permeability responds to changes of extracellular Ca2+ concentration. This can be gauged through changes of the transepithelial electrical conductance (G) determined in the absence of apical Na+. The early events of TJ dynamics were evaluated by the fast Ca2+ switch assay (FCSA) (Lacaz-Vieira, 2000), which consists of opening the TJs by removing basal calcium (Ca2+ bl) and closing by returning Ca2+ bl to normal values. Oscillations of TJ permeability were observed when Ca2+ bl is removed in the presence of apical calcium (Ca2+ ap) and were interpreted as resulting from oscillations of a feedback control loop which involves: (a) a sensor (the Ca2+ binding sites of zonula adhaerens), (b) a control unit (the cell signaling machinery), and (c) an effector (the TJs). A mathematical model to explain the dynamical behavior of the TJs and oscillations was developed. The extracellular route (ER), which comprises the paracellular space in series with the submucosal interstitial fluid, was modeled as a continuous aqueous medium having the TJ as a controlled barrier located at its apical end. The ER was approximated as a linear array of cells. The most apical cell is separated from the apical solution by the TJ and this cell bears the Ca2+ binding sites of zonula adhaerens that control the TJs. According to the model, the control unit receives information from the Ca2+ binding sites and delivers a signal that regulates the TJ barrier. Ca2+ moves along the ER according to one-dimensional diffusion following Fick's second law. Across the TJ, Ca2+ diffusion follows Fick's first law. Our first approach was to simulate the experimental results in a semiquantitative way. The model tested against experiment results performed in the frog urinary bladder adequately predicts the responses obtained in different experimental conditions, such as: (a) TJ opening and closing in a FCSA, (b) opening by the presence of apical Ca2+ and attainment of a new steady-state, (c) the escape phase which follows the halt of TJ opening induced by apical Ca2+, (d) the oscillations of TJ permeability, and (e) the effect of Ca2+ ap concentration on the frequency of oscillations. PMID:12149284
An Expanding Range of Functions for the Copper Chaperone/Antioxidant Protein Atox1

PubMed Central

Hatori, Yuta

2013-01-01

Abstract Significance: Antioxidant protein 1 (Atox1 in human cells) is a copper chaperone for the copper export pathway with an essential role in cellular copper distribution. In vitro, Atox1 binds and transfers copper to the copper-transporting ATPases, stimulating their catalytic activity. Inactivation of Atox1 in cells inhibits maturation of secreted cuproenzymes as well as copper export from cells. Recent Advances: Accumulating data suggest that cellular functions of Atox1 are not limited to its copper-trafficking role and may include storage of labile copper, modulation of transcription, and antioxidant defense. The conserved metal binding site of Atox1, CxGC, differs from the metal-binding sites of copper-transporting ATPases and has a physiologically relevant redox potential that equilibrates with the GSH:GSSG pair. Critical Issues: Tight relationship appears to exist between intracellular copper levels and glutathione (GSH) homeostasis. The biochemical properties of Atox1 place it at the intersection of cellular networks that regulate copper distribution and cellular redox balance. Mechanisms through which Atox1 facilitates copper export and contributes to oxidative defense are not fully understood. Future Directions: The current picture of cellular redox homeostasis and copper physiology will be enhanced by further mechanistic studies of functional interactions between the GSH:GSSG pair and copper-trafficking machinery. Antioxid. Redox Signal. 19, 945–957. PMID:23249252
Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.

2012-06-08

Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less
Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

PubMed

Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

2016-11-21

Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Nageswara Rao, B.D.; Kemple, M.D.; Prendergast, F.G.

Aequorin is a protein of low molecular weight (20,000) isolated from the jellyfish Aequorea forskalea which emits blue light upon the binding of Ca/sup 2 +/ ions. This bioluminescence requires neither exogenous oxygen nor any other cofactors. The light emission occurs from an excited state of a chromophore (an imidazolopyrazinone) which is tightly and noncovalently bound to the protein. Apparently the binding of Ca/sup 2 +/ by the protein induces changes in the protein conformation which allow oxygen, already bound or otherwise held by the protein, to react with and therein oxidize the chromophore. The resulting discharged protein remains intact,more » with the Ca/sup 2 +/ and the chromophore still bound, but is incapable of further luminescence. The fluorescence spectrum of this discharged protein and the bioluminescence spectrum of the original charged aequorin are identical. A green fluorescent protein (GFP) of approx. 30,000 mol wt isolated from the same organism, functions in vivo as an acceptor of energy from aequorin and subsequently emits green light. We are applying proton nuclear magnetic resonance (NMR) spectroscopy and fluorescence spectroscopy to examine structural details of, and fluctuations associated with the luminescent reaction of aequorin and the in vivo energy transfer from aequorin to the GFP.« less
Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

PubMed Central

Stefanski, Adrianne L.; McManaman, James L.

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572
Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

PubMed Central

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-01-01

Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539
Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

PubMed

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-08-09

The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.
Surface passivation for tight-binding calculations of covalent solids.

PubMed

Bernstein, N

2007-07-04

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.
Surface passivation for tight-binding calculations of covalent solids

NASA Astrophysics Data System (ADS)

Bernstein, N.

2007-07-01

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

PubMed Central

Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

2013-01-01

Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982
Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

PubMed

Martínez-González, Eduardo; Frontana, Carlos

2014-05-07

In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.
A new efficient method for calculation of Frenkel exciton parameters in molecular aggregates

NASA Astrophysics Data System (ADS)

Plötz, Per-Arno; Niehaus, Thomas; Kühn, Oliver

2014-05-01

The Frenkel exciton Hamiltonian is at the heart of many simulations of excitation energy transfer in molecular aggregates. It separates the aggregate into Coulomb-coupled monomers. Here it is shown that the respective parameters, i.e., monomeric excitation energies and Coulomb couplings between transition densities can be efficiently calculated using time-dependent tight-binding-based density functional theory (TD-DFTB). Specifically, Coulomb couplings are expressed in terms of self-consistently determined Mulliken transition charges. The approach is applied to two dimer systems. First, formaldehyde oxime for which a detailed comparison with standard DFT using the B3LYP and the PBE functionals as well as with SCS-CC2 is provided. Second, the Coulomb coupling is explored in dependence on the intermolecular coordinates for a perylene bisimide dimer. This provides structural evidence for the previously observed biphasic aggregation behavior of this dye.
Copper Metallochaperones

PubMed Central

Robinson, Nigel J.; Winge, Dennis R.

2014-01-01

The current state of knowledge on how copper metallochaperones support the maturation of cuproproteins is reviewed. Copper is needed within mitochondria to supply the CuA and intramembrane CuB sites of cytochrome oxidase, within the trans-Golgi network to supply secreted cuproproteins and within the cytosol to supply superoxide dismutase 1 (Sod1). Subpopulations of copper-zinc superoxide dismutase also localize to mitochondria, the secretory system, the nucleus and, in plants, the chloroplast, which also requires copper for plastocyanin. Prokaryotic cuproproteins are found in the cell membrane and in the periplasm of gram-negative bacteria. Cu(I) and Cu(II) form tight complexes with organic molecules and drive redox chemistry, which unrestrained would be destructive. Copper metallochaperones assist copper in reaching vital destinations without inflicting damage or becoming trapped in adventitious binding sites. Copper ions are specifically released from copper metallochaperones upon contact with their cognate cuproproteins and metal transfer is thought to proceed by ligand substitution. PMID:20205585
Simulation studies of carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

John, David Llewellyn

Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.
Dislocation Onset and Glide in Carbon Nanotubes under Torsion

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Zhang, Dong-Bo; James, Richard

2009-03-01

The torsional plastic response of carbon nanotubes is comprehensively described in the objective molecular dynamics framework [1-3]. It is shown that an (n,m) tube is prone to slip along a nearly-axial helical path, which introduces a distinct (+1,-1) change in the wrapping index. The low energy realization occurs without loss of mass, via nucleation of a 5-7-7-5 dislocation dipole, followed by a nearly-axial glide of the 5-7 dislocation. The onset of plasticity depends not only on chirality but also on handedness. For a given handedness of the applied twist, chiral tubes of opposed handedness are most susceptible to yield. A right-handed applied twist on an armchair (zig-zag) tube leads to a right- (left-) handed tube. [4pt] [1] T. Dumitrica and R.D. James, Objective Molecular Dynamics, Journal of the Mechanics and Physics of Solids 55, 2206 (2007). [0pt] [2] D.-B. Zhang, M. Hua, and T. Dumitrica, Stability of Polycrystalline and Wurtzite Si Nanowires via Symmetry-Adapted Tight-Binding Objective Molecular Dynamics, Journal of Chemical Physics 128, 084104 (2008). [0pt] [3] D.-B. Zhang and T. Dumitrica, Elasticity of Ideal Single-Walled Carbon Nanotubes via Symmetry-Adapted Tight-Binding Objective Modeling, Applied Physics Letters 93, 031919 (2008).
Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

PubMed

Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

2018-06-27

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000 × faster) but accurate (error < 1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.
Quantum Hall effect in ac driven graphene: From the half-integer to the integer case

NASA Astrophysics Data System (ADS)

Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu

2018-01-01

We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.
Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

NASA Astrophysics Data System (ADS)

Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

2018-06-01

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000 × faster) but accurate (error < 1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.
Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2

PubMed Central

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-01-01

Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534
Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.

PubMed

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-11-20

Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.
Specificity and kinetics of alpha-synuclein binding to model membranes determined with fluorescent excited state intramolecular proton transfer (ESIPT) probe.

PubMed

Shvadchak, Volodymyr V; Falomir-Lockhart, Lisandro J; Yushchenko, Dmytro A; Jovin, Thomas M

2011-04-15

Parkinson disease is characterized cytopathologically by the deposition in the midbrain of aggregates composed primarily of the presynaptic neuronal protein α-synuclein (AS). Neurotoxicity is currently attributed to oligomeric microaggregates subjected to oxidative modification and promoting mitochondrial and proteasomal dysfunction. Unphysiological binding to membranes of these and other organelles is presumably involved. In this study, we performed a systematic determination of the influence of charge, phase, curvature, defects, and lipid unsaturation on AS binding to model membranes using a new sensitive solvatochromic fluorescent probe. The interaction of AS with vesicular membranes is fast and reversible. The protein dissociates from neutral membranes upon thermal transition to the liquid disordered phase and transfers to vesicles with higher affinity. The binding of AS to neutral and negatively charged membranes occurs by apparently different mechanisms. Interaction with neutral bilayers requires the presence of membrane defects; binding increases with membrane curvature and rigidity and decreases in the presence of cholesterol. The association with negatively charged membranes is much stronger and much less sensitive to membrane curvature, phase, and cholesterol content. The presence of unsaturated lipids increases binding in all cases. These findings provide insight into the relation between membrane physical properties and AS binding affinity and dynamics that presumably define protein localization in vivo and, thereby, the role of AS in the physiopathology of Parkinson disease.
Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

2010-07-23

Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less
Modifications of adenovirus hexon allow for either hepatocyte detargeting or targeting with potential evasion from Kupffer cells.

PubMed

Prill, Jan-Michael; Espenlaub, Sigrid; Samen, Ulrike; Engler, Tatjana; Schmidt, Erika; Vetrini, Francesco; Rosewell, Amanda; Grove, Nathan; Palmer, Donna; Ng, Philip; Kochanek, Stefan; Kreppel, Florian

2011-01-01

In vivo gene transfer with adenovirus vectors would significantly benefit from a tight control of the adenovirus-inherent liver tropism. For efficient hepatocyte transduction, adenovirus vectors need to evade from Kupffer cell scavenging while delivery to peripheral tissues or tumors could be improved if both scavenging by Kupffer cells and uptake by hepatocytes were blocked. Here, we provide evidence that a single point mutation in the hexon capsomere designed to enable defined chemical capsid modifications may permit both detargeting from and targeting to hepatocytes with evasion from Kupffer cell scavenging. Vector particles modified with small polyethylene glycol (PEG) moieties specifically on hexon exhibited decreased transduction of hepatocytes by shielding from blood coagulation factor binding. Vector particles modified with transferrin or, surprisingly, 5,000 Da PEG or dextran increased hepatocyte transduction up to 18-fold independent of the presence of Kupffer cells. We further show that our strategy can be used to target high-capacity adenovirus vectors to hepatocytes emphasizing the potential for therapeutic liver-directed gene transfer. Our approach may lead to a detailed understanding of the interactions between adenovirus vectors and Kupffer cells, one of the most important barriers for adenovirus-mediated gene delivery.
Microscopic theory of optical absorption in graphene enhanced by lattices of plasmonic nanoparticles

NASA Astrophysics Data System (ADS)

Mueller, Niclas S.; Reich, Stephanie

2018-06-01

We present a microscopic description of plasmon-enhanced optical absorption in graphene, which is based on perturbation theory. We consider the interaction of graphene with a lattice of plasmonic nanoparticles, as was previously realized experimentally. By using tight-binding wave functions for the electronic states of graphene and the dipole approximation for the plasmon, we obtain analytic expressions for the coupling matrix element and enhanced optical absorption. The plasmonic nanostructure induces nonvertical optical transitions in the band structure of graphene with selection rules for the momentum transfer that depend on the periodicity of the plasmonic lattice. The plasmon-mediated optical absorption leads to an anisotropic carrier population around the K point in phase space, which depends on the polarization pattern of the plasmonic near field in the graphene plane. Using Fourier optics, we draw a connection to a macroscopic approach, which is independent from graphene-specific parameters. Each Fourier component of the plasmonic near field corresponds to the momentum transfer of an optical transition. Both approaches lead to the same expression for the integrated optical absorption enhancement, which is relevant for the photocurrent enhancement in graphene-based optoelectronic devices.
Defining protein electrostatic recognition processes

NASA Astrophysics Data System (ADS)

Getzoff, Elizabeth D.; Roberts, Victoria A.

