Characteristics of the transmission loss apparatus at NASA Langley Research Center

NASA Technical Reports Server (NTRS)

Grosveld, F. W.

1983-01-01

A description of the Transmission Loss Apparatus at NASA Langley Research Center, which is specifically designed to accommodate general aviation type aircraft structures, is presented. The measurement methodology, referred to as the Plate Reference Method, is discussed and compared with the classical method as described in the Standard of the American Society for Testing and Materials. This measurement procedure enables reliable and accurate noise transmission loss measurements down to the 50 Hz one-third octave band. The transmission loss characteristics of add-on acoustical treatments, applied to the basic structure, can be established by inclusion of appropriate absorption corrections for the treatment.

Measurement of the normalized broadband ultrasound attenuation in trabecular bone by using a bidirectional transverse transmission technique

NASA Astrophysics Data System (ADS)

Lee, Kang Il

2015-01-01

A new method for measuring the normalized broadband ultrasound attenuation (nBUA) in trabecular bone by using a bidirectional transverse transmission technique was proposed and validated with measurements obtained by using the conventional transverse transmission technique. There was no significant difference between the nBUA measurements obtained for 14 bovine femoral trabecular bone samples by using the bidirectional and the conventional transverse transmission techniques. The nBUA measured by using the two transverse transmission techniques showed strong positive correlations of r = 0.87 to 0.88 with the apparent bone density, consistent with the behavior in human trabecular bone invitro. We expect that the new method can be usefully applied for improved accuracy and precision in clinical measurements.

An improved method for design of expansion-chamber mufflers with application to an operational helicopter

NASA Technical Reports Server (NTRS)

Parrott, T. L.

1973-01-01

An improved method for the design of expansion-chamber mufflers is described and applied to the task of reducing exhaust noise generated by a helicopter. The method is an improvement of standard transmission-line theory in that it accounts for the effect of the mean exhaust-gas flow on the acoustic-transmission properties of a muffler system, including the termination boundary condition. The method has been computerized, and the computer program includes an optimization procedure that adjusts muffler component lengths to achieve a minimum specified desired transmission loss over a specified frequency range. A printout of the program is included together with a user-oriented description.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balser, S.; Sankar, S.; Miller, R.

In order to more fully integrate renewable resources, such as wind and solar, into the transmission system, additional capacity must be realized in the short term using the installed transmission capacity that exists today. The U.S. Department of Energy (DOE) and the National Renewable Energy Laboratory Transmission and Grid Integration Group supported this study to assemble the history of regulations and status of transmission technology to expand existing grid capacity. This report compiles data on various transmission technology methods and upgrades for increased capacity utilization of the existing transmission system and transmission corridors. The report discusses the technical merit ofmore » each method and explains how the method could be applied within the current regulatory structure to increase existing transmission conductor and/or corridor capacity. The history and current state of alternatives to new construction is presented for regulators, legislators, and other policy makers wrestling with issues surrounding integration of variable generation. Current regulations are assessed for opportunities to change them to promote grid expansion. To support consideration of these alternatives for expanding grid capacity, the report lists relevant rules, standards, and policy changes.« less

Implementation study of wearable sensors for activity recognition systems

PubMed Central

Ghassemian, Mona

2015-01-01

This Letter investigates and reports on a number of activity recognition methods for a wearable sensor system. The authors apply three methods for data transmission, namely ‘stream-based’, ‘feature-based’ and ‘threshold-based’ scenarios to study the accuracy against energy efficiency of transmission and processing power that affects the mote's battery lifetime. They also report on the impact of variation of sampling frequency and data transmission rate on energy consumption of motes for each method. This study leads us to propose a cross-layer optimisation of an activity recognition system for provisioning acceptable levels of accuracy and energy efficiency. PMID:26609413

Immersion transmission ellipsometry (ITE): a new method for the precise determination of the 3D indicatrix of thin films

NASA Astrophysics Data System (ADS)

Jung, C. C.; Stumpe, J.

2005-02-01

The new method of immersion transmission ellipsometry (ITE) [1] has been developed. It allows the highly accurate determination of the absolute three-dimensional (3D) refractive indices of anisotropic thin films. The method is combined with conventional ellipsometry in transmission and reflection, and the thickness determination of anisotropic films solely by optical methods also becomes more accurate. The method is applied to the determination of the 3D refractive indices of thin spin-coated films of an azobenzene-containing liquid-crystalline copolymer. The development of the anisotropy in these films by photo-orientation and subsequent annealing is demonstrated. Depending on the annealing temperature, oblate or prolate orders are generated.

Multi-band transmission color filters for multi-color white LEDs based visible light communication

NASA Astrophysics Data System (ADS)

Wang, Qixia; Zhu, Zhendong; Gu, Huarong; Chen, Mengzhu; Tan, Qiaofeng

2017-11-01

Light-emitting diodes (LEDs) based visible light communication (VLC) can provide license-free bands, high data rates, and high security levels, which is a promising technique that will be extensively applied in future. Multi-band transmission color filters with enough peak transmittance and suitable bandwidth play a pivotal role for boosting signal-noise-ratio in VLC systems. In this paper, multi-band transmission color filters with bandwidth of dozens nanometers are designed by a simple analytical method. Experiment results of one-dimensional (1D) and two-dimensional (2D) tri-band color filters demonstrate the effectiveness of the multi-band transmission color filters and the corresponding analytical method.

Cloud Properties Derived from Surface-Based Near-Infrared Spectral Transmission

NASA Technical Reports Server (NTRS)

Pilewskie, Peter; Twomey, S.; Gore, Warren J. Y. (Technical Monitor)

1996-01-01

Surface based near-infrared cloud spectral transmission measurements from a recent precipitation/cloud physics field study are used to determine cloud physical properties and relate them to other remote sensing and in situ measurements. Asymptotic formulae provide an effective means of closely approximating the qualitative and quantitative behavior of transmission computed by more laborious detailed methods. Relationships derived from asymptotic formulae are applied to measured transmission spectra to test objectively the internal consistency of data sets acquired during the field program and they confirmed the quality of the measurements. These relationships appear to be very useful in themselves, not merely as a quality control measure, but also a potentially valuable remote-sensing technique in its own right. Additional benefits from this analysis have been the separation of condensed water (cloud) transmission and water vapor transmission and the development of a method to derive cloud liquid water content.

High speed data transmission coaxial-cable in the space communication system

NASA Astrophysics Data System (ADS)

Su, Haohang; Huang, Jing

2018-01-01

An effective method is proved based on the scattering parameter of high speed 8-core coaxial-cable measured by vector network analyzer, and the semi-physical simulation is made to receive the eye diagram at different data transmission rate. The result can be apply to analysis decay and distortion of the signal through the coaxial-cable at high frequency, and can extensively design for electromagnetic compatibility of high-speed data transmission system.

A study of methods of prediction and measurement of the transmission sound through the walls of light aircraft

NASA Technical Reports Server (NTRS)

Forssen, B.; Wang, Y. S.; Crocker, M. J.

1981-01-01

Several aspects were studied. The SEA theory was used to develop a theoretical model to predict the transmission loss through an aircraft window. This work mainly consisted of the writing of two computer programs. One program predicts the sound transmission through a plexiglass window (the case of a single partition). The other program applies to the case of a plexiglass window window with a window shade added (the case of a double partition with an air gap). The sound transmission through a structure was measured in experimental studies using several different methods in order that the accuracy and complexity of all the methods could be compared. Also, the measurements were conducted on the simple model of a fuselage (a cylindrical shell), on a real aircraft fuselage, and on stiffened panels.

A study of methods of prediction and measurement of the transmission sound through the walls of light aircraft

NASA Astrophysics Data System (ADS)

Forssen, B.; Wang, Y. S.; Crocker, M. J.

1981-12-01

Several aspects were studied. The SEA theory was used to develop a theoretical model to predict the transmission loss through an aircraft window. This work mainly consisted of the writing of two computer programs. One program predicts the sound transmission through a plexiglass window (the case of a single partition). The other program applies to the case of a plexiglass window window with a window shade added (the case of a double partition with an air gap). The sound transmission through a structure was measured in experimental studies using several different methods in order that the accuracy and complexity of all the methods could be compared. Also, the measurements were conducted on the simple model of a fuselage (a cylindrical shell), on a real aircraft fuselage, and on stiffened panels.

