Sample records for transmission matrix method

  1. A-TEEMTM, a new molecular fingerprinting technique: simultaneous absorbance-transmission and fluorescence excitation-emission matrix method

    NASA Astrophysics Data System (ADS)

    Quatela, Alessia; Gilmore, Adam M.; Steege Gall, Karen E.; Sandros, Marinella; Csatorday, Karoly; Siemiarczuk, Alex; (Ben Yang, Boqian; Camenen, Loïc

    2018-04-01

    We investigate the new simultaneous absorbance-transmission and fluorescence excitation-emission matrix method for rapid and effective characterization of the varying components from a mixture. The absorbance-transmission and fluorescence excitation-emission matrix method uniquely facilitates correction of fluorescence inner-filter effects to yield quantitative fluorescence spectral information that is largely independent of component concentration. This is significant because it allows one to effectively monitor quantitative component changes using multivariate methods and to generate and evaluate spectral libraries. We present the use of this novel instrument in different fields: i.e. tracking changes in complex mixtures including natural water, wine as well as monitoring stability and aggregation of hormones for biotherapeutics.

  2. Selecting appropriate singular values of transmission matrix to improve precision of incident wavefront retrieval

    NASA Astrophysics Data System (ADS)

    Fang, Longjie; Zhang, Xicheng; Zuo, Haoyi; Pang, Lin; Yang, Zuogang; Du, Jinglei

    2018-06-01

    A method of selecting appropriate singular values of the transmission matrix to improve the precision of incident wavefront retrieval in focusing light through scattering media is proposed. The optimal singular values selected by this method can reduce the degree of ill-conditionedness of the transmission matrix effectively, which indicates that the incident wavefront retrieved from the optimal set of singular values is more accurate than the incident wavefront retrieved from other sets of singular values. The validity of this method is verified by numerical simulation and actual measurements of the incident wavefront of coherent light through ground glass.

  3. Calculation of transmission probability by solving an eigenvalue problem

    NASA Astrophysics Data System (ADS)

    Bubin, Sergiy; Varga, Kálmán

    2010-11-01

    The electron transmission probability in nanodevices is calculated by solving an eigenvalue problem. The eigenvalues are the transmission probabilities and the number of nonzero eigenvalues is equal to the number of open quantum transmission eigenchannels. The number of open eigenchannels is typically a few dozen at most, thus the computational cost amounts to the calculation of a few outer eigenvalues of a complex Hermitian matrix (the transmission matrix). The method is implemented on a real space grid basis providing an alternative to localized atomic orbital based quantum transport calculations. Numerical examples are presented to illustrate the efficiency of the method.

  4. Comparison of Transmission Line Methods for Surface Acoustic Wave Modeling

    NASA Technical Reports Server (NTRS)

    Wilson, William; Atkinson, Gary

    2009-01-01

    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method (a first order model), and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices. Keywords: Surface Acoustic Wave, SAW, transmission line models, Impulse Response Method.

  5. High frequency resolution terahertz time-domain spectroscopy

    NASA Astrophysics Data System (ADS)

    Sangala, Bagvanth Reddy

    2013-12-01

    A new method for the high frequency resolution terahertz time-domain spectroscopy is developed based on the characteristic matrix method. This method is useful for studying planar samples or stack of planar samples. The terahertz radiation was generated by optical rectification in a ZnTe crystal and detected by another ZnTe crystal via electro-optic sampling method. In this new characteristic matrix based method, the spectra of the sample and reference waveforms will be modeled by using characteristic matrices. We applied this new method to measure the optical constants of air. The terahertz transmission through the layered systems air-Teflon-air-Quartz-air and Nitrogen gas-Teflon-Nitrogen gas-Quartz-Nitrogen gas was modeled by the characteristic matrix method. A transmission coefficient is derived from these models which was optimized to fit the experimental transmission coefficient to extract the optical constants of air. The optimization of an error function involving the experimental complex transmission coefficient and the theoretical transmission coefficient was performed using patternsearch algorithm of MATLAB. Since this method takes account of the echo waveforms due to reflections in the layered samples, this method allows analysis of longer time-domain waveforms giving rise to very high frequency resolution in the frequency-domain. We have presented the high frequency resolution terahertz time-domain spectroscopy of air and compared the results with the literature values. We have also fitted the complex susceptibility of air to the Lorentzian and Gaussian functions to extract the linewidths.

  6. Phase matrix induced symmetrics for multiple scattering using the matrix operator method

    NASA Technical Reports Server (NTRS)

    Hitzfelder, S. J.; Kattawar, G. W.

    1973-01-01

    Entirely rigorous proofs of the symmetries induced by the phase matrix into the reflection and transmission operators used in the matrix operator theory are given. Results are obtained for multiple scattering in both homogeneous and inhomogeneous atmospheres. These results will be useful to researchers using the method since large savings in computer time and storage are obtainable.

  7. Development of a hybrid wave based-transfer matrix model for sound transmission analysis.

    PubMed

    Dijckmans, A; Vermeir, G

    2013-04-01

    In this paper, a hybrid wave based-transfer matrix model is presented that allows for the investigation of the sound transmission through finite multilayered structures placed between two reverberant rooms. The multilayered structure may consist of an arbitrary configuration of fluid, elastic, or poro-elastic layers. The field variables (structural displacements and sound pressures) are expanded in terms of structural and acoustic wave functions. The boundary and continuity conditions in the rooms determine the participation factors in the pressure expansions. The displacement of the multilayered structure is determined by the mechanical impedance matrix, which gives a relation between the pressures and transverse displacements at both sides of the structure. The elements of this matrix are calculated with the transfer matrix method. First, the hybrid model is numerically validated. Next a comparison is made with sound transmission loss measurements of a hollow brick wall and a sandwich panel. Finally, numerical simulations show the influence of structural damping, room dimensions and plate dimensions on the sound transmission loss of multilayered structures.

  8. TRANSMISSION NETWORK PLANNING METHOD FOR COMPARATIVE STUDIES (JOURNAL VERSION)

    EPA Science Inventory

    An automated transmission network planning method for comparative studies is presented. This method employs logical steps that may closely parallel those taken in practice by the planning engineers. Use is made of a sensitivity matrix to simulate the engineers' experience in sele...

  9. Spectral analysis of the UFBG-based acousto—optical modulator in V-I transmission matrix formalism

    NASA Astrophysics Data System (ADS)

    Wu, Liang-Ying; Pei, Li; Liu, Chao; Wang, Yi-Qun; Weng, Si-Jun; Wang, Jian-Shuai

    2014-11-01

    In this study, the V-I transmission matrix formalism (V-I method) is proposed to analyze the spectrum characteristics of the uniform fiber Bragg grating (FBG)-based acousto—optic modulators (UFBG-AOM). The simulation results demonstrate that both the amplitude of the acoustically induced strain and the frequency of the acoustic wave (AW) have an effect on the spectrum. Additionally, the wavelength spacing between the primary reflectivity peak and the secondary reflectivity peak is proportional to the acoustic frequency with the ratio 0.1425 nm/MHz. Meanwhile, we compare the amount of calculation. For the FBG whose period is M, the calculation of the V-I method is 4 × (2M-1) in addition/subtraction, 8 × (2M - 1) in multiply/division and 2M in exponent arithmetic, which is almost a quarter of the multi-film method and transfer matrix (TM) method. The detailed analysis indicates that, compared with the conventional multi-film method and transfer matrix (TM) method, the V-I method is faster and less complex.

  10. Solar system applications of Mie theory and of radiative transfer of polarized light

    NASA Technical Reports Server (NTRS)

    Whitehill, L. P.

    1972-01-01

    A theory of the multiple scattering of polarized light is discussed using the doubling method of van de Hulst. The concept of the Stokes parameters is derived and used to develop the form of the scattering phase matrix of a single particle. The diffuse reflection and transmission matrices of a single scattering plane parallel atmosphere are expressed as a function of the phase matrix, and the symmetry properties of these matrices are examined. Four matrices are required to describe scattering and transmission. The scattering matrix that results from the addition of two identical layers is derived. Using the doubling method, the scattering and transmission matrices of layers of arbitrary optical thickness can be derived. The doubling equations are then rewritten in terms of their Fourier components. Computation time is reduced since each Fourier component doubles independently. Computation time is also reduced through the use of symmetry properties.

  11. Performance analysis of cross-seeding WDM-PON system using transfer matrix method

    NASA Astrophysics Data System (ADS)

    Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

    2016-12-01

    In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

  12. Atmospheric pressure matrix-assisted laser desorption ionization as a plume diagnostic tool in laser evaporation methods

    NASA Astrophysics Data System (ADS)

    Callahan, John H.; Galicia, Marsha C.; Vertes, Akos

    2002-09-01

    Laser evaporation techniques, including matrix-assisted pulsed laser evaporation (MAPLE), are attracting increasing attention due to their ability to deposit thin layers of undegraded synthetic and biopolymers. Laser evaporation methods can be implemented in reflection geometry with the laser and the substrate positioned on the same side of the target. In some applications (e.g. direct write, DW), however, transmission geometry is used, i.e. the thin target is placed between the laser and the substrate. In this case, the laser pulse perforates the target and transfers some target material to the substrate. In order to optimize evaporation processes it is important to know the composition of the target plume and the material deposited from the plume. We used a recently introduced analytical method, atmospheric pressure matrix-assisted laser desorption ionization (AP-MALDI) to characterize the ionic components of the plume both in reflection and in transmission geometry. This technique can also be used to directly probe materials deposited on surfaces (such as glass slides) by laser evaporation methods. The test compound (small peptides, e.g. Angiotensin I, ATI or Substance P) was mixed with a MALDI matrix (α-cyano-4-hydroxycinnamic acid (CHCA), sinapinic acid (SA) or 2,5-dihydroxybenzoic acid (DHB)) and applied to the stainless steel (reflection geometry) or transparent conducting (transmission geometry) target holder. In addition to the classical dried droplet method, we also used electrospray target deposition to gain better control of crystallite size, thickness and homogeneity. The target was mounted in front of the inlet orifice of an ion trap mass spectrometer (IT-MS) that sampled the ionic components of the plume generated by a nitrogen laser. We studied the effect of several parameters, such as, the orifice to target distance, illumination geometry, extracting voltage distribution and sample preparation on the generated ions. Various analyte-matrix and matrix-matrix cluster ions were observed with relatively low abundance of the matrix ions.

  13. Fast mean and variance computation of the diffuse sound transmission through finite-sized thick and layered wall and floor systems

    NASA Astrophysics Data System (ADS)

    Decraene, Carolina; Dijckmans, Arne; Reynders, Edwin P. B.

    2018-05-01

    A method is developed for computing the mean and variance of the diffuse field sound transmission loss of finite-sized layered wall and floor systems that consist of solid, fluid and/or poroelastic layers. This is achieved by coupling a transfer matrix model of the wall or floor to statistical energy analysis subsystem models of the adjacent room volumes. The modal behavior of the wall is approximately accounted for by projecting the wall displacement onto a set of sinusoidal lateral basis functions. This hybrid modal transfer matrix-statistical energy analysis method is validated on multiple wall systems: a thin steel plate, a polymethyl methacrylate panel, a thick brick wall, a sandwich panel, a double-leaf wall with poro-elastic material in the cavity, and a double glazing. The predictions are compared with experimental data and with results obtained using alternative prediction methods such as the transfer matrix method with spatial windowing, the hybrid wave based-transfer matrix method, and the hybrid finite element-statistical energy analysis method. These comparisons confirm the prediction accuracy of the proposed method and the computational efficiency against the conventional hybrid finite element-statistical energy analysis method.

  14. Solid-perforated panel layout optimization by topology optimization based on unified transfer matrix.

    PubMed

    Kim, Yoon Jae; Kim, Yoon Young

    2010-10-01

    This paper presents a numerical method for the optimization of the sequencing of solid panels, perforated panels and air gaps and their respective thickness for maximizing sound transmission loss and/or absorption. For the optimization, a method based on the topology optimization formulation is proposed. It is difficult to employ only the commonly-used material interpolation technique because the involved layers exhibit fundamentally different acoustic behavior. Thus, an optimization method formulation using a so-called unified transfer matrix is newly proposed. The key idea is to form elements of the transfer matrix such that interpolated elements by the layer design variables can be those of air, perforated and solid panel layers. The problem related to the interpolation is addressed and bench mark-type problems such as sound transmission or absorption maximization problems are solved to check the efficiency of the developed method.

  15. Implementing transmission eigenchannels of disordered media by a binary-control digital micromirror device

    NASA Astrophysics Data System (ADS)

    Kim, Donggyu; Choi, Wonjun; Kim, Moonseok; Moon, Jungho; Seo, Keumyoung; Ju, Sanghyun; Choi, Wonshik

    2014-11-01

    We report a method for measuring the transmission matrix of a disordered medium using a binary-control of a digital micromirror device (DMD). With knowledge of the measured transmission matrix, we identified the transmission eigenchannels of the medium. We then used binary control of the DMD to shape the wavefront of incident waves and to experimentally couple light to individual eigenchannels. When the wave was coupled to the eigenchannel with the largest eigenvalue, in particular, we were able to achieve about two times more energy transmission than the mean transmittance of the medium. Our study provides an elaborated use of the DMD as a high-speed wavefront shaping device for controlling the multiple scattering of waves in highly scattering media.

  16. A low-rank matrix recovery approach for energy efficient EEG acquisition for a wireless body area network.

    PubMed

    Majumdar, Angshul; Gogna, Anupriya; Ward, Rabab

    2014-08-25

    We address the problem of acquiring and transmitting EEG signals in Wireless Body Area Networks (WBAN) in an energy efficient fashion. In WBANs, the energy is consumed by three operations: sensing (sampling), processing and transmission. Previous studies only addressed the problem of reducing the transmission energy. For the first time, in this work, we propose a technique to reduce sensing and processing energy as well: this is achieved by randomly under-sampling the EEG signal. We depart from previous Compressed Sensing based approaches and formulate signal recovery (from under-sampled measurements) as a matrix completion problem. A new algorithm to solve the matrix completion problem is derived here. We test our proposed method and find that the reconstruction accuracy of our method is significantly better than state-of-the-art techniques; and we achieve this while saving sensing, processing and transmission energy. Simple power analysis shows that our proposed methodology consumes considerably less power compared to previous CS based techniques.

  17. Scattering matrix of arbitrary tight-binding Hamiltonians

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

    2017-03-15

    A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

  18. Application of the matrix exponential kernel

    NASA Technical Reports Server (NTRS)

    Rohach, A. F.

    1972-01-01

    A point matrix kernel for radiation transport, developed by the transmission matrix method, has been used to develop buildup factors and energy spectra through slab layers of different materials for a point isotropic source. Combinations of lead-water slabs were chosen for examples because of the extreme differences in shielding properties of these two materials.

  19. Hybrid transfer-matrix FDTD method for layered periodic structures.

    PubMed

    Deinega, Alexei; Belousov, Sergei; Valuev, Ilya

    2009-03-15

    A hybrid transfer-matrix finite-difference time-domain (FDTD) method is proposed for modeling the optical properties of finite-width planar periodic structures. This method can also be applied for calculation of the photonic bands in infinite photonic crystals. We describe the procedure of evaluating the transfer-matrix elements by a special numerical FDTD simulation. The accuracy of the new method is tested by comparing computed transmission spectra of a 32-layered photonic crystal composed of spherical or ellipsoidal scatterers with the results of direct FDTD and layer-multiple-scattering calculations.

  20. A METHOD FOR IN-SITU CHARACTERIZATION OF RF HEATING IN PARALLEL TRANSMIT MRI

    PubMed Central

    Alon, Leeor; Deniz, Cem Murat; Brown, Ryan; Sodickson, Daniel K.; Zhu, Yudong

    2012-01-01

    In ultra high field magnetic resonance imaging, parallel radio-frequency (RF) transmission presents both opportunities and challenges for specific absorption rate (SAR) management. On one hand, parallel transmission provides flexibility in tailoring electric fields in the body while facilitating magnetization profile control. On the other hand, it increases the complexity of energy deposition as well as possibly exacerbating local SAR by improper design or delivery of RF pulses. This study shows that the information needed to characterize RF heating in parallel transmission is contained within a local power correlation matrix. Building upon a calibration scheme involving a finite number of magnetic resonance thermometry measurements, the present work establishes a way of estimating the local power correlation matrix. Determination of this matrix allows prediction of temperature change for an arbitrary parallel transmit RF pulse. In the case of a three transmit coil MR experiment in a phantom, determination and validation of the power correlation matrix was conducted in less than 200 minutes with induced temperature changes of <4 degrees C. Further optimization and adaptation are possible, and simulations evaluating potential feasibility for in vivo use are presented. The method allows general characteristics indicative of RF coil/pulse safety determined in situ. PMID:22714806

  1. Verification of three-microphone impedance tube method for measurement of transmission loss in aerogels

    NASA Astrophysics Data System (ADS)

    Connick, Robert J.

    Accurate measurement of normal incident transmission loss is essential for the acoustic characterization of building materials. In this research, a method of measuring normal incidence sound transmission loss proposed by Salissou et al. as a complement to standard E2611-09 of the American Society for Testing and Materials [Standard Test Method for Measurement of Normal Incidence Sound Transmission of Acoustical Materials Based on the Transfer Matrix Method (American Society for Testing and Materials, New York, 2009)] is verified. Two sam- ples from the original literature are used to verify the method as well as a Filtros RTM sample. Following the verification, several nano-material Aerogel samples are measured.

  2. Deghosting based on the transmission matrix method

    NASA Astrophysics Data System (ADS)

    Wang, Benfeng; Wu, Ru-Shan; Chen, Xiaohong

    2017-12-01

    As the developments of seismic exploration and subsequent seismic exploitation advance, marine acquisition systems with towed streamers become an important seismic data acquisition method. But the existing air-water reflective interface can generate surface related multiples, including ghosts, which can affect the accuracy and performance of the following seismic data processing algorithms. Thus, we derive a deghosting method from a new perspective, i.e. using the transmission matrix (T-matrix) method instead of inverse scattering series. The T-matrix-based deghosting algorithm includes all scattering effects and is convergent absolutely. Initially, the effectiveness of the proposed method is demonstrated using synthetic data obtained from a designed layered model, and its noise-resistant property is also illustrated using noisy synthetic data contaminated by random noise. Numerical examples on complicated data from the open SMAART Pluto model and field marine data further demonstrate the validity and flexibility of the proposed method. After deghosting, low frequency components are recovered reasonably and the fake high frequency components are attenuated, and the recovered low frequency components will be useful for the subsequent full waveform inversion. The proposed deghosting method is currently suitable for two-dimensional towed streamer cases with accurate constant depth information and its extension into variable-depth streamers in three-dimensional cases will be studied in the future.

  3. Deterministic control of broadband light through a multiply scattering medium via the multispectral transmission matrix

    PubMed Central

    Andreoli, Daria; Volpe, Giorgio; Popoff, Sébastien; Katz, Ori; Grésillon, Samuel; Gigan, Sylvain

    2015-01-01

    We present a method to measure the spectrally-resolved transmission matrix of a multiply scattering medium, thus allowing for the deterministic spatiospectral control of a broadband light source by means of wavefront shaping. As a demonstration, we show how the medium can be used to selectively focus one or many spectral components of a femtosecond pulse, and how it can be turned into a controllable dispersive optical element to spatially separate different spectral components to arbitrary positions. PMID:25965944

  4. Simplified microstrip discontinuity modeling using the transmission line matrix method interfaced to microwave CAD

    NASA Astrophysics Data System (ADS)

    Thompson, James H.; Apel, Thomas R.

    1990-07-01

    A technique for modeling microstrip discontinuities is presented which is derived from the transmission line matrix method of solving three-dimensional electromagnetic problems. In this technique the microstrip patch under investigation is divided into an integer number of square and half-square (triangle) subsections. An equivalent lumped-element model is calculated for each subsection. These individual models are then interconnected as dictated by the geometry of the patch. The matrix of lumped elements is then solved using either of two microwave CAD software interfaces with each port properly defined. Closed-form expressions for the lumped-element representation of the individual subsections is presented and experimentally verified through the X-band frequency range. A model demonstrating the use of symmetry and block construction of a circuit element is discussed, along with computer program development and CAD software interface.

  5. Transfer matrix method for four-flux radiative transfer.

    PubMed

    Slovick, Brian; Flom, Zachary; Zipp, Lucas; Krishnamurthy, Srini

    2017-07-20

    We develop a transfer matrix method for four-flux radiative transfer, which is ideally suited for studying transport through multiple scattering layers. The model predicts the specular and diffuse reflection and transmission of multilayer composite films, including interface reflections, for diffuse or collimated incidence. For spherical particles in the diffusion approximation, we derive closed-form expressions for the matrix coefficients and show remarkable agreement with numerical Monte Carlo simulations for a range of absorption values and film thicknesses, and for an example multilayer slab.

  6. A reduced-order integral formulation to account for the finite size effect of isotropic square panels using the transfer matrix method.

    PubMed

    Bonfiglio, Paolo; Pompoli, Francesco; Lionti, Riccardo

    2016-04-01

    The transfer matrix method is a well-established prediction tool for the simulation of sound transmission loss and the sound absorption coefficient of flat multilayer systems. Much research has been dedicated to enhancing the accuracy of the method by introducing a finite size effect of the structure to be simulated. The aim of this paper is to present a reduced-order integral formulation to predict radiation efficiency and radiation impedance for a panel with equal lateral dimensions. The results are presented and discussed for different materials in terms of radiation efficiency, sound transmission loss, and the sound absorption coefficient. Finally, the application of the proposed methodology for rectangular multilayer systems is also investigated and validated against experimental data.

  7. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  8. As-received microstructure of a SiC/Ti-15-3 composite

    NASA Technical Reports Server (NTRS)

    Lerch, Bradley A.; Hull, David R.; Leonhardt, Todd A.

    1988-01-01

    A silicon carbide fiber reinforced titanium (Ti-15V-3Cr-3Sn-3Al) composite is metallographically examined. Several methods for examining composite materials are investigated and documented. Polishing techniques for this material are described. An interference layering method is developed to reveal the structure of the fiber, the reaction zone, and various phases within the matrix. Microprobe and transmission electron microscope (TEM) analyses are performed on the fiber/matrix interface. A detailed description of the fiber distribution as well as the microstructure of the fiber and matrix are presented.

  9. A method for the detection of the refractive index of irregular shape solid pigments in light absorbing liquid matrix.

    PubMed

    Niskanen, Ilpo; Räty, Jukka; Peiponen, Kai-Erik

    2010-06-15

    The immersion liquid method is powerful for the measurement of the refractive index of solid particles in a liquid matrix. However, this method applies best for cases when the liquid matrix is transparent. A problem is usually how to assess the refractive index of a pigment when it is in a colored host liquid. In this article we introduce a method, and show that by combining so-called multifunction spectrophotometer, immersion liquid method and detection of light transmission and reflection we can assess the refractive index of a pigment in a colored liquid, and also the extinction or absorption coefficient of the host liquid.

  10. Experimental estimation of transmissibility matrices for industrial multi-axis vibration isolation systems

    NASA Astrophysics Data System (ADS)

    Beijen, Michiel A.; Voorhoeve, Robbert; Heertjes, Marcel F.; Oomen, Tom

    2018-07-01

    Vibration isolation is essential for industrial high-precision systems to suppress external disturbances. The aim of this paper is to develop a general identification approach to estimate the frequency response function (FRF) of the transmissibility matrix, which is a key performance indicator for vibration isolation systems. The major challenge lies in obtaining a good signal-to-noise ratio in view of a large system weight. A non-parametric system identification method is proposed that combines floor and shaker excitations. Furthermore, a method is presented to analyze the input power spectrum of the floor excitations, both in terms of magnitude and direction. In turn, the input design of the shaker excitation signals is investigated to obtain sufficient excitation power in all directions with minimum experiment cost. The proposed methods are shown to provide an accurate FRF of the transmissibility matrix in three relevant directions on an industrial active vibration isolation system over a large frequency range. This demonstrates that, despite their heavy weight, industrial vibration isolation systems can be accurately identified using this approach.

  11. Research on soundproof properties of cylindrical shells of generalized phononic crystals

    NASA Astrophysics Data System (ADS)

    Liu, Ru; Shu, Haisheng; Wang, Xingguo

    2017-04-01

    Based on the previous studies, the concept of generalized phononic crystals (GPCs) is further introduced into the cylindrical shell structures in this paper. And a type of cylindrical shells of generalized phononic crystals (CS-GPCs) is constructed, the structural field and acoustic-structural coupled field of the composite cylindrical shells are examined respectively. For the structural field, the transfer matrix method of mechanical state vector is adopted to build the transfer matrix of radial waves propagating from inside to outside. For the acoustic-structural coupled field, the expressions of the acoustic transmission/reflection coefficients and the sound insulation of acoustic waves with the excitation of center line sound source are set up. And the acoustic transmission coefficient and the frequency response of sound insulation in this mode were numerical calculated. Furthermore, the theoretical analysis results are verified by using the method of combining the numerical calculation and finite element simulation. Finally, the effects of inner and outer fluid parameters on the transmission/reflection coefficients of CS-GPCs are analyzed in detail.

  12. Modulus design multiwavelength polarization microscope for transmission Mueller matrix imaging

    NASA Astrophysics Data System (ADS)

    Zhou, Jialing; He, Honghui; Chen, Zhenhua; Wang, Ye; Ma, Hui

    2018-01-01

    We have developed a polarization microscope based on a commercial transmission microscope. We replace the halogen light source by a collimated LED light source module of six different colors. We use achromatic polarized optical elements that can cover the six different wavelength ranges in the polarization state generator (PSG) and polarization state analyzer (PSA) modules. The dual-rotating wave plate method is used to measure the Mueller matrix of samples, which requires the simultaneous rotation of the two quarter-wave plates in both PSG and PSA at certain angular steps. A scientific CCD detector is used as the image receiving module. A LabView-based software is developed to control the rotation angels of the wave plates and the exposure time of the detector to allow the system to run fully automatically in preprogrammed schedules. Standard samples, such as air, polarizers, and quarter-wave plates, are used to calibrate the intrinsic Mueller matrix of optical components, such as the objectives, using the eigenvalue calibration method. Errors due to the images walk-off in the PSA are studied. Errors in the Mueller matrices are below 0.01 using air and polarizer as standard samples. Data analysis based on Mueller matrix transformation and Mueller matrix polarization decomposition is used to demonstrate the potential application of this microscope in pathological diagnosis.

  13. Aluminum/alkaline earth metal composites and method for producing

    DOEpatents

    Russell, Alan M; Anderson, Iver E; Kim, Hyong J; Freichs, Andrew E

    2014-02-11

    A composite is provided having an electrically conducting Al matrix and elongated filaments comprising Ca and/or Sr and/or Ba disposed in the matrix and extending along a longitudinal axis of the composite. The filaments initially comprise Ca and/or Sr and/or Ba metal or allow and then may be reacted with the Al matrix to form a strengthening intermetallic compound comprising Al and Ca and/or Sr and/or Ba. The composite is useful as a long-distance, high voltage power transmission conductor.

  14. Controlling Light Transmission Through Highly Scattering Media Using Semi-Definite Programming as a Phase Retrieval Computation Method.

    PubMed

    N'Gom, Moussa; Lien, Miao-Bin; Estakhri, Nooshin M; Norris, Theodore B; Michielssen, Eric; Nadakuditi, Raj Rao

    2017-05-31

    Complex Semi-Definite Programming (SDP) is introduced as a novel approach to phase retrieval enabled control of monochromatic light transmission through highly scattering media. In a simple optical setup, a spatial light modulator is used to generate a random sequence of phase-modulated wavefronts, and the resulting intensity speckle patterns in the transmitted light are acquired on a camera. The SDP algorithm allows computation of the complex transmission matrix of the system from this sequence of intensity-only measurements, without need for a reference beam. Once the transmission matrix is determined, optimal wavefronts are computed that focus the incident beam to any position or sequence of positions on the far side of the scattering medium, without the need for any subsequent measurements or wavefront shaping iterations. The number of measurements required and the degree of enhancement of the intensity at focus is determined by the number of pixels controlled by the spatial light modulator.

  15. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  16. Pathloss Calculation Using the Transmission Line Matrix and Finite Difference Time Domain Methods With Coarse Grids

    DOE PAGES

    Nutaro, James; Kuruganti, Teja

    2017-02-24

    Numerical simulations of the wave equation that are intended to provide accurate time domain solutions require a computational mesh with grid points separated by a distance less than the wavelength of the source term and initial data. However, calculations of radio signal pathloss generally do not require accurate time domain solutions. This paper describes an approach for calculating pathloss by using the finite difference time domain and transmission line matrix models of wave propagation on a grid with points separated by distances much greater than the signal wavelength. The calculated pathloss can be kept close to the true value formore » freespace propagation with an appropriate selection of initial conditions. This method can also simulate diffraction with an error governed by the ratio of the signal wavelength to the grid spacing.« less

  17. Modulus design multiwavelength polarization microscope for transmission Mueller matrix imaging.

    PubMed

    Zhou, Jialing; He, Honghui; Chen, Zhenhua; Wang, Ye; Ma, Hui

    2018-01-01

    We have developed a polarization microscope based on a commercial transmission microscope. We replace the halogen light source by a collimated LED light source module of six different colors. We use achromatic polarized optical elements that can cover the six different wavelength ranges in the polarization state generator (PSG) and polarization state analyzer (PSA) modules. The dual-rotating wave plate method is used to measure the Mueller matrix of samples, which requires the simultaneous rotation of the two quarter-wave plates in both PSG and PSA at certain angular steps. A scientific CCD detector is used as the image receiving module. A LabView-based software is developed to control the rotation angels of the wave plates and the exposure time of the detector to allow the system to run fully automatically in preprogrammed schedules. Standard samples, such as air, polarizers, and quarter-wave plates, are used to calibrate the intrinsic Mueller matrix of optical components, such as the objectives, using the eigenvalue calibration method. Errors due to the images walk-off in the PSA are studied. Errors in the Mueller matrices are below 0.01 using air and polarizer as standard samples. Data analysis based on Mueller matrix transformation and Mueller matrix polarization decomposition is used to demonstrate the potential application of this microscope in pathological diagnosis. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

  18. Polarization-resolved sensing with tilted fiber Bragg gratings: theory and limits of detection

    NASA Astrophysics Data System (ADS)

    Bialiayeu, Aliaksandr; Ianoul, Anatoli; Albert, Jacques

    2015-08-01

    Polarization based sensing with tilted fiber Bragg grating (TFBG) sensors is analysed theoretically by two alternative approaches. The first method is based on tracking the grating transmission for two orthogonal states of linear polarized light that are extracted from the measured Jones matrix or Stokes vectors of the TFBG transmission spectra. The second method is based on the measurements along the system principle axes and polarization dependent loss (PDL) parameter, also calculated from measured data. It is shown that the frequent crossing of the Jones matrix eigenvalues as a function of wavelength leads to a non-physical interchange of the calculated principal axes; a method to remove this unwanted mathematical artefact and to restore the order of the system eigenvalues and the corresponding principal axes is provided. A comparison of the two approaches reveals that the PDL method provides a smaller standard deviation and therefore lower limit of detection in refractometric sensing. Furthermore, the polarization analysis of the measured spectra allows for the identification of the principal states of polarization of the sensor system and consequentially for the calculation of the transmission spectrum for any incident polarization state. The stability of the orientation of the system principal axes is also investigated as a function of wavelength.

  19. Characteristic analysis on UAV-MIMO channel based on normalized correlation matrix.

    PubMed

    Gao, Xi jun; Chen, Zi li; Hu, Yong Jiang

    2014-01-01

    Based on the three-dimensional GBSBCM (geometrically based double bounce cylinder model) channel model of MIMO for unmanned aerial vehicle (UAV), the simple form of UAV space-time-frequency channel correlation function which includes the LOS, SPE, and DIF components is presented. By the methods of channel matrix decomposition and coefficient normalization, the analytic formula of UAV-MIMO normalized correlation matrix is deduced. This formula can be used directly to analyze the condition number of UAV-MIMO channel matrix, the channel capacity, and other characteristic parameters. The simulation results show that this channel correlation matrix can be applied to describe the changes of UAV-MIMO channel characteristics under different parameter settings comprehensively. This analysis method provides a theoretical basis for improving the transmission performance of UAV-MIMO channel. The development of MIMO technology shows practical application value in the field of UAV communication.

  20. Characteristic Analysis on UAV-MIMO Channel Based on Normalized Correlation Matrix

    PubMed Central

    Xi jun, Gao; Zi li, Chen; Yong Jiang, Hu

    2014-01-01

    Based on the three-dimensional GBSBCM (geometrically based double bounce cylinder model) channel model of MIMO for unmanned aerial vehicle (UAV), the simple form of UAV space-time-frequency channel correlation function which includes the LOS, SPE, and DIF components is presented. By the methods of channel matrix decomposition and coefficient normalization, the analytic formula of UAV-MIMO normalized correlation matrix is deduced. This formula can be used directly to analyze the condition number of UAV-MIMO channel matrix, the channel capacity, and other characteristic parameters. The simulation results show that this channel correlation matrix can be applied to describe the changes of UAV-MIMO channel characteristics under different parameter settings comprehensively. This analysis method provides a theoretical basis for improving the transmission performance of UAV-MIMO channel. The development of MIMO technology shows practical application value in the field of UAV communication. PMID:24977185

  1. Morphology and dispersion of FeCo alloy nanoparticles dispersed in a matrix of IR pyrolized polyvinyl alcohol

    NASA Astrophysics Data System (ADS)

    Vasilev, A. A.; Dzidziguri, E. L.; Muratov, D. G.; Zhilyaeva, N. A.; Efimov, M. N.; Karpacheva, G. P.

    2018-04-01

    Metal-carbon nanocomposites consisting of FeCo alloy nanoparticles dispersed in a carbon matrix were synthesized by the thermal decomposition method of a precursor based on polyvinyl alcohol and metals salts. The synthesized powders were investigated by X-ray diffraction (XRD), X-ray fluorescent spectrometry (XRFS), transmission electron microscopy (TEM) and scanning electron microscopy (SEM). Surface characteristics of materials were measured by BET-method. The morphology and dispersity of metal nanoparticles were studied depending on the metals ratio in the composite.

  2. Electrical transport engineering of semiconductor superlattice structures

    NASA Astrophysics Data System (ADS)

    Shokri, Aliasghar

    2014-04-01

    We investigate the influence of doping concentration on band structures of electrons and electrical transmission in a typical aperiodic semiconductor superlattice consisting of quantum well and barrier layers, theoretically. For this purpose, we assume that each unit cell of the superlattice contains alternately two types of material GaAs (as a well) and GaAlAs (as a barrier) with six sublayers of two materials. Our calculations are based on the generalized Kronig-Penny (KP) model and the transfer matrix method within the framework of the parabolic conductance band effective mass approximation in the coherent regime. This model reduces the numerical calculation time and enables us to use the transfer matrix method to investigate transport in the superlattices. We show that by varying the doping concentration and geometrical parameters, one can easily block the transmission of the electrons. The numerical results may be useful in designing of nanoenergy filter devices.

  3. A Comparison of Surface Acoustic Wave Modeling Methods

    NASA Technical Reports Server (NTRS)

    Wilson, W. c.; Atkinson, G. M.

    2009-01-01

    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method a first order model, and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices.

  4. Transfer matrix modeling and experimental validation of cellular porous material with resonant inclusions.

    PubMed

    Doutres, Olivier; Atalla, Noureddine; Osman, Haisam

    2015-06-01

    Porous materials are widely used for improving sound absorption and sound transmission loss of vibrating structures. However, their efficiency is limited to medium and high frequencies of sound. A solution for improving their low frequency behavior while keeping an acceptable thickness is to embed resonant structures such as Helmholtz resonators (HRs). This work investigates the absorption and transmission acoustic performances of a cellular porous material with a two-dimensional periodic arrangement of HR inclusions. A low frequency model of a resonant periodic unit cell based on the parallel transfer matrix method is presented. The model is validated by comparison with impedance tube measurements and simulations based on both the finite element method and a homogenization based model. At the HR resonance frequency (i) the transmission loss is greatly improved and (ii) the sound absorption of the foam can be either decreased or improved depending on the HR tuning frequency and on the thickness and properties of the host foam. Finally, the diffuse field sound absorption and diffuse field sound transmission loss performance of a 2.6 m(2) resonant cellular material are measured. It is shown that the improvements observed at the Helmholtz resonant frequency on a single cell are confirmed at a larger scale.

  5. A Calculation Method of Electric Distance and Subarea Division Application Based on Transmission Impedance

    NASA Astrophysics Data System (ADS)

    Fang, G. J.; Bao, H.

    2017-12-01

    The widely used method of calculating electric distances is sensitivity method. The sensitivity matrix is the result of linearization and based on the hypothesis that the active power and reactive power are decoupled, so it is inaccurate. In addition, it calculates the ratio of two partial derivatives as the relationship of two dependent variables, so there is no physical meaning. This paper presents a new method for calculating electrical distance, namely transmission impedance method. It forms power supply paths based on power flow tracing, then establishes generalized branches to calculate transmission impedances. In this paper, the target of power flow tracing is S instead of Q. Q itself has no direction and the grid delivers complex power so that S contains more electrical information than Q. By describing the power transmission relationship of the branch and drawing block diagrams in both forward and reverse directions, it can be found that the numerators of feedback parts of two block diagrams are all the transmission impedances. To ensure the distance is scalar, the absolute value of transmission impedance is defined as electrical distance. Dividing network according to the electric distances and comparing with the results of sensitivity method, it proves that the transmission impedance method can adapt to the dynamic change of system better and reach a reasonable subarea division scheme.

  6. Improving properties of Mg with Al–Cu additions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rashad, Muhammad, E-mail: rashadphy87@gmail.com; National Engineering Research Center for Magnesium Alloys, Chongqing University, Chongqing 400044; Pan, Fusheng, E-mail: fspan@cqu.edu.cn

    The present work reports improvement in tensile properties of the Mg matrix reinforced with micron-sized copper–aluminum particulate hybrids. The Al–Cu particulate hybrids were incorporated into the Mg matrix through powder metallurgy method. The synthesized alloys exhibited homogeneously dispersed Mg{sub 2}Cu particles in the matrix, therefore leading to a 110% increase in yield strength (221 MPa) and a 72% enhancement in ultimate tensile strength (284 MPa) by addition of 1.0 wt.%Al–0.6 wt.%Cu particle hybrids. Optical microscopy, scanning election microscopy, transmission electron microscopy and X-ray diffraction were used to investigate the microstructure and intermetallic phases of the synthesized alloys. - Highlights: •more » Mg matrix is reinforced with Al–Cu particulate hybrids. • Powder metallurgic method is used to fabricate the alloys. • Tensile strength and ductility were increased simultaneously.« less

  7. Continuous-Time Bilinear System Identification

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan

    2003-01-01

    The objective of this paper is to describe a new method for identification of a continuous-time multi-input and multi-output bilinear system. The approach is to make judicious use of the linear-model properties of the bilinear system when subjected to a constant input. Two steps are required in the identification process. The first step is to use a set of pulse responses resulting from a constant input of one sample period to identify the state matrix, the output matrix, and the direct transmission matrix. The second step is to use another set of pulse responses with the same constant input over multiple sample periods to identify the input matrix and the coefficient matrices associated with the coupling terms between the state and the inputs. Numerical examples are given to illustrate the concept and the computational algorithm for the identification method.

  8. Multicoaxial cylindrical inclusions in locally resonant phononic crystals

    NASA Astrophysics Data System (ADS)

    Larabi, H.; Pennec, Y.; Djafari-Rouhani, B.; Vasseur, J. O.

    2007-06-01

    It is known that the transmission spectrum of the so-called locally resonant phononic crystal can exhibit absolute sharp dips in the sonic frequency range due to the resonance scattering of elastic waves. In this paper, we study theoretically, using a finite difference time domain method, the propagation of acoustic waves through a two-dimensional locally resonant crystal in which the matrix is a fluid (such as water) instead of being a solid as in most of the previous papers. The transmission is shown to be dependent upon the fluid or solid nature of the matrix as well as upon the nature of the coating material in contact with the matrix. The other main purpose of this paper is to consider inclusions constituted by coaxial cylindrical multilayers consisting of several alternate shells of a soft material (such as a soft rubber) and a hard material (such as steel). With respect to the usual case of a hard core coated with a soft rubber, the transmission spectrum can exhibit in the same frequency range several peaks instead of one. If two or more phononic crystals are associated together, we find that the structure displays all the zeros of transmission resulting from each individual crystal. Moreover, we show that it is possible to overlap the dips by an appropriate combination of phononic crystals and create a larger acoustic stop band.

  9. Elastic and viscoelastic effects in rubber/air acoustic band gap structures: A theoretical and experimental study

    NASA Astrophysics Data System (ADS)

    Merheb, B.; Deymier, P. A.; Jain, M.; Aloshyna-Lesuffleur, M.; Mohanty, S.; Berker, A.; Greger, R. W.

    2008-09-01

    The transmission of acoustic waves through centimeter-scale elastic and viscoelastic two-dimensional silicone rubber/air phononic crystal structures is investigated theoretically and experimentally. We introduce a finite difference time domain method for two-dimensional elastic and viscoelastic composite structures. Elastic fluid-solid phononic crystals composed of a two-dimensional array of cylindrical air inclusions in a solid rubber matrix, as well as an array of rubber cylinders in an air matrix, are shown to behave similarly to fluid-fluid composite structures. These systems exhibit very wide band gaps in their transmission spectra that extend to frequencies in the audible range of the spectrum. This effect is associated with the very low value of the transverse speed of sound in rubber compared to that of the longitudinal polarization. The difference in transmission between elastic and viscoelastic rubber/air crystals results from attenuation of transmission over a very wide frequency range, leaving only narrow passing bands at very low frequencies. These phononic crystals demonstrate the practical design of elastic or viscoelastic solid rubber/air acoustic band gap sound barriers with small dimensions.

  10. On prototypical wave transmission across a junction of waveguides with honeycomb structure

    NASA Astrophysics Data System (ADS)

    Sharma, Basant Lal

    2018-02-01

    An exact expression for the scattering matrix associated with a junction generated by partial unzipping along the zigzag direction of armchair tubes is presented. The assumed simple, but representative, model, for scalar wave transmission can be interpreted in terms of the transport of the out-of-plane phonons in the ribbon-side vis-a-vis the radial phonons in the tubular-side of junction, based on the nearest-neighbor interactions between lattice sites. The exact solution for the `bondlength' in `broken' versus intact bonds can be constructed via a standard application of the Wiener-Hopf technique. The amplitude distribution of outgoing phonons, far away from the junction on either side of it, is obtained in closed form by the mode-matching method; eventually, this leads to the provision of the scattering matrix. As the main result of the paper, a succinct and closed form expression for the accompanying reflection and transmission coefficients is provided along with a detailed derivation using the Chebyshev polynomials. Applications of the analysis presented in this paper include linear wave transmission in nanotubes, nanoribbons, and monolayers of honeycomb lattices containing carbon-like units.

  11. Theorems on symmetries and flux conservation in radiative transfer using the matrix operator theory.

    NASA Technical Reports Server (NTRS)

    Kattawar, G. W.

    1973-01-01

    The matrix operator approach to radiative transfer is shown to be a very powerful technique in establishing symmetry relations for multiple scattering in inhomogeneous atmospheres. Symmetries are derived for the reflection and transmission operators using only the symmetry of the phase function. These results will mean large savings in computer time and storage for performing calculations for realistic planetary atmospheres using this method. The results have also been extended to establish a condition on the reflection matrix of a boundary in order to preserve reciprocity. Finally energy conservation is rigorously proven for conservative scattering in inhomogeneous atmospheres.

  12. MMP inhibition as a potential method to augment the healing of skeletal muscle and tendon extracellular matrix

    PubMed Central

    Davis, Max E.; Gumucio, Jonathan P.; Sugg, Kristoffer B.; Bedi, Asheesh

    2013-01-01

    The extracellular matrix (ECM) of skeletal muscle and tendon is composed of different types of collagen molecules that play important roles in the transmission of forces throughout the body, and in the repair and regeneration of injured tissues. Fibroblasts are the primary cells in muscle and tendon that maintain, repair, and modify the ECM in response to mechanical loading, injury, and inactivity. Matrix metalloproteinases (MMPs) are enzymes that digest collagen and other structural molecules, which are synthesized and excreted by fibroblasts. MMPs are required for baseline ECM homeostasis, but disruption of MMP regulation due to injury or disease can alter the normal ECM architecture and prevent proper force transmission. Chronic injuries and diseases of muscles and tendons can be severely debilitating, and current therapeutic modalities to enhance healing are quite limited. This review will discuss the mechanobiology of MMPs, and the potential use of MMP inhibitors to improve the treatment of injured and diseased skeletal muscle and tendon tissue. PMID:23640595

  13. Heterogeneous Distribution of Carbonaceous Material in Murchison Matrix: In Situ Observations Using Energy Filtered Transmission Electron Microscopy

    NASA Technical Reports Server (NTRS)

    Brearley, Adrian J.

    2002-01-01

    Energy filtered TEM (Transmission Electron Microscopy) has been used to study the location of carbonaceous material in situ in Murchison matrix. Carbon occurs frequently as narrow rims around sulfide grains, but is rare in regions of matrix that are dominated by phyllosilicates. Additional information is contained in the original extended abstract.

  14. Acoustic wave transmission through piezoelectric structured materials.

    PubMed

    Lam, M; Le Clézio, E; Amorín, H; Algueró, M; Holc, Janez; Kosec, Marija; Hladky-Hennion, A C; Feuillard, G

    2009-05-01

    This paper deals with the transmission of acoustic waves through multilayered piezoelectric materials. It is modeled in an octet formalism via the hybrid matrix of the structure. The theoretical evolution with the angle and frequency of the transmission coefficients of ultrasonic plane waves propagating through a partially depoled PZT plate is compared to finite element calculations showing that both methods are in very good agreement. The model is then used to study a periodic stack of 0.65 PMN-0.35 PT/0.90 PMN-0.10 PT layers. The transmission spectra are interpreted in terms of a dispersive behavior of the critical angles of longitudinal and transverse waves, and band gap structures are analysed. Transmission measurements confirm the theoretical calculations and deliver an experimental validation of the model.

  15. Viscoelastic effect on acoustic band gaps in polymer-fluid composites

    NASA Astrophysics Data System (ADS)

    Merheb, B.; Deymier, P. A.; Muralidharan, K.; Bucay, J.; Jain, M.; Aloshyna-Lesuffleur, M.; Greger, R. W.; Mohanty, S.; Berker, A.

    2009-10-01

    In this paper, we present a theoretical analysis of the propagation of acoustic waves through elastic and viscoelastic two-dimensional phononic crystal structures. Numerical calculations of transmission spectra are conducted by extending the finite-difference-time-domain method to account for linear viscoelastic materials with time-dependent moduli. We study a phononic crystal constituted of a square array of cylindrical air inclusions in a solid viscoelastic matrix. The elastic properties of the solid are those of a silicone rubber. This system exhibits very wide band gaps in its transmission spectrum that extend to frequencies in the audible range of the spectrum. These gaps are characteristic of fluid matrix/air inclusion systems and result from the very large contrast between the longitudinal and transverse speeds of sound in rubber. By treating the matrix as a viscoelastic medium within the standard linear solid (SLS) model, we demonstrate that viscoelasticity impacts the transmission properties of the rubber/air phononic crystal not only by attenuating the transmitted acoustic waves but also by shifting the passing bands frequencies toward lower values. The ranges of frequencies exhibiting attenuation or frequency shift are determined by the value of the relaxation time in the SLS model. We show that viscoelasticity can be used to decrease the frequency of pass bands (and consequently stop bands) in viscoelastic/air phononic crystals.

  16. Giant oscillating magnetoresistance in silicene-based structures

    NASA Astrophysics Data System (ADS)

    Oubram, O.; Navarro, O.; Rodríguez-Vargas, I.; Guzman, E. J.; Cisneros-Villalobos, L.; Velásquez-Aguilar, J. G.

    2018-02-01

    Ballistic electron transport in a silicene structure, composed of a pair of magnetic gates, in the ferromagnetic and an-tiferromagnetic configuration is studied. This theoretical study has been done using the matrix transfer method to calculate the transmission, the conductance for parallel and antiparallel magnetic alignment and the magnetoresistance. Results show that conductance and magnetoresistance oscillate as a function of the length between the two magnetic domains. The forbidden transmission region also increases as a function of the barrier separation distance.

  17. Investigation of noise in gear transmissions by the method of mathematical smoothing of experiments

    NASA Technical Reports Server (NTRS)

    Sheftel, B. T.; Lipskiy, G. K.; Ananov, P. P.; Chernenko, I. K.

    1973-01-01

    A rotatable central component smoothing method is used to analyze rotating gear noise spectra. A matrix is formulated in which the randomized rows correspond to various tests and the columns to factor values. Canonical analysis of the obtained regression equation permits the calculation of optimal speed and load at a previous assigned noise level.

  18. A rapid Fourier-transform infrared (FTIR) spectroscopic method for direct quantification of paracetamol content in solid pharmaceutical formulations

    NASA Astrophysics Data System (ADS)

    Mallah, Muhammad Ali; Sherazi, Syed Tufail Hussain; Bhanger, Muhammad Iqbal; Mahesar, Sarfaraz Ahmed; Bajeer, Muhammad Ashraf

    2015-04-01

    A transmission FTIR spectroscopic method was developed for direct, inexpensive and fast quantification of paracetamol content in solid pharmaceutical formulations. In this method paracetamol content is directly analyzed without solvent extraction. KBr pellets were formulated for the acquisition of FTIR spectra in transmission mode. Two chemometric models: simple Beer's law and partial least squares employed over the spectral region of 1800-1000 cm-1 for quantification of paracetamol content had a regression coefficient of (R2) of 0.999. The limits of detection and quantification using FTIR spectroscopy were 0.005 mg g-1 and 0.018 mg g-1, respectively. Study for interference was also done to check effect of the excipients. There was no significant interference from the sample matrix. The results obviously showed the sensitivity of transmission FTIR spectroscopic method for pharmaceutical analysis. This method is green in the sense that it does not require large volumes of hazardous solvents or long run times and avoids prior sample preparation.

  19. Shock and vibration response of multistage structure

    NASA Technical Reports Server (NTRS)

    Lee, S. Y.; Liyeos, J. G.; Tang, S. S.

    1968-01-01

    Study of the shock and vibration response of a multistage structure employed analytically, lumped-mass, continuous-beam, multimode, and matrix-iteration methods. The study was made on the load paths, transmissibility, and attenuation properties along a longitudinal axis of a long, slender structure with increasing degree of complexity.

  20. Matrix method for two-dimensional waveguide mode solution

    NASA Astrophysics Data System (ADS)

    Sun, Baoguang; Cai, Congzhong; Venkatesh, Balajee Seshasayee

    2018-05-01

    In this paper, we show that the transfer matrix theory of multilayer optics can be used to solve the modes of any two-dimensional (2D) waveguide for their effective indices and field distributions. A 2D waveguide, even composed of numerous layers, is essentially a multilayer stack and the transmission through the stack can be analysed using the transfer matrix theory. The result is a transfer matrix with four complex value elements, namely A, B, C and D. The effective index of a guided mode satisfies two conditions: (1) evanescent waves exist simultaneously in the first (cladding) layer and last (substrate) layer, and (2) the complex element D vanishes. For a given mode, the field distribution in the waveguide is the result of a 'folded' plane wave. In each layer, there is only propagation and absorption; at each boundary, only reflection and refraction occur, which can be calculated according to the Fresnel equations. As examples, we show that this method can be used to solve modes supported by the multilayer step-index dielectric waveguide, slot waveguide, gradient-index waveguide and various plasmonic waveguides. The results indicate the transfer matrix method is effective for 2D waveguide mode solution in general.

  1. Supratransmission in a metastable modular metastructure for tunable non-reciprocal wave transmission

    NASA Astrophysics Data System (ADS)

    Wu, Zhen; Wang, K. W.

    2018-03-01

    In this research, we numerically and analytically investigate the nonlinear energy transmission phenomenon in a metastable modular metastructure. Numerical studies on a 1D metastable chain provide clear evidence that when driving frequency is within the stopband of the periodic structure, there exists a threshold for the driving amplitude, above which sudden increase in the energy transmission can be observed. This onset of transmission is due to nonlinear instability and is known as supratransmission. We discover that due to spatial asymmetry of strategically configured constituents, such transmission thresholds are considerably different when structure is excited from different ends and this discrepancy creates a region of non-reciprocal energy transmission. We demonstrate that when the loss of stability is due to saddlenode bifurcation, the transmission threshold can be predicted analytically using a localized nonlinear-linear system model, and analyzed via combining harmonic balancing and transfer matrix methods. These investigations elucidate the rich and complex dynamics achievable by nonlinearity and metastabilities, and provide synthesize tools for tunable bandgaps and non-reciprocal wave transmissions.

  2. Surface acoustic wave coding for orthogonal frequency coded devices

    NASA Technical Reports Server (NTRS)

    Malocha, Donald (Inventor); Kozlovski, Nikolai (Inventor)

    2011-01-01

    Methods and systems for coding SAW OFC devices to mitigate code collisions in a wireless multi-tag system. Each device producing plural stepped frequencies as an OFC signal with a chip offset delay to increase code diversity. A method for assigning a different OCF to each device includes using a matrix based on the number of OFCs needed and the number chips per code, populating each matrix cell with OFC chip, and assigning the codes from the matrix to the devices. The asynchronous passive multi-tag system includes plural surface acoustic wave devices each producing a different OFC signal having the same number of chips and including a chip offset time delay, an algorithm for assigning OFCs to each device, and a transceiver to transmit an interrogation signal and receive OFC signals in response with minimal code collisions during transmission.

  3. Single-phase power distribution system power flow and fault analysis

    NASA Technical Reports Server (NTRS)

    Halpin, S. M.; Grigsby, L. L.

    1992-01-01

    Alternative methods for power flow and fault analysis of single-phase distribution systems are presented. The algorithms for both power flow and fault analysis utilize a generalized approach to network modeling. The generalized admittance matrix, formed using elements of linear graph theory, is an accurate network model for all possible single-phase network configurations. Unlike the standard nodal admittance matrix formulation algorithms, the generalized approach uses generalized component models for the transmission line and transformer. The standard assumption of a common node voltage reference point is not required to construct the generalized admittance matrix. Therefore, truly accurate simulation results can be obtained for networks that cannot be modeled using traditional techniques.

  4. Transmission matrix analysis of the chinchilla middle ear

    PubMed Central

    Songer, Jocelyn E.; Rosowski, John J.

    2008-01-01

    Despite the common use of the chinchilla as an animal model in auditory research, a complete characterization of the chinchilla middle ear using transmission matrix analysis has not been performed. In this paper we describe measurements of middle-ear input admittance and stapes velocity in ears with the middle-ear cavity opened under three conditions: intact tympano-ossicular system and cochlea, after the cochlea has been drained, and after the stapes has been fixed. These measurements, made with stimulus frequencies of 100–8000 Hz, are used to define the transmission matrix parameters of the middle ear and to calculate the cochlear input impedance as well as the middle-ear output impedance. This transmission characterization of the chinchilla middle ear will be useful for modeling auditory sensitivity in the normal and pathological chinchilla ear. PMID:17672642

  5. Spin-resolved conductance of Dirac electrons through multibarrier arrays

    NASA Astrophysics Data System (ADS)

    Dahal, Dipendra; Gumbs, Godfrey; Iurov, Andrii

    We use a transfer matrix method to calculate the transmission coefficient of Dirac electrons through an arbitrary number of square potential barrier in gapped monolayer graphene(MLG) and bilayer graphene (BLG). The widths of barriers may not be chosen equal. The shift in the angle of incidence and the width of the barrier required for resonance are investigated numerically for both MLG and BLG. We compare the effects due to energy gap on these two transmission coefficient for each of these two structures (MLG and BLG). We present our results as functions of barrier width, height as well as incoming electron energy as well as band gap and examine the conditions for which perfect reflection or transmission occurs. Our transmission data are further used to calculate conductivity.

  6. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    NASA Astrophysics Data System (ADS)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  7. Theoretical study of the transmission properties of a one-dimensional polycarbonate-liquid photonic array

    NASA Astrophysics Data System (ADS)

    Sánchez, A.; Guerra, K. Y.; Porta, A. V.; Orozco, S.

    2018-02-01

    The opto-fluidics systems can be used for label free refractometric and biosensensing applications. In this work transmission properties of one-dimensional polycarbonate-liquid photonic arrays are studied, where methanol and ethanol were proposed as liquid components. The band structure and the transmission spectrum were calculated using the transference matrix method, in which we consider the dispersion relation for the refractive index n(w) of each material in the visible range. Using lattice parameters of 1 µm, 10 µm, and 4 µm, we obtained forbidden bandgaps in the visible region. When lattice parameters of 1000 µm were considered, we obtained several narrow bandgaps in the visible range.

  8. Preparation of nano cellulose fibers and its application in kappa-carrageenan based film.

    PubMed

    Savadekar, N R; Karande, V S; Vigneshwaran, N; Bharimalla, A K; Mhaske, S T

    2012-12-01

    Bio-based nanocomposite films were successfully developed using nanofibrillated cellulose (NFC) as the reinforcing phase and kappa-carrageenan (KCRG) as the matrix. NFC was successfully synthesis from short stable cotton fibers by chemo-mechanical process. The bionanocomposites were prepared by incorporating 0.1, 0.2, 0.3, 0.4, 0.5, and 1wt% of the NFC into a KCRG matrix using a solution casting method there characterization was done in terms of thermal properties (DSC), morphology (SEM), water vapor transmission rate (WVTR), oxygen transmission rate (OTR), X-ray diffractograms (XRD), and tensile properties. The main conclusion arising from the analysis of the result is that the bionanocomposites containing 0.4wt% of NFC exhibited the highest enhancement in tensile strength it is almost 44% improvement. WVTR and OTR results showed improvement of all nanocomposite film compare to control KCRG film. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Chiroplasmonic magnetic gold nanocomposites produced by one-step aqueous method using κ-carrageenan.

    PubMed

    Lesnichaya, Marina V; Sukhov, Boris G; Aleksandrova, Galina P; Gasilova, Ekaterina R; Vakul'skaya, Tamara I; Khutsishvili, Spartak S; Sapozhnikov, Anatoliy N; Klimenkov, Igor V; Trofimov, Boris A

    2017-11-01

    Novel water-soluble chiroplasmonic nanobiocomposites with directly varied gold content were synthesized by a one-step redox method in water using a biocompatible polysaccharide κ-carrageenan (industrial product from algae) as both reducing and stabilizing matrix. The influence of the reactants ratio, temperature, and pH on the reaction was studied and the optimal reaction parameters were found. The structure and the properties of composite nanomaterials were examined in solid state and aqueous solutions by using complementary physical-chemical methods X-ray diffraction analysis, transmission electron microscopy, spectroscopy of electron paramagnetic resonance, atomic absorption and optical spectroscopy, polarimetry including optical rotatory dispersion with registration of interphase-crossbred Cotton effect of a chiral polysaccharide matrix on plasmonic chromophore of gold nanoparticles, dynamic and static light scattering. The new perspective multi-purpose nanocomposites demonstrate a complex of chiroplasmonic and magnetic properties, imparted by both nanoparticles and radicals enriched chiral polysaccharide matrix. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. The pH-controlled synthesis of a gold nanoparticle/polymer matrix via electrodeposition at a liquid liquid interface

    NASA Astrophysics Data System (ADS)

    Lepková, K.; Clohessy, J.; Cunnane, V. J.

    2007-09-01

    A controlled synthesis of metal nanoparticles co-deposited in a polymer matrix at various pH conditions has been investigated at the interface between two immiscible phases. The pH value of the aqueous phase is modified, resulting in various types of reaction between the gold compound and the monomer. The types of electrochemical processes and their kinetic parameters are determined using both the method of Nicholson and a method based on the Butler-Volmer equation. Cyclic voltammetry is the experimental method used. A material analysis via transmission electron microscopy and particle size distribution calculations confirm that nanoparticles of different sizes can be synthesized by modification of the system pH. The stability of the generated nanocomposite is also discussed.

  11. A streaming multi-GPU implementation of image simulation algorithms for scanning transmission electron microscopy

    DOE PAGES

    Pryor, Alan; Ophus, Colin; Miao, Jianwei

    2017-10-25

    Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. In this paper, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditionalmore » multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic, using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic.« less

  12. A streaming multi-GPU implementation of image simulation algorithms for scanning transmission electron microscopy.

    PubMed

    Pryor, Alan; Ophus, Colin; Miao, Jianwei

    2017-01-01

    Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. Here, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditional multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic , using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic .

  13. A streaming multi-GPU implementation of image simulation algorithms for scanning transmission electron microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pryor, Alan; Ophus, Colin; Miao, Jianwei

    Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. In this paper, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditionalmore » multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic, using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic.« less

  14. Optical Analog to Electromagnetically Induced Transparency in Cascaded Ring-Resonator Systems.

    PubMed

    Wang, Yonghua; Zheng, Hua; Xue, Chenyang; Zhang, Wendong

    2016-07-25

    The analogue of electromagnetically induced transparency in optical methods has shown great potential in slow light and sensing applications. Here, we experimentally demonstrated a coupled resonator induced transparency system with three cascaded ring coupled resonators in a silicon chip. The structure was modeled by using the transfer matrix method. Influences of various parameters including coupling ratio of couplers, waveguide loss and additional loss of couplers on transmission characteristic and group index have been investigated theoretically and numerically in detail. The transmission character of the system was measured by the vertical grating coupling method. The enhanced quality factor reached 1.22 × 10⁵. In addition, we further test the temperature performance of the device. The results provide a new method for the manipulation of light in highly integrated optical circuits and sensing applications.

  15. Effect of reduced graphene oxide-carbon nanotubes hybrid nanofillers in mechanical properties of polymer nanocomposites

    NASA Astrophysics Data System (ADS)

    Sa, Kadambinee; Mahakul, Prakash C.; Subramanyam, B. V. R. S.; Raiguru, Jagatpati; Das, Sonali; Alam, Injamul; Mahanandia, Pitamber

    2018-03-01

    Graphene and carbon nanotubes (CNTs) have tremendous interest as reinforcing fillers due to their excellent physical properties. However, their reinforcing effect in polymer matrix is limited due to agglomeration of graphene and CNTs within the polymer matrix. Mechanical properties by the admixture of reduced graphene oxide (rGO) and CNTs in Poly (methyl methacrylate) (PMMA) prepared by solution mixing method has been investigated. The prepared samples are characterized using X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscope (TEM) and Raman spectroscopy. The hybrid composite shows improvement in the mechanical properties compared to rGO/PMMA and MWCNTs/PMMA composites due to better interaction between rGO-MWCNTs and polymer matrix.

  16. Design for a broad non-transmission band gap of three-color filters using photonic heterostructures

    NASA Astrophysics Data System (ADS)

    Li, Hongfei; Guan, Huihuan; Han, Peide; Li, Yuping; Zhang, Caili

    2013-01-01

    The bandgap characteristics of one-dimensional (1D) photonic crystal (PC) heterostructures containing defects are studied using the transfer matrix method. The key is to search for the best combination style for different 1D PCs to form heterostructures containing Si/MgF2 multilayer films. The non-transmission range over the entire visible range can be enlarged substantially, and the phenomenon of three-color PC filters in blue-green-red light can be realized by adjusting the repeat cycle counts of various PCs. With perfect omnidirectional and high peak transmission three-color filters for the electric magnetic (TE) mode, this optimization design opens a promising way to fabricate three-color PC filters with a wide non-transmission range in the visible range, which can be applied to white LEDs.

  17. Electromagnetic Tunneling and Resonances in Pseudochiral Omega Slabs

    PubMed Central

    Razzaz, Faroq; Alkanhal, Majeed A. S.

    2017-01-01

    This paper presents theoretical investigation of the electromagnetic wave tunneling and anomalous transmission around the trapped modes in a pseudochiral omega slab. The dispersion relation, the conditions of the trapped modes, and the evanescent wave coupling and tunneling in two different reciprocal pseudochiral omega slab structures are derived. The Berreman’s matrix method is applied to obtain the transmission coefficients across the pseudochiral omega slab. When the structure is perturbed, a resonance phenomenon is detected around the trapped modes. This resonance results in transmission anomalies (total transmission and total reflection) and dramatic field amplifications around the trapped modes. The number of the discrete trapped modes and then the resonance frequencies are prescribed by the parameters of the pseudochiral omega slab such as the value of the omega parameter and its orientation and the slab thickness. PMID:28165058

  18. Controlling resonant tunneling in graphene via Fermi velocity engineering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lima, Jonas R. F., E-mail: jonas.lima@ufrpe.br; Pereira, Luiz Felipe C.; Bezerra, C. G.

    We investigate the resonant tunneling in a single layer graphene superlattice with modulated energy gap and Fermi velocity via an effective Dirac-like Hamiltonian. We calculate the transmission coefficient with the transfer matrix method and analyze the effect of a Fermi velocity modulation on the electronic transmission, in the case of normal and oblique incidence. We find it is possible to manipulate the electronic transmission in graphene by Fermi velocity engineering, and show that it is possible to tune the transmitivity from 0 to 1. We also analyze how a Fermi velocity modulation influences the total conductance and the Fano factor.more » Our results are relevant for the development of novel graphene-based electronic devices.« less

  19. Study on spin filtering and switching action in a double-triangular network chain

    NASA Astrophysics Data System (ADS)

    Zhang, Yongmei

    2018-04-01

    Spin transport properties of a double-triangular quantum network with local magnetic moment on backbones and magnetic flux penetrating the network plane are studied. Numerical simulation results show that such a quantum network will be a good candidate for spin filter and spin switch. Local dispersion and density of states are considered in the framework of tight-binding approximation. Transmission coefficients are calculated by the method of transfer matrix. Spin transmission is regulated by substrate magnetic moment and magnetic flux piercing those triangles. Experimental realization of such theoretical research will be conducive to designing of new spintronic devices.