The objective is to elucidate the nature of electrostatic forces controlling protein recognition processes by using a tightly coupled computational and interactive computer graphics approach. The TURNIP program was developed to determine the most favorable precollision orientations for two molecules by systematic search of all orientations and evaluation of the resulting electrostatic interactions. TURNIP was applied to the transient interaction between two electron transfer metalloproteins, plastocyanin and cytochrome c. The results suggest that the productive electron-transfer complex involves interaction of the positive region of cytochrome c with the negative patch of plastocyanin, consistent with experimental data. Application of TURNIP to the formation of the stable complex between the HyHEL-5 antibody and its protein antigen lysozyme showed that long-distance electrostatic forces guide lysozyme toward the HyHEL-5 binding site, but do not fine tune its orientation. Determination of docked antigen/antibody complexes requires including steric as well as electrostatic interactions, as was done for the U10 mutant of the anti-phosphorylcholine antibody S107. The graphics program Flex, a convenient desktop workstation program for visualizing molecular dynamics and normal mode motions, was enhanced. Flex now has a user interface and was rewritten to use standard graphics libraries, so as to run on most desktop workstations.
First-Principles Calculations of Current-Induced Spin-Transfer Torques in Magnetic Domain Walls

NASA Astrophysics Data System (ADS)

Tang, Ling; Xu, Zhijun; Yang, Zejin

2013-05-01

Current-induced spin-transfer torques (STTs) have been studied in Fe, Co and Ni domain walls (DWs) by the method based on the first-principles noncollinear calculations of scattering wavefunctions expanded in the tight-binding linearized muffin-tin orbital (TB-LMTO) basis. The results show that the out-of-plane component of nonadiabatic STT in Fe DW has localized form, which is in contrast to the typical nonlocal oscillating nonadiabatic torques obtained in Co and Ni DWs. Meanwhile, the degree of nonadiabaticity in STT is also much greater for Fe DW. Further, our results demonstrate that compared to the well-known first-order nonadiabatic STT, the torque in the third-order spatial derivative of local spin can better describe the distribution of localized nonadiabatic STT in Fe DW. The dynamics of local spin driven by this third-order torques in Fe DW have been investigated by the Landau-Lifshitz-Gilbert (LLG) equation. The calculated results show that with the same amplitude of STTs the DW velocity induced by this third-order term is about half of the wall speed for the case of the first-order nonadiabatic STT.
Surface Passivation in Empirical Tight Binding

NASA Astrophysics Data System (ADS)

He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

2016-03-01

Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.
Tight-binding approximations to time-dependent density functional theory — A fast approach for the calculation of electronically excited states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig

2016-05-14

We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less
Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals

NASA Astrophysics Data System (ADS)

Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.

2000-02-01

We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.
Theoretical study on the perpendicular anisotropic magnetoresistance using Rashba-type ferromagnetic model

NASA Astrophysics Data System (ADS)

Yahagi, Y.; Miura, D.; Sakuma, A.

2018-05-01

We investigated the anisotropic magnetoresistance (AMR) effects in ferromagnetic-metal multi-layers stacked on non-magnetic insulators in the context of microscopic theory. We represented this situation with tight-binding models that included the exchange and Rashba fields, where the Rashba field was assumed to originate from spin-orbit interactions as junction effects with the insulator. To describe the AMR ratios, the DC conductivity was calculated based on the Kubo formula. As a result, we showed that the Rashba field induced both perpendicular and in-plane AMR effects and that the perpendicular AMR effect rapidly decayed with increasing film thickness.
Hidden order and unconventional superconductivity in URu2Si2

NASA Astrophysics Data System (ADS)

Rau, Jeffrey; Kee, Hae-Young

2012-02-01

The nature of the so-called hidden order in URu2Si2 and the subsequent superconducting phase have remained a puzzle for over two decades. Motivated by evidence for rotational symmetry breaking seen in recent magnetic torque measurements [Okazaki et al. Science 331, 439 (2011)], we derive a simple tight-binding model consistent with experimental Fermi surface probes and ab-initio calculations. From this model we use mean-field theory to examine the variety of hidden orders allowed by existing experimental results, including the torque measurements. We then construct a phase diagram in temperature and pressure and discuss relevant experimental consequences.
STARD4 Membrane Interactions and Sterol Binding

PubMed Central

2016-01-01

The steroidogenic acute regulatory protein-related lipid transfer (START) domain family is defined by a conserved 210-amino acid sequence that folds into an α/β helix-grip structure. Members of this protein family bind a variety of ligands, including cholesterol, phospholipids, sphingolipids, and bile acids, with putative roles in nonvesicular lipid transport, metabolism, and cell signaling. Among the soluble START proteins, STARD4 is expressed in most tissues and has previously been shown to transfer sterol, but the molecular mechanisms of membrane interaction and sterol binding remain unclear. In this work, we use biochemical techniques to characterize regions of STARD4 and determine their role in membrane interaction and sterol binding. Our results show that STARD4 interacts with anionic membranes through a surface-exposed basic patch and that introducing a mutation (L124D) into the Omega-1 (Ω1) loop, which covers the sterol binding pocket, attenuates sterol transfer activity. To gain insight into the attenuating mechanism of the L124D mutation, we conducted structural and biophysical studies of wild-type and L124D STARD4. These studies show that the L124D mutation reduces the conformational flexibility of the protein, resulting in a diminished level of membrane interaction and sterol transfer. These studies also reveal that the C-terminal α-helix, and not the Ω1 loop, partitions into the membrane bilayer. On the basis of these observations, we propose a model of STARD4 membrane interaction and sterol binding and release that requires dynamic movement of both the Ω1 loop and membrane insertion of the C-terminal α-helix. PMID:26168008
Stochastic Model of Supercoiling-Dependent Transcription

NASA Astrophysics Data System (ADS)

Brackley, C. A.; Johnson, J.; Bentivoglio, A.; Corless, S.; Gilbert, N.; Gonnella, G.; Marenduzzo, D.

2016-07-01

We propose a stochastic model for gene transcription coupled to DNA supercoiling, where we incorporate the experimental observation that polymerases create supercoiling as they unwind the DNA helix and that these enzymes bind more favorably to regions where the genome is unwound. Within this model, we show that when the transcriptionally induced flux of supercoiling increases, there is a sharp crossover from a regime where torsional stresses relax quickly and gene transcription is random, to one where gene expression is highly correlated and tightly regulated by supercoiling. In the latter regime, the model displays transcriptional bursts, waves of supercoiling, and up regulation of divergent or bidirectional genes. It also predicts that topological enzymes which relax twist and writhe should provide a pathway to down regulate transcription.
Symposium DD: Low-Dimensional Materials-Synthesis, Assembly, Property Scaling and Modeling. Held in San Francisco, CA on April 9-13, 2007

DTIC Science & Technology

2008-06-01

Ciencia e Ingenieria de los Materiales , Universidad de Costa Rica, San Jose, Costa Rica. We have developed a new unifying tight-binding theory that...Fisico Matem6ticas, Universidad Aut6noma de Nuevo Le6n, San Nicolas de los Garza, Nuevo LeAfA3n, Mexico; 2Chemical Engineering Department and Texas...ORNL), Oak Ridge, Tennessee; 2Departamento de Ciencia de los Materiales e IM y QI, Universidad de Cadiz, Puerto Real, Cadiz, Spain; 3Departamento de
Green's function calculations for semi-infinite carbon nanotubes

NASA Astrophysics Data System (ADS)

John, D. L.; Pulfrey, D. L.

2006-02-01

In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.
Lattice distortion and electron charge redistribution induced by defects in graphene

DOE PAGES

Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...

2016-09-14

Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.
Nonlinear susceptibilities of finite conjugated organic polymers

NASA Technical Reports Server (NTRS)

Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.

1987-01-01

Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.
Multiple Weyl points and the sign change of their topological charges in woodpile photonic crystals

NASA Astrophysics Data System (ADS)

Chang, Ming-Li; Xiao, Meng; Chen, Wen-Jie; Chan, C. T.

2017-03-01

We show that Weyl points with topological charges 1 and 2 can be found in very simple chiral woodpile photonic crystals and the distribution of the charges can be changed by changing the material parameters without altering space-group symmetry. The underlying physics can be understood through a tight-binding model. Gapless surface states and their backscattering immune properties also are demonstrated in these systems. Obtaining Weyl points in these easily fabricated woodpile photonic crystals will facilitate the realization of Weyl point physics in optical and IR frequencies.
Many-body instabilities and mass generation in slow Dirac materials

NASA Astrophysics Data System (ADS)

Triola, Christopher; Zhu, Jian-Xin; Migliori, Albert; Balatsky, Alexander V.

2015-07-01

Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum: the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model, we study the many-body instabilities of these systems and identify regions of parameter space in which the system exhibits spin density wave and charge density wave order.
Molecular dynamics simulations of dense plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, L.A.; Kress, J.D.; Kwon, I.

1993-12-31

We have performed quantum molecular dynamics simulations of hot, dense plasmas of hydrogen over a range of temperatures(0.1-5eV) and densities(0.0625-5g/cc). We determine the forces quantum mechanically from density functional, extended Huckel, and tight binding techniques and move the nuclei according to the classical equations of motion. We determine pair-correlation functions, diffusion coefficients, and electrical conductivities. We find that many-body effects predominate in this regime. We begin to obtain agreement with the OCP and Thomas-Fermi models only at the higher temperatures and densities.
Spin-polarized transport in multiterminal silicene nanodevices

NASA Astrophysics Data System (ADS)

Xu, Ning

2018-01-01

The spin-polarized transport properties of multiterminal silicene nanodevices are studied using the tight binding model and Landauer-Buttier approach. We propose a four-terminal †-shaped junction device and two types of three-terminal T-shaped junction devices, which are made of the crossing of a zigzag and an armchair silicene nanoribbon. If the electrons are injected into the metallic lead, the near-perfect spin polarization with 100% around the Fermi energy can be achieved easily at the other semiconducting leads. Thus the multiterminal silicene nanodevices can act as controllable spin filters.
Representational analysis of extended disorder in atomistic ensembles derived from total scattering data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neilson, James R.; McQueen, Tyrel M.

With the increased availability of high-intensity time-of-flight neutron and synchrotron X-ray scattering sources that can access wide ranges of momentum transfer, the pair distribution function method has become a standard analysis technique for studying disorder of local coordination spheres and at intermediate atomic separations. In some cases, rational modeling of the total scattering data (Bragg and diffuse) becomes intractable with least-squares approaches, necessitating reverse Monte Carlo simulations using large atomistic ensembles. However, the extraction of meaningful information from the resulting atomistic ensembles is challenging, especially at intermediate length scales. Representational analysis is used here to describe the displacements of atomsmore » in reverse Monte Carlo ensembles from an ideal crystallographic structure in an approach analogous to tight-binding methods. Rewriting the displacements in terms of a local basis that is descriptive of the ideal crystallographic symmetry provides a robust approach to characterizing medium-range order (and disorder) and symmetry breaking in complex and disordered crystalline materials. Lastly, this method enables the extraction of statistically relevant displacement modes (orientation, amplitude and distribution) of the crystalline disorder and provides directly meaningful information in a locally symmetry-adapted basis set that is most descriptive of the crystal chemistry and physics.« less
Phase-breaking effect on polaron transport in organic conjugated polymers

DOE PAGES

Meng, Ruixuan; Yin, Sun; Zheng, Yujun; ...

2017-06-15

Despite intense investigations and many accepted viewpoints on theory and experiment, the coherent and incoherent carrier transport in organic semiconductors remains an unsettled topic due to the strong electron-phonon coupling. Based on the tight-binding Su-Schrieffer-Heeger (SSH) model combined with a non-adiabatic dynamics method, we study the effect of phase-breaking on polaron transport by introducing a group of phase-breaking factors into π-electron wave-functions in organic conjugated polymers. Two approaches are applied: the modification of the transfer integral and the phase-breaking addition to the wave-function. Within the former, it is found that a single site phase-breaking can trap a polaron. However, withmore » a larger regular phase-breaking a polaron becomes more delocalized and lighter. Additionally, a group of disordered phase-breaking factors can make the polaron disperse in transport process. Within the latter approach, we show that the phase-breaking can render the delocalized state in valence band discrete and the state in the gap more localized. Consequently, the phase-breaking frequency and intensity can reduce the stability of a polaron. Furthermore, the phase-breaking in organic systems is the main factor that degrades the coherent transport and destroys the carrier stability.« less
Representational analysis of extended disorder in atomistic ensembles derived from total scattering data

DOE PAGES

Neilson, James R.; McQueen, Tyrel M.

2015-09-20

With the increased availability of high-intensity time-of-flight neutron and synchrotron X-ray scattering sources that can access wide ranges of momentum transfer, the pair distribution function method has become a standard analysis technique for studying disorder of local coordination spheres and at intermediate atomic separations. In some cases, rational modeling of the total scattering data (Bragg and diffuse) becomes intractable with least-squares approaches, necessitating reverse Monte Carlo simulations using large atomistic ensembles. However, the extraction of meaningful information from the resulting atomistic ensembles is challenging, especially at intermediate length scales. Representational analysis is used here to describe the displacements of atomsmore » in reverse Monte Carlo ensembles from an ideal crystallographic structure in an approach analogous to tight-binding methods. Rewriting the displacements in terms of a local basis that is descriptive of the ideal crystallographic symmetry provides a robust approach to characterizing medium-range order (and disorder) and symmetry breaking in complex and disordered crystalline materials. Lastly, this method enables the extraction of statistically relevant displacement modes (orientation, amplitude and distribution) of the crystalline disorder and provides directly meaningful information in a locally symmetry-adapted basis set that is most descriptive of the crystal chemistry and physics.« less
Phase-breaking effect on polaron transport in organic conjugated polymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng, Ruixuan; Yin, Sun; Zheng, Yujun

Despite intense investigations and many accepted viewpoints on theory and experiment, the coherent and incoherent carrier transport in organic semiconductors remains an unsettled topic due to the strong electron-phonon coupling. Based on the tight-binding Su-Schrieffer-Heeger (SSH) model combined with a non-adiabatic dynamics method, we study the effect of phase-breaking on polaron transport by introducing a group of phase-breaking factors into π-electron wave-functions in organic conjugated polymers. Two approaches are applied: the modification of the transfer integral and the phase-breaking addition to the wave-function. Within the former, it is found that a single site phase-breaking can trap a polaron. However, withmore » a larger regular phase-breaking a polaron becomes more delocalized and lighter. Additionally, a group of disordered phase-breaking factors can make the polaron disperse in transport process. Within the latter approach, we show that the phase-breaking can render the delocalized state in valence band discrete and the state in the gap more localized. Consequently, the phase-breaking frequency and intensity can reduce the stability of a polaron. Furthermore, the phase-breaking in organic systems is the main factor that degrades the coherent transport and destroys the carrier stability.« less
Quaternary Structure of the Oxaloacetate Decarboxylase Membrane Complex and Mechanistic Relationships to Pyruvate Carboxylases*

PubMed Central

Balsera, Monica; Buey, Ruben M.; Li, Xiao-Dan

2011-01-01

The oxaloacetate decarboxylase primary Na+ pump (OAD) is an essential membrane protein complex that functions in the citrate fermentation pathway of some pathogenic bacteria under anaerobic conditions. OAD contains three different subunits: Oad-α, a biotinylated extrinsic protein that catalyzes the α-ketodecarboxylation of oxaloacetate; Oad-γ, a structural bitopic membrane protein whose cytosolic tail (named as Oad-γ′) binds tightly to Oad-α; and Oad-β, a multispan transmembrane α-helical protein that constitutes the Na+ channel. How OAD is organized structurally at the membrane and what the molecular determinants are that lead to an efficient energy coupling mechanism remain elusive. In the present work, we elucidate the stoichiometry of the native complex as well as the low resolution structure of the peripheral components of OAD (Oad-α and Oad-γ′) by small angle x-ray scattering. Our results point to a quaternary assembly similar to the pyruvate carboxylase complex organization. Herein, we propose a model in which the association in pairs of Oad-α dimers, mediated by Oad-γ, results in the acquisition of a functional oligomeric state at the bacterial membrane. New structural insights for the conformational rearrangements associated with the carboxylbiotin transfer reaction within OAD are provided. PMID:21209096
The Mitochondrial Protein Import Component, TRANSLOCASE OF THE INNER MEMBRANE17-1, Plays a Role in Defining the Timing of Germination in Arabidopsis1[W][OPEN

PubMed Central

Wang, Yan; Law, Simon R.; Ivanova, Aneta; van Aken, Olivier; Kubiszewski-Jakubiak, Szymon; Uggalla, Vindya; van der Merwe, Margaretha; Duncan, Owen; Narsai, Reena; Whelan, James; Murcha, Monika W.