Study of Corrosion Resistance Improvement by Metallic Coating for Overhead Transmission Line Conductor

NASA Astrophysics Data System (ADS)

Isozaki, Masanori; Adachi, Kouichi; Hita, Takanori; Asano, Yuji

Applying anti-corrosion grease and aluminum clad steel (AC) wires to ACSR has adopted as general methods to prevent overhead transmission line conductors and/or wires from corrosion. However, there are some cases that ineffectiveness of those means are reported on some transmission lines passing through acid atmosphere in the vicinity of a factory exhausting acid smoke. The feature of the corrosion caused by acid atmosphere is to show a higher speed in its progressing as well known. As means against such acid corrosion, application of high purity aluminum, selective removal of inter-metallic compound in aluminum and plastic coating wires has been reported before, and each has both of advantage and disadvantage actually. In the former letter, we reported the new type of anti-corrosion grease that shows an excellent property against acid atmosphere as well as in a salty circumstance. Here presents a new type of anti-corrosion technology of applying high corrosion resistance aluminum alloy or zinc coatings on each component wires of a conductor that we succeed in developing through a serial study of anti-corrosion methods on overhead transmission lines.

Atmospheric monitoring in MAGIC and data corrections

NASA Astrophysics Data System (ADS)

Fruck, Christian; Gaug, Markus

2015-03-01

A method for analyzing returns of a custom-made "micro"-LIDAR system, operated alongside the two MAGIC telescopes is presented. This method allows for calculating the transmission through the atmospheric boundary layer as well as thin cloud layers. This is achieved by applying exponential fits to regions of the back-scattering signal that are dominated by Rayleigh scattering. Making this real-time transmission information available for the MAGIC data stream allows to apply atmospheric corrections later on in the analysis. Such corrections allow for extending the effective observation time of MAGIC by including data taken under adverse atmospheric conditions. In the future they will help reducing the systematic uncertainties of energy and flux.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Transmission Bottleneck Size Estimation from Pathogen Deep-Sequencing Data, with an Application to Human Influenza A Virus.

PubMed

Sobel Leonard, Ashley; Weissman, Daniel B; Greenbaum, Benjamin; Ghedin, Elodie; Koelle, Katia

2017-07-15

The bottleneck governing infectious disease transmission describes the size of the pathogen population transferred from the donor to the recipient host. Accurate quantification of the bottleneck size is particularly important for rapidly evolving pathogens such as influenza virus, as narrow bottlenecks reduce the amount of transferred viral genetic diversity and, thus, may decrease the rate of viral adaptation. Previous studies have estimated bottleneck sizes governing viral transmission by using statistical analyses of variants identified in pathogen sequencing data. These analyses, however, did not account for variant calling thresholds and stochastic viral replication dynamics within recipient hosts. Because these factors can skew bottleneck size estimates, we introduce a new method for inferring bottleneck sizes that accounts for these factors. Through the use of a simulated data set, we first show that our method, based on beta-binomial sampling, accurately recovers transmission bottleneck sizes, whereas other methods fail to do so. We then apply our method to a data set of influenza A virus (IAV) infections for which viral deep-sequencing data from transmission pairs are available. We find that the IAV transmission bottleneck size estimates in this study are highly variable across transmission pairs, while the mean bottleneck size of 196 virions is consistent with a previous estimate for this data set. Furthermore, regression analysis shows a positive association between estimated bottleneck size and donor infection severity, as measured by temperature. These results support findings from experimental transmission studies showing that bottleneck sizes across transmission events can be variable and influenced in part by epidemiological factors. IMPORTANCE The transmission bottleneck size describes the size of the pathogen population transferred from the donor to the recipient host and may affect the rate of pathogen adaptation within host populations. Recent advances in sequencing technology have enabled bottleneck size estimation from pathogen genetic data, although there is not yet a consistency in the statistical methods used. Here, we introduce a new approach to infer the bottleneck size that accounts for variant identification protocols and noise during pathogen replication. We show that failing to account for these factors leads to an underestimation of bottleneck sizes. We apply this method to an existing data set of human influenza virus infections, showing that transmission is governed by a loose, but highly variable, transmission bottleneck whose size is positively associated with the severity of infection of the donor. Beyond advancing our understanding of influenza virus transmission, we hope that this work will provide a standardized statistical approach for bottleneck size estimation for viral pathogens. Copyright © 2017 Sobel Leonard et al.

Parallel Excitation for B-Field Insensitive Fat-Saturation Preparation

PubMed Central

Heilman, Jeremiah A.; Derakhshan, Jamal D.; Riffe, Matthew J.; Gudino, Natalia; Tkach, Jean; Flask, Chris A.; Duerk, Jeffrey L.; Griswold, Mark A.

2016-01-01

Multichannel transmission has the potential to improve many aspects of MRI through a new paradigm in excitation. In this study, multichannel transmission is used to address the effects that variations in B0 homogeneity have on fat-saturation preparation through the use of the frequency, phase, and amplitude degrees of freedom afforded by independent transmission channels. B1 homogeneity is intrinsically included via use of coil sensitivities in calculations. A new method, parallel excitation for B-field insensitive fat-saturation preparation, can achieve fat saturation in 89% of voxels with Mz ≤ 0.1 in the presence of ±4 ppm B0 variation, where traditional CHESS methods achieve only 40% in the same conditions. While there has been much progress to apply multichannel transmission at high field strengths, particular focus is given here to application of these methods at 1.5 T. PMID:22247080

Optimal estimation of spatially variable recharge and transmissivity fields under steady-state groundwater flow. Part 1. Theory

NASA Astrophysics Data System (ADS)

Graham, Wendy D.; Tankersley, Claude D.

1994-05-01

Stochastic methods are used to analyze two-dimensional steady groundwater flow subject to spatially variable recharge and transmissivity. Approximate partial differential equations are developed for the covariances and cross-covariances between the random head, transmissivity and recharge fields. Closed-form solutions of these equations are obtained using Fourier transform techniques. The resulting covariances and cross-covariances can be incorporated into a Bayesian conditioning procedure which provides optimal estimates of the recharge, transmissivity and head fields given available measurements of any or all of these random fields. Results show that head measurements contain valuable information for estimating the random recharge field. However, when recharge is treated as a spatially variable random field, the value of head measurements for estimating the transmissivity field can be reduced considerably. In a companion paper, the method is applied to a case study of the Upper Floridan Aquifer in NE Florida.

A Review of Transmission Diagnostics Research at NASA Lewis Research Center

NASA Technical Reports Server (NTRS)

Zakajsek, James J.

1994-01-01

This paper presents a summary of the transmission diagnostics research work conducted at NASA Lewis Research Center over the last four years. In 1990, the Transmission Health and Usage Monitoring Research Team at NASA Lewis conducted a survey to determine the critical needs of the diagnostics community. Survey results indicated that experimental verification of gear and bearing fault detection methods, improved fault detection in planetary systems, and damage magnitude assessment and prognostics research were all critical to a highly reliable health and usage monitoring system. In response to this, a variety of transmission fault detection methods were applied to experimentally obtained fatigue data. Failure modes of the fatigue data include a variety of gear pitting failures, tooth wear, tooth fracture, and bearing spalling failures. Overall results indicate that, of the gear fault detection techniques, no one method can successfully detect all possible failure modes. The more successful methods need to be integrated into a single more reliable detection technique. A recently developed method, NA4, in addition to being one of the more successful gear fault detection methods, was also found to exhibit damage magnitude estimation capabilities.

Investigation of Current Methods to Identify Helicopter Gear Health

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Lewicki, David G.; Le, Dy D.

2007-01-01

This paper provides an overview of current vibration methods used to identify the health of helicopter transmission gears. The gears are critical to the transmission system that provides propulsion, lift and maneuvering of the helicopter. This paper reviews techniques used to process vibration data to calculate conditions indicators (CI's), guidelines used by the government aviation authorities in developing and certifying the Health and Usage Monitoring System (HUMS), condition and health indicators used in commercial HUMS, and different methods used to set thresholds to detect damage. Initial assessment of a method to set thresholds for vibration based condition indicators applied to flight and test rig data by evaluating differences in distributions between comparable transmissions are also discussed. Gear condition indicator FM4 values are compared on an OH58 helicopter during 14 maneuvers and an OH58 transmission test stand during crack propagation tests. Preliminary results show the distributions between healthy helicopter and rig data are comparable and distributions between healthy and damaged gears show significant differences.