  20. Verifying the Presence of Low Levels of Neptunium in a Uranium Matrix with Electron Energy-Loss Spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buck, Edgar C.; Douglas, Matthew; Wittman, Richard S.

    2010-01-01

    This paper examines the problems associated with the analysis of low levels of neptunium (Np) in a uranium (U) matrix with electron energy-loss spectroscopy (EELS) on the transmission electron microscope (TEM). The detection of Np in a matrix of uranium (U) can be impeded by the occurrence of a plural scattering event from U (U-M5 + U-O4,5) that results in severe overlap on the Np-M5 edge at 3665 eV. Low levels (1600 - 6300 ppm) of Np can be detected in U solids by confirming the energy gap between the Np-M5 and Np-M4 edges is at 184 eV and showingmore » that the M4/M5 ratio for the Np is smaller than that for U. The Richardson-Lucy deconvolution method was applied to energy-loss spectral images and was shown to increase the signal to noise. This method also improves the limits of detection for Np in a U matrix.« less

  1. MATIN: a random network coding based framework for high quality peer-to-peer live video streaming.

    PubMed

    Barekatain, Behrang; Khezrimotlagh, Dariush; Aizaini Maarof, Mohd; Ghaeini, Hamid Reza; Salleh, Shaharuddin; Quintana, Alfonso Ariza; Akbari, Behzad; Cabrera, Alicia Triviño

    2013-01-01

    In recent years, Random Network Coding (RNC) has emerged as a promising solution for efficient Peer-to-Peer (P2P) video multicasting over the Internet. This probably refers to this fact that RNC noticeably increases the error resiliency and throughput of the network. However, high transmission overhead arising from sending large coefficients vector as header has been the most important challenge of the RNC. Moreover, due to employing the Gauss-Jordan elimination method, considerable computational complexity can be imposed on peers in decoding the encoded blocks and checking linear dependency among the coefficients vectors. In order to address these challenges, this study introduces MATIN which is a random network coding based framework for efficient P2P video streaming. The MATIN includes a novel coefficients matrix generation method so that there is no linear dependency in the generated coefficients matrix. Using the proposed framework, each peer encapsulates one instead of n coefficients entries into the generated encoded packet which results in very low transmission overhead. It is also possible to obtain the inverted coefficients matrix using a bit number of simple arithmetic operations. In this regard, peers sustain very low computational complexities. As a result, the MATIN permits random network coding to be more efficient in P2P video streaming systems. The results obtained from simulation using OMNET++ show that it substantially outperforms the RNC which uses the Gauss-Jordan elimination method by providing better video quality on peers in terms of the four important performance metrics including video distortion, dependency distortion, End-to-End delay and Initial Startup delay.

  2. Compact Feed Circuit with Quarter Wavelength Transmission Line Matrix Controlling Beams in Three Directions Including Boresight

    NASA Astrophysics Data System (ADS)

    Tsuji, Masatoshi

    A compact feed circuit with a λ/4 transmission line matrix circuit for use in array antennas to control beams in three directions, including boresight, is presented. The feed circuit antenna is composed of five switches and λ/4 transmission lines, and the feeding matrix circuit yields phase differences of ±90° and 0°. The feed circuit can obtain a reliable output signal, as there is only a small degree of deviation of output signal with variations in the line width. The feed circuit is simulated, fabricated, and evaluated for ISM band, and the measured characteristics agree well with the results of the simulation. The size of feed circuit is 45 (H) × 48 (W) × 3 (T) mm.

  3. Microbiota-induced peritrophic matrix regulates midgut homeostasis and prevents systemic infection of malaria vector mosquitoes

    PubMed Central

    Rodgers, Faye H.

    2017-01-01

    Manipulation of the mosquito gut microbiota can lay the foundations for novel methods for disease transmission control. Mosquito blood feeding triggers a significant, transient increase of the gut microbiota, but little is known about the mechanisms by which the mosquito controls this bacterial growth whilst limiting inflammation of the gut epithelium. Here, we investigate the gut epithelial response to the changing microbiota load upon blood feeding in the malaria vector Anopheles coluzzii. We show that the synthesis and integrity of the peritrophic matrix, which physically separates the gut epithelium from its luminal contents, is microbiota dependent. We reveal that the peritrophic matrix limits the growth and persistence of Enterobacteriaceae within the gut, whilst preventing seeding of a systemic infection. Our results demonstrate that the peritrophic matrix is a key regulator of mosquito gut homeostasis and establish functional analogies between this and the mucus layers of the mammalian gastrointestinal tract. PMID:28545061

  4. Harmonic Resonance in Power Transmission Systems due to the Addition of Shunt Capacitors

    NASA Astrophysics Data System (ADS)

    Patil, Hardik U.

    Shunt capacitors are often added in transmission networks at suitable locations to improve the voltage profile. In this thesis, the transmission system in Arizona is considered as a test bed. Many shunt capacitors already exist in the Arizona transmission system and more are planned to be added. Addition of these shunt capacitors may create resonance conditions in response to harmonic voltages and currents. Such resonance, if it occurs, may create problematic issues in the system. It is main objective of this thesis to identify potential problematic effects that could occur after placing new shunt capacitors at selected buses in the Arizona network. Part of the objective is to create a systematic plan for avoidance of resonance issues. For this study, a method of capacitance scan is proposed. The bus admittance matrix is used as a model of the networked transmission system. The calculations on the admittance matrix were done using Matlab. The test bed is the actual transmission system in Arizona; however, for proprietary reasons, bus names are masked in the thesis copy intended for the public domain. The admittance matrix was obtained from data using the PowerWorld Simulator after equivalencing the 2016 summer peak load (planning case). The full Western Electricity Coordinating Council (WECC) system data were used. The equivalencing procedure retains only the Arizona portion of the WECC. The capacitor scan results for single capacitor placement and multiple capacitor placement cases are presented. Problematic cases are identified in the form of 'forbidden response. The harmonic voltage impact of known sources of harmonics, mainly large scale HVDC sources, is also presented. Specific key results for the study indicated include: (1) The forbidden zones obtained as per the IEEE 519 standard indicates the bus 10 to be the most problematic bus. (2) The forbidden zones also indicate that switching values for the switched shunt capacitor (if used) at bus 3 should be should be considered carefully to avoid resonance condition from existing. (3) The highest sensitivity of 0.0033 per unit for HVDC sources of harmonics was observed at bus 7 when all the HVDC sources were active at the same time.

  5. Hydraulic tomography of discrete networks of conduits and fractures in a karstic aquifer by using a deterministic inversion algorithm

    NASA Astrophysics Data System (ADS)

    Fischer, P.; Jardani, A.; Lecoq, N.

    2018-02-01

    In this paper, we present a novel inverse modeling method called Discrete Network Deterministic Inversion (DNDI) for mapping the geometry and property of the discrete network of conduits and fractures in the karstified aquifers. The DNDI algorithm is based on a coupled discrete-continuum concept to simulate numerically water flows in a model and a deterministic optimization algorithm to invert a set of observed piezometric data recorded during multiple pumping tests. In this method, the model is partioned in subspaces piloted by a set of parameters (matrix transmissivity, and geometry and equivalent transmissivity of the conduits) that are considered as unknown. In this way, the deterministic optimization process can iteratively correct the geometry of the network and the values of the properties, until it converges to a global network geometry in a solution model able to reproduce the set of data. An uncertainty analysis of this result can be performed from the maps of posterior uncertainties on the network geometry or on the property values. This method has been successfully tested for three different theoretical and simplified study cases with hydraulic responses data generated from hypothetical karstic models with an increasing complexity of the network geometry, and of the matrix heterogeneity.

  6. Visualization of newt aragonitic otoconial matrices using transmission electron microscopy

    NASA Technical Reports Server (NTRS)

    Steyger, P. S.; Wiederhold, M. L.

    1995-01-01

    Otoconia are calcified protein matrices within the gravity-sensing organs of the vertebrate vestibular system. These protein matrices are thought to originate from the supporting or hair cells in the macula during development. Previous studies of mammalian calcitic, barrel-shaped otoconia revealed an organized protein matrix consisting of a thin peripheral layer, a well-defined organic core and a flocculent matrix inbetween. No studies have reported the microscopic organization of the aragonitic otoconial matrix, despite its protein characterization. Pote et al. (1993b) used densitometric methods and inferred that prismatic (aragonitic) otoconia have a peripheral protein distribution, compared to that described for the barrel-shaped, calcitic otoconia of birds, mammals, and the amphibian utricle. By using tannic acid as a negative stain, we observed three kinds of organic matrices in preparations of fixed, decalcified saccular otoconia from the adult newt: (1) fusiform shapes with a homogenous electron-dense matrix; (2) singular and multiple strands of matrix; and (3) more significantly, prismatic shapes outlined by a peripheral organic matrix. These prismatic shapes remain following removal of the gelatinous matrix, revealing an internal array of organic matter. We conclude that prismatic otoconia have a largely peripheral otoconial matrix, as inferred by densitometry.

  7. Scattering matrix analysis for evaluating the photocurrent in hydrogenated-amorphous-silicon-based thin film solar cells.

    PubMed

    Shin, Myunghun; Lee, Seong Hyun; Lim, Jung Wook; Yun, Sun Jin

    2014-11-01

    A scattering matrix (S-matrix) analysis method was developed for evaluating hydrogenated amorphous silicon (a-Si:H)-based thin film solar cells. In this approach, light wave vectors A and B represent the incoming and outgoing behaviors of the incident solar light, respectively, in terms of coherent wave and incoherent intensity components. The S-matrix determines the relation between A and B according to optical effects such as reflection and transmission, as described by the Fresnel equations, scattering at the boundary surfaces, or scattering within the propagation medium, as described by the Beer-Lambert law and the change in the phase of the propagating light wave. This matrix can be used to evaluate the behavior of angle-incident coherent and incoherent light simultaneously, and takes into account not only the light scattering process at material boundaries (haze effects) but also nonlinear optical processes within the material. The optical parameters in the S-matrix were determined by modeling both a 2%-gallium-doped zinc oxide transparent conducting oxide and germanium-compounded a-Si:H (a-SiGe:H). Using the S-matrix equations, the photocurrent for an a-Si:H/a-SiGe:H tandem cell and the optical loss in semitransparent a-Si:H solar cells for use in building-integrated photovoltaic applications were analyzed. The developed S-matrix method can also be used as a general analysis tool for various thin film solar cells.

  8. Turbidimetric method for the determination of particle sizes in polypropylene/clay-composites during extrusion.

    PubMed

    Becker, Wolfgang; Guschin, Viktor; Mikonsaari, Irma; Teipel, Ulrich; Kölle, Sabine; Weiss, Patrick

    2017-01-01

    Nanocomposites with polypropylene as matrix material and nanoclay as filler were produced in a double twin screw extruder. The extrusion was monitored with a spectrometer in the visible and near-infrared spectral region with a diode array spectrometer. Two probes were installed at the end at the extruder die and the transmission spectra were measured during the extrusion. After measuring the transmission spectra and converting into turbidity units, the particle distribution density was calculated via numerical linear equation system. The distribution density function shows either a bimodal or mono modal shape in dependence of the processing parameters like screw speed, dosage, and concentration of the nanoclays. The method was verified with SEM measurements which yield comparable results. The method is suitable for industrial in-line processing monitoring of particle radii and dispersion process, respectively.

  9. Sensitivity analysis of the parameters of an HIV/AIDS model with condom campaign and antiretroviral therapy

    NASA Astrophysics Data System (ADS)

    Marsudi, Hidayat, Noor; Wibowo, Ratno Bagus Edy

    2017-12-01

    In this article, we present a deterministic model for the transmission dynamics of HIV/AIDS in which condom campaign and antiretroviral therapy are both important for the disease management. We calculate the effective reproduction number using the next generation matrix method and investigate the local and global stability of the disease-free equilibrium of the model. Sensitivity analysis of the effective reproduction number with respect to the model parameters were carried out. Our result shows that efficacy rate of condom campaign, transmission rate for contact with the asymptomatic infective, progression rate from the asymptomatic infective to the pre-AIDS infective, transmission rate for contact with the pre-AIDS infective, ARV therapy rate, proportion of the susceptible receiving condom campaign and proportion of the pre-AIDS receiving ARV therapy are highly sensitive parameters that effect the transmission dynamics of HIV/AIDS infection.

  10. On the Equivalence of the Summation and Transfer-Matrix Methods in Wave Propagation through Multilayers of Lossless and Lossy Media

    ERIC Educational Resources Information Center

    Pereyra, Pedro; Robledo-Martinez, Arturo

    2009-01-01

    We explicitly show that the well-known transmission and reflection amplitudes of planar slabs, obtained via an algebraic summation of Fresnel amplitudes, are completely equivalent to those obtained from transfer matrices in the scattering approach. This equivalence makes the finite periodic systems theory a powerful alternative to the cumbersome…

  11. Quasi-stationary states of an electron with linearly dependent effective mass in an open nanostructure within transmission coefficient and S-matrix methods

    NASA Astrophysics Data System (ADS)

    Seti, Julia; Tkach, Mykola; Voitsekhivska, Oxana

    2018-03-01

    The exact solutions of the Schrödinger equation for a double-barrier open semiconductor plane nanostructure are obtained by using two different approaches, within the model of the rectangular potential profile and the continuous position-dependent effective mass of the electron. The transmission coefficient and scattering matrix are calculated for the double-barrier nanostructure. The resonance energies and resonance widths of the electron quasi-stationary states are analyzed as a function of the size of the near-interface region between wells and barriers, where the effective mass linearly depends on the coordinate. It is established that, in both methods, the increasing size affects in a qualitatively similar way the spectral characteristics of the states, shifting the resonance energies into the low- or high-energy region and increasing the resonance widths. It is shown that the relative difference of resonance energies and widths of a certain state, obtained in the model of position-dependent effective mass and in the widespread abrupt model in physically correct range of near-interface sizes, does not exceed 0.5% and 5%, respectively, independently of the other geometrical characteristics of the structure.

  12. The Green's matrix and the boundary integral equations for analysis of time-harmonic dynamics of elastic helical springs.

    PubMed

    Sorokin, Sergey V

    2011-03-01

    Helical springs serve as vibration isolators in virtually any suspension system. Various exact and approximate methods may be employed to determine the eigenfrequencies of vibrations of these structural elements and their dynamic transfer functions. The method of boundary integral equations is a meaningful alternative to obtain exact solutions of problems of the time-harmonic dynamics of elastic springs in the framework of Bernoulli-Euler beam theory. In this paper, the derivations of the Green's matrix, of the Somigliana's identities, and of the boundary integral equations are presented. The vibrational power transmission in an infinitely long spring is analyzed by means of the Green's matrix. The eigenfrequencies and the dynamic transfer functions are found by solving the boundary integral equations. In the course of analysis, the essential features and advantages of the method of boundary integral equations are highlighted. The reported analytical results may be used to study the time-harmonic motion in any wave guide governed by a system of linear differential equations in a single spatial coordinate along its axis. © 2011 Acoustical Society of America

  13. Modal density of rectangular structures in a wide frequency range

    NASA Astrophysics Data System (ADS)

    Parrinello, A.; Ghiringhelli, G. L.

    2018-04-01

    A novel approach to investigate the modal density of a rectangular structure in a wide frequency range is presented. First, the modal density is derived, in the whole frequency range of interest, on the basis of sound transmission through the infinite counterpart of the structure; then, it is corrected by means of the low-frequency modal behavior of the structure, taking into account actual size and boundary conditions. A statistical analysis reveals the connection between the modal density of the structure and the transmission of sound through its thickness. A transfer matrix approach is used to compute the required acoustic parameters, making it possible to deal with structures having arbitrary stratifications of different layers. A finite element method is applied on coarse grids to derive the first few eigenfrequencies required to correct the modal density. Both the transfer matrix approach and the coarse grids involved in the finite element analysis grant high efficiency. Comparison with alternative formulations demonstrates the effectiveness of the proposed methodology.

  14. Hybrid matrix method for stable numerical analysis of the propagation of Dirac electrons in gapless bilayer graphene superlattices

    NASA Astrophysics Data System (ADS)

    Briones-Torres, J. A.; Pernas-Salomón, R.; Pérez-Álvarez, R.; Rodríguez-Vargas, I.

    2016-05-01

    Gapless bilayer graphene (GBG), like monolayer graphene, is a material system with unique properties, such as anti-Klein tunneling and intrinsic Fano resonances. These properties rely on the gapless parabolic dispersion relation and the chiral nature of bilayer graphene electrons. In addition, propagating and evanescent electron states coexist inherently in this material, giving rise to these exotic properties. In this sense, bilayer graphene is unique, since in most material systems in which Fano resonance phenomena are manifested an external source that provides extended states is required. However, from a numerical standpoint, the presence of evanescent-divergent states in the eigenfunctions linear superposition representing the Dirac spinors, leads to a numerical degradation (the so called Ωd problem) in the practical applications of the standard Coefficient Transfer Matrix (K) method used to study charge transport properties in Bilayer Graphene based multi-barrier systems. We present here a straightforward procedure based in the hybrid compliance-stiffness matrix method (H) that can overcome this numerical degradation. Our results show that in contrast to standard matrix method, the proposed H method is suitable to study the transmission and transport properties of electrons in GBG superlattice since it remains numerically stable regardless the size of the superlattice and the range of values taken by the input parameters: the energy and angle of the incident electrons, the barrier height and the thickness and number of barriers. We show that the matrix determinant can be used as a test of the numerical accuracy in real calculations.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Yiyi; Wang, Junli; Qi, Shengli

    In this report, a series of composite films consisting of polyimide as the matrix and multi-wall carbon nanotubes as the filler (PI/MWCNTs) were prepared in a water-based method with the use of triethylamine. Their dielectric properties were tested under frequency of between 100 Hz and 10 MHz, and it was revealed that the permittivity value behaved interestingly around the percolation threshold (8.01% in volume). The water-based method ensured that fillers had high dispersibility in the matrix before percolation, which led to a relatively high dielectric constant (284.28). However, the overlapping caused by excess MWCNTs created pathways for electrons inside the matrix, turningmore » the permittivity to negative. The former phenomenon was highly congruent with the percolation power law, while the latter could be explained by the Drude Model. AC conductivity was measured for more supportive information. Additionally, scanning electron microscopy and transmission electron microscopy were employed to record MWCNTs' microscopic distribution and morphology at the percolation threshold.« less

  16. Tailored porous silicon microparticles: fabrication and properties

    PubMed Central

    Chiappini, Ciro; Tasciotti, Ennio; Fakhoury, Jean R.; Fine, Daniel; Pullan, Lee; Wang, Young-Chung; Fu, Lianfeng

    2010-01-01

    The use of mesoporous silicon particles for drug delivery has been widely explored thanks to their biodegradability and biocompatibility. The ability to tailor the physicochemical properties of porous silicon at the micro and nano scale confers versatility to this material. We present a method for the fabrication of highly reproducible, monodisperse mesoporous silicon particles with controlled physical characteristics through electrochemical etch of patterned silicon trenches. We tailored particle size in the micrometer range and pore size in the nanometer range, shape from tubular to discoidal to hemispherical, and porosity from 46% to over 80%. In addition, we correlated the properties of the porous matrix with the loading of model nanoparticles (Q-dots) and observed their three-dimensional arrangement within the matrix by transmission electron microscopy tomography. The methods developed in this study provide effective means to fabricate mesoporous silicon particles according to the principles of rational design for therapeutic vectors and to characterize the distribution of nanoparticles within the porous matrix PMID:20162656

  17. Sound transmission through finite lightweight multilayered structures with thin air layers.

    PubMed

    Dijckmans, A; Vermeir, G; Lauriks, W

    2010-12-01

    The sound transmission loss (STL) of finite lightweight multilayered structures with thin air layers is studied in this paper. Two types of models are used to describe the vibro-acoustic behavior of these structures. Standard transfer matrix method assumes infinite layers and represents the plane wave propagation in the layers. A wave based model describes the direct sound transmission through a rectangular structure placed between two reverberant rooms. Full vibro-acoustic coupling between rooms, plates, and air cavities is taken into account. Comparison with double glazing measurements shows that this effect of vibro-acoustic coupling is important in lightweight double walls. For infinite structures, structural damping has no significant influence on STL below the coincidence frequency. In this frequency region, the non-resonant transmission or so-called mass-law behavior dominates sound transmission. Modal simulations suggest a large influence of structural damping on STL. This is confirmed by experiments with double fiberboard partitions and sandwich structures. The results show that for thin air layers, the damping induced by friction and viscous effects at the air gap surfaces can largely influence and improve the sound transmission characteristics.

  18. Targeted Multiplex Imaging Mass Spectrometry in Transmission Geometry for Subcellular Spatial Resolution

    PubMed Central

    Lavenant, Gwendoline Thiery; Zavalin, Andrey I.; Caprioli, Richard M.

    2013-01-01

    Targeted multiplex Imaging Mass Spectrometry utilizes several different antigen-specific primary antibodies, each directly labeled with a unique photocleavable mass tag, to detect multiple antigens in a single tissue section. Each photocleavable mass tag bound to an antibody has a unique molecular weight and can be readily ionized by laser desorption ionization mass spectrometry. This manuscript describes a mass spectrometry method that allows imaging of targeted single cells within tissue using transmission geometry laser desorption ionization mass spectrometry. Transmission geometry focuses the laser beam on the back side of the tissue placed on a glass slide, providing a 2 μm diameter laser spot irradiating the biological specimen. This matrix-free method enables simultaneous localization at the sub-cellular level of multiple antigens using specific tagged antibodies. We have used this technology to visualize the co-expression of synaptophysin and two major hormones peptides, insulin and somatostatin, in duplex assays in beta and delta cells contained in a human pancreatic islet. PMID:23397138

  19. Targeted Multiplex Imaging Mass Spectrometry in Transmission Geometry for Subcellular Spatial Resolution

    NASA Astrophysics Data System (ADS)

    Thiery-Lavenant, Gwendoline; Zavalin, Andre I.; Caprioli, Richard M.

    2013-04-01

    Targeted multiplex imaging mass spectrometry utilizes several different antigen-specific primary antibodies, each directly labeled with a unique photocleavable mass tag, to detect multiple antigens in a single tissue section. Each photocleavable mass tag bound to an antibody has a unique molecular weight and can be readily ionized by laser desorption ionization mass spectrometry. This article describes a mass spectrometry method that allows imaging of targeted single cells within tissue using transmission geometry laser desorption ionization mass spectrometry. Transmission geometry focuses the laser beam on the back side of the tissue placed on a glass slide, providing a 2 μm diameter laser spot irradiating the biological specimen. This matrix-free method enables simultaneous localization at the sub-cellular level of multiple antigens using specific tagged antibodies. We have used this technology to visualize the co-expression of synaptophysin and two major hormones peptides, insulin and somatostatin, in duplex assays in beta and delta cells contained in a human pancreatic islet.

  20. Dynamic analysis of flexible gear trains/transmissions - An automated approach

    NASA Technical Reports Server (NTRS)

    Amirouche, F. M. L.; Shareef, N. H.; Xie, M.

    1992-01-01

    In this paper an automated algorithmic method is presented for the dynamic analysis of geared trains/transmissions. These are treated as a system of interconnected flexible bodies. The procedure developed explains the switching of constraints with time as a result of the change in the contacting areas at the gear teeth. The elastic behavior of the system is studied through the employment of three-dimensional isoparametric elements having six degrees-of-freedom at each node. The contact between the bodies is assumed at the various nodes, which could be either a line or a plane. The kinematical expressions, together with the equations of motion using Kane's method, strain energy concepts, are presented in a matrix form suitable for computer implementation. The constraint Jacobian matrices are generated automatically based on the contact information between the bodies. The concepts of the relative velocity at the contacting points at the tooth pairs and the subsequent use of the transmission ratios in the analysis is presented.

  1. Developments in the design, analysis, and fabrication of advanced technology transmission elements

    NASA Technical Reports Server (NTRS)

    Drago, R. J.; Lenski, J. W., Jr.

    1982-01-01

    Over the last decade, the presently reported proprietary development program for the reduction of helicopter drive system weight and cost and the enhancement of reliability and survivability has produced high speed roller bearings, resin-matrix composite rotor shafts and transmission housings, gear/bearing/shaft system integrations, photoelastic investigation methods for gear tooth strength, and the automatic generation of complex FEM models for gear/shaft systems. After describing the design features and performance capabilities of the hardware developed, attention is given to the prospective benefits to be derived from application of these technologies, with emphasis on the relationship between helicopter drive system performance and cost.

  2. Transport in a magnetic field modulated graphene superlattice.

    PubMed

    Li, Yu-Xian

    2010-01-13

    Using the transfer matrix method, we study the transport properties through a magnetic field modulated graphene superlattice. It is found that the electrostatic barrier, the magnetic vector potential, and the number of wells in a superlattice modify the transmission remarkably. The angular dependent transmission is blocked by the magnetic vector potential because of the appearance of the evanescent states at certain incident angles, and the region of Klein tunneling shifts to the left. The angularly averaged conductivities exhibit oscillatory behavior. The magnitude and period of oscillation depend sensitively on the height of the electrostatic barrier, the number of wells, and the strength of the modulated magnetic field.

  3. MATIN: A Random Network Coding Based Framework for High Quality Peer-to-Peer Live Video Streaming

    PubMed Central

    Barekatain, Behrang; Khezrimotlagh, Dariush; Aizaini Maarof, Mohd; Ghaeini, Hamid Reza; Salleh, Shaharuddin; Quintana, Alfonso Ariza; Akbari, Behzad; Cabrera, Alicia Triviño

    2013-01-01

    In recent years, Random Network Coding (RNC) has emerged as a promising solution for efficient Peer-to-Peer (P2P) video multicasting over the Internet. This probably refers to this fact that RNC noticeably increases the error resiliency and throughput of the network. However, high transmission overhead arising from sending large coefficients vector as header has been the most important challenge of the RNC. Moreover, due to employing the Gauss-Jordan elimination method, considerable computational complexity can be imposed on peers in decoding the encoded blocks and checking linear dependency among the coefficients vectors. In order to address these challenges, this study introduces MATIN which is a random network coding based framework for efficient P2P video streaming. The MATIN includes a novel coefficients matrix generation method so that there is no linear dependency in the generated coefficients matrix. Using the proposed framework, each peer encapsulates one instead of n coefficients entries into the generated encoded packet which results in very low transmission overhead. It is also possible to obtain the inverted coefficients matrix using a bit number of simple arithmetic operations. In this regard, peers sustain very low computational complexities. As a result, the MATIN permits random network coding to be more efficient in P2P video streaming systems. The results obtained from simulation using OMNET++ show that it substantially outperforms the RNC which uses the Gauss-Jordan elimination method by providing better video quality on peers in terms of the four important performance metrics including video distortion, dependency distortion, End-to-End delay and Initial Startup delay. PMID:23940530

  4. Electromagnetic Compatibility in the Defense Systems of Future Years

    DTIC Science & Technology

    2002-06-01

    Technology activities. Its mission is to conduct and promote cooperative research and information exchange . The objective is to support the development...testing CLEARANCE PRODUCTION AND IN-SERVICE SUPPORT Modelling in support of conceptual design (structure & installation design) EMH Design guides for the... marketed by Advanced Electromagnetics [6-1]. Transmission Line Matrix Method The link between field theory and circuit theory, the major theories on

  5. An Estimation Method of System Voltage Sag Profile using Recorded Sag Data

    NASA Astrophysics Data System (ADS)

    Tanaka, Kazuyuki; Sakashita, Tadashi

    The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.

  6. Full wave two-dimensional modeling of scattering and inverse scattering for layered rough surfaces with buried objects

    NASA Astrophysics Data System (ADS)

    Kuo, Chih-Hao

    Efficient and accurate modeling of electromagnetic scattering from layered rough surfaces with buried objects finds applications ranging from detection of landmines to remote sensing of subsurface soil moisture. The formulation of a hybrid numerical/analytical solution to electromagnetic scattering from layered rough surfaces is first presented in this dissertation. The solution to scattering from each rough interface is sought independently based on the extended boundary condition method (EBCM), where the scattered fields of each rough interface are expressed as a summation of plane waves and then cast into reflection/transmission matrices. To account for interactions between multiple rough boundaries, the scattering matrix method (SMM) is applied to recursively cascade reflection and transmission matrices of each rough interface and obtain the composite reflection matrix from the overall scattering medium. The validation of this method against the Method of Moments (MoM) and Small Perturbation Method (SPM) is addressed and the numerical results which investigate the potential of low frequency radar systems in estimating deep soil moisture are presented. Computational efficiency of the proposed method is also discussed. In order to demonstrate the capability of this method in modeling coherent multiple scattering phenomena, the proposed method has been employed to analyze backscattering enhancement and satellite peaks due to surface plasmon waves from layered rough surfaces. Numerical results which show the appearance of enhanced backscattered peaks and satellite peaks are presented. Following the development of the EBCM/SMM technique, a technique which incorporates a buried object in layered rough surfaces by employing the T-matrix method and the cylindrical-to-spatial harmonics transformation is proposed. Validation and numerical results are provided. Finally, a multi-frequency polarimetric inversion algorithm for the retrieval of subsurface soil properties using VHF/UHF band radar measurements is devised. The top soil dielectric constant is first determined using an L-band inversion algorithm. For the retrieval of subsurface properties, a time-domain inversion technique is employed together with a parameter optimization for the pulse shape of time delay echoes from VHF/UHF band radar observations. Numerical studies to investigate the accuracy of the proposed inversion technique in presence of errors are addressed.

  7. Wave transmission approach based on modal analysis for embedded mechanical systems

    NASA Astrophysics Data System (ADS)

    Cretu, Nicolae; Nita, Gelu; Ioan Pop, Mihail

    2013-09-01

    An experimental method for determining the phase velocity in small solid samples is proposed. The method is based on measuring the resonant frequencies of a binary or ternary solid elastic system comprising the small sample of interest and a gauge material of manageable size. The wave transmission matrix of the combined system is derived and the theoretical values of its eigenvalues are used to determine the expected eigenfrequencies that, equated with the measured values, allow for the numerical estimation of the phase velocities in both materials. The known phase velocity of the gauge material is then used to asses the accuracy of the method. Using computer simulation and the experimental values for phase velocities, the theoretical values for the eigenfrequencies of the eigenmodes of the embedded elastic system are obtained, to validate the method. We conclude that the proposed experimental method may be reliably used to determine the elastic properties of small solid samples whose geometries do not allow a direct measurement of their resonant frequencies.

  8. Matrix Effects in Quantitative Assessment of Pharmaceutical Tablets Using Transmission Raman and Near-Infrared (NIR) Spectroscopy.

    PubMed

    Sparén, Anders; Hartman, Madeleine; Fransson, Magnus; Johansson, Jonas; Svensson, Olof

    2015-05-01

    Raman spectroscopy can be an alternative to near-infrared spectroscopy (NIR) for nondestructive quantitative analysis of solid pharmaceutical formulations. Compared with NIR spectra, Raman spectra have much better selectivity, but subsampling was always an issue for quantitative assessment. Raman spectroscopy in transmission mode has reduced this issue, since a large volume of the sample is measured in transmission mode. The sample matrix, such as particle size of the drug substance in a tablet, may affect the Raman signal. In this work, matrix effects in transmission NIR and Raman spectroscopy were systematically investigated for a solid pharmaceutical formulation. Tablets were manufactured according to an experimental design, varying the factors particle size of the drug substance (DS), particle size of the filler, compression force, and content of drug substance. All factors were varied at two levels plus a center point, except the drug substance content, which was varied at five levels. Six tablets from each experimental point were measured with transmission NIR and Raman spectroscopy, and their concentration of DS was determined for a third of those tablets. Principal component analysis of NIR and Raman spectra showed that the drug substance content and particle size, the particle size of the filler, and the compression force affected both NIR and Raman spectra. For quantitative assessment, orthogonal partial least squares regression was applied. All factors varied in the experimental design influenced the prediction of the DS content to some extent, both for NIR and Raman spectroscopy, the particle size of the filler having the largest effect. When all matrix variations were included in the multivariate calibrations, however, good predictions of all types of tablets were obtained, both for NIR and Raman spectroscopy. The prediction error using transmission Raman spectroscopy was about 30% lower than that obtained with transmission NIR spectroscopy.

  9. Terahertz spectroscopic polarimetry of generalized anisotropic media composed of Archimedean spiral arrays: Experiments and simulations.

    PubMed

    Aschaffenburg, Daniel J; Williams, Michael R C; Schmuttenmaer, Charles A

    2016-05-07

    Terahertz time-domain spectroscopic polarimetry has been used to measure the polarization state of all spectral components in a broadband THz pulse upon transmission through generalized anisotropic media consisting of two-dimensional arrays of lithographically defined Archimedean spirals. The technique allows a full determination of the frequency-dependent, complex-valued transmission matrix and eigenpolarizations of the spiral arrays. Measurements were made on a series of spiral array orientations. The frequency-dependent transmission matrix elements as well as the eigenpolarizations were determined, and the eigenpolarizations were found be to elliptically corotating, as expected from their symmetry. Numerical simulations are in quantitative agreement with measured spectra.

  10. Operational modal analysis using SVD of power spectral density transmissibility matrices

    NASA Astrophysics Data System (ADS)

    Araújo, Iván Gómez; Laier, Jose Elias

    2014-05-01

    This paper proposes the singular value decomposition of power spectrum density transmissibility matrices with different references, (PSDTM-SVD), as an identification method of natural frequencies and mode shapes of a dynamic system subjected to excitations under operational conditions. At the system poles, the rows of the proposed transmissibility matrix converge to the same ratio of amplitudes of vibration modes. As a result, the matrices are linearly dependent on the columns, and their singular values converge to zero. Singular values are used to determine the natural frequencies, and the first left singular vectors are used to estimate mode shapes. A numerical example of the finite element model of a beam subjected to colored noise excitation is analyzed to illustrate the accuracy of the proposed method. Results of the PSDTM-SVD method in the numerical example are compared with obtained using frequency domain decomposition (FDD) and power spectrum density transmissibility (PSDT). It is demonstrated that the proposed method does not depend on the excitation characteristics contrary to the FDD method that assumes white noise excitation, and further reduces the risk to identify extra non-physical poles in comparison to the PSDT method. Furthermore, a case study is performed using data from an operational vibration test of a bridge with a simply supported beam system. The real application of a full-sized bridge has shown that the proposed PSDTM-SVD method is able to identify the operational modal parameter. Operational modal parameters identified by the PSDTM-SVD in the real application agree well those identified by the FDD and PSDT methods.

  11. Wave Propagation in Discontinuous Media by the Scattering Matrix Method

    NASA Astrophysics Data System (ADS)

    Perino, A.; Orta, R.; Barla, G.

    2012-09-01

    Propagation of elastic waves in discontinuous media is studied in this paper by the scattering matrix method (SMM). An electromagnetic transmission line analogy is also used to set up the mathematical model. The SMM operates in the frequency domain and allows for all wave polarizations (P, SV and SH). Rock masses are examples of discontinuous media in which the discontinuities (fractures or joints) influence wave propagation. Both elastic and viscoelastic joints are considered and the latter are described by Kelvin-Voigt, Maxwell and Burgers models. Rock joints with Coulomb slip behavior are also analyzed, by applying the averaging principle of Caughy (J Appl Mech 27:640-643, 1960). The evaluation of the effects of periodic discontinuities in a homogeneous medium is presented by introducing the concept of Bloch waves. The dispersion curves of these waves are useful to explain the existence of frequency bands of strong attenuation, also in the case of lossless (perfectly elastic) structures. Simple expressions of transmission and reflection coefficients are obtained. Finally, the SMM results are compared with those computed via the distinct element method (DEM). The comparisons are performed on a medium with joints with Coulomb slip behavior and the agreement is satisfactory, although the SMM must be applied in conjunction with the equivalent linearization technique. Even if the DEM is much more general, the SMM in these simple cases is extremely faster and provides a higher physical insight.

  12. Stage-structured transmission of phocine distemper virus in the Dutch 2002 outbreak

    PubMed Central

    Klepac, Petra; Pomeroy, Laura W.; Bjørnstad, Ottar N.; Kuiken, Thijs; Osterhaus, Albert D.M.E.; Rijks, Jolianne M.

    2009-01-01

    Heterogeneities in transmission among hosts can be very important in shaping infectious disease dynamics. In mammals with strong social organization, such heterogeneities are often structured by functional stage: juveniles, subadults and adults. We investigate the importance of such stage-related heterogeneities in shaping the 2002 phocine distemper virus (PDV) outbreak in the Dutch Wadden Sea, when more than 40 per cent of the harbour seals were killed. We do this by comparing the statistical fit of a hierarchy of models with varying transmission complexity: homogeneous versus heterogeneous mixing and density- versus frequency-dependent transmission. We use the stranding data as a proxy for incidence and use Poisson likelihoods to estimate the ‘who acquires infection from whom’ (WAIFW) matrix. Statistically, the model with strong heterogeneous mixing and density-dependent transmission was found to best describe the transmission dynamics. However, patterns of incidence support a model of frequency-dependent transmission among adults and juveniles. Based on the maximum-likelihood WAIFW matrix estimates, we use the next-generation formalism to calculate an R0 between 2 and 2.5 for the Dutch 2002 PDV epidemic. PMID:19364743

  13. Radio-physical properties of radiotransparent thermal protection materials in ablation mode

    NASA Astrophysics Data System (ADS)

    Petrovskiy, V. P.; Pakhomov, E. P.; Politiko, A. A.; Semenenko, V. N.; Chistyaev, V. A.; Balakirev, B. A.; Pervov, A. Yu; Kamalov, A. D.; Sotskova, L. P.

    2018-01-01

    Experimental method for assessing the impact of the effects of high-temperature ablation processes on the radio physical characteristics of radiotransparent thermal protection materials (RTPM) is developed. Researches for the following RTPM with various structures of glass fillers are completed: press material (radiotransparent thermal protection press material or RTP-200); glass-fiber laminate (glass-fiber radiotransparent organic ceramic matrix or GFR-CM); reinforced composite material of class SiO2-SiO2 (high-temperature radiotransparent ceramic organic matrix or HTRC-OM). The influence of physicochemical transformations in the surface layer of RTPM on transmission and reflection coefficients of electromagnetic waves of RTPM samples and on the value of their complex permittivity is determined.

  14. Quantization of an electromagnetic field in two-dimensional photonic structures based on the scattering matrix formalism ( S-quantization)

    NASA Astrophysics Data System (ADS)

    Ivanov, K. A.; Nikolaev, V. V.; Gubaydullin, A. R.; Kaliteevski, M. A.

    2017-10-01

    Based on the scattering matrix formalism, we have developed a method of quantization of an electromagnetic field in two-dimensional photonic nanostructures ( S-quantization in the two-dimensional case). In this method, the fields at the boundaries of the quantization box are expanded into a Fourier series and are related with each other by the scattering matrix of the system, which is the product of matrices describing the propagation of plane waves in empty regions of the quantization box and the scattering matrix of the photonic structure (or an arbitrary inhomogeneity). The quantization condition (similarly to the onedimensional case) is formulated as follows: the eigenvalues of the scattering matrix are equal to unity, which corresponds to the fact that the set of waves that are incident on the structure (components of the expansion into the Fourier series) is equal to the set of waves that travel away from the structure (outgoing waves). The coefficients of the matrix of scattering through the inhomogeneous structure have been calculated using the following procedure: the structure is divided into parallel layers such that the permittivity in each layer varies only along the axis that is perpendicular to the layers. Using the Fourier transform, the Maxwell equations have been written in the form of a matrix that relates the Fourier components of the electric field at the boundaries of neighboring layers. The product of these matrices is the transfer matrix in the basis of the Fourier components of the electric field. Represented in a block form, it is composed by matrices that contain the reflection and transmission coefficients for the Fourier components of the field, which, in turn, constitute the scattering matrix. The developed method considerably simplifies the calculation scheme for the analysis of the behavior of the electromagnetic field in structures with a two-dimensional inhomogeneity. In addition, this method makes it possible to obviate difficulties that arise in the analysis of the Purcell effect because of the divergence of the integral describing the effective volume of the mode in open systems.

  15. Generalized Bloch theorem for complex periodic potentials: A powerful application to quantum transport calculations

    NASA Astrophysics Data System (ADS)

    Zhang, X.-G.; Varga, Kalman; Pantelides, Sokrates T.

    2007-07-01

    Band-theoretic methods with periodically repeated supercells have been a powerful approach for ground-state electronic structure calculations but have not so far been adapted for quantum transport problems with open boundary conditions. Here, we introduce a generalized Bloch theorem for complex periodic potentials and use a transfer-matrix formulation to cast the transmission probability in a scattering problem with open boundary conditions in terms of the complex wave vectors of a periodic system with absorbing layers, allowing a band technique for quantum transport calculations. The accuracy and utility of the method are demonstrated by the model problems of the transmission of an electron over a square barrier and the scattering of a phonon in an inhomogeneous nanowire. Application to the resistance of a twin boundary in nanocrystalline copper yields excellent agreement with recent experimental data.

  16. Radiative Transfer Model for Operational Retrieval of Cloud Parameters from DSCOVR-EPIC Measurements

    NASA Astrophysics Data System (ADS)

    Yang, Y.; Molina Garcia, V.; Doicu, A.; Loyola, D. G.

    2016-12-01

    The Earth Polychromatic Imaging Camera (EPIC) onboard the Deep Space Climate Observatory (DSCOVR) measures the radiance in the backscattering region. To make sure that all details in the backward glory are covered, a large number of streams is required by a standard radiative transfer model based on the discrete ordinates method. Even the use of the delta-M scaling and the TMS correction do not substantially reduce the number of streams. The aim of this work is to analyze the capability of a fast radiative transfer model to retrieve operationally cloud parameters from EPIC measurements. The radiative transfer model combines the discrete ordinates method with matrix exponential for the computation of radiances and the matrix operator method for the calculation of the reflection and transmission matrices. Standard acceleration techniques as, for instance, the use of the normalized right and left eigenvectors, telescoping technique, Pade approximation and successive-order-of-scattering approximation are implemented. In addition, the model may compute the reflection matrix of the cloud by means of the asymptotic theory, and may use the equivalent Lambertian cloud model. The various approximations are analyzed from the point of view of efficiency and accuracy.

  17. Transmission properties of one-dimensional ternary plasma photonic crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shiveshwari, Laxmi; Awasthi, S. K.

    2015-09-15

    Omnidirectional photonic band gaps (PBGs) are found in one-dimensional ternary plasma photonic crystals (PPC) composed of single negative metamaterials. The band characteristics and transmission properties are investigated through the transfer matrix method. We show that the proposed structure can trap light in three-dimensional space due to the elimination of Brewster's angle transmission resonance allowing the existence of complete PBG. The results are discussed in terms of incident angle, layer thickness, dielectric constant of the dielectric material, and number of unit cells (N) for TE and TM polarizations. It is seen that PBG characteristics is apparent even in an N ≥ 2 system,more » which is weakly sensitive to the incident angle and completely insensitive to the polarization. Finite PPC could be used for multichannel transmission filter without introducing any defect in the geometry. We show that the locations of the multichannel transmission peaks are in the allowed band of the infinite structure. The structure can work as a single or multichannel filter by varying the number of unit cells. Binary PPC can also work as a polarization sensitive tunable filter.« less

  18. Effect of a gap opening on the conductance of graphene with magnetic barrier structures

    NASA Astrophysics Data System (ADS)

    Esmailpour, Mohammad

    2018-04-01

    In the present study Klein tunneling in a single-layer gapped graphene was investigated by transfer matrix method under normal magnetic field for one and two magnetic barriers. Calculations show that electron transmission through a magnetic barrier is deflected to positive angles and reduces as the magnitude of magnetic field and especially the energy gap increases. This reduction is even more significant in larger fields so that after reaching a specific value of energy gap, an effective confinement for fermions and suppression of Klein tunneling is reached particularly in normal incidence and the conductance becomes zero. Unlike one barrier, the process of tunneling through two magnetic barriers induces symmetric transmission probability versus the incident angle; even, for lower energy gaps, electron transmission probability increases which in turn reduces total conductance via proper changes in the value of the magnetic field and energy gap. In general, it is concluded that confining electrons in asymmetric transmission through one barrier is conducted better than two barriers.

  19. Study on sensing property of one-dimensional ring mirror-defect photonic crystal

    NASA Astrophysics Data System (ADS)

    Chen, Ying; Luo, Pei; Cao, Huiying; Zhao, Zhiyong; Zhu, Qiguang

    2018-02-01

    Based on the photon localization and the photonic bandgap characteristics of photonic crystals (PCs), one-dimensional (1D) ring mirror-defect photonic crystal structure is proposed. Due to the introduction of mirror structure, a defect cavity is formed in the center of the photonic crystal, and then the resonant transmission peak can be obtained in the bandgap of transmission spectrum. The transfer matrix method is used to establish the relationship model between the resonant transmission peak and the structure parameters of the photonic crystals. Using the rectangular air gate photonic crystal structure, the dynamic monitoring of the detected gas sample parameters can be achieved from the shift of the resonant transmission peak. The simulation results show that the Q-value can attain to 1739.48 and the sensitivity can attain to 1642 nm ṡ RIU-1, which demonstrates the effectiveness of the sensing structure. The structure can provide certain theoretical reference for air pollution monitoring and gas component analysis.

  20. Conversion between EIT and Fano spectra in a microring-Bragg grating coupled-resonator system

    NASA Astrophysics Data System (ADS)

    Zhang, Zecen; Ng, Geok Ing; Hu, Ting; Qiu, Haodong; Guo, Xin; Wang, Wanjun; Rouifed, Mohamed Saïd; Liu, Chongyang; Wang, Hong

    2017-08-01

    A conversion between the electromagnetically induced transparency (EIT) transmission and Fano transmission is theoretically and experimentally demonstrated in an all-pass microring-Bragg grating (APMR-BG) coupled-resonator system. In this work, the coupling between the two resonators (the microring resonator and the Fabry-Perot resonator formed by two Bragg gratings) gives rise to the EIT and Fano transmissions. The resonant status strongly depends on the round-trip attenuation of the microring and the coupling strength. By tuning the coupling strength, the EIT and Fano transmissions can be controlled and converted. The device performance has been theoretically calculated and analyzed with a specially developed numerical model based on the transfer matrix method. The APMR-BG coupled-resonator systems with different gap widths were designed, fabricated, and characterized on a silicon-on-insulator (SOI) platform. The conversion of resonance was experimentally observed and verified. In addition, this on-chip system has the advantage of a small footprint, and the fabrication process is compatible with the planar waveguide fabrication process.

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Transport properties of electrons in fractal magnetic-barrier structures

    NASA Astrophysics Data System (ADS)

    Sun, Lifeng; Fang, Chao; Guo, Yong

    2010-09-01

    Quantum transport properties in fractal magnetically modulated structures are studied by the transfer-matrix method. It is found that the transmission spectra depend sensitively not only on the incident energy and the direction of the wave vector but also on the stage of the fractal structures. Resonance splitting, enhancement, and position shift of the resonance peaks under different magnetic modulation are observed at four different fractal stages, and the relationship between the conductance in the fractal structure and magnetic modulation is also revealed. The results indicate the spectra of the transmission can be considered as fingerprints for the fractal structures, which show the subtle correspondence between magnetic structures and transport behaviors.

  3. The dependence of the tunneling characteristic on the electronic energy bands and the carrier’s states of Graphene superlattice

    NASA Astrophysics Data System (ADS)

    Yang, C. H.; Shen, G. Z.; Ao, Z. M.; Xu, Y. W.

    2016-09-01

    Using the transfer matrix method, the carrier tunneling properties in graphene superlattice generated by the Thue-Morse sequence and Kolakoski sequence are investigated. The positions and strength of the transmission can be modulated by the barrier structures, the incident energy and angle, the height and width of the potential. These carriers tunneling characteristic can be understood from the energy band structures in the corresponding superlattice systems and the carrier’s states in well/barriers. The transmission peaks above the critical incident angle rely on the carrier’s resonance in the well regions. The structural diversity can modulate the electronic and transport properties, thus expanding its applications.

  4. Interfacial Reaction During High Energy Ball Milling Dispersion of Carbon Nanotubes into Ti6Al4V

    NASA Astrophysics Data System (ADS)

    Adegbenjo, A. O.; Olubambi, P. A.; Potgieter, J. H.; Nsiah-Baafi, E.; Shongwe, M. B.

    2017-12-01

    The unique thermal and mechanical properties of carbon nanotubes (CNTs) have made them choice reinforcements for metal matrix composites (MMCs). However, there still remains a critical challenge in achieving homogeneous dispersion of CNTs in metallic matrices. Although high energy ball milling (HEBM) has been reported as an effective method of dispersing CNTs into metal matrices, a careful selection of the milling parameters is important not to compromise the structural integrity of CNTs which may cause interfacial reactions with the matrix. In this study, multi-walled carbon nanotubes (MWCNTs) were purified by annealing in argon and vacuum atmospheres at 1000 and 1800 °C, respectively, for 5 h to remove possible metallic catalyst impurities. Subsequently, 1, 2 and 3 wt.% MWCNTs were dispersed by adapted HEBM into Ti6Al4V alloy metal matrix. Raman spectroscopy (RS), x-ray diffraction, scanning electron microscopy, energy-dispersive x-ray spectrometry and transmission electron microscopy techniques were used to characterize the as-received and annealed MWCNTs, as well as the admixed MWCNT/Ti6Al4V nanocomposite powders. The experimental results showed that vacuum annealing successfully eliminated retained nickel (Ni) catalysts from MWCNTs, while the adapted HEBM method achieved a relative homogeneous dispersion of MWCNTs into the Ti6Al4V matrix and helped to control interfacial reactions between defective MWCNTs and the metal matrix.

  5. Microscopic and histochemical manifestations of hyaline cartilage dynamics.

    PubMed

    Malinin, G I; Malinin, T I

    1999-01-01

    Structure and function of hyaline cartilages has been the focus of many correlative studies for over a hundred years. Much of what is known regarding dynamics and function of cartilage constituents has been derived or inferred from biochemical and electron microscopic investigations. Here we show that in conjunction with ultrastructural, and high-magnification transmission light and polarization microscopy, the well-developed histochemical methods are indispensable for the analysis of cartilage dynamics. Microscopically demonstrable aspects of cartilage dynamics include, but are not limited to, formation of the intracellular liquid crystals, phase transitions of the extracellular matrix and tubular connections between chondrocytes. The role of the interchondrocytic liquid crystals is considered in terms of the tensegrity hypothesis and non-apoptotic cell death. Phase transitions of the extracellular matrix are discussed in terms of self-alignment of chondrons, matrix guidance pathways and cartilage growth in the absence of mitosis. The possible role of nonenzymatic glycation reactions in cartilage dynamics is also reviewed.

  6. Modeling of trim panels in the energy finite element analysis

    NASA Astrophysics Data System (ADS)

    Moravaeji, Seyed-Javid

    Modeling a trim panel is divided into finding the power exchange through two different paths: (i) the connection of the outer and inner panels (ii) through the layers directly. The vibrational power exchanged through the mounts is modeled as the connection of two parallel plates connected via a beam. Wave matrices representing plates and beams are derived separately; then a matrix method is proposed to solve for the wave amplitudes and hence the vibrational power exchange between the plates accordingly. A closed form formula for the case of connection of two identical plates is derived. For the power transmission loss directly through the layers, first transfer matrices representing layers made of different materials is considered. New matrices for a porous layer are derived. A method of finding the layered structure transfer matrix is proposed. It is concluded that in general a single isotropic layer cannot replace a structure accurately. Finally, on the basis of an equivalent transfer matrix, an optimization process for is proposed to replace the panel by a suitable set of layers.

  7. Determination of dextrose in peritoneal dialysis solution by localized surface plasmon resonance technique based on silver nanoparticles formation

    NASA Astrophysics Data System (ADS)

    Masrournia, Mahboube; Montazarolmahdi, Maliheh; Sani, Faramarz Aliasghari

    2017-07-01

    Determination of dextrose in peritoneal dialysis with a method based on silver nanoparticles (AgNPs) formation was investigated. In a green chemistry method, silver nanoparticles (AgNPs) were synthesized in the natural polymeric matrix of gelatin. The nanoparticles were characterized with UV-Vis spectroscopy and transmission electron microscopy (TEM). Absorbance signal of AgNPs could be applied to determine the various concentrations of dextrose solutions. Drop wise and ultrasonic methods were used and compared with each other. The dynamic range of methods with limit of detection and relative standard deviations were obtained. Results for real sample (peritoneal dialysis) were satisfied.

  8. Optimum design of structures of composite materials in response to aerodynamic noise and noise transmission

    NASA Technical Reports Server (NTRS)

    Yang, J. C. S.; Tsui, C. Y.

    1977-01-01

    Elastic wave propagation and attenuation in a model fiber matrix was investigated. Damping characteristics in graphite epoxy composite materials were measured. A sound transmission test facility suitable to incorporate into NASA Ames wind tunnel for measurement of transmission loss due to sound generation in boundary layers was constructed. Measurement of transmission loss of graphite epoxy composite panels was also included.

  9. RF system calibration for global Q matrix determination.

    PubMed

    Padormo, Francesco; Beqiri, Arian; Malik, Shaihan J; Hajnal, Joseph V

    2016-06-01

    The use of multiple transmission channels (known as Parallel Transmission, or PTx) provides increased control of the MRI signal formation process. This extra flexibility comes at a cost of uncertainty of the power deposited in the patient under examination: the electric fields produced by each transmitter can interfere in such a way to lead to excessively high heating. Although it is not possible to determine local heating, the global Q matrix (which allows the whole-body Specific Absorption Rate (SAR) to be known for any PTx pulse) can be measured in-situ by monitoring the power incident upon and reflected by each transmit element during transmission. Recent observations have shown that measured global Q matrices can be corrupted by losses between the coil array and location of power measurement. In this work we demonstrate that these losses can be accounted for, allowing accurate global Q matrix measurement independent of the location of the power measurement devices. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Reflection and transmission for layered composite materials

    NASA Technical Reports Server (NTRS)

    Graglia, Roberto D.; Uslenghi, Piergiorgio L. E.

    1991-01-01

    A layered planar structure consisting of different bianisotropic materials separated by jump-immittance sheets is considered. Reflection and transmission coefficients are determined via a chain-matrix algorithm. Applications are important for radomes and radar-absorbing materials.

  11. Transmission Index Research of Parallel Manipulators Based on Matrix Orthogonal Degree

    NASA Astrophysics Data System (ADS)

    Shao, Zhu-Feng; Mo, Jiao; Tang, Xiao-Qiang; Wang, Li-Ping

    2017-11-01

    Performance index is the standard of performance evaluation, and is the foundation of both performance analysis and optimal design for the parallel manipulator. Seeking the suitable kinematic indices is always an important and challenging issue for the parallel manipulator. So far, there are extensive studies in this field, but few existing indices can meet all the requirements, such as simple, intuitive, and universal. To solve this problem, the matrix orthogonal degree is adopted, and generalized transmission indices that can evaluate motion/force transmissibility of fully parallel manipulators are proposed. Transmission performance analysis of typical branches, end effectors, and parallel manipulators is given to illustrate proposed indices and analysis methodology. Simulation and analysis results reveal that proposed transmission indices possess significant advantages, such as normalized finite (ranging from 0 to 1), dimensionally homogeneous, frame-free, intuitive and easy to calculate. Besides, proposed indices well indicate the good transmission region and relativity to the singularity with better resolution than the traditional local conditioning index, and provide a novel tool for kinematic analysis and optimal design of fully parallel manipulators.

  12. Magnons in one-dimensional k-component Fibonacci structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costa, C. H., E-mail: carloshocosta@hotmail.com; Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN; Vasconcelos, M. S.

    2014-05-07

    We have studied the magnon transmission through of one-dimensional magnonic k-component Fibonacci structures, where k different materials are arranged in accordance with the following substitution rule: S{sub n}{sup (k)}=S{sub n−1}{sup (k)}S{sub n−k}{sup (k)} (n≥k=0,1,2,…), where S{sub n}{sup (k)} is the nth stage of the sequence. The calculations were carried out in exchange dominated regime within the framework of the Heisenberg model and taking into account the RPA approximation. We have considered multilayers composed of simple cubic spin-S Heisenberg ferromagnets, and, by using the powerful transfer-matrix method, the spin wave transmission is obtained. It is demonstrated that the transmission coefficient has amore » rich and interesting magnonic pass- and stop-bands structures, which depends on the frequency of magnons and the k values.« less

  13. Two-color light-emitting diodes with polarization-sensitive high extraction efficiency based on graphene

    NASA Astrophysics Data System (ADS)

    H, Sattarian; S, Shojaei; E, Darabi

    2016-05-01

    In the present study, graphene photonic crystals are employed to enhance the light extraction efficiency (LEE) of two-color, red and blue, light-emitting diode (LED). The transmission characteristics of one-dimensional (1D) Fibonacci graphene photonic crystal LED (FGPC-LED) are investigated by using the transfer matrix method and the scaling study is presented. We analyzed the influence of period, thickness, and permittivity in the structure to enhance the LEE. The transmission spectrum of 1D FGPC has been optimized in detail. In addition, the effects of the angle of incidence and the state of polarization are investigated. As the main result, we found the optimum values of relevant parameters to enhance the extraction of red and blue light from an LED as well as provide perfect omnidirectional and high peak transmission filters for the TE and TM modes.

  14. Formation of pure Cu nanocrystals upon post-growth annealing of Cu-C material obtained from focused electron beam induced deposition: comparison of different methods.

    PubMed

    Szkudlarek, Aleksandra; Rodrigues Vaz, Alfredo; Zhang, Yucheng; Rudkowski, Andrzej; Kapusta, Czesław; Erni, Rolf; Moshkalev, Stanislav; Utke, Ivo

    2015-01-01

    In this paper we study in detail the post-growth annealing of a copper-containing material deposited with focused electron beam induced deposition (FEBID). The organometallic precursor Cu(II)(hfac)2 was used for deposition and the results were compared to that of compared to earlier experiments with (hfac)Cu(I)(VTMS) and (hfac)Cu(I)(DMB). Transmission electron microscopy revealed the deposition of amorphous material from Cu(II)(hfac)2. In contrast, as-deposited material from (hfac)Cu(I)(VTMS) and (hfac)Cu(I)(DMB) was nano-composite with Cu nanocrystals dispersed in a carbonaceous matrix. After annealing at around 150-200 °C all deposits showed the formation of pure Cu nanocrystals at the outer surface of the initial deposit due to the migration of Cu atoms from the carbonaceous matrix containing the elements carbon, oxygen, and fluorine. Post-irradiation of deposits with 200 keV electrons in a transmission electron microscope favored the formation of Cu nanocrystals within the carbonaceous matrix of freestanding rods and suppressed the formation on their surface. Electrical four-point measurements on FEBID lines from Cu(hfac)2 showed five orders of magnitude improvement in conductivity when being annealed conventionally and by laser-induced heating in the scanning electron microscope chamber.

  15. Development of a direct procedure for the measurement of sulfur isotope variability in beers by MC-ICP-MS.

    PubMed

    Giner Martínez-Sierra, J; Santamaria-Fernandez, R; Hearn, R; Marchante Gayón, J M; García Alonso, J I

    2010-04-14

    In this work, a multi-collector inductively coupled plasma mass spectrometer (MC-ICP-MS) was evaluated for the direct measurement of sulfur stable isotope ratios in beers as a first step toward a general study of the natural isotope variability of sulfur in foods and beverages. Sample preparation consisted of a simple dilution of the beers with 1% (v/v) HNO(3). It was observed that different sulfur isotope ratios were obtained for different dilutions of the same sample indicating that matrix effects affected differently the transmission of the sulfur ions at masses 32, 33, and 34 in the mass spectrometer. Correction for mass bias related matrix effects was evaluated using silicon internal standardization. For that purpose, silicon isotopes at masses 29 and 30 were included in the sulfur cup configuration and the natural silicon content in beers used for internal mass bias correction. It was observed that matrix effects on differential ion transmission could be corrected adequately using silicon internal standardization. The natural isotope variability of sulfur has been evaluated by measuring 26 different beer brands. Measured delta(34)S values ranged from -0.2 to 13.8 per thousand. Typical combined standard uncertainties of the measured delta(34)S values were < or = 2 per thousand. The method has therefore great potential to study sulfur isotope variability in foods and beverages.

  16. Study and analysis of filtering characteristics of 1D photonic crystal

    NASA Astrophysics Data System (ADS)

    Juyal, Rohan; Suthar, Bhuvneshwer; Kumar, Arun

    2018-05-01

    Propagation of electromagnetic wave have been studied and analyzed through 1D photonic crystal. 1D photonic band gap material with low and high refractive index material has been chosen for this study. Band structure and reflectivity of this 1D structure has been calculated using transmission matrix method (TMM). Study and analysis of the band structure and reflectivity of this structure shows that this structure may work as an optical filter.

  17. High-energy X-ray detection by hafnium-doped organic-inorganic hybrid scintillators prepared by sol-gel method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Yan; Koshimizu, Masanori, E-mail: koshi@qpc.che.tohoku.ac.jp; Yahaba, Natsuna

    2014-04-28

    With the aim of enhancing the efficiency with which plastic scintillators detect high-energy X-rays, hafnium-doped organic-inorganic hybrid scintillators were fabricated via a sol-gel method. Transmission electron microscopy of sampled material reveals the presence of Hf{sub x}Si{sub 1−x}O{sub 2} nanoparticles, dispersed in a polymer matrix that constitutes the active material of the X-ray detector. With Hf{sub x}Si{sub 1−x}O{sub 2} nanoparticles incorporated in the polymer matrix, the absorption edge and the luminescence wavelength is shifted, which we attribute to Mie scattering. The detection efficiency for 67.4-keV X-rays in a 0.6-mm-thick piece of this material is two times better than the same thicknessmore » of a commercial plastic scintillator-NE142.« less

  18. Matrix operator theory of radiative transfer. I - Rayleigh scattering.

    NASA Technical Reports Server (NTRS)

    Plass, G. N.; Kattawar, G. W.; Catchings, F. E.

    1973-01-01

    An entirely rigorous method for the solution of the equations for radiative transfer based on the matrix operator theory is reviewed. The advantages of the present method are: (1) all orders of the reflection and transmission matrices are calculated at once; (2) layers of any thickness may be combined, so that a realistic model of the atmosphere can be developed from any arbitrary number of layers, each with different properties and thicknesses; (3) calculations can readily be made for large optical depths and with highly anisotropic phase functions; (4) results are obtained for any desired value of the surface albedo including the value unity and for a large number of polar and azimuthal angles; (5) all fundamental equations can be interpreted immediately in terms of the physical interactions appropriate to the problem; and (6) both upward and downward radiance can be calculated at interior points from relatively simple expressions.

  19. Nanodiamond embedded ta-C composite film by pulsed filtered vacuum arc deposition from a single target

    NASA Astrophysics Data System (ADS)

    Iyer, Ajai; Etula, Jarkko; Ge, Yanling; Liu, Xuwen; Koskinen, Jari

    2016-11-01

    Detonation Nanodiamonds (DNDs) are known to have sp3 core, sp2 shell, small size (few nm) and are gaining importance as multi-functional nanoparticles. Diverse methods have been used to form composites, containing detonation nanodiamonds (DNDs) embedded in conductive and dielectric matrices for various applications. Here we show a method, wherein DND-ta-C composite film, consisting of DNDs embedded in ta-C matrix have been co-deposited from the same cathode by pulsed filtered cathodic vacuum arc method. Transmission Electron Microscope analysis of these films revel the presence of DNDs embedded in the matrix of amorphous carbon. Raman spectroscopy indicates that the presence of DNDs does not adversely affect the sp3 content of DND-ta-C composite film compared to ta-C film of same thickness. Nanoindentation and nanowear tests indicate that DND-ta-C composite films possess improved mechanical properties in comparison to ta-C films of similar thickness.

  20. Fully nonlocal inelastic scattering computations for spectroscopical transmission electron microscopy methods

    NASA Astrophysics Data System (ADS)

    Rusz, Ján; Lubk, Axel; Spiegelberg, Jakob; Tyutyunnikov, Dmitry

    2017-12-01

    The complex interplay of elastic and inelastic scattering amenable to different levels of approximation constitutes the major challenge for the computation and hence interpretation of TEM-based spectroscopical methods. The two major approaches to calculate inelastic scattering cross sections of fast electrons on crystals—Yoshioka-equations-based forward propagation and the reciprocal wave method—are founded in two conceptually differing schemes—a numerical forward integration of each inelastically scattered wave function, yielding the exit density matrix, and a computation of inelastic scattering matrix elements using elastically scattered initial and final states (double channeling). Here, we compare both approaches and show that the latter is computationally competitive to the former by exploiting analytical integration schemes over multiple excited states. Moreover, we show how to include full nonlocality of the inelastic scattering event, neglected in the forward propagation approaches, at no additional computing costs in the reciprocal wave method. Detailed simulations show in some cases significant errors due to the z -locality approximation and hence pitfalls in the interpretation of spectroscopical TEM results.