2014-01-01

In Arabidopsis (Arabidopsis thaliana), small gene families encode multiple isoforms for many of the components of the mitochondrial protein import apparatus. There are three isoforms of the TRANSLOCASE OF THE INNER MEMBRANE17 (Tim17). Transcriptome analysis indicates that AtTim17-1 is only detectable in dry seed. In this study, two independent transfer DNA insertional mutant lines of tim17-1 exhibited a germination-specific phenotype, showing a significant increase in the rate of germination. Microarray analyses revealed that Attim17-1 displayed alterations in the temporal sequence of transcriptomic events during germination, peaking earlier compared with the wild type. Promoter analysis of AtTim17-1 further identified an abscisic acid (ABA)-responsive element, which binds ABA-responsive transcription factors, acting to repress the expression of AtTim17-1. Attim17-1 dry seeds contained significantly increased levels of ABA and gibberellin, 2- and 5-fold, respectively. These results support the model that mitochondrial biogenesis is regulated in a tight temporal sequence of events during germination and that altering mitochondrial biogenesis feeds back to alter the germination rate, as evidenced by the altered levels of the master regulatory hormones that define germination. PMID:25253887
Thermodynamics of cooperative binding of FAD to human NQO1: Implications to understanding cofactor-dependent function and stability of the flavoproteome.

PubMed

Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis

2017-12-15

The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.

Kinetics of bacterial phospholipase C activity at micellar interfaces: effect of substrate aggregate microstructure and a model for the kinetic parameters.

PubMed

Singh, Jasmeet; Ranganathan, Radha; Hajdu, Joseph

2008-12-25

Activity at micellar interfaces of bacterial phospholipase C from Bacillus cereus on phospholipids solubilized in micelles was investigated with the goal of elucidating the role of the interface microstructure and developing further an existing kinetic model. Enzyme kinetics and physicochemical characterization of model substrate aggregates were combined, thus enabling the interpretation of kinetics in the context of the interface. Substrates were diacylphosphatidylcholine of different acyl chain lengths in the form of mixed micelles with dodecyldimethylammoniopropanesulfonate. An early kinetic model, reformulated to reflect the interfacial nature of the kinetics, was applied to the kinetic data. A better method of data treatment is proposed, use of which makes the presence of microstructure effects quite transparent. Models for enzyme-micelle binding and enzyme-lipid binding are developed, and expressions incorporating the microstructural properties are derived for the enzyme-micelle dissociation constant K(s) and the interface Michaelis-Menten constant, K(M). Use of these expressions in the interface kinetic model brings excellent agreement between the kinetic data and the model. Numerical values for the thermodynamic and kinetic parameters are determined. Enzyme-lipid binding is found to be an activated process with an acyl chain length dependent free energy of activation that decreases with micelle lipid molar fraction with a coefficient of about -15RT and correlates with the tightness of molecular packing in the substrate aggregate. Thus, the physical insight obtained includes a model for the kinetic parameters that shows that these parameters depend on the substrate concentration and acyl chain length of the lipid. Enzyme-micelle binding is indicated to be hydrophobic and solvent mediated with a dissociation constant of 1.2 mM.
Tight-binding molecular-dynamics study of point defects in GaAs

NASA Astrophysics Data System (ADS)

Seong, Hyangsuk; Lewis, Laurent J.

1995-08-01

Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.
Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.

PubMed

Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-14

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.
Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.

PubMed

Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel

2018-02-13

Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots

NASA Astrophysics Data System (ADS)

Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-01

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.
Development of an in vitro cell culture model to study milk to plasma ratios of therapeutic drugs.

PubMed

Athavale, Maithili A; Maitra, Anurupa; Patel, Shahnaz; Bhate, Vijay R; Toddywalla, Villi S

2013-01-01

To create an in vitro cell culture model to predict the M/P (concentration of drug in milk/concentration in maternal plasma) ratios of therapeutic drugs viz. rifampicin, theophylline, paracetamol, and aspirin. An in vitro cell culture model using CIT3 cells (mouse mammary epithelial cells) was created by culturing the cells on transwells. The cells formed an integral monolayer, allowing only transcellular transport as it happens in vivo. Functionality of the cells was confirmed through scanning electron microscopy. Time wise transfer of the study drugs from plasma to milk was studied and compared with actual (in vivo) M/P ratios obtained at reported tmax for the respective drugs. The developed model mimicked two important intrinsic factors of mammary epithelial cells viz. secretory and tight-junction properties and also the passive route of drug transport. The in vitro M/P ratios at reported tmax were 0.23, 0.61, 0.87, and 0.03 respectively, for rifampicin, theophylline, paracetamol, and salicylic acid as compared to 0.29, 0.65, 0.65, and 0.22, respectively, in vitro. Our preliminary effort to develop an in vitro physiological model showed promising results. Transfer rate of the drugs using the developed model compared well with the transfer potential seen in vivo except for salicylic acid, which was transferred in far lower concentration in vitro. The model has a potential to be developed as a non-invasive alternative to the in vitro technique for determining the transfer of therapeutic drugs into breast milk.
Identification of a regulation network in response to cadmium toxicity using blood clam Tegillarca granosa as model

PubMed Central

Bao, Yongbo; Liu, Xiao; Zhang, Weiwei; Cao, Jianping; Li, Wei; Li, Chenghua; Lin, Zhihua

2016-01-01

Clam, a filter-feeding lamellibranch mollusk, is capable to accumulate high levels of trace metals and has therefore become a model for investigation the mechanism of heavy metal toxification. In this study, the effects of cadmium were characterized in the gills of Tegillarca granosa during a 96-hour exposure course using integrated metabolomic and proteomic approaches. Neurotoxicity and disturbances in energy metabolism were implicated according to the metabolic responses after Cd exposure, and eventually affected the osmotic function of gill tissue. Proteomic analysis showed that oxidative stress, calcium-binding and sulfur-compound metabolism proteins were key factors responding to Cd challenge. A knowledge-based network regulation model was constructed with both metabolic and proteomic data. The model suggests that Cd stimulation mainly inhibits a core regulation network that is associated with histone function, ribosome processing and tight junctions, with the hub proteins actin, gamma 1 and Calmodulin 1. Moreover, myosin complex inhibition causes abnormal tight junctions and is linked to the irregular synthesis of amino acids. For the first time, this study provides insight into the proteomic and metabolomic changes caused by Cd in the blood clam T. granosa and suggests a potential toxicological pathway for Cd. PMID:27760991
From non-covalent binding to irreversible DNA lesions: nile blue and nile red as photosensitizing agents

PubMed Central

Gattuso, Hugo; Besancenot, Vanessa; Grandemange, Stéphanie; Marazzi, Marco; Monari, Antonio

2016-01-01

We report a molecular modeling study, coupled with spectroscopy experiments, on the behavior of two well known organic dyes, nile blue and nile red, when interacting with B-DNA. In particular, we evidence the presence of two competitive binding modes, for both drugs. However their subsequent photophysical behavior is different and only nile blue is able to induce DNA photosensitization via an electron transfer mechanism. Most notably, even in the case of nile blue, its sensitization capabilities strongly depend on the environment resulting in a single active binding mode: the minor groove. Fluorescence spectroscopy confirms the presence of competitive interaction modes for both sensitizers, while the sensitization via electron transfer, is possible only in the case of nile blue. PMID:27329409
Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.
Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.
Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.
Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordejon, P.; Lebedenko, D.; Menon, M.

1994-08-15

We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v
Phenylalanine transfer across the isolated perfused human placenta: an experimental and modeling investigation

PubMed Central

Lofthouse, E. M.; Perazzolo, S.; Brooks, S.; Crocker, I. P.; Glazier, J. D.; Johnstone, E. D.; Panitchob, N.; Sibley, C. P.; Widdows, K. L.; Sengers, B. G.

2015-01-01

Membrane transporters are considered essential for placental amino acid transfer, but the contribution of other factors, such as blood flow and metabolism, is poorly defined. In this study we combine experimental and modeling approaches to understand the determinants of [14C]phenylalanine transfer across the isolated perfused human placenta. Transfer of [14C]phenylalanine across the isolated perfused human placenta was determined at different maternal and fetal flow rates. Maternal flow rate was set at 10, 14, and 18 ml/min for 1 h each. At each maternal flow rate, fetal flow rates were set at 3, 6, and 9 ml/min for 20 min each. Appearance of [14C]phenylalanine was measured in the maternal and fetal venous exudates. Computational modeling of phenylalanine transfer was undertaken to allow comparison of the experimental data with predicted phenylalanine uptake and transfer under different initial assumptions. Placental uptake (mol/min) of [14C]phenylalanine increased with maternal, but not fetal, flow. Delivery (mol/min) of [14C]phenylalanine to the fetal circulation was not associated with fetal or maternal flow. The absence of a relationship between placental phenylalanine uptake and net flux of phenylalanine to the fetal circulation suggests that factors other than flow or transporter-mediated uptake are important determinants of phenylalanine transfer. These observations could be explained by tight regulation of free amino acid levels within the placenta or properties of the facilitated transporters mediating phenylalanine transport. We suggest that amino acid metabolism, primarily incorporation into protein, is controlling free amino acid levels and, thus, placental transfer. PMID:26676251
Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

NASA Astrophysics Data System (ADS)

Flechsig, Holger

2016-02-01

ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter. Possible explanations are discussed in the light of currently debated transport scenarios of ABC transporters.
Crystal structures of penicillin-binding protein 3 (PBP3) from methicillin-resistant Staphylococcus aureus in the apo and cefotaxime-bound forms.

PubMed

Yoshida, Hisashi; Kawai, Fumihiro; Obayashi, Eiji; Akashi, Satoko; Roper, David I; Tame, Jeremy R H; Park, Sam-Yong

2012-10-26

Staphylococcus aureus is a widespread Gram-positive opportunistic pathogen, and a methicillin-resistant form (MRSA) is particularly difficult to treat clinically. We have solved two crystal structures of penicillin-binding protein (PBP) 3 (PBP3) from MRSA, the apo form and a complex with the β-lactam antibiotic cefotaxime, and used electrospray mass spectrometry to measure its sensitivity to a variety of penicillin derivatives. PBP3 is a class B PBP, possessing an N-terminal non-penicillin-binding domain, sometimes called a dimerization domain, and a C-terminal transpeptidase domain. The model shows a different orientation of its two domains compared to earlier models of other class B PBPs and a novel, larger N-domain. Consistent with the nomenclature of "dimerization domain", the N-terminal region forms an apparently tight interaction with a neighboring molecule related by a 2-fold symmetry axis in the crystal structure. This dimer form is predicted to be highly stable in solution by the PISA server, but mass spectrometry and analytical ultracentrifugation provide unequivocal evidence that the protein is a monomer in solution. Copyright © 2012 Elsevier Ltd. All rights reserved.
Hysteresis in DNA compaction by Dps is described by an Ising model

PubMed Central

Vtyurina, Natalia N.; Dulin, David; Docter, Margreet W.; Meyer, Anne S.; Dekker, Nynke H.; Abbondanzieri, Elio A.

2016-01-01

In all organisms, DNA molecules are tightly compacted into a dynamic 3D nucleoprotein complex. In bacteria, this compaction is governed by the family of nucleoid-associated proteins (NAPs). Under conditions of stress and starvation, an NAP called Dps (DNA-binding protein from starved cells) becomes highly up-regulated and can massively reorganize the bacterial chromosome. Although static structures of Dps–DNA complexes have been documented, little is known about the dynamics of their assembly. Here, we use fluorescence microscopy and magnetic-tweezers measurements to resolve the process of DNA compaction by Dps. Real-time in vitro studies demonstrated a highly cooperative process of Dps binding characterized by an abrupt collapse of the DNA extension, even under applied tension. Surprisingly, we also discovered a reproducible hysteresis in the process of compaction and decompaction of the Dps–DNA complex. This hysteresis is extremely stable over hour-long timescales despite the rapid binding and dissociation rates of Dps. A modified Ising model is successfully applied to fit these kinetic features. We find that long-lived hysteresis arises naturally as a consequence of protein cooperativity in large complexes and provides a useful mechanism for cells to adopt unique epigenetic states. PMID:27091987
Study of interactions between metal ions and protein model compounds by energy decomposition analyses and the AMOEBA force field

NASA Astrophysics Data System (ADS)

Jing, Zhifeng; Qi, Rui; Liu, Chengwen; Ren, Pengyu

2017-10-01

The interactions between metal ions and proteins are ubiquitous in biology. The selective binding of metal ions has a variety of regulatory functions. Therefore, there is a need to understand the mechanism of protein-ion binding. The interactions involving metal ions are complicated in nature, where short-range charge-penetration, charge transfer, polarization, and many-body effects all contribute significantly, and a quantitative description of all these interactions is lacking. In addition, it is unclear how well current polarizable force fields can capture these energy terms and whether these polarization models are good enough to describe the many-body effects. In this work, two energy decomposition methods, absolutely localized molecular orbitals and symmetry-adapted perturbation theory, were utilized to study the interactions between Mg2+/Ca2+ and model compounds for amino acids. Comparison of individual interaction components revealed that while there are significant charge-penetration and charge-transfer effects in Ca complexes, these effects can be captured by the van der Waals (vdW) term in the AMOEBA force field. The electrostatic interaction in Mg complexes is well described by AMOEBA since the charge penetration is small, but the distance-dependent polarization energy is problematic. Many-body effects were shown to be important for protein-ion binding. In the absence of many-body effects, highly charged binding pockets will be over-stabilized, and the pockets will always favor Mg and thus lose selectivity. Therefore, many-body effects must be incorporated in the force field in order to predict the structure and energetics of metalloproteins. Also, the many-body effects of charge transfer in Ca complexes were found to be non-negligible. The absorption of charge-transfer energy into the additive vdW term was a main source of error for the AMOEBA many-body interaction energies.
Anticancer drug-DNA interactions measured using a photoinduced electron-transfer mechanism based on luminescent quantum dots.