Investigation of Current Methods to Identify Helicopter Gear Health

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Lewicki, David G.; Le, Dy D.

2007-01-01

This paper provides an overview of current vibration methods used to identify the health of helicopter transmission gears. The gears are critical to the transmission system that provides propulsion, lift and maneuvering of the helicopter. This paper reviews techniques used to process vibration data to calculate conditions indicators (CI s), guidelines used by the government aviation authorities in developing and certifying the Health and Usage Monitoring System (HUMS), condition and health indicators used in commercial HUMS, and different methods used to set thresholds to detect damage. Initial assessment of a method to set thresholds for vibration based condition indicators applied to flight and test rig data by evaluating differences in distributions between comparable transmissions are also discussed. Gear condition indicator FM4 values are compared on an OH58 helicopter during 14 maneuvers and an OH58 transmission test stand during crack propagation tests. Preliminary results show the distributions between healthy helicopter and rig data are comparable and distributions between healthy and damaged gears show significant differences.

A research to reduce interior noise in general aviation airplanes. General aviation interior noise study

NASA Technical Reports Server (NTRS)

Roskam, J.; Muirhead, V. U.; Smith, H. W.; Peschier, T. D.

1977-01-01

The construction, calibration, and properties of a facility for measuring sound transmission through aircraft type panels are described along with the theoretical and empirical methods used. Topics discussed include typical noise source, sound transmission path, and acoustic cabin properties and their effect on interior noise. Experimental results show an average sound transmission loss in the mass controlled frequency region comparable to theoretical predictions. The results also verify that transmission losses in the stiffness controlled region directly depend on the fundamental frequency of the panel. Experimental and theoretical results indicate that increases in this frequency, and consequently in transmission loss, can be achieved by applying pressure differentials across the specimen.

Performance analysis of cross-seeding WDM-PON system using transfer matrix method

NASA Astrophysics Data System (ADS)

Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

2016-12-01

In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

A low-level stress measurement method by integrating white light photoelasticity and spectrometry

NASA Astrophysics Data System (ADS)

Sung, Po-Chi; Wang, Wei-Chung; Hwang, Chi-Hung; Lai, Guan-Ting

2018-01-01

To face the increasing demand of residual stress measurement in many hi-tech industries, the integration of photoelasticity and advanced image acquisition equipment is a natural trend. With the integration of photoelasticity and spectrometry, the measurement capability of low-level stress and the stress in low birefringence materials can be enhanced. In fact, there is a significant correlation between the stress level and transmissivity spectrum. The key of the stress measurement method proposed in this paper is to find this scarcely explored correlation. By analyzing the periodic extinction phenomenon of isochromatic fringe pattern obtained from white light photoelasticity and the equation of transmissivity spectrum expressed in stress and wavelength, a three-dimensional (3D) systematic relationship of transmissivity with stress and wavelength can be established. By applying the 3D systematic transmissivity with stress and wavelength, the stress value can be determined directly from the transmissivity of the light transmitted through the polariscope. Moreover, when the proposed method is employed, the required parameters can be directly obtained from the database. There is no need to know the wavelength-dependent stress-optic coefficient beforehand. Glass, a very low birefringence material, was used to confirm the feasibility of the proposed method. Two regression approaches to search the transmissivity extremities were attempted to find the optimum systematic relationship.

Simultaneous inference of phylogenetic and transmission trees in infectious disease outbreaks

PubMed Central

2017-01-01

Whole-genome sequencing of pathogens from host samples becomes more and more routine during infectious disease outbreaks. These data provide information on possible transmission events which can be used for further epidemiologic analyses, such as identification of risk factors for infectivity and transmission. However, the relationship between transmission events and sequence data is obscured by uncertainty arising from four largely unobserved processes: transmission, case observation, within-host pathogen dynamics and mutation. To properly resolve transmission events, these processes need to be taken into account. Recent years have seen much progress in theory and method development, but existing applications make simplifying assumptions that often break up the dependency between the four processes, or are tailored to specific datasets with matching model assumptions and code. To obtain a method with wider applicability, we have developed a novel approach to reconstruct transmission trees with sequence data. Our approach combines elementary models for transmission, case observation, within-host pathogen dynamics, and mutation, under the assumption that the outbreak is over and all cases have been observed. We use Bayesian inference with MCMC for which we have designed novel proposal steps to efficiently traverse the posterior distribution, taking account of all unobserved processes at once. This allows for efficient sampling of transmission trees from the posterior distribution, and robust estimation of consensus transmission trees. We implemented the proposed method in a new R package phybreak. The method performs well in tests of both new and published simulated data. We apply the model to five datasets on densely sampled infectious disease outbreaks, covering a wide range of epidemiological settings. Using only sampling times and sequences as data, our analyses confirmed the original results or improved on them: the more realistic infection times place more confidence in the inferred transmission trees. PMID:28545083

Simultaneous inference of phylogenetic and transmission trees in infectious disease outbreaks.

PubMed

Klinkenberg, Don; Backer, Jantien A; Didelot, Xavier; Colijn, Caroline; Wallinga, Jacco

2017-05-01

Whole-genome sequencing of pathogens from host samples becomes more and more routine during infectious disease outbreaks. These data provide information on possible transmission events which can be used for further epidemiologic analyses, such as identification of risk factors for infectivity and transmission. However, the relationship between transmission events and sequence data is obscured by uncertainty arising from four largely unobserved processes: transmission, case observation, within-host pathogen dynamics and mutation. To properly resolve transmission events, these processes need to be taken into account. Recent years have seen much progress in theory and method development, but existing applications make simplifying assumptions that often break up the dependency between the four processes, or are tailored to specific datasets with matching model assumptions and code. To obtain a method with wider applicability, we have developed a novel approach to reconstruct transmission trees with sequence data. Our approach combines elementary models for transmission, case observation, within-host pathogen dynamics, and mutation, under the assumption that the outbreak is over and all cases have been observed. We use Bayesian inference with MCMC for which we have designed novel proposal steps to efficiently traverse the posterior distribution, taking account of all unobserved processes at once. This allows for efficient sampling of transmission trees from the posterior distribution, and robust estimation of consensus transmission trees. We implemented the proposed method in a new R package phybreak. The method performs well in tests of both new and published simulated data. We apply the model to five datasets on densely sampled infectious disease outbreaks, covering a wide range of epidemiological settings. Using only sampling times and sequences as data, our analyses confirmed the original results or improved on them: the more realistic infection times place more confidence in the inferred transmission trees.

Increasing role of arthropod bites in tularaemia transmission in Poland - case reports and diagnostic methods.

PubMed

Formińska, Kamila; Zasada, Aleksandra A; Rastawicki, Waldemar; Śmietańska, Karolina; Bander, Dorota; Wawrzynowicz-Syczewska, Marta; Yanushevych, Mariya; Niścigórska-Olsen, Jolanta; Wawszczak, Marek

2015-01-01

The study describes four cases of tularaemia - one developed after contact with rabbits and three developed after an arthropod bite. Due to non-specific clinical symptoms, accurate diagnosis of tularaemia may be difficult. The increasing contribution of the arthropod vectors in the transmission of the disease indicates that special effort should be made to apply sensitive and specific diagnostic methods for tularaemia, and to remind health-care workers about this route of Francisella tularensis infections. The advantages and disadvantages of various diagnostic methods - molecular, serological and microbiological culture - are discussed. The PCR as a rapid and proper diagnostic method for ulceroglandular tularaemia is presented.

A hybrid Boundary Element Unstructured Transmission-line (BEUT) method for accurate 2D electromagnetic simulation

NASA Astrophysics Data System (ADS)

Simmons, Daniel; Cools, Kristof; Sewell, Phillip

2016-11-01

Time domain electromagnetic simulation tools have the ability to model transient, wide-band applications, and non-linear problems. The Boundary Element Method (BEM) and the Transmission Line Modeling (TLM) method are both well established numerical techniques for simulating time-varying electromagnetic fields. The former surface based method can accurately describe outwardly radiating fields from piecewise uniform objects and efficiently deals with large domains filled with homogeneous media. The latter volume based method can describe inhomogeneous and non-linear media and has been proven to be unconditionally stable. Furthermore, the Unstructured TLM (UTLM) enables modelling of geometrically complex objects by using triangular meshes which removes staircasing and unnecessary extensions of the simulation domain. The hybridization of BEM and UTLM which is described in this paper is named the Boundary Element Unstructured Transmission-line (BEUT) method. It incorporates the advantages of both methods. The theory and derivation of the 2D BEUT method is described in this paper, along with any relevant implementation details. The method is corroborated by studying its correctness and efficiency compared to the traditional UTLM method when applied to complex problems such as the transmission through a system of Luneburg lenses and the modelling of antenna radomes for use in wireless communications.