  1. Mode coupling at connectors in mode-division multiplexed transmission over few-mode fiber.

    PubMed

    Vuong, Jordi; Ramantanis, Petros; Frignac, Yann; Salsi, Massimiliano; Genevaux, Philippe; Bendimerad, Djalal F; Charlet, Gabriel

    2015-01-26

    In mode-division multiplexed (MDM) transmission systems, mode coupling is responsible for inter-modal crosstalk. We consider the transmission of modulated signals over a few-mode fiber (FMF) having low mode coupling and large differential mode group delay in the presence of a non-ideal fiber connection responsible for extra mode coupling. In this context, we first analytically derive the coupling matrix of the multimode connector and we numerically study the dependence of the matrix coefficients as a function of the butt-joint connection characteristics. The numerical results are then validated through an experiment with a five-mode setup. Finally, through numerical simulations, we assess the impact of the connector on the signal quality investigating different receiver digital signal processing (DSP) schemes.

  2. Design And Construction of an Impedance Tube for Measuring Sound Absorptivity and Transmissibility of Materials Using Transfer Function Method

    NASA Astrophysics Data System (ADS)

    Gowda, Haarish Kapaninaikappa

    Noise is defined as unwanted sound, when perceived in excess can cause many harmful effects such as annoyance, interference with speech, and hearing loss, hence there is a need to control noise in practical situations. Noise can be controlled actively and/or passively, here we discuss the passive noise control techniques. Passive noise control involves using energy dissipating or reflecting materials such as absorbers or barriers respectively. Damping and isolating materials are also used in eliminating structure-borne noise. These materials exhibit properties such as reflection, absorption and transmission loss when incidence is by a sound source. Thus, there is a need to characterize the acoustical properties of these materials for practical use. The theoretical background of the random incident sound absorption with reverberation room and normal incident sound absorption using impedance tube are well documented. The Transfer Matrix method for measuring transmission loss and absorption coefficient using impedance tube is very attractive since it is rather inexpensive and fast. In this research, a low-cost Impedance Tube is constructed using transfer function method to measure both absorption and transmissibility of materials. Equipment and measurement instruments available in the laboratory were used in the construction of the tube, adhering to cost-effectiveness. Care has been taken for precise construction of tube to ensure better measurement results. Further various samples varying from hard non-porous to soft porous materials were tested for absorption and sound transmission loss. Absorption values were also compared with reverberation room method with the available samples further ensuring the reliability of the newly constructed tube for future measurements.

  3. Fracture Network Characteristics Informed by Detailed Studies of Chlorinated Solvent Plumes in Sedimentary Rock Aquifers

    NASA Astrophysics Data System (ADS)

    Parker, B. L.; Chapman, S.

    2015-12-01

    Various numerical approaches have been used to simulate contaminant plumes in fractured porous rock, but the one that allows field and laboratory measurements to be most directly used as inputs to these models is the Discrete Fracture Network (DFN) Approach. To effectively account for fracture-matrix interactions, emphasis must be placed on identifying and parameterizing all of the fractures that participate substantially in groundwater flow and contaminated transport. High resolution plume studies at four primary research sites, where chlorinated solvent plumes serve as long-term (several decades) tracer tests, provide insight concerning the density of the fracture network unattainable by conventional methods. Datasets include contaminant profiles from detailed VOC subsampling informed by continuous core logs, hydraulic head and transmissivity profiles, packer testing and sensitive temperature logging methods in FLUTe™ lined holes. These show presence of many more transmissive fractures, contrasting observations of only a few flow zones per borehole obtained from conventional hydraulic tests including flow metering in open boreholes. Incorporating many more fractures with a wider range of transmissivities is key to predicting contaminant migration. This new understanding of dense fracture networks combined with matrix property measurements have informed 2-D DFN flow and transport modelling using Fractran and HydroGeosphere to simulate plume characteristics ground-truthed by detailed field site plume characterization. These process-based simulations corroborate field findings that plumes in sedimentary rock after decades of transport show limited plume front distances and strong internal plume attenuation by diffusion, transverse dispersion and slow degradation. This successful application of DFN modeling informed by field-derived parameters demonstrates how the DFN Approach can be applied to other sites to inform plume migration rates and remedial efficacy.

  4. Singular observation of the polarization-conversion effect for a gammadion-shaped metasurface

    PubMed Central

    Lin, Chu-En; Yen, Ta-Jen; Yu, Chih-Jen; Hsieh, Cheng-Min; Lee, Min-Han; Chen, Chii-Chang; Chang, Cheng-Wei

    2016-01-01

    In this article, the polarization-conversion effects of a gammadion-shaped metasurface in transmission and reflection modes are discussed. In our experiment, the polarization-conversion effect of a gammadion-shaped metasurface is investigated because of the contribution of the phase and amplitude anisotropies. According to our experimental and simulated results, the polarization property of the first-order transmitted diffraction is dominated by linear anisotropy and has weak depolarization; the first-order reflected diffraction exhibits both linear and circular anisotropies and has stronger depolarization than the transmission mode. These results are different from previously published research. The Mueller matrix ellipsometer and polar decomposition method will aid in the investigation of the polarization properties of other nanostructures. PMID:26915332

  5. Compact SOI optimized slot microring coupled phase-shifted Bragg grating resonator for sensing

    NASA Astrophysics Data System (ADS)

    Zhao, Chao Ying; Zhang, Lei; Zhang, Cheng Mei

    2018-05-01

    We propose a novel sensor structure composed of a slot microring and a phase-shifted sidewall Bragg gratings in a slot waveguide. We first present a theoretical analysis of transmission by using the transfer matrix. Then, the mode-field distributions of transmission spectrum obtained from 3D simulations based on FDTD method demonstrates that our sensor exhibit theoretical sensitivity of 297 . 13 nm / RIU, a minimum detection limit of 1 . 1 × 10-4 RIU, the maximum extinction ratio of 20 dB, the quality factor of 2 × 103 and a compact dimension-theoretical structure of 15 μm × 8 . 5 μm. Finally, the sensor's performance is simulated for NaCl solution.

  6. A new method to prepare colloids of size-controlled clusters from a matrix assembly cluster source

    NASA Astrophysics Data System (ADS)

    Cai, Rongsheng; Jian, Nan; Murphy, Shane; Bauer, Karl; Palmer, Richard E.

    2017-05-01

    A new method for the production of colloidal suspensions of physically deposited clusters is demonstrated. A cluster source has been used to deposit size-controlled clusters onto water-soluble polymer films, which are then dissolved to produce colloidal suspensions of clusters encapsulated with polymer molecules. This process has been demonstrated using different cluster materials (Au and Ag) and polymers (polyvinylpyrrolidone, polyvinyl alcohol, and polyethylene glycol). Scanning transmission electron microscopy of the clusters before and after colloidal dispersion confirms that the polymers act as stabilizing agents. We propose that this method is suitable for the production of biocompatible colloids of ultraprecise clusters.

  7. Growth of group II-VI semiconductor quantum dots with strong quantum confinement and low size dispersion

    NASA Astrophysics Data System (ADS)

    Pandey, Praveen K.; Sharma, Kriti; Nagpal, Swati; Bhatnagar, P. K.; Mathur, P. C.

    2003-11-01

    CdTe quantum dots embedded in glass matrix are grown using two-step annealing method. The results for the optical transmission characterization are analysed and compared with the results obtained from CdTe quantum dots grown using conventional single-step annealing method. A theoretical model for the absorption spectra is used to quantitatively estimate the size dispersion in the two cases. In the present work, it is established that the quantum dots grown using two-step annealing method have stronger quantum confinement, reduced size dispersion and higher volume ratio as compared to the single-step annealed samples. (

  8. Chinchilla middle ear transmission matrix model and middle-ear flexibilitya)

    PubMed Central

    Ravicz, Michael E.; Rosowski, John J.

    2017-01-01

    The function of the middle ear (ME) in transforming ME acoustic inputs and outputs (sound pressures and volume velocities) can be described with an acoustic two-port transmission matrix. This description is independent of the load on the ME (cochlea or ear canal) and holds in either direction: forward (from ear canal to cochlea) or reverse (from cochlea to ear canal). A transmission matrix describing ME function in chinchilla, an animal commonly used in auditory research, is presented, computed from measurements of forward ME function: input admittance YTM, ME pressure gain GMEP, ME velocity transfer function HV, and cochlear input admittance YC, in the same set of ears [Ravicz and Rosowski (2012b). J. Acoust. Soc. Am. 132, 2437–2454; (2013a). J. Acoust. Soc. Am. 133, 2208–2223; (2013b). J. Acoust. Soc. Am. 134, 2852–2865]. Unlike previous estimates, these computations require no assumptions about the state of the inner ear, effectiveness of ME manipulations, or measurements of sound transmission in the reverse direction. These element values are generally consistent with physical constraints and the anatomical ME “transformer ratio.” Differences from a previous estimate in chinchilla [Songer and Rosowski (2007). J. Acoust. Soc. Am. 122, 932–942] may be due to a difference in ME flexibility between the two subject groups. PMID:28599566

  9. Chinchilla middle ear transmission matrix model and middle-ear flexibility.

    PubMed

    Ravicz, Michael E; Rosowski, John J

    2017-05-01

    The function of the middle ear (ME) in transforming ME acoustic inputs and outputs (sound pressures and volume velocities) can be described with an acoustic two-port transmission matrix. This description is independent of the load on the ME (cochlea or ear canal) and holds in either direction: forward (from ear canal to cochlea) or reverse (from cochlea to ear canal). A transmission matrix describing ME function in chinchilla, an animal commonly used in auditory research, is presented, computed from measurements of forward ME function: input admittance Y TM , ME pressure gain G MEP , ME velocity transfer function H V , and cochlear input admittance Y C , in the same set of ears [Ravicz and Rosowski (2012b). J. Acoust. Soc. Am. 132, 2437-2454; (2013a). J. Acoust. Soc. Am. 133, 2208-2223; (2013b). J. Acoust. Soc. Am. 134, 2852-2865]. Unlike previous estimates, these computations require no assumptions about the state of the inner ear, effectiveness of ME manipulations, or measurements of sound transmission in the reverse direction. These element values are generally consistent with physical constraints and the anatomical ME "transformer ratio." Differences from a previous estimate in chinchilla [Songer and Rosowski (2007). J. Acoust. Soc. Am. 122, 932-942] may be due to a difference in ME flexibility between the two subject groups.

  10. Defect modes in photonic crystal slabs studied using terahertz time-domain spectroscopy.

    PubMed

    Jian, Zhongping; Pearce, Jeremy; Mittleman, Daniel M

    2004-09-01

    We describe broadband coherent transmission studies of two-dimensional photonic crystals consisting of a hexagonal array of air holes in a dielectric slab in a planar waveguide. By filling several of the air holes in the photonic crystal slab, we observe the signature of a defect mode within the stop band, in both the amplitude and phase spectra. The experimental results are in reasonable agreement with theoretical calculations using the transfer matrix method.

  11. Simulation of Optical Resonators for Vertical-Cavity Surface-Emitting Lasers (vcsel)

    NASA Astrophysics Data System (ADS)

    Mansour, Mohy S.; Hassen, Mahmoud F. M.; El-Nozahey, Adel M.; Hafez, Alaa S.; Metry, Samer F.

    2010-04-01

    Simulation and modeling of the reflectivity and transmissivity of the multilayer DBR of VCSEL, as well as inside the active region quantum well are analyzed using the characteristic matrix method. The electric field intensity distributions inside such vertical-cavity structure are calculated. A software program under MATLAB environment is constructed for the simulation. This study was performed for two specific Bragg wavelengths 980 nm and 370 nm for achieving a resonant periodic gain (RPG)

  12. A modified NARMAX model-based self-tuner with fault tolerance for unknown nonlinear stochastic hybrid systems with an input-output direct feed-through term.

    PubMed

    Tsai, Jason S-H; Hsu, Wen-Teng; Lin, Long-Guei; Guo, Shu-Mei; Tann, Joseph W

    2014-01-01

    A modified nonlinear autoregressive moving average with exogenous inputs (NARMAX) model-based state-space self-tuner with fault tolerance is proposed in this paper for the unknown nonlinear stochastic hybrid system with a direct transmission matrix from input to output. Through the off-line observer/Kalman filter identification method, one has a good initial guess of modified NARMAX model to reduce the on-line system identification process time. Then, based on the modified NARMAX-based system identification, a corresponding adaptive digital control scheme is presented for the unknown continuous-time nonlinear system, with an input-output direct transmission term, which also has measurement and system noises and inaccessible system states. Besides, an effective state space self-turner with fault tolerance scheme is presented for the unknown multivariable stochastic system. A quantitative criterion is suggested by comparing the innovation process error estimated by the Kalman filter estimation algorithm, so that a weighting matrix resetting technique by adjusting and resetting the covariance matrices of parameter estimate obtained by the Kalman filter estimation algorithm is utilized to achieve the parameter estimation for faulty system recovery. Consequently, the proposed method can effectively cope with partially abrupt and/or gradual system faults and input failures by the fault detection. Copyright © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

  13. An approach for the assessment of the statistical aspects of the SEA coupling loss factors and the vibrational energy transmission in complex aircraft structures: Experimental investigation and methods benchmark

    NASA Astrophysics Data System (ADS)

    Bouhaj, M.; von Estorff, O.; Peiffer, A.

    2017-09-01

    In the application of Statistical Energy Analysis "SEA" to complex assembled structures, a purely predictive model often exhibits errors. These errors are mainly due to a lack of accurate modelling of the power transmission mechanism described through the Coupling Loss Factors (CLF). Experimental SEA (ESEA) is practically used by the automotive and aerospace industry to verify and update the model or to derive the CLFs for use in an SEA predictive model when analytical estimates cannot be made. This work is particularly motivated by the lack of procedures that allow an estimate to be made of the variance and confidence intervals of the statistical quantities when using the ESEA technique. The aim of this paper is to introduce procedures enabling a statistical description of measured power input, vibration energies and the derived SEA parameters. Particular emphasis is placed on the identification of structural CLFs of complex built-up structures comparing different methods. By adopting a Stochastic Energy Model (SEM), the ensemble average in ESEA is also addressed. For this purpose, expressions are obtained to randomly perturb the energy matrix elements and generate individual samples for the Monte Carlo (MC) technique applied to derive the ensemble averaged CLF. From results of ESEA tests conducted on an aircraft fuselage section, the SEM approach provides a better performance of estimated CLFs compared to classical matrix inversion methods. The expected range of CLF values and the synthesized energy are used as quality criteria of the matrix inversion, allowing to assess critical SEA subsystems, which might require a more refined statistical description of the excitation and the response fields. Moreover, the impact of the variance of the normalized vibration energy on uncertainty of the derived CLFs is outlined.

  14. Ex Situ Investigation of Anisotropic Interconnection in Silicon-Titanium-Nickel Alloy Anode Material

    DOE PAGES

    Cho, Jong -Soo; Alaboina, Pankaj Kumar; Kang, Chan -Soon; ...

    2017-03-10

    Herein we investigate the nanostructural evolution of Silicon-Titanium-Nickel (Si-Ti-Ni) ternary alloy material synthesized by melt spinning process for advanced lithium-ion battery anode. The synthesized material was found to have nano-Silicon particles dispersed in the Ti 4Ni 4Si 7 (STN) alloy buffering matrix and was characterized by X-ray diffraction (XRD), High resolution- transmission electron microscope (HR-TEM), Scanning transmission electron microscopes - energy dispersive X-ray spectrometer (STEM-EDS), and electrochemical performance test. The role of STN matrix is to accommodate the volume expansion stresses of the dispersed Si nanoparticles. However, an interesting behavior was observed during cycling. The Si nanoparticles were observed tomore » form interconnection channels growing through the weak STN matrix cracks and evolving to a network isolating the STN matrix into small puddles. In conclusion, this unique nanostructural evolution of Si particles and isolation of the STN matrix failing to offer significant buffering effect to the grown Si network eventually accelerates more volume expansions during cycling due to less mechanical confinement and leads to performance degradation and poor cycle stability.« less

  15. Efficient design of multituned transmission line NMR probes: the electrical engineering approach.

    PubMed

    Frydel, J A; Krzystyniak, M; Pienkowski, D; Pietrzak, M; de Sousa Amadeu, N; Ratajczyk, T; Idzik, K; Gutmann, T; Tietze, D; Voigt, S; Fenn, A; Limbach, H H; Buntkowsky, G

    2011-01-01

    Transmission line-based multi-channel solid state NMR probes have many advantages regarding the cost of construction, number of RF-channels, and achievable RF-power levels. Nevertheless, these probes are only rarely employed in solid state-NMR-labs, mainly owing to the difficult experimental determination of the necessary RF-parameters. Here, the efficient design of multi-channel solid state MAS-NMR probes employing transmission line theory and modern techniques of electrical engineering is presented. As technical realization a five-channel ((1)H, (31)P, (13)C, (2)H and (15)N) probe for operation at 7 Tesla is described. This very cost efficient design goal is a multi port single coil transmission line probe based on the design developed by Schaefer and McKay. The electrical performance of the probe is determined by measuring of Scattering matrix parameters (S-parameters) in particular input/output ports. These parameters are compared to the calculated parameters of the design employing the S-matrix formalism. It is shown that the S-matrix formalism provides an excellent tool for examination of transmission line probes and thus the tool for a rational design of these probes. On the other hand, the resulting design provides excellent electrical performance. From a point of view of Nuclear Magnetic Resonance (NMR), calibration spectra of particular ports (channels) are of great importance. The estimation of the π/2 pulses length for all five NMR channels is presented. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. 76 FR 53430 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14076-000 would consist of: (1) Up to 376 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  17. 76 FR 53435 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14089-000 would consist of: (1) Up to 260 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  18. 76 FR 53436 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14091-000 would consist of: (1) Up to 400 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  19. 76 FR 53443 - Northland Power Mississippi River LLC; Notice of Preliminary Permit Application Accepted for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ... would consist of the following: (1) Up to 120 TREK generating units installed in a matrix on the bottom...) shielded underwater cables would convey each matrix power to a substation; and (4) a transmission line...

  20. 76 FR 53434 - Free Flow Power Corporation, Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ...) Up to 160 TREK generating units installed in a matrix on the bottom of the river; (2) the total... each matrix power to a substation; and (4) a transmission line would interconnect with the power grid...

  1. 76 FR 53433 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ...-000 would consist of: (1) Up to 400 TREK generating units installed in a matrix on the bottom of the... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  2. 76 FR 53436 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14090-000 would consist of: (1) Up to 200 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix's power to a substation; and (4) a transmission line would...

  3. 76 FR 53427 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14074-000 would consist of: (1) Up to 376 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  4. 76 FR 53438 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14081-000 would consist of: (1) Up to 50 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  5. 76 FR 53434 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14093-000 would consist of: (1) Up to 160 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  6. 76 FR 53431 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14072-000 would consist of: (1) Up to 150 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  7. 76 FR 53443 - Northland Power Mississippi River LLC; Notice of Preliminary Permit Application Accepted for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ... of the following: (1) Up to 75 TREK generating units installed in a matrix on the bottom of the river... cables would convey each matrix power to a substation; and (4) a transmission line would interconnect...

  8. 76 FR 53427 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14092-000 would consist of: (1) Up to 180 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  9. 76 FR 53432 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14099-000 would consist of: (1) Up to 380 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  10. 76 FR 53438 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    .... 14096-000 would consist of: (1) Up to 340 TREK generating units installed in a matrix on the bottom of... underwater cables would convey each matrix power to a substation; and (4) a transmission line would...

  11. Influence of Normal and Shear Stress on the Hydraulic Transmissivity of Thin Cracks in a Tight Quartz Sandstone, a Granite, and a Shale

    NASA Astrophysics Data System (ADS)

    Rutter, Ernest H.; Mecklenburgh, Julian

    2018-02-01

    Transmissivity of fluids along fractures in rocks is reduced by increasing normal stress acting across them, demonstrated here through gas flow experiments on Bowland shale, and oil flow experiments on Pennant sandstone and Westerly granite. Additionally, the effect of imposing shear stress at constant normal stress was determined, until frictional sliding started. In all cases, increasing shear stress causes an accelerating reduction of transmissivity by 1 to 3 orders of magnitude as slip initiated, as a result of the formation of wear products that block fluid pathways. Only in the case of granite, and to a lesser extent in the sandstone, was there a minor amount of initial increase of transmissivity prior to the onset of slip. These results cast into doubt the commonly applied presumption that cracks with high resolved shear stresses are the most conductive. In the shale, crack transmissivity is commensurate with matrix permeability, such that shales are expected always to be good seals. For the sandstone and granite, unsheared crack transmissivity was respectively 2 and 2.5 orders of magnitude greater than matrix permeability. For these rocks crack transmissivity can dominate fluid flow in the upper crust, potentially enough to permit maintenance of a hydrostatic fluid pressure gradient in a normal (extensional) faulting regime.

  12. Validation of Dosimetric Leaf Gap (DLG) prior to its implementation in Treatment Planning System (TPS): TrueBeam™ millennium 120 leaf MLC.

    PubMed

    Shende, Ravindra; Patel, Ganesh

    2017-01-01

    Objective of present study is to determine optimum value of DLG and its validation prior to being incorporated in TPS for Varian TrueBeam™ millennium 120 leaves MLC. Partial transmission through the rounded leaf ends of the Multi Leaf Collimator (MLC) causes a conflict between the edges of the light field and radiation field. Parameter account for this partial transmission is called Dosimetric Leaf Gap (DLG). The complex high precession technique, such as Intensity Modulated Radiation Therapy (IMRT), entails the modeling of optimum value of DLG inside Eclipse Treatment Planning System (TPS) for precise dose calculation. Distinct synchronized uniformed extension of sweeping dynamic MLC leaf gap fields created by Varian MLC shaper software were use to determine DLG. DLG measurements performed with both 0.13 cc semi-flex ionization chamber and 2D-Array I-Matrix were used to validate the DLG; similarly, values of DLG from TPS were estimated from predicted dose. Similar mathematical approaches were employed to determine DLG from delivered and TPS predicted dose. DLG determined from delivered dose measured with both ionization chamber (DLG Ion ) and I-Matrix (DLG I-Matrix ) compared with DLG estimate from TPS predicted dose (DLG TPS ). Measurements were carried out for all available 6MV, 10MV, 15MV, 6MVFFF and 10MVFFF beam energies. Maximum and minimum DLG deviation between measured and TPS calculated DLG was found to be 0.2 mm and 0.1 mm, respectively. Both of the measured DLGs (DLG Ion and DLG I-Matrix ) were found to be in a very good agreement with estimated DLG from TPS (DLG TPS ). Proposed method proved to be helpful in verifying and validating the DLG value prior to its clinical implementation in TPS.

  13. Global dynamic modeling of a transmission system

    NASA Technical Reports Server (NTRS)

    Choy, F. K.; Qian, W.

    1993-01-01

    The work performed on global dynamic simulation and noise correlation of gear transmission systems at the University of Akron is outlined. The objective is to develop a comprehensive procedure to simulate the dynamics of the gear transmission system coupled with the effects of gear box vibrations. The developed numerical model is benchmarked with results from experimental tests at NASA Lewis Research Center. The modal synthesis approach is used to develop the global transient vibration analysis procedure used in the model. Modal dynamic characteristics of the rotor-gear-bearing system are calculated by the matrix transfer method while those of the gear box are evaluated by the finite element method (NASTRAN). A three-dimensional, axial-lateral coupled bearing model is used to couple the rotor vibrations with the gear box motion. The vibrations between the individual rotor systems are coupled through the nonlinear gear mesh interactions. The global equations of motion are solved in modal coordinates and the transient vibration of the system is evaluated by a variable time-stepping integration scheme. The relationship between housing vibration and resulting noise of the gear transmission system is generated by linear transfer functions using experimental data. A nonlinear relationship of the noise components to the fundamental mesh frequency is developed using the hypercoherence function. The numerically simulated vibrations and predicted noise of the gear transmission system are compared with the experimental results from the gear noise test rig at NASA Lewis Research Center. Results of the comparison indicate that the global dynamic model developed can accurately simulate the dynamics of a gear transmission system.

  14. Characterization of human immunodeficiency virus type 1 p17 matrix protein motifs associated with mother-to-child transmission.

    PubMed Central

    Narwa, R; Roques, P; Courpotin, C; Parnet-Mathieu, F; Boussin, F; Roane, A; Marce, D; Lasfargues, G; Dormont, D

    1996-01-01

    In order to determine if viral selection occurs during mother-to-child transmission of human immunodeficiency virus type 1 (HIV-1), we used a direct solid-phase sequencing method to sequence the p17 matrix protein-encoding regions of viral isolates from 12 HIV-1-infected mother-and-child pairs, 4 infected infants, 4 transmitting mothers, and 22 nontransmitting mothers and compared the sequences. The blood samples were collected during the delivery period for the mothers and during the first month of life for most of the children. The p17 nucleic sequences were distributed among several clades corresponding to the HIV-1 A, B, and G subtypes. At the amino acid level, no significant differences within the known p17 functional regions were observed among the subtypes. Statistical analyses could be performed with the B subtype. Within the major p17 antibody binding site, a constant KIEEEQN motif (amino acids 103 to 109) was found in all mother-and-child isolates from the B subtype. On the other hand, 9 of 17 nontransmitting mother isolates were variable in this 103 to 109 region. Thus, this motif was significantly associated with the transmitting status (chi square, P = 0.0034). A valine residue at position 104 was significantly associated with the nontransmitting phenotype (chi square, P = 0.014), suggesting that it has a protective role during vertical transmission. The C-terminal end of p17 was globally conserved among nontransmitting mother isolates (chi square, P = 0.0037). These results might improve the understanding of the pathogenesis of HIV-1 vertical transmission and might allow the screening of seropositive mothers by a rapid molecular or peptide test. PMID:8676472

  15. 76 FR 53439 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ... consist of: (1) Up to 75 TREK generating units installed in a matrix on the bottom of the river; (2) the... convey each matrix power to a substation; and (4) a transmission line would interconnect with the power...

  16. 76 FR 53444 - Northland Power Mississippi River LLC; Notice of Preliminary Permit Application Accepted for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ... following: (1) Up to 240 TREK generating units installed in a matrix on the bottom of the river; (2) the... convey each matrix power to a substation; and (4) a transmission line would interconnect with the power...

  17. 76 FR 53432 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ...: (1) Up to 1,053 TREK generating units installed in a matrix on the bottom of the river; (2) the total... each matrix power to a substation; and (4) a transmission line would interconnect with the power grid...

  18. 76 FR 53429 - Free Flow Power Corporation; Northland Power Mississippi River LLC; Notice of Competing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ... consist of: (1) Up to 677 TREK generating units installed in a matrix on the bottom of the river; (2) the... would convey each matrix power to a substation; and (4) a transmission line would interconnect with the...

  19. Millimeter-wave studies

    NASA Technical Reports Server (NTRS)

    Allen, Kenneth C.

    1988-01-01

    Progress on millimeter-wave propagation experiments in Hawaii is reported. A short path for measuring attenuation in rain at 9.6, 28.8, 57.6, and 96.1 GHz is in operation. A slant path from Hilo to the top of Mauna Kea is scheduled. On this path, scattering from rain and clouds that may cause interference for satellites closely spaced in geosynchronous orbit will be measured at the same frequencies at 28.8 and 96.1 GHz. In addition the full transmission matrix will be measured at the same frequencies on the slant path. The technique and equipment used to measure the transmission matrix are described.

  20. Verification of an acoustic transmission matrix analysis of sound propagation in a variable area duct without flow

    NASA Technical Reports Server (NTRS)

    Miles, J. H.

    1981-01-01

    A predicted standing wave pressure and phase angle profile for a hard wall rectangular duct with a region of converging-diverging area variation is compared to published experimental measurements in a study of sound propagation without flow. The factor of 1/2 area variation used is sufficient magnitude to produce large reflections. The prediction is based on a transmission matrix approach developed for the analysis of sound propagation in a variable area duct with and without flow. The agreement between the measured and predicted results is shown to be excellent.

  1. Research on bandgaps in two-dimensional phononic crystal with two resonators.

    PubMed

    Gao, Nansha; Wu, Jiu Hui; Yu, Lie

    2015-02-01

    In this paper, the bandgap properties of a two-dimensional phononic crystal with the two resonators is studied and embedded in a homogenous matrix. The resonators are not connected with the matrix but linked with connectors directly. The dispersion relationship, transmission spectra, and displacement fields of the eigenmodes of this phononic crystal are studied with finite-element method. In contrast to the phononic crystals with one resonators and hollow structure, the proposed structures with two resonators can open bandgaps at lower frequencies. This is a very interesting and useful phenomenon. Results show that, the opening of the bandgaps is because of the local resonance and the scattering interaction between two resonators and matrix. An equivalent spring-pendulum model can be developed in order to evaluate the frequencies of the bandgap edge. The study in this paper is beneficial to the design of opening and tuning bandgaps in phononic crystals and isolators in low-frequency range. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Amino acid-functionalized multi-walled carbon nanotubes for improving compatibility with chiral poly(amide-ester-imide) containing L-phenylalanine and L-tyrosine linkages

    NASA Astrophysics Data System (ADS)

    Abdolmaleki, Amir; Mallakpour, Shadpour; Borandeh, Sedigheh

    2013-12-01

    Amino acid functionalized multi-walled carbon nanotubes (f-MWCNTs)/poly(amide-ester-imide) (PAEI) composites were fabricated by solution mixing method. Proper functionalization and mixing strategy of MWCNTs provides the best opportunity for better distribution and bonding of nanoparticles to the polymer matrix. MWCNTs have been chemically modified with L-phenylalanine to improve their compatibility with L-phenylalanine based PAEI. Field emission scanning electron microscopy micrographs of composite revealed that f-MWCNTs made a good interaction with polymer chains by wrapping the polymer around them, and transmission electron microscopy results confirmed well dispersion with nano size of f-MWCNTs in the polymer matrix. In addition, thermal analysis showed good enhancement in thermal properties of composites compared to pure polymer. Thermal stability of the composites containing f-MWCNTs was enhanced due to their good dispersion and improved interfacial interaction between the amino acid based PAEI matrix and f-MWCNTs.

  3. BIREFRINGENT FILTER MODEL

    NASA Technical Reports Server (NTRS)

    Cross, P. L.

    1994-01-01

    Birefringent filters are often used as line-narrowing components in solid state lasers. The Birefringent Filter Model program generates a stand-alone model of a birefringent filter for use in designing and analyzing a birefringent filter. It was originally developed to aid in the design of solid state lasers to be used on aircraft or spacecraft to perform remote sensing of the atmosphere. The model is general enough to allow the user to address problems such as temperature stability requirements, manufacturing tolerances, and alignment tolerances. The input parameters for the program are divided into 7 groups: 1) general parameters which refer to all elements of the filter; 2) wavelength related parameters; 3) filter, coating and orientation parameters; 4) input ray parameters; 5) output device specifications; 6) component related parameters; and 7) transmission profile parameters. The program can analyze a birefringent filter with up to 12 different components, and can calculate the transmission and summary parameters for multiple passes as well as a single pass through the filter. The Jones matrix, which is calculated from the input parameters of Groups 1 through 4, is used to calculate the transmission. Output files containing the calculated transmission or the calculated Jones' matrix as a function of wavelength can be created. These output files can then be used as inputs for user written programs. For example, to plot the transmission or to calculate the eigen-transmittances and the corresponding eigen-polarizations for the Jones' matrix, write the appropriate data to a file. The Birefringent Filter Model is written in Microsoft FORTRAN 2.0. The program format is interactive. It was developed on an IBM PC XT equipped with an 8087 math coprocessor, and has a central memory requirement of approximately 154K. Since Microsoft FORTRAN 2.0 does not support complex arithmetic, matrix routines for addition, subtraction, and multiplication of complex, double precision variables are included. The Birefringent Filter Model was written in 1987.

  4. Quantum propagation and confinement in 1D systems using the transfer-matrix method

    NASA Astrophysics Data System (ADS)

    Pujol, Olivier; Carles, Robert; Pérez, José-Philippe

    2014-05-01

    The aim of this article is to provide some Matlab scripts to the teaching community in quantum physics. The scripts are based on the transfer-matrix formalism and offer a very efficient and versatile tool to solve problems of a physical object (electron, proton, neutron, etc) with one-dimensional (1D) stationary potential energy. Resonant tunnelling through a multiple-barrier or confinement in wells of various shapes is particularly analysed. The results are quantitatively discussed with semiconductor heterostructures, harmonic and anharmonic molecular vibrations, or neutrons in a gravity field. Scripts and other examples (hydrogen-like ions and transmission by a smooth variation of potential energy) are available freely at http://www-loa.univ-lille1.fr/˜pujol in three languages: English, French and Spanish.

  5. Improving Dispersion and Barrier Properties of Polyketone/Graphene Nanoplatelet Composites via Noncovalent Functionalization Using Aminopyrene.

    PubMed

    Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young

    2017-08-23

    A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.

  6. A transmission electron microscopy study of CoFe2O4 ferrite nanoparticles in silica aerogel matrix using HREM and STEM imaging and EDX spectroscopy and EELS.

    PubMed

    Falqui, Andrea; Corrias, Anna; Wang, Peng; Snoeck, Etienne; Mountjoy, Gavin

    2010-04-01

    Magnetic nanocomposite materials consisting of 5 and 10 wt% CoFe2O4 nanoparticles in a silica aerogel matrix have been synthesized by the sol-gel method. For the CoFe2O4-10wt% sample, bright-field scanning transmission electron microscopy (BF STEM) and high-resolution transmission electron microscopy (HREM) images showed distinct, rounded CoFe2O4 nanoparticles, with typical diameters of roughly 8 nm. For the CoFe2O4-5wt% sample, BF STEM images and energy dispersive X-ray (EDX) measurements showed CoFe2O4 nanoparticles with diameters of roughly 3 +/- 1 nm. EDX measurements indicate that all nanoparticles consist of stoichiometric CoFe2O4, and electron energy-loss spectroscopy measurements from lines crossing nanoparticles in the CoFe2O4-10wt% sample show a uniform composition within nanoparticles, with a precision of at best than +/-0.5 nm in analysis position. BF STEM images obtained for the CoFe2O4-10wt% sample showed many "needle-like" nanostructures that typically have a length of 10 nm and a width of 1 nm, and frequently appear to be attached to nanoparticles. These needle-like nanostructures are observed to contain layers with interlayer spacing 0.33 +/- 0.1 nm, which could be consistent with Co silicate hydroxide, a known precursor phase in these nanocomposite materials.

  7. Transmission Electron Microscopy of Single Wall Carbon Nanotube/Polymer Nanocomposites: A First-Principles Study

    NASA Technical Reports Server (NTRS)

    Sola, Francisco; Xia, Zhenhai; Lebrion-Colon, Marisabel; Meador, Michael A.

    2012-01-01

    The physics of HRTEM image formation and electron diffraction of SWCNT in a polymer matrix were investigated theoretically on the basis of the multislice method, and the optics of a FEG Super TWIN Philips CM 200 TEM operated at 80 kV. The effect of nanocomposite thickness on both image contrast and typical electron diffraction reflections of nanofillers were explored. The implications of the results on the experimental applicability to study dispersion, chirality and diameter of nanofillers are discussed.

  8. Location of laccase in ordered mesoporous materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  9. Surface plasmons in new waveguide structures containing ultra-thin metal and silicon layers

    NASA Astrophysics Data System (ADS)

    Shabat, M. M.; Ubeid, M. F.; Abu Rahma, M. A.

    2018-05-01

    Reflected and transmitted powers due to the interaction of electromagnetic waves with a structure containing thin metal and silicon layer are investigated in more detail. The formulations for the transverse electric wave case are provided. Transfer matrix method is used to find the reflection and the transmission coefficients at each interface. Numerical results are presented to show the effect of the structure parameters, the incidence angle and the wavelength on the reflected, transmitted and loss powers.

  10. Location of laccase in ordered mesoporous materials

    NASA Astrophysics Data System (ADS)

    Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  11. Matrix operator theory of radiative transfer. 1: rayleigh scattering.

    PubMed

    Plass, G N; Kattawar, G W; Catchings, F E

    1973-02-01

    An entirely rigorous method for the solution of the equations for radiative transfer based on the matrix operator theory is reviewed. The advantages of the present method are: (1) all orders of the reflection and transmission matrices are calculated at once; (2) layers of any thickness may be combined, so that a realistic model of the atmosphere can be developed from any arbitrary number of layers, each with different properties and thicknesses; (3) calculations can readily be made for large optical depths and with highly anisotropic phase functions; (4) results are obtained for any desired value of the surface albedo including the value unity and for a large number of polar and azimuthal angles including the polar angle theta = 0 degrees ; (5) all fundamental equations can be interpreted immediately in terms of the physical interactions appropriate to the problem; (6) both upward and downward radiance can be calculated at interior points from relatively simple expressions. Both the general theory and its history together with the method of calculation are discussed. As a first example of the method numerous curves are given for both the reflected and transmitted radiance for Rayleigh scattering from a homogeneous layer for a range of optical thicknesses from 0.0019 to 4096, surface albedo A = 0, 0.2, and 1, and cosine of solar zenith angle micro = 1, 0.5397, and 0.1882. It is shown that the matrix operator approach contains the doubling method as a special case.

  12. 76 FR 53449 - Northland Power Mississippi River LLC; Notice of Preliminary Permit Application Accepted for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-26

    ...) Up to 320 TREK generating units installed in a matrix on the bottom of the river; (2) the total... each matrix's power to a substation; and (4) a transmission line would interconnect with the power grid. The proposed [[Page 53450

  13. A systematic and efficient method for modeling acoustic response of multilayered media

    NASA Astrophysics Data System (ADS)

    Feng, Shi-Jin; Chen, Zhang-Long; Chen, Hong-Xin

    2017-12-01

    A generalized transmission and reflection matrix (GTRM) method for determining the acoustic response of multilayered media is developed in this paper. The principle of the method is to decipher the wave vectors by constructing generalized T/R matrices and recursive formulas. The generalized T/R matrices are introduced to account for the contributions of multiple reflection and transmission in a global manner. Three types of interface T/R matrices are developed to accommodate the coupling between any type of physical medium. This method is not only stable for high-frequency and large thickness cases by excluding the growing terms but also explicitly exhibits the physical mechanism of wave propagation. Acoustic response in both frequency and time domains can be solved by the method. Moreover, the method has a simple framework, and it is easy to be implemented in numerical tools. The method is successfully validated by several typical acoustic problems, including poroelastic medium immersed in fluid, aluminum-glass-aluminum immersed in fluid, and poroelastic sediment sandwiched between water and bedrock. In fact, the present method can be extended to any physical problem of a multilayered structure. When the wave frequency is high or the layered media is greatly thick or the material combination is highly complex, the advantage of the GTRM method is more conspicuous.

  14. Measurement of gamma' precipitates in a nickel-based superalloy using energy-filtered transmission electron microscopy coupled with automated segmenting techniques.

    PubMed

    Tiley, J S; Viswanathan, G B; Shiveley, A; Tschopp, M; Srinivasan, R; Banerjee, R; Fraser, H L

    2010-08-01

    Precipitates of the ordered L1(2) gamma' phase (dispersed in the face-centered cubic or FCC gamma matrix) were imaged in Rene 88 DT, a commercial multicomponent Ni-based superalloy, using energy-filtered transmission electron microscopy (EFTEM). Imaging was performed using the Cr, Co, Ni, Ti and Al elemental L-absorption edges in the energy loss spectrum. Manual and automated segmentation procedures were utilized for identification of precipitate boundaries and measurement of precipitate sizes. The automated region growing technique for precipitate identification in images was determined to measure accurately precipitate diameters. In addition, the region growing technique provided a repeatable method for optimizing segmentation techniques for varying EFTEM conditions. (c) 2010 Elsevier Ltd. All rights reserved.

  15. Enhanced absorption of TM waves in conductive nanoparticles structure

    NASA Astrophysics Data System (ADS)

    Mousa, H. M.; Shabat, M. M.; Ouda, A. K.; Schaadt, D. M.

    2018-05-01

    This paper tackles anti-reflection coating structure for silicon solar cell where conductive nanoparticle (CNP) film is sandwiched between a semi-infinite glass cover and a semi-infinite silicon substrate. The transmission and reflection coefficients are derived by the transfer matrix method and simulated for values of unit cell sizes, gab widths in visible and near-infrared radiation. We also illustrated the dependence of the absorption, transmission and reflection coefficients on several angles of incidence of the transverse magnetic polarized (TM) waves. We found out that reflection decreases by the increase of incident angle to 50∘. If nanoparticles are suitably located and sized at gab width of 3.5 nm, unit cell of 250 nm and CNP layer thickness of 150 nm, the absorptivity of the structure achieves 100%.

  16. The dynamical conductance of graphene tunnelling structures.

    PubMed

    Zhang, Huan; Chan, K S; Lin, Zijing

    2011-12-16

    The dynamical conductances of graphene tunnelling structures were numerically calculated using the scattering matrix method with the interaction effect included in a phenomenological approach. The overall single-barrier dynamical conductance is capacitative. Transmission resonances in the single-barrier structure lead to dips in the capacitative imaginary part of the response. This is different from the ac responses of typical semiconductor nanostructures, where transmission resonances usually lead to inductive peaks. The features of the dips depend on the Fermi energy. When the Fermi energy is below half of the barrier height, the dips are sharper. When the Fermi energy is higher than half of the barrier height, the dips are broader. Inductive behaviours can be observed in a double-barrier structure due to the resonances formed by reflection between the two barriers.

  17. The integrin expression profile modulates orientation and dynamics of force transmission at cell-matrix adhesions.

    PubMed

    Balcioglu, Hayri E; van Hoorn, Hedde; Donato, Dominique M; Schmidt, Thomas; Danen, Erik H J

    2015-04-01

    Integrin adhesion receptors connect the extracellular matrix (ECM) to the cytoskeleton and serve as bidirectional mechanotransducers. During development, angiogenesis, wound healing and cancer progression, the relative abundance of fibronectin receptors, including integrins α5β1 and αvβ3, changes, thus altering the integrin composition of cell-matrix adhesions. Here, we show that enhanced αvβ3 expression can fully compensate for loss of α5β1 and other β1 integrins to support outside-in and inside-out force transmission. α5β1 and αvβ3 each mediate actin cytoskeletal remodeling in response to stiffening or cyclic stretching of the ECM. Likewise, α5β1 and αvβ3 support cellular traction forces of comparable magnitudes and similarly increase these forces in response to ECM stiffening. However, cells using αvβ3 respond to lower stiffness ranges, reorganize their actin cytoskeleton more substantially in response to stretch, and show more randomly oriented traction forces. Centripetal traction force orientation requires long stress fibers that are formed through the action of Rho kinase (ROCK) and myosin II, and that are supported by α5β1. Thus, altering the relative abundance of fibronectin-binding integrins in cell-matrix adhesions affects the spatiotemporal organization of force transmission. © 2015. Published by The Company of Biologists Ltd.

  18. Analytical modeling of a sandwiched plate piezoelectric transformer-based acoustic-electric transmission channel.

    PubMed

    Lawry, Tristan J; Wilt, Kyle R; Scarton, Henry A; Saulnier, Gary J

    2012-11-01

    The linear propagation of electromagnetic and dilatational waves through a sandwiched plate piezoelectric transformer (SPPT)-based acoustic-electric transmission channel is modeled using the transfer matrix method with mixed-domain two-port ABCD parameters. This SPPT structure is of great interest because it has been explored in recent years as a mechanism for wireless transmission of electrical signals through solid metallic barriers using ultrasound. The model we present is developed to allow for accurate channel performance prediction while greatly reducing the computational complexity associated with 2- and 3-dimensional finite element analysis. As a result, the model primarily considers 1-dimensional wave propagation; however, approximate solutions for higher-dimensional phenomena (e.g., diffraction in the SPPT's metallic core layer) are also incorporated. The model is then assessed by comparing it to the measured wideband frequency response of a physical SPPT-based channel from our previous work. Very strong agreement between the modeled and measured data is observed, confirming the accuracy and utility of the presented model.

  19. Filtering properties of Thue-Morse nano-photonic crystals containing high-temperature superconductor

    NASA Astrophysics Data System (ADS)

    Talebzadeh, Robabeh; Bavaghar, Mehrdad

    2018-05-01

    In this paper, we introduced new design of quasi-periodic layered structures by choosing order two of ternary Thue-Morse structure. We considered Superconductor-dielectric photonic crystal with mirror symmetric as (ABSSAB)N(BASSBA)N composed of two kinds of nano-scale dielectric layers (A and B) and high-temperature superconductor layers where N is the number of period. This structure is assumed to be the free space. By using the transfer matrix method and the two fluid model, we theoretically study the transmission spectrum of ternary Thue-Morse superconducting photonic crystals with mirror symmetry and introduce this structure as a narrow optical filter. We showed that transmission peak so-called defect mode appears itself inside the transmission spectrum of suggested structure as same as defective layered structure. Also, we analyzed the influence of various related parameters such as the operating temperature of superconductor layer on position of defect mode. The redshift of defect mode with increasing the operating temperature was observed.

  20. Inclusion-based effective medium models for the field-scale permeability of 3D fractured rock masses

    NASA Astrophysics Data System (ADS)

    Ebigbo, Anozie; Lang, Philipp S.; Paluszny, Adriana; Zimmerman, Robert W.

    2016-04-01

    Fractures that are more permeable than their host rock can act as preferential, or at least additional, pathways for fluid to flow through the rock. The additional transmissivity contributed by these fractures will be of great relevance in several areas of earth science and engineering, such as radioactive waste disposal in crystalline rock, exploitation of fractured hydrocarbon and geothermal reservoirs, or hydraulic fracturing. In describing or predicting flow through fractured rock, the effective permeability of the rock mass, comprising both the rock matrix and a network of fractures, is a crucial parameter, and will depend on several geometric properties of the fractures/networks, such as lateral extent, aperture, orientation, and fracture density. This study investigates the ability of classical inclusion-based effective medium models (following the work of Sævik et al., Transp. Porous Media, 2013) to predict this permeability. In these models, the fractures are represented as thin, spheroidal inclusions, the interiors of which are treated as porous media having a high (but finite) permeability. The predictions of various effective medium models, such as the symmetric and asymmetric self-consistent schemes, the differential scheme, and Maxwell's method, are tested against the results of explicit numerical simulations of mono- and polydisperse isotropic fracture networks embedded in a permeable rock matrix. Comparisons are also made with the Hashin-Shrikman bounds, Snow's model, and Mourzenko's heuristic model (Mourzenko et al., Phys. Rev. E, 2011). This problem is characterised mathematically by two small parameters, the aspect ratio of the spheroidal fractures, α, and the ratio between matrix and fracture permeability, κ. Two different regimes can be identified, corresponding to α/κ < 1 and α/κ > 1. The lower the value of α/κ, the more significant is flow through the matrix. Due to differing flow patterns, the dependence of effective permeability on fracture density differs in the two regimes. When α/κ > 1, a distinct percolation threshold is observed, whereas for α/κ < 1, the matrix is sufficiently transmissive that a percolation-like transition is not observed. The self-consistent effective medium methods show good accuracy for both mono- and polydisperse isotropic fracture networks. Mourzenko's equation is also found to be very accurate, particularly for monodisperse networks. Finally, it is shown that Snow's model essentially coincides with the Hashin-Shtrikman upper bound.

  1. Residue 41 of the Eurasian Avian-Like Swine Influenza A Virus Matrix Protein Modulates Virion Filament Length and Efficiency of Contact Transmission

    PubMed Central

    Campbell, Patricia J.; Kyriakis, Constantinos S.; Marshall, Nicolle; Suppiah, Suganthi; Seladi-Schulman, Jill; Danzy, Shamika; Lowen, Anice C.

    2014-01-01

    ABSTRACT Position 41 of the influenza A virus matrix protein encodes a highly conserved alanine in human and avian lineages. Nonetheless, strains of the Eurasian avian-like swine (Easw) lineage contain a change at this position: position 41 of A/swine/Spain/53207/04 (H1N1) (SPN04) encodes a proline. To assess the impact of this naturally occurring polymorphism on viral fitness, we utilized reverse genetics to produce recombinant viruses encoding wild-type M1 41P (rSPN04-P) and consensus 41A (rSPN04-A) residues. Relative to rSPN04-A, rSPN04-P virus displayed reduced growth in vitro. In the guinea pig model, rSPN04-P was transmitted to fewer contact animals than rSPN04-A and failed to infect guinea pigs that received a low-dose inoculum. Moreover, the P41A change altered virion morphology, reducing the number and length of filamentous virions, as well as reducing the neuraminidase activity of virions. The lab-adapted human isolate, A/PR/8/34 (H1N1) (PR8), is nontransmissible in the guinea pig model, making it a useful background in which to identify certain viral factors that enhance transmissibility. We assessed transmission in the context of single-, double-, and triple-reassortant viruses between PR8 and SPN04; PR8/SPN04 M, PR8/SPN04 M+NA, and PR8/SPN04 M+NA+HA, encoding either matrix 41 A or P, were generated. In each case, the virus possessing 41P transmitted less well than the corresponding 41A-encoding virus. In summary, we have identified a naturally occurring mutation in the influenza A virus matrix protein that impacts transmission efficiency and can alter virion morphology and neuraminidase activity. IMPORTANCE We have developed a practical model for examining the genetics underlying transmissibility of the Eurasian avian-like swine lineage viruses, which contributed M and NA segments to the 2009 pandemic strain. Here, we use our system to investigate the impact on viral fitness of a naturally occurring polymorphism at matrix (M1) position 41 in an Easw isolate. Position 41 has been implicated previously in adaptation to laboratory substrates and to mice. Here we show that the polymorphism at M1 41 has a limited effect on growth in vitro but changes the morphology of the virus and impacts growth and transmission in the guinea pig model. PMID:24760887

  2. Transmission Electron Microscopy of the Matrix Minerals in the Tagish Lake Carbonaceous Chondrite

    NASA Technical Reports Server (NTRS)

    Mikouchi, T.; Kasama, T.; Zolensky, M. E.; Tachikawa, O.

    2001-01-01

    We studied the Tagish Lake matrix minerals by TEM. The result shows similarities to CIs (and CRs) and differences from CMs, but its heterogeneity (e.g., carbonate abundance, saponite/serpentine ratio) suggests its complex history. Additional information is contained in the original extended abstract.

  3. Method of synthesizing bulk transition metal carbide, nitride and phosphide catalysts

    DOEpatents

    Choi, Jae Soon; Armstrong, Beth L; Schwartz, Viviane

    2015-04-21

    A method for synthesizing catalyst beads of bulk transmission metal carbides, nitrides and phosphides is provided. The method includes providing an aqueous suspension of transition metal oxide particles in a gel forming base, dropping the suspension into an aqueous solution to form a gel bead matrix, heating the bead to remove the binder, and carburizing, nitriding or phosphiding the bead to form a transition metal carbide, nitride, or phosphide catalyst bead. The method can be tuned for control of porosity, mechanical strength, and dopant content of the beads. The produced catalyst beads are catalytically active, mechanically robust, and suitable for packed-bed reactor applications. The produced catalyst beads are suitable for biomass conversion, petrochemistry, petroleum refining, electrocatalysis, and other applications.

  4. LCMV beamforming for a novel wireless local positioning system: a stationarity analysis

    NASA Astrophysics Data System (ADS)

    Tong, Hui; Zekavat, Seyed A.

    2005-05-01

    In this paper, we discuss the implementation of Linear Constrained Minimum Variance (LCMV) beamforming (BF) for a novel Wireless Local Position System (WLPS). WLPS main components are: (a) a dynamic base station (DBS), and (b) a transponder (TRX), both mounted on mobiles. WLPS might be considered as a node in a Mobile Adhoc NETwork (MANET). Each TRX is assigned an identification (ID) code. DBS transmits periodic short bursts of energy which contains an ID request (IDR) signal. The TRX transmits back its ID code (a signal with a limited duration) to the DBS as soon as it detects the IDR signal. Hence, the DBS receives non-continuous signals transmitted by TRX. In this work, we assume asynchronous Direct-Sequence Code Division Multiple Access (DS-CDMA) transmission from the TRX with antenna array/LCMV BF mounted at the DBS, and we discuss the implementation of the observed signal covariance matrix for LCMV BF. In LCMV BF, the observed covariance matrix should be estimated. Usually sample covariance matrix (SCM) is used to estimate this covariance matrix assuming a stationary model for the observed data which is the case in many communication systems. However, due to the non-stationary behavior of the received signal in WLPS systems, SCM does not lead to a high WLPS performance compared to even a conventional beamformer. A modified covariance matrix estimation method which utilizes the cyclostationarity property of WLPS system is introduced as a solution to this problem. It is shown that this method leads to a significant improvement in the WLPS performance.

  5. Valley-spin filtering through a nonmagnetic resonant tunneling structure in silicene

    NASA Astrophysics Data System (ADS)

    Wu, Xiuqiang; Meng, Hao; Zhang, Haiyang; Bai, Yujie; Xu, Xing

    2018-07-01

    We theoretically investigate how a silecene-based nonmagnetic resonant-tunneling structure, i.e. a double electrostatic potential structure, can be tailored to generate valley- and spin-polarized filtering by using the scattering matrix method. This method allows us to find simple analytical expressions for the scattering amplitudes. It is found that the transmissions of electrons from opposite spin and valley show exactly opposite behaviors, leading to valley and spin filtering in a wide range of transmission directions. These directional-dependent valley-spin polarization behaviors can be used to select preferential directions along which the valley-spin polarization of an initially unpolarized carrier can be strongly enhanced. We also find that this phenomenon arises from the combinations of the coherent effect, electrostatic potential and external electric field. Especially when the direction of the external electric field is changed, the spin filtering properties are contained, while the valley filtering properties can be switched. In addition, the filtering behaviors can be conveniently controlled by electrical gating. Therefore, the results can offer an all-electric method to construct a valley-spin filter in silicene.

  6. Assessment of morphology and property of graphene oxide-hydroxypropylmethylcellulose nanocomposite films.

    PubMed

    Ghosh, Tapas Kumar; Gope, Shirshendu; Mondal, Dibyendu; Bhowmik, Biplab; Mollick, Md Masud Rahaman; Maity, Dipanwita; Roy, Indranil; Sarkar, Gunjan; Sadhukhan, Sourav; Rana, Dipak; Chakraborty, Mukut; Chattopadhyay, Dipankar

    2014-05-01

    Graphene oxide (GO) was synthesized by Hummer's method and characterized by using Fourier transform infrared spectroscopy and Raman spectroscopy. The as synthesized GO was used to make GO/hydroxypropylmethylcellulose (HPMC) nanocomposite films by the solution mixing method using different concentrations of GO. The nanocomposite films were characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM) and thermo-gravimetric analysis. Mechanical properties, water absorption property and water vapor transmission rate were also measured. XRD analysis showed the formation of exfoliated HPMC/GO nanocomposites films. The FESEM results revealed high interfacial adhesion between the GO and HPMC matrix. The tensile strength and Young's modulus of the nanocomposite films containing the highest weight percentage of GO increased sharply. The thermal stability of HPMC/GO nanocomposites was slightly better than pure HPMC. The water absorption and water vapor transmission rate of HPMC film was reduced with the addition of up to 1 wt% GO. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Effect of temperature on storage modulus and glass transition temperature of ZnS/PS nanocomposites

    NASA Astrophysics Data System (ADS)

    Agarwal, Sonalika; Awasthi, Kamlendra; Saxena, N. S.

    2018-05-01

    In the present study, a simplified solution casting method has been used for preparation of ZnS/PS nanocomposites, based on mixing the ZnS nano filler in nanometer range with the polymer matrix. The prepared nanocomposites with different concentration (0, 2, 4, 6 & 8 wt %) are structurally characterized through X-ray diffraction (XRD) and transmission electron microscope (TEM). The main objective of this study is to investigate the variation of storage modulus and glass transition temperature (Tg) within temperature range 30oC to 150oC for PS and ZnS/PS nanocomposites and have been performed through dynamic mechanical analyzer (DMA). The result shows that storage modulus and Tg of nanocomposites increase with the increase of ZnS nanoparticles up to 4 wt. % in PS and beyond this wt. %, both storage modulus and Tg decrease. The increasing behavior is due to the good adhesion between the ZnS nanoparticles and PS matrix which indicates that ZnS nanoparticles are capable of reinforcing the PS matrix. Beside this the decreasing behaviour at higher filler concentration (6 and 8 wt. %) is due to the agglomeratation of nanoparticles in polymer matrix.

  8. Low complexity Reed-Solomon-based low-density parity-check design for software defined optical transmission system based on adaptive puncturing decoding algorithm

    NASA Astrophysics Data System (ADS)

    Pan, Xiaolong; Liu, Bo; Zheng, Jianglong; Tian, Qinghua

    2016-08-01

    We propose and demonstrate a low complexity Reed-Solomon-based low-density parity-check (RS-LDPC) code with adaptive puncturing decoding algorithm for elastic optical transmission system. Partial received codes and the relevant column in parity-check matrix can be punctured to reduce the calculation complexity by adaptive parity-check matrix during decoding process. The results show that the complexity of the proposed decoding algorithm is reduced by 30% compared with the regular RS-LDPC system. The optimized code rate of the RS-LDPC code can be obtained after five times iteration.

  9. Transmission electron microscopy characterization of microstructural features of Al-Li-Cu alloys

    NASA Technical Reports Server (NTRS)

    Avalos-Borja, M.; Pizzo, P. P.; Larson, L. A.

    1983-01-01

    A transmission electron microscopy (TEM) examination of aluminum-lithium-copper alloys was conducted. The principal purpose is to characterize the nature, size, and distribution of stringer particles which result from the powder metallurgy (P/M) processing of these alloys. Microstructural features associated with the stringer particles are reported that help explain the stress corrosion susceptibility of the powder metallurgy-processed Al-Li-Cu alloys. In addition, matrix precipitation events are documented for a variety of heat treatments and process variations. Hot rolling is observed to significant alter the nature of matrix precipitation, and the observations are correlated with concomitant mechanical property variations.

  10. Transmission electron microscopy characterization of microstructural features in aluminum-lithium-copper alloys

    NASA Technical Reports Server (NTRS)

    Avalos-Borja, M.; Larson, L. A.; Pizzo, P. P.

    1984-01-01

    A transmission electron microscopy (TEM) examination of aluminum-lithium-copper alloys was conducted. The principal purpose is to characterize the nature, size, and distribution of stringer particles which result from the powder metallurgy (P/M) processing of these alloys. Microstructural features associated with the stringer particles are reported that help explain the stress corrosion susceptibility of the powder metallurgy-processed Al-Li-Cu alloys. In addition, matrix precipitaton events are documented for a variety of heat treatments and process variations. Hot rolling is observed to significantly alter the nature of matrix precipitation, and the observations are correlated with concomitant mechanical property variations.

  11. Addressable Inverter Matrix Tests Integrated-Circuit Wafer

    NASA Technical Reports Server (NTRS)

    Buehler, Martin G.

    1988-01-01

    Addressing elements indirectly through shift register reduces number of test probes. With aid of new technique, complex test structure on silicon wafer tested with relatively small number of test probes. Conserves silicon area by reduction of area devoted to pads. Allows thorough evaluation of test structure characteristics and of manufacturing process parameters. Test structure consists of shift register and matrix of inverter/transmission-gate cells connected to two-by-ten array of probe pads. Entire pattern contained in square area having only 1.6-millimeter sides. Shift register is conventional static CMOS device using inverters and transmission gates in master/slave D flip-flop configuration.

  12. Method for observation of deembedded sections of fish gonad by scanning electron microscopy

    NASA Astrophysics Data System (ADS)

    Mao, Lian-Ju

    2000-09-01

    This article reports a method for examining the intracellular structure of fish gonads using a scanning electron microscope(SEM). The specimen preparation procedure is similar to that for transmission electron microscopy wherein samples cut into semi-thin sections are fixed and embedded in plastic. The embedment matrix was removed by solvents. Risen-free specimens could be observed by SEM. The morphology of matured sperms in the gonad was very clear, and the oocyte internal structures appeared in three-dimensional images. Spheroidal nucleoli and yolk vesicles and several bundles of filaments adhered on the nucleoli could be viewed by SEM for the first time.

  13. Analysis of the transmission of Trypanosoma cruzi infection through hosts and vectors.

    PubMed

    Fabrizio, María C; Schweigmann, Nicolás J; Bartoloni, Norberto J

    2016-08-01

    Calculating epidemiological measures of infection by Trypanosoma cruzi, the causative agent of Chagas disease, is complex, because it involves several species, different stages of infection in humans and multiple transmission routes. Using the next-generation matrix method, we analysed a model which considers the three stages of human infection, triatomines and dogs (the main domestic reservoirs of T. cruzi when triatomines are present) and the main transmission routes. We derived R 0 and type-reproduction numbers T. We deduced formulas for the number of new infections generated through each transmission route by each infected individual. We applied our findings in Argentine Gran Chaco. The expressions achieved allowed quantifying the high infectivity of dogs and emphasizing the epidemiological importance of the long and asymptomatic chronic indeterminate stage in humans in the spread of the infection. According to the model, it is expected that one infected human infects 21 triatomines, that 100 infected triatomines are necessary to infect one human and 34 to infect a dog, and that each dog infects on average one triatomine per day. Our results may allow quantifying the effect of control measures on infected humans, triatomines and dogs (or other highly infected vertebrate) or on a specific route of transmission, in other scenarios.

  14. Effects of external and gap mean flows on sound transmission through a double-wall sandwich panel

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Sebastian, Alexis

    2015-05-01

    This paper studies analytically the effects of an external mean flow and an internal gap mean flow on sound transmission through a double-wall sandwich panel lined with poroelastic materials. Biot's theory is employed to describe wave propagation in poroelastic materials, and the transfer matrix method with three types of boundary conditions is applied to solve the system simultaneously. The random incidence transmission loss in a diffuse field is calculated numerically, and the limiting angle of incidence due to total internal reflection is discussed in detail. The numerical predictions suggest that the sound insulation performance of such a double-wall panel is enhanced considerably by both external and gap mean flows particularly in the high-frequency range. Similar effects on transmission loss are observed for the two mean flows. It is shown that the effect of the gap mean flow depends on flow velocity, flow direction, gap depth and fluid properties and also that the fluid properties within the gap appear to influence the transmission loss more effectively than the gap flow. Despite the implementation difficulty in practice, an internal gap flow provides more design space for tuning the sound insulation performance of a double-wall sandwich panel and has great potential for active/passive noise control.

  15. Calibration-independent measurement of complex permittivity of liquids using a coaxial transmission line

    NASA Astrophysics Data System (ADS)

    Guoxin, Cheng

    2015-01-01

    In recent years, several calibration-independent transmission/reflection methods have been developed to determine the complex permittivity of liquid materials. However, these methods experience their own respective defects, such as the requirement of multi measurement cells, or the presence of air gap effect. To eliminate these drawbacks, a fast calibration-independent method is proposed in this paper. There are two main advantages of the present method over those in the literature. First, only one measurement cell is required. The cell is measured when it is empty and when it is filled with liquid. This avoids the air gap effect in the approach, in which the structure with two reference ports connected with each other is needed to be measured. Second, it eliminates the effects of uncalibrated coaxial cables, adaptors, and plug sections; systematic errors caused by the experimental setup are avoided by the wave cascading matrix manipulations. Using this method, three dielectric reference liquids, i.e., ethanol, ethanediol, and pure water, and low-loss transformer oil are measured over a wide frequency range to validate the proposed method. Their accuracy is assessed by comparing the results with those obtained from the other well known techniques. It is demonstrated that this proposed method can be used as a robust approach for fast complex permittivity determination of liquid materials.

  16. Hard X-ray-induced damage on carbon–binder matrix for in situ synchrotron transmission X-ray microscopy tomography of Li-ion batteries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Cheolwoong; Kang, Huixiao; De Andrade, Vincent

    2017-03-21

    The electrode of Li-ion batteries is required to be chemically and mechanically stable in the electrolyte environment forin situmonitoring by transmission X-ray microscopy (TXM). Evidence has shown that continuous irradiation has an impact on the microstructure and the electrochemical performance of the electrode. To identify the root cause of the radiation damage, a wire-shaped electrode is soaked in an electrolyte in a quartz capillary and monitored using TXM under hard X-ray illumination. The results show that expansion of the carbon–binder matrix by the accumulated X-ray dose is the key factor of radiation damage. Forin situTXM tomography, intermittent X-ray exposure duringmore » image capturing can be used to avoid the morphology change caused by radiation damage on the carbon–binder matrix.« less

  17. Theoretical and experimental evidence of Fano-like resonances in simple monomode photonic circuits

    NASA Astrophysics Data System (ADS)

    Mouadili, A.; El Boudouti, E. H.; Soltani, A.; Talbi, A.; Akjouj, A.; Djafari-Rouhani, B.

    2013-04-01

    A simple photonic device consisting of two dangling side resonators grafted at two sites on a waveguide is designed in order to obtain sharp resonant states inside the transmission gaps without introducing any defects in the structure. This results from an internal resonance of the structure when such a resonance is situated in the vicinity of a zero of transmission or placed between two zeros of transmission, the so-called Fano resonances. A general analytical expression for the transmission coefficient is given for various systems of this kind. The amplitude of the transmission is obtained following the Fano form. The full width at half maximum of the resonances as well as the asymmetric Fano parameter are discussed explicitly as function of the geometrical parameters of the system. In addition to the usual asymmetric Fano resonance, we show that this system may exhibit an electromagnetic induced transparency resonance as well as well as a particular case where such resonances collapse in the transmission coefficient. Also, we give a comparison between the phase of the determinant of the scattering matrix, the so-called Friedel phase, and the phase of the transmission amplitude. The analytical results are obtained by means of the Green's function method, whereas the experiments are carried out using coaxial cables in the radio-frequency regime. These results should have important consequences for designing integrated devices such as narrow-frequency optical or microwave filters and high-speed switches. This system is proposed as a simpler alternative to coupled-micoresonators.