PubMed

Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang

2009-01-01

A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.
Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Oleic acid transfer from microsomes to egg lecithin liposomes: participation of fatty acid binding protein.

PubMed

Catalá, A; Avanzati, B

1983-11-01

Oleic acid transfer from microsomes or mitochondria to egg lecithin liposomes was stimulated by fatty acid binding protein. By gel filtration, it could be demonstrated that this protein incorporates oleic acid into liposomes. Fatty acid binding protein transfer activity was higher using microsomes rather than mitochondria, which suggests a selective interaction with different kinds of membranes. Transfer of oleic acid by this soluble protein is greater than that of stearic acid. The results indicate that fatty acid binding protein may participate in the intracellular transport of fatty acids.

Tight coupling of Na+/K+-ATPase with glycolysis demonstrated in permeabilized rat cardiomyocytes.

PubMed

Sepp, Mervi; Sokolova, Niina; Jugai, Svetlana; Mandel, Merle; Peterson, Pearu; Vendelin, Marko

2014-01-01

The effective integrated organization of processes in cardiac cells is achieved, in part, by the functional compartmentation of energy transfer processes. Earlier, using permeabilized cardiomyocytes, we demonstrated the existence of tight coupling between some of cardiomyocyte ATPases and glycolysis in rat. In this work, we studied contribution of two membrane ATPases and whether they are coupled to glycolysis--sarcoplasmic reticulum Ca2+ ATPase (SERCA) and plasmalemma Na+/K+-ATPase (NKA). While SERCA activity was minor in this preparation in the absence of calcium, major role of NKA was revealed accounting to ∼30% of the total ATPase activity which demonstrates that permeabilized cell preparation can be used to study this pump. To elucidate the contribution of NKA in the pool of ATPases, a series of kinetic measurements was performed in cells where NKA had been inhibited by 2 mM ouabain. In these cells, we recorded: ADP- and ATP-kinetics of respiration, competition for ADP between mitochondria and pyruvate kinase (PK), ADP-kinetics of endogenous PK, and ATP-kinetics of total ATPases. The experimental data was analyzed using a series of mathematical models with varying compartmentation levels. The results show that NKA is tightly coupled to glycolysis with undetectable flux of ATP between mitochondria and NKA. Such tight coupling of NKA to PK is in line with its increased importance in the pathological states of the heart when the substrate preference shifts to glucose.
X-ray Raman scattering from molecules and solids in the framework of the Mahan-Nozières-De Dominicis model

NASA Astrophysics Data System (ADS)

Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans

2001-10-01

We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.
Ni2C surface carbide to catalyze low-temperature graphene growth

NASA Astrophysics Data System (ADS)

Martinez-Gordillo, Rafael; Varvenne, Céline; Amara, Hakim; Bichara, Christophe

2018-05-01

The possibility to grow a graphene layer using the chemical-vapor-deposition technique over a Ni2C /Ni (111 ) substrate has been identified experimentally, with the advantage of having a lower processing temperature (T <500 ∘C ), compared to standard growth over a Ni (111 ) surface. To understand the role of the metal carbide/metal catalyst, we first perform a static study of the Ni2C /Ni (111 ) structure and of the binding and removal of a carbon atom at the surface, using both a tight-binding (TB) energetic model and ab initio calculations. Grand-canonical Monte Carlo TB simulations then allow us (i) to determine the thermodynamic conditions to grow graphene and (ii) to separate key reaction steps in the growth mechanism explaining how the Ni2C /Ni (111 ) substrate catalyzes graphene formation at low temperature.
46 CFR 151.45-4 - Cargo-handling.

Code of Federal Regulations, 2010 CFR

2010-10-01

... vessel shall be considered when making the cargo connections to insure safe cargo transfer. Suitable material shall be used in joints and in couplings when making connections to insure that they are tight... connections are supported by the vessel's tackle, the person in charge of the transfer operations shall...
Identification of the coupling step in Na(+)-translocating NADH:quinone oxidoreductase from real-time kinetics of electron transfer.

PubMed

Belevich, Nikolai P; Bertsova, Yulia V; Verkhovskaya, Marina L; Baykov, Alexander A; Bogachev, Alexander V

2016-02-01

Bacterial Na(+)-translocating NADH:quinone oxidoreductase (Na(+)-NQR) uses a unique set of prosthetic redox groups-two covalently bound FMN residues, a [2Fe-2S] cluster, FAD, riboflavin and a Cys4[Fe] center-to catalyze electron transfer from NADH to ubiquinone in a reaction coupled with Na(+) translocation across the membrane. Here we used an ultra-fast microfluidic stopped-flow instrument to determine rate constants and the difference spectra for the six consecutive reaction steps of Vibrio harveyi Na(+)-NQR reduction by NADH. The instrument, with a dead time of 0.25 ms and optical path length of 1 cm allowed collection of visible spectra in 50-μs intervals. By comparing the spectra of reaction steps with the spectra of known redox transitions of individual enzyme cofactors, we were able to identify the chemical nature of most intermediates and the sequence of electron transfer events. A previously unknown spectral transition was detected and assigned to the Cys4[Fe] center reduction. Electron transfer from the [2Fe-2S] cluster to the Cys4[Fe] center and all subsequent steps were markedly accelerated when Na(+) concentration was increased from 20 μM to 25 mM, suggesting coupling of the former step with tight Na(+) binding to or occlusion by the enzyme. An alternating access mechanism was proposed to explain electron transfer between subunits NqrF and NqrC. According to the proposed mechanism, the Cys4[Fe] center is alternatively exposed to either side of the membrane, allowing the [2Fe-2S] cluster of NqrF and the FMN residue of NqrC to alternatively approach the Cys4[Fe] center from different sides of the membrane. Copyright © 2015 Elsevier B.V. All rights reserved.
Structure and Regulatory Interactions of the Cytoplasmic Terminal Domains of Serotonin Transporter

PubMed Central

2014-01-01

Uptake of neurotransmitters by sodium-coupled monoamine transporters of the NSS family is required for termination of synaptic transmission. Transport is tightly regulated by protein–protein interactions involving the small cytoplasmic segments at the amino- and carboxy-terminal ends of the transporter. Although structures of homologues provide information about the transmembrane regions of these transporters, the structural arrangement of the terminal domains remains largely unknown. Here, we combined molecular modeling, biochemical, and biophysical approaches in an iterative manner to investigate the structure of the 82-residue N-terminal and 30-residue C-terminal domains of human serotonin transporter (SERT). Several secondary structures were predicted in these domains, and structural models were built using the Rosetta fragment-based methodology. One-dimensional 1H nuclear magnetic resonance and circular dichroism spectroscopy supported the presence of helical elements in the isolated SERT N-terminal domain. Moreover, introducing helix-breaking residues within those elements altered the fluorescence resonance energy transfer signal between terminal cyan fluorescent protein and yellow fluorescent protein tags attached to full-length SERT, consistent with the notion that the fold of the terminal domains is relatively well-defined. Full-length models of SERT that are consistent with these and published experimental data were generated. The resultant models predict confined loci for the terminal domains and predict that they move apart during the transport-related conformational cycle, as predicted by structures of homologues and by the “rocking bundle” hypothesis, which is consistent with spectroscopic measurements. The models also suggest the nature of binding to regulatory interaction partners. This study provides a structural context for functional and regulatory mechanisms involving SERT terminal domains. PMID:25093911
Intense conductivity suppression by edge defects in zigzag MoS2 and WSe2 nanoribbons: a density functional based tight-binding study.

PubMed

Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B

2016-11-04

The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.
Study of the effect of soil disturbance on vapor transport through integrated modeling of the atmospheric boundary layer and shallow subsurface

NASA Astrophysics Data System (ADS)

Trautz, A.; Smits, K. M.; Cihan, A.; Wallen, B.

2014-12-01

Soil-water evaporation is one of the governing processes responsible for controlling water and energy exchanges between the land and atmosphere. Despite its wide relevance and application in many natural and manmade environments (e.g. soil tillage practices, wheel-track compaction, fire burn environments, textural layering and buried ordinances), there are very few studies of evaporation from disturbed soil profiles. The purpose of this study was to explore the effect of soil disturbance and capillary coupling on water distribution and fluxes. We modified a theory previously developed by the authors that allows for coupling single-phase (gas), two-component (air and water vapor) transfer in the atmosphere and two-phase (gas, liquid), two-component (air and water vapor) flow in porous media at the REV scale under non-isothermal, non-equilibrium conditions to better account for the hydraulic and thermal interactions within the media. Modeling results were validated and compared using precision data generated in a two-dimensional soil tank consisting of a loosely packed soil surrounded by a tightly packed soil. The soil tank was outfitted with an array of sensors for the measurement of wind velocity, soil and air temperature, relative humidity, soil moisture, and weight. Results demonstrated that, by using this coupling approach, it is possible to predict the different stages of the drying process in heterogeneous soils with good accuracy. Evaporation from a heterogeneous soil consisting of a loose and tight packing condition is larger than the homogeneous equivalent systems. Liquid water is supplied from the loosely packed soil region to the tightly packed soil regions, sustaining a longer Stage I evaporation in the tightly packed regions with overall greater evaporation rate than uniform homogeneous packing. In contrast, lower evaporation rates from the loosely packed regions are observed due to a limited liquid water supply resulting from capillary flow to the tightly packed regions and a shorter stage 1 evaporation period.
The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

PubMed

Vetrano, Stefania; Danese, Silvio

2009-05-01

Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.
Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.
Continuum theory of edge states of topological insulators: variational principle and boundary conditions.

PubMed

Medhi, Amal; Shenoy, Vijay B

2012-09-05

We develop a continuum theory to model low energy excitations of a generic four-band time reversal invariant electronic system with boundaries. We propose a variational energy functional for the wavefunctions which allows us to derive natural boundary conditions valid for such systems. Our formulation is particularly suited for developing a continuum theory of the protected edge/surface excitations of topological insulators both in two and three dimensions. By a detailed comparison of our analytical formulation with tight binding calculations of ribbons of topological insulators modelled by the Bernevig-Hughes-Zhang (BHZ) Hamiltonian, we show that the continuum theory with a natural boundary condition provides an appropriate description of the low energy physics.
Spin-selective electronic reconstruction in quantum ferromagnets: A view from the spin-asymmetric Hubbard model

NASA Astrophysics Data System (ADS)

Faúndez, J.; Jorge, T. N.; Craco, L.

2018-03-01

Using the tight-binding treatment for the spin-asymmetric Hubbard model we explore the effect of electronic interactions in the ferromagnetic, partially filled Lieb lattice. As a key result we demonstrate the formation of correlation satellites in the minority spin channel. In addition, we consider the role played by transverse-field spin fluctuations in metallic ferromagnets. We quantify the degree of electronic demagnetization, showing that the half-metallic state is rather robust to local spin flips. Not being restricted to the case of a partially filled Lieb lattice, our findings are expected to advance the general understanding of spin-selective electronic reconstruction in strongly correlated quantum ferromagnets.
Opening-assisted coherent transport in the semiclassical regime

NASA Astrophysics Data System (ADS)

Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev

2017-02-01

We study quantum enhancement of transport in open systems in the presence of disorder and dephasing. Quantum coherence effects may significantly enhance transport in open systems even in the semiclassical regime (where the decoherence rate is greater than the intersite hopping amplitude), as long as the disorder is sufficiently strong. When the strengths of disorder and dephasing are fixed, there is an optimal opening strength at which the coherent transport enhancement is optimized. Analytic results are obtained in two simple paradigmatic tight-binding models of large systems: the linear chain and the fully connected network. The physical behavior is also reflected in the Fenna-Matthews-Olson (FMO) photosynthetic complex, which may be viewed as intermediate between these paradigmatic models.
Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

PubMed Central

Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

1999-01-01

Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307
Mutation-linked, excessively tight interaction between the calmodulin binding domain and the C-terminal domain of the cardiac ryanodine receptor as a novel cause of catecholaminergic polymorphic ventricular tachycardia.

PubMed

Nishimura, Shigehiko; Yamamoto, Takeshi; Nakamura, Yoshihide; Kohno, Michiaki; Hamada, Yoriomi; Sufu, Yoko; Fukui, Go; Nanno, Takuma; Ishiguchi, Hironori; Kato, Takayoshi; Xu, Xiaojuan; Ono, Makoto; Oda, Tetsuro; Okuda, Shinichi; Kobayashi, Shigeki; Yano, Masafumi

2018-06-01

Ryanodine receptor (RyR2) is known to be a causal gene of catecholaminergic polymorphic ventricular tachycardia (CPVT), an important inherited disease. Some of the human CPVT-associated mutations have been found in a domain (4026-4172) that has EF hand motifs, the so-called calmodulin (CaM)-like domain (CaMLD). The purpose of this study was to investigate the underlying mechanism by which CPVT is induced by a mutation at CaMLD. A new N4103K/+ knock-in (KI) mice model was generated. Sustained ventricular tachycardia was frequently observed after infusion of caffeine plus epinephrine in KI mice. Endogenous CaM bound to RyR2 decreased even at baseline in isolated KI cardiomyocytes. Ca 2+ spark frequency (CaSpF) was much higher in KI cells than in wild-type cells. Addition of GSH-CaM (higher affinity CaM to RyR2) significantly decreased CaSpF. In response to isoproterenol, spontaneous Ca 2+ transient (SCaT) was frequently observed in intact KI cells. Incorporation of GSH-CaM into intact KI cells using a protein delivery kit decreased SCaT significantly. An assay using a quartz crystal microbalance technique revealed that mutated CaMLD peptide showed higher binding affinity to CaM binding domain (CaMBD) peptide. In the N4103K mutant, CaM binding affinity to RyR2 was significantly reduced regardless of beta-adrenergic stimulation. We found that this was caused by an abnormally tight interaction between CaMBD and mutated CaM-like domain (N4103K-CaMBD). Thus, CaMBD-CaMLD interaction may be a novel therapeutic target for treatment of lethal arrhythmia. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported.

PubMed

Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry

2006-12-01

Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.
The effects of the glycation of transferrin on chromium binding and the transport and distribution of chromium in vivo.