A hybrid Boundary Element Unstructured Transmission-line (BEUT) method for accurate 2D electromagnetic simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, Daniel, E-mail: daniel.simmons@nottingham.ac.uk; Cools, Kristof; Sewell, Phillip

Time domain electromagnetic simulation tools have the ability to model transient, wide-band applications, and non-linear problems. The Boundary Element Method (BEM) and the Transmission Line Modeling (TLM) method are both well established numerical techniques for simulating time-varying electromagnetic fields. The former surface based method can accurately describe outwardly radiating fields from piecewise uniform objects and efficiently deals with large domains filled with homogeneous media. The latter volume based method can describe inhomogeneous and non-linear media and has been proven to be unconditionally stable. Furthermore, the Unstructured TLM (UTLM) enables modelling of geometrically complex objects by using triangular meshes which removesmore » staircasing and unnecessary extensions of the simulation domain. The hybridization of BEM and UTLM which is described in this paper is named the Boundary Element Unstructured Transmission-line (BEUT) method. It incorporates the advantages of both methods. The theory and derivation of the 2D BEUT method is described in this paper, along with any relevant implementation details. The method is corroborated by studying its correctness and efficiency compared to the traditional UTLM method when applied to complex problems such as the transmission through a system of Luneburg lenses and the modelling of antenna radomes for use in wireless communications. - Graphical abstract:.« less

Optical modeling of fiber organic photovoltaic structures using a transmission line method.

PubMed

Moshonas, N; Stathopoulos, N A; O'Connor, B T; Bedeloglu, A Celik; Savaidis, S P; Vasiliadis, S

2017-12-01

An optical model has been developed and evaluated for the calculation of the external quantum efficiency of cylindrical fiber photovoltaic structures. The model is based on the transmission line theory and has been applied on single and bulk heterojunction fiber-photovoltaic cells. Using this model, optimum design characteristics have been proposed for both configurations, and comparison with experimental results has been assessed.

High frequency resolution terahertz time-domain spectroscopy

NASA Astrophysics Data System (ADS)

Sangala, Bagvanth Reddy

2013-12-01

A new method for the high frequency resolution terahertz time-domain spectroscopy is developed based on the characteristic matrix method. This method is useful for studying planar samples or stack of planar samples. The terahertz radiation was generated by optical rectification in a ZnTe crystal and detected by another ZnTe crystal via electro-optic sampling method. In this new characteristic matrix based method, the spectra of the sample and reference waveforms will be modeled by using characteristic matrices. We applied this new method to measure the optical constants of air. The terahertz transmission through the layered systems air-Teflon-air-Quartz-air and Nitrogen gas-Teflon-Nitrogen gas-Quartz-Nitrogen gas was modeled by the characteristic matrix method. A transmission coefficient is derived from these models which was optimized to fit the experimental transmission coefficient to extract the optical constants of air. The optimization of an error function involving the experimental complex transmission coefficient and the theoretical transmission coefficient was performed using patternsearch algorithm of MATLAB. Since this method takes account of the echo waveforms due to reflections in the layered samples, this method allows analysis of longer time-domain waveforms giving rise to very high frequency resolution in the frequency-domain. We have presented the high frequency resolution terahertz time-domain spectroscopy of air and compared the results with the literature values. We have also fitted the complex susceptibility of air to the Lorentzian and Gaussian functions to extract the linewidths.

Phylogenetic studies of transmission dynamics in generalized HIV epidemics: An essential tool where the burden is greatest?

PubMed Central

Dennis, Ann M.; Herbeck, Joshua T.; Brown, Andrew Leigh; Kellam, Paul; de Oliveira, Tulio; Pillay, Deenan; Fraser, Christophe; Cohen, Myron S.

2014-01-01

Efficient and effective HIV prevention measures for generalized epidemics in sub-Saharan Africa have not yet been validated at the population-level. Design and impact evaluation of such measures requires fine-scale understanding of local HIV transmission dynamics. The novel tools of HIV phylogenetics and molecular epidemiology may elucidate these transmission dynamics. Such methods have been incorporated into studies of concentrated HIV epidemics to identify proximate and determinant traits associated with ongoing transmission. However, applying similar phylogenetic analyses to generalized epidemics, including the design and evaluation of prevention trials, presents additional challenges. Here we review the scope of these methods and present examples of their use in concentrated epidemics in the context of prevention. Next, we describe the current uses for phylogenetics in generalized epidemics, and discuss their promise for elucidating transmission patterns and informing prevention trials. Finally, we review logistic and technical challenges inherent to large-scale molecular epidemiological studies of generalized epidemics, and suggest potential solutions. PMID:24977473

Quantifying Transmission Investment in Malaria Parasites

PubMed Central

Greischar, Megan A.; Mideo, Nicole; Read, Andrew F.; Bjørnstad, Ottar N.

2016-01-01

Many microparasites infect new hosts with specialized life stages, requiring a subset of the parasite population to forgo proliferation and develop into transmission forms. Transmission stage production influences infectivity, host exploitation, and the impact of medical interventions like drug treatment. Predicting how parasites will respond to public health efforts on both epidemiological and evolutionary timescales requires understanding transmission strategies. These strategies can rarely be observed directly and must typically be inferred from infection dynamics. Using malaria as a case study, we test previously described methods for inferring transmission stage investment against simulated data generated with a model of within-host infection dynamics, where the true transmission investment is known. We show that existing methods are inadequate and potentially very misleading. The key difficulty lies in separating transmission stages produced by different generations of parasites. We develop a new approach that performs much better on simulated data. Applying this approach to real data from mice infected with a single Plasmodium chabaudi strain, we estimate that transmission investment varies from zero to 20%, with evidence for variable investment over time in some hosts, but not others. These patterns suggest that, even in experimental infections where host genetics and other environmental factors are controlled, parasites may exhibit remarkably different patterns of transmission investment. PMID:26890485

Large-scale collision cross-section profiling on a travelling wave ion mobility mass spectrometer

PubMed Central

Lietz, Christopher B.; Yu, Qing; Li, Lingjun

2014-01-01

Ion mobility (IM) is a gas-phase electrophoretic method that separates ions according to charge and ion-neutral collision cross-section (CCS). Herein, we attempt to apply a travelling wave (TW) IM polyalanine calibration method to shotgun proteomics and create a large peptide CCS database. Mass spectrometry methods that utilize IM, such as HDMSE, often use high transmission voltages for sensitive analysis. However, polyalanine calibration has only been demonstrated with low voltage transmission used to prevent gas-phase activation. If polyalanine ions change conformation under higher transmission voltages used for HDMSE, the calibration may no longer be valid. Thus, we aimed to characterize the accuracy of calibration and CCS measurement under high transmission voltages on a TW IM instrument using the polyalanine calibration method and found that the additional error was not significant. We also evaluated the potential error introduced by liquid chromatography (LC)-HDMSE analysis, and found it to be insignificant as well, validating the calibration method. Finally, we demonstrated the utility of building a large-population peptide CCS database by investigating the effects of terminal lysine position, via LysC or LysN digestion, on the formation of two structural sub-families formed by triply charged ions. PMID:24845359

Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12

PubMed Central

Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted

2012-01-01

SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962

Mixture model to assess the extent of cross-transmission of multidrug-resistant pathogens in hospitals.