  18. Local Probing Spinel and Perovskite Complex Magnetic Systems

    NASA Astrophysics Data System (ADS)

    Oliveira, Goncalo Nuno de Pinho

    Noise is defined as unwanted sound, when perceived in excess can cause many harmful effects such as annoyance, interference with speech, and hearing loss, hence there is a need to control noise in practical situations. Noise can be controlled actively and/or passively, here we discuss the passive noise control techniques. Passive noise control involves using energy dissipating or reflecting materials such as absorbers or barriers respectively. Damping and isolating materials are also used in eliminating structure-borne noise. These materials exhibit properties such as reflection, absorption and transmission loss when incidence is by a sound source. Thus, there is a need to characterize the acoustical properties of these materials for practical use. The theoretical background of the random incident sound absorption with reverberation room and normal incident sound absorption using impedance tube are well documented. The Transfer Matrix method for measuring transmission loss and absorption coefficient using impedance tube is very attractive since it is rather inexpensive and fast. In this research, a low-cost Impedance Tube is constructed using transfer function method to measure both absorption and transmissibility of materials. Equipment and measurement instruments available in the laboratory were used in the construction of the tube, adhering to cost-effectiveness. Care has been taken for precise construction of tube to ensure better measurement results. Further various samples varying from hard non-porous to soft porous materials were tested for absorption and sound transmission loss. Absorption values were also compared with reverberation room method with the available samples further ensuring the reliability of the newly constructed tube for future measurements.

  19. Progressive transmission of road network

    NASA Astrophysics Data System (ADS)

    Ai, Bo; Ai, Tinghua; Tang, Xinming; Li, Zhen

    2009-10-01

    The progressive transmission of vector map data requires efficient multi-scale data model to process the data into hierarchical structure. This paper presents such a data structure of road network without redundancy of geometry for progressive transmission. For a given scale, the road network display has to settle two questions. One is which road objects to be represented and the other is what geometric details to be visualized for the selected roads. This paper combines the Töpfer law and the BLG-tree structure into a multi-scale representation matrix to answer simultaneously the above two questions. In the matrix, rows from top to bottom represent the roads in the sequence of descending classification of traffic and length, which can support the Töpfer law to retrieve the more important roads. In a row, columns record one road by a linear BLG-tree to provide good line graphics.

  20. Chaotic reconfigurable ZCMT precoder for OFDM data encryption and PAPR reduction

    NASA Astrophysics Data System (ADS)

    Chen, Han; Yang, Xuelin; Hu, Weisheng

    2017-12-01

    A secure orthogonal frequency division multiplexing (OFDM) transmission scheme precoded by chaotic Zadoff-Chu matrix transform (ZCMT) is proposed and demonstrated. It is proved that the reconfigurable ZCMT matrices after row/column permutations can be applied as an alternative precoder for peak-to-average power ratio (PAPR) reduction. The permutations and the reconfigurable parameters in ZCMT matrix are generated by a hyper digital chaos, in which a huge key space of ∼ 10800 is created for physical-layer OFDM data encryption. An encrypted data transmission of 8.9 Gb/s optical OFDM signals is successfully demonstrated over 20 km standard single-mode fiber (SSMF) for 16-QAM. The BER performance of the encrypted signals is improved by ∼ 2 dB (BER@ 10-3), which is mainly attributed to the effective reduction of PAPR via chaotic ZCMT precoding. Moreover, the chaotic ZCMT precoding scheme requires no sideband information, thus the spectrum efficiency is enhanced during transmission.

  1. Vibration transmission through rolling element bearings in geared rotor system, part 1. Ph.D. Thesis Final Report

    NASA Technical Reports Server (NTRS)

    Singh, Rajendra; Lim, Teik Chin

    1989-01-01

    A mathematical model is proposed to examine the vibration transmission through rolling element bearings in geared rotor systems. Current bearing models, based on either ideal boundary conditions for the shaft or purely translational stiffness element description, cannot explain how the vibratory motion may be transmitted from the rotating shaft to the casing. This study clarifies this issue qualitatively and quantitatively by developing a comprehensive bearing stiffness matrix of dimension 6 model for the precision rolling element bearings from basic principles. The proposed bearing formulation is extended to analyze the overall geared rotor system dynamics including casing and mounts. The bearing stiffness matrix is included in discrete system models using lumped parameter and/or dynamic finite element techniques. Eigensolution and forced harmonic response due to rotating mass unbalance or kinematic transmission error excitation for a number of examples are computed.

  2. Sound transmission through triple-panel structures lined with poroelastic materials

    NASA Astrophysics Data System (ADS)

    Liu, Yu

    2015-03-01

    In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying appropriate types of boundary conditions for these configurations. The transmission loss of the triple-panel structures in a diffuse sound field is calculated as a function of frequency and compared with that of corresponding double-panel structures. Generally, the triple-panel structure with poroelastic linings has superior acoustic performance to the double-panel counterpart, remarkably in the mid-high frequency range and possibly at low frequencies, by selecting appropriate configurations in which those with two air gaps in the structure exhibit the best overall performance over the entire frequency range. The poroelastic lining significantly lowers the cut-on frequency above which the triple-panel structure exhibits noticeably higher transmission loss. Compared with a double-panel structure, the wider range of system parameters for a triple-panel structure due to the additional partition provides more design space for tuning the sound insulation performance. Despite the increased structural complexity, the triple-panel structure lined with poroelastic materials has the obvious advantages in sound transmission loss while without the penalties in weight and volume, and is hence a promising replacement for the widely used double-panel sandwich structure.

  3. Transmission and transport properties in Cantor graphene structures: The case of magnetoelectric modulation

    NASA Astrophysics Data System (ADS)

    Rodríguez-González, R.; Rodríguez-Vargas, I.

    2017-04-01

    We discuss theoretically the transmission and transport properties of Dirac electrons in a Cantor graphene system under magnetoelectric effects. The transfer matrix method and the Landauer-Büttiker formalism have been implemented to compute the transmittance and the linear-regime conductance, respectively. The fractal order of Cantor type together with the magnetic and electric field are used to distribute and generate the magnetoelectric barriers. This system give us the possibility of compare the mentioned physical properties for magnetic and magnetoelectric barriers. We found a bifurcation process in the transmission spectra which is observable when the generation increases. Also, an asymmetrical and symmetrical behavior is presented for magnetic and magnetoelectric barriers, respectively. In general, an oscillatory behavior is manifested in the conductance. Moreover, we can describe the peaks (form and location) that give rise to the oscillations through the contour plots of the transmittance in the (E ,ky) space. Likewise, by increasing the generation of the system the conductance is enhanced, the oscillations reduced and less pronounced. In short, the magnetoelectric modulation along with the fractal order can be used to control the transmission and transport properties in graphene-based structures.

  4. Chiral tunneling modulated by a time-periodic potential on the surface states of a topological insulator

    PubMed Central

    Li, Yuan; Jalil, Mansoor B. A.; Tan, S. G.; Zhao, W.; Bai, R.; Zhou, G. H.

    2014-01-01

    Time-periodic perturbation can be used to modify the transport properties of the surface states of topological insulators, specifically their chiral tunneling property. Using the scattering matrix method, we study the tunneling transmission of the surface states of a topological insulator under the influence of a time-dependent potential and finite gate bias voltage. It is found that perfect transmission is obtained for electrons which are injected normally into the time-periodic potential region in the absence of any bias voltage. However, this signature of Klein tunneling is destroyed when a bias voltage is applied, with the transmission probability of normally incident electrons decreasing with increasing gate bias voltage. Likewise, the overall conductance of the system decreases significantly when a gate bias voltage is applied. The characteristic left-handed helicity of the transmitted spin polarization is also broken by the finite gate bias voltage. In addition, the time-dependent potential modifies the large-angle transmission profile, which exhibits an oscillatory or resonance-like behavior. Finally, time-dependent transport modes (with oscillating potential in the THz frequency) can result in enhanced overall conductance, irrespective of the presence or absence of the gate bias voltage. PMID:24713634

  5. A transmission line model for propagation in elliptical core optical fibers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Georgantzos, E.; Boucouvalas, A. C.; Papageorgiou, C.

    The calculation of mode propagation constants of elliptical core fibers has been the purpose of extended research leading to many notable methods, with the classic step index solution based on Mathieu functions. This paper seeks to derive a new innovative method for the determination of mode propagation constants in single mode fibers with elliptic core by modeling the elliptical fiber as a series of connected coupled transmission line elements. We develop a matrix formulation of the transmission line and the resonance of the circuits is used to calculate the mode propagation constants. The technique, used with success in the casemore » of cylindrical fibers, is now being extended for the case of fibers with elliptical cross section. The advantage of this approach is that it is very well suited to be able to calculate the mode dispersion of arbitrary refractive index profile elliptical waveguides. The analysis begins with the deployment Maxwell’s equations adjusted for elliptical coordinates. Further algebraic analysis leads to a set of equations where we are faced with the appearance of harmonics. Taking into consideration predefined fixed number of harmonics simplifies the problem and enables the use of the resonant circuits approach. According to each case, programs have been created in Matlab, providing with a series of results (mode propagation constants) that are further compared with corresponding results from the ready known Mathieu functions method.« less

  6. Scanning transmission X-ray, laser scanning, and transmission electron microscopy mapping of the exopolymeric matrix of microbial biofilms.

    PubMed

    Lawrence, J R; Swerhone, G D W; Leppard, G G; Araki, T; Zhang, X; West, M M; Hitchcock, A P

    2003-09-01

    Confocal laser scanning microscopy (CLSM), transmission electron microscopy (TEM), and soft X-ray scanning transmission X-ray microscopy (STXM) were used to map the distribution of macromolecular subcomponents (e.g., polysaccharides, proteins, lipids, and nucleic acids) of biofilm cells and matrix. The biofilms were developed from river water supplemented with methanol, and although they comprised a complex microbial community, the biofilms were dominated by heterotrophic bacteria. TEM provided the highest-resolution structural imaging, CLSM provided detailed compositional information when used in conjunction with molecular probes, and STXM provided compositional mapping of macromolecule distributions without the addition of probes. By examining exactly the same region of a sample with combinations of these techniques (STXM with CLSM and STXM with TEM), we demonstrate that this combination of multimicroscopy analysis can be used to create a detailed correlative map of biofilm structure and composition. We are using these correlative techniques to improve our understanding of the biochemical basis for biofilm organization and to assist studies intended to investigate and optimize biofilms for environmental remediation applications.

  7. Event-triggered distributed filtering over sensor networks with deception attacks and partial measurements

    NASA Astrophysics Data System (ADS)

    Bu, Xianye; Dong, Hongli; Han, Fei; Li, Gongfa

    2018-07-01

    This paper is concerned with the distributed filtering problem for a class of time-varying systems subject to deception attacks and event-triggering protocols. Due to the bandwidth limitation, an event-triggered communication strategy is adopted to alleviate the data transmission pressure in the algorithm implementation process. The partial nodes-based filtering problem is considered, where only a partial of nodes can measure the information of the plant. Meanwhile, the measurement information possibly suffers the deception attacks in the transmission process. Sufficient conditions can be established such that the error dynamics satisfies the prescribed average ? performance constraints. The parameters of designed filters can be calculated by solving a series of recursive linear matrix inequalities. A simulation example is presented to demonstrate the effectiveness of the proposed filtering method in this paper.

  8. Transparent bulk-size nanocomposites with high inorganic loading

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Shi; Gaume, Romain, E-mail: gaume@ucf.edu; Department of Materials Science and Engineering, University of Central Florida, Orlando, Florida 32816

    2015-12-14

    With relatively high nanoparticle loading in polymer matrices, hybrid nanocomposites made by colloidal dispersion routes suffer from severe inhomogeneous agglomeration, a phenomenon that deteriorates light transmission even when the refractive indices of the inorganic and organic phases are closely matched. The dispersion of particles in a matrix is of paramount importance to obtain composites of high optical quality. Here, we describe an innovative, yet straightforward method to fabricate monolithic transparent hybrid nanocomposites with very high particle loading and high refractive index mismatch tolerance between the inorganic and organic constituents. We demonstrate 77% transmission at 800 nm in a 2 mm-thick acrylate polymermore » nanocomposite containing 61 vol. % CaF{sub 2} nanoparticles. Modeling shows that similar performance could easily be obtained with various inorganic phases relevant to a number of photonic applications.« less

  9. Quantum interference in multi-branched molecules: The exact transfer matrix solutions.

    PubMed

    Jiang, Yu

    2017-12-07

    We present a transfer matrix formalism for studying quantum interference in a single molecule electronic system with internal branched structures. Based on the Schrödinger equation with the Bethe ansatz and employing Kirchhoff's rule for quantum wires, we derive a general closed-form expression for the transmission and reflection amplitudes of a two-port quantum network. We show that the transport through a molecule with complex internal structures can be reduced to that of a single two-port scattering unit, which contains all the information of the original composite molecule. Our method allows for the calculation of the transmission coefficient for various types of individual molecular modules giving rise to different resonant transport behaviors such as the Breit-Wigner, Fano, and Mach-Zehnder resonances. As an illustration, we first re-derive the transmittance of the Aharonov-Bohm ring, and then we apply our formulation to N identical parity-time (PT)-symmetric potentials, connected in series as well as in parallel. It is shown that the spectral singularities and PT-symmetric transitions of single scattering cells may be observed in coupled systems. Such transitions may occur at the same or distinct values of the critical parameters, depending on the connection modes under which the scattering objects are coupled.

  10. Investigation on active vibration isolation of a Stewart platform with piezoelectric actuators

    NASA Astrophysics Data System (ADS)

    Wang, Chaoxin; Xie, Xiling; Chen, Yanhao; Zhang, Zhiyi

    2016-11-01

    A Stewart platform with piezoelectric actuators is presented for micro-vibration isolation. The Jacobi matrix of the Stewart platform, which reveals the relationship between the position/pointing of the payload and the extensions of the six struts, is derived by kinematic analysis. The dynamic model of the Stewart platform is established by the FRF (frequency response function) synthesis method. In the active control loop, the direct feedback of integrated forces is combined with the FxLMS based adaptive feedback to dampen vibration of inherent modes and suppress transmission of periodic vibrations. Numerical simulations were conducted to prove vibration isolation performance of the Stewart platform under random and periodical disturbances, respectively. In the experiment, the output consistencies of the six piezoelectric actuators were measured at first and the theoretical Jacobi matrix as well as the feedback gain of each piezoelectric actuator was subsequently modified according to the measured consistencies. The direct feedback loop was adjusted to achieve sufficient active damping and the FxLMS based adaptive feedback control was adopted to suppress vibration transmission in the six struts. Experimental results have demonstrated that the Stewart platform can achieve 30 dB attenuation of periodical disturbances and 10-20 dB attenuation of random disturbances in the frequency range of 5-200 Hz.

  11. Optical Properties of Metal-Dielectric Structures Based on Photon-Crystal Opal Matrices

    NASA Astrophysics Data System (ADS)

    Vanin, A. I.; Lukin, A. E.; Romanov, S. G.; Solovyev, V. G.; Khanin, S. D.; Yanikov, M. V.

    2018-04-01

    Optical properties of novel metal-dielectric nanocomposite materials based on opal matrices have been investigated. The position of optical resonances of nanocomposites, obtained by embedding of silver into the opal matrix by the electrothermodiffusion method, is explained by the Bragg diffraction, and an asymmetric form of resonance curves is attributed to the Fano resonance. An anomalous transmission and absorption of light by hybrid plasmon-photonic layered heterostructures, which is apparently associated with excitation of surface plasmon-polaritons, propagating along "metal-dielectric" interfaces, was revealed.

  12. Tunneling calculations for GaAs-Al(x)Ga(1-x) as graded band-gap sawtooth superlattices. Thesis

    NASA Technical Reports Server (NTRS)

    Forrest, Kathrine A.; Meijer, Paul H. E.

    1991-01-01

    Quantum mechanical tunneling calculations for sawtooth (linearly graded band-gap) and step-barrier AlGaAs superlattices were performed by means of a transfer matrix method, within the effective mass approximation. The transmission coefficient and tunneling current versus applied voltage were computed for several representative structures. Particular consideration was given to effective mass variations. The tunneling properties of step and sawtooth superlattices show some qualitative similarities. Both structures exhibit resonant tunneling, however, because they deform differently under applied fields, the J-V curves differ.

  13. High rate deposition system for metal-cluster/SiO x C y H z -polymer nanocomposite thin films

    NASA Astrophysics Data System (ADS)

    Peter, T.; Rehders, S.; Schürmann, U.; Strunskus, T.; Zaporojtchenko, V.; Faupel, F.

    2013-06-01

    A system for deposition of nanocomposite materials consisting of a SiO x C y H z -polymer matrix and Ag nanoclusters is presented. Ag nanoclusters with sizes between 2 and 20 nm are produced in a gas aggregation cluster source and are deposited through a focused beam at a high rate. This cluster source is presented in detail and the characteristics of the produced nanoclusters are shown. Simultaneously, a SiO x C y H z -polymer matrix is grown from the precursor hexamethyldisiloxane in an RF plasma. The beam of clusters is deposited into the growing polymer, forming the composite material. This process allows the rapid deposition of composite material with varying metal nanocluster concentrations and properties. Since the cluster generation is separated from the matrix growth, the properties of both can be controlled independently. In this study, we present two types of nanocomposite samples, in the first the Ag nanoclusters are homogeneously distributed in the matrix, in the second type the Ag nanoclusters form a layer which is covered by the matrix. These samples are investigated using transmission electron micrography to determine the morphology. Furthermore, the optical properties are probed using optical transmission spectroscopy and the plasmonic resonance behavior is discussed.

  14. Hybrid-dimensional modelling of two-phase flow through fractured porous media with enhanced matrix fracture transmission conditions

    NASA Astrophysics Data System (ADS)

    Brenner, Konstantin; Hennicker, Julian; Masson, Roland; Samier, Pierre

    2018-03-01

    In this work, we extend, to two-phase flow, the single-phase Darcy flow model proposed in [26], [12] in which the (d - 1)-dimensional flow in the fractures is coupled with the d-dimensional flow in the matrix. Three types of so called hybrid-dimensional two-phase Darcy flow models are proposed. They all account for fractures acting either as drains or as barriers, since they allow pressure jumps at the matrix-fracture interfaces. The models also permit to treat gravity dominated flow as well as discontinuous capillary pressure at the material interfaces. The three models differ by their transmission conditions at matrix fracture interfaces: while the first model accounts for the nonlinear two-phase Darcy flux conservations, the second and third ones are based on the linear single phase Darcy flux conservations combined with different approximations of the mobilities. We adapt the Vertex Approximate Gradient (VAG) scheme to this problem, in order to account for anisotropy and heterogeneity aspects as well as for applicability on general meshes. Several test cases are presented to compare our hybrid-dimensional models to the generic equi-dimensional model, in which fractures have the same dimension as the matrix, leading to deep insight about the quality of the proposed reduced models.

  15. Flux-dependent anti-crossing of resonances in parallel non-coupled double quantum dots

    NASA Astrophysics Data System (ADS)

    Joe, Yong S.; Hedin, Eric R.; Kim, Jiseok

    2008-08-01

    We present novel resonant phenomena through parallel non-coupled double quantum dots (QDs) embedded in each arm of an Aharonov-Bohm (AB) ring with magnetic flux passing through its center. The electron transmission through this AB ring with each QD formed by two short-range potential barriers is calculated using a scattering matrix at each junction and a transfer matrix in each arm. We show that as the magnetic flux modulates, a distortion of the grid-like square transmission occurs and an anti-crossing of the resonances appears. Hence, the modulation of magnetic flux in this system can have an equivalent effect to the control of inter-dot coupling between the two QDs.

  16. Infrared-optical transmission and reflection measurements on loose powders

    NASA Astrophysics Data System (ADS)

    Kuhn, J.; Korder, S.; Arduini-Schuster, M. C.; Caps, R.; Fricke, J.

    1993-09-01

    A method is described to determine quantitatively the infrared-optical properties of loose powder beds via directional-hemispherical transmission and reflection measurements. Instead of the integration of the powders into a potassium bromide (KBr) or a paraffin oil matrix, which would drastically alter the scattering behavior, the powders are placed onto supporting layers of polyethylene (PE) and KBr. A commercial spectrometer is supplemented by an external optics, which enables measurements on horizontally arranged samples. For data evaluation we use a solution of the equation of radiative transfer in the 3-flux approximation under boundary conditions adapted to the PE or KBr/powder system. A comparison with Kubelka-Munk's theory and Schuster's 2-flux approximation is performed, which shows that 3-flux approximation yields results closest to the exact solution. Equations are developed, which correct transmission and reflection of the samples for the influence of the supporting layer and calculate the specific extinction and the albedo of the powder and thus enables us to separate scattering and absorption part of the extinction spectrum. Measurements on TiO2 powder are presented, which show the influence of preparation techniques and data evaluation with different methods to obtain the albedo. The specific extinction of various TiO2 powders is presented.

  17. A method to calculate synthetic waveforms in stratified VTI media

    NASA Astrophysics Data System (ADS)

    Wang, W.; Wen, L.

    2012-12-01

    Transverse isotropy with a vertical axis of symmetry (VTI) may be an important material property in the Earth's interior. In this presentation, we develop a method to calculate synthetic seismograms for wave propagation in stratified VTI media. Our method is based on the generalized reflection and transmission method (GRTM) (Luco & Apsel 1983). We extend it to transversely isotropic VTI media. GRTM has the advantage of remaining stable in high frequency calculations compared to the Haskell Matrix method (Haskell 1964), which explicitly excludes the exponential growth terms in the propagation matrix and is limited to low frequency computation. In the implementation, we also improve GRTM in two aspects. 1) We apply the Shanks transformation (Bender & Orszag 1999) to improve the convergence rate of convergence. This improvement is especially important when the depths of source and receiver are close. 2) We adopt a self-adaptive Simpson integration method (Chen & Zhang 2001) in the discrete wavenumber integration so that the integration can still be efficiently carried out at large epicentral distances. Because the calculation is independent in each frequency, the program can also be effectively implemented in parallel computing. Our method provides a powerful tool to synthesize broadband seismograms of VIT media at a large epicenter distance range. We will present examples of using the method to study possible transverse isotropy in the upper mantle and the lowermost mantle.

  18. Electronic excitation induced modifications of structural, electrical and optical properties of Cu-C60 nanocomposite thin films

    NASA Astrophysics Data System (ADS)

    Inani, H.; Singhal, R.; Sharma, P.; Vishnoi, R.; Ojha, S.; Chand, S.; Sharma, G. D.

    2017-09-01

    High energy ion irradiation significantly affects the size and shape of nanoparticles in composites. Low concentration metal fraction embedded in fullerene matrix in form of nanocomposites was synthesized by thermal co-evaporation method. Swift heavy ion irradiation was performed with 120 MeV Au ion beam on Cu-C60 nanocomposites at different fluences 1 × 1012, 3 × 1012, 6 × 1012, 1 × 1013 and 3 × 1013 ions/cm2. Absorption spectra demonstrated that absorption intensity of nanocomposite thin film was increased whereas absorption modes of fullerene C60 were diminished with fluence. Rutherford backscattering spectroscopy was also performed to estimate the thickness of the film and atomic metal fraction in matrix and found to be 45 nm and 3%, respectively. Transmission electron microscopy was performed for structural and particle size evaluation of Cu nanoparticles (NPs) in fullerene C60 matrix. A growth of Cu nanoparticles is observed at a fluence of 3 × 1013 ions/cm2 with a bi-modal distribution in fullerene C60. Structural evolution of fullerene C60 matrix with increasing fluence of 120 MeV Au ion beam is studied by Raman spectroscopy which shows the amorphization of matrix (fullerene C60) at lower fluence. The growth of Cu nanoparticles is explained using the phenomena of Ostwald ripening.

  19. Reinforcement of poly(amide-imide) containing N-trimellitylimido-L-phenylalanine by using nano α-Al2O3 surface-coupled with bromo-flame retardant under ultrasonic irradiation technique

    NASA Astrophysics Data System (ADS)

    Mallakpour, Shadpour; Khadem, Elham

    2014-10-01

    By the uniform dispersion of nanoparticles into a polymer matrix, a substantial improvement of physicochemical properties can be attained. In this study, a series of poly(amide-imide)/Al2O3 nanocomposites (PANC)s based on various amounts of modified α-Al2O3 nanoparticles (ANP)s were prepared using the ultrasonic irradiation method. In the process of manufacturing the nanocomposites (NC)s, severe agglomeration of ANPs into the polymer matrix can be reduced using 2,3,4,5-tetrabromo-6-[(4-hydroxyphenyl)carbamoyl]benzoic acid as novel coupling agent. The effects of modified ANPs on the morphology and properties of the polymer matrix were studied by means of Fourier transform infrared spectroscopy, X-ray diffraction, field emission scanning electron microscopy, transmission electron microscopy and thermal gravimetric analysis (TGA). The results obtained by TGA showed that the thermal stability of the NCs was improved with the addition of the small amounts of ANPs as effective thermal degradation resistant reinforcement.

  20. Network analysis of wildfire transmission and implications for risk governance

    Treesearch

    Alan A. Ager; Cody R. Evers; Michelle A. Day; Haiganoush K. Preisler; Ana M. G. Barros; Max Nielsen-Pincus

    2017-01-01

    We characterized wildfire transmission and exposure within a matrix of large land tenures (federal, state, and private) surrounding 56 communities within a 3.3 million ha fire prone region of central Oregon US. Wildfire simulation and network analysis were used to quantify the exchange of fire among land tenures and communities and analyze the relative contributions of...

  1. Effective increase in beam emittance by phase-space expansion using asymmetric Bragg diffraction.

    PubMed

    Chu, Chia-Hung; Tang, Mau-Tsu; Chang, Shih-Lin

    2015-08-24

    We propose an innovative method to extend the utilization of the phase space downstream of a synchrotron light source for X-ray transmission microscopy. Based on the dynamical theory of X-ray diffraction, asymmetrically cut perfect crystals are applied to reshape the position-angle-wavelength space of the light source, by which the usable phase space of the source can be magnified by over one hundred times, thereby "phase-space-matching" the source with the objective lens of the microscope. The method's validity is confirmed using SHADOW code simulations, and aberration through an optical lens such as a Fresnel zone plate is examined via matrix optics for nano-resolution X-ray images.

  2. Water-assisted extrusion of bio-based PETG/clay nanocomposites

    NASA Astrophysics Data System (ADS)

    Lee, Naeun; Lee, Sangmook

    2018-02-01

    Bio-based polyethylene terephthalate glycol-modified (PETG)/clay nanocomposites were prepared using the water-assisted extrusion process. The effects of different types of clay and clay mixing methods (with or without the use of water) and the resulting nanocomposites properties were investigated by measuring the rheological and tensile properties and morphologies. The valuable properties were achieved when Cloisite 30B was mixed in a slurry state. The results of the X-ray diffraction (XRD) and transmission electron microscopy (TEM) studies showed that the nano-clay was well dispersed within the PETG matrix. This shows that the slurry process could be an effective exfoliation method for many nanocomposites systems as well as for bio-based PETG/clay nanocomposites.

  3. Analysis of band structure, transmission properties, and dispersion behavior of THz wave in one-dimensional parabolic plasma photonic crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Askari, Nasim; Eslami, Esmaeil, E-mail: eeslami@iust.ac.ir; Mirzaie, Reza

    2015-11-15

    The photonic band gap of obliquely incident terahertz electromagnetic waves in a one-dimensional plasma photonic crystal is studied. The periodic structure consists of lossless dielectric and inhomogeneous plasma with a parabolic density profile. The dispersion relation and the THz wave transmittance are analyzed based on the electromagnetic equations and transfer matrix method. The dependence of effective plasma frequency and photonic band gap characteristics on dielectric and plasma thickness, plasma density, and incident angle are discussed in detail. A theoretical calculation for effective plasma frequency is presented and compared with numerical results. Results of these two methods are in good agreement.

  4. Two Coils Resonant Ramsey's Method for the Measurement of Time Reversal Invariance Violation in Neutron Transmission.

    PubMed

    Loukachevitch, V V; Aldushchenkov, A V

    2005-01-01

    It is proposed within the framework of Ramsey's method to register two-dimensional spectra, depending on the neutron phase and neutron energy, for measuring parity (P) and time (T) violating amplitudes of the interaction of polarized neutrons with polarized (139)La nuclei in region of the p-wave resonance. The form of the phase spectrum and corresponding expressions for the asymmetries are obtained on the basis of a formalism of a spin density matrix. It is shown that the ratio of the P,T,-violating to P-violating imaginary amplitudes can be obtained from the measurements of the neutron phase spectrum with polarized and unpolarized (139)La target.

  5. Asymmetrical external effects on transmission, conductance and giant tunneling magnetoresistance in silicene

    NASA Astrophysics Data System (ADS)

    Oubram, O.; Navarro, O.; Guzmán, E. J.; Rodríguez-Vargas, I.

    2018-01-01

    Electron transport in a silicene structure, composed of a pair of magnetic gates, is studied in a ferromagnetic and antiferromagnetic configuration. The transport properties are investigated for asymmetrical external effects like an electrostatic potential, a magnetic field and for asymmetrical geometric structure. This theoretical study, has been done using the matrix transfer method to calculate the transmission, the conductance for parallel and antiparallel magnetic alignment and the tunneling magnetoresistance (TMR). In Particular, we have found that the transmission, conductance and magnetoresistance oscillate as a function of the width of barriers. It is also found that a best control and high values of TMR spectrum are achieved by an asymmetrical application of the contact voltage. Besides, we have shown that the TMR is enhanced several orders of magnitude by the combined asymmetrical magnetization effect with an adequate applied electrostatic potential. Whereby, the asymmetrical external effects play an important role to improve TMR than symmetrical ones. Finally, the giant TMR can be flexibly modulated by incident energy and a specific asymmetrical application of control voltage. These results could be useful to design filters and digital nanodevices.

  6. Neutron shielding behavior of thermoplastic natural rubber/boron carbide composites

    NASA Astrophysics Data System (ADS)

    Mat Zali, Nurazila; Yazid, Hafizal; Megat Ahmad, Megat Harun Al Rashid

    2018-01-01

    Many shielding materials have been designed against the harm of different types of radiation to the human body. Today, polymer-based lightweight composites have been chosen by the radiation protection industry. In the present study, thermoplastic natural rubber (TPNR) composites with different weight percent of boron carbide (B4C) fillers (0% to 30%) were fabricated as neutron shielding through melt blending method. Neutron attenuation properties of TPNR/B4C composites have been investigated. The macroscopic cross section (Σ), half value layer (HVL) and mean free path length (λ) of the composites have been calculated and the transmission curves have been plotted. The obtained results show that Σ, HVL and λ greatly depend on the B4C content. Addition of B4C fillers into TPNR matrix were found to enhance the macroscopic cross section values thus decrease the mean free path length (λ) and half value layer (HVL) of the composites. The transmission curves exhibited that the neutron transmission of the composites decreased with increasing shielding thickness. These results showed that TPNR/B4C composites have high potential for neutron shielding applications.

  7. Discrete Huygens’ modeling for the characterization of a sound absorbing medium

    NASA Astrophysics Data System (ADS)

    Chai, L.; Kagawa, Y.

    2007-07-01

    Based on the equivalence between the wave propagation in the electrical transmission-lines and acoustic tubes, the authors proposed the use of the transmission-line matrix modeling (TLM) for time-domain solution method of the sound field. TLM is known in electromagnetic engineering community, which is equivalent to the discrete Huygens' modeling. The wave propagation is simulated by tracing the sequences of the transmission and scattering of impulses. The theory and the demonstrated examples are presented in the references, in which a sound absorbing field was preliminarily considered to be a medium with simple acoustic resistance independent of frequency and the angle of incidence for the absorbing layer placed on the room wall surface. The present work is concerned with the time-domain response for the characterization of the sound absorbing materials. A lossy component with variable propagation velocity is introduced for sound absorbing materials to facilitate the energy consumption. The frequency characteristics of the absorption coefficient are also considered for the normal, oblique and random incidence. Some numerical demonstrations show that the present modeling provide a reasonable modeling of the homogeneous sound absorbing materials in time domain.

  8. External mean flow influence on sound transmission through finite clamped double-wall sandwich panels

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Catalan, Jean-Cédric

    2017-09-01

    This paper studies the influence of an external mean flow on the sound transmission through finite clamped double-wall sandwich panels lined with poroelastic materials. Biot's theory is employed to describe wave propagation in poroelastic materials and various configurations of coupling the poroelastic layer to the facing plates are considered. The clamped boundary of finite panels are dealt with by the modal superposition theory and the weighted residual (Garlekin) method, leading to a matrix equation solution for the sound transmission loss (STL) through the structure. The theoretical model is validated against existing theories of infinite sandwich panels with and without an external flow. The numerical results of a single incident wave show that the external mean flow has significant effects on the STL which are coupled with the clamped boundary effect dominating in the low-frequency range. The external mean flow also influences considerably the limiting incidence angle of the panel system and the effect of the incidence angle on the STL. However, the influences of the azimuthal angle and the external flow orientation are negligible.

  9. A User''s Guide to the Zwikker-Kosten Transmission Line Code (ZKTL)

    NASA Technical Reports Server (NTRS)

    Kelly, J. J.; Abu-Khajeel, H.

    1997-01-01

    This user's guide documents updates to the Zwikker-Kosten Transmission Line Code (ZKTL). This code was developed for analyzing new liner concepts developed to provide increased sound absorption. Contiguous arrays of multi-degree-of-freedom (MDOF) liner elements serve as the model for these liner configurations, and Zwikker and Kosten's theory of sound propagation in channels is used to predict the surface impedance. Transmission matrices for the various liner elements incorporate both analytical and semi-empirical methods. This allows standard matrix techniques to be employed in the code to systematically calculate the composite impedance due to the individual liner elements. The ZKTL code consists of four independent subroutines: 1. Single channel impedance calculation - linear version (SCIC) 2. Single channel impedance calculation - nonlinear version (SCICNL) 3. Multi-channel, multi-segment, multi-layer impedance calculation - linear version (MCMSML) 4. Multi-channel, multi-segment, multi-layer impedance calculation - nonlinear version (MCMSMLNL) Detailed examples, comments, and explanations for each liner impedance computation module are included. Also contained in the guide are depictions of the interactive execution, input files and output files.

  10. Image compression using singular value decomposition

    NASA Astrophysics Data System (ADS)

    Swathi, H. R.; Sohini, Shah; Surbhi; Gopichand, G.

    2017-11-01

    We often need to transmit and store the images in many applications. Smaller the image, less is the cost associated with transmission and storage. So we often need to apply data compression techniques to reduce the storage space consumed by the image. One approach is to apply Singular Value Decomposition (SVD) on the image matrix. In this method, digital image is given to SVD. SVD refactors the given digital image into three matrices. Singular values are used to refactor the image and at the end of this process, image is represented with smaller set of values, hence reducing the storage space required by the image. Goal here is to achieve the image compression while preserving the important features which describe the original image. SVD can be adapted to any arbitrary, square, reversible and non-reversible matrix of m × n size. Compression ratio and Mean Square Error is used as performance metrics.

  11. Bionanocomposites of regenerated cellulose/zeolite prepared using environmentally benign ionic liquid solvent.

    PubMed

    Soheilmoghaddam, Mohammad; Wahit, Mat Uzir; Tuck Whye, Wong; Ibrahim Akos, Noel; Heidar Pour, Raheleh; Ali Yussuf, Abdirahman

    2014-06-15

    Bionanocomposite films based on regenerated cellulose (RC) and incorporated with zeolite at different concentrations were fabricated by dissolving cellulose in 1-ethyl-3-methylimidazolium chloride (EMIMCl) ionic liquid using a simple green method. The interactions between the zeolite and the cellulose matrix were confirmed by Fourier transform infrared spectra. Mechanical properties of the nanocomposite films significantly improved as compared with the pure regenerated cellulose film, without the loss of extensibility. Zeolite incorporation enhanced the thermal stability and char yield of the nanocomposites. The scanning electron microscopy and transmission electron microscopy showed that zeolite was uniformly dispersed in the regenerated cellulose matrix. In vitro cytotoxicity test demonstrated that both RC and RC/zeolite nanocomposite films are cytocompatible. These results indicate that the prepared nanocomposites have potential applications in biodegradable packaging, membranes and biomedical areas. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Morphological and mechanical properties of styrene butadiene rubber/nano copper nanocomposites

    NASA Astrophysics Data System (ADS)

    Harandi, Maryam Hadizadeh; Alimoradi, Fakhrodin; Rowshan, Gholamhussein; Faghihi, Morteza; Keivani, Maryam; Abadyan, Mohamadreza

    In this research, rubber based nanocomposites with presence of nanoparticle has been studied. Styrene butadiene rubber (SBR)/nanocopper (NC) composites were prepared using two-roll mill method. Transmission electron microscope (TEM) and scanning electron microscope (SEM) images showed proper dispersion of NC in the SBR matrix without substantial agglomeration of nanoparticles. To evaluate the curing properties of nanocomposite samples, swelling and cure rheometric tests were conducted. Moreover, the rheological studies were carried out over a range of shear rates. The effect of NC particles was examined on the thermal behavior of the SBR using thermal gravimetric analysis (TGA). Furthermore, tensile tests were employed to investigate the capability of nanoparticles to enhance mechanical behavior of the compounds. The results showed enhancement in tensile properties with incorporation of NC to SBR matrix. Moreover, addition of NC increased shear viscosity and curing time of SBR composites.

  13. Transmittance properties of one dimensional ternary nanocomposite photonic crystals

    NASA Astrophysics Data System (ADS)

    Elsayed, Hussein A.

    2018-03-01

    In the present work, we have theoretically investigated the transmittance characteristics of one dimensional ternary photonic crystals that containing a nanocomposite layer. The nanocomposite layer was designed from metallic nanoparticles of (Ag) in a transparent matrix of a dielectric material (MgF2). The numerical results are obtained based on the theoretical modeling of the characteristic matrix method and Maxwell-Garnett model. The investigated results demonstrate the significant effect of the volume fraction of the nanoparticles on the effective permittivity of the nanocomposite material as well as the transmission characteristics of our design. Moreover, the roles played by other parameters such as the thickness of the nanocomposite layer, the permittivity of the host dielectric material and the spherical radius of the nanoparticles are included her. The proposed structure could be promising for many applications such as THz optical filters, reflectors and optical switches.

  14. Asymptotic Linear Spectral Statistics for Spiked Hermitian Random Matrices

    NASA Astrophysics Data System (ADS)

    Passemier, Damien; McKay, Matthew R.; Chen, Yang

    2015-07-01

    Using the Coulomb Fluid method, this paper derives central limit theorems (CLTs) for linear spectral statistics of three "spiked" Hermitian random matrix ensembles. These include Johnstone's spiked model (i.e., central Wishart with spiked correlation), non-central Wishart with rank-one non-centrality, and a related class of non-central matrices. For a generic linear statistic, we derive simple and explicit CLT expressions as the matrix dimensions grow large. For all three ensembles under consideration, we find that the primary effect of the spike is to introduce an correction term to the asymptotic mean of the linear spectral statistic, which we characterize with simple formulas. The utility of our proposed framework is demonstrated through application to three different linear statistics problems: the classical likelihood ratio test for a population covariance, the capacity analysis of multi-antenna wireless communication systems with a line-of-sight transmission path, and a classical multiple sample significance testing problem.

  15. Steep and flat bandpass filter using linearly chirped and apodized fiber Bragg grating

    NASA Astrophysics Data System (ADS)

    Wu, Xunqi; Jacquet, Jo"l.; Duan, Guanghua

    2010-02-01

    The development of new optical systems requires the design of novel components that fulfill the market constraints. In particular, low loss, high optical rejection and low cost narrowband filters can play an important role for the introduction of the Wavelength Division Multiplexing (WDM) technology in the local network. So, a novel fiber filter is proposed in this article, with a special combined apodized Linearly Chirped Fiber Bragg Grating (LCFBG) which presents the preferable flat-top and steep-edge characteristics. In the design, we use a continuum cavity condition which is obtained when the effective round-trip phase of oscillated wavelength band is kept identical over the whole Bragg wavelength range. And the transmission spectra are calculated by the reconstruction of the matrixes with the continuum oscillation condition. Therefore, our works show that the ideal square shaped filter is obtained with a lower chirp value relatively together with symmetric reflectivity on both mirrors. The coupling coefficient of the FBG is adjusted to get the same reflectivity values and then to get a transmission filter close to unity. We have then introduced an apodization function of the filter to get a flatter transfer function. Various apodizations schemes have been tested. In this paper, we design and analyze a type of continuum fiber filter with the cavity formed between mirror and apodized LCFBG as reflectors. We calculate firstly the reflectivity, the transmissivity and the group time delay of LCFBG modeled by a simple and practical Transfer Matrix Method (TMM), and then the cavity is reconstructed by TMM, the length of the oscillated cavity is calculated by the continuum oscillation condition, so the output of transmission from the side of LCFBG is continuous in the corresponded reflected bandwidth of LCFBG. We obtain the results and discuss some characteristics of this type of continuum fiber filter.

  16. Improved Secret Image Sharing Scheme in Embedding Capacity without Underflow and Overflow.

    PubMed

    Pang, Liaojun; Miao, Deyu; Li, Huixian; Wang, Qiong

    2015-01-01

    Computational secret image sharing (CSIS) is an effective way to protect a secret image during its transmission and storage, and thus it has attracted lots of attentions since its appearance. Nowadays, it has become a hot topic for researchers to improve the embedding capacity and eliminate the underflow and overflow situations, which is embarrassing and difficult to deal with. The scheme, which has the highest embedding capacity among the existing schemes, has the underflow and overflow problems. Although the underflow and overflow situations have been well dealt with by different methods, the embedding capacities of these methods are reduced more or less. Motivated by these concerns, we propose a novel scheme, in which we take the differential coding, Huffman coding, and data converting to compress the secret image before embedding it to further improve the embedding capacity, and the pixel mapping matrix embedding method with a newly designed matrix is used to embed secret image data into the cover image to avoid the underflow and overflow situations. Experiment results show that our scheme can improve the embedding capacity further and eliminate the underflow and overflow situations at the same time.

  17. Interfacial characteristics of diamond/aluminum composites with high thermal conductivity fabricated by squeeze-casting method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Longtao, E-mail: longtaojiang@163.com; Wang, Pingping; Xiu, Ziyang

    2015-08-15

    In this work, aluminum matrix composites reinforced with diamond particles (diamond/aluminum composites) were fabricated by squeeze casting method. The material exhibited a thermal conductivity as high as 613 W / (m · K). The obtained composites were investigated by scanning electron microscope and transmission electron microscope in terms of the (100) and (111) facets of diamond particles. The diamond particles were observed to be homogeneously distributed in the aluminum matrix. The diamond{sub (111)}/Al interface was found to be devoid of reaction products. While at the diamond{sub (100)}/Al interface, large-sized aluminum carbides (Al{sub 4}C{sub 3}) with twin-crystal structure were identified. Themore » interfacial characteristics were believed to be responsible for the excellent thermal conductivity of the material. - Graphical abstract: Display Omitted - Highlights: • Squeeze casting method was introduced to fabricate diamond/Al composite. • Sound interfacial bonding with excellent thermal conductivity was produced. • Diamond{sub (111)}/ aluminum interface was firstly characterized by TEM/HRTEM. • Physical combination was the controlling bonding for diamond{sub (111)}/aluminum. • The growth mechanism of Al{sub 4}C{sub 3} was analyzed by crystallography theory.« less

  18. The direct field boundary impedance of two-dimensional periodic structures with application to high frequency vibration prediction.

    PubMed

    Langley, Robin S; Cotoni, Vincent

    2010-04-01

    Large sections of many types of engineering construction can be considered to constitute a two-dimensional periodic structure, with examples ranging from an orthogonally stiffened shell to a honeycomb sandwich panel. In this paper, a method is presented for computing the boundary (or edge) impedance of a semi-infinite two-dimensional periodic structure, a quantity which is referred to as the direct field boundary impedance matrix. This terminology arises from the fact that none of the waves generated at the boundary (the direct field) are reflected back to the boundary in a semi-infinite system. The direct field impedance matrix can be used to calculate elastic wave transmission coefficients, and also to calculate the coupling loss factors (CLFs), which are required by the statistical energy analysis (SEA) approach to predicting high frequency vibration levels in built-up systems. The calculation of the relevant CLFs enables a two-dimensional periodic region of a structure to be modeled very efficiently as a single subsystem within SEA, and also within related methods, such as a recently developed hybrid approach, which couples the finite element method with SEA. The analysis is illustrated by various numerical examples involving stiffened plate structures.

  19. Improved Secret Image Sharing Scheme in Embedding Capacity without Underflow and Overflow

    PubMed Central

    Pang, Liaojun; Miao, Deyu; Li, Huixian; Wang, Qiong

    2015-01-01

    Computational secret image sharing (CSIS) is an effective way to protect a secret image during its transmission and storage, and thus it has attracted lots of attentions since its appearance. Nowadays, it has become a hot topic for researchers to improve the embedding capacity and eliminate the underflow and overflow situations, which is embarrassing and difficult to deal with. The scheme, which has the highest embedding capacity among the existing schemes, has the underflow and overflow problems. Although the underflow and overflow situations have been well dealt with by different methods, the embedding capacities of these methods are reduced more or less. Motivated by these concerns, we propose a novel scheme, in which we take the differential coding, Huffman coding, and data converting to compress the secret image before embedding it to further improve the embedding capacity, and the pixel mapping matrix embedding method with a newly designed matrix is used to embed secret image data into the cover image to avoid the underflow and overflow situations. Experiment results show that our scheme can improve the embedding capacity further and eliminate the underflow and overflow situations at the same time. PMID:26351657

  20. A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

    NASA Astrophysics Data System (ADS)

    Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; Lambrakos, Samuel G.; Moody, Nathan A.; Petillo, John J.; Yamaguchi, Hisato; Liu, Fangze

    2018-01-01

    Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al. [Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated by an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quantum yield, emittance, and emission models needed by beam optics codes are discussed.

  1. A transmission electron microscopy study of Fe-Co alloy nanoparticles in silica aerogel matrix using HREM, EDX, and EELS.

    PubMed

    Falqui, Andrea; Corrias, Anna; Gass, Mhairi; Mountjoy, Gavin

    2009-04-01

    Magnetic nanocomposite materials consisting of 5.5 wt% Fe-Co alloy nanoparticles in a silica aerogel matrix, with compositions Fe(x)Co(1-x) of x = 0.50 and 0.67, have been synthesized by the sol-gel method. The high-resolution transmission electron microscopy images show nanoparticles consisting of single crystal grains of body-centered cubic Fe-Co alloy, with typical crystal grain diameters of approximately 4 and 7 nm for Fe(0.5)Co(0.5) and Fe(0.67)Co(0.33) samples, respectively. The energy dispersive X-ray (EDX) spectra summed over areas of the samples gave compositions Fe(x)C(o1-x) with x = 0.48 +/- 0.06 and 0.68 +/- 0.05. The EDX spectra obtained with the 1.5 nm probe positioned at the centers of approximately 20 nanoparticles gave slightly lower concentrations of Fe, with means of x = 0.43 +/- 0.01 and x = 0.64 +/- 0.02, respectively. The Fe(0.5)Co(0.50) sample was studied using electron energy loss spectroscopy (EELS), and EELS spectra summed over whole nanoparticles gave x = 0.47 +/- 0.06. The EELS spectra from analysis profiles of nanoparticles show a distribution of Fe and Co that is homogeneous, i.e., x = 0.5, within a precision of at best +/-0.05 in x and +/-0.4 nm in position. The present microscopy results have not shown the presence of a thin layer of iron oxide, but this might be at the limit of detectability of the methods.

  2. Wavelength dependent in-plane birefringence of transparent flexible films determined by using transmission ellipsometry

    NASA Astrophysics Data System (ADS)

    Yang, Sung Mo; Hong, Sera; Kim, Sang Youl

    2018-05-01

    We introduce a simple method to determine the in-plane birefringence of transparent flexible films by using transmission spectroscopic ellipsometry. The pseudo-ellipsometric constants which can represent their sample azimuthal angle dependent characteristics are introduced. The effect of in-plane birefringence and sample azimuthal angle on the pseudo ellipsometric constants is calculated using Jones matrix formalism, and the observed sample azimuthal angle dependence of measured pseudo-ellipsometric data is well understood. Wavelength dependence of in-plane birefringence is expressed in terms of the Sellmeier dispersion equation. The best fit pseudo-ellipsometric spectra to the measured ones at the sample azimuthal angles of every 15° from 0 to 90° are searched. The dispersion coefficients of the Sellmeier equation and the azimuthal angle of the optic axis are determined for polycarbonate (PC), poly(ethylene naphthalate) (PEN), poly(ethylene terephthalate) (PET), polyimide (PI), and colorless polyimide (CPI) films.

  3. A transmission Kikuchi diffraction study of cementite in a quenched and tempered steel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saleh, Ahmed A., E-mail: asaleh@uow.edu.au; Casillas, Gilberto; Pereloma, Elena V.

    2016-04-15

    This is the first transmission Kikuchi diffraction (TKD) study to report the indexing of nano-sized cementite as distinct structures and its orientation relationship with the body-centered cubic matrix in a quenched and tempered steel. Crystallographic analysis via TKD and selected area diffraction returned the well-known Bagaryatskii and Isaichev orientation relationships. However, the indexing of nano-sized cementite via TKD was sensitive to the thickness of the electron transparent region such that TEM remains the most precise method to characterise such precipitates. - Highlights: • Nano-sized cementite in a QT steel has been investigated by TKD and TEM. • Cementite has beenmore » indexed as distinct structures via TKD. • Crystallographic analysis returned the Bagaryatskii and Isaichev ORs. • Success of TKD is sensitive to the thickness of the electron transparent region. • TEM remains the most precise technique to characterise nano-sized precipitates.« less

  4. Pd-Ni-MWCNT nanocomposite thin films: preparation and structure

    NASA Astrophysics Data System (ADS)

    Kozłowski, Mirosław; Czerwosz, ElŻbieta; Sobczak, Kamil

    2017-08-01

    The properties of nanocomposite palladium-nickel-multi-walled (Pd-Ni-MWCNT) films deposited on aluminum oxide (Al2O3) substrate have been prepared and investigated. These films were obtained by 3 step process consisted of PVD/CVD/PVD methods. The morphology and structure of the obtained films were characterized by Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM) techniques at various stages of the film formation. EDX spectrometer was used to measurements of elements segregation in the obtained film. TEM and STEM (Scanning Transmission Electron Microscopy) observations showed MWCNTs decorated with palladium nanoparticles in the film obtained in the last step of film formation (final PVD process). The average size of the palladium nanoparticles observed both on MWCNTs and carbonaceous matrix does not exceed 5 nm. The research was conducted on the use of the obtained films as potential sensors of gases (e.g. H2, NH3, CO2) and bio-sensors or optical sensors.

  5. Extension of photonic band gap in one-dimensional ternary metal-dielectric photonic crystal

    NASA Astrophysics Data System (ADS)

    Pandey, G. N.; Thapa, Khem B.

    2018-05-01

    In this paper, the photonic band gap structure in the visible and near infrared for a ternary metal dielectric photonic crystal has been theoretically investigated. At the normal incidence, the high reflectance range can be significantly enlarged at a thicker metal film. The transmission of the structure containing Cu has large compared to the other metals like Al and Ag metals. The transmission properties of the metal are dependent upon the value of the plasma frequency. In this paper we consider the effect of the variation of the thickness of the metal on the reflection bands of ternary metallic-dielectric photonic crystal (MDPC). Finally we find that the enlargement of band gap in MDPC is due to the addition of increase of the thickness of metallic film at normal incidence. All the theoretical calculations are made based on the transfer matrix method together with the Drude model of metal.

  6. The application of polyethylene glycol (PEG) to electron microscopy

    PubMed Central

    1980-01-01

    The cytoplasm of cells from a variety of tissues has been viewed in sections (0.25-1 micrometers) devoid of any embedding resin. Glutaraldehyde- and osmium tetroxide-fixed tissues were infiltrated and embedded in a water-miscible wax, polyethylene glycol (PEG), and subsequently sectioned on dry glass or diamond knives. The PEG matrix was removed and the sections were placed on Formvarcarbon-polylysine- coated grids, dehydrated, dried by the critical-point method, and observed in either the high- or low-voltage electron microscope. Stereoscopic views of cells devoid of embedding resin present an image of cell utrastructure unobscured by electron-scattering resins similar to the image of whole, unembedded critical-point-dried or freeze-dried cultured cells observed by transmission electron microscopy. All organelles, including the cytoskeletal structures, are identified and appear not to have been damaged during processing, although membrane components appear somewhat less distinct. The absence of an embedding matrix eliminates the need for additional staining to increase contrast, unlike the situation with specimens embedded in standard electron-scattering resins. The PEG technique thus appears to be a valuable adjunct to conventional methods for ultrastructural analysis. PMID:7400222

  7. The application of polyethylene glycol (PEG) to electron microscopy.

    PubMed

    Wolosewick, J J

    1980-08-01

    The cytoplasm of cells from a variety of tissues has been viewed in sections (0.25-1 micrometers) devoid of any embedding resin. Glutaraldehyde- and osmium tetroxide-fixed tissues were infiltrated and embedded in a water-miscible wax, polyethylene glycol (PEG), and subsequently sectioned on dry glass or diamond knives. The PEG matrix was removed and the sections were placed on Formvarcarbon-polylysine-coated grids, dehydrated, dried by the critical-point method, and observed in either the high- or low-voltage electron microscope. Stereoscopic views of cells devoid of embedding resin present an image of cell utrastructure unobscured by electron-scattering resins similar to the image of whole, unembedded critical-point-dried or freeze-dried cultured cells observed by transmission electron microscopy. All organelles, including the cytoskeletal structures, are identified and appear not to have been damaged during processing, although membrane components appear somewhat less distinct. The absence of an embedding matrix eliminates the need for additional staining to increase contrast, unlike the situation with specimens embedded in standard electron-scattering resins. The PEG technique thus appears to be a valuable adjunct to conventional methods for ultrastructural analysis.

  8. Effect of rapid thermal annealing temperature on the dispersion of Si nanocrystals in SiO2 matrix

    NASA Astrophysics Data System (ADS)

    Saxena, Nupur; Kumar, Pragati; Gupta, Vinay

    2015-05-01

    Effect of rapid thermal annealing temperature on the dispersion of silicon nanocrystals (Si-NC's) embedded in SiO2 matrix grown by atom beam sputtering (ABS) method is reported. The dispersion of Si NCs in SiO2 is an important issue to fabricate high efficiency devices based on Si-NC's. The transmission electron microscopy studies reveal that the precipitation of excess silicon is almost uniform and the particles grow in almost uniform size upto 850 °C. The size distribution of the particles broadens and becomes bimodal as the temperature is increased to 950 °C. This suggests that by controlling the annealing temperature, the dispersion of Si-NC's can be controlled. The results are supported by selected area diffraction (SAED) studies and micro photoluminescence (PL) spectroscopy. The discussion of effect of particle size distribution on PL spectrum is presented based on tight binding approximation (TBA) method using Gaussian and log-normal distribution of particles. The study suggests that the dispersion and consequently emission energy varies as a function of particle size distribution and that can be controlled by annealing parameters.

  9. Effect of metal surfaces on matrix-assisted laser desorption/ionization analyte peak intensities.

    PubMed

    Kancharla, Vidhyullatha; Bashir, Sajid; Liu, Jingbo L; Ramirez, Oscar M; Derrick, Peter J; Beran, Kyle A

    2017-10-01

    Different metal surfaces in the form of transmission electron microscope grids were examined as support surfaces in matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with a view towards enhancement of peptide signal intensity. The observed enhancement between 5-fold and 20-fold relative to the normal stainless steel slide was investigated by applying the thermal desorption model for matrix-assisted laser desorption/ionization. A simple model evaluates the impact that the thermal properties of the metals have on the ion yield of the analyte. It was observed that there was not a direct, or strong, correlation between the thermal properties of the metals and the corresponding ion yield of the peptides. The effects of both fixed and variable laser irradiances versus ion yield were also examined for the respective metals studied. In all cases the use of transmission electron microscope grids required much lower laser irradiances in order to generate similar peak intensities as those observed with a stainless steel surface.

  10. Effective seat-to-head transmissibility in whole-body vibration: Effects of posture and arm position

    NASA Astrophysics Data System (ADS)

    Rahmatalla, Salam; DeShaw, Jonathan

    2011-12-01

    Seat-to-head transmissibility is a biomechanical measure that has been widely used for many decades to evaluate seat dynamics and human response to vibration. Traditionally, transmissibility has been used to correlate single-input or multiple-input with single-output motion; it has not been effectively used for multiple-input and multiple-output scenarios due to the complexity of dealing with the coupled motions caused by the cross-axis effect. This work presents a novel approach to use transmissibility effectively for single- and multiple-input and multiple-output whole-body vibrations. In this regard, the full transmissibility matrix is transformed into a single graph, such as those for single-input and single-output motions. Singular value decomposition and maximum distortion energy theory were used to achieve the latter goal. Seat-to-head transmissibility matrices for single-input/multiple-output in the fore-aft direction, single-input/multiple-output in the vertical direction, and multiple-input/multiple-output directions are investigated in this work. A total of ten subjects participated in this study. Discrete frequencies of 0.5-16 Hz were used for the fore-aft direction using supported and unsupported back postures. Random ride files from a dozer machine were used for the vertical and multiple-axis scenarios considering two arm postures: using the armrests or grasping the steering wheel. For single-input/multiple-output, the results showed that the proposed method was very effective in showing the frequencies where the transmissibility is mostly sensitive for the two sitting postures and two arm positions. For multiple-input/multiple-output, the results showed that the proposed effective transmissibility indicated higher values for the armrest-supported posture than for the steering-wheel-supported posture.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Dan, E-mail: danzhou@is.mpg.de; Sigle, Wilfried; Wang, Yi

    We studied ZrO{sub 2} − La{sub 2/3}Sr{sub 1/3}MnO{sub 3} pillar–matrix thin films which were found to show anomalous magnetic and electron transport properties. With the application of an aberration-corrected transmission electron microscope, interfacial chemistry, and atomic-arrangement of the system, especially of the pillar–matrix interface were revealed at atomic resolution. Minor amounts of Zr were found to occupy Mn positions within the matrix. The Zr concentration reaches a minimum near the pillar–matrix interface accompanied by oxygen vacancies. La and Mn diffusion into the pillar was revealed at atomic resolution and a concomitant change of the Mn valence state was observed.

  12. Enhanced and reduced transmission of acoustic waves with bubble meta-screens

    NASA Astrophysics Data System (ADS)

    Bretagne, Alice; Tourin, Arnaud; Leroy, Valentin

    2011-11-01

    We present a class of sonic meta-screens for manipulating air-borne acoustic waves at ultrasonic or audible frequencies. Our screens consist of periodic arrangements of air bubbles in water or possibly embedded in a soft elastic matrix. They can be used for soundproofing but also for exalting transmission at an air/water interface or even to achieve enhanced absorption.

  13. MODFLOW 2000 Head Uncertainty, a First-Order Second Moment Method

    USGS Publications Warehouse

    Glasgow, H.S.; Fortney, M.D.; Lee, J.; Graettinger, A.J.; Reeves, H.W.

    2003-01-01

    A computationally efficient method to estimate the variance and covariance in piezometric head results computed through MODFLOW 2000 using a first-order second moment (FOSM) approach is presented. This methodology employs a first-order Taylor series expansion to combine model sensitivity with uncertainty in geologic data. MODFLOW 2000 is used to calculate both the ground water head and the sensitivity of head to changes in input data. From a limited number of samples, geologic data are extrapolated and their associated uncertainties are computed through a conditional probability calculation. Combining the spatially related sensitivity and input uncertainty produces the variance-covariance matrix, the diagonal of which is used to yield the standard deviation in MODFLOW 2000 head. The variance in piezometric head can be used for calibrating the model, estimating confidence intervals, directing exploration, and evaluating the reliability of a design. A case study illustrates the approach, where aquifer transmissivity is the spatially related uncertain geologic input data. The FOSM methodology is shown to be applicable for calculating output uncertainty for (1) spatially related input and output data, and (2) multiple input parameters (transmissivity and recharge).

  14. Compressive sensing based wireless sensor for structural health monitoring

    NASA Astrophysics Data System (ADS)

    Bao, Yuequan; Zou, Zilong; Li, Hui

    2014-03-01

    Data loss is a common problem for monitoring systems based on wireless sensors. Reliable communication protocols, which enhance communication reliability by repetitively transmitting unreceived packets, is one approach to tackle the problem of data loss. An alternative approach allows data loss to some extent and seeks to recover the lost data from an algorithmic point of view. Compressive sensing (CS) provides such a data loss recovery technique. This technique can be embedded into smart wireless sensors and effectively increases wireless communication reliability without retransmitting the data. The basic idea of CS-based approach is that, instead of transmitting the raw signal acquired by the sensor, a transformed signal that is generated by projecting the raw signal onto a random matrix, is transmitted. Some data loss may occur during the transmission of this transformed signal. However, according to the theory of CS, the raw signal can be effectively reconstructed from the received incomplete transformed signal given that the raw signal is compressible in some basis and the data loss ratio is low. This CS-based technique is implemented into the Imote2 smart sensor platform using the foundation of Illinois Structural Health Monitoring Project (ISHMP) Service Tool-suite. To overcome the constraints of limited onboard resources of wireless sensor nodes, a method called random demodulator (RD) is employed to provide memory and power efficient construction of the random sampling matrix. Adaptation of RD sampling matrix is made to accommodate data loss in wireless transmission and meet the objectives of the data recovery. The embedded program is tested in a series of sensing and communication experiments. Examples and parametric study are presented to demonstrate the applicability of the embedded program as well as to show the efficacy of CS-based data loss recovery for real wireless SHM systems.

  15. Beam-based calibrations of the BPM offset at C-ADS Injector II

    NASA Astrophysics Data System (ADS)

    Chen, Wei-Long; Wang, Zhi-Jun; Feng, Chi; Dou, Wei-Ping; Tao, Yue; Jia, Huan; Wang, Wang-Sheng; Liu, Shu-Hui; He, Yuan

    2016-07-01

    Beam-based BPM offset calibration was carried out for Injector II at the C-ADS demonstration facility at the Institute of Modern Physics (IMP), Chinese Academy of Science (CAS). By using the steering coils integrated in the quadrupoles, the beam orbit can be effectively adjusted and BPM positions recorded at the Medium Energy Beam Transport of the Injector II Linac. The studies were done with a 2 mA, 2.1 MeV proton beam in pulsed mode. During the studies, the “null comparison method” was applied for the calibration. This method is less sensitive to errors compared with the traditional transmission matrix method. In addition, the quadrupole magnet’s center can also be calibrated with this method. Supported by National Natural Science Foundation of China (91426303, 11525523)

  16. In vitro growth of flat aragonite crystals between the layers of the insoluble organic matrix of the abalone Haliotis laevigata

    NASA Astrophysics Data System (ADS)

    Gries, Katharina I.; Heinemann, Fabian; Rosenauer, Andreas; Fritz, Monika

    2012-11-01

    Nacre of abalone shells consists of aragonite platelets and organic material, the so-called organic matrix. During the growth process of the shell the aragonite platelets grow into a scaffold formed by the organic matrix. In this work we tried to mimic this growth process by placing a piece of the insoluble organic matrix (which is a part of the organic matrix) of the abalone Haliotis laevigata in a crystallization device which was flowed through by CaCl2 and NaHCO3 solutions. Using this setup amongst others flat aragonite crystals grow on the insoluble organic matrix. When investigating these crystals in a transmission electron microscope it is possible to recognize similarities to the structure of nacre, like the formation of mineral bridges and growth between layers of the insoluble organic matrix. These similarities are presented in this paper.

  17. The Eclectic Simulator Program (ESP) Usage Guide.

    DTIC Science & Technology

    1980-05-01

    DataStorage and H-5.1 1-t- Transmission.) For example, the columns of a 3 x 3 matrix BMAT could be declared on an *INFORM card as: ’ INFORM 3 1 BMAT (1,J...but not the rows: *INFORM 1 3 BMAT (J, 1) $ because the data in a matrix row is not stored contiguously. In other words, BMAT (J, 1) is the starting...location for an array of the 3 next elements in storage, and since FORTRAN always stores a matrix such as BMAT by columns, a reference to BMAT (J, 1

  18. Planning and Analysis of Fractured Rock Injection Tests in the Cerro Brillador Underground Laboratory, Northern Chile

    NASA Astrophysics Data System (ADS)

    Fairley, J. P., Jr.; Oyarzún L, R.; Villegas, G.