PubMed

Deng, Ge; Dyroff, Samantha L; Lockart, Molly; Bowman, Michael K; Vincent, John B

2016-11-01

Chromium (III) has been shown to act as a pharmacological agent improving insulin sensitivity in rodent models of obesity, insulin resistance, and diabetes. To act in beneficial fashion, chromium must reach insulin-sensitive tissues. Chromium is transported from the bloodstream to the tissues by the iron-transport protein transferrin. When blood concentrations of glucose are high (as in a diabetic subject), transferrin can be glycated, modifying its ability to bind and transport iron. However, the effects of glycation of transferrin on its ability to bind and transport Cr have not been examined previously. Storage of transferrin at 37°C in the presence and absence of glucose has significant effects on the binding of Cr. Transferrin stored in the absence of glucose only binds one equivalent of Cr tightly, compared to the normal binding of two equivalents of Cr by transferrin. Glycated transferrin (stored in the presence of glucose) binds two equivalents of Cr but the changes in its extinction coefficient at 245nm that accompany binding suggest that the Cr-bound transferrin possesses a conformation that deviates appreciably from untreated transferrin. These changes have dramatic effects, greatly reducing the ability of transferrin to transport Cr in vivo in rats. The results suggest that glycation of transferrin in subjects with high blood glucose concentrations should reduce the ability of Cr from pharmacological agents to enter tissues. Copyright © 2016 Elsevier Inc. All rights reserved.
Generation of SV40-transformed rabbit tracheal-epithelial-cell-derived blastocyst by somatic cell nuclear transfer

PubMed Central

de Semir, D.; Maurisse, R.; Du, F.; Xu, J.; Yang, X.; Illek, B.; Gruenert, D. C.

2013-01-01

The prospect of developing large animal models for the study of inherited diseases, such as cystic fibrosis (CF), through somatic cell nuclear transfer (SCNT) has opened up new opportunities for enhancing our understanding of disease pathology and for identifying new therapies. Thus, the development of species-specific in vitro cell systems that will provide broader insight into organ- and cell-type-specific functions relevant to the pathology of the disease is crucial. Studies have been undertaken to establish transformed rabbit airway epithelial cell lines that display differentiated features characteristic of the primary airway epithelium. This study describes the successful establishment and characterization of two SV40-transformed rabbit tracheal epithelial cell lines. These cell lines, 5RTEo- and 9RTEo-, express the CF transmembrane conductance regulator (CFTR) gene, retain epithelial-specific differentiated morphology and show CFTR-based cAMP-dependent Cl− ion transport across the apical membrane of a confluent monolayer. Immunocytochemical analysis indicates the presence of airway cytokeratins and tight-junction proteins in the 9RTEo- cell line after multiple generations. However, the tight junctions appear to diminish in their efficacy in both cell lines after at least 100 generations. Initial SCNT studies with the 9RTEo- cells have revealed that SV40-transformed rabbit airway epithelial donor cells can be used to generate blastocysts. These cell systems provide valuable models for studying the developmental and metabolic modulation of CFTR gene expression and rabbit airway epithelial cell biology. PMID:22234514
Optical properties of drug metabolites in latent fingermarks

PubMed Central

Shen, Yao; Ai, Qing

2016-01-01

Drug metabolites usually have structures of split-ring resonators (SRRs), which might lead to negative permittivity and permeability in electromagnetic field. As a result, in the UV-vis region, the latent fingermarks images of drug addicts and non drug users are inverse. The optical properties of latent fingermarks are quite different between drug addicts and non-drug users. This is a technic superiority for crime scene investigation to distinguish them. In this paper, we calculate the permittivity and permeability of drug metabolites using tight-binding model. The latent fingermarks of smokers and non-smokers are given as an example. PMID:26838730
Bipolaron assisted Bloch-like oscillations in organic lattices

NASA Astrophysics Data System (ADS)

Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; Magela e Silva, Geraldo

2017-06-01

The transport of a dissociated bipolaron in organic one-dimensional lattices is theoretically investigated in the scope of a tight-binding model that includes electron-lattice interactions and an external electric field. Remarkably, the results point to a physical picture in which the dissociated bipolaron propagates as a combined state of two free-like electrons that coherently perform spatial Bloch oscillations (BO) above a critical field strength. It was also obtained that the BO's trajectory presents a net forward motion in the direction of the applied electric field. The impact of dynamical disorder in the formation of electronic BOs is determined.

Electronic properties of long DNA nanowires in dry and wet conditions

NASA Astrophysics Data System (ADS)

Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek

2015-11-01

The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.
Effect of Hydrogen Adsorption on the Stone-Wales Transformation in Small-Diameter Carbon Nanotubes

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2018-04-01

The effect of hydrogenation of (4, 0) and (3, 0) carbon nanotubes on the Stone-Wales transformation is studied in the framework of the nonorthogonal tight-binding model. It is shown that the atomic hydrogen adsorption can lead to both a decrease and an increase in the barriers for the direct and inverse transformations depending on the orientation of a rotating C-C bond with respect to the nanotube axis. The characteristic times of formation and annealing the Stone-Wales defects have been estimated. The Young's moduli have been calculated.
d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes

NASA Astrophysics Data System (ADS)

Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping

2018-04-01

We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.
Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae

2000-01-01

The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.
Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe.

PubMed

Gurevich, A S; Kochereshko, V P; Bleuse, J; Mariette, H; Waag, A; Akimoto, R

2011-09-07

The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.
Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe

NASA Astrophysics Data System (ADS)

Gurevich, A. S.; Kochereshko, V. P.; Bleuse, J.; Mariette, H.; Waag, A.; Akimoto, R.

2011-09-01

The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.
Many-body instabilities and mass generation in slow Dirac materials

NASA Astrophysics Data System (ADS)

Triola, Christopher; Zhu, Jianxin; Migliori, Albert; Balatsky, Alexander

2015-03-01

Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum, the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model we study the many-body instabilities of these systems and identify regions of parameter space for which antiferromagnetic, ferromagnetic and charge density wave instabilities occur. Work Supported by USDOE BES E304.
Thermally induced charge current through long molecules

NASA Astrophysics Data System (ADS)

Zimbovskaya, Natalya A.; Nitzan, Abraham

2018-01-01

In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.
Structural basis of kynurenine 3-monooxygenase inhibition.

PubMed

Amaral, Marta; Levy, Colin; Heyes, Derren J; Lafite, Pierre; Outeiro, Tiago F; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S

2013-04-18

Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (that is, kynurenine pathway), leads to amelioration of Huntington's-disease-relevant phenotypes in yeast, fruitfly and mouse models, as well as in a mouse model of Alzheimer's disease. KMO is a flavin adenine dinucleotide (FAD)-dependent monooxygenase and is located in the outer mitochondrial membrane where it converts l-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders, as well as cancer and several peripheral inflammatory conditions. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained unknown. Here we report the first crystal structure of Saccharomyces cerevisiae KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active-site structure, preventing productive binding of the substrate l-kynurenine. Functional assays and targeted mutagenesis reveal that the active-site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO-UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington's, Alzheimer's and Parkinson's diseases.
Transfer of Ho Endonuclease and Ufo1 to the Proteasome by the UbL-UbA Shuttle Protein, Ddi1, Analysed by Complex Formation In Vitro

PubMed Central

Voloshin, Olga; Bakhrat, Anya; Herrmann, Sharon; Raveh, Dina

2012-01-01

The F-box protein, Ufo1, recruits Ho endonuclease to the SCFUfo1 complex for ubiquitylation. Both ubiquitylated Ho and Ufo1 are transferred by the UbL-UbA protein, Ddi1, to the 19S Regulatory Particle (RP) of the proteasome for degradation. The Ddi1-UbL domain binds Rpn1 of the 19S RP, the Ddi1-UbA domain binds ubiquitin chains on the degradation substrate. Here we used complex reconstitution in vitro to identify stages in the transfer of Ho and Ufo1 from the SCFUfo1 complex to the proteasome. We report SCFUfo1 complex at the proteasome formed in the presence of Ho. Subsequently Ddi1 is recruited to this complex by interaction between the Ddi1-UbL domain and Ufo1. The core of Ddi1 binds both Ufo1 and Rpn1; this interaction confers specificity of SCFUfo1 for Ddi1. The substrate-shield model predicts that Ho would protect Ufo1 from degradation and we find that Ddi1 binds Ho, Ufo1, and Rpn1 simultaneously forming a complex for transfer of Ho to the 19S RP. In contrast, in the absence of Ho, Rpn1 displaces Ufo1 from Ddi1 indicating a higher affinity of the Ddi1-UbL for the 19S RP. However, at high Rpn1 levels there is synergistic binding of Ufo1 to Ddi1 that is dependent on the Ddi1-UbA domain. Our interpretation is that in the absence of substrate, the Ddi1-UbL binds Rpn1 while the Ddi1-UbA binds ubiquitin chains on Ufo1. This would promote degradation of Ufo1 and disassembly of SCFUfo1 complexes. PMID:22815701
Tight-binding calculation of the magnetic moment of CrAs under pressure

NASA Astrophysics Data System (ADS)

Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

2018-03-01

We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.
Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2012-02-01

The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.
Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

NASA Astrophysics Data System (ADS)

Graefe, E. M.; Korsch, H. J.; Rush, A.

2016-07-01

Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.
ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2018-03-01

We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less
Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less
Reusable Component Model Development Approach for Parallel and Distributed Simulation

PubMed Central

Zhu, Feng; Yao, Yiping; Chen, Huilong; Yao, Feng

2014-01-01

Model reuse is a key issue to be resolved in parallel and distributed simulation at present. However, component models built by different domain experts usually have diversiform interfaces, couple tightly, and bind with simulation platforms closely. As a result, they are difficult to be reused across different simulation platforms and applications. To address the problem, this paper first proposed a reusable component model framework. Based on this framework, then our reusable model development approach is elaborated, which contains two phases: (1) domain experts create simulation computational modules observing three principles to achieve their independence; (2) model developer encapsulates these simulation computational modules with six standard service interfaces to improve their reusability. The case study of a radar model indicates that the model developed using our approach has good reusability and it is easy to be used in different simulation platforms and applications. PMID:24729751
Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

PubMed Central

Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

2018-01-01

Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348
DOE Office of Scientific and Technical Information (OSTI.GOV)

BRISC is a developmental prototype for a nextgeneration systems-level integrated performance and safety code (IPSC) for nuclear reactors. Its development served to demonstrate how a lightweight multi-physics coupling approach can be used to tightly couple the physics models in several different physics codes (written in a variety of languages) into one integrated package for simulating accident scenarios in a liquid sodium cooled burner nuclear reactor. For example, the RIO Fluid Flow and Heat transfer code developed at Sandia (SNL: Chris Moen, Dept. 08005) is used in BRISC to model fluid flow and heat transfer, as well as conduction heat transfermore » in solids. Because BRISC is a prototype, its most practical application is as a foundation or starting point for developing a true production code. The sub-codes and the associated models and correlations currently employed within BRISC were chosen to cover the required application space and demonstrate feasibility, but were not optimized or validated against experimental data within the context of their use in BRISC.« less
Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

PubMed

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

Assembly of streptolysin O pores assessed by quartz crystal microbalance and atomic force microscopy provides evidence for the formation of anchored but incomplete oligomers.

PubMed

Stewart, Sarah E; D'Angelo, Michael E; Paintavigna, Stefania; Tabor, Rico F; Martin, Lisandra L; Bird, Phillip I

2015-01-01

Streptolysin O (SLO) is a bacterial pore forming protein that is part of the cholesterol dependent cytolysin (CDC) family. We have used quartz crystal microbalance with dissipation monitoring (QCM-D) to examine SLO membrane binding and pore formation. In this system, SLO binds tightly to cholesterol-containing membranes, and assembles into partial and complete pores confirmed by atomic force microscopy. SLO binds to the lipid bilayer at a single rate consistent with the Langmuir isotherm model of adsorption. Changes in dissipation illustrate that SLO alters the viscoelastic properties of the bilayer during pore formation, but there is no loss of material from the bilayer as reported for small membrane-penetrating peptides. SLO mutants were used to further dissect the assembly and insertion processes by QCM-D. This shows the signature of SLO in QCM-D changes when pore formation is inhibited, and that bound and inserted SLO forms can be distinguished. Furthermore a pre-pore locked SLO mutant binds reversibly to lipid, suggesting that the partially complete wtSLO forms observed by AFM are anchored to the membrane. Copyright © 2014 Elsevier B.V. All rights reserved.
Transition States and transition state analogue interactions with enzymes.

PubMed

Schramm, Vern L

2015-04-21

Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.
Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

PubMed Central

Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

2009-01-01

Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464
Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

PubMed

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Theory of Exciton Energy Transfer in Carbon Nanotube Composites

DOE PAGES

Davoody, A. H.; Karimi, F.; Arnold, M. S.; ...

2016-06-24

Here, we compute the exciton transfer (ET) rate between semiconducting single-wall carbon nanotubes (SWNTs). We show that the main reasons for the wide range of measured ET rates reported in the literature are (1) exciton confinement in local quantum wells stemming from disorder in the environment and (2) exciton thermalization between dark and bright states due to intratube scattering. The SWNT excitonic states are calculated by solving the Bethe–Salpeter equation using tight-binding basis functions. The ET rates due to intertube Coulomb interaction are computed via Fermi’s golden rule. In pristine samples, the ET rate between parallel (bundled) SWNTs of similarmore » chirality is very high (~10 14 s –1), while the ET rate for dissimilar or nonparallel tubes is considerably lower (~10 12 s –1). Exciton confinement reduces the ET rate between same-chirality parallel SWNTs by 2 orders of magnitude but has little effect otherwise. Consequently, the ET rate in most measurements will be on the order of 10 12 s –1, regardless of the tube relative orientation or chirality. Exciton thermalization between bright and dark states further reduces the ET rate to ~10 11 s –1. The ET rate also increases with increasing temperature and decreases with increasing dielectric constant of the surrounding medium.« less
Theory of Exciton Energy Transfer in Carbon Nanotube Composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davoody, A. H.; Karimi, F.; Arnold, M. S.

Here, we compute the exciton transfer (ET) rate between semiconducting single-wall carbon nanotubes (SWNTs). We show that the main reasons for the wide range of measured ET rates reported in the literature are (1) exciton confinement in local quantum wells stemming from disorder in the environment and (2) exciton thermalization between dark and bright states due to intratube scattering. The SWNT excitonic states are calculated by solving the Bethe–Salpeter equation using tight-binding basis functions. The ET rates due to intertube Coulomb interaction are computed via Fermi’s golden rule. In pristine samples, the ET rate between parallel (bundled) SWNTs of similarmore » chirality is very high (~10 14 s –1), while the ET rate for dissimilar or nonparallel tubes is considerably lower (~10 12 s –1). Exciton confinement reduces the ET rate between same-chirality parallel SWNTs by 2 orders of magnitude but has little effect otherwise. Consequently, the ET rate in most measurements will be on the order of 10 12 s –1, regardless of the tube relative orientation or chirality. Exciton thermalization between bright and dark states further reduces the ET rate to ~10 11 s –1. The ET rate also increases with increasing temperature and decreases with increasing dielectric constant of the surrounding medium.« less
Reaction mechanism of guanidinoacetate methyltransferase, concerted or step-wise.