PubMed

Mikolajczyk, Rafael T; Kauermann, Göran; Sagel, Ulrich; Kretzschmar, Mirjam

2009-08-01

Creation of a mixture model based on Poisson processes for assessment of the extent of cross-transmission of multidrug-resistant pathogens in the hospital. We propose a 2-component mixture of Poisson processes to describe the time series of detected cases of colonization. The first component describes the admission process of patients with colonization, and the second describes the cross-transmission. The data set used to illustrate the method consists of the routinely collected records for methicillin-resistant Staphylococcus aureus (MRSA), imipenem-resistant Pseudomonas aeruginosa, and multidrug-resistant Acinetobacter baumannii over a period of 3 years in a German tertiary care hospital. For MRSA and multidrug-resistant A. baumannii, cross-transmission was estimated to be responsible for more than 80% of cases; for imipenem-resistant P. aeruginosa, cross-transmission was estimated to be responsible for 59% of cases. For new cases observed within a window of less than 28 days for MRSA and multidrug-resistant A. baumannii or 40 days for imipenem-resistant P. aeruginosa, there was a 50% or greater probability that the cause was cross-transmission. The proposed method offers a solution to assessing of the extent of cross-transmission, which can be of clinical use. The method can be applied using freely available software (the package FlexMix in R) and it requires relatively little data.

A Simplified Theory of ELF Propagation in the Earth-Ionosphere Transmission Line and Its Worldwide Application.

DTIC Science & Technology

1980-03-31

1.56 1.26 153 ~.Comparison with the method of Papper and Moler (1974) The method of calculation described in Chapter 3 and applied in this chapter was...digitization of the profiles. Using their method, Papper and Moler (private communication) have kindly performed calculations corresponding to those presented

Dosage Transmission Disequilibrium Test (dTDT) for Linkage and Association Detection

PubMed Central

Zhang, Zhehao; Wang, Jen-Chyong; Howells, William; Lin, Peng; Agrawal, Arpana; Edenberg, Howard J.; Tischfield, Jay A.; Schuckit, Marc A.; Bierut, Laura J.; Goate, Alison; Rice, John P.

2013-01-01

Both linkage and association studies have been successfully applied to identify disease susceptibility genes with genetic markers such as microsatellites and Single Nucleotide Polymorphisms (SNPs). As one of the traditional family-based studies, the Transmission/Disequilibrium Test (TDT) measures the over-transmission of an allele in a trio from its heterozygous parents to the affected offspring and can be potentially useful to identify genetic determinants for complex disorders. However, there is reduced information when complete trio information is unavailable. In this study, we developed a novel approach to “infer” the transmission of SNPs by combining both the linkage and association data, which uses microsatellite markers from families informative for linkage together with SNP markers from the offspring who are genotyped for both linkage and a Genome-Wide Association Study (GWAS). We generalized the traditional TDT to process these inferred dosage probabilities, which we name as the dosage-TDT (dTDT). For evaluation purpose, we developed a simulation procedure to assess its operating characteristics. We applied the dTDT to the simulated data and documented the power of the dTDT under a number of different realistic scenarios. Finally, we applied our methods to a family study of alcohol dependence (COGA) and performed individual genotyping on complete families for the top signals. One SNP (rs4903712 on chromosome 14) remained significant after correcting for multiple testing Methods developed in this study can be adapted to other platforms and will have widespread applicability in genomic research when case-control GWAS data are collected in families with existing linkage data. PMID:23691058

Elastohydrodynamic principles applied to the design of helicopter components.

NASA Technical Reports Server (NTRS)

Townsend, D. P.

1973-01-01

Elastohydrodynamic principles affecting the lubrication of transmission components are presented and discussed. Surface temperatures of the transmission bearings and gears affect elastohydrodynamic film thickness. Traction forces and sliding as well as the inlet temperature determine surface temperatures. High contact ratio gears cause increased sliding and may run at higher surface temperatures. Component life is a function of the ratio of elastohydrodynamic film thickness to composite surface roughness. Lubricant starvation reduces elastohydrodynamic film thickness and increases surface temperatures. Methods are presented which allow for the application of elastohydrodynamic principles to transmission design in order to increase system life and reliability.

Elastohydrodynamic principles applied to the design of helicopter components

NASA Technical Reports Server (NTRS)

Townsend, D. P.

1973-01-01

Elastohydrodynamic principles affecting the lubrication of transmission components are presented and discussed. Surface temperature of the transmission bearings and gears affect elastohydrodynamic film thickness. Traction forces and sliding as well as the inlet temperature determine surface temperatures. High contact ratio gears cause increased sliding and may run at higher surface temperatures. Component life is a function of the ratio of elastohydrodynamic film thickness to composite surface roughness. Lubricant starvation reduces elastrohydrodynamic film thickness and increases surface temperatures. Methods are presented which allow for the application of elastohydrodynamic principles to transmission design in order to increase system life and reliability.

The transmission or scattering of elastic waves by an inhomogeneity of simple geometry: A comparison of theories

NASA Technical Reports Server (NTRS)

Sheu, Y. C.; Fu, L. S.

1983-01-01

The extended method of equivalent inclusions is applied to study the specific wave problems: (1) the transmission of elastic waves in an infinite medium containing a layer of inhomogeneity, and (2) the scattering of elastic waves in an infinite medium containing a perfect spherical inhomogeneity. Eigenstrains are expanded as a geometric series and a method of integration based on the inhomogeneous Helmholtz operator is adopted. This study compares results, obtained by using limited number of terms in the eigenstrain expansion, with exact solutions for the layer problem and that for a perfect sphere.

Transient heating of expressed breast milk up to 65°C inactivates HIV-1 in milk: a simple, rapid, and cost-effective method to prevent postnatal transmission.

PubMed

Hoque, Sheikh Ariful; Hoshino, Hiroo; Anwar, Kazi Selim; Tanaka, Atsushi; Shinagawa, Masahiko; Hayakawa, Yuko; Okitsu, Shoko; Wada, Yuichi; Ushijima, Hiroshi

2013-02-01

The postnatal transmission of human immunodeficiency virus (HIV) from mothers to children occurs through breastfeeding. Although heat treatment of expressed breast milk is a promising approach to make breastfeeding safer, it is still not popular, mainly because the recommended procedures are difficult to follow, or time-consuming, or because mothers do not know which temperature is sufficient to inactivate HIV without destroying the nutritional elements of milk. To overcome these drawbacks, a simple and rapid method of heat treatment that a mother could perform with regular household materials applying her day-to-day art of cooking was examined. This structured experiment has demonstrated that both cell-free and cell-associated HIV type 1 (HIV-1) in expressed breast milk could be inactivated once the temperature of milk reached 65°C. Furthermore, a heating method as simple as heating the milk in a pan over a stove to 65°C inhibited HIV-1 transmission retaining milk's nutritional key elements, for example, total protein, IgG, IgA, and vitamin B(12) . This study has highlighted a simple, handy, and cost-effective method of heat treatment of expressed breast milk that mothers infected with HIV could apply easily and with more confidence. Copyright © 2012 Wiley Periodicals, Inc.

Multivariate classification of the infrared spectra of cell and tissue samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haaland, D.M.; Jones, H.D.; Thomas, E.V.

1997-03-01

Infrared microspectroscopy of biopsied canine lymph cells and tissue was performed to investigate the possibility of using IR spectra coupled with multivariate classification methods to classify the samples as normal, hyperplastic, or neoplastic (malignant). IR spectra were obtained in transmission mode through BaF{sub 2} windows and in reflection mode from samples prepared on gold-coated microscope slides. Cytology and histopathology samples were prepared by a variety of methods to identify the optimal methods of sample preparation. Cytospinning procedures that yielded a monolayer of cells on the BaF{sub 2} windows produced a limited set of IR transmission spectra. These transmission spectra weremore » converted to absorbance and formed the basis for a classification rule that yielded 100{percent} correct classification in a cross-validated context. Classifications of normal, hyperplastic, and neoplastic cell sample spectra were achieved by using both partial least-squares (PLS) and principal component regression (PCR) classification methods. Linear discriminant analysis applied to principal components obtained from the spectral data yielded a small number of misclassifications. PLS weight loading vectors yield valuable qualitative insight into the molecular changes that are responsible for the success of the infrared classification. These successful classification results show promise for assisting pathologists in the diagnosis of cell types and offer future potential for {ital in vivo} IR detection of some types of cancer. {copyright} {ital 1997} {ital Society for Applied Spectroscopy}« less

Numerical study of influence of different dispersed components of crystal cloud on transmission of radiant energy

NASA Astrophysics Data System (ADS)

Shefer, Olga

2017-11-01

The calculated results of the transmission of visible and infrared radiation by an atmosphere layer involving ensembles of large preferentially oriented crystals and spherical particles are presented. To calculate extinction characteristics, the physical optics method and the Mie theory are applied. Among all atmospheric particles, both the small particles that are commensurable with the wavelength of the incident radiation and the large plates and the columns are distinguished by the most pronounced dependence of the transmission on spectra of radiant energy. The work illustrates features of influence of parameters of the particle size distribution, particle aspect ratios, orientation and particle refractive index, also polarization state of the incident radiation on the transmission. The predominant effect of the plates on the wavelength dependence of the transmission is shown. A separated and cooperative contributes of the large plates and the small volume shape particles to the common transmission by medium are considered.