    2015-12-01

    Early theories of fluid migration in unsaturated fractured rock hypothesized that matrix suction would dominate flow up to the point of matrix saturation. However, experiments in underground laboratories such as the ESF (Yucca Mountain, NV) have demonstrated that liquid water can migrate significant distances through fractures in an unsaturated porous medium, suggesting limited interaction between fractures and unsaturated matrix blocks and potentially rapid transmission of recharge to the sat- urated zone. Determining the conditions under which this rapid recharge may take place is an important factor in understanding deep percolation processes in arid areas with thick unsaturated zones. As part of an on-going, Fondecyt-funded project (award 11150587) to study mountain block hydrological processes in arid regions, we are plan- ning a series of in-situ fracture flow injection tests in the Cerro Brillador/Mina Escuela, an underground laboratory and teaching facility belonging to the Universidad la Serena, Chile. Planning for the tests is based on an analytical model and curve-matching method, originally developed to evaluate data from injection tests at Yucca Mountain (Fairley, J.P., 2010, WRR 46:W08542), that uses a known rate of liquid injection to a fracture (for example, from a packed-off section of borehole) and the observed rate of seepage discharging from the fracture to estimate effective fracture aperture, matrix sorptivity, fracture/matrix flow partitioning, and the wetted fracture/matrix interac- tion area between the injection and recovery points. We briefly review the analytical approach and its application to test planning and analysis, and describe the proposed tests and their goals.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Xiaojun; Lei, Guangtsai; Pan, Guangwen

    In this paper, the continuous operator is discretized into matrix forms by Galerkin`s procedure, using periodic Battle-Lemarie wavelets as basis/testing functions. The polynomial decomposition of wavelets is applied to the evaluation of matrix elements, which makes the computational effort of the matrix elements no more expensive than that of method of moments (MoM) with conventional piecewise basis/testing functions. A new algorithm is developed employing the fast wavelet transform (FWT). Owing to localization, cancellation, and orthogonal properties of wavelets, very sparse matrices have been obtained, which are then solved by the LSQR iterative method. This algorithm is also adaptive in thatmore » one can add at will finer wavelet bases in the regions where fields vary rapidly, without any damage to the system orthogonality of the wavelet basis functions. To demonstrate the effectiveness of the new algorithm, we applied it to the evaluation of frequency-dependent resistance and inductance matrices of multiple lossy transmission lines. Numerical results agree with previously published data and laboratory measurements. The valid frequency range of the boundary integral equation results has been extended two to three decades in comparison with the traditional MoM approach. The new algorithm has been integrated into the computer aided design tool, MagiCAD, which is used for the design and simulation of high-speed digital systems and multichip modules Pan et al. 29 refs., 7 figs., 6 tabs.« less

  20. Extremality of Gaussian quantum states.

    PubMed

    Wolf, Michael M; Giedke, Geza; Cirac, J Ignacio

    2006-03-03

    We investigate Gaussian quantum states in view of their exceptional role within the space of all continuous variables states. A general method for deriving extremality results is provided and applied to entanglement measures, secret key distillation and the classical capacity of bosonic quantum channels. We prove that for every given covariance matrix the distillable secret key rate and the entanglement, if measured appropriately, are minimized by Gaussian states. This result leads to a clearer picture of the validity of frequently made Gaussian approximations. Moreover, it implies that Gaussian encodings are optimal for the transmission of classical information through bosonic channels, if the capacity is additive.

  1. Analysis of photonic band gap in novel piezoelectric photonic crystal

    NASA Astrophysics Data System (ADS)

    Malar Kodi, A.; Doni Pon, V.; Joseph Wilson, K. S.

    2018-03-01

    The transmission properties of one-dimensional novel photonic crystal having silver-doped novel piezoelectric superlattice and air as the two constituent layers have been investigated by means of transfer matrix method. By changing the appropriate thickness of the layers and filling factor of nanocomposite system, the variation in the photonic band gap can be studied. It is found that the photonic band gap increases with the filling factor of the metal nanocomposite and with the thickness of the layer. These structures possess unique characteristics enabling one to operate as optical waveguides, selective filters, optical switches, integrated piezoelectric microactuators, etc.

  2. Microstructural evolution and magnetic properties of ultrafine solute-atom particles formed in a Cu75-Ni20-Fe5 alloy on isothermal annealing

    NASA Astrophysics Data System (ADS)

    Kim, Jun-Seop; Takeda, Mahoto; Bae, Dong-Sik

    2016-12-01

    Microstructural features strongly affect magnetism in nano-granular magnetic materials. In the present work we have investigated the relationship between the magnetic properties and the self-organized microstructure formed in a Cu75-Ni20-Fe5 alloy comprising ferromagnetic elements and copper atoms. High resolution transmission electron microscopy (HRTEM) observations showed that on isothermal annealing at 873 K, nano-scale solute (Fe,Ni)-rich clusters initially formed with a random distribution in the Cu-rich matrix. Superconducting quantum interference device (SQUID) measurements revealed that these ultrafine solute clusters exhibited super-spinglass and superparamagnetic states. On further isothermal annealing the precipitates evolved to cubic or rectangular ferromagnetic particles and aligned along the <100> directions of the copper-rich matrix. Electron energy-band calculations based on the first-principle Korringa-Kohn-Rostocker (KKR) method were also implemented to investigate both the electronic structure and the magnetic properties of the alloy. Inputting compositions obtained experimentally by scanning transmission electron microscopy-electron dispersive X-ray spectroscopy (STEM-EDS) analysis, the KKR calculation confirmed that ferromagnetic precipitates (of moment 1.07μB per atom) formed after annealing for 2 × 104 min. Magneto-thermogravimetric (MTG) analysis determined with high sensitivity the Curie temperatures and magnetic susceptibility above room temperature of samples containing nano-scale ferromagnetic particles.

  3. What happens to an acellular dermal matrix after implantation in the human body? A histological and electron microscopic study.

    PubMed

    Boháč, Martin; Danišovič, Ľuboš; Koller, Ján; Dragúňová, Jana; Varga, Ivan

    2018-01-22

    Acellular matrices are used for various purposes and they have been studied extensively for their potential roles in regenerating tissues or organs. The acellular matrix generates physiological cues that mimic the native tissue microenvironment. Acellular dermal matrix (ADM) is a soft connective tissue graft generated by a decellularization process that preserves the intact extracellular skin matrix. Upon implantation, this structure serves as a scaffold for donor-side cells to facilitate subsequent incorporation and revascularization. In breast reconstruction, ADM is used mainly for lower pole coverage and the shaping of a new breast. It helps control the positioning of the implant in the inframammary fold, and prevent the formation of contractile pseudocapsule around the breast implant. In this study, we provide a comprehensive histological description of ADM used for human breast reconstruction over the course of several months following implementation. Using immunohistochemical methods (a panel of 12 antibodies) coupled with optical and transmission electron microscopy, we confirmed that the original acellular dermal matrix became recolonized by fibroblasts and myofibroblasts, and also by various other free cells of the connective tissue (lymphocytes, macrophages and multinucleated giant cells, granulocytes, mast cells) after implantation into the patient's body. Within the implanted ADM, there was a relatively rapid ingrowth of blood vessels. Lymphatic vessels were only detected in one case 9 months after the implantation of the ADM. These results suggest that lymphangiogenesis is a longer process than angiogenesis.

  4. Secure and Energy-Efficient Data Transmission System Based on Chaotic Compressive Sensing in Body-to-Body Networks.

    PubMed

    Peng, Haipeng; Tian, Ye; Kurths, Jurgen; Li, Lixiang; Yang, Yixian; Wang, Daoshun

    2017-06-01

    Applications of wireless body area networks (WBANs) are extended from remote health care to military, sports, disaster relief, etc. With the network scale expanding, nodes increasing, and links complicated, a WBAN evolves to a body-to-body network. Along with the development, energy saving and data security problems are highlighted. In this paper, chaotic compressive sensing (CCS) is proposed to solve these two crucial problems, simultaneously. Compared with the traditional compressive sensing, CCS can save vast storage space by only storing the matrix generation parameters. Additionally, the sensitivity of chaos can improve the security of data transmission. Aimed at image transmission, modified CCS is proposed, which uses two encryption mechanisms, confusion and mask, and performs a much better encryption quality. Simulation is conducted to verify the feasibility and effectiveness of the proposed methods. The results show that the energy efficiency and security are strongly improved, while the storage space is saved. And the secret key is extremely sensitive, [Formula: see text] perturbation of the secret key could lead to a total different decoding, the relative error is larger than 100%. Particularly for image encryption, the performance of the modified method is excellent. The adjacent pixel correlation is smaller than 0.04 in different directions including horizontal, vertical, and diagonal; the entropy of the cipher image with a 256-level gray value is larger than 7.98.

  5. Modeling the formation of cell-matrix adhesions on a single 3D matrix fiber.

    PubMed

    Escribano, J; Sánchez, M T; García-Aznar, J M

    2015-11-07

    Cell-matrix adhesions are crucial in different biological processes like tissue morphogenesis, cell motility, and extracellular matrix remodeling. These interactions that link cell cytoskeleton and matrix fibers are built through protein clutches, generally known as adhesion complexes. The adhesion formation process has been deeply studied in two-dimensional (2D) cases; however, the knowledge is limited for three-dimensional (3D) cases. In this work, we simulate different local extracellular matrix properties in order to unravel the fundamental mechanisms that regulate the formation of cell-matrix adhesions in 3D. We aim to study the mechanical interaction of these biological structures through a three dimensional discrete approach, reproducing the transmission pattern force between the cytoskeleton and a single extracellular matrix fiber. This numerical model provides a discrete analysis of the proteins involved including spatial distribution, interaction between them, and study of the different phenomena, such as protein clutches unbinding or protein unfolding. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Spin wave steering in three-dimensional magnonic networks

    NASA Astrophysics Data System (ADS)

    Beginin, E. N.; Sadovnikov, A. V.; Sharaevskaya, A. Yu.; Stognij, A. I.; Nikitov, S. A.

    2018-03-01

    We report the concept of three-dimensional (3D) magnonic structures which are especially promising for controlling and manipulating magnon currents. The approach for fabrication of 3D magnonic crystals (MCs) and 3D magnonic networks is presented. A meander type ferromagnetic film grown at the top of the initially structured substrate can be a candidate for such 3D crystals. Using the finite element method, transfer matrix method, and micromagnetic simulations, we study spin-wave propagation in both isolated and coupled 3D MCs and reconstruct spin-wave dispersion and transmission response to elucidate the mechanism of magnonic bandgap formation. Our results show the possibility of the utilization of proposed structures for fabrication of a 3D magnonic network.

  7. Establishment of a multiplex real-time RT-PCR assay for rapid identification of H6 subtype avian influenza viruses.

    PubMed

    Yang, Fan; Wu, Haibo; Liu, Fumin; Lu, Xiangyun; Peng, Xiuming; Wu, Nanping

    2018-06-01

    The H6 subtype avian influenza viruses (AIVs) possess the capacity for zoonotic transmission from avian species to humans. Establishment of a specific, rapid and sensitive method to screen H6 AIVs is necessary. Based on the conserved domain of the matrix and H6 AIV hemagglutinin genes, two TaqMan minor-groove-binder probes and multiplex real-time RT-PCR primers were designed in this study. The multiplex real-time RT-PCR assay developed in this study had high specificity and repeatability and a detection limit of 30 copies per reaction. This rapid diagnostic method will be useful for clinical detection and surveillance of H6 AIVs in China.

  8. Interior radiances in optically deep absorbing media. 1: Exact solutions for one-dimensional model

    NASA Technical Reports Server (NTRS)

    Kattawar, G. W.; Plass, G. N.

    1973-01-01

    The exact solutions are obtained for a one dimensional model of a scattering and absorbing medium. The results are given for both the reflected and transmitted radiance for any arbitrary surface albedo as well as for the interior radiance. These same quantities are calculated by the matrix operator method. The relative error of the solutions is obtained by comparison with the exact solutions as well as by an error analysis of the equations. The importance of an accurate starting value for the reflection and transmission operators is shown. A fourth order Runge-Kutta method can be used to solve the differential equations satisfied by these operators in order to obtain such accurate starting values.

  9. Characterization of hybrid cobalt-porous silicon systems: protective effect of the Matrix in the metal oxidation

    PubMed Central

    2012-01-01

    In the present work, the characterization of cobalt-porous silicon (Co-PSi) hybrid systems is performed by a combination of magnetic, spectroscopic, and structural techniques. The Co-PSi structures are composed by a columnar matrix of PSi with Co nanoparticles embedded inside, as determined by Transmission Electron Microscopy (TEM). The oxidation state, crystalline structure, and magnetic behavior are determined by X-Ray Absorption Spectroscopy (XAS) and Alternating Gradient Field Magnetometry (AGFM). Additionally, the Co concentration profile inside the matrix has been studied by Rutherford Backscattering Spectroscopy (RBS). It is concluded that the PSi matrix can be tailored to provide the Co nanoparticles with extra protection against oxidation. PMID:22938050

  10. Identification and Quantification of Carbon Phases in Conversion Fuel for the Transient Reactor Test Facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steele, Robert; Mata, Angelica; Dunzik-Gougar, Mary Lou

    2016-06-01

    As part of an overall effort to convert US research reactors to low-enriched uranium (LEU) fuel use, a LEU conversion fuel is being designed for the Transient Reactor Test Facility (TREAT) at the Idaho National Laboratory. TREAT fuel compacts are comprised of UO2 fuel particles in a graphitic matrix material. In order to refine heat transfer modeling, as well as determine other physical and nuclear characteristics of the fuel, the amount and type of graphite and non-graphite phases within the fuel matrix must be known. In this study, we performed a series of complementary analyses, designed to allow detailed characterizationmore » of the graphite and phenolic resin based fuel matrix. Methods included Scanning Electron and Transmission Electron Microscopies, Raman spectroscopy, X-ray Diffraction, and Dual-Beam Focused Ion Beam Tomography. Our results indicate that no single characterization technique will yield all of the desired information; however, through the use of statistical and empirical data analysis, such as curve fitting, partial least squares regression, volume extrapolation and spectra peak ratios, a degree of certainty for the quantity of each phase can be obtained.« less

  11. Time-varying phononic crystals

    NASA Astrophysics Data System (ADS)

    Wright, Derek Warren

    The primary objective of this thesis was to gain a deeper understanding of acoustic wave propagation in phononic crystals, particularly those that include materials whose properties can be varied periodically in time. This research was accomplished in three ways. First, a 2D phononic crystal was designed, created, and characterized. Its properties closely matched those determined through simulation. The crystal demonstrated band gaps, dispersion, and negative refraction. It served as a means of elucidating the practicalities of phononic crystal design and construction and as a physical verification of their more interesting properties. Next, the transmission matrix method for analyzing 1D phononic crystals was extended to include the effects of time-varying material parameters. The method was then used to provide a closed-form solution for the case of periodically time-varying material parameters. Some intriguing results from the use of the extended method include dramatically altered transmission properties and parametric amplification. New insights can be gained from the governing equations and have helped to identify the conditions that lead to parametric amplification in these structures. Finally, 2D multiple scattering theory was modified to analyze scatterers with time-varying material parameters. It is shown to be highly compatible with existing multiple scattering theories. It allows the total scattered field from a 2D time-varying phononic crystal to be determined. It was shown that time-varying material parameters significantly affect the phononic crystal transmission spectrum, and this was used to switch an incident monochromatic wave. Parametric amplification can occur under certain circumstances, and this effect was investigated using the closed-form solutions provided by the new 1D method. The complexity of the extended methods grows logarithmically as opposed linearly with existing methods, resulting in superior computational complexity for large numbers of scatterers. Also, since both extended methods provide analytic solutions, they may give further insights into the factors that govern the behaviour of time-varying phononic crystals. These extended methods may now be used to design an active phononic crystal that could demonstrate new or enhanced properties.

  12. Diffusion in Brain Extracellular Space

    PubMed Central

    Syková, Eva; Nicholson, Charles

    2009-01-01

    Diffusion in the extracellular space (ECS) of the brain is constrained by the volume fraction and the tortuosity and a modified diffusion equation represents the transport behavior of many molecules in the brain. Deviations from the equation reveal loss of molecules across the blood-brain barrier, through cellular uptake, binding or other mechanisms. Early diffusion measurements used radiolabeled sucrose and other tracers. Presently, the real-time iontophoresis (RTI) method is employed for small ions and the integrative optical imaging (IOI) method for fluorescent macromolecules, including dextrans or proteins. Theoretical models and simulations of the ECS have explored the influence of ECS geometry, effects of dead-space microdomains, extracellular matrix and interaction of macromolecules with ECS channels. Extensive experimental studies with the RTI method employing the cation tetramethylammonium (TMA) in normal brain tissue show that the volume fraction of the ECS typically is about 20% and the tortuosity about 1.6 (i.e. free diffusion coefficient of TMA is reduced by 2.6), although there are regional variations. These parameters change during development and aging. Diffusion properties have been characterized in several interventions, including brain stimulation, osmotic challenge and knockout of extracellular matrix components. Measurements have also been made during ischemia, in models of Alzheimer's and Parkinson's diseases and in human gliomas. Overall, these studies improve our conception of ECS structure and the roles of glia and extracellular matrix in modulating the ECS microenvironment. Knowledge of ECS diffusion properties are valuable in contexts ranging from understanding extrasynaptic volume transmission to the development of paradigms for drug delivery to the brain. PMID:18923183

  13. A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew

    Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less

  14. A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

    DOE PAGES

    Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; ...

    2018-01-28

    Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less

  15. Microstructure characterization of Al matrix composite reinforced with Ti-6Al-4V meshes after compression by scanning electron microscope and transmission electron microscope.

    PubMed

    Guo, Q; Sun, D L; Han, X L; Cheng, S R; Chen, G Q; Jiang, L T; Wu, G H

    2012-02-01

    Compressive properties of Al matrix composite reinforced with Ti-6Al-4V meshes (TC4(m)/5A06 Al composite) under the strain rates of 10(-3)S(-1) and 1S(-1) at different temperature were measured and microstructure of composites after compression was characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM). Compressive strength decreased with the test temperature increased and the strain-rate sensitivity (R) of composite increased with the increasing temperature. SEM observations showed that grains of Al matrix were elongated severely along 45° direction (angle between axis direction and fracture surface) and TC4 fibres were sheared into several parts in composite compressed under the strain rate of 10(-3)S(-1) at 25°C and 250°C. Besides, amounts of cracks were produced at the interfacial layer between TC4 fibre and Al matrix and in (Fe, Mn)Al(6) phases. With the compressive temperature increasing to 400°C, there was no damage at the interfacial layer between TC4 fibre and Al matrix and in (Fe, Mn)Al(6) phases, while equiaxed recrystal grains with sizes about 10 μm at the original grain boundaries of Al matrix were observed. However, interface separation of TC4 fibres and Al matrix occurred in composite compressed under the strain rate of 1S(-1) at 250°C and 400°C. With the compressive temperature increasing from 25°C to 100°C under the strain rate of 10(-3) S(-1), TEM microstructure in Al matrix exhibited high density dislocations and slipping bands (25°C), polygonized dislocations and dynamic recovery (100°C), equiaxed recrystals with sizes below 500 μm (250°C) and growth of equiaxed recrystals (400°C), respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Comprehensive Deployment Method for Technical Characteristics Base on Multi-failure Modes Correlation Analysis

    NASA Astrophysics Data System (ADS)

    Zheng, W.; Gao, J. M.; Wang, R. X.; Chen, K.; Jiang, Y.

    2017-12-01

    This paper put forward a new method of technical characteristics deployment based on Reliability Function Deployment (RFD) by analysing the advantages and shortages of related research works on mechanical reliability design. The matrix decomposition structure of RFD was used to describe the correlative relation between failure mechanisms, soft failures and hard failures. By considering the correlation of multiple failure modes, the reliability loss of one failure mode to the whole part was defined, and a calculation and analysis model for reliability loss was presented. According to the reliability loss, the reliability index value of the whole part was allocated to each failure mode. On the basis of the deployment of reliability index value, the inverse reliability method was employed to acquire the values of technology characteristics. The feasibility and validity of proposed method were illustrated by a development case of machining centre’s transmission system.

  17. Geometric phase and o -mode blueshift in a chiral anisotropic medium inside a Fabry-Pérot cavity

    NASA Astrophysics Data System (ADS)

    Timofeev, Ivan V.; Gunyakov, Vladimir A.; Sutormin, Vitaly S.; Myslivets, Sergey A.; Arkhipkin, Vasily G.; Vetrov, Stepan Ya.; Lee, Wei; Zyryanov, Victor Ya.

    2015-11-01

    Anomalous spectral shift of transmission peaks is observed in a Fabry-Pérot cavity filled with a chiral anisotropic medium. The effective refractive index value resides out of the interval between the ordinary and the extraordinary refractive indices. The spectral shift is explained by contribution of a geometric phase. The problem is solved analytically using the approximate Jones matrix method, numerically using the accurate Berreman method, and geometrically using the generalized Mauguin-Poincaré rolling cone method. The o -mode blueshift is measured for a 4-methoxybenzylidene-4 '-n -butylaniline twisted-nematic layer inside the Fabry-Pérot cavity. The twist is electrically induced due to the homeoplanar-twisted configuration transition in an ionic-surfactant-doped liquid crystal layer. Experimental evidence confirms the validity of the theoretical model.

  18. Effects of poly (3-hydroxybutyrate-co-3-hydroxyvalerate) microparticles on morphological, mechanical, thermal, and barrier properties in thermoplastic potato starch films.

    PubMed

    Malmir, Sara; Montero, Belén; Rico, Maite; Barral, Luis; Bouza, Rebeca; Farrag, Yousof

    2018-08-15

    Biocomposites of potato starch/poly (3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) microparticles were prepared through the solvent casting method. Glycerol was used as a plasticizer. The effects of concentrations of PHBV microparticles as filler and glycerol on crystallinity behavior, surface morphology, dynamic mechanical properties, and thermal stability were studied. Humidity absorption and the water vapor transmission rate (WVTR) were investigated as well. Wide angle X-ray scattering (WAXS) patterns revealed that the plasticizing process occurred successfully. Scanning electron microscopy (SEM) micrographs exhibited good homogeneity of the surfaces for the biocomposites with a lower glycerol concentration. Dynamic mechanical analysis (DMA) results confirmed the reinforcing effect of PHBV microparticles inside the matrix. Thermogravimetric analysis (TGA) indicated that the presence of PHBV microparticles increased the thermal stability of the starch. Results of humidity absorption tests showed that the high hydrophilicity of the starch was reduced once the PHBV microparticles had been incorporated. Also, increasing PHBV microparticles reduced the water vapor transmission rate. However, samples with reduced glycerol content absorbed less humidity and showed a lower water vapor transmission rate. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Multichannel tunable filter properties of 1D magnetized ternary plasma photonic crystal in the presence of evanescent wave

    NASA Astrophysics Data System (ADS)

    Awasthi, Suneet Kumar; Panda, Ranjita; Shiveshwari, Laxmi

    2017-07-01

    The multichannel tunable filter properties of one-dimensional ternary plasma photonic crystal composed of magnetized plasma and lossless dielectric have been theoretically investigated using transfer matrix method in the microwave region. The proposed filters possess 2N - 2 comb-like sharp resonant peaks also called transmission channels for N > 1 in transmission spectra in the absence and presence of an external magnetic field. Due to the coupling between evanescent waves and propagating modes in plasma and dielectric layers, respectively, 2N - 2 transmission channels are found without the addition of any defect, enabling the structure to work as a multichannel filter. Next, the filter properties can be made tunable by the application of an external magnetic field, i.e., channel frequency can either be red or blue shifted depending upon the orientation of an external magnetic field. The number of channels and their positions can also be modulated by changing the number of periods (N) and the incident angle (θo), respectively, for both transverse electric (TE) and transverse magnetic (TM) modes besides other parameters such as plasma collision frequency, thickness of the plasma layer, plasma frequency, etc.

  20. Dielectric multilayer beam splitter with differential phase shift on transmission and reflection for division-of-amplitude photopolarimeter.

    PubMed

    Yuan, Wenjia; Shen, Weidong; Zhang, Yueguang; Liu, Xu

    2014-05-05

    Dielectric multilayer beam splitter with differential phase shift on transmission and reflection for division-of-amplitude photopolarimeter (DOAP) was presented for the first time to our knowledge. The optimal parameters for the beam splitter are Tp = 78.9%, Ts = 21.1% and Δr - Δt = π/2 at 532nm at an angle of incidence of 45°. Multilayer anti-reflection coating with low phase shift was applied to reduce the backside reflection. Different design strategies that can achieve all optimal targets at the wavelength were tested. Two design methods were presented to optimize the differential phase shift. The samples were prepared by ion beam sputtering (IBS). The experimental results show good agreement with those of the design. The ellipsometric parameters of samples were measured in reflection (ψr, Δr) = (26.5°, 135.1°) and (28.2°, 133.5°), as well as in transmission (ψt, Δt) = (62.5°, 46.1°) and (63.5°, 46°) at 532.6nm. The normalized determinant of instrument matrix to evaluate the performance of samples is respectively 0.998 and 0.991 at 532.6nm.

  1. One-dimensional pressure transfer models for acoustic-electric transmission channels

    NASA Astrophysics Data System (ADS)

    Wilt, K. R.; Lawry, T. J.; Scarton, H. A.; Saulnier, G. J.

    2015-09-01

    A method for modeling piezoelectric-based ultrasonic acoustic-electric power and data transmission channels is presented. These channels employ piezoelectric disk transducers to convey signals across a series of physical layers using ultrasonic waves. This model decomposes the mechanical pathway of the signal into individual ultrasonic propagation layers which are generally independent of the layer's adjacent domains. Each layer is represented by a two-by-two traveling pressure wave transfer matrix which relates the forward and reverse pressure waves on one side of the layer to the pressure waves on the opposite face, where each face is assumed to be in contact with a domain of arbitrary reference acoustic impedance. A rigorous implementation of ultrasonic beam spreading is introduced and implemented within applicable domains. Compatible pressure-wave models for piezoelectric transducers are given, which relate the electric voltage and current interface of the transducer to the pressure waves on one mechanical interface while also allowing for passive acoustic loading of the secondary mechanical interface. It is also shown that the piezoelectric model's electrical interface is compatible with transmission line parameters (ABCD-parameters), allowing for connection of electronic components and networks. The model is shown to be capable of reproducing the behavior of realistic physical channels.

  2. Preparation and characterization of CNTs/UHMWPE nanocomposites via a novel mixer under synergy of ultrasonic wave and extensional deformation.

    PubMed

    Yin, Xiaochun; Li, Sai; He, Guangjian; Feng, Yanhong; Wen, Jingsong

    2018-05-01

    In this work, design and development of a new melt mixing method and corresponding mixer for polymer materials were reported. Effects of ultrasonic power and sonication time on the carbon nanotubes (CNTs) filled ultra high molecular weight polyethylene (UHMWPE) nanocomposites were experimentally studied. Transmission Electron Microscopy images showed that homogeneous dispersion of CNTs in intractable UHMWPE matrix is successfully realized due to the synergetic effect of ultrasonic wave and extensional deformation without any aid of other additives or solvents. Differential scanning calorimetry results revealed an increase in crystallinity and crystallization rate due to the finer dispersion of the CNTs in the matrix which act as nucleating point. Composites' complex viscosity and storage modulus decreased sharply at first and then leveled off with the increase of sonication time or the ultrasonic power. The thermal stability and the tensile strength of the CNTs/UHMWPE nanocomposites improved by using this novel mixing method. This is the first method that combined the ultrasonic wave and the extensional deformation in which the elongation rate, sonication time and ultrasonic power can be adjusted simultaneously during mixing. The novel mixer offers several advantages such as environment-friendly, high mixing efficiency, self-cleaning and wide adaptability to materials. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Influence of Cd2+/S2- molar ratio and of different capping environments in the optical properties of CdS nanoparticles incorporated within a hybrid diureasil matrix

    NASA Astrophysics Data System (ADS)

    Gonçalves, Luis F. F. F.; Silva, Carlos J. R.; Kanodarwala, Fehmida K.; Stride, John A.; Pereira, Mario R.; Gomes, Maria J. M.

    2014-09-01

    The incorporation of CdS nanoparticles (NPs), as prepared through colloidal methods using reverse micelles, within diureasil hybrid organic-inorganic sol-gel matrices was investigated. Several experimental conditions, namely the influence of capping agent 3-mercaptopropyltrimethoxysilane (MPTMS) or the use of tetraethoxysilane (TEOS), were studied in order to assure the preservation of the original optical properties of colloidal CdS NPs after the incorporation of the NPs within the solid diureasil hybrid matrix. The diureasil matrix is based on a siliceous network cross linked through urea bonds to poly(oxyethylene)/poly(oxypropylene) (PEO/PPO) chains. The influence of the Cd2+/S2- molar ratio of the NPs in the stability and dispersion of the NPs within the diureasil matrix was also investigated. The obtained CdS doped hybrid matrix was characterized by absorption, steady-state and time-resolved photoluminescence (PL) spectroscopy and by transmission electron microscopy (TEM). The stability of the CdS NPs within the hybrid matrix showed to be dependent on the Cd2+/S2- molar ratio used in the synthesis of the NPs. The use of MPTMS proved to be crucial in the preservation of the original optical properties of the colloidal CdS NPs after the incorporation of the NPs within the hybrid matrix. The effect of MPTMS was in turn influenced by the Cd2+/S2- molar ratio employed in the synthesis of the CdS NPs. The use of MPTMS was less effective when Cd2+/S2- molar ratio equal to 0.5 was used. In the absence of MPTMS or TEOS larger NPs size distribution and clustering of the CdS NPs were obtained after the transfer of the NPs into the hybrid matrix.

  4. Fractional flow in fractured chalk; a flow and tracer test revisited.

    PubMed

    Odling, N E; West, L J; Hartmann, S; Kilpatrick, A

    2013-04-01

    A multi-borehole pumping and tracer test in fractured chalk is revisited and reinterpreted in the light of fractional flow. Pumping test data analyzed using a fractional flow model gives sub-spherical flow dimensions of 2.2-2.4 which are interpreted as due to the partially penetrating nature of the pumped borehole. The fractional flow model offers greater versatility than classical methods for interpreting pumping tests in fractured aquifers but its use has been hampered because the hydraulic parameters derived are hard to interpret. A method is developed to convert apparent transmissivity and storativity (L(4-n)/T and S(2-n)) to conventional transmissivity and storativity (L2/T and dimensionless) for the case where flow dimension, 2

  5. The use of sodium trimetaphosphate as a biomimetic analog of matrix phosphoproteins for remineralization of artificial caries-like dentin

    PubMed Central

    Liu, Yan; Li, Nan; Qi, Yipin; Niu, Li-na; Elshafiy, Sally; Mao, Jing; Breschi, Lorenzo; Pashley, David H.; Tay, Franklin R.

    2011-01-01

    Objectives This study examined the use of sodium trimetaphosphate (STMP) as a biomimetic analog of matrix phosphoproteins for remineralization of artificial carious-affected dentin. Methods Artificial carious lesions with lesion depths of 300±30 µm were created by pH-cycling. 2.5% hydrolyzed STMP was applied to the artificial carious lesions to phosphorylate the partially-demineralized collagen matrix. Half of the STMP-treated specimens were bonded with One-Step. The adhesive and non-adhesive infiltrated specimens were remineralized in a Portland cement-simulated body fluid system containing polyacrylic acid (PAA) to stabilize amorphous calcium phosphate as nanoprecursors. Micro-computed tomography (micro-CT) and transmission electron microscopy (TEM) were used to evaluate the results of remineralization after a 4-month period. Results In absence of PAA and STMP as biomimetic analogs (control groups), there was no remineralization irrespective of whether the lesions were infiltrated with adhesive. For the STMP-treated experimental groups immersed in PAA-containing simulated body fluid, specimens without adhesive infiltration were more heavily remineralized than those infiltrated with adhesive. Statistical analysis of the 4-month micro-CT data revealed significant differences in the lesion depth, relative mineral content along the lesion surface and changes in ΔZ between the non-adhesive and adhesive experimental groups (p<0.05 for all the three parameters). TEM examination indicated that collagen degradation occurred in both the non-adhesive and adhesive control and experimental groups after 4 months of remineralization. Significance Biomimetic remineralization using STMP is a promising method to remineralize artificial carious lesions particularly in areas devoid of seed crystallites. Future studies should consider the incorporation of MMP-inhibitors within the partially-demineralized collagen matrix to prevent collagen degradation during remineralization. PMID:21354608

  6. Novel method of optical image registration in wide wavelength range using matrix of piezoelectric crystals

    NASA Astrophysics Data System (ADS)

    Pigarev, Aleksey V.; Bazarov, Timur O.; Fedorov, Vladimir V.; Ryabushkin, Oleg A.

    2018-02-01

    Most modern systems of the optical image registration are based on the matrices of photosensitive semiconductor heterostructures. However, measurement of radiation intensities up to several MW/cm2 -level using such detectors is a great challenge because semiconductor elements have low optical damage threshold. Reflecting or absorbing filters that can be used for attenuation of radiation intensity, as a rule, distort beam profile. Furthermore, semiconductor based devices have relatively narrow measurement wavelength bandwidth. We introduce a novel matrix method of optical image registration. This approach doesn't require any attenuation when measuring high radiation intensities. A sensitive element is the matrix made of thin transparent piezoelectric crystals that absorb just a small part of incident optical power. Each crystal element has its own set of intrinsic (acoustic) vibration modes. These modes can be exited due to the inverse piezoelectric effect when the external electric field is applied to the crystal sample providing that the field frequency corresponds to one of the vibration mode frequencies. Such piezoelectric resonances (PR) can be observed by measuring the radiofrequency response spectrum of the crystal placed between the capacitor plates. PR frequencies strongly depend on the crystal temperature. Temperature calibration of PR frequencies is conducted in the uniform heating conditions. In the case a crystal matrix is exposed to the laser radiation the incident power can be obtained separately for each crystal element by measuring its PR frequency kinetics providing that the optical absorption coefficient is known. The operating wavelength range of such sensor is restricted by the transmission bandwidth of the applied crystals. A plane matrix constituting of LiNbO3 crystals was assembled in order to demonstrate the possibility of application of the proposed approach. The crystal elements were placed between two electrodes forming a capacitor which was interconnected to the lock-in detection system. The radiofrequency response to the applied voltage from the generator was measured simultaneously for all elements.

  7. Side-branch resonators modelling with Green's function methods

    NASA Astrophysics Data System (ADS)

    Perrey-Debain, E.; Maréchal, R.; Ville, J. M.

    2014-09-01

    This paper deals with strategies for computing efficiently the propagation of sound waves in ducts containing passive components. In many cases of practical interest, these components are acoustic cavities which are connected to the duct. Though standard Finite Element software could be used for the numerical prediction of sound transmission through such a system, the method is known to be extremely demanding, both in terms of data preparation and computation, especially in the mid-frequency range. To alleviate this, a numerical technique that exploits the benefit of the FEM and the BEM approach has been devised. First, a set of eigenmodes is computed in the cavity to produce a numerical impedance matrix connecting the pressure and the acoustic velocity on the duct wall interface. Then an integral representation for the acoustic pressure in the main duct is used. By choosing an appropriate Green's function for the duct, the integration procedure is limited to the duct-cavity interface only. This allows an accurate computation of the scattering matrix of such an acoustic system with a numerical complexity that grows very mildly with the frequency. Typical applications involving Helmholtz and Herschel-Quincke resonators are presented.

  8. Enhanced mechanical properties of hydrothermal carbamated cellulose nanocomposite film reinforced with graphene oxide.

    PubMed

    Gan, Sinyee; Zakaria, Sarani; Syed Jaafar, Sharifah Nabihah

    2017-09-15

    Cellulose carbamate (CC) was synthesized via hydrothermal process and mixed with graphene oxide (GO) to form a homogeneous cellulose matrix nanocomposite films. The properties of CC/GO nanocomposite films fabricated using simple solution-mixing method with different GO loadings were studied. Transmission electron microscope analysis showed the exfoliation of self-synthesized GO nanosheets within the CC matrix. X-ray diffraction results confirmed the crystalline structure of CC/GO films as the CC/GO mass ratio increased from 100/0 to 100/4. The mechanical properties of CC/GO film were significantly improved as compared to neat CC film. From thermogravimetric analysis result, the introduction of GO enhanced the thermal stability and carbon yields. The 3D homogeneous porous structures of the CC/GO films were observed under Field emission scanning electron microscope. These improvements in nanocomposite film properties could be confirmed by Fourier transform infrared spectroscopy due to the strong and good interactions between CC and GO. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. In situ analysis of the organic framework in the prismatic layer of mollusc shell.

    PubMed

    Tong, Hua; Hu, Jiming; Ma, Wentao; Zhong, Guirong; Yao, Songnian; Cao, Nianxing

    2002-06-01

    A novel in situ analytic approach was constructed by means of ion sputtering, decalcification and deprotein techniques combining with scanning electron microscopy (SEM) and transmission electron microscope (TEM) ultrastructural analysis. The method was employed to determine the spatial distribution of the organic framework outside and the inner crystal and organic/inorganic interface spatial geometrical relationship in the prismatic layer of cristaris plicate (leach). The results show that there is a substructure of organic matrix in the intracrystalline region. The prismatic layer forms according to strict hierarchical configuration of regular pattern. Each unit of organic template of prismatic layer can uniquely determine the column crystal growth direction, spatial orientation and size. Cavity templates are responsible for supporting. limiting size and shape and determining the crystal growth spatial orientation, while the intracrystal organic matrix is responsible for providing nucleation point and inducing the nucleation process of calcite. The stereo hierarchical fabrication of prismatic layer was elucidated for the first time.

  10. Enhanced metal loading in SBA-15-type catalysts facilitated by salt addition. Synthesis, characterization and catalytic epoxide alcoholysis activity of molybdenum incorporated porous silica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Budhi, Sridhar; Peeraphatdit, Chorthip; Pylypenko, Svitlana

    2014-02-07

    We report a novel method to increase the metal loading in SBA-15 silica matrix via direct synthesis. It was demonstrated through the synthesis and characterization of a series of molybdenum containing SBA-15 mesoporous silica catalysts prepared with and without diammonium hydrogen phosphate (DHP) as an additive. Catalysts prepared with DHP show a 2–3 times increase in incorporation of molybdenum in the silica matrix and pore size enlargement. The synthesized catalysts were characterized using nitrogen sorption, X-ray diffraction (XRD), Raman spectroscopy, scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and inductively coupled plasma–optical emission spectroscopy (ICP–OES). Themore » catalytic activity of catalysts prepared with DHP for alcoholysis of epoxides was superior than the catalyst prepared without DHP. Alcoholysis of epoxides was demonstrated for a range of alcohols and epoxides under ambient conditions in as little as 30 min with high selectivity.« less

  11. Study of the sodium phenytoin effect on the formation of sol-gel SiO 2 nanotubes by TEM

    NASA Astrophysics Data System (ADS)

    López, T.; Asomoza, M.; Picquart, M.; Castillo-Ocampo, P.; Manjarrez, J.; Vázquez, A.; Ascencio, J. A.

    2005-04-01

    Microencapsulation is a versatile technology that allows controlling the release of different active molecules. Recently the sol-gel process has emerged like a promising method to immobilization and stabilization of biologically active compounds like enzymes, antigens, microorganisms and drugs. Porous silica and titanium dioxide materials made by low temperature sol-gel processes are promising host matrixes for encapsulation of biological molecules. The preparation of a low-temperature silica sol followed by gelation to neutral pH with water for injection containing the antiepileptic drug is reported here. The structure is very important so the analysis of the new developed material is also reported. Particularly interesting is the presence of nanotubes and microtubes, produced in the inorganic matrix in the presence of the sodium phenytoin. The use of transmission electron microscopy and quantum mechanics molecular simulation allows determining a micelle-like effect during the synthesis of these materials, which controls the size, structure and stability of them.

  12. Artificial dispersion via high-order homogenization: magnetoelectric coupling and magnetism from dielectric layers

    PubMed Central

    Liu, Yan; Guenneau, Sébastien; Gralak, Boris

    2013-01-01

    We investigate a high-order homogenization (HOH) algorithm for periodic multi-layered stacks. The mathematical tool of choice is a transfer matrix method. Expressions for effective permeability, permittivity and magnetoelectric coupling are explored by frequency power expansions. On the physical side, this HOH uncovers a magnetoelectric coupling effect (odd-order approximation) and artificial magnetism (even-order approximation) in moderate contrast photonic crystals. Comparing the effective parameters' expressions of a stack with three layers against that of a stack with two layers, we note that the magnetoelectric coupling effect vanishes while the artificial magnetism can still be achieved in a centre-symmetric periodic structure. Furthermore, we numerically check the effective parameters through the dispersion law and transmission property of a stack with two dielectric layers against that of an effective bianisotropic medium: they are in good agreement throughout the low-frequency (acoustic) band until the first stop band, where the analyticity of the logarithm function of the transfer matrix () breaks down. PMID:24101891

  13. Synthesis and characterization of CdS/PVA nanocomposite films

    NASA Astrophysics Data System (ADS)

    Wang, Hongmei; Fang, Pengfei; Chen, Zhe; Wang, Shaojie

    2007-08-01

    A series CdS/PVA nanocomposite films with different amount of Cd salt have been prepared by means of the in situ synthesis method via the reaction of Cd 2+-dispersed poly vinyl-alcohol (PVA) with H 2S. The as-prepared films were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), ultraviolet-visible (UV-vis) absorption, photoluminescence (PL) spectra, Fourier transform infrared spectroscope (FTIR) and thermogravimetric analysis (TGA). The XRD results indicated the formation of CdS nanoparticles with hexagonal phase in the PVA matrix. The primary FTIR spectra of CdS/PVA nanocomposite in different processing stages have been discussed. The vibrational absorption peak of Cd sbnd S bond at 405 cm -1 was observed, which further testified the generation of CdS nanoparticles. The TGA results showed incorporation of CdS nanoparticles significantly altered the thermal properties of PVA matrix. The photoluminescence and UV-vis spectroscopy revealed that the CdS/PVA films showed quantum confinement effect.

  14. Intrasystem Analysis Program (IAP) code summaries

    NASA Astrophysics Data System (ADS)

    Dobmeier, J. J.; Drozd, A. L. S.; Surace, J. A.

    1983-05-01

    This report contains detailed descriptions and capabilities of the codes that comprise the Intrasystem Analysis Program. The four codes are: Intrasystem Electromagnetic Compatibility Analysis Program (IEMCAP), General Electromagnetic Model for the Analysis of Complex Systems (GEMACS), Nonlinear Circuit Analysis Program (NCAP), and Wire Coupling Prediction Models (WIRE). IEMCAP is used for computer-aided evaluation of electromagnetic compatibility (ECM) at all stages of an Air Force system's life cycle, applicable to aircraft, space/missile, and ground-based systems. GEMACS utilizes a Method of Moments (MOM) formalism with the Electric Field Integral Equation (EFIE) for the solution of electromagnetic radiation and scattering problems. The code employs both full matrix decomposition and Banded Matrix Iteration solution techniques and is expressly designed for large problems. NCAP is a circuit analysis code which uses the Volterra approach to solve for the transfer functions and node voltage of weakly nonlinear circuits. The Wire Programs deal with the Application of Multiconductor Transmission Line Theory to the Prediction of Cable Coupling for specific classes of problems.

  15. X-ray peak broadening analysis of AA 6061{sub 100-x} - x wt.% Al{sub 2}O{sub 3} nanocomposite prepared by mechanical alloying

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sivasankaran, S., E-mail: sivasankarangs1979@gmail.com; Sivaprasad, K., E-mail: ksp@nitt.edu; Narayanasamy, R., E-mail: narayan@nitt.edu

    2011-07-15

    Nanocrystalline AA 6061 alloy reinforced with alumina (0, 4, 8, and 12 wt.%) in amorphized state composite powder was synthesized by mechanical alloying and consolidated by conventional powder metallurgy route. The as-milled and as-sintered (573 K and 673 K) nanocomposites were characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The peaks corresponding to fine alumina was not observed by XRD patterns due to amorphization. Using high-resolution transmission electron microscope, it is confirmed that the presence of amorphized alumina observed in Al lattice fringes. The crystallite size, lattice strain, deformation stress, and strain energy density of AA 6061 matrixmore » were determined precisely from the first five most intensive reflection of XRD using simple Williamson-Hall models; uniform deformation model, uniform stress deformation model, and uniform energy density deformation model. Among the developed models, uniform energy density deformation model was observed to be the best fit and realistic model for mechanically alloyed powders. This model evidenced the more anisotropic nature of the ball milled powders. The XRD peaks of as-milled powder samples demonstrated a considerable broadening with percentage of reinforcement due to grain refinement and lattice distortions during same milling time (40 h). The as-sintered (673 K) unreinforced AA 6061 matrix crystallite size from well fitted uniform energy density deformation model was 98 nm. The as-milled and as-sintered (673 K) nanocrystallite matrix sizes for 12 wt.% Al{sub 2}O{sub 3} well fitted by uniform energy density deformation model were 38 nm and 77 nm respectively, which indicate that the fine Al{sub 2}O{sub 3} pinned the matrix grain boundary and prevented the grain growth during sintering. Finally, the lattice parameter of Al matrix in as-milled and as-sintered conditions was also investigated in this paper. Research highlights: {yields} Integral breadth methods using various Williamson-Hall models were investigated for line profile analysis. {yields} Uniform energy density deformation model is observed to the best realistic model. {yields} The present analysis is used for understanding the stress and the strain present in the nanocomposites.« less

  16. Nonreciprocal optical isolation via graphene based photonic crystals

    NASA Astrophysics Data System (ADS)

    Roshan Entezar, S.; Karimi Habil, M.

    2018-03-01

    The transmission properties of a one-dimensional photonic crystal containing graphene mono-layers are studied using the transfer matrix method. It is shown that the structure can be used as a polarization-selective nonreciprocal device which discriminates between the two circularly polarized waves with different handedness impinging in the same direction. This structure may be utilized in designing optical isolators for the circularly polarized waves due to the gyrotropic behavior of the graphene mono-layers under the perpendicularly applied external magnetic field. Moreover, the effect of an external magnetic field and the chemical potential of the graphene mono-layers on the band gap of the structure are investigated.

  17. New insights on ion track morphology in pyrochlores by aberration corrected scanning transmission electron microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sachan, Ritesh; Zhang, Yanwen; Ou, Xin

    Here we demonstrate the enhanced imaging capabilities of an aberration corrected scanning transmission electron microscope to advance the understanding of ion track structure in pyrochlore structured materials (i.e., Gd 2Ti 2O 7 and Gd 2TiZrO 7). Track formation occurs due to the inelastic transfer of energy from incident ions to electrons, and atomic-level details of track morphology as a function of energy-loss are revealed in the present work. A comparison of imaging details obtained by varying collection angles of detectors is discussed in the present work. A quantitative analysis of phase identification using high-angle annular dark field imaging is performedmore » on the ion tracks. Finally, a novel 3-dimensional track reconstruction method is provided that is based on depth dependent imaging of the ion tracks. The technique is used in extracting the atomic-level details of nanoscale features, such as the disordered ion tracks, which are embedded in relatively thicker matrix. Another relevance of the method is shown by measuring the tilt of the ion tracks relative to the electron beam incidence that helps in knowing the structure and geometry of ion tracks quantitatively.« less

  18. New insights on ion track morphology in pyrochlores by aberration corrected scanning transmission electron microscopy

    DOE PAGES

    Sachan, Ritesh; Zhang, Yanwen; Ou, Xin; ...

    2016-12-13

    Here we demonstrate the enhanced imaging capabilities of an aberration corrected scanning transmission electron microscope to advance the understanding of ion track structure in pyrochlore structured materials (i.e., Gd 2Ti 2O 7 and Gd 2TiZrO 7). Track formation occurs due to the inelastic transfer of energy from incident ions to electrons, and atomic-level details of track morphology as a function of energy-loss are revealed in the present work. A comparison of imaging details obtained by varying collection angles of detectors is discussed in the present work. A quantitative analysis of phase identification using high-angle annular dark field imaging is performedmore » on the ion tracks. Finally, a novel 3-dimensional track reconstruction method is provided that is based on depth dependent imaging of the ion tracks. The technique is used in extracting the atomic-level details of nanoscale features, such as the disordered ion tracks, which are embedded in relatively thicker matrix. Another relevance of the method is shown by measuring the tilt of the ion tracks relative to the electron beam incidence that helps in knowing the structure and geometry of ion tracks quantitatively.« less

  19. Dynamics of a split torque helicopter transmission

    NASA Astrophysics Data System (ADS)

    Krantz, Timothy L.

    1994-06-01

    Split torque designs, proposed as alternatives to traditional planetary designs for helicopter main rotor transmissions, can save weight and be more reliable than traditional designs. This report presents the results of an analytical study of the system dynamics and performance of a split torque gearbox that uses a balance beam mechanism for load sharing. The Lagrange method was applied to develop a system of equations of motion. The mathematical model includes time-varying gear mesh stiffness, friction, and manufacturing errors. Cornell's method for calculating the stiffness of spur gear teeth was extended and applied to helical gears. The phenomenon of sidebands spaced at shaft frequencies about gear mesh fundamental frequencies was simulated by modeling total composite gear errors as sinusoid functions. Although the gearbox has symmetric geometry, the loads and motions of the two power paths differ. Friction must be considered to properly evaluate the balance beam mechanism. For the design studied, the balance beam is not an effective device for load sharing unless the coefficient of friction is less than 0.003. The complete system stiffness as represented by the stiffness matrix used in this analysis must be considered to precisely determine the optimal tooth indexing position.

  20. Dynamics of a split torque helicopter transmission. M.S. Thesis - Cleveland State Univ.

    NASA Technical Reports Server (NTRS)

    Krantz, Timothy L.

    1994-01-01

    Split torque designs, proposed as alternatives to traditional planetary designs for helicopter main rotor transmissions, can save weight and be more reliable than traditional designs. This report presents the results of an analytical study of the system dynamics and performance of a split torque gearbox that uses a balance beam mechanism for load sharing. The Lagrange method was applied to develop a system of equations of motion. The mathematical model includes time-varying gear mesh stiffness, friction, and manufacturing errors. Cornell's method for calculating the stiffness of spur gear teeth was extended and applied to helical gears. The phenomenon of sidebands spaced at shaft frequencies about gear mesh fundamental frequencies was simulated by modeling total composite gear errors as sinusoid functions. Although the gearbox has symmetric geometry, the loads and motions of the two power paths differ. Friction must be considered to properly evaluate the balance beam mechanism. For the design studied, the balance beam is not an effective device for load sharing unless the coefficient of friction is less than 0.003. The complete system stiffness as represented by the stiffness matrix used in this analysis must be considered to precisely determine the optimal tooth indexing position.

  1. Easy-to-use phylogenetic analysis system for hepatitis B virus infection.

    PubMed

    Sugiyama, Masaya; Inui, Ayano; Shin-I, Tadasu; Komatsu, Haruki; Mukaide, Motokazu; Masaki, Naohiko; Murata, Kazumoto; Ito, Kiyoaki; Nakanishi, Makoto; Fujisawa, Tomoo; Mizokami, Masashi

    2011-10-01

      The molecular phylogenetic analysis has been broadly applied to clinical and virological study. However, the appropriate settings and application of calculation parameters are difficult for non-specialists of molecular genetics. In the present study, the phylogenetic analysis tool was developed for the easy determination of genotypes and transmission route.   A total of 23 patients of 10 families infected with hepatitis B virus (HBV) were enrolled and expected to undergo intrafamilial transmission. The extracted HBV DNA were amplified and sequenced in a region of the S gene.   The software to automatically classify query sequence was constructed and installed on the Hepatitis Virus Database (HVDB). Reference sequences were retrieved from HVDB, which contained major genotypes from A to H. Multiple-alignments using CLUSTAL W were performed before the genetic distance matrix was calculated with the six-parameter method. The phylogenetic tree was output by the neighbor-joining method. User interface using WWW-browser was also developed for intuitive control. This system was named as the easy-to-use phylogenetic analysis system (E-PAS). Twenty-three sera of 10 families were analyzed to evaluate E-PAS. The queries obtained from nine families were genotype C and were located in one cluster per family. However, one patient of a family was classified into the cluster different from her family, suggesting that E-PAS detected the sample distinct from that of her family on the transmission route.   The E-PAS to output phylogenetic tree was developed since requisite material was sequence data only. E-PAS could expand to determine HBV genotypes as well as transmission routes. © 2011 The Japan Society of Hepatology.

  2. Electromagnetic-field amplification in finite one-dimensional photonic crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gorelik, V. S.; Kapaev, V. V., E-mail: kapaev@sci.lebedev.ru

    2016-09-15

    The electromagnetic-field distribution in a finite one-dimensional photonic crystal is studied using the numerical solution of Maxwell’s equations by the transfer-matrix method. The dependence of the transmission coefficient T on the period d (or the wavelength λ) has the characteristic form with M–1 (M is the number of periods in the structure) maxima with T = 1 in the allowed band of an infinite crystal and zero values in the forbidden band. The field-modulus distribution E(x) in the structure for parameters that correspond to the transmission maxima closest to the boundaries of forbidden bands has maxima at the center ofmore » the structure; the value at the maximum considerably exceeds the incident-field strength. For the number of periods M ~ 50, more than an order of magnitude increase in the field amplification is observed. The numerical results are interpreted with an analytic theory constructed by representing the solution in the form of a linear combination of counterpropagating Floquet modes in a periodic structure.« less

  3. Effects of superconducting film on the defect mode in dielectric photonic crystal heterostructure

    NASA Astrophysics Data System (ADS)

    Hu, Chung-An; Liu, Jia-Wei; Wu, Chien-Jang; Yang, Tzong-Jer; Yang, Su-Lin

    2013-03-01

    Effects of superconducting thin film on the defect mode in a dielectric photonic crystal heterostructure (PCH) are theoretically investigated. The considered structure is (12)NS(21)N, in which both layers 1 and 2 are dielectrics, layer S is a high-temperature superconducting layer, and N is the stack number. The defect mode is analyzed based on the transmission spectrum calculated by using the transfer matrix method. It is found that, in the normal incidence, the defect mode existing in the host PCH of (12)N(21)N will be blue-shifted as the thickness of layer S increases. In addition, the defect mode is also blue-shifted for both TE and TM modes in the case of oblique incidence. The embedded superconducting thin film plays the role of tuning agent for the defect mode of PCH. As a result, the proposed structure can be designed as a tunable narrowband transmission filter which could be of technical use in the optoelectronic applications.

  4. Mapping the dynamics of force transduction at cell–cell junctions of epithelial clusters

    PubMed Central

    Ng, Mei Rosa; Besser, Achim; Brugge, Joan S; Danuser, Gaudenz

    2014-01-01

    Force transduction at cell-cell adhesions regulates tissue development, maintenance and adaptation. We developed computational and experimental approaches to quantify, with both sub-cellular and multi-cellular resolution, the dynamics of force transmission in cell clusters. Applying this technology to spontaneously-forming adherent epithelial cell clusters, we found that basal force fluctuations were coupled to E-cadherin localization at the level of individual cell-cell junctions. At the multi-cellular scale, cell-cell force exchange depended on the cell position within a cluster, and was adaptive to reconfigurations due to cell divisions or positional rearrangements. Importantly, force transmission through a cell required coordinated modulation of cell-matrix adhesion and actomyosin contractility in the cell and its neighbors. These data provide insights into mechanisms that could control mechanical stress homeostasis in dynamic epithelial tissues, and highlight our methods as a resource for the study of mechanotransduction in cell-cell adhesions. DOI: http://dx.doi.org/10.7554/eLife.03282.001 PMID:25479385

  5. Construction of a new regular LDPC code for optical transmission systems

    NASA Astrophysics Data System (ADS)

    Yuan, Jian-guo; Tong, Qing-zhen; Xu, Liang; Huang, Sheng

    2013-05-01

    A novel construction method of the check matrix for the regular low density parity check (LDPC) code is proposed. The novel regular systematically constructed Gallager (SCG)-LDPC(3969,3720) code with the code rate of 93.7% and the redundancy of 6.69% is constructed. The simulation results show that the net coding gain (NCG) and the distance from the Shannon limit of the novel SCG-LDPC(3969,3720) code can respectively be improved by about 1.93 dB and 0.98 dB at the bit error rate (BER) of 10-8, compared with those of the classic RS(255,239) code in ITU-T G.975 recommendation and the LDPC(32640,30592) code in ITU-T G.975.1 recommendation with the same code rate of 93.7% and the same redundancy of 6.69%. Therefore, the proposed novel regular SCG-LDPC(3969,3720) code has excellent performance, and is more suitable for high-speed long-haul optical transmission systems.

  6. Microwave absorption properties of a wave-absorbing coating employing carbonyl-iron powder and carbon black

    NASA Astrophysics Data System (ADS)

    Liu, Lidong; Duan, Yuping; Ma, Lixin; Liu, Shunhua; Yu, Zhen

    2010-11-01

    To prevent serious electromagnetic interference, a single-layer wave-absorbing coating employing complex absorbents composed of carbonyl-iron powder (CIP) and carbon black (CB) with epoxy resin as matrix was prepared. The morphologies of CIP and CB were characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM), respectively. The electromagnetic parameters of CIP and CB were measured in the frequency range of 2-18 GHz by transmission/reflection technology, and the electromagnetic loss mechanisms of the two particles were discussed, respectively. The microwave absorption properties of the coatings were investigated by measuring reflection loss (RL) using arch method. The effects of CIP ratio, CB content and thickness on the microwave absorption properties were discussed, respectively. The results showed that the higher thickness, CIP or CB content could make the absorption band shift towards the lower frequency range. Significantly, the wave-absorbing coating could be applied in different frequency ranges according to actual demand by controlling the content of CIP or CB in composites.

  7. Multibands tunneling in AAA-stacked trilayer graphene

    NASA Astrophysics Data System (ADS)

    Redouani, Ilham; Jellal, Ahmed; Bahaoui, Abdelhadi; Bahlouli, Hocine

    2018-04-01

    We study the electronic transport through np and npn junctions for AAA-stacked trilayer graphene. Two kinds of gates are considered where the first is a single gate and the second is a double gate. After obtaining the solutions for the energy spectrum, we use the transfer matrix method to determine the three transmission probabilities for each individual cone τ = 0 , ± 1 . We show that the quasiparticles in AAA-stacked trilayer graphene are not only chiral but also labeled by an additional cone index τ. The obtained bands are composed of three Dirac cones that depend on the chirality indexes. We show that there is perfect transmission for normal or near normal incidence, which is a manifestation of the Klein tunneling effect. We analyze also the corresponding total conductance, which is defined as the sum of the conductance channels in each individual cone. Our results are numerically discussed and compared with those obtained for ABA- and ABC-stacked trilayer graphene.

  8. Design and Implementation of Secure and Reliable Communication using Optical Wireless Communication

    NASA Astrophysics Data System (ADS)

    Saadi, Muhammad; Bajpai, Ambar; Zhao, Yan; Sangwongngam, Paramin; Wuttisittikulkij, Lunchakorn

    2014-11-01

    Wireless networking intensify the tractability in the home and office environment to connect the internet without wires but at the cost of risks associated with stealing the data or threat of loading malicious code with the intention of harming the network. In this paper, we proposed a novel method of establishing a secure and reliable communication link using optical wireless communication (OWC). For security, spatial diversity based transmission using two optical transmitters is used and the reliability in the link is achieved by a newly proposed method for the construction of structured parity check matrix for binary Low Density Parity Check (LDPC) codes. Experimental results show that a successful secure and reliable link between the transmitter and the receiver can be achieved by using the proposed novel technique.

  9. Estimating reproduction numbers for adults and children from case data

    PubMed Central

    Glass, K.; Mercer, G. N.; Nishiura, H.; McBryde, E. S.; Becker, N. G.

    2011-01-01

    We present a method for estimating reproduction numbers for adults and children from daily onset data, using pandemic influenza A(H1N1) data as a case study. We investigate the impact of different underlying transmission assumptions on our estimates, and identify that asymmetric reproduction matrices are often appropriate. Under-reporting of cases can bias estimates of the reproduction numbers if reporting rates are not equal across the two age groups. However, we demonstrate that the estimate of the higher reproduction number is robust to disproportionate data-thinning. Applying the method to 2009 pandemic influenza H1N1 data from Japan, we demonstrate that the reproduction number for children was considerably higher than that of adults, and that our estimates are insensitive to our choice of reproduction matrix. PMID:21345858

  10. Fluctuations in an established transmission in the presence of a complex environment

    NASA Astrophysics Data System (ADS)

    Savin, Dmitry V.; Richter, Martin; Kuhl, Ulrich; Legrand, Olivier; Mortessagne, Fabrice

    2017-09-01

    In various situations where wave transport is preeminent, like in wireless communication, a strong established transmission is present in a complex scattering environment. We develop a nonperturbative approach to describe emerging fluctuations which combines a transmitting channel and a chaotic background in a unified effective Hamiltonian. Modeling such a background by random matrix theory, we derive exact results for both transmission and reflection distributions at arbitrary absorption that is typically present in real systems. Remarkably, in such a complex scattering situation, the transport is governed by only two parameters: an absorption rate and the ratio of the so-called spreading width to the natural width of the transmission line. In particular, we find that the established transmission disappears sharply when this ratio exceeds unity. The approach exemplifies the role of the chaotic background in dephasing the deterministic scattering.

  11. Synthesis and characterization of aluminium–alumina micro- and nano-composites by spark plasma sintering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dash, K., E-mail: khushbudash@gmail.com; Chaira, D.; Ray, B.C.

    Graphical abstract: The evolution of microstructure by varying the particle size of reinforcement in the matrix employing spark plasma sintering has been demonstrated here in Al–Al{sub 2}O{sub 3} system. An emphasis has been laid on varying the reinforcement particle size and evaluating the microstructural morphologies and their implications on mechanical performance of the composites. Nanocomposites of 0.5, 1, 3, 5, 7 volume % alumina (average size < 50 nm) reinforced in aluminium matrix were fabricated by powder metallurgy route using spark plasma sintering technique technique at a temperature of 773 K and pressure of 50 MPa. Another set of specimensmore » having composition 1, 5, 20 vol.% of alumina (average size ∼ 10 μm) had been fabricated to compare the physical as well as mechanical attributes of the microcomposite as well as the nanocomposites. These micro- and nano-composites have been characterized using X-ray diffraction, scanning electron microscopy and transmission electron microscopy followed by density, microhardness and nanoindentation measurements. The alumina nanoparticles revealed an interface showing appreciable physical intimacy with the aluminium matrix compared to that of the alumina microparticles. The interfacial integrity in case of nanocomposites is better than in the microcomposite which has been studied using microscopic techniques. Spark plasma sintering imparts enhanced densification as well as matrix-reinforcement proximity which has been corroborated with the experimental results. - Highlights: • The Al–Al{sub 2}O{sub 3} micro- and nano-composites fabricated by spark plasma sintering. • Better matrix-reinforcement integrity in nanocomposites than microcomposites. • Spark plasma sintering method results in higher density and hardness values. • High density and hardness values of nanocomposites than microcomposites. • High dislocation density in spark plasma sintered Al–Al{sub 2}O{sub 3} composites. - Abstract: In the present study, an emphasis has been laid on evaluation of the microstructural morphologies and their implications on mechanical performance of the composites by varying the reinforcement particle size. Nanocomposites of 0.5, 1, 3, 5, 7 volume % alumina (average size < 50 nm) and microcomposites of 1, 5, 20 volume % of alumina (average size ∼ 10 μm) reinforced in aluminium matrix were fabricated by spark plasma sintering technique at a temperature of 773 K and pressure of 50 MPa. These micro- and nano-composites have been characterized using X-ray diffraction, scanning electron microscopy and transmission electron microscopy followed by density, microhardness and nanoindentation hardness measurements. The alumina nanoparticles revealed appreciable physical intimacy with the aluminium matrix than that of alumina microparticles. The highest nanohardness recorded 0.85 GPa and 99% densification for 7 and 1 vol.% Al–Al{sub 2}O{sub 3} nancomposites respectively. Spark plasma sintering imparts enhanced densification and matrix-reinforcement proximity which have been corroborated with the experimental results.« less

  12. Rheological behaviour, mechanical properties and morphological aspects of thermoplastic polyurethane reinforced with multiwalled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Russo, Pietro; Acierno, Domenico; Spena, Paola

    2010-06-01

    Melt blended compounds based on a film grade thermoplastic polyurethane resin filled with relatively low contents of multiwalled carbon nanotubes have been investigated. Materials, prepared through the production of a masterbatch containing 3 wt% of nanotubes and subsequent dilution of the same by addition of matrix pellets, were analyzed in the form of tapes and films always taking the neat matrix, processed in the same conditions, as the reference. Improvements of the matrix extrudability and mechanical benefits showed for all investigated composite samples have been satisfactorily interpreted by morphological observations carried out in both transmission and scanning electron microscopy.

  13. In-situ high resolution transmission electron microscopy observation of silicon nanocrystal nucleation in a SiO{sub 2} bilayered matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, T. C.-J., E-mail: terry.yang@unsw.edu.au; Wu, L.; Lin, Z.