PubMed

Zhang, Xiaodong; Bruice, Thomas C

2006-10-31

We describe a quantum mechanics/molecular mechanics investigation of the guanidinoacetate methyltransferase catalyzed reaction, which shows that proton transfer from guanidinoacetate (GAA) to Asp-134 and methyl transfer from S-adenosyl-L-methionine (AdoMet) to GAA are concerted. By self-consistent-charge density functional tight binding/molecular mechanics, the bond lengths in the concerted mechanism's transition state are 1.26 A for both the OD1 (Asp-134)-H(E) (GAA) and H(E) (GAA)-N(E) (GAA) bonds, and 2.47 and 2.03 A for the S8 (AdoMet)-C9 (AdoMet) and C9 (AdoMet)-N(E) (GAA) bonds, respectively. The potential-energy barrier (DeltaE++) determined by single-point B3LYP/6-31+G*//MM is 18.9 kcal/mol. The contributions of the entropy (-TDeltaS++) and zero-point energy corrections Delta(ZPE)++ by normal mode analysis are 2.3 kcal/mol and -1.7 kcal/mol, respectively. Thus, the activation enthalpy of this concerted mechanism is predicted to be DeltaH++ = DeltaE++ plus Delta(ZPE)++ = 17.2 kcal/mol. The calculated free-energy barrier for the concerted mechanism is DeltaG++ = 19.5 kcal/mol, which is in excellent agreement with the value of 19.0 kcal/mol calculated from the experimental rate constant (3.8 +/- 0.2.min(-1)).
Fe-S cluster biogenesis in Gram-positive bacteria: SufU is a zinc-dependent sulfur transfer protein.

PubMed

Selbach, Bruna P; Chung, Alexander H; Scott, Aubrey D; George, Simon J; Cramer, Stephen P; Dos Santos, Patricia C

2014-01-14

The biosynthesis of Fe-S clusters in Bacillus subtilis and other Gram-positive bacteria is catalyzed by the SufCDSUB system. The first step in this pathway involves the sulfur mobilization from the free amino acid cysteine to a sulfur acceptor protein SufU via a PLP-dependent cysteine desulfurase SufS. In this reaction scheme, the formation of an enzyme S-covalent intermediate is followed by the binding of SufU. This event leads to the second half of the reaction where a deprotonated thiol of SufU promotes the nucleophilic attack onto the persulfide intermediate of SufS. Kinetic analysis combined with spectroscopic methods identified that the presence of a zinc atom tightly bound to SufU (Ka = 10(17) M(-1)) is crucial for its structural and catalytic competency. Fe-S cluster assembly experiments showed that despite the high degree of sequence and structural similarity to the ortholog enzyme IscU, the B. subtilis SufU does not act as a standard Fe-S cluster scaffold protein. The involvement of SufU as a dedicated agent of sulfur transfer, rather than as an assembly scaffold, in the biogenesis of Fe-S clusters in Gram-positive microbes indicates distinct strategies used by bacterial systems to assemble Fe-S clusters.
Dynamic Responses and Initial Decomposition under Shock Loading: A DFTB Calculation Combined with MSST Method for β-HMX with Molecular Vacancy.

PubMed

He, Zheng-Hua; Chen, Jun; Ji, Guang-Fu; Liu, Li-Min; Zhu, Wen-Jun; Wu, Qiang

2015-08-20

Despite extensive efforts on studying the decomposition mechanism of HMX under extreme condition, an intrinsic understanding of mechanical and chemical response processes, inducing the initial chemical reaction, is not yet achieved. In this work, the microscopic dynamic response and initial decomposition of β-HMX with (1 0 0) surface and molecular vacancy under shock condition, were explored by means of the self-consistent-charge density-functional tight-binding method (SCC-DFTB) in conjunction with multiscale shock technique (MSST). The evolutions of various bond lengths and charge transfers were analyzed to explore and understand the initial reaction mechanism of HMX. Our results discovered that the C-N bond close to major axes had less compression sensitivity and higher stretch activity. The charge was transferred mainly from the N-NO2 group along the minor axes and H atom to C atom during the early compression process. The first reaction of HMX primarily initiated with the fission of the molecular ring at the site of the C-N bond close to major axes. Further breaking of the molecular ring enhanced intermolecular interactions and promoted the cleavage of C-H and N-NO2 bonds. More significantly, the dynamic response behavior clearly depended on the angle between chemical bond and shock direction.
The human placental perfusion model: a systematic review and development of a model to predict in vivo transfer of therapeutic drugs.

PubMed

Hutson, J R; Garcia-Bournissen, F; Davis, A; Koren, G

2011-07-01

Dual perfusion of a single placental lobule is the only experimental model to study human placental transfer of substances in organized placental tissue. To date, there has not been any attempt at a systematic evaluation of this model. The aim of this study was to systematically evaluate the perfusion model in predicting placental drug transfer and to develop a pharmacokinetic model to account for nonplacental pharmacokinetic parameters in the perfusion results. In general, the fetal-to-maternal drug concentration ratios matched well between placental perfusion experiments and in vivo samples taken at the time of delivery of the infant. After modeling for differences in maternal and fetal/neonatal protein binding and blood pH, the perfusion results were able to accurately predict in vivo transfer at steady state (R² = 0.85, P < 0.0001). Placental perfusion experiments can be used to predict placental drug transfer when adjusting for extra parameters and can be useful for assessing drug therapy risks and benefits in pregnancy.
Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.
A global reaction route mapping-based kinetic Monte Carlo algorithm

NASA Astrophysics Data System (ADS)

Mitchell, Izaac; Irle, Stephan; Page, Alister J.

2016-07-01

We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.
A global reaction route mapping-based kinetic Monte Carlo algorithm.

PubMed

Mitchell, Izaac; Irle, Stephan; Page, Alister J

2016-07-14

We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.
Angular momentum transport with twisted exciton wave packets

NASA Astrophysics Data System (ADS)

Zang, Xiaoning; Lusk, Mark T.

2017-10-01

A chain of cofacial molecules with CN or CN h symmetry supports excitonic states with a screwlike structure. These can be quantified with the combination of an axial wave number and an azimuthal winding number. Combinations of these states can be used to construct excitonic wave packets that spiral down the chain with well-determined linear and angular momenta. These twisted exciton wave packets can be created and annihilated using laser pulses, and their angular momentum can be optically modified during transit. This allows for the creation of optoexcitonic circuits in which information, encoded in the angular momentum of light, is converted into excitonic wave packets that can be manipulated, transported, and then reemitted. A tight-binding paradigm is used to demonstrate the key ideas. The approach is then extended to quantify the evolution of twisted exciton wave packets in a many-body, multilevel time-domain density functional theory setting. In both settings, numerical methods are developed that allow the site-to-site transfer of angular momentum to be quantified.
Replacement of Cetyltrimethylammoniumbromide Bilayer on Gold Nanorod by Alkanethiol Crosslinker for Enhanced Plasmon Resonance Sensitivity

PubMed Central

Casas, Justin; Venkataramasubramani, Meenakshi; Wang, Yanyan; Tang, Liang

2013-01-01

Surface modification of gold nanorods (GNRs) is often problematic due to tightly packed cetyltrimethylammoniumbromide (CTAB) bilayer. Herein, we performed a double phase transfer ligand exchange to achieve displacement of CTAB on nanorods. During the removal, 11-mercaptoundecanoic acid (MUDA) crosslinker is simultaneously assembled on nanorod surfaces to prevent aggregation. The resulting MUDA-GNRs retain the shape and position of plasmon peaks similar to CTAB-capped GNRs. The introduction of carboxyl groups allows covalent conjugation of biological receptors in a facile fashion to construct a robust, label-free biosensor based on localized surface plasmon resonance (LSPR) transduction of biomolecular interaction. More importantly, smaller MUDA layer on the GNRs reduces the distance of target binding to the plasmonic nanostructure interface, leading to a significant enhancement in LSPR assay sensitivity and specificity. Compared to modification using conventional electropolymer adsorption, MUDA-coated gold nanosensor exhibits five times lower detection limit for cardiac troponin I assay with a high selectivity. PMID:23816849
Resonant and nondissipative tunneling in independently contacted graphene structures

NASA Astrophysics Data System (ADS)

Vasko, F. T.

2013-02-01

The tunneling processes between independently contacted graphene sheets separated by thin insulator are restricted by the momentum and energy conservation laws. Because of this, both dissipative tunneling transitions, with momentum transfer due to disorder scattering, and nondissipative regime of tunneling, which appears due to intersection of electron and hole branches of energy spectrum, must be taken into account. The tunneling current density is calculated for the graphene-boron nitride-graphene layers, which is described by the tight-binding approach, and for the predominant momentum scattering by static disorder. Dependencies of current on concentrations in top and bottom graphene layers, which are governed by the voltages applied through independent contacts and gates, are considered for the back- and double-gated structures. The current-voltage characteristics of the back-gated structure are in agreement with the recent experiment [ScienceSCIEAS0036-807510.1126/science.1218461 335, 947 (2012)]. For the double-gated structures, the resonant dissipative tunneling causes a 10-fold enhancement of response which is important for transistor applications.
Antifreeze Protein Binds Irreversibly to Ice

NASA Astrophysics Data System (ADS)

Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

2006-03-01

Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.
Quantitative analyses of bifunctional molecules.

PubMed

Braun, Patrick D; Wandless, Thomas J

2004-05-11

Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

PubMed Central

Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

2011-01-01

RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

PubMed

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

Engineering Encodable Lanthanide-Binding Tags (LBTs) into Loop Regions of Proteins

PubMed Central

Barthelmes, Katja; Reynolds, Anne M.; Peisach, Ezra; Jonker, Hendrik R. A.; DeNunzio, Nicholas J.; Allen, Karen N.; Imperiali, Barbara; Schwalbe, Harald

2011-01-01

Lanthanide-binding-tags (LBTs) are valuable tools for investigation of protein structure, function, and dynamics by NMR spectroscopy, X-ray crystallography and luminescence studies. We have inserted LBTs into three different loop positions (denoted L, R, and S) of the model protein interleukin-1β and varied the length of the spacer between the LBT and the protein (denoted 1-3). Luminescence studies demonstrate that all nine constructs bind Tb3+ tightly in the low nanomolar range. No significant change in the fusion protein occurs from insertion of the LBT, as shown by two X-ray crystallographic structures of the IL1β-S1 and IL1β-L3 constructs and for the remaining constructs by comparing 1H-15N-HSQC NMR spectra with wild-type IL1β. Additionally, binding of LBT-loop IL1β proteins to their native binding partner in vitro remains unaltered. X-ray crystallographic phasing was successful using only the signal from the bound lanthanide. Large residual dipolar couplings (RDCs) could be determined by NMR spectroscopy for all LBT-loop-constructs and revealed that the LBT-2 series were rigidly incorporated into the interleukin-1β structure. The paramagnetic NMR spectra of loop-LBT mutant IL1β-R2 were assigned and the Δχ tensor components were calculated based on RDCs and pseudocontact shifts (PCSs). A structural model of the IL1β-R2 construct was calculated using the paramagnetic restraints. The current data provide support that encodable LBTs serve as versatile biophysical tags when inserted into loop regions of proteins of known structure or predicted via homology modelling. PMID:21182275
AFRRI Reports, Second Quarter 1994

DTIC Science & Technology

1994-08-01

the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in
Triazole biotin: a tight-binding biotinidase-resistant conjugate.

PubMed

Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

2013-11-28

The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.
Regulation of transcriptional activators by DNA-binding domain ubiquitination

PubMed Central

Landré, Vivien; Revi, Bhindu; Mir, Maria Gil; Verma, Chandra; Hupp, Ted R; Gilbert, Nick; Ball, Kathryn L

2017-01-01

Ubiquitin is a key component of the regulatory network that maintains gene expression in eukaryotes, yet the molecular mechanism(s) by which non-degradative ubiquitination modulates transcriptional activator (TA) function is unknown. Here endogenous p53, a stress-activated transcription factor required to maintain health, is stably monoubiquitinated, following pathway activation by IR or Nutlin-3 and localized to the nucleus where it becomes tightly associated with chromatin. Comparative structure–function analysis and in silico modelling demonstrate a direct role for DNA-binding domain (DBD) monoubiquitination in TA activation. When attached to the DBD of either p53, or a second TA IRF-1, ubiquitin is orientated towards, and makes contact with, the DNA. The contact is made between a predominantly cationic surface on ubiquitin and the anionic DNA. Our data demonstrate an unexpected role for ubiquitin in the mechanism of TA-activity enhancement and provides insight into a new level of transcriptional regulation. PMID:28362432
A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.

PubMed Central

Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J

1996-01-01

The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115
Deciphering the fluorescence resonance energy transfer from denatured transport protein to anthracene 1,5 disulphonate in reverse micellar environment

NASA Astrophysics Data System (ADS)

Singharoy, Dipti; Bhattacharya, Subhash Chandra

2017-12-01

Constrained environmental effect inside AOT reverse micellar media has been employed in this work to collect the information about energy transfer efficacy between sodium salt of anthracene 1,5 disulphonate (1,5-AS) with model transport proteins, bovine serum albumin (BSA), and human serum albumin (HSA). Steady state, time-resolved fluorescence and circular dichroism techniques have been used for this purpose and corresponding Fӧrster-type resonance energy transfer (FRET) from tryptophan residues to 1,5-AS indicates that 1,5-AS binds in the vicinity of the tryptophan residue (BSA and HSA) with equal strength. Indication of protein damage from fluorescence data and its confirmation has been measured from CD measurement. Molecular modeling study hereby plays a crucial role to predict the minimum energy docked conformation of the probe inside the protein environment. From the docked conformation the distance between 1,5-AS and tryptophan moiety of BSA/HSA has successfully explained the FRET possibility between them. A comparative modeling study between BSA and HSA with 1,5-AS assigning their binding site within specific amino acids plays a crucial role in support of the FRET study.
Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

PubMed

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.
Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

PubMed Central

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971
Electrical design of InAs-Sb/GaSb superlattices for optical detectors using full bandstructure sp3s* tight-binding method and Bloch boundary conditions

NASA Astrophysics Data System (ADS)

Mir, Raja N.; Frensley, William R.

2013-10-01

InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.
Effect of ceramide-1-phosphate transfer protein on intestinal bacterial translocation in severe acute pancreatitis.