Analysis of microstrip dipoles and slots transversely coupled to a microstrip line using the FDTD method

NASA Technical Reports Server (NTRS)

Tulintseff, A. N.

1993-01-01

Printed dipole elements and their complement, linear slots, are elementary radiators that have found use in low-profile antenna arrays. Low-profile antenna arrays, in addition to their small size and low weight characteristics, offer the potential advantage of low-cost, high-volume production with easy integration with active integrated circuit components. The design of such arrays requires that the radiation and impedance characteristics of the radiating elements be known. The FDTD (Finite-Difference Time-Domain) method is a general, straight-forward implementation of Maxwell's equations and offers a relatively simple way of analyzing both printed dipole and slot elements. Investigated in this work is the application of the FDTD method to the analysis of printed dipole and slot elements transversely coupled to an infinite transmission line in a multilayered configuration. Such dipole and slot elements may be used in dipole and slot series-fed-type linear arrays, where element offsets and interelement line lengths are used to obtain the desired amplitude distribution and beam direction, respectively. The design of such arrays is achieved using transmission line theory with equivalent circuit models for the radiating elements. In an equivalent circuit model, the dipole represents a shunt impedance to the transmission line, where the impedance is a function of dipole offset, length, and width. Similarly, the slot represents a series impedance to the transmission line. The FDTD method is applied to single dipole and slot elements transversely coupled to an infinite microstrip line using a fixed rectangular grid with Mur's second order absorbing boundary conditions. Frequency-dependent circuit and scattering parameters are obtained by saving desired time-domain quantities and using the Fourier transform. A Gaussian pulse excitation is applied to the microstrip transmission line, where the resulting reflected signal due to the presence of the radiating element is used to determine the equivalent element impedance.

Eight-channel transmit/receive body MRI coil at 3T.

PubMed

Vernickel, P; Röschmann, P; Findeklee, C; Lüdeke, K-M; Leussler, Ch; Overweg, J; Katscher, U; Grässlin, I; Schünemann, K

2007-08-01

Multichannel transmit magnetic resonance imaging (MR) systems have the potential to compensate for signal-intensity variations occurring at higher field strengths due to wave propagation effects in tissue. Methods such as RF shimming and local excitation in combination with parallel transmission can be applied to compensate for these effects. Moreover, parallel transmission can be applied to ease the excitation of arbitrarily shaped magnetization patterns. The implementation of these methods adds new requirements in terms of MRI hardware. This article describes the design of a decoupled eight-element transmit/receive body coil for 3T. The setup of the coil is explained, starting with standard single-channel resonators. Special focus is placed on the decoupling of the elements to obtain independent RF resonators. After a brief discussion of the underlying theory, the properties and limitations of the coil are outlined. Finally, the functionality and capabilities of the coil are demonstrated using RF measurements as well as MRI sequences.

First principle study of transport properties of a graphene nano structure

NASA Astrophysics Data System (ADS)

Kumar, Naveen; Sharma, Munish; Sharma, Jyoti Dhar; Ahluwalia, P. K.

2013-06-01

The first principle quantum transport calculations have been performed for graphene using Tran SIESTA which calculates transport properties using nonequilibrium Green's function method in conjunction with density-functional theory. Transmission functions, electron density of states and current-voltage characteristic have been calculated for a graphene nano structure using graphene electrodes. Transmission function, density of states and projected density of states show a discrete band structure which varies with applied voltage. The value of current is very low for applied voltage between 0.0 V to 5.0 V and lies in the range of pico ampere. In the V-I characteristic current shows non-linear fluctuating pattern with increase in voltage.

USSR Report, Electronics and Electrical Engineering, No. 102

DTIC Science & Technology

1983-04-29

S. IAbstract] The laser probing method is applied to measurement of absorption , transmission, and reflection coefficients, also insertion losses...electronic clock. The method of measurements is based on absorption of monochromatic radiation from the lasers, the latter being tuned to the fine...Acoustic-Wave Transducer by Laser Probing Method (A. B. Voroshnin, G. S. Felinskiy; IZVESTIYA VYSSHIKH UCHEBNYKH ZAVEDENIY: RADIOELEKTRONIKA, Dec 82

Size-dependent magnetic anisotropy of PEG coated Fe3O4 nanoparticles; comparing two magnetization methods

NASA Astrophysics Data System (ADS)

Nayek, C.; Manna, K.; Imam, A. A.; Alqasrawi, A. Y.; Obaidat, I. M.

2018-02-01

Understanding the size dependent magnetic anisotropy of iron oxide nanoparticles is essential for the successful application of these nanoparticles in several technological and medical fields. PEG-coated iron oxide (Fe3O4) nanoparticles with core diameters of 12 nm, 15 nm, and 16 nm were synthesized by the usual co-precipitation method. The morphology and structure of the nanoparticles were investigated using transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM), selected area electron diffraction (SAED), and X-ray diffraction (XRD). Magnetic measurements were conducted using a SQUID. The effective magnetic anisotropy was calculated using two methods from the magnetization measurements. In the first method the zero-field-cooled magnetization versus temperature measurements were used at several applied magnetic fields. In the second method we used the temperature-dependent coercivity curves obtained from the zero-field-cooled magnetization versus magnetic field hysteresis loops. The role of the applied magnetic field on the effective magnetic anisotropy, calculated form the zero-field-cooled magnetization versus temperature measurements, was revealed. The size dependence of the effective magnetic anisotropy constant Keff obtained by the two methods are compared and discussed.

VALIDATION OF MICROSATELLITE MARKERS FOR USE IN GENOTYPING POLYCLONAL PLASMODIUM FALCIPARUM INFECTIONS

PubMed Central

GREENHOUSE, BRYAN; MYRICK, ALISSA; DOKOMAJILAR, CHRISTIAN; WOO, JONATHAN M.; CARLSON, ELAINE J.; ROSENTHAL, PHILIP J.; DORSEY, GRANT

2006-01-01

Genotyping methods for Plasmodium falciparum drug efficacy trials have not been standardized and may fail to accurately distinguish recrudescence from new infection, especially in high transmission areas where polyclonal infections are common. We developed a simple method for genotyping using previously identified microsatellites and capillary electrophoresis, validated this method using mixtures of laboratory clones, and applied the method to field samples. Two microsatellite markers produced accurate results for single-clone but not polyclonal samples. Four other microsatellite markers were as sensitive as, and more specific than, commonly used genotyping techniques based on merozoite surface proteins 1 and 2. When applied to samples from 15 patients in Burkina Faso with recurrent parasitemia after treatment with sulphadoxine-pyrimethamine, the addition of these four microsatellite markers to msp1 and msp2 genotyping resulted in a reclassification of outcomes that strengthened the association between dhfr 59R, an anti-folate resistance mutation, and recrudescence (P = 0.31 versus P = 0.03). Four microsatellite markers performed well on polyclonal samples and may provide a valuable addition to genotyping for clinical drug efficacy studies in high transmission areas. PMID:17123974

Control system for a hybrid powertrain system

DOEpatents

Naqvi, Ali K.; Demirovic, Besim; Gupta, Pinaki; Kaminsky, Lawrence A.

2014-09-09

A vehicle includes a powertrain with an engine, first and second torque machines, and a hybrid transmission. A method for operating the vehicle includes operating the engine in an unfueled state, releasing an off-going clutch which when engaged effects operation of the hybrid transmission in a first continuously variable mode, and applying a friction braking torque to a wheel of the vehicle to compensate for an increase in an output torque of the hybrid transmission resulting from releasing the off-going clutch. Subsequent to releasing the off-going clutch, an oncoming clutch which when engaged effects operation of the hybrid transmission in a second continuously variable mode is synchronized. Subsequent to synchronization of the oncoming clutch, the oncoming clutch is engaged.