    2014-08-04

    Solid-state nucleation of Si nanocrystals in a SiO{sub 2} bilayered matrix was observed at temperatures as low as 450 °C. This was achieved by aberration corrected high-resolution transmission electron microscopy (HRTEM) with real-time in-situ heating up to 600 °C. This technique is a valuable characterization tool especially with the recent interest in Si nanostructures for light emitting devices, non-volatile memories, and third-generation photovoltaics which all typically require a heating step in their fabrication. The control of size, shape, and distribution of the Si nanocrystals are critical for these applications. This experimental study involves in-situ observation of the nucleation of Si nanocrystals inmore » a SiO{sub 2} bilayered matrix fabricated through radio frequency co-sputtering. The results show that the shapes of Si nanocrystals in amorphous SiO{sub 2} bilayered matrices are irregular and not spherical, in contrast to many claims in the literature. Furthermore, the Si nanocrystals are well confined within their layers by the amorphous SiO{sub 2}. This study demonstrates the potential of in-situ HRTEM as a tool to observe the real time nucleation of Si nanocrystals in a SiO{sub 2} bilayered matrix. Furthermore, ideas for improvements on this in-situ heating HRTEM technique are discussed.« less

  14. Computational segmentation of collagen fibers in bone matrix indicates bone quality in ovariectomized rat spine.

    PubMed

    Daghma, Diaa Eldin S; Malhan, Deeksha; Simon, Paul; Stötzel, Sabine; Kern, Stefanie; Hassan, Fathi; Lips, Katrin Susanne; Heiss, Christian; El Khassawna, Thaqif

    2018-05-01

    Bone loss varies according to disease and age and these variations affect bone cells and extracellular matrix. Osteoporosis rat models are widely investigated to assess mechanical and structural properties of bone; however, bone matrix proteins and their discrepant regulation of diseased and aged bone are often overlooked. The current study considered the spine matrix properties of ovariectomized rats (OVX) against control rats (Sham) at 16 months of age. Diseased bone showed less compact structure with inhomogeneous distribution of type 1 collagen (Col1) and changes in osteocyte morphology. Intriguingly, demineralization patches were noticed in the vicinity of blood vessels in the OVX spine. The organic matrix structure was investigated using computational segmentation of collagen fibril properties. In contrast to the aged bone, diseased bone showed longer fibrils and smaller orientation angles. The study shows the potential of quantifying transmission electron microscopy images to predict the mechanical properties of bone tissue.

  15. Microwave absorption properties of reduced graphene oxide strontium hexaferrite/poly(methyl methacrylate) composites

    NASA Astrophysics Data System (ADS)

    Acharya, Sanghamitra; Ray, J.; Patro, T. U.; Alegaonkar, Prashant; Datar, Suwarna

    2018-03-01

    The key factors to consider when designing microwave absorber materials for eradication of electromagnetic (EM) pollution are absorption of incident EM waves and good impedance matching. By keeping these things in mind, flexible microwave absorber composite films can be fabricated by simple gel casting techniques using reduced graphene oxide (RGO) and strontium ferrite (SF) in a poly(methyl methacrylate) (PMMA) matrix. SF nanoparticles are synthesized by the well known sol-gel method. Subsequently, reduced graphene oxide (RGO) and SF nanocomposite (RGOSF) are prepared through a chemical reduction method using hydrazine. The structure, morphology, chemical composition, thermal stability and magnetic properties of the nanocomposite are characterized in detail by various techniques. The SF particles are found to be nearly 500 nm and decorated on RGO sheets as revealed by field emission scanning electron microscopy and transmission electron microscopy analysis. Fourier transform infrared and and Raman spectroscopy clearly show the presence of SF in the graphene sheet by the lower peak positions. Finally, ternary polymer composites of RGO/SF/PMMA are prepared by an in situ polymerization method. Magnetic and dielectric studies of the composite reveal that the presence of RGO/SF/PMMA lead to polarization effects contributing to dielectric loss. Also, RGO surrounding SF provides a conductive network in the polymer matrix which is in turn responsible for the magnetic loss in the composite. Thus, the permittivity as well as the permeability of the composite can be controlled by an appropriate combination of RGO and SF in PMMA. More than 99% absorption efficiency is achieved by a suitable combination of magneto-dielectric coupling in the X-band frequency range by incorporating 9 wt% of RGO and 1 wt% of SF in the polymer matrix.

  16. Silica Coating of Nonsilicate Nanoparticles for Resin-Based Composite Materials

    PubMed Central

    Kaizer, M.R.; Almeida, J.R.; Gonçalves, A.P.R.; Zhang, Y.; Cava, S.S.; Moraes, R.R.

    2016-01-01

    This study was designed to develop and characterize a silica-coating method for crystalline nonsilicate ceramic nanoparticles (Al2O3, TiO2, and ZrO2). The hypothesis was that the coated nonsilicate nanoparticles would stably reinforce a polymeric matrix due to effective silanation. Silica coating was applied via a sol-gel method, with tetraethyl orthosilicate as a silica precursor, followed by heat treatment. The chemical and microstructural characteristics of the nanopowders were evaluated before and after silica coating through x-ray diffraction, BET (Brunauer-Emmett-Teller), energy-dispersive x-ray spectroscopy, field emission scanning electron microscopy, and transmission electron microscopy analyses. Coated and noncoated nanoparticles were silanated before preparation of hybrid composites, which contained glass microparticles in addition to the nanoparticles. The composites were mechanically tested in 4-point bending mode after aging (10,000 thermal cycles). Results of all chemical and microstructural analyses confirmed the successful obtaining of silica-coated nanoparticles. Two distinct aspects were observed depending on the type of nanoparticle tested: 1) formation of a silica shell on the surface of the particles and 2) nanoparticle clusters embedded into a silica matrix. The aged hybrid composites formulated with the coated nanoparticles showed improved flexural strength (10% to 30% higher) and work of fracture (35% to 40% higher) as compared with composites formulated with noncoated nanoparticles. The tested hypothesis was confirmed: silanated silica-coated nonsilicate nanoparticles yielded stable reinforcement of dimethacrylate polymeric matrix due to effective silanation. The silica-coating method presented here is a versatile and promising novel strategy for the use of crystalline nonsilicate ceramics as a reinforcing phase of polymeric composite biomaterials. PMID:27470069

  17. Oxide nanoparticles in an Al-alloyed oxide dispersion strengthened steel: crystallographic structure and interface with ferrite matrix

    NASA Astrophysics Data System (ADS)

    Zhang, Zhenbo; Pantleon, Wolfgang

    2017-07-01

    Oxide nanoparticles are quintessential for ensuring the extraordinary properties of oxide dispersion strengthened (ODS) steels. In this study, the crystallographic structure of oxide nanoparticles, and their interface with the ferritic steel matrix in an Al-alloyed ODS steel, i.e. PM2000, were systematically investigated by high-resolution transmission electron microscopy. The majority of oxide nanoparticles were identified to be orthorhombic YAlO3. During hot consolidation and extrusion, they develop a coherent interface and a near cuboid-on-cube orientation relationship with the ferrite matrix in the material. After annealing at 1200 °C for 1 h, however, the orientation relationship between the oxide nanoparticles and the matrix becomes arbitrary, and their interface mostly incoherent. Annealing at 1300 °C leads to considerable coarsening of oxide nanoparticles, and a new orientation relationship of pseudo-cube-on-cube between oxide nanoparticles and ferrite matrix develops. The reason for the developing interfaces and orientation relationships between oxide nanoparticles and ferrite matrix under different conditions is discussed.

  18. Influence of severe plastic deformation on intermetallic particles in Mg-12 wt.%Zn alloy investigated using transmission electron microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Němec, M., E-mail: nemecm@fzu.cz

    The in-depth microstructural characterization of intermetallic particles in an Mg-12 wt.%Zn binary alloy subjected to a severe plastic deformation is presented. The alloy was processed by four passes via equal channel angular pressing with an applied back pressure at a gradually decreasing temperature and analyzed using transmission electron microscopy techniques to observe the influence of processing on intermetallic particles. The results are compared with the initial state of the material prior to severe plastic deformation. The microstructural evolution of the α-Mg matrix and the Mg{sub 21}Zn{sub 25}, Mg{sub 51}Zn{sub 20} and MgZn{sub 2} was analyzed using bright field imaging, selectedmore » area electron diffraction, high-resolution transmission electron microscopy and high-angle annular dark field imaging in scanning mode. The plastic deformation process influenced the α-Mg matrix and each type of intermetallic particle. The α-Mg matrix consisted of two types of areas. The first type of area had a highly deformed structure, and the second type of area had a partially recrystallized structure with an average grain size of approximately 250 nm. The Mg{sub 21}Zn{sub 25} microparticles exhibited distinct forms in the α-Mg matrix that were characterized as a single-crystalline form, a nano-crystalline form and a broken up form. No evidence of Mg{sub 51}Zn{sub 20} nanoparticles within the α-Mg matrix was found in the microstructure, which indicates their dissolution or phase transformation during the deformation process. MgZn{sub 2} nanoparticles exhibited different behavior in both types of α-Mg matrix. Two orientation relationships toward the highly deformed α-Mg matrix were observed; however, there was no relationship toward the partially recrystallized α-Mg matrix. Additionally, the growth of the MgZn{sub 2} nanoparticles was different in the two types of α-Mg matrix. The Mg{sub 51}Zn{sub 20} nanoparticles inside Mg{sub 21}Zn{sub 25} microparticles exhibited a distinct behavior within the single-crystalline or nano-crystalline form of the parent Mg{sub 21}Zn{sub 25} microparticles. The Mg{sub 21}Zn{sub 25} + Mg{sub 51}Zn{sub 20} eutectic compound was confirmed for both forms of the parent Mg{sub 21}Zn{sub 25} microparticles, and the growth of Mg{sub 51}Zn{sub 20} nanoparticles is discussed. - Highlights: •Comprehensive microstructure characterization of Mg-12 wt.%Zn alloy after ECAP-BP •TEM analysis of changes of intermetallic phases caused by SPD •Mg{sub 21}Zn{sub 25} particles exhibit nano-crystalline regions with grain size below 100 nm. •MgZn{sub 2} preserved its orientation relationship toward highly deformed α-Mg after SPD. •Existence of Mg{sub 21}Zn{sub 25} + Mg{sub 51}Zn{sub 20} eutectic remained for each Mg{sub 21}Zn{sub 25} particle form.« less

  19. High Resolution Displays Using NCAP Liquid Crystals

    NASA Astrophysics Data System (ADS)

    Macknick, A. Brian; Jones, Phil; White, Larry

    1989-07-01

    Nematic curvilinear aligned phase (NCAP) liquid crystals have been found useful for high information content video displays. NCAP materials are liquid crystals which have been encapsulated in a polymer matrix and which have a light transmission which is variable with applied electric fields. Because NCAP materials do not require polarizers, their on-state transmission is substantially better than twisted nematic cells. All dimensional tolerances are locked in during the encapsulation process and hence there are no critical sealing or spacing issues. By controlling the polymer/liquid crystal morphology, switching speeds of NCAP materials have been significantly improved over twisted nematic systems. Recent work has combined active matrix addressing with NCAP materials. Active matrices, such as thin film transistors, have given displays of high resolution. The paper will discuss the advantages of NCAP materials specifically designed for operation at video rates on transistor arrays; applications for both backlit and projection displays will be discussed.

  20. Surface self-potential patterns related to transmissive fracture trends during a water injection test

    NASA Astrophysics Data System (ADS)

    DesRoches, A. J.; Butler, K. E.; MacQuarrie, K. TB

    2018-03-01

    Variations in self-potential (SP) signals were recorded over an electrode array during a constant head injection test in a fractured bedrock aquifer. Water was injected into a 2.2 m interval isolated between two inflatable packers at 44 m depth in a vertical well. Negative SP responses were recorded on surface corresponding to the start of the injection period with strongest magnitudes recorded in electrodes nearest the well. SP response decreased in magnitude at electrodes further from the well. Deflation of the packer system resulted in a strong reversal in the SP signal. Anomalous SP patterns observed at surface at steady state were found to be aligned with dominant fracture strike orientations found within the test interval. Numerical modelling of fluid and current flow within a simplified fracture network showed that azimuthal patterns in SP are mainly controlled by transmissive fracture orientations. The strongest SP gradients occur parallel to hydraulic gradients associated with water flowing out of the transmissive fractures into the tighter matrix and other less permeable cross-cutting fractures. Sensitivity studies indicate that increasing fracture frequency near the well increases the SP magnitude and enhances the SP anomaly parallel to the transmissive set. Decreasing the length of the transmissive fractures leads to more fluid flow into the matrix and into cross-cutting fractures proximal to the well, resulting in a more circular and higher magnitude SP anomaly. Results from the field experiment and modelling provide evidence that surface-based SP monitoring during constant head injection tests has the ability to identify groundwater flow pathways within a fractured bedrock aquifer.

  1. A fine-tuned vector-parasite dialogue in tsetse's cardia determines peritrophic matrix integrity and trypanosome transmission success

    PubMed Central

    Aksoy, Emre; Weiss, Brian L.; Zhao, Xin; Awuoche, Erick O.; Wu, Yineng; Aksoy, Serap

    2018-01-01

    Arthropod vectors have multiple physical and immunological barriers that impede the development and transmission of parasites to new vertebrate hosts. These barriers include the peritrophic matrix (PM), a chitinous barrier that separates the blood bolus from the midgut epithelia and modulates vector-pathogens interactions. In tsetse flies, a sleeve-like PM is continuously produced by the cardia organ located at the fore- and midgut junction. African trypanosomes, Trypanosoma brucei, must bypass the PM twice; first to colonize the midgut and secondly to reach the salivary glands (SG), to complete their transmission cycle in tsetse. However, not all flies with midgut infections develop mammalian transmissible SG infections—the reasons for which are unclear. Here, we used transcriptomics, microscopy and functional genomics analyses to understand the factors that regulate parasite migration from midgut to SG. In flies with midgut infections only, parasites fail to cross the PM as they are eliminated from the cardia by reactive oxygen intermediates (ROIs)—albeit at the expense of collateral cytotoxic damage to the cardia. In flies with midgut and SG infections, expression of genes encoding components of the PM is reduced in the cardia, and structural integrity of the PM barrier is compromised. Under these circumstances trypanosomes traverse through the newly secreted and compromised PM. The process of PM attrition that enables the parasites to re-enter into the midgut lumen is apparently mediated by components of the parasites residing in the cardia. Thus, a fine-tuned dialogue between tsetse and trypanosomes at the cardia determines the outcome of PM integrity and trypanosome transmission success. PMID:29614112

  2. Power systems locational marginal pricing in deregulated markets

    NASA Astrophysics Data System (ADS)

    Wang, Hui-Fung Francis

    Since the beginning of the 1990s, the electricity business is transforming from a vertical integrating business to a competitive market operations. The generation, transmission, distribution subsystem of an electricity utility are operated independently as Genco (generation subsystem), Transco (transmission subsystem), and Distco (distribution subsystem). This trend promotes more economical inter- and intra regional transactions to be made by the participating companies and the users of electricity to achieve the intended objectives of deregulation. There are various types of electricity markets that are implemented in the North America in the past few years. However, transmission congestion management becomes a key issue in the electricity market design as more bilateral transactions are traded across long distances competing for scarce transmission resources. It directly alters the traditional concept of energy pricing and impacts the bottom line, revenue and cost of electricity, of both suppliers and buyers. In this research, transmission congestion problem in a deregulated market environment is elucidated by implementing by the Locational Marginal Pricing (LMP) method. With a comprehensive understanding of the LMP method, new mathematical tools will aid electric utilities in exploring new business opportunities are developed and presented in this dissertation. The dissertation focuses on the development of concept of (LMP) forecasting and its implication to the market participants in deregulated market. Specifically, we explore methods of developing fast LMP calculation techniques that are differ from existing LMPs. We also explore and document the usefulness of the proposed LMP in determining electricity pricing of a large scale power system. The developed mathematical tools use of well-known optimization techniques such as linear programming that are support by several flow charts. The fast and practical security constrained unit commitment methods are the integral parts of the LMP algorithms. Different components of optimization techniques, unit commitment, power flow analysis, and matrix manipulations for large scale power systems are integrated and represented by several new flow charts. The LMP concept and processes, mathematical models, and their corresponding algorithms has been implemented to study a small six bus test power system/market and also the real size New York power system/market where the transmission congestion is high and electricity market is deregulated. The simulated results documented in the dissertation are satisfactory and produce very encouraging result when compared to the actual Located Based Marginal Price (LMP) results posted by the New York Independent System Operator (ISO). The further research opportunities inspired by this dissertation are also elaborated.

  3. Design of a Matrix Transducer for Three-Dimensional Second Harmonic Transesophageal Echocardiography

    NASA Astrophysics Data System (ADS)

    Blaak, Sandra; van Neer, Paul L. M. J.; Prins, Christian; Bosch, Johan G.; Lancée, Charles T.; van der Steen, Antonius F. W.; de Jong, Nico

    Three-dimensional (3D) echocardiography visualizes the 3D anatomy and function of the heart. For 3D imaging an ultrasound matrix of several thousands of elements is required. To connect the matrix to an external imaging system, smart signal processing with integrated circuitry in the tip of the TEE probe is required for channel reduction. To separate the low voltage integrated receive circuitry from the high voltages required for transmission, our design features a separate transmit and receive subarray. In this study we focus on the transmit subarray. A 3D model of an individual element was developed using the finite element method (FEM). The model was validated by laser interferometer and acoustic measurements. Measurement and simulations matched well. The maximum transmit transfer was 3 nm/V at 2.4 MHz for both the FEM simulation of an element in air and the laser interferometer measurement. The FEM simulation of an element in water resulted in a maximum transfer of 43 kPa/V at 2.3 MHz and the acoustic measurement in 55 kPa/V at 2.5 MHz. The maximum pressure is ~1 MPa/120Vpp, which is sufficient pressure for second harmonic imaging. The proposed design of the transmit subarray is suitable for its role in a 3D 2H TEE probe.

  4. Titanate nanotubes for reinforcement of a poly(ethylene oxide)/chitosan polymer matrix

    NASA Astrophysics Data System (ADS)

    Porras, R.; Bavykin, D. V.; Zekonyte, J.; Walsh, F. C.; Wood, R. J.

    2016-05-01

    Soft polyethylene oxide (PEO)/chitosan mixtures, reinforced with hard titanate nanotubes (TiNTs) by co-precipitation from aqueous solution, have been used to produce compact coatings by the ‘drop-cast’ method, using water soluble PEO polymer and stable, aqueous colloidal solutions of TiNTs. The effects of the nanotube concentration and their length on the hardness and modulus of the prepared composite have been studied using nanoindentation and nanoscratch techniques. The uniformity of TiNT dispersion within the polymer matrix has been studied using transmission electron microscopy (TEM). A remarkable increase in hardness and reduced Young’s modulus of the composites, compared to pure polymer blends, has been observed at a TiNT concentration of 25 wt %. The short (up to 30 min) ultrasound treatment of aqueous solutions containing polymers and a colloidal TiNT mixture prior to drop casting has resulted in some improvements in both hardness and reduced Young’s modulus of dry composite films, probably due to a better dispersion of ceramic nanotubes within the matrix. However, further (more than 1 h) treatment of the mixture with ultrasound resulted in a deterioration of the mechanical properties of the composite accompanied by a shortening of the nanotubes, as observed by the TEM.

  5. General design approach and practical realization of decoupling matrices for parallel transmission coils.

    PubMed

    Mahmood, Zohaib; McDaniel, Patrick; Guérin, Bastien; Keil, Boris; Vester, Markus; Adalsteinsson, Elfar; Wald, Lawrence L; Daniel, Luca

    2016-07-01

    In a coupled parallel transmit (pTx) array, the power delivered to a channel is partially distributed to other channels because of coupling. This power is dissipated in circulators resulting in a significant reduction in power efficiency. In this study, a technique for designing robust decoupling matrices interfaced between the RF amplifiers and the coils is proposed. The decoupling matrices ensure that most forward power is delivered to the load without loss of encoding capabilities of the pTx array. The decoupling condition requires that the impedance matrix seen by the power amplifiers is a diagonal matrix whose entries match the characteristic impedance of the power amplifiers. In this work, the impedance matrix of the coupled coils is diagonalized by a successive multiplication by its eigenvectors. A general design procedure and software are developed to generate automatically the hardware that implements diagonalization using passive components. The general design method is demonstrated by decoupling two example parallel transmit arrays. Our decoupling matrices achieve better than -20 db decoupling in both cases. A robust framework for designing decoupling matrices for pTx arrays is presented and validated. The proposed decoupling strategy theoretically scales to any arbitrary number of channels. Magn Reson Med 76:329-339, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  6. Synthesis and characterization of metal-dielectric composites with copper nanoparticles embedded in a glass matrix: A multitechnique approach

    NASA Astrophysics Data System (ADS)

    Lipinska-Kalita, Kristina E.; Krol, Denise M.; Hemley, Russell J.; Mariotto, Gino; Kalita, Patricia E.; Ohki, Yoshimichi

    2005-09-01

    The precipitation and growth of copper nanoparticles in an optically transparent aluminosilicate glass matrix was investigated. The size of particles in this heterophase glass-based composite was modified in a controlled manner by isothermal heat treatments. A multitechnique approach, consisting of Raman scattering spectroscopy, high-resolution transmission electron microscopy, x-ray diffraction technique, and optical absorption spectroscopy, has been used to study the nucleation and crystallization processes. Optical absorption spectroscopy revealed the presence of intense absorption bands attributed to oscillations of free electrons, known as the surface-plasmon resonance band of copper particles, and confirmed a gradual increase of the particles' mean size and density with annealing time. The Raman scattering on acoustical phonons from Cu quantum dots in the glass matrix measured for off-resonance conditions demonstrated the presence of intense, inhomogeneously broadened peaks that have been assigned to the confined acoustic eigenmodes of copper nanoparticles. The particle-size dependence of the acoustic peak energies and the relation between the size distribution and bandwidths of these peaks were derived. High-resolution transmission electron microscopy was used to monitor the nucleation of the nanoparticles and to estimate their mean size.

  7. Data on a Laves phase intermetallic matrix composite in situ toughened by ductile precipitates.

    PubMed

    Knowles, Alexander J; Bhowmik, Ayan; Purkayastha, Surajit; Jones, Nicholas G; Giuliani, Finn; Clegg, William J; Dye, David; Stone, Howard J

    2017-10-01

    The data presented in this article are related to the research article entitled "Laves phase intermetallic matrix composite in situ toughened by ductile precipitates" (Knowles et al.) [1]. The composite comprised a Fe 2 (Mo, Ti) matrix with bcc (Mo, Ti) precipitated laths produced in situ by an aging heat treatment, which was shown to confer a toughening effect (Knowles et al.) [1]. Here, details are given on a focused ion beam (FIB) slice and view experiment performed on the composite so as to determine that the 3D morphology of the bcc (Mo, Ti) precipitates were laths rather than needles. Scanning transmission electron microscopy (S(TEM)) micrographs of the microstructure as well as energy dispersive X-ray spectroscopy (EDX) maps are presented that identify the elemental partitioning between the C14 Laves matrix and the bcc laths, with Mo rejected from the matrix into laths. A TEM selected area diffraction pattern (SADP) and key is provided that was used to validate the orientation relation between the matrix and laths identified in (Knowles et al.) [1] along with details of the transformation matrix determined.

  8. Advanced Doubling Adding Method for Radiative Transfer in Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Liu, Quanhua; Weng, Fuzhong

    2006-12-01

    The doubling adding method (DA) is one of the most accurate tools for detailed multiple-scattering calculations. The principle of the method goes back to the nineteenth century in a problem dealing with reflection and transmission by glass plates. Since then the doubling adding method has been widely used as a reference tool for other radiative transfer models. The method has never been used in operational applications owing to tremendous demand on computational resources from the model. This study derives an analytical expression replacing the most complicated thermal source terms in the doubling adding method. The new development is called the advanced doubling adding (ADA) method. Thanks also to the efficiency of matrix and vector manipulations in FORTRAN 90/95, the advanced doubling adding method is about 60 times faster than the doubling adding method. The radiance (i.e., forward) computation code of ADA is easily translated into tangent linear and adjoint codes for radiance gradient calculations. The simplicity in forward and Jacobian computation codes is very useful for operational applications and for the consistency between the forward and adjoint calculations in satellite data assimilation.

  9. Evaluation of damping loss factor of flat laminates by sound transmission

    NASA Astrophysics Data System (ADS)

    Parrinello, A.; Ghiringhelli, G. L.

    2018-06-01

    A novel approach to investigate and evaluate the damping loss factor of a planar multilayered structure is presented. A statistical analysis reveals the connection between the damping properties of the structure and the transmission of sound through the thickness of its laterally infinite counterpart. The obtained expression for the panel loss factor involves all the derivatives of the transmission and reflection coefficients of the layered structure with respect each layer damping. The properties of the fluid for which the sound transmission is evaluated are chosen to fulfil the hypotheses on the basis of the statistical formulation. A transfer matrix approach is used to compute the required transmission and reflection coefficients, making it possible to deal with structures having arbitrary stratifications of different layers and also granting high efficiency in a wide frequency range. Comparison with alternative formulations and measurements demonstrates the effectiveness of the proposed methodology.

  10. Mueller matrix microscopy on a Morpho butterfly

    NASA Astrophysics Data System (ADS)

    Arteaga, Oriol; Kuntman, Ertan; Antó, Joan; Pascual, Esther; Canillas, Adolf; Bertran, Enric

    2015-04-01

    The brilliant iridescent colouring in male Morpho butterflies is due to the microstrutures and nanostructures present in the wing scales, rather than pigments. In this work Mueller matrix microscopy is used to investigate the polarization properties of butterfly wing scales in reflection and transmission. It is found that the top layer of more transparent scales (cover scales) have very different polarimetric properties from the ground iridescent scales. Images with high spatial resolution showing the retarding and diattenuating optical properties for both types of scales are provided.

  11. Preparation and properties of optically transparent, pressure-cured poly(methyl methacrylate) composites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weaver, K.D.

    The objective of this work was to develop optically transparent glass fiber reinforced poly(methyl methacrylate) composites by matching the refractive index of the glass fiber to that of the PMMA matrix. A pressure curing process [65[degrees]C under 6.9 MPa N[sub 2] for 18 hrs] is described for preparing composites 10 [times] 15 [times] 0.6 cm which typically contain [approximately]10 vol% of 13[mu]m diameter fiber and have 84% optical transmission (92% maximum for PMMA) at 600 nm and 25[degrees]C. Evidence is presented relating the interfacial bonding strength and the optical transmission of transparent, glass fiber (13 [mu]m) reinforced PMMA composites. Themore » temperature dependent (20-50[degrees]C) transmission of composites containing uncoated fiber and fiber coated with divinyltetramethyl disilazane or 3-(trimethoxysilyl)propyl methacrylate was found to decrease in the same order as the bond strength of the PMMA/fiber interface, namely, silane coated, disilazane coated, and uncoated fiber. By using annealed (1 1/3 hours/400[degrees]C) 13 [mu]m BK10 fiber, these pressure-cured composites function optically as ultra-violet Solid Matrix Christiansen Filters. The composite filters have an optical transmission of 51% at 51[degrees]C and 305 nm with a half-height bandwidth of only 28 nm, which is more wavelength selective than reported solid matrix Christiansen filters and typical band pass filters. While the density (1.18-1.19 g/ml at 23[degrees]C) and coefficient of thermal expansion (9.9[times]10[sup [minus]5] K[sup [minus]1]) show no change at these curing conditions, the minimum stress to craze (33 wt% toluene in isobutyl acetate) for pressure-cured [65[degrees]C/6.9 MPa N[sub 2]/18 hrs] PMMA was found to be improved.« less

  12. Influence of thickness and permeability of endothelial surface layer on transmission of shear stress in capillaries

    NASA Astrophysics Data System (ADS)

    Zhang, SongPeng; Zhang, XiangJun; Tian, Yu; Meng, YongGang; Lipowsky, Herbert

    2015-07-01

    The molecular coating on the surface of microvascular endothelium has been identified as a barrier to transvascular exchange of solutes. With a thickness of hundreds of nanometers, this endothelial surface layer (ESL) has been treated as a porous domain within which fluid shear stresses are dissipated and transmitted to the solid matrix to initiate mechanotransduction events. The present study aims to examine the effects of the ESL thickness and permeability on the transmission of shear stress throughout the ESL. Our results indicate that fluid shear stresses rapidly decrease to insignificant levels within a thin transition layer near the outer boundary of the ESL with a thickness on the order of ten nanometers. The thickness of the transition zone between free fluid and the porous layer was found to be proportional to the square root of the Darcy permeability. As the permeability is reduced ten-fold, the interfacial fluid and solid matrix shear stress gradients increase exponentially two-fold. While the interfacial fluid shear stress is positively related to the ESL thickness, the transmitted matrix stress is reduced by about 50% as the ESL thickness is decreased from 500 to 100 nm, which may occur under pathological conditions. Thus, thickness and permeability of the ESL are two main factors that determine flow features and the apportionment of shear stresses between the fluid and solid phases of the ESL. These results may shed light on the mechanisms of force transmission through the ESL and the pathological events caused by alterations in thickness and permeability of the ESL.

  13. Other notable protein blotting methods: a brief review.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2015-01-01

    Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

  14. Modelling the effect of urbanization on the transmission of an infectious disease.

    PubMed

    Zhang, Ping; Atkinson, Peter M

    2008-01-01

    This paper models the impact of urbanization on infectious disease transmission by integrating a CA land use development model, population projection matrix model and CA epidemic model in S-Plus. The innovative feature of this model lies in both its explicit treatment of spatial land use development, demographic changes, infectious disease transmission and their combination in a dynamic, stochastic model. Heuristically-defined transition rules in cellular automata (CA) were used to capture the processes of both land use development with urban sprawl and infectious disease transmission. A population surface model and dwelling distribution surface were used to bridge the gap between urbanization and infectious disease transmission. A case study is presented involving modelling influenza transmission in Southampton, a dynamically evolving city in the UK. The simulation results for Southampton over a 30-year period show that the pattern of the average number of infection cases per day can depend on land use and demographic changes. The modelling framework presents a useful tool that may be of use in planning applications.

  15. Transmission Heterogeneity and Autoinoculation in a Multisite Infection Model of HPV

    PubMed Central

    Brouwer, Andrew F.; Meza, Rafael; Eisenberg, Marisa C.

    2015-01-01

    The human papillomavirus (HPV) is sexually transmitted and can infect oral, genital, and anal sites in the human epithelium. Here, we develop a multisite transmission model that includes autoinoculation, to study HPV and other multisite diseases. Under a homogeneous-contacts assumption, we analyze the basic reproduction number R0, as well as type and target reproduction numbers, for a two-site model. In particular, we find that R0 occupies a space between taking the maximum of next generation matrix terms for same site transmission and taking the geometric average of cross-site transmission terms in such a way that heterogeneity in the same-site transmission rates increases R0 while heterogeneity in the cross-site transmission decreases it. Additionally, autoinoculation adds considerable complexity to the form of R0. We extend this analysis to a heterosexual population, which additionally yields dynamics analogous to those of vector–host models. We also examine how these issues of heterogeneity may affect disease control, using type and target reproduction numbers. PMID:26518265

  16. Biophotonic applications of eigenchannels in a scattering medium (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Kim, Moonseok; Choi, Wonjun; Choi, Youngwoon; Yoon, Changhyeong; Choi, Wonshik

    2016-03-01

    When waves travel through disordered media such as ground glass and skin tissues, they are scattered multiple times. Most of the incoming energy bounces back at the superficial layers and only a small fraction can penetrate deep inside. This has been a limiting factor for the working depth of various optical techniques. We present a systematic method to enhance wave penetration to the scattering media. Specifically, we measured the reflection matrix of a disordered medium with wide angular coverage for each orthogonal polarization states. From the reflection matrix, we identified reflection eigenchannels of the medium, and shaped the incident wave into the reflection eigenchannel with smallest eigenvalue, which we call anti-reflection mode. This makes reflectance reduced and wave penetration increased as a result of the energy conservation. We demonstrated transmission enhancement by more than a factor of 3 by the coupling of the incident waves to the anti-reflection modes. Based on the uneven distribution of eigenvalues of reflection eigenchannels, we further developed an iterative feedback control method for finding and coupling light to anti-reflection modes. Since this adaptive control method can keep up with sample perturbation, it promotes the applicability of exploiting reflection eigenchannels. Our approach of delivering light deep into the scattering media will contribute to enhancing the sensitivity of detecting objects hidden under scattering layers, which is universal problem ranging from geology to life science.

  17. Wave Propagation and Localization via Quasi-Normal Modes and Transmission Eigenchannels

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Shi, Zhou; Davy, Matthieu; Genack, Azriel Z.

    2013-10-01

    Field transmission coefficients for microwave radiation between arrays of points on the incident and output surfaces of random samples are analyzed to yield the underlying quasi-normal modes and transmission eigenchannels of each realization of the sample. The linewidths, central frequencies, and transmitted speckle patterns associated with each of the modes of the medium are found. Modal speckle patterns are found to be strongly correlated leading to destructive interference between modes. This explains distinctive features of transmission spectra and pulsed transmission. An alternate description of wave transport is obtained from the eigenchannels and eigenvalues of the transmission matrix. The maximum transmission eigenvalue, τ1 is near unity for diffusive waves even in turbid samples. For localized waves, τ1 is nearly equal to the dimensionless conductance, which is the sum of all transmission eigenvalues, g = Στn. The spacings between the ensemble averages of successive values of lnτn are constant and equal to the inverse of the bare conductance in accord with predictions by Dorokhov. The effective number of transmission eigenvalues Neff determines the contrast between the peak and background of radiation focused for maximum peak intensity. The connection between the mode and channel approaches is discussed.

  18. Wave Propagation and Localization via Quasi-Normal Modes and Transmission Eigenchannels

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Shi, Zhou; Davy, Matthieu; Genack, Azriel Z.

    Field transmission coefficients for microwave radiation between arrays of points on the incident and output surfaces of random samples are analyzed to yield the underlying quasi-normal modes and transmission eigenchannels of each realization of the sample. The linewidths, central frequencies, and transmitted speckle patterns associated with each of the modes of the medium are found. Modal speckle patterns are found to be strongly correlated leading to destructive interference between modes. This explains distinctive features of transmission spectra and pulsed transmission. An alternate description of wave transport is obtained from the eigenchannels and eigenvalues of the transmission matrix. The maximum transmission eigenvalue, τ1 is near unity for diffusive waves even in turbid samples. For localized waves, τ1 is nearly equal to the dimensionless conductance, which is the sum of all transmission eigenvalues, g = Στn. The spacings between the ensemble averages of successive values of lnτn are constant and equal to the inverse of the bare conductance in accord with predictions by Dorokhov. The effective number of transmission eigenvalues Neff determines the contrast between the peak and background of radiation focused for maximum peak intensity. The connection between the mode and channel approaches is discussed.

  19. Scattering of ultrasonic waves from porous piezoelectric multilayered structures immersed in a fluid

    NASA Astrophysics Data System (ADS)

    Vashishth, Anil K.; Gupta, Vishakha

    2012-12-01

    The interest in porous piezoelectric materials is due to the demand for low-frequency hydrophone/actuator devices for use in underwater acoustic systems and other oceanographic applications. Porosity decreases the acoustic impedance, thus improving the transfer of acoustic energy to water or biological tissues. The impedance mismatching problem between the dense piezoelectric materials and the surrounding medium can be solved by inclusion of porosity in dense piezoceramics. The complete description of acoustic propagation in a multilayered system is of great interest in a variety of applications, such as non-destructive evaluation and acoustic design, and there is need for a flexible model that can describe the reflection and transmission of ultrasonic waves in these media. The present paper elaborates a theoretical model, based on the transfer matrix method, for describing reflection and transmission of plane elastic waves through a porous piezoelectric laminated plate, immersed in a fluid. The analytical expressions for the reflection coefficient, transmission coefficient and acoustic impedance are derived. The effects of frequency, angle of incidence, number of layers, layer thickness and porosity are observed numerically for different configurations. The results obtained are deduced for the piezoelectric laminated structure, piezoelectric layer and poro-elastic layer immersed in a fluid, which are in agreement with earlier established results and experimental studies.

  20. Pros and cons of estimating the reproduction number from early epidemic growth rate of influenza A (H1N1) 2009.

    PubMed

    Nishiura, Hiroshi; Chowell, Gerardo; Safan, Muntaser; Castillo-Chavez, Carlos

    2010-01-07

    In many parts of the world, the exponential growth rate of infections during the initial epidemic phase has been used to make statistical inferences on the reproduction number, R, a summary measure of the transmission potential for the novel influenza A (H1N1) 2009. The growth rate at the initial stage of the epidemic in Japan led to estimates for R in the range 2.0 to 2.6, capturing the intensity of the initial outbreak among school-age children in May 2009. An updated estimate of R that takes into account the epidemic data from 29 May to 14 July is provided. An age-structured renewal process is employed to capture the age-dependent transmission dynamics, jointly estimating the reproduction number, the age-dependent susceptibility and the relative contribution of imported cases to secondary transmission. Pitfalls in estimating epidemic growth rates are identified and used for scrutinizing and re-assessing the results of our earlier estimate of R. Maximum likelihood estimates of R using the data from 29 May to 14 July ranged from 1.21 to 1.35. The next-generation matrix, based on our age-structured model, predicts that only 17.5% of the population will experience infection by the end of the first pandemic wave. Our earlier estimate of R did not fully capture the population-wide epidemic in quantifying the next-generation matrix from the estimated growth rate during the initial stage of the pandemic in Japan. In order to quantify R from the growth rate of cases, it is essential that the selected model captures the underlying transmission dynamics embedded in the data. Exploring additional epidemiological information will be useful for assessing the temporal dynamics. Although the simple concept of R is more easily grasped by the general public than that of the next-generation matrix, the matrix incorporating detailed information (e.g., age-specificity) is essential for reducing the levels of uncertainty in predictions and for assisting public health policymaking. Model-based prediction and policymaking are best described by sharing fundamental notions of heterogeneous risks of infection and death with non-experts to avoid potential confusion and/or possible misuse of modelling results.

  1. In situ synthesis of ultra-fine, porous, tin oxide-carbon nanocomposites via a molten salt method for lithium-ion batteries

    NASA Astrophysics Data System (ADS)

    Liu, Bin; Guo, Zai Ping; Du, Guodong; Nuli, Yanna; Hassan, Mohd Faiz; Jia, Dianzeng

    Ultra-fine, porous, tin oxide-carbon (SnO 2/C) nanocomposites are fabricated by a molten salt method at 300 °C, and malic acid is decomposed as the carbon source. In situ synthesis is favourable for the combination of carbon and SnO 2. The structure and morphology are confirmed by X-ray diffraction analysis, specific surface-area measurements, and transmission electron microscopy (TEM). Examination of TEM images reveals that the SnO 2 nanoparticles are embedded in the carbon matrix, with sizes between 2 and 5 nm. The electrochemical measurements show that the nanocomposite delivers a high capacity with good capacity retention as an anode material for lithium-ion batteries, due to the combination of the ultra-fine porous structure and the carbon component.

  2. Design of a projection display screen with vanishing color shift for rear-projection HDTV

    NASA Astrophysics Data System (ADS)

    Liu, Xiu; Zhu, Jin-lin

    1996-09-01

    Using bi-convex cylinder lens with matrix structure, the transmissive projection display screen with high contrast and wider viewing angle has been widely used in large rear projection TV and video projectors, it obtained a inhere color shift and puzzled the designer of display screen for RGB projection tube in-line adjustment. Based on the method of light beam racing, the general software of designing projection display screen has been developed and the computer model of vanishing color shift for rear projection HDTV has bee completed. This paper discussed the practical designing method to vanish the defect of color shift and mentioned the relations between the primary optical parameters of display screen and relative geometry sizes of lens' surface. The distributions of optical gain to viewing angle and the influences on engineering design are briefly analyzed.

  3. Infiltration of CdTe nano crystals into a ZnO wire vertical matrix by using the isothermal closed space technique

    NASA Astrophysics Data System (ADS)

    Larramendi, S.; Vaillant Roca, Lidice; Saint-Gregoire, Pierre; Ferraz Dias, Johnny; Behar, Moni

    2017-10-01

    A ZnO nanorod structure was grown by the hydrothermal method and interpenetrated with CdTe using the isothermal closed space sublimation technique. The obtained structure was studied by using the Rutherford backscattering spectrometry (RBS), Scanning Electron Microscopy (SEM), High Resolution Transmission Electron Microscopy (HRTEM). The X-ray Diffraction (XRD) technique confirmed the presence of CdTe nanocrystals (NCs) of very small size formed on the surface and in the interspaces between the ZnO nanorods. The RBS observations together with the SEM observations give information on the obtained structure. Finally the photoluminescence studies show a strong energy confinement effect on the grown CdTe NCs.

  4. Vibration analysis of rotor blades with an attached concentrated mass

    NASA Technical Reports Server (NTRS)

    Murthy, V. R.; Barna, P. S.

    1977-01-01

    The effect of an attached concentrated mass on the dynamics of helicopter rotor blades is determined. The point transmission matrix method was used to define, through three completely automated computer programs, the natural vibrational characteristics (natural frequencies and mode shapes) of rotor blades. The problems of coupled flapwise bending, chordwise bending, and torsional vibration of a twisted nonuniform blade and its special subcase pure torsional vibration are discussed. The orthogonality relations that exist between the natural modes of rotor blades with an attached concentrated mass are derived. The effect of pitch, rotation, and point mass parameters on the collective, cyclic, scissor, and pure torsional modes of a seesaw rotor blade is determined.

  5. Resolving the morphology of niobium carbonitride nano-precipitates in steel using atom probe tomography.

    PubMed

    Breen, Andrew J; Xie, Kelvin Y; Moody, Michael P; Gault, Baptiste; Yen, Hung-Wei; Wong, Christopher C; Cairney, Julie M; Ringer, Simon P

    2014-08-01

    Atom probe is a powerful technique for studying the composition of nano-precipitates, but their morphology within the reconstructed data is distorted due to the so-called local magnification effect. A new technique has been developed to mitigate this limitation by characterizing the distribution of the surrounding matrix atoms, rather than those contained within the nano-precipitates themselves. A comprehensive chemical analysis enables further information on size and chemistry to be obtained. The method enables new insight into the morphology and chemistry of niobium carbonitride nano-precipitates within ferrite for a series of Nb-microalloyed ultra-thin cast strip steels. The results are supported by complementary high-resolution transmission electron microscopy.

  6. Transmission and Andreev reflection in one-dimensional chain with randomly doped superconducting grains

    NASA Astrophysics Data System (ADS)

    Hu, Dong-Sheng; Xiong, Shi-Jie

    2002-11-01

    We investigate the transport properties and Andreev reflection in one-dimensional (1D) systems with randomly doped superconducting grains. The superconducting grains are described by the Bogoliubov-de Gene Hamiltonian and the conductance is calculated by using the transfer matrix method and Landauer-Büttiker formula. It is found that although the quasiparticle states are localized due to the randomness and the low dimensionality, the conductance is still kept finite in the thermodynamical limit due to the Andreev reflection. We also investigate the effect of correlation of disorder in such systems and the results show the delocalization of quasiparticle states and suppression of Andreev reflection in a wide energy window.

  7. Generation of higher odd harmonics in a defective photonic crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramanujam, N. R., E-mail: wilsonpra@yahoo.co.in; Wilson, K. S. Joseph

    2015-06-24

    A photonic crystal (AB){sup 2}(DB)(AB){sup 2} with high refractive index medium as silicon and low refractive medium as air is considered. Using the transfer matrix method, the transmission properties as a function of wavelength with photonic band gaps has been obtained. We are able to demonstrate the generation of third, fifth, seventh and ninth harmonics in the present work. We show that if the air medium is removed in the defect, the defect modes are generated but not harmonics. It can be designed to have a frequency conversion, and have a potential for becoming the basis for the next generationmore » of optical devices.« less

  8. Precipitation of Carbides in Early Aging Stages and Their Crystallographic Orientations in Hadfield Steel Mn13

    NASA Astrophysics Data System (ADS)

    Ding, Zhimin; Liang, Bo; Zhao, Ruirong; Chen, Chunhuan

    2015-05-01

    The methods of transmission electron microscopy (TEM) and electron diffraction are used to study the carbides precipitated in Hadfield steel Mn13 during 2-h aging at 475°C. It is shown that carbides of types (Fe, Mn, Cr)23C6 and mixed (Fe, Mn, Cr)7C3 + (Fe, Mn, Cr)3C precipitate simultaneously over austenite grain boundaries. The data on precipitation of M23C- and M7C3-type carbides in a Hadfield steel after water quenching and aging are pioneer ones. Strict orientation relations of the M23C6 carbides and of the austenite matrix are determined.

  9. Appendix E: Research papers. Use of remote sensing in landscape stratification for environmental impact assessment

    NASA Technical Reports Server (NTRS)

    Stanturf, J. A.; Heimbuch, D. G.

    1980-01-01

    A refinement to the matrix approach to environmental impact assessment is to use landscape units in place of separate environmental elements in the analysis. Landscape units can be delineated by integrating remotely sensed data and available single-factor data. A remote sensing approach to landscape stratification is described and the conditions under which it is superior to other approaches that require single-factor maps are indicated. Flowcharts show the steps necessary to develop classification criteria, delineate units and a map legend, and use the landscape units in impact assessment. Application of the approach to assessing impacts of a transmission line in Montana is presented to illustrate the method.

  10. Electronic and optical properties of GaAs/AlGaAs Fibonacci ordered multiple quantum well systems

    NASA Astrophysics Data System (ADS)

    Amini, M.; Soleimani, M.; Ehsani, M. H.

    2017-12-01

    We numerically investigated the optical rectification coefficients (ORCs), transmission coefficient, energy levels and corresponding eigen-functions of GaAs/AlGaAs Fibonacci ordered multiple quantum well systems (FO-MQWs) in the presence of an external electric field. In our calculations, two different methods, including transfer matrix and finite-difference have been used. It has been illustrated that with three types of the FO-MQWs, presented here, localization of the wave-function in any position of the structure is possible. Therefore, managing the electron distribution within the system is easier now. Finally, using the presented structures we could tune the position and amplitude of the ORCs.

  11. Transport properties in a monolayer graphene modulated by the realistic magnetic field and the Schottky metal stripe

    NASA Astrophysics Data System (ADS)

    Lu, Jian-Duo; Li, Yun-Bao; Liu, Hong-Yu; Peng, Shun-Jin; Zhao, Fei-Xiang

    2016-09-01

    Based on the transfer-matrix method, a systematic investigation of electron transport properties is done in a monolayer graphene modulated by the realistic magnetic field and the Schottky metal stripe. The strong dependence of the electron transmission and the conductance on the incident angle of carriers is clearly seen. The height, position as well as width of the barrier also play an important role on the electron transport properties. These interesting results are very useful for understanding the tunneling mechanism in the monolayer graphene and helpful for designing the graphene-based electrical device modulated by the realistic magnetic field and the electrical barrier.

  12. Matrix mineralogy of the Lance CO3 carbonaceous chondrite - A transmission electron microscope study

    NASA Technical Reports Server (NTRS)

    Keller, Lindsay P.; Buseck, Peter R.

    1990-01-01

    Results are presented on electron microprobe analyses of three CO chondrites, all of which are falls: Lance, Kainsaz, and Warrenton. The TEM mineralogy results of Lance chondrite show that Fe-rich matrix olivines have been altered to Fe-bearing serpentine and Fe(3+) oxide; matrix metal was also altered to produce Fe(3+) oxides, leaving the residual metal enriched in Ni. Olivine grains in Lance's matrix contain channels along their 100-line and 001-line directions; the formation and convergence of such channels resulted in a grain-size reduction of the olivine. A study of Kainsaz and Warrenton showed that these meteorites do not contain phyllosilicates in their matrices, although both contain Fe(3+) oxide between olivine grains. It is suggested that, prior to its alteration, Lance probably resembled Kainsaz, an unaltered CO3 chondrite.

  13. Effect of metallic coating on the properties of copper-silicon carbide composites

    NASA Astrophysics Data System (ADS)

    Chmielewski, M.; Pietrzak, K.; Teodorczyk, M.; Nosewicz, S.; Jarząbek, D.; Zybała, R.; Bazarnik, P.; Lewandowska, M.; Strojny-Nędza, A.

    2017-11-01

    In the presented paper a coating of SiC particles with a metallic layer was used to prepare copper matrix composite materials. The role of the layer was to protect the silicon carbide from decomposition and dissolution of silicon in the copper matrix during the sintering process. The SiC particles were covered by chromium, tungsten and titanium using Plasma Vapour Deposition method. After powder mixing of components, the final densification process via Spark Plasma Sintering (SPS) method at temperature 950 °C was provided. The almost fully dense materials were obtained (>97.5%). The microstructure of obtained composites was studied using scanning electron microscopy as well as transmission electron microscopy. The microstructural analysis of composites confirmed that regardless of the type of deposited material, there is no evidence for decomposition process of silicon carbide in copper. In order to measure the strength of the interface between ceramic particles and the metal matrix, the micro tensile tests have been performed. Furthermore, thermal diffusivity was measured with the use of the laser pulse technique. In the context of performed studies, the tungsten coating seems to be the most promising solution for heat sink application. Compared to pure composites without metallic layer, Cu-SiC with W coating indicate the higher tensile strength and thermal diffusitivy, irrespective of an amount of SiC reinforcement. The improvement of the composite properties is related to advantageous condition of Cu-SiC interface characterized by well homogenity and low porosity, as well as individual properties of the tungsten coating material.

  14. Acoustic resonance in MEMS scale cylindrical tubes with side branches

    NASA Astrophysics Data System (ADS)

    Schill, John F.; Holthoff, Ellen L.; Pellegrino, Paul M.; Marcus, Logan S.

    2014-05-01

    Photoacoustic spectroscopy (PAS) is a useful monitoring technique that is well suited for trace gas detection. This method routinely exhibits detection limits at the parts-per-million (ppm) or parts-per-billion (ppb) level for gaseous samples. PAS also possesses favorable detection characteristics when the system dimensions are scaled to a microelectromechanical system (MEMS) design. One of the central issues related to sensor miniaturization is optimization of the photoacoustic cell geometry, especially in relationship to high acoustical amplification and reduced system noise. Previous work relied on a multiphysics approach to analyze the resonance structures of the MEMS scale photo acoustic cell. This technique was unable to provide an accurate model of the acoustic structure. In this paper we describe a method that relies on techniques developed from musical instrument theory and electronic transmission line matrix methods to describe cylindrical acoustic resonant cells with side branches of various configurations. Experimental results are presented that demonstrate the ease and accuracy of this method. All experimental results were within 2% of those predicted by this theory.

  15. The band gap properties of the three-component semi-infinite plate-like LRPC by using PWE/FE method

    NASA Astrophysics Data System (ADS)

    Qian, Denghui; Wang, Jianchun

    2018-06-01

    This paper applies coupled plane wave expansion and finite element (PWE/FE) method to calculate the band structure of the proposed three-component semi-infinite plate-like locally resonant phononic crystal (LRPC). In order to verify the accuracy of the result, the band structure calculated by PWE/FE method is compared to that calculated by the traditional finite element (FE) method, and the frequency range of the band gap in the band structure is compared to that of the attenuation in the transmission power spectrum. Numerical results and further analysis demonstrate that a band gap is opened by the coupling between the dominant vibrations of the rubber layer and the matrix modes. In addition, the influences of the geometry parameters on the band gap are studied and understood with the help of the simple “base-spring-mass” model, the influence of the viscidity of rubber layer on the band gap is also investigated.

  16. Pattern classifier for health monitoring of helicopter gearboxes

    NASA Technical Reports Server (NTRS)

    Chin, Hsinyung; Danai, Kourosh; Lewicki, David G.

    1993-01-01

    The application of a newly developed diagnostic method to a helicopter gearbox is demonstrated. This method is a pattern classifier which uses a multi-valued influence matrix (MVIM) as its diagnostic model. The method benefits from a fast learning algorithm, based on error feedback, that enables it to estimate gearbox health from a small set of measurement-fault data. The MVIM method can also assess the diagnosability of the system and variability of the fault signatures as the basis to improve fault signatures. This method was tested on vibration signals reflecting various faults in an OH-58A main rotor transmission gearbox. The vibration signals were then digitized and processed by a vibration signal analyzer to enhance and extract various features of the vibration data. The parameters obtained from this analyzer were utilized to train and test the performance of the MVIM method in both detection and diagnosis. The results indicate that the MVIM method provided excellent detection results when the full range of faults effects on the measurements were included in training, and it had a correct diagnostic rate of 95 percent when the faults were included in training.

  17. Correlative characterization of primary Al{sub 3}(Sc,Zr) phase in an Al–Zn–Mg based alloy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, J.H., E-mail: jie-hua.li@hotmail.com; Wiessner, M.; Albu, M.

    2015-04-15

    Three-dimensional electron backscatter diffraction, focused ion beam, transmission electron microscopy and energy filtered transmission electron microscopy were employed to investigate the structural information of primary Al{sub 3}(Sc,Zr) phase, i.e. size, shape, element distribution and orientation relationship with the α-Al matrix. It was found that (i) most primary Al{sub 3}(Sc,Zr) phases have a cubic three-dimensional morphology, with a size of about 6–10 μm, (ii) most primary Al{sub 3}(Sc,Zr) phases are located within the α-Al matrix, and exhibit a cube to cube orientation relationship with the α-Al matrix, and (iii) a layer by layer growth was observed within primary Al{sub 3}(Sc,Zr) phases.more » Al, Cu, Si and Fe are enriched in the α-Al matrix between the layers of cellular eutectic Al{sub 3}(Sc,Zr) phase, while Sc, Ti and Zr are enriched in small Al{sub 3}(Sc,Zr) phases. A peritectic reaction and subsequent eutectic reaction between Al{sub 3}Sc and Al was proposed to interpret the observed layer by layer growth. This paper demonstrates that the presence of impurities (Fe, Si, Cu, Ti) in the diffusion field surrounding the growing Al{sub 3}(Sc,Zr) particle enhances the heterogeneous nucleation of Al{sub 3}(Sc,Zr) phases. - Highlights: • Most fine cubic primary Al{sub 3}(Sc,Zr) phases were observed within the α-Al matrix. • A layer by layer growth within primary Al{sub 3}(Sc,Zr) phase was observed. • A peritectic and subsequent eutectic reaction between Al{sub 3}Sc and Al was proposed. • Impurities in diffusion fields enhance heterogeneous nucleation of Al{sub 3}(Sc,Zr)« less

  18. Statistical model for the mechanical behavior of the tissue engineering non-woven fibrous matrices under large deformation.

    PubMed

    Rizvi, Mohd Suhail; Pal, Anupam

    2014-09-01

    The fibrous matrices are widely used as scaffolds for the regeneration of load-bearing tissues due to their structural and mechanical similarities with the fibrous components of the extracellular matrix. These scaffolds not only provide the appropriate microenvironment for the residing cells but also act as medium for the transmission of the mechanical stimuli, essential for the tissue regeneration, from macroscopic scale of the scaffolds to the microscopic scale of cells. The requirement of the mechanical loading for the tissue regeneration requires the fibrous scaffolds to be able to sustain the complex three-dimensional mechanical loading conditions. In order to gain insight into the mechanical behavior of the fibrous matrices under large amount of elongation as well as shear, a statistical model has been formulated to study the macroscopic mechanical behavior of the electrospun fibrous matrix and the transmission of the mechanical stimuli from scaffolds to the cells via the constituting fibers. The study establishes the load-deformation relationships for the fibrous matrices for different structural parameters. It also quantifies the changes in the fiber arrangement and tension generated in the fibers with the deformation of the matrix. The model reveals that the tension generated in the fibers on matrix deformation is not homogeneous and hence the cells located in different regions of the fibrous scaffold might experience different mechanical stimuli. The mechanical response of fibrous matrices was also found to be dependent on the aspect ratio of the matrix. Therefore, the model establishes a structure-mechanics interdependence of the fibrous matrices under large deformation, which can be utilized in identifying the appropriate structure and external mechanical loading conditions for the regeneration of load-bearing tissues. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Optical and vibrational properties of PbSe nanoparticles synthesized in clinoptilolite

    NASA Astrophysics Data System (ADS)

    Flores-Valenzuela, J.; Cortez-Valadez, M.; Ramírez-Bon, R.; Arizpe-Chavez, H.; Román-Zamorano, J. F.; Flores-Acosta, M.

    2015-08-01

    In this work, the optical and vibrational properties of composites based on PbSe semiconductor immersed in a zeolite matrix are reported. The natural zeolite, (clinoptilolite) was used as the host material of PbSe nanoparticles. The method for obtaining these particles is also reported here, which is based on ion exchange processes inside the natural zeolite in alkaline aqueous solution that contains the precursor ions Pb2+ and Se2-. The process of synthesis was conducted temperature, volume, concentration and reaction time of the precursors. The samples were studied by powder X-ray diffraction, TEM (transmission electron microscopy), diffuse reflectance and Raman spectroscopy. The experimental results demonstrate that with this method, the particles with nanometric PbSe sizes were synthesized in the zeolite matrix. Vibrational Raman bands at low wave numbers were detected in these particles by the presence of a shoulder located at 135 cm-1 and a band at around 149 cm-1. The vibrational calculations for small clusters of PbSe at LSDA (Local Spin Density Approximation) level combined with the basis set LANDL2DZ (Los Alamos National Laboratory 2 double ζ), were considered through DFT (Density Functionl Theory). The "breathing" Raman modes located at 119-152 cm-1 were detected for this level of theory.

  20. Preparation and Characterization of Polyhydroxybutyrate/Polycaprolactone Nanocomposites

    PubMed Central

    Liau, Cha Ping; Bin Ahmad, Mansor; Shameli, Kamyar; Yunus, Wan Md Zin Wan

    2014-01-01

    Polyhydroxybutyrate (PHB)/polycaprolactone (PCL)/stearate Mg-Al layered double hydroxide (LDH) nanocomposites were prepared via solution casting intercalation method. Coprecipitation method was used to prepare the anionic clay Mg-Al LDH from nitrate salt solution. Modification of nitrate anions by stearate anions between the LDH layers via ion exchange reaction. FTIR spectra showed the presence of carboxylic acid (COOH) group which indicates that stearate anions were successfully intercalated into the Mg-Al LDH. The formation of nanocomposites only involves physical interaction as there are no new functional groups or new bonding formed. X-ray diffraction (XRD) and transmission electron microscopy (TEM) indicated that the mixtures of nanocomposites are intercalated and exfoliated types. XRD results showed increasing of basal spacing from 8.66 to 32.97 Å in modified stearate Mg-Al LDH, and TEM results revealed that the stearate Mg-Al LDH layers are homogeneously distributed in the PHB/PCL polymer blends matrix. Enhancement in 300% elongation at break and 66% tensile strength in the presence of 1.0 wt % of the stearate Mg-Al LDH as compare with PHB/PCL blends. Scanning electron microscopy (SEM) proved that clay improves compatibility between polymer matrix and the best ratio 80PHB/20PCL/1stearate Mg-Al LDH surface is well dispersed and stretched before it breaks. PMID:24600329

  1. Secure Image Transmission over DFT-precoded OFDM-VLC systems based on Chebyshev Chaos scrambling

    NASA Astrophysics Data System (ADS)

    Wang, Zhongpeng; Qiu, Weiwei

    2017-08-01

    This paper proposes a physical layer image secure transmission scheme for discrete Fourier transform (DFT) precoded OFDM-based visible light communication systems by using Chebyshev chaos maps. In the proposed scheme, 256 subcarriers and QPSK modulation are employed. The transmitted digital signal of the image is encrypted with a Chebyshev chaos sequence. The encrypted signal is then transformed by a DFT precoding matrix to reduce the PAPR of the OFDM signal. After that, the encrypted and DFT-precoded OFDM are transmitted over a VLC channel. The simulation results show that the proposed image security transmission scheme can not only protect the DFT-precoded OFDM-based VLC from eavesdroppers but also improve BER performance.

  2. High-performance sub-terahertz transmission imaging system for food inspection

    PubMed Central

    Ok, Gyeongsik; Park, Kisang; Chun, Hyang Sook; Chang, Hyun-Joo; Lee, Nari; Choi, Sung-Wook

    2015-01-01

    Unlike X-ray systems, a terahertz imaging system can distinguish low-density materials in a food matrix. For applying this technique to food inspection, imaging resolution and acquisition speed ought to be simultaneously enhanced. Therefore, we have developed the first continuous-wave sub-terahertz transmission imaging system with a polygonal mirror. Using an f-theta lens and a polygonal mirror, beam scanning is performed over a range of 150 mm. For obtaining transmission images, the line-beam is incorporated with sample translation. The imaging system demonstrates that a pattern with 2.83 mm line-width at 210 GHz can be identified with a scanning speed of 80 mm/s. PMID:26137392

  3. Mechanical Four-Pole Parameters: Transmission Matrices

    DTIC Science & Technology

    1976-04-19

    moment of inertia, it is pcssible to state that 1, = i2 ’jV 2 (127) ~ =v 2 ,(128) B, = B2 ,(129) el e2 (130) 28 1 -JA 0 0 P2 0 1 0 0 VM 0 1 j :(. 131 ...Eq. 129 now becomes + JCI ,2(1.32) so that F1 1 -JaM 0 0 F2 V, 0 1 0 0 V2 ~ :~ (133) B. 0 0o 1 Jcn B 2 1 2 3. Spring of Stiffness K in Cascade [Fig...transmission matrix is that of Eq. 131 in which the element - JaM has been replaced py - Za. 9. VALUES OF TRANSMISSION MATRICES (BERNOULLI-EUER BEANS

  4. Evaluation of S190A radiometric exposure test data

    NASA Technical Reports Server (NTRS)

    Lockwood, H. E.; Goodding, R. A.

    1974-01-01

    The S190A preflight radiometric exposure test data generated as part of preflight and system test of KM-002 Sequence 29 on flight camera S/N 002 was analyzed. The analysis was to determine camera system transmission using available data which included: (1) films exposed to a calibrated light source subject; (2) filter transmission data; (3) calibrated light source data; (4) density vs. log10 exposure curves for the films; and (5) spectral sensitometric data for the films. The procedure used is outlined, and includes the data and a transmission matrix as a function of field position for nine measured points on each station-film-filter-aperture-shutter speed combination.

  5. Nanoimprint-defined, large-area meta-surfaces for unidirectional optical transmission with superior extinction in the visible-to-infrared range.

    PubMed

    Yao, Yuhan; Liu, He; Wang, Yifei; Li, Yuanrui; Song, Boxiang; Wang, Richard P; Povinelli, Michelle L; Wu, Wei

    2016-07-11

    Optical devices with asymmetric transmission have important applications in optical systems, but optical isolators with the modal asymmetry can only be built using magneto-optical or nonlinear materials, as dictated by the Lorentz reciprocity theorem. However, optical devices with the power asymmetry can be achieved by linear materials such as metals and dielectrics. In this paper, we report a large-area, nanoimprint-defined meta-surface (stacked subwavelength gratings) with high-contrast asymmetric transmittance in the visible-to-infrared wavelength range for TM-polarized light. The physical origin of asymmetric transmission through the meta-surface is studied by analyzing the scattering matrix.

  6. Phenomenological methodology for assessing the influence of flow conditions on the acoustic response of exhaust aftertreatment systems

    NASA Astrophysics Data System (ADS)

    Torregrosa, A. J.; Arnau, F. J.; Piqueras, P.; Sanchis, E. J.; Tartoussi, H.

    2017-05-01

    The increasing limits of standards on aerosol and gaseous emissions from internal combustion engines have led to the progressive inclusion of different exhaust aftertreatment systems (EATS) as a part of the powertrain. Regulated emissions are generally abated making use of devices based on monolithic structures with different chemical functions. As a side effect, wave transmission across the device is affected and so is the boundary at the exhaust line inlet, so that the design of the latter is in turn affected. While some models are available for the prediction of these effects, the geometrical complexity of many devices makes still necessary in many cases to rely on experimental measurements, which cannot cover all the diversity of flow conditions under which these devices operate. To overcome this limitation, a phenomenological methodology is proposed in this work that allows for the sound extrapolation of experimental results to flow conditions different from those used in the measurements. The transfer matrix is obtained from tests in an impulse rig for different excitation amplitudes and mean flows. The experimental coefficients of the transmission matrix of the device are fitted to Fourier series. It allows treating the influence of the flow conditions on the acoustic response, which is manifested on changes in the characteristic periods, separately from the specific properties of every device. In order to provide predictive capabilities to the method, the Fourier series approach is coupled to a gas dynamics model able to account for the sensitivity of propagation velocity to variations in the flow conditions.

  7. Transmission Electron Microscopy Analysis of Epithelial Basement Membrane Repair in Rabbit Corneas With Haze

    PubMed Central

    Torricelli, Andre A. M.; Singh, Vivek; Agrawal, Vandana; Santhiago, Marcony R.; Wilson, Steven E.

    2013-01-01

    Purpose. To assess the ultrastructure of the epithelial basement membrane using transmission electron microscopy (TEM) in rabbit corneas with and without subepithelial stroma opacity (haze). Methods. Two groups of eight rabbits each were included in this study. Photorefractive keratectomy (PRK) was performed using an excimer laser. The first group had −4.5-diopter (−4.5D) PRK and the second group had −9.0D PRK. Contralateral eyes were unwounded controls. Rabbits were sacrificed at 4 weeks after surgery. Immunohistochemical analysis was performed to detect the myofibroblast marker α-smooth muscle actin (SMA). TEM was performed to analyze the ultrastructure of the epithelial basement membrane and stroma. Results. At 4 weeks after PRK, α-SMA+ myofibroblasts were present at high density in the subepithelial stroma of rabbit eyes that had −9.0D PRK, along with prominent disorganized extracellular matrix, whereas few myofibroblasts and little disorganized extracellular matrix were noted in eyes that had −4.5D PRK. The epithelial basement membrane was irregular and discontinuous and lacking typical morphology in all corneas at 1 month after −9D PRK compared to corneas at 1 month in the −4.5D PRK group. Conclusions. The epithelial basement membrane acts as a critical modulator of corneal wound healing. Structural and functional defects in the epithelial basement membrane correlate to both stromal myofibroblast development from precursor cells and continued myofibroblast viability, likely through the modulation of epithelial–stromal interactions mediated by cytokines. Prolonged stromal haze in the cornea is associated with abnormal regeneration of the epithelial basement membrane. PMID:23696606

  8. Proposed Standard For Variable Format Picture Processing And A Codec Approach To Match Diverse Imaging Devices

    NASA Astrophysics Data System (ADS)

    Wendler, Th.; Meyer-Ebrecht, D.