PubMed

Wang, Jiang; Li, Chang; Jiang, Yingjian; Zheng, Hongmei; Li, Dehui; Liang, Yibo; Deng, Wensheng; Zhang, Dianliang

2017-02-01

The aim of the study was to investigate the effects of ceramide-1-phosphate transfer protein (CPTP) on the intestinal epithelial tight junction proteins in patients with severe acute pancreatitis (SAP). Fifty patients with SAP were classified into two groups according to the presence of bacterial translocation (BT) in the blood. Thirty healthy individuals were included in the control group. The presence of BT was analyzed by polymerase chain reaction. The expression of tight junction proteins and CPTP was determined using immunohistochemistry and western blotting. Bacterial DNA was detected in the peripheral blood of 62.0% of the patients with SAP. The expression of CPTP and tight junction proteins in SAP patients was lower than that in healthy controls. Among the patients with SAP, those positive for BT(+) showed a lower level of CPTP and occluding (OC) and zonula occludens-1 (ZO-1) expression and a higher level of IVA cPLA2 expression than BT(-) patients. Moreover, the expression of CPTP was significantly associated with ZO-1 and showed a negative correlation with expression of IVA cPLA2 in SAP-BT(+) patients. CPTP affects the expression of tight junction proteins and may protects the intestinal epithelial barrier by downregulating the expression of IVA cPLA2. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Playing relativistic billiards beyond graphene

NASA Astrophysics Data System (ADS)

Sadurní, E.; Seligman, T. H.; Mortessagne, F.

2010-05-01

The possibility of using hexagonal structures in general, and graphene in particular, to emulate the Dirac equation is the topic under consideration here. We show that Dirac oscillators with or without rest mass can be emulated by distorting a tight-binding model on a hexagonal structure. In the quest to make a toy model for such relativistic equations, we first show that a hexagonal lattice of attractive potential wells would be a good candidate. Firstly, we consider the corresponding one-dimensional (1D) model giving rise to a 1D Dirac oscillator and then construct explicitly the deformations needed in the 2D case. Finally, we discuss how such a model can be implemented as an electromagnetic billiard using arrays of dielectric resonators between two conducting plates that ensure evanescent modes outside the resonators for transversal electric modes, and we describe a feasible experimental setup.
Dopaminergic striatal innervation predicts interlimb transfer of a visuomotor skill

PubMed Central

Isaias, IU; Moisello, C; Marotta, G; Schiavella, M; Canesi, M; Perfetti, B; Cavallari, P; Pezzoli, G; Ghilardi, MF

2011-01-01

We investigated whether dopamine influences the rate of adaptation to a visuomotor distortion and the transfer of this learning from the right to the left limb in human subjects. We thus studied patients with Parkinson disease as a putative in vivo model of dopaminergic denervation. Despite normal adaptation rates, patients showed a reduced transfer compared to age-matched healthy controls. The magnitude of the transfer, but not of the adaptation rate, was positively predicted by the values of dopamine-transporter binding of the right caudate and putamen. We conclude that striatal dopaminergic activity plays an important role in the transfer of visuomotor skills. PMID:21994362
Dopaminergic striatal innervation predicts interlimb transfer of a visuomotor skill.

PubMed

Isaias, Ioannis U; Moisello, Clara; Marotta, Giorgio; Schiavella, Mauro; Canesi, Margherita; Perfetti, Bernardo; Cavallari, Paolo; Pezzoli, Gianni; Ghilardi, M Felice

2011-10-12

We investigated whether dopamine influences the rate of adaptation to a visuomotor distortion and the transfer of this learning from the right to the left limb in human subjects. We thus studied patients with Parkinson disease as a putative in vivo model of dopaminergic denervation. Despite normal adaptation rates, patients showed a reduced transfer compared with age-matched healthy controls. The magnitude of the transfer, but not of the adaptation rate, was positively predicted by the values of dopamine-transporter binding of the right caudate and putamen. We conclude that striatal dopaminergic activity plays an important role in the transfer of visuomotor skills.
Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

PubMed Central

Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

2013-01-01

Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854
Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

PubMed

Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

2014-01-01

Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.
Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria

2016-08-15

Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP 2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL -) with a distinct second site is required for high PIP 2sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP 2sensitivity, even in the absence of PL -. Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP 2(2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domainmore » (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL -binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP 2site and explaining the positive allostery between PL -binding and PIP 2sensitivity.« less
Increasing the potency of an alhydrogel-formulated anthrax vaccine by minimizing antigen-adjuvant interactions.

PubMed

Watkinson, Allan; Soliakov, Andrei; Ganesan, Ashok; Hirst, Karie; Lebutt, Chris; Fleetwood, Kelly; Fusco, Peter C; Fuerst, Thomas R; Lakey, Jeremy H

2013-11-01

Aluminum salts are the most widely used vaccine adjuvants, and phosphate is known to modulate antigen-adjuvant interactions. Here we report an unexpected role for phosphate buffer in an anthrax vaccine (SparVax) containing recombinant protective antigen (rPA) and aluminum oxyhydroxide (AlOH) adjuvant (Alhydrogel). Phosphate ions bind to AlOH to produce an aluminum phosphate surface with a reduced rPA adsorption coefficient and binding capacity. However, these effects continued to increase as the free phosphate concentration increased, and the binding of rPA changed from endothermic to exothermic. Crucially, phosphate restored the thermostability of bound rPA so that it resembled the soluble form, even though it remained tightly bound to the surface. Batches of vaccine with either 0.25 mM (subsaturated) or 4 mM (saturated) phosphate were tested in a disease model at batch release, which showed that the latter was significantly more potent. Both formulations retained their potency for 3 years. The strongest aluminum adjuvant effects are thus likely to be via weakly attached or easily released native-state antigen proteins.
Ubiquitin-like domains can target to the proteasome but proteolysis requires a disordered region.

PubMed

Yu, Houqing; Kago, Grace; Yellman, Christopher M; Matouschek, Andreas

2016-07-15

Ubiquitin and some of its homologues target proteins to the proteasome for degradation. Other ubiquitin-like domains are involved in cellular processes unrelated to the proteasome, and proteins containing these domains remain stable in the cell. We find that the 10 yeast ubiquitin-like domains tested bind to the proteasome, and that all 11 identified domains can target proteins for degradation. Their apparent proteasome affinities are not directly related to their stabilities or functions. That is, ubiquitin-like domains in proteins not part of the ubiquitin proteasome system may bind the proteasome more tightly than domains in proteins that are bona fide components. We propose that proteins with ubiquitin-like domains have properties other than proteasome binding that confer stability. We show that one of these properties is the absence of accessible disordered regions that allow the proteasome to initiate degradation. In support of this model, we find that Mdy2 is degraded in yeast when a disordered region in the protein becomes exposed and that the attachment of a disordered region to Ubp6 leads to its degradation. © 2016 The Authors.
Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids.

PubMed

Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria; Heyman, Sarah; Stary-Weinzinger, Anna; Yuan, Peng; Nichols, Colin G

2016-09-01

Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL(-)) with a distinct second site is required for high PIP2 sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP2 sensitivity, even in the absence of PL(-) Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP2 (2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domain (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL(-) binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP2 site and explaining the positive allostery between PL(-) binding and PIP2 sensitivity. © 2016 Lee et al.
Changes in intestinal tight junction permeability associated with industrial food additives explain the rising incidence of autoimmune disease.

PubMed

Lerner, Aaron; Matthias, Torsten

2015-06-01

The incidence of autoimmune diseases is increasing along with the expansion of industrial food processing and food additive consumption. The intestinal epithelial barrier, with its intercellular tight junction, controls the equilibrium between tolerance and immunity to non-self-antigens. As a result, particular attention is being placed on the role of tight junction dysfunction in the pathogenesis of AD. Tight junction leakage is enhanced by many luminal components, commonly used industrial food additives being some of them. Glucose, salt, emulsifiers, organic solvents, gluten, microbial transglutaminase, and nanoparticles are extensively and increasingly used by the food industry, claim the manufacturers, to improve the qualities of food. However, all of the aforementioned additives increase intestinal permeability by breaching the integrity of tight junction paracellular transfer. In fact, tight junction dysfunction is common in multiple autoimmune diseases and the central part played by the tight junction in autoimmune diseases pathogenesis is extensively described. It is hypothesized that commonly used industrial food additives abrogate human epithelial barrier function, thus, increasing intestinal permeability through the opened tight junction, resulting in entry of foreign immunogenic antigens and activation of the autoimmune cascade. Future research on food additives exposure-intestinal permeability-autoimmunity interplay will enhance our knowledge of the common mechanisms associated with autoimmune progression. Copyright © 2015. Published by Elsevier B.V.

Quantum mechanics/molecular mechanics modeling of photoelectron spectra: the carbon 1s core-electron binding energies of ethanol-water solutions.

PubMed

Löytynoja, T; Niskanen, J; Jänkälä, K; Vahtras, O; Rinkevicius, Z; Ågren, H

2014-11-20

Using ethanol-water solutions as illustration, we demonstrate the capability of the hybrid quantum mechanics/molecular mechanics (QM/MM) paradigm to simulate core photoelectron spectroscopy: the binding energies and the chemical shifts. An integrated approach with QM/MM binding energy calculations coupled to preceding molecular dynamics sampling is adopted to generate binding energies averaged over the solute-solvent configurations available at a particular temperature and pressure and thus allowing for a statistical assessment with confidence levels for the final binding energies. The results are analyzed in terms of the contributions in the molecular mechanics model-electrostatic, polarization, and van der Waals-with atom or bond granulation of the corresponding MM charge and polarizability force-fields. The role of extramolecular charge transfer screening of the core-hole and explicit hydrogen bonding is studied by extending the QM core to cover the first solvation shell. The results are compared to those obtained from pure electrostatic and polarizable continuum models. Particularly, the dependence of the carbon 1s binding energies with respect to the ethanol concentration is studied. Our results indicate that QM/MM can be used as an all-encompassing model to study photoelectron binding energies and chemical shifts in solvent environments.
Programming Saposin-Mediated Compensatory Metabolic Sinks for Enhanced Ubiquinone Production.

PubMed

Xu, Wen; Yuan, Jifeng; Yang, Shuiyun; Ching, Chi-Bun; Liu, Jiankang

2016-12-16

Microbial synthesis of ubiquinone by fermentation processes has been emerging in recent years. However, as ubiquinone is a primary metabolite that is tightly regulated by the host central metabolism, tweaking the individual pathway components could only result in a marginal improvement on the ubiquinone production. Given that ubiquinone is stored in the lipid bilayer, we hypothesized that introducing additional metabolic sink for storing ubiquinone might improve the CoQ 10 production. As human lipid binding/transfer protein saposin B (hSapB) was reported to extract ubiquinone from the lipid bilayer and form the water-soluble complex, hSapB was chosen to build a compensatory metabolic sink for the ubiquinone storage. As a proof-of-concept, hSapB-mediated metabolic sink systems were devised and systematically investigated in the model organism of Escherichia coli. The hSapB-mediated periplasmic sink resulted in more than 200% improvement of CoQ 8 over the wild type strain. Further investigation revealed that hSapB-mediated sink systems could also improve the CoQ 10 production in a CoQ 10 -hyperproducing E. coli strain obtained by a modular pathway rewiring approach. As the design principles and the engineering strategies reported here are generalizable to other microbes, compensatory sink systems will be a method of significant interest to the synthetic biology community.
Slow-binding inhibition of sialidase from influenza virus.

PubMed

Pegg, M S; von Itzstein, M

1994-04-01

Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.
Implementing the SU(2) Symmetry for the DMRG

NASA Astrophysics Data System (ADS)

Alvarez, Gonzalo

2010-03-01

In the Density Matrix Renormalization Group (DMRG) algorithm (White, 1992), Hamiltonian symmetries play an important role. Using symmetries, the matrix representation of the Hamiltonian can be blocked. Diagonalizing each matrix block is more efficient than diagonalizing the original matrix. This talk will explain how the DMRG++ codefootnotetextarXiv:0902.3185 or Computer Physics Communications 180 (2009) 1572-1578. has been extended to handle the non-local SU(2) symmetry in a model independent way. Improvements in CPU times compared to runs with only local symmetries will be discussed for typical tight-binding models of strongly correlated electronic systems. The computational bottleneck of the algorithm, and the use of shared memory parallelization will also be addressed. Finally, a roadmap for future work on DMRG++ will be presented.
The Biotin/Avidin complex adhesion force

NASA Astrophysics Data System (ADS)

Balsera, Manel A.; Izrailev, Sergei; Stepaniants, Sergey; Oono, Yoshitsugu; Schulten, Klaus

1997-03-01

The vitamin Biotin and the protein avidin form one of the strongest non-covalent bonds between biological molecules. We have performed molecular and stochastic dynamic modeling of the unbinding of this complex(Izrailev et al., Biophysical Journal, In press). These simulations provide insight into the effect of particular residues and water on the tight binding of the system. With the aid of simple phenomenological models we have related qualitatively our results to Atomic Force Microscopy adhesion force measurements (E.-L. Florin, V. T. Moy and H. E. Gaub Science) 264:415-417 and kinetic dissociation experiments( A. Chilcotti and P. S. Stayton, J. Am. Chem. Soc.) 117:10622-10628. We will discuss the difficulties preventing a more quantitative understanding of the unbinding force and kinetics.
Intermediate activity of midge antifreeze protein is due to a tyrosine-rich ice-binding site and atypical ice plane affinity.

PubMed

Basu, Koli; Wasserman, Samantha S; Jeronimo, Paul S; Graham, Laurie A; Davies, Peter L

2016-04-01

An antifreeze protein (AFP) from a midge (Chironomidae) was recently discovered and modelled as a tightly wound disulfide-braced solenoid with a surface-exposed rank of stacked tyrosines. New isoforms of the midge AFP have been identified from RT-PCR and are fully consistent with the model. Although they differ in the number of 10-residue coils, the row of tyrosines that form the putative ice-binding site is conserved. Recombinant midge AFP has been produced, and the properly folded form purified by ice affinity. This monomeric AFP has a distinct circular dichroism spectrum, a melting temperature between 35 and 50 °C and is fully renaturable on cooling. Mutagenesis of the middle tyrosine in the rank of seven eliminates antifreeze activity, whereas mutation of a tyrosine off this predicted ice-binding face had no such effect. This AFP has unusual properties compared to other known AFPs. First, its freezing-point depression activity is intermediate between that of the hyperactive and moderately active AFPs. As with hyperactive AFPs, when midge AFP-bound ice crystals exceed their freezing-point depression, ice grows explosively perpendicular to the c-axis. However, midge AFP does not bind to the basal plane of ice as do hyperactive AFPs, but rather to a pyramidal plane that is at a shallower angle relative to the basal plane than binding planes of moderate AFPs. These properties distinguish midge AFP from all other ice-binding proteins and the intermediate activity level fits well to the modest challenge of protecting newly emerged adult insects from late spring frosts. Nucleotide sequences of new midge AFP isoforms are available in the GenBank database under accession numbers KU094814-8. Sequences will be released after publication. © 2016 Federation of European Biochemical Societies.
Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

PubMed

Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

2018-05-10

Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).
Glucose monitoring using a polymer brush modified polypropylene hollow fiber-based hydraulic flow sensor.