Bayesian reconstruction of transmission within outbreaks using genomic variants.

PubMed

De Maio, Nicola; Worby, Colin J; Wilson, Daniel J; Stoesser, Nicole

2018-04-01

Pathogen genome sequencing can reveal details of transmission histories and is a powerful tool in the fight against infectious disease. In particular, within-host pathogen genomic variants identified through heterozygous nucleotide base calls are a potential source of information to identify linked cases and infer direction and time of transmission. However, using such data effectively to model disease transmission presents a number of challenges, including differentiating genuine variants from those observed due to sequencing error, as well as the specification of a realistic model for within-host pathogen population dynamics. Here we propose a new Bayesian approach to transmission inference, BadTrIP (BAyesian epiDemiological TRansmission Inference from Polymorphisms), that explicitly models evolution of pathogen populations in an outbreak, transmission (including transmission bottlenecks), and sequencing error. BadTrIP enables the inference of host-to-host transmission from pathogen sequencing data and epidemiological data. By assuming that genomic variants are unlinked, our method does not require the computationally intensive and unreliable reconstruction of individual haplotypes. Using simulations we show that BadTrIP is robust in most scenarios and can accurately infer transmission events by efficiently combining information from genetic and epidemiological sources; thanks to its realistic model of pathogen evolution and the inclusion of epidemiological data, BadTrIP is also more accurate than existing approaches. BadTrIP is distributed as an open source package (https://bitbucket.org/nicofmay/badtrip) for the phylogenetic software BEAST2. We apply our method to reconstruct transmission history at the early stages of the 2014 Ebola outbreak, showcasing the power of within-host genomic variants to reconstruct transmission events.

Proposed design procedure for transmission shafting under fatigue loading

NASA Technical Reports Server (NTRS)

Loewenthal, S. H.

1978-01-01

A new standard for the design of transmission shafting is reported. Computed was the diameter of rotating solid steel shafts under combined cyclic bending and steady torsion is presented. The formula is based on an elliptical variation of endurance strength with torque exhibited by combined stress fatigue data. Fatigue factors are cited to correct specimen bending endurance strength data for use in the shaft formula. A design example illustrates how the method is to be applied.

Two-Stage Design Method for Enhanced Inductive Energy Transmission with Q-Constrained Planar Square Loops.

PubMed

Eteng, Akaa Agbaeze; Abdul Rahim, Sharul Kamal; Leow, Chee Yen; Chew, Beng Wah; Vandenbosch, Guy A E

2016-01-01

Q-factor constraints are usually imposed on conductor loops employed as proximity range High Frequency Radio Frequency Identification (HF-RFID) reader antennas to ensure adequate data bandwidth. However, pairing such low Q-factor loops in inductive energy transmission links restricts the link transmission performance. The contribution of this paper is to assess the improvement that is reached with a two-stage design method, concerning the transmission performance of a planar square loop relative to an initial design, without compromise to a Q-factor constraint. The first stage of the synthesis flow is analytical in approach, and determines the number and spacing of turns by which coupling between similar paired square loops can be enhanced with low deviation from the Q-factor limit presented by an initial design. The second stage applies full-wave electromagnetic simulations to determine more appropriate turn spacing and widths to match the Q-factor constraint, and achieve improved coupling relative to the initial design. Evaluating the design method in a test scenario yielded a more than 5% increase in link transmission efficiency, as well as an improvement in the link fractional bandwidth by more than 3%, without violating the loop Q-factor limit. These transmission performance enhancements are indicative of a potential for modifying proximity HF-RFID reader antennas for efficient inductive energy transfer and data telemetry links.

Efficient Sparse Signal Transmission over a Lossy Link Using Compressive Sensing

PubMed Central

Wu, Liantao; Yu, Kai; Cao, Dongyu; Hu, Yuhen; Wang, Zhi

2015-01-01

Reliable data transmission over lossy communication link is expensive due to overheads for error protection. For signals that have inherent sparse structures, compressive sensing (CS) is applied to facilitate efficient sparse signal transmissions over lossy communication links without data compression or error protection. The natural packet loss in the lossy link is modeled as a random sampling process of the transmitted data, and the original signal will be reconstructed from the lossy transmission results using the CS-based reconstruction method at the receiving end. The impacts of packet lengths on transmission efficiency under different channel conditions have been discussed, and interleaving is incorporated to mitigate the impact of burst data loss. Extensive simulations and experiments have been conducted and compared to the traditional automatic repeat request (ARQ) interpolation technique, and very favorable results have been observed in terms of both accuracy of the reconstructed signals and the transmission energy consumption. Furthermore, the packet length effect provides useful insights for using compressed sensing for efficient sparse signal transmission via lossy links. PMID:26287195

A novel method for transmitting southern rice black-streaked dwarf virus to rice without insect vector.

PubMed

Yu, Lu; Shi, Jing; Cao, Lianlian; Zhang, Guoping; Wang, Wenli; Hu, Deyu; Song, Baoan

2017-08-15

Southern rice black-streaked dwarf virus (SRBSDV) has spread from the south of China to the north of Vietnam in the past few years, and has severely influenced rice production. However, previous study of traditional SRBSDV transmission method by the natural virus vector, the white-backed planthopper (WBPH, Sogatella furcifera), in the laboratory, researchers are frequently confronted with lack of enough viral samples due to the limited life span of infected vectors and rice plants and low virus acquisition and inoculation efficiency by the vector. Meanwhile, traditional mechanical inoculation of virus only apply to dicotyledon because of the higher content of lignin in the leaves of the monocot. Therefore, establishing an efficient and persistent-transmitting model, with a shorter virus transmission time and a higher virus transmission efficiency, for screening novel anti-SRBSDV drugs is an urgent need. In this study, we firstly reported a novel method for transmitting SRBSDV in rice using the bud-cutting method. The transmission efficiency of SRBSDV in rice was investigated via the polymerase chain reaction (PCR) method and the replication of SRBSDV in rice was also investigated via the proteomics analysis. Rice infected with SRBSDV using the bud-cutting method exhibited similar symptoms to those infected by the WBPH, and the transmission efficiency (>80.00%), which was determined using the PCR method, and the virus transmission time (30 min) were superior to those achieved that transmitted by the WBPH. Proteomics analysis confirmed that SRBSDV P1, P2, P3, P4, P5-1, P5-2, P6, P8, P9-1, P9-2, and P10 proteins were present in infected rice seedlings infected via the bud-cutting method. The results showed that SRBSDV could be successfully transmitted via the bud-cutting method and plants infected SRBSDV exhibited the symptoms were similar to those transmitted by the WBPH. Therefore, the use of the bud-cutting method to generate a cheap, efficient, reliable supply of SRBSDV-infected rice seedlings should aid the development of disease control strategies. Meanwhile, this method also could provide a new idea for the other virus transmission in monocot.

Characterization of a high-transmissivity zone by well test analysis: Steady state case

USGS Publications Warehouse

Tiedeman, Claire; Hsieh, Paul A.; Christian, Sarah B.

1995-01-01

A method is developed to analyze steady horizontal flow to a well pumped from a confined aquifer composed of two homogeneous zones with contrasting transmissivities. Zone 1 is laterally unbounded and encloses zone 2, which is elliptical in shape and is several orders of magnitude more transmissive than zone 1. The solution for head is obtained by the boundary integral equation method. Nonlinear least squares regression is used to estimate the model parameters, which include the transmissivity of zone 1, and the location, size, and orientation of zone 2. The method is applied to a hypothetical aquifer where zone 2 is a long and narrow zone of vertical fractures. Synthetic data are generated from three different well patterns, representing different areal coverage and proximity to the fracture zone. When zone 1 of the hypothetical aquifer is homogeneous, the method correctly estimates all model parameters. When zone 1 is a randomly heterogeneous transmissivity field, some parameter estimates, especially the length of zone 2, become highly uncertain. To reduce uncertainty, the pumped well should be close to the fracture zone, and surrounding observation wells should cover an area similar in dimension to the length of the fracture zone. Some prior knowledge of the fracture zone, such as that gained from a surface geophysical survey, would greatly aid in designing the well test.

The use of whole genome sequencing in the investigation of a nosocomial influenza virus outbreak.