    1982-01-01

    Picture archiving and communication systems, especially those for medical applications, will offer the potential to integrate the various image sources of different nature. A major problem, however, is the incompatibility of the different matrix sizes and data formats. This may be overcome by a novel hierarchical coding process, which could lead to a unified picture format standard. A picture coding scheme is described, which decomposites a given (2n)2 picture matrix into a basic (2m)2 coarse information matrix (representing lower spatial frequencies) and a set of n-m detail matrices, containing information of increasing spatial resolution. Thus, the picture is described by an ordered set of data blocks rather than by a full resolution matrix of pixels. The blocks of data are transferred and stored using data formats, which have to be standardized throughout the system. Picture sources, which produce pictures of different resolution, will provide the coarse-matrix datablock and additionally only those detail matrices that correspond to their required resolution. Correspondingly, only those detail-matrix blocks need to be retrieved from the picture base, that are actually required for softcopy or hardcopy output. Thus, picture sources and retrieval terminals of diverse nature and retrieval processes for diverse purposes are easily made compatible. Furthermore this approach will yield an economic use of storage space and transmission capacity: In contrast to fixed formats, redundand data blocks are always skipped. The user will get a coarse representation even of a high-resolution picture almost instantaneously with gradually added details, and may abort transmission at any desired detail level. The coding scheme applies the S-transform, which is a simple add/substract algorithm basically derived from the Hadamard Transform. Thus, an additional data compression can easily be achieved especially for high-resolution pictures by applying appropriate non-linear and/or adaptive quantizing.

  9. Factors controlling the permeability distribution in fault vein zones surrounding granitic intrusions (Ore Mountains/Germany)

    NASA Astrophysics Data System (ADS)

    Achtziger-Zupančič, P.; Loew, S.; Hiller, A.

    2017-03-01

    An outstanding legacy data set has been compiled from underground excavations mostly prospected and mined by the former Soviet (German) Stock Company Wismut describing the hydrology of faulted basement rocks in the Ore Mountains (SE Germany). It consists of more than 5000 detailed descriptions of groundwater inflows to about 660 km of tunnels and 57 km of drillings measured during or shortly after excavation. Inflow measurements (recorded between 1E-8 and 4E-2 m3/s) have been converted to fracture transmissivities using a simplified analytical solution. Discarding site specific effects, the median log transmissivity decreases from 1E-7 to 1E-10 m2/s within the studied depth interval of 0-2000 meters below ground surface (mbgs), and the spacing of conductive fracture increases from 0.1 to 2500 m. This general trend is overprinted at three mining sites by a clear reversal of fracture transmissivity which correlates with contact metamorphic aureoles around Variscan granite intrusions (327-295 Ma). We hypothesize that this transmissivity increase is caused by processes accompanying granite intrusion and contact metamorphism. The thickness of these hydraulically active aureoles is greater in lower-grade metamorphic schist than in higher-grade metamorphic gneisses. Rock mass equivalent continuum conductivities have been estimated by arithmetic averaging of fracture and matrix transmissivities over 100 m intervals and have been converted to permeabilities. The median equivalent continuum permeability decreases with depth according to log(k) = - 1.7 * log(z) - 17.3 (k in m2 and increasing depth z in kilometer being positive). Matrix conductivity controls the bulk conductivity below about 1000 mbgs and is less sensitive to the occurrence of contact metamorphic aureoles.

  10. 3D TEM reconstruction and segmentation process of laminar bio-nanocomposites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iturrondobeitia, M., E-mail: maider.iturrondobeitia@ehu.es; Okariz, A.; Fernandez-Martinez, R.

    2015-03-30

    The microstructure of laminar bio-nanocomposites (Poly (lactic acid)(PLA)/clay) depends on the amount of clay platelet opening after integration with the polymer matrix and determines the final properties of the material. Transmission electron microscopy (TEM) technique is the only one that can provide a direct observation of the layer dispersion and the degree of exfoliation. However, the orientation of the clay platelets, which affects the final properties, is practically immeasurable from a single 2D TEM image. This issue can be overcome using transmission electron tomography (ET), a technique that allows the complete 3D characterization of the structure, including the measurement ofmore » the orientation of clay platelets, their morphology and their 3D distribution. ET involves a 3D reconstruction of the study volume and a subsequent segmentation of the study object. Currently, accurate segmentation is performed manually, which is inefficient and tedious. The aim of this work is to propose an objective/automated segmentation methodology process of a 3D TEM tomography reconstruction. In this method the segmentation threshold is optimized by minimizing the variation of the dimensions of the segmented objects and matching the segmented V{sub clay} (%) and the actual one. The method is first validated using a fictitious set of objects, and then applied on a nanocomposite.« less

  11. The study of RMB exchange rate complex networks based on fluctuation mode

    NASA Astrophysics Data System (ADS)

    Yao, Can-Zhong; Lin, Ji-Nan; Zheng, Xu-Zhou; Liu, Xiao-Feng

    2015-10-01

    In the paper, we research on the characteristics of RMB exchange rate time series fluctuation with methods of symbolization and coarse gaining. First, based on fluctuation features of RMB exchange rate, we define the first type of fluctuation mode as one specific foreign currency against RMB in four days' fluctuating situations, and the second type as four different foreign currencies against RMB in one day's fluctuating situation. With the transforming method, we construct the unique-currency and multi-currency complex networks. Further, through analyzing the topological features including out-degree, betweenness centrality and clustering coefficient of fluctuation-mode complex networks, we find that the out-degree distribution of both types of fluctuation mode basically follows power-law distributions with exponents between 1 and 2. The further analysis reveals that the out-degree and the clustering coefficient generally obey the approximated negative correlation. With this result, we confirm previous observations showing that the RMB exchange rate exhibits a characteristic of long-range memory. Finally, we analyze the most probable transmission route of fluctuation modes, and provide probability prediction matrix. The transmission route for RMB exchange rate fluctuation modes exhibits the characteristics of partially closed loop, repeat and reversibility, which lays a solid foundation for predicting RMB exchange rate fluctuation patterns with large volume of data.

  12. Observation of electromagnetically induced transparency and absorption in Yttrium Iron Garnet loaded split ring resonator

    NASA Astrophysics Data System (ADS)

    Tay, Z. J.; Soh, W. T.; Ong, C. K.

    2018-04-01

    In this paper, we propose a new method of controlling microwave transmission from Electromagnetically Induced Absorption (EIA) to Electromagnetically Induced Transparency (EIT). EIA describes the state where the system strongly absorbs microwaves, whereas EIT describes the state in which the system is transparent to microwaves. Control is achieved via coupling of the 3 GHz photon mode of a metamaterial Split Ring Resonator (SRR) to the spin wave magnon modes of a Yttrium Iron Garnet (YIG) bulk. The system is described by a 2-body interaction matrix with an additional fitting parameter τ which takes into account the fact that the microstrip feed line could excite the SRR as well as the YIG. The parameter τ reveals the effect of geometry and shielding on the coupling behaviour and gives rise to unique physics. In low τ (τ ⩽ 2) configurations, only EIT is reported. However, in high τ (τ ≈ 10) configurations, EIA is reported. Furthermore, we report that the system can be easily changed from a low τ to high τ configuration by shielding the SRR from the microstrip with a thin metal piece. Varying the τ parameter through shielding is thus proposed as a new method of controlling the microwave transmission at the coupling region.

  13. Stochastic Ground Water Flow Simulation with a Fracture Zone Continuum Model

    USGS Publications Warehouse

    Langevin, C.D.

    2003-01-01

    A method is presented for incorporating the hydraulic effects of vertical fracture zones into two-dimensional cell-based continuum models of ground water flow and particle tracking. High hydraulic conductivity features are used in the model to represent fracture zones. For fracture zones that are not coincident with model rows or columns, an adjustment is required for the hydraulic conductivity value entered into the model cells to compensate for the longer flowpath through the model grid. A similar adjustment is also required for simulated travel times through model cells. A travel time error of less than 8% can occur for particles moving through fractures with certain orientations. The fracture zone continuum model uses stochastically generated fracture zone networks and Monte Carlo analysis to quantify uncertainties with simulated advective travel times. An approach is also presented for converting an equivalent continuum model into a fracture zone continuum model by establishing the contribution of matrix block transmissivity to the bulk transmissivity of the aquifer. The methods are used for a case study in west-central Florida to quantify advective travel times from a potential wetland rehydration site to a municipal supply wellfield. Uncertainties in advective travel times are assumed to result from the presence of vertical fracture zones, commonly observed on aerial photographs as photolineaments.

  14. Inhibition effects of protein-conjugated amorphous zinc sulfide nanoparticles on tumor cells growth

    NASA Astrophysics Data System (ADS)

    Cao, Ying; Wang, Hua-Jie; Cao, Cui; Sun, Yuan-Yuan; Yang, Lin; Wang, Bao-Qing; Zhou, Jian-Guo

    2011-07-01

    In this article, a facile and environmentally friendly method was applied to fabricate BSA-conjugated amorphous zinc sulfide (ZnS) nanoparticles using bovine serum albumin (BSA) as the matrix. Transmission electron microscopy analysis indicated that the stable and well-dispersed nanoparticles with the diameter of 15.9 ± 2.1 nm were successfully prepared. The energy dispersive X-ray, X-ray powder diffraction, Fourier transform infrared spectrograph, high resolution transmission electron microscope, and selected area electron diffraction measurements showed that the obtained nanoparticles had the amorphous structure and the coordination occurred between zinc sulfide surfaces and BSA in the nanoparticles. In addition, the inhibition effects of BSA-conjugated amorphous zinc sulfide nanoparticles on tumor cells growth were described in detail by cell viability analysis, optical and electron microscopy methods. The results showed that BSA-conjugated amorphous zinc sulfide nanoparticles could inhibit the metabolism and proliferation of human hepatocellular carcinoma cells, and the inhibition was dose dependent. The half maximal inhibitory concentration (IC50) was 0.36 mg/mL. Overall, this study suggested that BSA-conjugated amorphous zinc sulfide nanoparticles had the application potential as cytostatic agents and BSA in the nanoparticles could provide the modifiable site for the nanoparticles to improve their bioactivity or to endow them with the target function.

  15. Optical transmission of nematic liquid crystal 5CB doped by single-walled and multi-walled carbon nanotubes.

    PubMed

    Lisetski, L N; Fedoryako, A P; Samoilov, A N; Minenko, S S; Soskin, M S; Lebovka, N I

    2014-08-01

    Comparative studies of optical transmission of single-walled carbon nanotubes (SWCNTs) and multi-walled carbon nanotubes (MWCNTs), dispersed in nematic liquid crystal matrix 5CB, were carried out. The data evidence violations of Beer-Lambert-Bouguer (BLB) law both in cell thickness and concentration dependencies. The most striking is the fact that optical transmission dependencies for SWCNTs and MWCNTs were quite different in the nematic phase, but they were practically indistinguishable in the isotropic phase. Monte Carlo simulations of the impact of aggregation on direct transmission and violation of BLB law were also done. The results were discussed accounting for the tortuous shape of CNTs, their physical properties and aggregation, as well as strong impact of perturbations of the nematic 5CB structure inside coils and in the vicinity of CNT aggregates.

  16. Magnetic properties evolution of the CoxFe3-xO4/SiO2 system due to advanced thermal treatment at 700 °C and 1000 °C

    NASA Astrophysics Data System (ADS)

    Dippong, Thomas; Levei, Erika Andrea; Tanaselia, Claudiu; Gabor, Mihai; Nasui, Mircea; Barbu Tudoran, Lucian; Borodi, Gheorghe

    2016-07-01

    The CoxFe3-xO4 (x=0.5-2.5) system embedded in the silica matrix was synthesised by sol-gel method using cobalt nitrate, iron nitrate, 1.4-butanediol and tetraethyl orthosilicate. Five different Co/Fe molar ratios in the presence of diol and one without diol were used for the synthesis. The obtained gels were subjected to thermal treatment at 700 °C and 1000 °C. The oxide species formed in the silica matrix, the optimum temperature for the CoFe2O4 phase formation, the evolution of nanocrystallites size and magnetic properties with the calcination temperature were studied. The formed oxide species were studied using X-ray diffraction, Fourier transformed infrared spectrometry, the Co/Fe molar ratio was confirmed using inductively coupled plasma optical emission spectrometry, the nanocrystallites size, shape and clustering was identified by transmission electron microscopy and scanning electron microscopy, while the formation of magnetic phases was investigated by hysteresis and magnetization derivatives measurements.

  17. Preparation and physical properties of tara gum film reinforced with cellulose nanocrystals.

    PubMed

    Ma, Qianyun; Hu, Dongying; Wang, Lijuan

    2016-05-01

    Cellulose nanocrystals (CNC) prepared from microcrystalline cellulose were blended in tara gum solution to prepare nanocomposite films. The morphology, crystallinity, and thermal properties of the CNC and films were evaluated by using transmission electron microscopy, X-ray diffractometry, and thermogravimetric analysis, respectively. The resultant CNC was rod-shaped with diameters of around 8.6 nm. The effect of CNC content on physical and thermal properties of films was studied. The composite film tensile strength increased from 27.86 to 65.73 MPa, elastic modulus increased from 160.98 MPa to 882.49 MPa and the contact angle increased from 55.8° to 98.7° with increasing CNC content from 0 to 6 wt%. However, CNC addition increased the thermal stability slightly and CNC content above 6 wt% decreased the tensile strength by CNC aggregation in the matrix. The nanocomposite film containing 6 wt% CNC possessed the highest light transmittance, mechanical properties, and lowest oxygen permeability. CNC addition is a suitable method to modify tara gum matrix polymer properties. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. A Transfer Hamiltonian Model for Devices Based on Quantum Dot Arrays

    PubMed Central

    Illera, S.; Prades, J. D.; Cirera, A.; Cornet, A.

    2015-01-01

    We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide. PMID:25879055

  19. Magnetic anisotropy of nickel nanorods and the mechanical torque in an elastic environment

    NASA Astrophysics Data System (ADS)

    Schopphoven, C.; Tschöpe, A.

    2018-03-01

    Nickel nanorods with average length L=340~nm and diameter D=20~nm were prepared by the anodic aluminum oxide (AAO)-template method, processed to a colloidal dispersion and embedded in a gelatine hydrogel matrix at low volume fraction φ ≤slant 10-4 . The large aspect ratio of these single-domain particles gives rise to a high magnetic shape anisotropy in combination with a significant anisotropic optical polarizability. The magnetic anisotropy enables exertion of a torque on nanorods without contact by applying a homogeneous magnetic field. In response, the nanorods rotate by an angle which is determined by the balance between the magnetic torque and the mechanical counter torque, caused by the elastic deformation of the surrounding matrix. This rotation was experimentally detected using optical transmission of linearly polarized light. We used the combination of magnetization and torque-driven rotation measurements to evaluate an adapted Stoner-Wohlfarth model of the orientation- and field-dependent magnetic torque on Ni nanorods in an elastic environment as base for optimization of torque-driven magnetic actuators.

  20. Phase separation in SiGe nanocrystals embedded in SiO{sub 2} matrix during high temperature annealing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mogaddam, N. A. P.; Turan, R.; Alagoz, A. S.

    2008-12-15

    SiGe nanocrystals have been formed in SiO{sub 2} matrix by cosputtering Si, Ge, and SiO{sub 2} independently on Si substrate. Effects of the annealing time and temperature on structural and compositional properties are studied by transmission electron microscopy, x-ray diffraction (XRD), and Raman spectroscopy measurements. It is observed that Ge-rich Si{sub (1-x)}Ge{sub x} nanocrystals do not hold their compositional uniformity when annealed at high temperatures for enough long time. A segregation process leading to separation of Ge and Si atoms from each other takes place. This process has been evidenced by a double peak formation in the XRD and Ramanmore » spectra. We attributed this phase separation to the differences in atomic size, surface energy, and surface diffusion disparity between Si and Ge atoms leading to the formation of nonhomogenous structure consist of a Si-rich SiGe core covered by a Ge-rich SiGe shell. This experimental observation is consistent with the result of reported theoretical and simulation methods.« less

  1. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  2. A transfer hamiltonian model for devices based on quantum dot arrays.

    PubMed

    Illera, S; Prades, J D; Cirera, A; Cornet, A

    2015-01-01

    We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide.

  3. Quantitatively characterizing the microstructural features of breast ductal carcinoma tissues in different progression stages by Mueller matrix microscope.

    PubMed

    Dong, Yang; Qi, Ji; He, Honghui; He, Chao; Liu, Shaoxiong; Wu, Jian; Elson, Daniel S; Ma, Hui

    2017-08-01

    Polarization imaging has been recognized as a potentially powerful technique for probing the microstructural information and optical properties of complex biological specimens. Recently, we have reported a Mueller matrix microscope by adding the polarization state generator and analyzer (PSG and PSA) to a commercial transmission-light microscope, and applied it to differentiate human liver and cervical cancerous tissues with fibrosis. In this paper, we apply the Mueller matrix microscope for quantitative detection of human breast ductal carcinoma samples at different stages. The Mueller matrix polar decomposition and transformation parameters of the breast ductal tissues in different regions and at different stages are calculated and analyzed. For more quantitative comparisons, several widely-used image texture feature parameters are also calculated to characterize the difference in the polarimetric images. The experimental results indicate that the Mueller matrix microscope and the polarization parameters can facilitate the quantitative detection of breast ductal carcinoma tissues at different stages.