PubMed

Fortin, Nicolas; Klok, Harm-Anton

2015-03-04

Tight regulation of blood glucose levels of diabetic patients requires durable and robust continuous glucose sensing schemes. This manuscript reports the fabrication of ultrathin, phenylboronic acid (PBA) functionalized polymer brushes that swell upon glucose binding and which were integrated as the sensing interface in a new polypropylene hollow fiber (PPHF)-based hydraulic flow glucose sensor prototype. The polymer brushes were prepared via surface-initiated atom transfer radical polymerization of sodium methacrylate followed by postpolymerization modification with 3-aminophenyl boronic acid. In a first series of experiments, the glucose-response of PBA-functionalized poly(methacrylic acid) (PMAA) brushes grafted from planar silicon surfaces was investigated by quartz crystal microbalance with dissipation (QCM-D) and atomic force microscopy (AFM) experiments. The QCM-D experiments revealed a more or less linear change of the frequency shift for glucose concentrations up to ∼10 mM and demonstrated that glucose binding was completely reversible for up to seven switching cycles. The AFM experiments indicated that glucose binding was accompanied by an increase in the film thickness of the PBA functionalized PMAA brushes. The PBA functionalized PMAA brushes were subsequently grafted from the surface of PPHF membranes. The hydraulic permeability of these porous fibers depends on the thickness and swelling of the PMAA brush coating. PBA functionalized brush-coated PPHFs showed a decrease in flux upon exposure to glucose, which is consistent with swelling of the brush coating. Because they avoid the use of enzymes and do not rely on an electrochemical transduction scheme, these PPHF-based hydraulic flow sensors could represent an interesting alternative class of continuous glucose sensors.
The K-turn motif in riboswitches and other RNA species☆

PubMed Central

Lilley, David M.J.

2014-01-01

The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078
Optimization of binding electrostatics: Charge complementarity in the barnase-barstar protein complex

PubMed Central

lee, Lee-Peng; Tidor, Bruce

2001-01-01

Theoretical and experimental studies have shown that the large desolvation penalty required for polar and charged groups frequently precludes their involvement in electrostatic interactions that contribute strongly to net stability in the folding or binding of proteins in aqueous solution near room temperature. We have previously developed a theoretical framework for computing optimized electrostatic interactions and illustrated use of the algorithm with simplified geometries. Given a receptor and model assumptions, the method computes the ligand-charge distribution that provides the most favorable balance of desolvation and interaction effects on binding. In this paper the method has been extended to treat complexes using actual molecular shapes. The barnase-barstar protein complex was investigated with barnase treated as a target receptor. The atomic point charges of barstar were varied to optimize the electrostatic binding free energy. Barnase and natural barstar form a tight complex (Kd ∼ 10−14 M) with many charged and polar groups near the interface that make this a particularly relevant system for investigating the role of electrostatic effects on binding. The results show that sets of barstar charges (resulting from optimization with different constraints) can be found that give rise to relatively large predicted improvements in electrostatic binding free energy. Principles for enhancing the effect of electrostatic interactions in molecular binding in aqueous environments are discussed in light of the optima. Our findings suggest that, in general, the enhancements in electrostatic binding free energy resulting from modification of polar and charged groups can be substantial. Moreover, a recently proposed definition of electrostatic complementarity is shown to be a useful tool for examining binding interfaces. Finally, calculational results suggest that wild-type barstar is closer to being affinity optimized than is barnase for their mutual binding, consistent with the known roles of these proteins. PMID:11266622
Interaction of Gramicidin S and its Aromatic Amino-Acid Analog with Phospholipid Membranes

PubMed Central

Jelokhani-Niaraki, Masoud; Hodges, Robert S.; Meissner, Joseph E.; Hassenstein, Una E.; Wheaton, Laura

2008-01-01

To investigate the mechanism of interaction of gramicidin S-like antimicrobial peptides with biological membranes, a series of five decameric cyclic cationic β-sheet-β-turn peptides with all possible combinations of aromatic D-amino acids, Cyclo(Val-Lys-Leu-D-Ar1-Pro-Val-Lys-Leu-D-Ar2-Pro) (Ar ≡ Phe, Tyr, Trp), were synthesized. Conformations of these cyclic peptides were comparable in aqueous solutions and lipid vesicles. Isothermal titration calorimetry measurements revealed entropy-driven binding of cyclic peptides to POPC and POPE/POPG lipid vesicles. Binding of peptides to both vesicle systems was endothermic—exceptions were peptides containing the Trp-Trp and Tyr-Trp pairs with exothermic binding to POPC vesicles. Application of one- and two-site binding (partitioning) models to binding isotherms of exothermic and endothermic binding processes, respectively, resulted in determination of peptide-lipid membrane binding constants (Kb). The Kb1 and Kb2 values for endothermic two-step binding processes corresponded to high and low binding affinities (Kb1 ≥ 100 Kb2). Conformational change of cyclic peptides in transferring from buffer to lipid bilayer surfaces was estimated using fluorescence resonance energy transfer between the Tyr-Trp pair in one of the peptide constructs. The cyclic peptide conformation expands upon adsorption on lipid bilayer surface and interacts more deeply with the outer monolayer causing bilayer deformation, which may lead to formation of nonspecific transient peptide-lipid porelike zones causing membrane lysis. PMID:18621820
Increasing the affinity of selective bZIP-binding peptides through surface residue redesign.

PubMed

Kaplan, Jenifer B; Reinke, Aaron W; Keating, Amy E

2014-07-01

The coiled-coil dimer is a prevalent protein interaction motif that is important for many cellular processes. The basic leucine-zipper (bZIP) transcription factors are one family of proteins for which coiled-coil mediated dimerization is essential for function, and misregulation of bZIPs can lead to disease states including cancer. This makes coiled coils attractive protein-protein interaction targets to disrupt using engineered molecules. Previous work designing peptides to compete with native coiled-coil interactions focused primarily on designing the core residues of the interface to achieve affinity and specificity. However, folding studies on the model bZIP GCN4 show that coiled-coil surface residues also contribute to binding affinity. Here we extend a prior study in which peptides were designed to bind tightly and specifically to representative members of each of 20 human bZIP families. These "anti-bZIP" peptides were designed with an emphasis on target-binding specificity, with contributions to design-target specificity and affinity engineered considering only the coiled-coil core residues. High-throughput testing using peptide arrays indicated many successes. We have now measured the binding affinities and specificities of anti-bZIPs that bind to FOS, XBP1, ATF6, and CREBZF in solution and tested whether redesigning the surface residues can increase design-target affinity. Incorporating residues that favor helix formation into the designs increased binding affinities in all cases, providing low-nanomolar binders of each target. However, changes in surface electrostatic interactions sometimes changed the binding specificity of the designed peptides. © 2014 The Protein Society.
{open_quotes}Horizontal{close_quotes} gene transfer from a transgenic potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs - if at all - at an extremely low frequency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlueter, K.; Fuetterer, J.; Potrykus, I.

1995-10-01

The frequency of possible {open_quotes}horizontal{close_quotes} gene transfer between a plant and a tightly associated bacterial pathogen was studied in a model system consisting of transgenic Solanum tuberosum, containing a {beta}-lactamase gene linked to a pBR322 origin of replication, and Erwinia chrysanthemi. This experimental system offers optimal conditions for the detection of possible horizontal gene transfer events, even when they occur at very low frequency. Horizontal gene transfer was not detected under conditions mimicking a {open_quotes}natural{close_quotes} infection. The gradual, stepwise alteration of artificial, positive control conditions to idealized natural conditions, however, allowed the characterization of factors that affected gene transfer, andmore » revealed a gradual decrease of the gene transfer frequency from 6.3 x 10{sup -2} under optimal control conditions to a calculated 2.0 x 10{sub -17} under idealized natural conditions. These data, in combination with other published studies, argue that horizontal gene transfer is so rare as to be essentially irrelevant to any realistic assessment of the risk involved in release experiments involving transgenic plants. 22 refs., 3 figs., 2 tabs.« less
Comparison of the interaction between lactoferrin and isomeric drugs

NASA Astrophysics Data System (ADS)

Guo, Ming; Lu, Xiaowang; Wang, Yan; Brodelius, Peter E.

2017-02-01

The binding properties of pentacyclic triterpenoid isomeric drugs, i.e. ursolic acid (UA) and oleanolic acid (OA), to bovine lactoferrin (BLF) have been studied by molecule modeling, fluorescence spectroscopy, UV-visible absorbance spectroscopy and infrared spectroscopy (IR). Molecular docking, performed to reveal the possible binding mode or mechanism, suggested that hydrophobic interaction and hydrogen bonding play important roles to stabilize the complex. The results of spectroscopic measurements showed that the two isomeric drugs both strongly quenched the intrinsic fluorescence of BLF through a static quenching procedure although some differences between UA and OA binding strength and non-radiation energy transfer occurred within the molecules. The number of binding sites was 3.44 and 3.10 for UA and OA, respectively, and the efficiency of Förster energy transfer provided a distance of 0.77 and 1.21 nm for UA and OA, respectively. The conformation transformation of BLF affected by the drugs conformed to the ;all-or-none; pattern. In addition, the changes of the ratios of α-helices, β-sheets and β-turns of BLF during the process of the interaction were obtained. The results of the experiments in combination with the calculations showed that there are two modes of pentacyclic triterpenoid binding to BLF instead of one binding mode only governed by the principle of the lowest bonding energy.
Conductance of AFM Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

2002-01-01

This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.
The Challenges to Coupling Dynamic Geospatial Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldstein, N

2006-06-23

Many applications of modeling spatial dynamic systems focus on a single system and a single process, ignoring the geographic and systemic context of the processes being modeled. A solution to this problem is the coupled modeling of spatial dynamic systems. Coupled modeling is challenging for both technical reasons, as well as conceptual reasons. This paper explores the benefits and challenges to coupling or linking spatial dynamic models, from loose coupling, where information transfer between models is done by hand, to tight coupling, where two (or more) models are merged as one. To illustrate the challenges, a coupled model of Urbanizationmore » and Wildfire Risk is presented. This model, called Vesta, was applied to the Santa Barbara, California region (using real geospatial data), where Urbanization and Wildfires occur and recur, respectively. The preliminary results of the model coupling illustrate that coupled modeling can lead to insight into the consequences of processes acting on their own.« less
Processing Impact on Monoclonal Antibody Drug Products: Protein Subvisible Particulate Formation Induced by Grinding Stress.

PubMed

Gikanga, Benson; Eisner, Devon Roshan; Ovadia, Robert; Day, Eric S; Stauch, Oliver B; Maa, Yuh-Fun

2017-01-01

Subvisible particle formation in monoclonal antibody drug product resulting from mixing and filling operations represents a significant processing risk that can lead to filter fouling and thereby lead to process delays or failures. Several previous studies from our lab and others demonstrated the formation of subvisible particulates in mAb formulations resulting from mixing operations using some bottom-mounted mixers or stirrer bars. It was hypothesized that the stress (e.g., shear/cavitation) derived from tight clearance and/or close contact between the impeller and shaft was responsible for protein subvisible particulate generation. These studies, however, could not distinguish between the two surfaces without contact (tight clearance) or between two contacting surfaces (close contact). In the present study we expand on those findings and utilize small-scale mixing models that are able to, for the first time, distinguish between tight clearances and tight contact. In this study we evaluated different mixer types including a top-mounted mixer, several impeller-based bottom-mounted mixers, and a rotary piston pump. The impact of tight clearance/close contact on subvisible particle formation in at-scale mixing platforms was demonstrated in the gap between the impeller and drive unit as well as between the piston and the housing of the pump. Furthermore, small-scale mixing models based on different designs of magnetic stir bars that mimic the tight clearance/close contact of the manufacturing-scale mixers also induced subvisible particles in mAb formulations. Additional small-scale models that feature tight clearance but no close contact (grinding) suggested that it is the repeated grinding/contacting of the moving parts and not the presence of tight clearance in the processing equipment that is the root cause of protein subvisible particulate formation. When multiple mAbs, Fabs (fragment antigen binding), or non-antibody related proteins were mixed in the small-scale mixing model, for molecules investigated, it was observed that mAbs and Fabs appear to be more susceptible to particle formation than non-antibody-related proteins. In the grinding zone, mAb/Fab molecules aggregated into insoluble particles with neither detectable soluble aggregates nor fragmented species. This investigation represents a step closer to the understanding of the underlying stress mechanism leading to mAb subvisible particulate formation as the result of drug product processing. LAY ABSTRACT: Mixing and fill finish are important unit operations in drug product manufacturing for compounding (dilution, pooling, homogenization, etc.) and filling into primary packaging containers (vials, pre-filled syringes, etc.), respectively. The current trend in adopting bottom-mounted mixers as well as low fill-volume filling systems has raised concerns about their impact on drug product quality and process performance. However, investigations into the effects of their use for biopharmaceutical products, particularly monoclonal antibody formulations, are rarely published. The purpose of this study is three-fold: (1) to revisit the impact of bottom-mounted mixer design on monoclonal antibody subvisible particle formation; (2) to identify the root cause for subvisible particle formation; and (3) to fully utilize available particle analysis tools to demonstrate the correlation between particle count in the solution and filter fouling during sterile filtration. The outcomes of this study will benefit scientists and engineers who develop biologic product manufacturing processes by providing a better understanding of drug product process challenges. © PDA, Inc. 2017.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in

We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less
Highly tunable charge and spin transport in silicene junctions: phase transitions and half-metallic states.

PubMed

Mahdavifar, Maryam; Khoeini, Farhad

2018-08-10

We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.
Gate-Controllable Magneto-optic Kerr Effect in Layered Collinear Antiferromagnets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sivadas, Nikhil; Okamoto, Satoshi; Xiao, Di

2016-12-23

In this paper, using symmetry arguments and a tight-binding model, we show that for layered collinear antiferromagnets, magneto-optic effects can be generated and manipulated by controlling crystal symmetries through a gate voltage. This provides a promising route for electric field manipulation of the magneto-optic effects without modifying the underlying magnetic structure. We further demonstrate the gate control of the magneto-optic Kerr effect (MOKE) in bilayer MnPSe 3 using first-principles calculations. Finally, the field-induced inversion symmetry breaking effect leads to gate-controllable MOKE, whose direction of rotation can be switched by the reversal of the gate voltage.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.