  4. On the use of the fourier modal method for calculation of localized eigenmodes of integrated optical resonators O пpineнeнii neToдa фypьe-noд k pacчёTy лokaлiзoвaнныx noд iнTegpaльныx oпTiчeckix peзoнaTopoв</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Bykov, D. A.; Doskolovich, L. L.</p> <p>2015-12-01</p> <p>We propose the generalization of the Fourier modal method aimed at calculating localized eigenmodes of integrated optical resonators. The method is based on constructing the analytic continuation of the structure's scattering matrix and calculating its poles. The method allows one to calculate the complex frequency of the localized mode and the corresponding field distribution. We use the proposed method to calculate the eigenmodes of rectangular dielectric block located on metal surface. We show that excitation of these modes by surface plasmon-polariton (SPP) results in resonant features in the SPP transmission spectrum. The proposed method can be used to design and investigate optical properties of integrated and plasmonic optical devices.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19880019596','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19880019596"><span>Investigation of a SiC/Ti-24Al-11Nb composite</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Brindley, P. K.; Bartolotta, P. A.; Klima, S. J.</p> <p>1988-01-01</p> <p>A summary of ongoing research on the characterization of a continuous fiber reinforced SiC/Ti-24Al-11Nb (at percent) composite is presented. The powder metallurgy fabrication technique is described as are the nondestructive evaluation results of the as-fabricated composite plates. Tensile properties of the SiC fiber, the matrix material, and the 0-deg SiC/Ti-24Al-11Nb composite (fibers oriented unidirectionally, parallel to the loading axis) from room temperature to 1100 C are presented and discussed with regard to the resultant fractography. The as-fabricated fiber-matrix interface has been examined by scanning transmission electron microscopy and the compounds present in the reaction zone have been identified. Fiber-matrix interaction and stability of the matrix near the fiber is characterized at 815, 985, and 1200 C from 1 to 500 hr. Measurements of the fiber-matrix reaction, the loss of C-rich coating from the surface of the SiC fiber, and the growth of the Beta depleted zone in the matrix adjacent to the fiber are presented. These data and the difference in coefficient of thermal expansion between the fiber and the matrix are discussed in terms of their likely effects on mechanical properties.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28936658','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28936658"><span>Analysis of Peroxisome Biogenesis in Pollen by Confocal Microscopy and Transmission Electron Microscopy.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Jia, Peng-Fei; Li, Hong-Ju; Yang, Wei-Cai</p> <p>2017-01-01</p> <p>Peroxisome is an essential single-membrane bound organelle in most eukaryotic cells and functions in diverse cellular processes. De novo formation, division, and turnover of peroxisomes contribute to its biogenesis, morphology, and population regulation. In plants, peroxisome plays multiple roles, including metabolism, development, and stress response. Defective peroxisome biogenesis and development retard plant growth, adaption, and reproduction. Through tracing the subcellular localization of fluorescent reporter tagged matrix protein of peroxisome, fluorescence microscopy is a reliable and fast way to detect peroxisome biogenesis. Further fine-structural observation of peroxisome by TEM enables researchers to observe the detailed ultrastructure of its morphology and spatial contact with other organelles. Pollen grain is a specialized structure where two small sperm cells are enclosed in the cytoplasm of a large vegetative cell. Two features make pollen grain a good system to study peroxisome biogenesis: indispensable requirement of peroxisome for germination on the stigma and homogeneity. Here, we describe the methods of studying peroxisome biogenesis in Arabidopsis pollen grains by fluorescent live-imaging with confocal laser scanning microscopy (CLSM) and by DAB-staining based transmission electron microscopy (TEM).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MMI...tmp...53W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MMI...tmp...53W"><span>Effect of Various Retrogression Regimes on Aging Behavior and Precipitates Characterization of a High Zn-Containing Al-Zn-Mg-Cu Alloy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wen, Kai; Xiong, Baiqing; Zhang, Yongan; Li, Zhihui; Li, Xiwu; Huang, Shuhui; Yan, Lizhen; Yan, Hongwei; Liu, Hongwei</p> <p>2018-03-01</p> <p>In the present work, the influence of various retrogression treatments on hardness, electrical conductivity and mechanical properties of a high Zn-containing Al-Zn-Mg-Cu alloy is investigated and several retrogression regimes subjected to a same strength level are proposed. The precipitates are qualitatively investigated by means of transmission electron microscopy (TEM) and high-resolution transmission electron microscopy techniques. Based on the matrix precipitate observations, the distributions of precipitate size and nearest inter-precipitate distance are extracted from bright-field TEM images projected along <110>Al orientation with the aid of an imaging analysis and an arithmetic method. The results show that GP zones and η' precipitates are the major precipitates and the precipitate size and its distribution range continuously enlarge with the retrogression regime expands to an extent of high temperature. The nearest inter-precipitate distance ranges obtained are quite the same and the average distance of nearest inter-precipitates show a slight increase. The influence of precipitates on mechanical properties is discussed through the interaction relationship between precipitates and dislocations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MMI....24..537W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MMI....24..537W"><span>Effect of Various Retrogression Regimes on Aging Behavior and Precipitates Characterization of a High Zn-Containing Al-Zn-Mg-Cu Alloy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wen, Kai; Xiong, Baiqing; Zhang, Yongan; Li, Zhihui; Li, Xiwu; Huang, Shuhui; Yan, Lizhen; Yan, Hongwei; Liu, Hongwei</p> <p>2018-05-01</p> <p>In the present work, the influence of various retrogression treatments on hardness, electrical conductivity and mechanical properties of a high Zn-containing Al-Zn-Mg-Cu alloy is investigated and several retrogression regimes subjected to a same strength level are proposed. The precipitates are qualitatively investigated by means of transmission electron microscopy (TEM) and high-resolution transmission electron microscopy techniques. Based on the matrix precipitate observations, the distributions of precipitate size and nearest inter-precipitate distance are extracted from bright-field TEM images projected along <110>Al orientation with the aid of an imaging analysis and an arithmetic method. The results show that GP zones and η' precipitates are the major precipitates and the precipitate size and its distribution range continuously enlarge with the retrogression regime expands to an extent of high temperature. The nearest inter-precipitate distance ranges obtained are quite the same and the average distance of nearest inter-precipitates show a slight increase. The influence of precipitates on mechanical properties is discussed through the interaction relationship between precipitates and dislocations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/11865552','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/11865552"><span>[Nosocomial infections due to human coronaviruses in the newborn].</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Gagneur, A; Legrand, M C; Picard, B; Baron, R; Talbot, P J; de Parscau, L; Sizun, J</p> <p>2002-01-01</p> <p>Human coronaviruses, with two known serogroups named 229-E and OC-43, are enveloped positive-stranded RNA viruses. The large RNA is surrounded by a nucleoprotein (protein N). The envelop contains 2 or 3 glycoproteins: spike protein (or protein S), matrix protein (or protein M) and a hemagglutinin (or protein HE). Their pathogen role remains unclear because their isolation is difficult. Reliable and rapid methods as immunofluorescence with monoclonal antibodies and reverse transcription-polymerase chain reaction allow new researches on epidemiology. Human coronaviruses can survive for as long as 6 days in suspension and 3 hours after drying on surfaces, suggesting that they could be a source of hospital-acquired infections. Two prospective studies conducted in a neonatal and paediatric intensive care unit demonstrated a significant association of coronavirus-positive nasopharyngal samples with respiratory illness in hospitalised preterm neonates. Positive samples from staff suggested either a patient-to-staff or a staff-to-patient transmission. No cross-infection were observed from community-acquired respiratory-syncitial virus or influenza-infected children to neonates. Universal precautions with hand washing and surface desinfection could be proposed to prevent coronavirus transmission.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/12908305','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/12908305"><span>New poly(butylene succinate)/layered silicate nanocomposites: preparation and mechanical properties.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ray, Suprakas Sinha; Okamoto, Kazuaki; Maiti, Pralay; Okamoto, Masami</p> <p>2002-04-01</p> <p>New poly(butylene succinate) (PBS)/layered silicate nanocomposites have been successfully prepared by simple melt extrusion of PBS and octadecylammonium modified montmorillonite (C18-mmt) at 150 degrees C. The d-spacing of both C18-mmt and intercalated nanocomposites was investigated by wide-angle X-ray diffraction analysis. Bright-field transmission electron microscopic study showed several stacked silicate layers with random orientation in the PBS matrix. The intercalated nanocomposites exhibited remarkable improvement of mechanical properties in both solid and melt states as compared with that of PBS matrix without clay.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA093645','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA093645"><span>Development of a Tabletop Model for the Generation of Amorphous/ Microcrystalline Metal Powders</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1980-04-30</p> <p>Voltage Characteristics for Wetting (si) and Non-wetting (AZ 4.5% Cu ) EHD Spray 2-57 28 Schematic of the Process of Electrohydrodynamic Droplet...Microscope Image of a Deposit , Fine Powders and "Matrix" Film of Fe-Ni-B-P Metallic Glass Alloy Produced by the EHD Technique 3-9 45 Selected Area...Transmission Electron Microscope Image of a Deposit , Fine Powders and "Matrix" Film of Fe-Ni-B-P Metallic Glass Alloy Produced by the EHD Technique 3-11 xi</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1221541-duplex-precipitates-effects-room-temperature-fracture-behaviour-nial-strengthened-ferritic-alloy','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1221541-duplex-precipitates-effects-room-temperature-fracture-behaviour-nial-strengthened-ferritic-alloy"><span>Duplex precipitates and their effects on the room-temperature fracture behaviour of a NiAl-strengthened ferritic alloy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Sun, Zhiqian; Song, Gian; Ilavsky, Jan; ...</p> <p>2015-03-23</p> <p>Duplex precipitates are presented in a NiAl-strengthened ferritic alloy. They were characterized by the ultra-small angle X-ray scattering and transmission electron microscope. Fine cooling precipitates with the size of several to tens of nanometres harden the matrix considerably at room temperature. The cracks will likely to initiate from precipitates, and coalesce and propagate quickly through the matrix due to the excessive hardening effect of cooling precipitates, which lead to the premature fracture of NiAl-strengthened ferritic alloys.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1278749','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1278749"><span>Matrix recrystallization for MALDI-MS imaging of maize lipids at high-spatial resolution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Duenas, Maria Emilia; Carlucci, Laura; Lee, Young Jin</p> <p></p> <p>Matrix recrystallization is optimized and applied to improve lipid ion signals in maize embryos and leaves. A systematic study was performed varying solvent and incubation time. During this study, unexpected side reactions were found when methanol was used as a recrystallization solvent, resulting in the formation of a methyl ester of phosphatidic acid. Furthermore, using an optimum recrystallization condition with isopropanol, there is no apparent delocalization demonstrated with a transmission electron microscopy (TEM) pattern and maize leaf images obtained at 10 μm spatial resolution.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1278749-matrix-recrystallization-maldi-ms-imaging-maize-lipids-high-spatial-resolution','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1278749-matrix-recrystallization-maldi-ms-imaging-maize-lipids-high-spatial-resolution"><span>Matrix recrystallization for MALDI-MS imaging of maize lipids at high-spatial resolution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Duenas, Maria Emilia; Carlucci, Laura; Lee, Young Jin</p> <p>2016-06-27</p> <p>Matrix recrystallization is optimized and applied to improve lipid ion signals in maize embryos and leaves. A systematic study was performed varying solvent and incubation time. During this study, unexpected side reactions were found when methanol was used as a recrystallization solvent, resulting in the formation of a methyl ester of phosphatidic acid. Furthermore, using an optimum recrystallization condition with isopropanol, there is no apparent delocalization demonstrated with a transmission electron microscopy (TEM) pattern and maize leaf images obtained at 10 μm spatial resolution.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016JASMS..27.1575D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016JASMS..27.1575D"><span>Matrix Recrystallization for MALDI-MS Imaging of Maize Lipids at High-Spatial Resolution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Dueñas, Maria Emilia; Carlucci, Laura; Lee, Young Jin</p> <p>2016-09-01</p> <p>Matrix recrystallization is optimized and applied to improve lipid ion signals in maize embryos and leaves. A systematic study was performed varying solvent and incubation time. During this study, unexpected side reactions were found when methanol was used as a recrystallization solvent, resulting in the formation of a methyl ester of phosphatidic acid. Using an optimum recrystallization condition with isopropanol, there is no apparent delocalization demonstrated with a transmission electron microscopy (TEM) pattern and maize leaf images obtained at 10 μm spatial resolution.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19820008024','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19820008024"><span>Role of optical computers in aeronautical control applications</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Baumbick, R. J.</p> <p>1981-01-01</p> <p>The role that optical computers play in aircraft control is determined. The optical computer has the potential high speed capability required, especially for matrix/matrix operations. The optical computer also has the potential for handling nonlinear simulations in real time. They are also more compatible with fiber optic signal transmission. Optics also permit the use of passive sensors to measure process variables. No electrical energy need be supplied to the sensor. Complex interfacing between optical sensors and the optical computer is avoided if the optical sensor outputs can be directly processed by the optical computer.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27349253','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27349253"><span>Matrix Recrystallization for MALDI-MS Imaging of Maize Lipids at High-Spatial Resolution.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Dueñas, Maria Emilia; Carlucci, Laura; Lee, Young Jin</p> <p>2016-09-01</p> <p>Matrix recrystallization is optimized and applied to improve lipid ion signals in maize embryos and leaves. A systematic study was performed varying solvent and incubation time. During this study, unexpected side reactions were found when methanol was used as a recrystallization solvent, resulting in the formation of a methyl ester of phosphatidic acid. Using an optimum recrystallization condition with isopropanol, there is no apparent delocalization demonstrated with a transmission electron microscopy (TEM) pattern and maize leaf images obtained at 10 μm spatial resolution. Graphical Abstract ᅟ.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28888098','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28888098"><span>Wave propagation through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Jiao, Fengyu; Wei, Peijun; Li, Yueqiu</p> <p>2018-01-01</p> <p>Reflection and transmission of plane waves through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces are studied in this paper. The secular equations in the flexoelectric piezoelectric material are first derived from the general governing equation. Different from the classical piezoelectric medium, there are five kinds of coupled elastic waves in the piezoelectric material with the microstructure effects taken into consideration. The state vectors are obtained by the summation of contributions from all possible partial waves. The state transfer equation of flexoelectric piezoelectric slab is derived from the motion equation by the reduction of order, and the transfer matrix of flexoelectric piezoelectric slab is obtained by solving the state transfer equation. By using the continuous conditions at the interface and the approach of partition matrix, we get the resultant algebraic equations in term of the transfer matrix from which the reflection and transmission coefficients can be calculated. The amplitude ratios and further the energy flux ratios of various waves are evaluated numerically. The numerical results are shown graphically and are validated by the energy conservation law. Based on these numerical results, the influences of two characteristic lengths of microstructure and the flexoelectric coefficients on the wave propagation are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19980002525','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19980002525"><span>Determination of Residual Stress in Composite Materials Using Ultrasonic Waves</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Rokhlin, S. I.</p> <p>1997-01-01</p> <p>The performance of high temperature composites can be significantly affected by the presence of residual stresses. These stresses arise during cooling processes from fabrication to room temperature due to mismatch of thermal expansion coefficients between matrix and fiber materials. This effect is especially pronounced in metal matrix and intermetallic composites. It can lead to plastic deformations, matrix cracking and fiber/matrix interface debonding. In this work the feasibility of ultrasonic techniques for residual stress assessment in composites is addressed. A novel technique for absolute stress determination in orthotropic materials from angular dependencies of ultrasonic velocities is described. The technique is applicable for determination of both applied and residual stresses and does not require calibration measurements on a reference sample. The important advantage of this method is that stress is determined simultaneously with stress-dependent elastic constants and is thus decoupled from the material texture. It is demonstrated that when the principal plane stress directions coincide with acoustical axes, the angular velocity data in the plane perpendicular to the stress plane may be used to determine both stress components. When the stress is off the acoustical axes, the shear and the difference of the normal stress components may be determined from the angular dependence of group velocities in the plane of stresses. Synthetic sets of experimental data corresponding to materials with different anisotropy and stress levels are used to check the applicability of the technique. The method is also verified experimentally. A high precision ultrasonic wave transmission technique is developed to measure angular dependence of ultrasonic velocities. Examples of stress determination from experimental velocity data are given. A method is presented for determination of velocities of ultrasonic waves propagating through the composite material with residual stresses. It is based on the generalized self-consistent multiple scattering model. Calculation results for longitudinal and shear ultrasonic wave velocities propagating perpendicular to the fibers direction in SCS-6/Ti composite with and without residual stresses are presented. They show that velocity changes due to presence of stresses are of order 1%.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20140012903','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20140012903"><span>A TEM Investigation of the Fine-Grained Matrix of the Martian Basaltic Breccia NWA 7034</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Muttik, N.; Keller, L. P.; Agee, C. B.; McCubbin, F. M.; Santos, A. R.; Rahman, Z.</p> <p>2014-01-01</p> <p>The martian basaltic breccia NWA 7034 is characterized by fine-grained groundmass containing several different types of mineral grains and lithologic clasts. The matrix composition closely resembles Martian crustal rock and soil composition measured by recent rover and orbiter missions. The first results of NWA 7034 suggest that the brecciation of this martian meteorite may have formed due to eruptive volcanic processes; however, impact related brecciation processes have been proposed for paired meteorites NWA 7533 and NWA 7475]. Due to the very fine grain size of matrix, its textural details are difficult to resolve by optical and microprobe observations. In order to examine the potential nature of brecciation, transmission electron microscopy (TEM) studies combined with focused ion-beam technique (FIB) has been undertaken. Here we present the preliminary observations of fine-grained groundmass of NWA 7034 from different matrix areas by describing its textural and mineralogical variations and micro-structural characteristics.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li class="active"><span>21</span></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_21 --> <div id="page_22" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li class="active"><span>22</span></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="421"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018ResPh...9...71T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018ResPh...9...71T"><span>PEG-template for surface modification of zeolite: A convenient material to the design of polypropylene based composite for packaging films</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Toommee, S.; Pratumpong, P.</p> <p>2018-06-01</p> <p>Zeolite was successfully modified by conventional synthetic route. Polyethylene glycol was employed for surface modification of zeolite. The surface of zeolite exhibited therefore hydrophobic properties. Less than 5 wt% of modified zeolites with uniform size and shape were integrated into polypropylene matrix. Mechanical properties of composite exhibited the similar trend compare to neat polypropylene. Oxygen transmission rate and water vapor transmission rate were evaluated and it exhibited the strong potential to be a good candidate material in active packaging.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4347311','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4347311"><span>Transmission Electron Microscopy Analysis of Skin Lesions from Sporotrichosis Epidemic in Rio de Janeiro, Brazil</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Porto Ferreira, Cassio; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana</p> <p>2015-01-01</p> <p>Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. PMID:25653392</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22084044','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22084044"><span>Vibrotactile pattern recognition: a portable compact tactile matrix.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Thullier, Francine; Bolmont, Benoît; Lestienne, Francis G</p> <p>2012-02-01</p> <p>Compact tactile matrix (CTM) is a vibrotactile device composed of a seven-by-seven array of electromechanical vibrators "tactip" used to represent tactile patterns applied to a small skin area. The CTM uses a dynamic feature to generate spatiotemporal tactile patterns. The design requirements focus particularly on maximizing the transmission of the vibration from one tactip to the others as well as to the skin over a square area of 16 cm (2) while simultaneously minimizing the transmission of vibrations throughout the overall structure of the CTM. Experiments were conducted on 22 unpracticed subjects to evaluate how the CTM could be used to develop a tactile semantics for communication of instructions in order to test the ability of the subjects to identify: 1) directional prescriptors for gesture guidance and 2) instructional commands for operational task requirements in a military context. The results indicate that, after familiarization, recognition accuracies in the tactile patterns were remarkably precise for more 80% of the subjects. © 2011 IEEE</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24896880','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24896880"><span>Transmission geometry laserspray ionization vacuum using an atmospheric pressure inlet.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lutomski, Corinne A; El-Baba, Tarick J; Inutan, Ellen D; Manly, Cory D; Wager-Miller, James; Mackie, Ken; Trimpin, Sarah</p> <p>2014-07-01</p> <p>This represents the first report of laserspray ionization vacuum (LSIV) with operation directly from atmospheric pressure for use in mass spectrometry. Two different types of electrospray ionization source inlets were converted to LSIV sources by equipping the entrance of the atmospheric pressure inlet aperture with a customized cone that is sealed with a removable glass plate holding the matrix/analyte sample. A laser aligned in transmission geometry (at 180° relative to the inlet) ablates the matrix/analyte sample deposited on the vacuum side of the glass slide. Laser ablation from vacuum requires lower inlet temperature relative to laser ablation at atmospheric pressure. However, higher inlet temperature is required for high-mass analytes, for example, α-chymotrypsinogen (25.6 kDa). Labile compounds such as gangliosides and cardiolipins are detected in the negative ion mode directly from mouse brain tissue as intact doubly deprotonated ions. Multiple charging enhances the ion mobility spectrometry separation of ions derived from complex tissue samples.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4082395','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4082395"><span>Transmission Geometry Laserspray Ionization Vacuum Using an Atmospheric Pressure Inlet</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2015-01-01</p> <p>This represents the first report of laserspray ionization vacuum (LSIV) with operation directly from atmospheric pressure for use in mass spectrometry. Two different types of electrospray ionization source inlets were converted to LSIV sources by equipping the entrance of the atmospheric pressure inlet aperture with a customized cone that is sealed with a removable glass plate holding the matrix/analyte sample. A laser aligned in transmission geometry (at 180° relative to the inlet) ablates the matrix/analyte sample deposited on the vacuum side of the glass slide. Laser ablation from vacuum requires lower inlet temperature relative to laser ablation at atmospheric pressure. However, higher inlet temperature is required for high-mass analytes, for example, α-chymotrypsinogen (25.6 kDa). Labile compounds such as gangliosides and cardiolipins are detected in the negative ion mode directly from mouse brain tissue as intact doubly deprotonated ions. Multiple charging enhances the ion mobility spectrometry separation of ions derived from complex tissue samples. PMID:24896880</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MSSP..106..249Z','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MSSP..106..249Z"><span>Clutch pressure estimation for a power-split hybrid transmission using nonlinear robust observer</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zhou, Bin; Zhang, Jianwu; Gao, Ji; Yu, Haisheng; Liu, Dong</p> <p>2018-06-01</p> <p>For a power-split hybrid transmission, using the brake clutch to realize the transition from electric drive mode to hybrid drive mode is an available strategy. Since the pressure information of the brake clutch is essential for the mode transition control, this research designs a nonlinear robust reduced-order observer to estimate the brake clutch pressure. Model uncertainties or disturbances are considered as additional inputs, thus the observer is designed in order that the error dynamics is input-to-state stable. The nonlinear characteristics of the system are expressed as the lookup tables in the observer. Moreover, the gain matrix of the observer is solved by two optimization procedures under the constraints of the linear matrix inequalities. The proposed observer is validated by offline simulation and online test, the results have shown that the observer achieves significant performance during the mode transition, as the estimation error is within a reasonable range, more importantly, it is asymptotically stable.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016OptEn..55l1703G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016OptEn..55l1703G"><span>Total variation optimization for imaging through turbid media with transmission matrix</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Gong, Changmei; Shao, Xiaopeng; Wu, Tengfei; Liu, Jietao; Zhang, Jianqi</p> <p>2016-12-01</p> <p>With the transmission matrix (TM) of the whole optical system measured, the image of the object behind a turbid medium can be recovered from its speckle field by means of an image reconstruction algorithm. Instead of Tikhonov regularization algorithm (TRA), the total variation minimization by augmented Lagrangian and alternating direction algorithms (TVAL3) is introduced to recover object images. As a total variation (TV)-based approach, TVAL3 allows to effectively damp more noise and preserve more edges compared with TRA, thus providing more outstanding image quality. Different levels of detector noise and TM-measurement noise are successively added to analyze the antinoise performance of these two algorithms. Simulation results show that TVAL3 is able to recover more details and suppress more noise than TRA under different noise levels, thus providing much more excellent image quality. Furthermore, whether it be detector noise or TM-measurement noise, the reconstruction images obtained by TVAL3 at SNR=15 dB are far superior to those by TRA at SNR=50 dB.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018SPIE10539E..1BB','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018SPIE10539E..1BB"><span>Implementation of webcam-based hyperspectral imaging system</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Balooch, Ali; Nazeri, Majid; Abbasi, Hamed</p> <p>2018-02-01</p> <p>In the present work, a hyperspectral imaging system (imaging spectrometer) using a commercial webcam has been designed and developed. This system was able to capture two-dimensional spectra (in emission, transmission and reflection modes) directly from the scene in the desired wavelengths. Imaging of the object is done directly by linear sweep (pushbroom method). To do so, the spectrometer is equipped with a suitable collecting lens and a linear travel stage. A 1920 x 1080 pixel CMOS webcam was used as a detector. The spectrometer has been calibrated by the reference spectral lines of standard lamps. The spectral resolution of this system was about 2nm and its spatial resolution was about 1 mm for a 10 cm long object. The hardware solution is based on data acquisition working on the USB platform and controlled by a LabVIEW program. In this system, the initial output was a three-dimensional matrix in which two dimensions of the matrix were related to the spatial information of the object and the third dimension was the spectrum of any point of the object. Finally, the images in different wavelengths were created by reforming the data of the matrix. The free spectral range (FSR) of the system was 400 to 1100 nm. The system was successfully tested for some applications, such as plasma diagnosis as well as applications in food and agriculture sciences.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26736533','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26736533"><span>Steganography in arrhythmic electrocardiogram signal.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Edward Jero, S; Ramu, Palaniappan; Ramakrishnan, S</p> <p>2015-08-01</p> <p>Security and privacy of patient data is a vital requirement during exchange/storage of medical information over communication network. Steganography method hides patient data into a cover signal to prevent unauthenticated accesses during data transfer. This study evaluates the performance of ECG steganography to ensure secured transmission of patient data where an abnormal ECG signal is used as cover signal. The novelty of this work is to hide patient data into two dimensional matrix of an abnormal ECG signal using Discrete Wavelet Transform and Singular Value Decomposition based steganography method. A 2D ECG is constructed according to Tompkins QRS detection algorithm. The missed R peaks are computed using RR interval during 2D conversion. The abnormal ECG signals are obtained from the MIT-BIH arrhythmia database. Metrics such as Peak Signal to Noise Ratio, Percentage Residual Difference, Kullback-Leibler distance and Bit Error Rate are used to evaluate the performance of the proposed approach.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017CoPhC.212....8P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017CoPhC.212....8P"><span>Improvements on non-equilibrium and transport Green function techniques: The next-generation TRANSIESTA</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Papior, Nick; Lorente, Nicolás; Frederiksen, Thomas; García, Alberto; Brandbyge, Mads</p> <p>2017-03-01</p> <p>We present novel methods implemented within the non-equilibrium Green function code (NEGF) TRANSIESTA based on density functional theory (DFT). Our flexible, next-generation DFT-NEGF code handles devices with one or multiple electrodes (Ne ≥ 1) with individual chemical potentials and electronic temperatures. We describe its novel methods for electrostatic gating, contour optimizations, and assertion of charge conservation, as well as the newly implemented algorithms for optimized and scalable matrix inversion, performance-critical pivoting, and hybrid parallelization. Additionally, a generic NEGF "post-processing" code (TBTRANS/PHTRANS) for electron and phonon transport is presented with several novelties such as Hamiltonian interpolations, Ne ≥ 1 electrode capability, bond-currents, generalized interface for user-defined tight-binding transport, transmission projection using eigenstates of a projected Hamiltonian, and fast inversion algorithms for large-scale simulations easily exceeding 106 atoms on workstation computers. The new features of both codes are demonstrated and bench-marked for relevant test systems.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27010536','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27010536"><span>A Biological Approach for the Synthesis of Bismuth Nanoparticles: Using Thiolated M13 Phage as Scaffold.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Vera-Robles, L Irais; Escobar-Alarcón, Luis; Picquart, Michel; Hernández-Pozos, J Luis; Haro-Poniatowski, Emmanuel</p> <p>2016-04-05</p> <p>We report the synthesis of Bi nanoparticles (Bi NPs) using the M13 phage as scaffold. The p8 protein of the phage is functionalized with thiol groups of different lengths, and these thiolated regions act as nucleation centers for Bi(3+) ions. The size distribution, shape, and resilience to oxidation of the Bi NPs depend on the length of the thiol group used. The NPs are characterized by high resolution transmission electron microscopy, Raman, and IR spectroscopies, matrix assisted laser desorption/ionization, and optical absorption. These results show that the nanoparticles are crystalline and have a typical diameter of ∼3.0 nm. The method of preparation presented here is reproducible and implies "greener" conditions than those reported elsewhere. To the best of our knowledge, this is the first report of bismuth nanoparticles synthesized by a biomineralization method.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22274225','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22274225"><span>Weakly modulated silicon-dioxide-cladding gratings for silicon waveguide Fabry-Pérot cavities.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Grote, Richard R; Driscoll, Jeffrey B; Biris, Claudiu G; Panoiu, Nicolae C; Osgood, Richard M</p> <p>2011-12-19</p> <p>We show by theory and experiment that silicon-dioxide-cladding gratings for Fabry-Pérot cavities on silicon-on-insulator channel ("wire") waveguides provide a low-refractive-index perturbation, which is required for several important integrated photonics components. The underlying refractive index perturbation of these gratings is significantly weaker than that of analogous silicon gratings, leading to finer control of the coupling coefficient κ. Our Fabry-Pérot cavities are designed using the transfer-matrix method (TMM) in conjunction with the finite element method (FEM) for calculating the effective index of each waveguide section. Device parameters such as coupling coefficient, κ, Bragg mirror stop band, Bragg mirror reflectivity, and quality factor Q are examined via TMM modeling. Devices are fabricated with representative values of distributed Bragg reflector lengths, cavity lengths, and propagation losses. The measured transmission spectra show excellent agreement with the FEM/TMM calculations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29334739','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29334739"><span>Microfluidic-Assisted Production of Size-Controlled Superparamagnetic Iron Oxide Nanoparticles-Loaded Poly(methyl methacrylate) Nanohybrids.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ding, Shukai; Attia, Mohamed F; Wallyn, Justine; Taddei, Chiara; Serra, Christophe A; Anton, Nicolas; Kassem, Mohamad; Schmutz, Marc; Er-Rafik, Meriem; Messaddeq, Nadia; Collard, Alexandre; Yu, Wei; Giordano, Michele; Vandamme, Thierry F</p> <p>2018-02-06</p> <p>In this paper, superparamagnetic iron oxide nanoparticles (SPIONs, around 6 nm) encapsulated in poly(methyl methacrylate) nanoparticles (PMMA NPs) with controlled sizes ranging from 100 to 200 nm have been successfully produced. The hybrid polymeric NPs were prepared following two different methods: (1) nanoprecipitation and (2) nanoemulsification-evaporation. These two methods were implemented in two different microprocesses based on the use of an impact jet micromixer and an elongational-flow microemulsifier. SPIONs-loaded PMMA NPs synthesized by the two methods presented completely different physicochemical properties. The polymeric NPs prepared with the micromixer-assisted nanoprecipitation method showed a heterogeneous dispersion of SPIONs inside the polymer matrix, an encapsulation efficiency close to 100 wt %, and an irregular shape. In contrast, the polymeric NPs prepared with the microfluidic-assisted nanoemulsification-evaporation method showed a homogeneous dispersion, an almost complete encapsulation, and a spherical shape. The properties of the polymeric NPs have been characterized by dynamic light scattering, thermogravimetric analysis, and transmission electron microscope. In vitro cytotoxicity assays were also performed on the nanohybrids and pure PMMA NPs.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/764685','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/764685"><span>Development and Evaluation of an Externally Air-Cooled Low-Flow torch and the Attenuation of Space Charge and Matrix Effects in Inductively Coupled Plasma Mass Spectrometry</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Praphairaksit, Narong</p> <p>2000-09-12</p> <p>An externally air-cooled low-flow torch has been constructed and successfully demonstrated for applications in inductively coupled plasma mass spectrometry (ICP-MS). The torch is cooled by pressurized air flowing at ~70 L/min through a quartz air jacket onto the exterior of the outer tube. The outer gas flow rate and operating RF forward power are reduced considerably. Although plasmas can be sustained at the operating power as low as 400 W with a 2 L/min of outer gas flow, somewhat higher power and outer gas flows are advisable. A stable and analytical useful plasma can be obtained at 850 W withmore » an outer gas flow rate of ~4 L/min. Under these conditions, the air-cooled plasma produces comparable sensitivities, doubly charged ion ratios, matrix effects and other analytical merits as those produced by a conventional torch while using significantly less argon and power requirements. Metal oxide ion ratios are slightly higher with the air-cooled plasma but can be mitigated by reducing the aerosol gas flow rate slightly with only minor sacrifice in analyte sensitivity. A methodology to alleviate the space charge and matrix effects in ICP-MS has been developed. A supplemental electron source adapted from a conventional electron impact ionizer is added to the base of the skimmer. Electrons supplied from this source downstream of the skimmer with suitable amount and energy can neutralize the positive ions in the beam extracted from the plasma and diminish the space charge repulsion between them. As a result, the overall ion transmission efficiency and consequent analyte ion sensitivities are significantly improved while other important analytical aspects, such as metal oxide ion ratio, doubly charged ion ratio and background ions remain relatively unchanged with the operation of this electron source. This technique not only improves the ion transmission efficiency but also minimizes the matrix effects drastically. The matrix-induced suppression of signal for even the most troublesome combination of light analyte and heavy matrix elements can be attenuated from 90-99% to only 2-10% for 2 mM matrix solutions with an ultrasonic nebulizer. The supplemental electron current can be adjusted to ''titrate'' out the matrix effects as desired.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015JaJAP..54gHG05Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015JaJAP..54gHG05Y"><span>Performance comparison between packet and continuous data transmission using two adaptive equalizers in shallow water</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yoon, Jong Rak; Park, Kyu-Chil; Park, Jihyun</p> <p>2015-07-01</p> <p>Transmitted signals are markedly affected by sea surface and bottom boundaries in shallow water. The time variant reflection signals from such boundaries characterize the channel as a frequency-selective fading channel and cause intersymbol interference (ISI) in underwater acoustic communication. A channel-estimate-based equalizer is usually adopted to compensate for the reflected signals under this kind of acoustic channel. In this study, we apply two approaches for packet and continuous data transmission of the quadrature phase shift keying (QPSK) system. One is the use of a two-dimensional (2D) rotation matrix in a non-frequency-selective channel. The other is the use of two equalizers of types — the feed forward equalizer (FFE) and decision-directed equalizer (DDE) — with a normalized least mean square (NLMS) algorithm in a frequency-selective channel. The percentage improvement of packet transmission is notably better than that of continuous transmission.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PhRvE..97f2202S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PhRvE..97f2202S"><span>Envelope and phase distribution of a resonance transmission through a complex environment</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Savin, Dmitry V.</p> <p>2018-06-01</p> <p>A transmission amplitude is considered for quantum or wave transport mediated by a single resonance coupled to the background of many chaotic states. Such a model provides a useful approach to quantify fluctuations in an established signal induced by a complex environment. Applying random matrix theory to the problem, we derive an exact result for the joint distribution of the transmission intensity (envelope) and the transmission phase at arbitrary coupling to the background with finite absorption. The intensity and phase are distributed within a certain region, revealing essential correlations even at strong absorption. In the latter limit, we obtain a simple asymptotic expression that provides a uniformly good approximation of the exact distribution within its whole support, thus going beyond the Rician distribution often used for such purposes. Exact results are also derived for the marginal distribution of the phase, including its limiting forms at weak and strong absorption.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/1349775-pathloss-calculation-using-transmission-line-matrix-finite-difference-time-domain-methods-coarse-grids','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/1349775-pathloss-calculation-using-transmission-line-matrix-finite-difference-time-domain-methods-coarse-grids"><span></span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Nutaro, James; Kuruganti, Teja</p> <p></p> <p>Numerical simulations of the wave equation that are intended to provide accurate time domain solutions require a computational mesh with grid points separated by a distance less than the wavelength of the source term and initial data. However, calculations of radio signal pathloss generally do not require accurate time domain solutions. This paper describes an approach for calculating pathloss by using the finite difference time domain and transmission line matrix models of wave propagation on a grid with points separated by distances much greater than the signal wavelength. The calculated pathloss can be kept close to the true value formore » freespace propagation with an appropriate selection of initial conditions. This method can also simulate diffraction with an error governed by the ratio of the signal wavelength to the grid spacing.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MMTA...49..718G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MMTA...49..718G"><span>Gamma Prime Precipitate Evolution During Aging of a Model Nickel-Based Superalloy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Goodfellow, A. J.; Galindo-Nava, E. I.; Christofidou, K. A.; Jones, N. G.; Martin, T.; Bagot, P. A. J.; Boyer, C. D.; Hardy, M. C.; Stone, H. J.</p> <p>2018-03-01</p> <p>The microstructural stability of nickel-based superalloys is critical for maintaining alloy performance during service in gas turbine engines. In this study, the precipitate evolution in a model polycrystalline Ni-based superalloy during aging to 1000 hours has been studied via transmission electron microscopy, atom probe tomography, and neutron diffraction. Variations in phase composition and precipitate morphology, size, and volume fraction were observed during aging, while the constrained lattice misfit remained constant at approximately zero. The experimental composition of the γ matrix phase was consistent with thermodynamic equilibrium predictions, while significant differences were identified between the experimental and predicted results from the γ' phase. These results have implications for the evolution of mechanical properties in service and their prediction using modeling methods.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20110014829','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20110014829"><span>Evaluation of Lightning Induced Effects in a Graphite Composite Fairing Structure</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Trout, Dawn H.; Stanley, James E.; Wahid, Parveen F.</p> <p>2011-01-01</p> <p>Defining the electromagnetic environment inside a graphite composite fairing due to near-by lightning strikes is of interest to spacecraft developers. This effort develops a transmission-line-matrix (TLM) model with a CST Microstripes to examine induced voltages. on interior wire loops in a composite fairing due to a simulated near-by lightning strike. A physical vehicle-like composite fairing test fixture is constructed to anchor a TLM model in the time domain and a FEKO method of moments model in the frequency domain. Results show that a typical graphite composite fairing provides adequate shielding resulting in a significant reduction in induced voltages on high impedance circuits despite minimal attenuation of peak magnetic fields propagating through space in near-by lightning strike conditions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017MS%26E..241a2001L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017MS%26E..241a2001L"><span>Tunable Properties of Exfoliated Polyvinylalcohol Nanocomposites by In Situ Coprecipitation of Layered Double Hydroxides</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Liu, Jiajia; Yuen, Richard K. K.; Hu, Yuan</p> <p>2017-10-01</p> <p>Poly(vinyl alcohol) (PVA) nanocomposites were prepared by a “one step” method based on the coprecipitation of layered double hydroxide (LDH) nanosheets in the polymer aqueous solution. The morphology, fire resistance properties, mechanical and optical properties of the PVA/LDH nanocomposites were studied. The LDH nanosheets were homogeneously dispersed in the PVA matrix as indicated by X-ray diffraction (XRD) pattern and transmission electron microscopy (TEM) characterization. Meanwhile, the peak of heat release rate (pHRR) and total heat release (THR) were decreased by 58% and 28%, respectively. Storage modulus at 30 °C was increased, and the transmittance of more than 90% at the visible region was obtained upon addition of 5 wt% LDH.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li class="active"><span>22</span></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_22 --> <div id="page_23" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li class="active"><span>23</span></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="441"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PlST...20a4015B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PlST...20a4015B"><span>Collision effects on propagation characteristics of electromagnetic waves in a sub-wavelength plasma slab of partially ionized dense plasmas</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Bowen, LI; Zhibin, WANG; Qiuyue, NIE; Xiaogang, WANG; Fanrong, KONG; Zhenyu, WANG</p> <p>2018-01-01</p> <p>Intensive collisions between electrons and neutral particles in partially ionized plasmas generated in atmospheric/sub-atmospheric pressure environments can sufficiently affect the propagation characteristics of electromagnetic waves, particularly in the sub-wavelength regime. To investigate the collisional effect in such plasmas, we introduce a simplified plasma slab model with a thickness on the order of the wavelength of the incident electromagnetic wave. The scattering matrix method (SMM) is applied to solve the wave equation in the plasma slab with significant nonuniformity. Results show that the collisions between the electrons and the neutral particles, as well as the incident angle and the plasma thickness, can disturb the transmission and reduce reflection significantly.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19810020101','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19810020101"><span>Middle atmosphere project: A radiative heating and cooling algorithm for a numerical model of the large scale stratospheric circulation</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Wehrbein, W. M.; Leovy, C. B.</p> <p>1981-01-01</p> <p>A Curtis matrix is used to compute cooling by the 15 micron and 10 micron bands of carbon dioxide. Escape of radiation to space and exchange the lower boundary are used for the 9.6 micron band of ozone. Voigt line shape, vibrational relaxation, line overlap, and the temperature dependence of line strength distributions and transmission functions are incorporated into the Curtis matrices. The distributions of the atmospheric constituents included in the algorithm, and the method used to compute the Curtis matrices are discussed as well as cooling or heating by the 9.6 micron band of ozone. The FORTRAN programs and subroutines that were developed are described and listed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017ApSS..424..184T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017ApSS..424..184T"><span>Optical properties of thin fibrous PVP/SiO2 composite mats prepared via the sol-gel and electrospinning methods</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tański, Tomasz; Matysiak, Wiktor; Krzemiński, Łukasz; Jarka, Paweł; Gołombek, Klaudiusz</p> <p>2017-12-01</p> <p>The aim of the research was to create thin, nanofibrous composite mats with a polyvinylpyrrolidone (PVP) matrix, with the reinforcing phase in the form of silicon oxide (SiO2) nanoparticles. SiO2 nanopowder was obtained using the zol-gel method with a mixture of tetraethyl orthosilicate (TEOS, Si (OC2H5)), hydrochloric acid (HCl), ethanol (C3H5OH) and distilled water. The produced colloidal suspension was subjected to a drying process and a calcination process at 550 °C, resulting in an amorphous silica nanopowder with an average particle diameter of 20 nm. The morphology and structure of the manufactured SiO2 nanoparticles was tested using transmission electron microscopy (TEM) and X-ray diffraction analysis (XRD). Then, using the electrospinning method with a 15% (weight) solution of PVP in ethanol and a 15% solution of PVP/EtOH containing the produced nanoparticles equivalent to 5% of the mass concentration relative to the polymer matrix, polymer PVP nanofibres and PVP/SiO2 composite nanofibres/SiO2 nanoparticles were produced. The morphology and chemical composition of the produced polymer and composite nanofibres were tested using a scanning electron microscope (SEM) with an energy dispersive spectrometer (EDS). The analysis of the impact of the reinforcing phase on the absorption of electromagnetic radiation was conducted on the basis of UV-vis spectra, based on which the rated values of band gaps of the produced thin fibrous mats were assessed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JQSRT.196...17E','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JQSRT.196...17E"><span>A review of the matrix-exponential formalism in radiative transfer</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Efremenko, Dmitry S.; Molina García, Víctor; Gimeno García, Sebastián; Doicu, Adrian</p> <p>2017-07-01</p> <p>This paper outlines the matrix exponential description of radiative transfer. The eigendecomposition method which serves as a basis for computing the matrix exponential and for representing the solution in a discrete ordinate setting is considered. The mathematical equivalence of the discrete ordinate method, the matrix operator method, and the matrix Riccati equations method is proved rigorously by means of the matrix exponential formalism. For optically thin layers, approximate solution methods relying on the Padé and Taylor series approximations to the matrix exponential, as well as on the matrix Riccati equations, are presented. For optically thick layers, the asymptotic theory with higher-order corrections is derived, and parameterizations of the asymptotic functions and constants for a water-cloud model with a Gamma size distribution are obtained.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70155173','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70155173"><span>Lattice Boltzmann methods applied to large-scale three-dimensional virtual cores constructed from digital optical borehole images of the karst carbonate Biscayne aquifer in southeastern Florida</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Michael Sukop,; Cunningham, Kevin J.</p> <p>2014-01-01</p> <p>Digital optical borehole images at approximately 2 mm vertical resolution and borehole caliper data were used to create three-dimensional renderings of the distribution of (1) matrix porosity and (2) vuggy megaporosity for the karst carbonate Biscayne aquifer in southeastern Florida. The renderings based on the borehole data were used as input into Lattice Boltzmann methods to obtain intrinsic permeability estimates for this extremely transmissive aquifer, where traditional aquifer test methods may fail due to very small drawdowns and non-Darcian flow that can reduce apparent hydraulic conductivity. Variogram analysis of the borehole data suggests a nearly isotropic rock structure at lag lengths up to the nominal borehole diameter. A strong correlation between the diameter of the borehole and the presence of vuggy megaporosity in the data set led to a bias in the variogram where the computed horizontal spatial autocorrelation is strong at lag distances greater than the nominal borehole size. Lattice Boltzmann simulation of flow across a 0.4 × 0.4 × 17 m (2.72 m3 volume) parallel-walled column of rendered matrix and vuggy megaporosity indicates a high hydraulic conductivity of 53 m s−1. This value is similar to previous Lattice Boltzmann calculations of hydraulic conductivity in smaller limestone samples of the Biscayne aquifer. The development of simulation methods that reproduce dual-porosity systems with higher resolution and fidelity and that consider flow through horizontally longer renderings could provide improved estimates of the hydraulic conductivity and help to address questions about the importance of scale.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014WRR....50.8807S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014WRR....50.8807S"><span>Lattice Boltzmann methods applied to large-scale three-dimensional virtual cores constructed from digital optical borehole images of the karst carbonate Biscayne aquifer in southeastern Florida</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sukop, Michael C.; Cunningham, Kevin J.</p> <p>2014-11-01</p> <p>Digital optical borehole images at approximately 2 mm vertical resolution and borehole caliper data were used to create three-dimensional renderings of the distribution of (1) matrix porosity and (2) vuggy megaporosity for the karst carbonate Biscayne aquifer in southeastern Florida. The renderings based on the borehole data were used as input into Lattice Boltzmann methods to obtain intrinsic permeability estimates for this extremely transmissive aquifer, where traditional aquifer test methods may fail due to very small drawdowns and non-Darcian flow that can reduce apparent hydraulic conductivity. Variogram analysis of the borehole data suggests a nearly isotropic rock structure at lag lengths up to the nominal borehole diameter. A strong correlation between the diameter of the borehole and the presence of vuggy megaporosity in the data set led to a bias in the variogram where the computed horizontal spatial autocorrelation is strong at lag distances greater than the nominal borehole size. Lattice Boltzmann simulation of flow across a 0.4 × 0.4 × 17 m (2.72 m3 volume) parallel-walled column of rendered matrix and vuggy megaporosity indicates a high hydraulic conductivity of 53 m s-1. This value is similar to previous Lattice Boltzmann calculations of hydraulic conductivity in smaller limestone samples of the Biscayne aquifer. The development of simulation methods that reproduce dual-porosity systems with higher resolution and fidelity and that consider flow through horizontally longer renderings could provide improved estimates of the hydraulic conductivity and help to address questions about the importance of scale.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27608426','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27608426"><span>Designing of silk and ZnO based antibacterial and noncytotoxic bionanocomposite films and study of their mechanical and UV absorption behavior.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kiro, Anamika; Bajpai, Jaya; Bajpai, A K</p> <p>2017-01-01</p> <p>Bionanocomposites of sericin and polyvinyl alcohol (PVA) were prepared by solution casting method and zinc oxide nanoparticles were impregnated within the polymer blend matrix through homogenous phase reaction between zinc chloride and sodium hydroxide at high temperature following an ex-situ co-precipitation method. The prepared bionanocomposites were characterized using Fourier Transform Infrared Spectroscopy, X-ray diffraction, Field Emission Scanning Electron Microscopy, Transmission Electron Microscopy and Atomic Force Microscopy techniques. The presence of characteristic groups of sericin and ZnO nanoparticles was ascertained by the FTIR spectra. XRD analysis confirmed the impregnation of ZnO nanoparticles and sericin within the PVA matrix. XRD and FESEM of the bionanocomposites provided information about their semicrystalline nature, crystallite size of the particles, and irregular rough surfaces. The TEM confirmed the size of ZnO particles to be in the nanometer range. AFM confirmed the platykurtic nature of the surface while the negative surface skewness shows the predominance of valleys over peaks suggesting for the planar nature of the surface of the bionanocomposites. UV absorption properties of bionanocomposite films were determined by UV absorption spectroscopy. UV absorption increased with increasing amount of ZnO nanoparticles in the nanocomposites. Sericin was found to absorb UV-C radiations between 200-290nm which is mainly due to aromatic amino acids like tryptophan, tyrosine and phenylalanine. The ZnO nanoparticles and sericin protein showed antimicrobial properties as evident from the inhibition zones obtained against Staphylococcus aureus and Escherichia coli. The bionanocomposite was found to be noncytotoxic which was proved by in vitro cytotoxicity test. Microhardness of bionanocomposite films increased with increase in the amount of ZnO nanoparticles in the sericin and PVA matrix. Copyright © 2016 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AIPC.1773k0012S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AIPC.1773k0012S"><span>Efficient sparse matrix-matrix multiplication for computing periodic responses by shooting method on Intel Xeon Phi</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Stoykov, S.; Atanassov, E.; Margenov, S.</p> <p>2016-10-01</p> <p>Many of the scientific applications involve sparse or dense matrix operations, such as solving linear systems, matrix-matrix products, eigensolvers, etc. In what concerns structural nonlinear dynamics, the computations of periodic responses and the determination of stability of the solution are of primary interest. Shooting method iswidely used for obtaining periodic responses of nonlinear systems. The method involves simultaneously operations with sparse and dense matrices. One of the computationally expensive operations in the method is multiplication of sparse by dense matrices. In the current work, a new algorithm for sparse matrix by dense matrix products is presented. The algorithm takes into account the structure of the sparse matrix, which is obtained by space discretization of the nonlinear Mindlin's plate equation of motion by the finite element method. The algorithm is developed to use the vector engine of Intel Xeon Phi coprocessors. It is compared with the standard sparse matrix by dense matrix algorithm and the one developed by Intel MKL and it is shown that by considering the properties of the sparse matrix better algorithms can be developed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1360965','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1360965"><span>Method of forming a ceramic matrix composite and a ceramic matrix component</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>de Diego, Peter; Zhang, James</p> <p></p> <p>A method of forming a ceramic matrix composite component includes providing a formed ceramic member having a cavity, filling at least a portion of the cavity with a ceramic foam. The ceramic foam is deposited on a barrier layer covering at least one internal passage of the cavity. The method includes processing the formed ceramic member and ceramic foam to obtain a ceramic matrix composite component. Also provided is a method of forming a ceramic matrix composite blade and a ceramic matrix composite component.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012SSEle..70..106V','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012SSEle..70..106V"><span>Quantum simulation of an ultrathin body field-effect transistor with channel imperfections</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Vyurkov, V.; Semenikhin, I.; Filippov, S.; Orlikovsky, A.</p> <p>2012-04-01</p> <p>An efficient program for the all-quantum simulation of nanometer field-effect transistors is elaborated. The model is based on the Landauer-Buttiker approach. Our calculation of transmission coefficients employs a transfer-matrix technique involving the arbitrary precision (multiprecision) arithmetic to cope with evanescent modes. Modified in such way, the transfer-matrix technique turns out to be much faster in practical simulations than that of scattering-matrix. Results of the simulation demonstrate the impact of realistic channel imperfections (random charged centers and wall roughness) on transistor characteristics. The Landauer-Buttiker approach is developed to incorporate calculation of the noise at an arbitrary temperature. We also validate the ballistic Landauer-Buttiker approach for the usual situation when heavily doped contacts are indispensably included into the simulation region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.fs.usda.gov/treesearch/pubs/48235','TREESEARCH'); return false;" href="https://www.fs.usda.gov/treesearch/pubs/48235"><span>Nanocomposite film prepared by depositing xylan on cellulose nanowhiskers matrix</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.fs.usda.gov/treesearch/">Treesearch</a></p> <p>Qining Sun; Anurag Mandalika; Thomas Elder; Sandeep S. Nair; Xianzhi Meng; Fang Huang; Art J. Ragauskas</p> <p>2014-01-01</p> <p>Novel bionanocomposite films have been prepared by depositing xylan onto cellulose nanowhiskers through a pH adjustment. Analysis of strength properties, water vapour transmission, transparency, surface morphology and thermal decomposition showed the enhancement of film performance. This provides a new green route to the utilization of biomass for sustainable...</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20000080579&hterms=microscope&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D70%26Ntt%3Dmicroscope','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20000080579&hterms=microscope&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D70%26Ntt%3Dmicroscope"><span>Transmission Electron Microscope Observations of Phyllosilicate Development During Experimental Aqueous Alteration of Allende</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Jones, C. L.; Brearley, A. J.</p> <p>2000-01-01</p> <p>Samples of Allende have been altered hydrothermally under oxidizing conditions at 200 C. TEM studies show that within 30 days evidence of replacement of matrix olivines by fine-grained serpentine is present and by 90 days complete alteration of many grains has occurred.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20030000484&hterms=sharma&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D90%26Ntt%3Dsharma','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20030000484&hterms=sharma&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D90%26Ntt%3Dsharma"><span>Structural Health Monitoring of Composite Materials Using Distributed Fiber Bragg Sensors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Grant, Joseph; Kual, Raj; Taylor, Scott; Jackson, Kurt V.; Myers, George; Wang, Y.; Sharma, A.; Burdine, Robert (Technical Monitor)</p> <p>2002-01-01</p> <p>Health monitoring of polymer matrix composite materials using fiber optic Bragg grating (FBG) sensors is accomplished using a tunable IR (infrared) laser via transmission mode. Results are presented from experiments of composite structures with FBG's embedded at various orientations, and surface measurements of various cryogenic composite vessels.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26280279','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26280279"><span>Differentiating characteristic microstructural features of cancerous tissues using Mueller matrix microscope.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Wang, Ye; He, Honghui; Chang, Jintao; Zeng, Nan; Liu, Shaoxiong; Li, Migao; Ma, Hui</p> <p>2015-12-01</p> <p>Polarized light imaging can provide rich microstructural information of samples, and has been applied to the detections of various abnormal tissues. In this paper, we report a polarized light microscope based on Mueller matrix imaging by adding the polarization state generator and analyzer (PSG and PSA) to a commercial transmission optical microscope. The maximum errors for the absolute values of Mueller matrix elements are reduced to 0.01 after calibration. This Mueller matrix microscope has been used to examine human cervical and liver cancerous tissues with fibrosis. Images of the transformed Mueller matrix parameters provide quantitative assessment on the characteristic features of the pathological tissues. Contrast mechanism of the experimental results are backed up by Monte Carlo simulations based on the sphere-cylinder birefringence model, which reveal the relationship between the pathological features in the cancerous tissues at the cellular level and the polarization parameters. Both the experimental and simulated data indicate that the microscopic transformed Mueller matrix parameters can distinguish the breaking down of birefringent normal tissues for cervical cancer, or the formation of birefringent surrounding structures accompanying the inflammatory reaction for liver cancer. With its simple structure, fast measurement and high precision, polarized light microscope based on Mueller matrix shows a good diagnosis application prospect. Copyright © 2015 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2006MMI....12..467H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2006MMI....12..467H"><span>RETRACTED ARTICLE: Precipitation behavior of B2-ordered aluminide</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Han, Chang-Suk</p> <p>2006-12-01</p> <p>Fine dispersion of disordered phases is obtained in Ni-Al-Cr and Fe-Al-Co temary systems. A transmission electron microscope investigation has been performed on the precipitation of α-Cr in B2-ordered β-NiAl with different stoichiometry and α-Fe in B2-FeAl(Co) compound. Precipitation behavior and hardening were investigated by measuring the hardness variation. The hardness of NiAl and FeAl increases appreciably with the fine precipitation of α-Cr and α-Fe, and over-age softening occurs after prolonged aging. In the case of B2-NiAl(Cr), perfect lattice coherency is maintained at the interfaces between the α-Cr particles and the matrix during the initial stage of aging. After prolonged aging, a loss of coherency occurs by the attraction of matrix dislocations to the particle/matrix interface, followed by climbing around the particles. On the other hand, in the case of B2-FeAl(Co), the disordered α-Fe phase is present as a precipitate in the B2-FeAl(Co) matrix and has a cubic-cubic orientation with the matrix. At the early aging periods, prismatic dislocation loops formed in the B2-FeAl(Co) matrix. B2-FeAl(Co) matrix is typically hardened by the precipitation of α-Fe.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017SPIE10427E..1LL','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017SPIE10427E..1LL"><span>Progressive sample processing of band selection for hyperspectral imagery</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Liu, Keng-Hao; Chien, Hung-Chang; Chen, Shih-Yu</p> <p>2017-10-01</p> <p>Band selection (BS) is one of the most important topics in hyperspectral image (HSI) processing. The objective of BS is to find a set of representative bands that can represent the whole image with lower inter-band redundancy. Many types of BS algorithms were proposed in the past. However, most of them can be carried on in an off-line manner. It means that they can only be implemented on the pre-collected data. Those off-line based methods are sometime useless for those applications that are timeliness, particular in disaster prevention and target detection. To tackle this issue, a new concept, called progressive sample processing (PSP), was proposed recently. The PSP is an "on-line" framework where the specific type of algorithm can process the currently collected data during the data transmission under band-interleavedby-sample/pixel (BIS/BIP) protocol. This paper proposes an online BS method that integrates a sparse-based BS into PSP framework, called PSP-BS. In PSP-BS, the BS can be carried out by updating BS result recursively pixel by pixel in the same way that a Kalman filter does for updating data information in a recursive fashion. The sparse regression is solved by orthogonal matching pursuit (OMP) algorithm, and the recursive equations of PSP-BS are derived by using matrix decomposition. The experiments conducted on a real hyperspectral image show that the PSP-BS can progressively output the BS status with very low computing time. The convergence of BS results during the transmission can be quickly achieved by using a rearranged pixel transmission sequence. This significant advantage allows BS to be implemented in a real time manner when the HSI data is transmitted pixel by pixel.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JASMS..28.1977W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JASMS..28.1977W"><span>Investigation of Ion Transmission Effects on Intact Protein Quantification in a Triple Quadrupole Mass Spectrometer</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wang, Evelyn H.; Appulage, Dananjaya Kalu; McAllister, Erin A.; Schug, Kevin A.</p> <p>2017-09-01</p> <p>Recently, direct intact protein quantitation using triple quadrupole mass spectrometry (QqQ-MS) and multiple reaction monitoring (MRM) was demonstrated (J. Am. Soc. Mass Spectrom. 27, 886-896 (2016)). Even though QqQ-MS is known to provide extraordinary detection sensitivity for quantitative analysis, we found that intact proteins exhibited a less than 5% ion transmission from the first quadrupole to the third quadrupole mass analyzer in the presence of zero collision energy (ZCE). With the goal to enhance intact protein quantitation sensitivity, ion scattering effects, proton transfer effects, and mass filter resolution widths were examined for their contributions to the lost signal. Protein standards myoglobin and ubiquitin along with small molecules reserpine and vancomycin were analyzed together with various collision induced dissociation (CID) gases (N2, He, and Ar) at different gas pressures. Mass resolution settings played a significant role in reducing ion transmission signal. By narrowing the mass resolution window by 0.35 m/z on each side, roughly 75%-90% of the ion signal was lost. The multiply charged proteins experienced additional proton transfer effects, corresponding to 10-fold signal reduction. A study of increased sensitivity of the method was also conducted with various MRM summation techniques. Although the degree of enhancement was analyte-dependent, an up to 17-fold increase in sensitivity was observed for ubiquitin using a summation of multiple MRM transitions. Biological matrix, human urine, and equine plasma were spiked with proteins to demonstrate the specificity of the method. This study provides additional insight into optimizing the use and sensitivity of QqQ-MS for intact protein quantification. [Figure not available: see fulltext.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018JNuM..500..141T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018JNuM..500..141T"><span>Uranium migration in spark plasma sintered W/UO2 CERMETS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tucker, Dennis S.; Wu, Yaqiao; Burns, Jatuporn</p> <p>2018-03-01</p> <p>W/UO2 CERMET samples were sintered in a Spark Plasma Sintering (SPS) furnace at various temperature under vacuum and pressure. High Resolution Transmission Electron Microscopy (HRTEM) with Energy Dispersive Spectroscopy (EDS) was performed on the samples to determine interface structures and uranium diffusion from the UO2 particles into the tungsten matrix. Local Electrode Atom Probe (LEAP) was also performed to determine stoichiometry of the UO2 particles. It was seen that uranium diffused approximately 10-15 nm into the tungsten matrix. This is explained in terms of production of oxygen vacancies and Fick's law of diffusion.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018JNuM..504..261P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018JNuM..504..261P"><span>Microstructure and mechanical behavior of Zr substrates coated with FeCrAl and Mo by cold-spraying</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Park, Dong Jun; Kim, Hyun Gil; Jung, Yang Il; Park, Jung Hwan; Yang, Jae Ho; Koo, Yang Hyun</p> <p>2018-06-01</p> <p>FeCrAl and Mo layers were cold-sprayed onto a Zr surface, with the Mo layer introduced between the FeCrAl coating and the Zr matrix preventing high-temperature interdiffusion. Microstructural characterization of the first-deposited Mo layer and the Zr matrix immediately below the Mo/Zr interface was performed using transmission electron microscopy, and near-interface elemental distributions were obtained using energy-dispersive X-ray spectroscopy. The deformation of the coated Mo powder induced the formation of microbands and mechanically interlocked nanoscale structures. The mechanical behavior of Zr with a coating layer was compared with those characteristic of conventional Zr samples. The coated sample showed smaller strength reduction in the test conducted at elevated temperature. The hardness and fracture morphology of the Zr matrix near the interface region were investigated to determine the effect of impacting Mo particles on the matrix microstructure. The enhanced hardness and cleavage fracture morphology of the Zr matrix immediately below the Mo/Zr interface indicated the occurrence of localized deformation owing to Mo particle impact.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27474588','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27474588"><span>Formation and properties of hyaluronan/nano Ag and hyaluronan-lecithin/nano Ag films.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Khachatryan, Gohar; Khachatryan, Karen; Grzyb, Jacek; Fiedorowicz, Maciej</p> <p>2016-10-20</p> <p>A facile and environmentally friendly method of the preparation of silver nanoparticles embedded in hyaluronan (Hyal/Ag) and hyaluronan-lecithin (Hyal-L/Ag) matrix was developed. Thin, elastic foils were prepared from gels by an in situ synthesis of Ag in an aqueous solution of sodium hyaluronate (Hyal), using aq. d-(+)-xylose solution as a reducing agent. The gels were applied to a clean, smooth, defatted Teflon surface and left for drying in the air. The dry foils were stored in a closed container. UV-vis spectroscopy, transmission electron microscopy (TEM) and Fourier transform infrared (FTIR) spectra confirmed formation of about 10nm ball-shaped Ag nanoparticles situated within the polysaccharide template. Thermal properties of the composites were characterized involving differential scanning calorimetry (DSC) and thermogravimetric (TGA) analyses, whereas molecular weights of polysaccharide chains of the matrix were estimated with the size exclusion chromatography coupled with multiangle laser light scattering and refractometric detectors (HPSEC-MALLS-RI). An increase in the molecular weight of the hyaluronate after generation of Ag nanoparticles was observed. The foils showed specific properties. The study confirmed that silver nanoparticles can be successfully prepared with environmentally friendly method, using hyaluronan as a stabilizing template. Hyaluronan and hyaluronan-lecithin matrices provide nanocrystals uniform in size and shape. The composites demonstrated a bacteriostatic activity. Copyright © 2016 Elsevier Ltd. All rights reserved.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li class="active"><span>23</span></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_23 --> <div id="page_24" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li class="active"><span>24</span></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="461"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22689604-sem-tem-characterization-microstructure-stainless-steel-composites-reinforced-tib-sub','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22689604-sem-tem-characterization-microstructure-stainless-steel-composites-reinforced-tib-sub"><span>SEM and TEM characterization of microstructure of stainless steel composites reinforced with TiB{sub 2}</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Sulima, Iwona, E-mail: isulima@up.krakow.pl</p> <p></p> <p>Steel-8TiB{sub 2} composites were produced by two new sintering techniques, i.e. Spark Plasma Sintering (SPS) and High Pressure-High Temperature (HP-HT) sintering. This study discusses the impact of these sintering methods on the microstructure of steel composites reinforced with TiB{sub 2} particles. Scanning electron microscopy (SEM), wavelength dispersive spectroscopy (WDS), X-ray diffraction, electron backscatter diffraction (EBSD) and transmission electron microscopy (TEM) were used to analyze the microstructure evolution in steel matrix composites. The results of microscopic examinations revealed a close relationship between the composite microstructure and the methods and conditions of sintering. Substantial differences were observed in the grain size ofmore » materials sintered by HP-HT and SPS. It has been demonstrated that the composites sintered by HP-HT tend to form a chromium-iron-nickel phase in the steel matrix. In contrast, the microstructure of the composites sintered by SPS is characterized by the presence of complex borides and chromium-iron phase. - Highlights: •The steel-8TiB{sub 2} composites were fabricated by Spark Plasma Sintering (SPS) and High Pressure-High Temperature (HP-HT). •Sintering techniques has an important effect on changes in the microstructure of steel-8TiB{sub 2} composites. •New phases of different size and morphology were identified.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017ApSS..401..271W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017ApSS..401..271W"><span>Improvement of interfacial interactions using natural polyphenol-inspired tannic acid-coated nanoclay enhancement of soy protein isolate biofilms</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wang, Zhong; Kang, Haijiao; Zhang, Wei; Zhang, Shifeng; Li, Jianzhang</p> <p>2017-04-01</p> <p>In this study, a novel and economic surface modification technique for montmorillonite (MMT) nanosheets, a biocompatible coupling cross-linking agent, was developed on an attempt at improving the interfacial adhesion with soy protein isolate (SPI) matrix. Inspired by natural polyphenol, the "green dip-coating" method using tannic acid (TA) to surface-modify MMT (TA@MMT). SPI nanocomposite films modified with MMT or TA@MMT, as well as the control ones, were prepared via the casting method. The TA layer was successfully coated on the MMT surface through the (FeIII) ions coordination chemistry and the synthetic samples were characterized by the Fourier transform infrared (FT-IR) spectroscopy, X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD), thermogravimetric analysis (TGA), atomic force microscopy (AFM), and transmission electron microscopy (TEM). The compatibility and interfacial interactions between modified MMT and SPI matrix were greatly enhanced by the TA-FeIII coating on the MMT surface. The mechanical properties, water resistance, and thermal stability of the resultant biofilm were increased accordingly. Compared with that of the unmodified SPI film, the tensile strength of the nanocomposite films modified by the green dip-coating was increased by 113.3%. These SPI-based nanocomposite films showed the favorable potential in terms of food packing applications due to their efficient barriers to water vapor and UV and/or visible light.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/1041991-chain-confinement-electrospun-nanocomposites-using-thermal-analysis-investigate-polymer-filler-interactions','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/1041991-chain-confinement-electrospun-nanocomposites-using-thermal-analysis-investigate-polymer-filler-interactions"><span>Chain Confinement in Electrospun Nanocomposites: using Thermal Analysis to Investigate Polymer-Filler Interactions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Q Ma; B Mao; P Cebe</p> <p>2011-12-31</p> <p>We investigate the interaction of the polymer matrix and filler in electrospun nanofibers using advanced thermal analysis methods. In particular, we study the ability of silicon dioxide nanoparticles to affect the phase structure of poly(ethylene terephthalate), PET. SiO{sub 2} nanoparticles (either unmodified or modified with silane) ranging from 0 to 2.0 wt% in PET were electrospun from hexafluoro-2-propanol solutions. The morphologies of both the electrospun (ES) nanofibers and the SiO{sub 2} powders were observed by scanning and transmission electron microscopy, while the amorphous or crystalline nature of the fibers was determined by real-time wide-angle X-ray scattering. The fractions of themore » crystal, mobile amorphous, and rigid amorphous phases of the non-woven, nanofibrous composite mats were quantified by using heat capacity measurements. The amount of the immobilized polymer layer, the rigid amorphous fraction, was obtained from the specific reversing heat capacity for both as-spun amorphous fibers and isothermally crystallized fibers. Existence of the rigid amorphous phase in the absence of crystallinity was verified in nanocomposite fibers, and two origins for confinement of the rigid amorphous fraction are proposed. Thermal analysis of electrospun fibers, including quasi-isothermal methods, provides new insights to quantitatively characterize the polymer matrix phase structure and thermal transitions, such as devitrification of the rigid amorphous fraction.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29154225','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29154225"><span>Matrix completion by deep matrix factorization.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Fan, Jicong; Cheng, Jieyu</p> <p>2018-02-01</p> <p>Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010IEITF..93.1102T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010IEITF..93.1102T"><span>Key-Generation Algorithms for Linear Piece In Hand Matrix Method</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tadaki, Kohtaro; Tsujii, Shigeo</p> <p></p> <p>The linear Piece In Hand (PH, for short) matrix method with random variables was proposed in our former work. It is a general prescription which can be applicable to any type of multivariate public-key cryptosystems for the purpose of enhancing their security. Actually, we showed, in an experimental manner, that the linear PH matrix method with random variables can certainly enhance the security of HFE against the Gröbner basis attack, where HFE is one of the major variants of multivariate public-key cryptosystems. In 1998 Patarin, Goubin, and Courtois introduced the plus method as a general prescription which aims to enhance the security of any given MPKC, just like the linear PH matrix method with random variables. In this paper we prove the equivalence between the plus method and the primitive linear PH matrix method, which is introduced by our previous work to explain the notion of the PH matrix method in general in an illustrative manner and not for a practical use to enhance the security of any given MPKC. Based on this equivalence, we show that the linear PH matrix method with random variables has the substantial advantage over the plus method with respect to the security enhancement. In the linear PH matrix method with random variables, the three matrices, including the PH matrix, play a central role in the secret-key and public-key. In this paper, we clarify how to generate these matrices and thus present two probabilistic polynomial-time algorithms to generate these matrices. In particular, the second one has a concise form, and is obtained as a byproduct of the proof of the equivalence between the plus method and the primitive linear PH matrix method.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28531874','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28531874"><span>Sparse subspace clustering for data with missing entries and high-rank matrix completion.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Fan, Jicong; Chow, Tommy W S</p> <p>2017-09-01</p> <p>Many methods have recently been proposed for subspace clustering, but they are often unable to handle incomplete data because of missing entries. Using matrix completion methods to recover missing entries is a common way to solve the problem. Conventional matrix completion methods require that the matrix should be of low-rank intrinsically, but most matrices are of high-rank or even full-rank in practice, especially when the number of subspaces is large. In this paper, a new method called Sparse Representation with Missing Entries and Matrix Completion is proposed to solve the problems of incomplete-data subspace clustering and high-rank matrix completion. The proposed algorithm alternately computes the matrix of sparse representation coefficients and recovers the missing entries of a data matrix. The proposed algorithm recovers missing entries through minimizing the representation coefficients, representation errors, and matrix rank. Thorough experimental study and comparative analysis based on synthetic data and natural images were conducted. The presented results demonstrate that the proposed algorithm is more effective in subspace clustering and matrix completion compared with other existing methods. Copyright © 2017 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29680520','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29680520"><span>A new method for mapping the three-dimensional atomic distribution within nanoparticles by atom probe tomography (APT).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Se-Ho; Kang, Phil Woong; Park, O Ok; Seol, Jae-Bok; Ahn, Jae-Pyoung; Lee, Ji Yeong; Choi, Pyuck-Pa</p> <p>2018-07-01</p> <p>We present a new method of preparing needle-shaped specimens for atom probe tomography from freestanding Pd and C-supported Pt nanoparticles. The method consists of two steps, namely electrophoresis of nanoparticles on a flat Cu substrate followed by electrodeposition of a Ni film acting as an embedding matrix for the nanoparticles. Atom probe specimen preparation can be subsequently carried out by means of focused-ion-beam milling. Using this approach, we have been able to perform correlative atom probe tomography and transmission electron microscopy analyses on both nanoparticle systems. Reliable mass spectra and three-dimensional atom maps could be obtained for Pd nanoparticle specimens. In contrast, atom probe samples prepared from C-supported Pt nanoparticles showed uneven field evaporation and hence artifacts in the reconstructed atom maps. Our developed method is a viable means of mapping the three-dimensional atomic distribution within nanoparticles and is expected to contribute to an improved understanding of the structure-composition-property relationships of various nanoparticle systems. Copyright © 2018 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29105647','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29105647"><span>STM contrast of a CO dimer on a Cu(1 1 1) surface: a wave-function analysis.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Gustafsson, Alexander; Paulsson, Magnus</p> <p>2017-12-20</p> <p>We present a method used to intuitively interpret the scanning tunneling microscopy (STM) contrast by investigating individual wave functions originating from the substrate and tip side. We use localized basis orbital density functional theory, and propagate the wave functions into the vacuum region at a real-space grid, including averaging over the lateral reciprocal space. Optimization by means of the method of Lagrange multipliers is implemented to perform a unitary transformation of the wave functions in the middle of the vacuum region. The method enables (i) reduction of the number of contributing tip-substrate wave function combinations used in the corresponding transmission matrix, and (ii) to bundle up wave functions with similar symmetry in the lateral plane, so that (iii) an intuitive understanding of the STM contrast can be achieved. The theory is applied to a CO dimer adsorbed on a Cu(1 1 1) surface scanned by a single-atom Cu tip, whose STM image is discussed in detail by the outlined method.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JPCM...29X5301G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JPCM...29X5301G"><span>STM contrast of a CO dimer on a Cu(1 1 1) surface: a wave-function analysis</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Gustafsson, Alexander; Paulsson, Magnus</p> <p>2017-12-01</p> <p>We present a method used to intuitively interpret the scanning tunneling microscopy (STM) contrast by investigating individual wave functions originating from the substrate and tip side. We use localized basis orbital density functional theory, and propagate the wave functions into the vacuum region at a real-space grid, including averaging over the lateral reciprocal space. Optimization by means of the method of Lagrange multipliers is implemented to perform a unitary transformation of the wave functions in the middle of the vacuum region. The method enables (i) reduction of the number of contributing tip-substrate wave function combinations used in the corresponding transmission matrix, and (ii) to bundle up wave functions with similar symmetry in the lateral plane, so that (iii) an intuitive understanding of the STM contrast can be achieved. The theory is applied to a CO dimer adsorbed on a Cu(1 1 1) surface scanned by a single-atom Cu tip, whose STM image is discussed in detail by the outlined method.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018SPIE10609E..0RZ','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018SPIE10609E..0RZ"><span>A method of non-contact reading code based on computer vision</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zhang, Chunsen; Zong, Xiaoyu; Guo, Bingxuan</p> <p>2018-03-01</p> <p>With the purpose of guarantee the computer information exchange security between internal and external network (trusted network and un-trusted network), A non-contact Reading code method based on machine vision has been proposed. Which is different from the existing network physical isolation method. By using the computer monitors, camera and other equipment. Deal with the information which will be on exchanged, Include image coding ,Generate the standard image , Display and get the actual image , Calculate homography matrix, Image distort correction and decoding in calibration, To achieve the computer information security, Non-contact, One-way transmission between the internal and external network , The effectiveness of the proposed method is verified by experiments on real computer text data, The speed of data transfer can be achieved 24kb/s. The experiment shows that this algorithm has the characteristics of high security, fast velocity and less loss of information. Which can meet the daily needs of the confidentiality department to update the data effectively and reliably, Solved the difficulty of computer information exchange between Secret network and non-secret network, With distinctive originality, practicability, and practical research value.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19820037348&hterms=refraction&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D60%26Ntt%3Drefraction','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19820037348&hterms=refraction&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D60%26Ntt%3Drefraction"><span>Refraction at a curved dielectric interface - Geometrical optics solution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Lee, S.-W.; Sheshadri, M. S.; Mittra, R.; Jamnejad, V.</p> <p>1982-01-01</p> <p>The transmission of a spherical or plane wave through an arbitrarily curved dielectric interface is solved by the geometrical optics theory. The transmitted field is proportional to the product of the conventional Fresnel's transmission coefficient and a divergence factor (DF), which describes the cross-sectional variation (convergence or divergence) of a ray pencil as the latter propagates in the transmitted region. The factor DF depends on the incident wavefront, the curvatures of the interface, and the relative indices of the two media. Explicit matrix formulas for calculating DF are given, and its physical significance is illustrated via examples.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25653392','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25653392"><span>Transmission electron microscopy analysis of skin lesions from sporotrichosis epidemic in Rio de Janeiro, Brazil.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ferreira, Cassio Porto; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana</p> <p>2015-02-01</p> <p>Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. © The American Society of Tropical Medicine and Hygiene.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PhRvM...2d4203S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PhRvM...2d4203S"><span>Electronic and structural properties of B i2S e3:Cu</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sobczak, Kamil; Strak, Pawel; Kempisty, Pawel; Wolos, Agnieszka; Hruban, Andrzej; Materna, Andrzej; Borysiuk, Jolanta</p> <p>2018-04-01</p> <p>Electronic and structural properties of B i2S e3 and its extension to copper doped B i2S e3:Cu were studied using combined ab initio simulations and transmission electron microscopy based techniques, including electron energy loss spectroscopy, energy filtered transmission electron microscopy, and energy dispersive x-ray spectroscopy. The stability of the mixed phases was investigated for substitutional and intercalation changes of basic B i2S e3 structure. Four systems were compared: B i2S e3 , structures obtaining by Cu intercalation of the van der Waals gap, by substitution of Bi by Cu in quintuple layers, and C u2Se . The structures were identified and their electronic properties were obtained. Transmission electron microscopy measurements of B i2S e3 and the B i2S e3:Cu system identified the first structure as uniform and the second as composite, consisting of a nonuniform lower-Cu-content matrix and randomly distributed high-Cu-concentration precipitates. Critical comparison of the ab initio and experimental data identified the matrix as having a B i2S e3 dominant part with randomly distributed Cu-intercalated regions having 1Cu-B i2S e3 structure. The precipitates were determined to have 3Cu-B i2S e3 structure.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017SbMat.208.1138K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017SbMat.208.1138K"><span>A one-dimensional model of flow in a junction of thin channels, including arterial trees</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kozlov, V. A.; Nazarov, S. A.</p> <p>2017-08-01</p> <p>We study a Stokes flow in a junction of thin channels (of diameter O(h)) for fixed flows of the fluid at the inlet cross-sections and fixed peripheral pressure at the outlet cross-sections. On the basis of the idea of the pressure drop matrix, apart from Neumann conditions (fixed flow) and Dirichlet conditions (fixed pressure) at the outer vertices, the ordinary one-dimensional Reynolds equations on the edges of the graph are equipped with transmission conditions containing a small parameter h at the inner vertices, which are transformed into the classical Kirchhoff conditions as h\\to+0. We establish that the pre-limit transmission conditions ensure an exponentially small error O(e-ρ/h), ρ>0, in the calculation of the three-dimensional solution, but the Kirchhoff conditions only give polynomially small error. For the arterial tree, under the assumption that the walls of the blood vessels are rigid, for every bifurcation node a ( 2×2)-pressure drop matrix appears, and its influence on the transmission conditions is taken into account by means of small variations of the lengths of the graph and by introducing effective lengths of the one-dimensional description of blood vessels whilst keeping the Kirchhoff conditions and exponentially small approximation errors. We discuss concrete forms of arterial bifurcation and available generalizations of the results, in particular, the Navier-Stokes system of equations. Bibliography: 59 titles.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19940027961','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19940027961"><span>A visual detection model for DCT coefficient quantization</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Ahumada, Albert J., Jr.; Watson, Andrew B.</p> <p>1994-01-01</p> <p>The discrete cosine transform (DCT) is widely used in image compression and is part of the JPEG and MPEG compression standards. The degree of compression and the amount of distortion in the decompressed image are controlled by the quantization of the transform coefficients. The standards do not specify how the DCT coefficients should be quantized. One approach is to set the quantization level for each coefficient so that the quantization error is near the threshold of visibility. Results from previous work are combined to form the current best detection model for DCT coefficient quantization noise. This model predicts sensitivity as a function of display parameters, enabling quantization matrices to be designed for display situations varying in luminance, veiling light, and spatial frequency related conditions (pixel size, viewing distance, and aspect ratio). It also allows arbitrary color space directions for the representation of color. A model-based method of optimizing the quantization matrix for an individual image was developed. The model described above provides visual thresholds for each DCT frequency. These thresholds are adjusted within each block for visual light adaptation and contrast masking. For given quantization matrix, the DCT quantization errors are scaled by the adjusted thresholds to yield perceptual errors. These errors are pooled nonlinearly over the image to yield total perceptual error. With this model one may estimate the quantization matrix for a particular image that yields minimum bit rate for a given total perceptual error, or minimum perceptual error for a given bit rate. Custom matrices for a number of images show clear improvement over image-independent matrices. Custom matrices are compatible with the JPEG standard, which requires transmission of the quantization matrix.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017PhRvE..95c3309T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017PhRvE..95c3309T"><span>Self-energy matrices for electron transport calculations within the real-space finite-difference formalism</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tsukamoto, Shigeru; Ono, Tomoya; Hirose, Kikuji; Blügel, Stefan</p> <p>2017-03-01</p> <p>The self-energy term used in transport calculations, which describes the coupling between electrode and transition regions, is able to be evaluated only from a limited number of the propagating and evanescent waves of a bulk electrode. This obviously contributes toward the reduction of the computational expenses in transport calculations. In this paper, we present a mathematical formula for reducing the computational expenses further without using any approximation and without losing accuracy. So far, the self-energy term has been handled as a matrix with the same dimension as the Hamiltonian submatrix representing the interaction between an electrode and a transition region. In this work, through the singular-value decomposition of the submatrix, the self-energy matrix is handled as a smaller matrix, whose dimension is the rank number of the Hamiltonian submatrix. This procedure is practical in the case of using the pseudopotentials in a separable form, and the computational expenses for determining the self-energy matrix are reduced by 90% when employing a code based on the real-space finite-difference formalism and projector-augmented wave method. In addition, this technique is applicable to the transport calculations using atomic or localized basis sets. Adopting the self-energy matrices obtained from this procedure, we present the calculation of the electron transport properties of C20 molecular junctions. The application demonstrates that the electron transmissions are sensitive to the orientation of the molecule with respect to the electrode surface. In addition, channel decomposition of the scattering wave functions reveals that some unoccupied C20 molecular orbitals mainly contribute to the electron conduction through the molecular junction.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2948635','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2948635"><span>A Chemical Phosphorylation-inspired Design for Type I Collagen Biomimetic Remineralization</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Gu, Li-sha; Kim, Jongryul; Kim, Young Kyung; Liu, Yan; Dickens, Sabine H.; Pashley, David H.; Ling, Jun-qi; Tay, Franklin R.</p> <p>2010-01-01</p> <p>Objectives Type I collagen alone cannot initiate tissue mineralization. Sodium trimetaphosphate (STMP) is frequently employed as a chemical phosphorylating reagent in the food industry. This study examined the feasibility of using STMP as a functional analog of matrix phosphoproteins for biomimetic remineralization of resin-bonded dentin. Methods Equilibrium adsorption and desorption studies of STMP were performed using demineralized dentin powder (DDP). Interaction between STMP and DDP was examined using Fourier-transform infrared spectroscopy. Based on those results, a bio-inspired mineralization scheme was developed for chemical phosphorylation of acid-etched dentin with STMP, followed by infiltration of the STMP-treated collagen matrix with two etch-and-rinse adhesives. Resin-dentin interfaces were remineralized in a Portland cement-simulated body fluid system, with or without the use of polyacrylic acid (PAA) as a dual biomimetic analog. Remineralized resin-dentin interfaces were examined unstained using transmission electron microscopy. Results Analysis of saturation binding curves revealed the presence of irreversible phosphate group binding sites on the surface of the DDP. FT-IR provided additional evidence of chemical interaction between STMP and DDP, with increased in the peak intensities of the P=O and P–O–C stretching modes. Those peaks returned to their original intensities after alkaline phosphatase treatment. Evidence of intrafibrillar apatite formation could be seen in incompletely resin-infiltrated, STMP-phosphorylated collagen matrices only when PAA was present in the SBF. Significance These results reinforce the importance of PAA for sequestration of amorphous calcium phosphate nanoprecursors in the biomimetic remineralization scheme. They also highlight the role of STMP as a templating analog of dentin matrix phosphoproteins for inducing intrafibrillar remineralization of apatite nanocrystals within the collagen matrix of incompletely resin-infiltrated dentin. PMID:20688381</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27643391','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27643391"><span>Generation of gas-phase ions from charged clusters: an important ionization step causing suppression of matrix and analyte ions in matrix-assisted laser desorption/ionization mass spectrometry.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lou, Xianwen; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W</p> <p>2016-12-30</p> <p>Ionization in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a very complicated process. It has been reported that quaternary ammonium salts show extremely strong matrix and analyte suppression effects which cannot satisfactorily be explained by charge transfer reactions. Further investigation of the reasons causing these effects can be useful to improve our understanding of the MALDI process. The dried-droplet and modified thin-layer methods were used as sample preparation methods. In the dried-droplet method, analytes were co-crystallized with matrix, whereas in the modified thin-layer method analytes were deposited on the surface of matrix crystals. Model compounds, tetrabutylammonium iodide ([N(Bu) 4 ]I), cesium iodide (CsI), trihexylamine (THA) and polyethylene glycol 600 (PEG 600), were selected as the test analytes given their ability to generate exclusively pre-formed ions, protonated ions and metal ion adducts respectively in MALDI. The strong matrix suppression effect (MSE) observed using the dried-droplet method might disappear using the modified thin-layer method, which suggests that the incorporation of analytes in matrix crystals contributes to the MSE. By depositing analytes on the matrix surface instead of incorporating in the matrix crystals, the competition for evaporation/ionization from charged matrix/analyte clusters could be weakened resulting in reduced MSE. Further supporting evidence for this inference was found by studying the analyte suppression effect using the same two sample deposition methods. By comparing differences between the mass spectra obtained via the two sample preparation methods, we present evidence suggesting that the generation of gas-phase ions from charged matrix/analyte clusters may induce significant suppression of matrix and analyte ions. The results suggest that the generation of gas-phase ions from charged matrix/analyte clusters is an important ionization step in MALDI-MS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018JAG...152..110Z','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018JAG...152..110Z"><span>A robust method of computing finite difference coefficients based on Vandermonde matrix</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zhang, Yijie; Gao, Jinghuai; Peng, Jigen; Han, Weimin</p> <p>2018-05-01</p> <p>When the finite difference (FD) method is employed to simulate the wave propagation, high-order FD method is preferred in order to achieve better accuracy. However, if the order of FD scheme is high enough, the coefficient matrix of the formula for calculating finite difference coefficients is close to be singular. In this case, when the FD coefficients are computed by matrix inverse operator of MATLAB, inaccuracy can be produced. In order to overcome this problem, we have suggested an algorithm based on Vandermonde matrix in this paper. After specified mathematical transformation, the coefficient matrix is transformed into a Vandermonde matrix. Then the FD coefficients of high-order FD method can be computed by the algorithm of Vandermonde matrix, which prevents the inverse of the singular matrix. The dispersion analysis and numerical results of a homogeneous elastic model and a geophysical model of oil and gas reservoir demonstrate that the algorithm based on Vandermonde matrix has better accuracy compared with matrix inverse operator of MATLAB.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/12914034','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/12914034"><span>Nanostructure and giant magnetoresistive properties of granular systems.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kooi, B J; Vystavel, T; De Hosson, J T</p> <p>2001-03-01</p> <p>This article aims to make a connection between the microstructures of various nanostructured alloys and giant magnetoresistive (GMR) properties. The GMR behavior of nanoclusters embedded in a nonmagnetic matrix differs considerably from an alloy with the content of a magnetic phase above the percolation threshold; that is to say, an increase of GMR effect upon going from 300 to 10 K for the former and a decrease of the GMR effect for the latter. The following materials systems were examined with high-resolution transmission electron microscopy and magnetoelectrical resistance measurements: magnetic Co and CoFe nanoclusters in a Au matrix, NiFe clusters in a Cu matrix, and NiFe/Cu spinodal decomposition waves with interconnection of the magnetic phase. After annealing (> or = 300 degrees C), Co particles in Au become semi- or incoherent, whereas under other conditions and in all other systems, the interfaces remain coherent. This state of coherency at the interface between magnetic particles and a nonmagnetic matrix turned out to have a detectable influence on the GMR behavior.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li class="active"><span>24</span></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_24 --> <div id="page_25" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li class="active"><span>25</span></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="481"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1224522-microyielding-core-shell-crystal-dendrites-bulk-metallic-glass-matrix-composite','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1224522-microyielding-core-shell-crystal-dendrites-bulk-metallic-glass-matrix-composite"><span>Microyielding of core-shell crystal dendrites in a bulk-metallic-glass matrix composite</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Huang, E. -Wen; Qiao, Junwei; Winiarski, Bartlomiej; ...</p> <p>2014-03-18</p> <p>In-situ synchrotron x-ray experiments have been used to follow the evolution of the diffraction peaks for crystalline dendrites embedded in a bulk metallic glass matrix subjected to a compressive loading-unloading cycle. We observe irreversible diffraction-peak splitting even though the load does not go beyond half of the bulk yield strength. The chemical analysis coupled with the transmission electron microscopy mapping suggests that the observed peak splitting originates from the chemical heterogeneity between the core (major peak) and the stiffer shell (minor peak) of the dendrites. A molecular dynamics model has been developed to compare the hkl-dependent microyielding of the bulkmore » metallic-glass matrix composite. As a result, the complementary diffraction measurements and the simulation results suggest that the interfaces between the amorphous matrix and the (211) crystalline planes relax under prolonged load that causes a delay in the reload curve which ultimately catches up with the original path.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1992PNAS...89.1276M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1992PNAS...89.1276M"><span>Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Miles, Jeff; Formosa, Tim</p> <p>1992-02-01</p> <p>We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4423841','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4423841"><span>cAMP-Signalling Regulates Gametocyte-Infected Erythrocyte Deformability Required for Malaria Parasite Transmission</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Thompson, Eloise; Breil, Florence; Lorthiois, Audrey; Dupuy, Florian; Cummings, Ross; Duffier, Yoann; Corbett, Yolanda; Mercereau-Puijalon, Odile; Vernick, Kenneth; Taramelli, Donatella; Baker, David A.; Langsley, Gordon; Lavazec, Catherine</p> <p>2015-01-01</p> <p>Blocking Plasmodium falciparum transmission to mosquitoes has been designated a strategic objective in the global agenda of malaria elimination. Transmission is ensured by gametocyte-infected erythrocytes (GIE) that sequester in the bone marrow and at maturation are released into peripheral blood from where they are taken up during a mosquito blood meal. Release into the blood circulation is accompanied by an increase in GIE deformability that allows them to pass through the spleen. Here, we used a microsphere matrix to mimic splenic filtration and investigated the role of cAMP-signalling in regulating GIE deformability. We demonstrated that mature GIE deformability is dependent on reduced cAMP-signalling and on increased phosphodiesterase expression in stage V gametocytes, and that parasite cAMP-dependent kinase activity contributes to the stiffness of immature gametocytes. Importantly, pharmacological agents that raise cAMP levels in transmissible stage V gametocytes render them less deformable and hence less likely to circulate through the spleen. Therefore, phosphodiesterase inhibitors that raise cAMP levels in P. falciparum infected erythrocytes, such as sildenafil, represent new candidate drugs to block transmission of malaria parasites. PMID:25951195</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70191881','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70191881"><span>Urban landscapes can change virus gene flow and evolution in a fragmentation-sensitive carnivore</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Fountain-Jones, Nicholas M.; Craft, Meggan E.; Funk, W. Chris; Kozakiewicz, Chris; Trumbo, Daryl; Boydston, Erin E.; Lyren, Lisa M.; Crooks, Kevin R.; Lee, Justin S.; VandeWoude, Sue; Carver, Scott</p> <p>2017-01-01</p> <p>Urban expansion has widespread impacts on wildlife species globally, including the transmission and emergence of infectious diseases. However, there is almost no information about how urban landscapes shape transmission dynamics in wildlife. Using an innovative phylodynamic approach combining host and pathogen molecular data with landscape characteristics and host traits, we untangle the complex factors that drive transmission networks of Feline Immunodeficiency Virus (FIV) in bobcats (Lynx rufus). We found that the urban landscape played a significant role in shaping FIV transmission. Even though bobcats were often trapped within the urban matrix, FIV transmission events were more likely to occur in areas with more natural habitat elements. Urban fragmentation also resulted in lower rates of pathogen evolution, possibly owing to a narrower range of host genotypes in the fragmented area. Combined, our findings show that urban landscapes can have impacts on a pathogen and its evolution in a carnivore living in one of the most fragmented and urban systems in North America. The analytical approach used here can be broadly applied to other host-pathogen systems, including humans.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MRE.....5e5013L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MRE.....5e5013L"><span>Transfer matrix approach to electron transport in monolayer MoS2/MoO x heterostructures</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Li, Gen</p> <p>2018-05-01</p> <p>Oxygen plasma treatment can introduce oxidation into monolayer MoS2 to transfer MoS2 into MoO x , causing the formation of MoS2/MoO x heterostructures. We find the MoS2/MoO x heterostructures have the similar geometry compared with GaAs/Ga1‑x Al x As semiconductor superlattice. Thus, We employ the established transfer matrix method to analyse the electron transport in the MoS2/MoO x heterostructures with double-well and step-well geometries. We also considere the coupling between transverse and longitudinal kinetic energy because the electron effective mass changes spatially in the MoS2/MoO x heterostructures. We find the resonant peaks show red shift with the increasing of transverse momentum, which is similar to the previous work studying the transverse-momentum-dependent transmission in GaAs/Ga1‑x Al x As double-barrier structure. We find electric field can enhance the magnitude of peaks and intensify the coupling between longitudinal and transverse momentums. Moreover, higher bias is applied to optimize resonant tunnelling condition to show negative differential effect can be observed in the MoS2/MoO x system.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013IJMMM..20..896L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013IJMMM..20..896L"><span>Microstructure and mechanical properties of AZ91 magnesium alloy subject to deep cryogenic treatments</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Li, Gui-rong; Wang, Hong-ming; Cai, Yun; Zhao, Yu-tao; Wang, Jun-jie; Gill, Simon P. A.</p> <p>2013-09-01</p> <p>AZ91 magnesium alloy was subjected to a deep cryogenic treatment. X-ray diffraction (XRD), scanning electronic microscopy (SEM), and transmission electronic microscopy (TEM) methods were utilized to characterize the composition and microstructure of the treated samples. The results show that after two cryogenic treatments, the quantity of the precipitate hardening β phase increases, and the sizes of the precipitates are refined from 8-10 μm to 2-4 μm. This is expected to be due to the decreased solubility of aluminum in the matrix at low temperature and the significant plastic deformation owing to internal differences in thermal contraction between phases and grains. The polycrystalline matrix is also noticeably refined, with the sizes of the subsequent nanocrystalline grains in the range of 50-100 nm. High density dislocations are observed to pile up at the grain boundaries, inducing the dynamic recrystallization of the microstructure, leading to the generation of a nanocrystalline grain structure. After two deep cryogenic treatments, the tensile strength and elongation are found to be substantially increased, rising from 243 MPa and 4.4% of as-cast state to 299 MPa and 5.1%.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015NatSR...515050H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015NatSR...515050H"><span>Reliable and cost effective design of intermetallic Ni2Si nanowires and direct characterization of its mechanical properties</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Han, Seung Zeon; Kang, Joonhee; Kim, Sung-Dae; Choi, Si-Young; Kim, Hyung Giun; Lee, Jehyun; Kim, Kwangho; Lim, Sung Hwan; Han, Byungchan</p> <p>2015-10-01</p> <p>We report that a single crystal Ni2Si nanowire (NW) of intermetallic compound can be reliably designed using simple three-step processes: casting a ternary Cu-Ni-Si alloy, nucleate and growth of Ni2Si NWs as embedded in the alloy matrix via designing discontinuous precipitation (DP) of Ni2Si nanoparticles and thermal aging, and finally chemical etching to decouple the Ni2Si NWs from the alloy matrix. By direct application of uniaxial tensile tests to the Ni2Si NW we characterize its mechanical properties, which were rarely reported in previous literatures. Using integrated studies of first principles density functional theory (DFT) calculations, high-resolution transmission electron microscopy (HRTEM), and energy-dispersive X-ray spectroscopy (EDX) we accurately validate the experimental measurements. Our results indicate that our simple three-step method enables to design brittle Ni2Si NW with high tensile strength of 3.0 GPa and elastic modulus of 60.6 GPa. We propose that the systematic methodology pursued in this paper significantly contributes to opening innovative processes to design various kinds of low dimensional nanomaterials leading to advancement of frontiers in nanotechnology and related industry sectors.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5708530','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5708530"><span>New advances in probing cell–extracellular matrix interactions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2017-01-01</p> <p>The extracellular matrix (ECM) provides structural and biochemical support to cells within tissues. An emerging body of evidence has established that the ECM plays a key role in cell mechanotransduction – the study of coupling between mechanical inputs and cellular phenotype – through either mediating transmission of forces to the cells, or presenting mechanical cues that guide cellular behaviors. Recent progress in cell mechanotransduction research has been facilitated by advances of experimental tools, particularly microtechnologies, engineered biomaterials, and imaging and analytical methods. Microtechnologies have enabled the design and fabrication of controlled physical microenvironments for the study and measurement of cell–ECM interactions. Advances in engineered biomaterials have allowed researchers to develop synthetic ECMs that mimic tissue microenvironments and investigate the impact of altered physicochemical properties on various cellular processes. Finally, advanced imaging and spectroscopy techniques have facilitated the visualization of the complex interaction between cells and ECM in vitro and in living tissues. This review will highlight the application of recent innovations in these areas to probing cell–ECM interactions. We believe cross-disciplinary approaches, combining aspects of the different technologies reviewed here, will inspire innovative ideas to further elucidate the secrets of ECM-mediated cell control. PMID:28352896</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2006Nanot..17.4195P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2006Nanot..17.4195P"><span>Ni3Si(Al)/a-SiOx core shell nanoparticles: characterization, shell formation, and stability</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Pigozzi, G.; Mukherji, D.; Gilles, R.; Barbier, B.; Kostorz, G.</p> <p>2006-08-01</p> <p>We have used an electrochemical selective phase dissolution method to extract nanoprecipitates of the Ni3Si-type intermetallic phase from two-phase Ni-Si and Ni-Si-Al alloys by dissolving the matrix phase. The extracted nanoparticles are characterized by transmission electron microscopy, energy-dispersive x-ray spectrometry, x-ray powder diffraction, and electron powder diffraction. It is found that the Ni3Si-type nanoparticles have a core-shell structure. The core maintains the size, the shape, and the crystal structure of the precipitates that existed in the bulk alloys, while the shell is an amorphous phase, containing only Si and O (SiOx). The shell forms around the precipitates during the extraction process. After annealing the nanoparticles in nitrogen at 700 °C, the tridymite phase recrystallizes within the shell, which remains partially amorphous. In contrast, on annealing in air at 1000 °C, no changes in the composition or the structure of the nanoparticles occur. It is suggested that the shell forms after dealloying of the matrix phase, where Si atoms, the main constituents of the shell, migrate to the surface of the precipitates.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/21727559','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/21727559"><span>Ni(3)Si(Al)/a-SiO(x) core-shell nanoparticles: characterization, shell formation, and stability.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Pigozzi, G; Mukherji, D; Gilles, R; Barbier, B; Kostorz, G</p> <p>2006-08-28</p> <p>We have used an electrochemical selective phase dissolution method to extract nanoprecipitates of the Ni(3)Si-type intermetallic phase from two-phase Ni-Si and Ni-Si-Al alloys by dissolving the matrix phase. The extracted nanoparticles are characterized by transmission electron microscopy, energy-dispersive x-ray spectrometry, x-ray powder diffraction, and electron powder diffraction. It is found that the Ni(3)Si-type nanoparticles have a core-shell structure. The core maintains the size, the shape, and the crystal structure of the precipitates that existed in the bulk alloys, while the shell is an amorphous phase, containing only Si and O (SiO(x)). The shell forms around the precipitates during the extraction process. After annealing the nanoparticles in nitrogen at 700 °C, the tridymite phase recrystallizes within the shell, which remains partially amorphous. In contrast, on annealing in air at 1000 °C, no changes in the composition or the structure of the nanoparticles occur. It is suggested that the shell forms after dealloying of the matrix phase, where Si atoms, the main constituents of the shell, migrate to the surface of the precipitates.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26456769','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26456769"><span>Reliable and cost effective design of intermetallic Ni2Si nanowires and direct characterization of its mechanical properties.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Han, Seung Zeon; Kang, Joonhee; Kim, Sung-Dae; Choi, Si-Young; Kim, Hyung Giun; Lee, Jehyun; Kim, Kwangho; Lim, Sung Hwan; Han, Byungchan</p> <p>2015-10-12</p> <p>We report that a single crystal Ni2Si nanowire (NW) of intermetallic compound can be reliably designed using simple three-step processes: casting a ternary Cu-Ni-Si alloy, nucleate and growth of Ni2Si NWs as embedded in the alloy matrix via designing discontinuous precipitation (DP) of Ni2Si nanoparticles and thermal aging, and finally chemical etching to decouple the Ni2Si NWs from the alloy matrix. By direct application of uniaxial tensile tests to the Ni2Si NW we characterize its mechanical properties, which were rarely reported in previous literatures. Using integrated studies of first principles density functional theory (DFT) calculations, high-resolution transmission electron microscopy (HRTEM), and energy-dispersive X-ray spectroscopy (EDX) we accurately validate the experimental measurements. Our results indicate that our simple three-step method enables to design brittle Ni2Si NW with high tensile strength of 3.0 GPa and elastic modulus of 60.6 GPa. We propose that the systematic methodology pursued in this paper significantly contributes to opening innovative processes to design various kinds of low dimensional nanomaterials leading to advancement of frontiers in nanotechnology and related industry sectors.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MMTA..tmp.1595R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MMTA..tmp.1595R"><span>Microstructural Evolution of Nanocrystalline ZrO2 in a Fe Matrix During High-Temperature Exposure</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Raghavendra, K. G.; Dasgupta, Arup; Athreya, C. N.; Jayasankar, K.; Saroja, S.; Subramanya Sarma, V.</p> <p>2018-06-01</p> <p>The current study examines the evolution of nanocrystallites of ZrO2 with time and temperature in a Fe-ZrO2 composite. The crystallite sizes were determined through X-ray peak broadening analysis by the Williamson-Hall method together with dark field transmission electron microscopy. The ZrO2 crystallites were found to be stable and retained their sizes at 973 K and 1073 K for hold durations up to 600 minutes. On the other hand, the crystallites were seen to grow at 1173 K and reached up to 200 nm for a hold time of 600 minutes. The Ostwald ripening model was adopted to understand crystallite growth while a dislocation-driven pipe diffusion was adopted for understanding the kinetics of grain growth. The activation energy of grain growth was calculated as 379 kJ mol-1. The modeled and experimentally calculated size evolutions with time and temperature were shown to be in good agreement with each other. A detailed discussion on the kinetics and activation energy of grain growth of ZrO2 crystallites in a Fe matrix is presented in this manuscript.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015ApSS..357..704J','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015ApSS..357..704J"><span>Effect of SiO2 grafted MWCNTs on the mechanical and dielectric properties of PEN composite films</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Jin, Fei; Feng, Mengna; Huang, Xu; Long, Cheng; Jia, Kun; Liu, Xiaobo</p> <p>2015-12-01</p> <p>In this study, the functional poly (arylene ether nitrile) (PEN)/multiwall carbon nanotubes (MWCNTs)/SiO2 nanocomposite with high mechanical and good electrical properties were fabricated through a simple and effective method. Specifically, the surface modification using highly ordered and porous SiO2 not only improves the dispersion of the MWCNTs in polymer matrix, but also combines the excellent properties of SiO2 and MWCNTs. Transmission electron microscopy (TEM), Fourier transform infrared spectra (FTIR), and scanning electron microscope (SEM) were employed to confirm the surface functionalization of MWCNTs. As a result, all the composite films exhibited good dielectric properties with high dielectric constant of 7 as well as low dielectric loss of 0.04. Besides, the results of mechanical tests showed that the tensile strength and modulus reached their highest values at the 2 wt% MWCNTs-SiO2 loading content (125 MPa and 2950 MPa, respectively). The rheological results showed that MWCNTs-SiO2/PEN composites have a typical solid-like viscoelastic response as frequencies changes. Therefore, all the results revealed that surface functionalization has strong influence on the dispersion state of MWCNTs in PEN matrix.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1369451-comparison-two-galerkin-quadrature-methods','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1369451-comparison-two-galerkin-quadrature-methods"><span>Comparison of two Galerkin quadrature methods</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Morel, Jim E.; Warsa, James; Franke, Brian C.; ...</p> <p>2017-02-21</p> <p>Here, we compare two methods for generating Galerkin quadratures. In method 1, the standard S N method is used to generate the moment-to-discrete matrix and the discrete-to-moment matrix is generated by inverting the moment-to-discrete matrix. This is a particular form of the original Galerkin quadrature method. In method 2, which we introduce here, the standard S N method is used to generate the discrete-to-moment matrix and the moment-to-discrete matrix is generated by inverting the discrete-to-moment matrix. With an N-point quadrature, method 1 has the advantage that it preserves N eigenvalues and N eigenvectors of the scattering operator in a pointwisemore » sense. With an N-point quadrature, method 2 has the advantage that it generates consistent angular moment equations from the corresponding S N equations while preserving N eigenvalues of the scattering operator. Our computational results indicate that these two methods are quite comparable for the test problem considered.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1369451','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1369451"><span>Comparison of two Galerkin quadrature methods</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Morel, Jim E.; Warsa, James; Franke, Brian C.</p> <p></p> <p>Here, we compare two methods for generating Galerkin quadratures. In method 1, the standard S N method is used to generate the moment-to-discrete matrix and the discrete-to-moment matrix is generated by inverting the moment-to-discrete matrix. This is a particular form of the original Galerkin quadrature method. In method 2, which we introduce here, the standard S N method is used to generate the discrete-to-moment matrix and the moment-to-discrete matrix is generated by inverting the discrete-to-moment matrix. With an N-point quadrature, method 1 has the advantage that it preserves N eigenvalues and N eigenvectors of the scattering operator in a pointwisemore » sense. With an N-point quadrature, method 2 has the advantage that it generates consistent angular moment equations from the corresponding S N equations while preserving N eigenvalues of the scattering operator. Our computational results indicate that these two methods are quite comparable for the test problem considered.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1400353','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1400353"><span>Effect of Silicon in U-10Mo Alloy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Kautz, Elizabeth J.; Devaraj, Arun; Kovarik, Libor</p> <p>2017-08-31</p> <p>This document details a method for evaluating the effect of silicon impurity content on U-10Mo alloys. Silicon concentration in U-10Mo alloys has been shown to impact the following: volume fraction of precipitate phases, effective density of the final alloy, and 235-U enrichment in the gamma-UMo matrix. This report presents a model for calculating these quantities as a function of Silicon concentration, which along with fuel foil characterization data, will serve as a reference for quality control of the U-10Mo final alloy Si content. Additionally, detailed characterization using scanning electron microscope imaging, transmission electron microscope diffraction, and atom probe tomography showedmore » that Silicon impurities present in U-10Mo alloys form a Si-rich precipitate phase.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014ITSP...62.4451W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014ITSP...62.4451W"><span>Transmit Designs for the MIMO Broadcast Channel With Statistical CSI</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wu, Yongpeng; Jin, Shi; Gao, Xiqi; McKay, Matthew R.; Xiao, Chengshan</p> <p>2014-09-01</p> <p>We investigate the multiple-input multiple-output broadcast channel with statistical channel state information available at the transmitter. The so-called linear assignment operation is employed, and necessary conditions are derived for the optimal transmit design under general fading conditions. Based on this, we introduce an iterative algorithm to maximize the linear assignment weighted sum-rate by applying a gradient descent method. To reduce complexity, we derive an upper bound of the linear assignment achievable rate of each receiver, from which a simplified closed-form expression for a near-optimal linear assignment matrix is derived. This reveals an interesting construction analogous to that of dirty-paper coding. In light of this, a low complexity transmission scheme is provided. Numerical examples illustrate the significant performance of the proposed low complexity scheme.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22590774-optimal-laser-wavelength-efficient-laser-power-converter-operation-over-temperature','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22590774-optimal-laser-wavelength-efficient-laser-power-converter-operation-over-temperature"><span>Optimal laser wavelength for efficient laser power converter operation over temperature</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Höhn, O., E-mail: oliver.hoehn@ise.fraunhofer.de; Walker, A. W.; Bett, A. W.</p> <p>2016-06-13</p> <p>A temperature dependent modeling study is conducted on a GaAs laser power converter to identify the optimal incident laser wavelength for optical power transmission. Furthermore, the respective temperature dependent maximal conversion efficiencies in the radiative limit as well as in a practically achievable limit are presented. The model is based on the transfer matrix method coupled to a two-diode model, and is calibrated to experimental data of a GaAs photovoltaic device over laser irradiance and temperature. Since the laser wavelength does not strongly influence the open circuit voltage of the laser power converter, the optimal laser wavelength is determined tomore » be in the range where the external quantum efficiency is maximal, but weighted by the photon flux of the laser.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015STAdM..16b5002S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015STAdM..16b5002S"><span>Planar silver nanowire, carbon nanotube and PEDOT:PSS nanocomposite transparent electrodes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Stapleton, Andrew J.; Yambem, Soniya D.; Johns, Ashley H.; Afre, Rakesh A.; Ellis, Amanda V.; Shapter, Joe G.; Andersson, Gunther G.; Quinton, Jamie S.; Burn, Paul L.; Meredith, Paul; Lewis, David A.</p> <p>2015-04-01</p> <p>Highly conductive, transparent and flexible planar electrodes were fabricated using interwoven silver nanowires and single-walled carbon nanotubes (AgNW:SWCNT) in a PEDOT:PSS matrix via an epoxy transfer method from a silicon template. The planar electrodes achieved a sheet resistance of 6.6 ± 0.0 Ω/□ and an average transmission of 86% between 400 and 800 nm. A high figure of merit of 367 Ω-1 is reported for the electrodes, which is much higher than that measured for indium tin oxide and reported for other AgNW composites. The AgNW:SWCNT:PEDOT:PSS electrode was used to fabricate low temperature (annealing free) devices demonstrating their potential to function with a range of organic semiconducting polymer:fullerene bulk heterojunction blend systems.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24274483','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24274483"><span>Development of regenerated cellulose/halloysites nanocomposites via ionic liquids.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hanid, Nurbaiti Abdul; Wahit, Mat Uzir; Guo, Qipeng; Mahmoodian, Shaya; Soheilmoghaddam, Mohammad</p> <p>2014-01-01</p> <p>In this study, regenerated cellulose/halloysites (RC/HNT) nanocomposites with different nanofillers loading were fabricated by dissolving the cellulose in 1-ethyl-3-methylimidazolium chloride (EMIMCl) ionic liquid. The films were prepared via solution casting method and were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The mechanical properties were investigated by tensile testing. It clearly displayed a good enhancement of both tensile strength and Young's modulus with HNT loading up to 5 wt%. As the HNT loadings increased to 5 wt%, the thermal behaviour and water resistance rate was also increased. The TEM and SEM images also depicted even dispersion of the HNT and a good intertubular interaction between the HNT and the cellulose matrix. Copyright © 2013 Elsevier Ltd. All rights reserved.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li class="active"><span>25</span></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_25 --> <div class="footer-extlink text-muted" style="margin-bottom:1rem; text-align:center;">Some links on this page may take you to non-federal websites. Their policies may differ from this site.</div> </div><!-- container --> <a id="backToTop" href="#top"> Top </a> <footer> <nav> <ul class="links"> <li><a href="/sitemap.html">Site Map</a></li> <li><a href="/website-policies.html">Website Policies</a></li> <li><a href="https://www.energy.gov/vulnerability-disclosure-policy" target="_blank">Vulnerability Disclosure Program</a></li> <li><a href="/contact.html">Contact Us</a></li> </ul> </nav> </footer> <script type="text/javascript"><!-- // var lastDiv = ""; function showDiv(divName) { // hide last div if (lastDiv) { document.getElementById(lastDiv).className = "hiddenDiv"; } //if value of the box is not nothing and an object with that name exists, then change the class if (divName && document.getElementById(divName)) { document.getElementById(divName).className = "visibleDiv"; lastDiv = divName; } } //--> </script> <script> /** * Function that tracks a click on an outbound link in Google Analytics. * This function takes a valid URL string as an argument, and uses that URL string * as the event label. */ var trackOutboundLink = function(url,collectionCode) { try { h = window.open(url); setTimeout(function() { ga('send', 'event', 'topic-page-click-through', collectionCode, url); }, 1000); } catch(err){} }; </script> <!-- Google Analytics --> <script> (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','//www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-1122789-34', 'auto'); ga('send', 'pageview'); </script> <!-- End Google Analytics --> <script> showDiv('page_1') </script> </body> </html>