PubMed

Houlihan, Catherine; Frampton, Dan; Ferns, R Bridget; Raffle, Jade; Grant, Paul; Reidy, Myriam; Hail, Leila; Thomson, Kirsty; Mattes, Frank; Kozlakidis, Zisis; Pillay, Deenan; Hayward, Andrew; Nastouli, Eleni

2018-06-05

Traditional epidemiological investigation of nosocomial transmission of influenza involves the identification of patients who have the same influenza virus type and who have overlapped in time and place. This method may miss-identify transmission where it has not occurred or miss transmission when it has. We applied influenza virus whole genome sequencing (WGS) to an outbreak of influenza A in a haematology/oncology ward and identified two separate introductions; one which resulted in 5 additional infections and 79 bed-days lost. Results from WGS are becoming rapidly available and may supplement traditional infection control procedures in the investigation and management of nosocomial outbreaks.

Bayesian estimation of the transmissivity spatial structure from pumping test data

NASA Astrophysics Data System (ADS)

Demir, Mehmet Taner; Copty, Nadim K.; Trinchero, Paolo; Sanchez-Vila, Xavier

2017-06-01

Estimating the statistical parameters (mean, variance, and integral scale) that define the spatial structure of the transmissivity or hydraulic conductivity fields is a fundamental step for the accurate prediction of subsurface flow and contaminant transport. In practice, the determination of the spatial structure is a challenge because of spatial heterogeneity and data scarcity. In this paper, we describe a novel approach that uses time drawdown data from multiple pumping tests to determine the transmissivity statistical spatial structure. The method builds on the pumping test interpretation procedure of Copty et al. (2011) (Continuous Derivation method, CD), which uses the time-drawdown data and its time derivative to estimate apparent transmissivity values as a function of radial distance from the pumping well. A Bayesian approach is then used to infer the statistical parameters of the transmissivity field by combining prior information about the parameters and the likelihood function expressed in terms of radially-dependent apparent transmissivities determined from pumping tests. A major advantage of the proposed Bayesian approach is that the likelihood function is readily determined from randomly generated multiple realizations of the transmissivity field, without the need to solve the groundwater flow equation. Applying the method to synthetically-generated pumping test data, we demonstrate that, through a relatively simple procedure, information on the spatial structure of the transmissivity may be inferred from pumping tests data. It is also shown that the prior parameter distribution has a significant influence on the estimation procedure, given the non-uniqueness of the estimation procedure. Results also indicate that the reliability of the estimated transmissivity statistical parameters increases with the number of available pumping tests.

Bandwidth efficient channel estimation method for airborne hyperspectral data transmission in sparse doubly selective communication channels

NASA Astrophysics Data System (ADS)

Vahidi, Vahid; Saberinia, Ebrahim; Regentova, Emma E.

2017-10-01

A channel estimation (CE) method based on compressed sensing (CS) is proposed to estimate the sparse and doubly selective (DS) channel for hyperspectral image transmission from unmanned aircraft vehicles to ground stations. The proposed method contains three steps: (1) the priori estimate of the channel by orthogonal matching pursuit (OMP), (2) calculation of the linear minimum mean square error (LMMSE) estimate of the received pilots given the estimated channel, and (3) estimate of the complex amplitudes and Doppler shifts of the channel using the enhanced received pilot data applying a second round of a CS algorithm. The proposed method is named DS-LMMSE-OMP, and its performance is evaluated by simulating transmission of AVIRIS hyperspectral data via the communication channel and assessing their fidelity for the automated analysis after demodulation. The performance of the DS-LMMSE-OMP approach is compared with that of two other state-of-the-art CE methods. The simulation results exhibit up to 8-dB figure of merit in the bit error rate and 50% improvement in the hyperspectral image classification accuracy.

Visualization of Data Regarding Infections Using Eye Tracking Techniques

PubMed Central

Yoon, Sunmoo; Cohen, Bevin; Cato, Kenrick D.; Liu, Jianfang; Larson, Elaine L.

2016-01-01

Objective To evaluate ease of use and usefulness for nurses of visualizations of infectious disease transmission in a hospital. Design An observational study was used to evaluate perceptions of several visualizations of data extracted from electronic health records designed using a participatory approach. Twelve nurses in the master’s program in an urban research-intensive nursing school participated in May 2015. Methods A convergent parallel mixed method was used to evaluate nurses’ perceptions on ease of use and usefulness of five visualization conveying trends in hospital infection transmission applying think-aloud, interview, and eye-tracking techniques. Findings Subjective data from the interview and think-aloud techniques indicated that participants preferred the traditional line graphs in simple data representation due to their familiarity, clarity, and easiness to read. An objective quantitative measure of eye movement analysis (444,421 gaze events) identified a high degree of participants’ attention span in infographics in all three scenarios. All participants responded with the correct answer within 1 min in comprehensive tests. Conclusions A user-centric approach was effective in developing and evaluating visualizations for hospital infection transmission. For the visualizations designed by the users, the participants were easily able to comprehend the infection visualizations on both line graphs and infographics for simple visualization. The findings from the objective comprehension test and eye movement and subjective attitudes support the feasibility of integrating user-centric visualization designs into electronic health records, which may inspire clinicians to be mindful of hospital infection transmission. Future studies are needed to investigate visualizations and motivation, and the effectiveness of visualization on infection rate. Clinical Relevance This study designed visualization images using clinical data from electronic health records applying a user-centric approach. The design insights can be applied for visualizing patient data in electronic health records. PMID:27061619

Key Technologies and Applications of Gas Drainage in Underground Coal Mine

NASA Astrophysics Data System (ADS)

Zhou, Bo; Xue, Sheng; Cheng, Jiansheng; Li, Wenquan; Xiao, Jiaping

2018-02-01

It is the basis for the long-drilling directional drilling, precise control of the drilling trajectory and ensuring the effective extension of the drilling trajectory in the target layer. The technology can be used to complete the multi-branch hole construction and increase the effective extraction distance of the coal seam. The gas drainage and the bottom grouting reinforcement in the advanced area are realized, and the geological structure of the coal seam can be proved accurately. It is the main technical scheme for the efficient drainage of gas at home and abroad, and it is applied to the field of geological structure exploration and water exploration and other areas. At present, the data transmission method is relatively mature in the technology and application, including the mud pulse and the electromagnetic wave. Compared with the mud pulse transmission mode, the electromagnetic wave transmission mode has obvious potential in the data transmission rate and drilling fluid, and it is suitable for the coal mine. In this paper, the key technologies of the electromagnetic wave transmission mode are analyzed, including the attenuation characteristics of the electromagnetic transmission channel, the digital modulation scheme, the channel coding method and the weak signal processing technology. A coal mine under the electromagnetic wave drilling prototype is developed, and the ground transmission experiments and down hole transmission test are carried out. The main work includes the following aspects. First, the equivalent transmission line method is used to establish the electromagnetic transmission channel model of coal mine drilling while drilling, and the attenuation of the electromagnetic signal is measured when the electromagnetic channel measured. Second, the coal mine EM-MWD digital modulation method is developed. Third, the optimal linear block code which suitable for EM-MWD communication channel in coal mine is proposed. Fourth, the noise characteristics of well near horizontal directional drilling are analyzed, and the multi-stage filter method is proposed to suppress the natural potential and strong frequency interference signal. And the weak electromagnetic communication signal is extracted from the received signal. Finally, the detailed design of the electromagnetic wave while drilling is given.

Whole-genome sequencing to determine Neisseria gonorrhoeae transmission: an observational study

PubMed Central

Cole, Kevin; Cole, Michelle J; Cresswell, Fiona; Dean, Gillian; Dave, Jayshree; Thomas, Daniel Rh; Foster, Kirsty; Waldram, Alison; Wilson, Daniel J; Didelot, Xavier; Grad, Yonatan H; Crook, Derrick W; Peto, Tim EA; Walker, A Sarah

2016-01-01

Background New approaches are urgently required to address increasing rates of gonorrhoea and the emergence and global spread of antibiotic-resistant Neisseria gonorrhoeae. Whole genome sequencing (WGS) can be applied to study transmission and track resistance. Methods We performed WGS on 1659 isolates from Brighton, UK, and 217 additional isolates from other UK locations. We included WGS data (n=196) from the USA. Estimated mutation rates, plus diversity observed within patients across anatomical sites and probable transmission pairs, were used to fit a coalescent model to determine the number of single nucleotide polymorphisms (SNPs) expected between sequences related by direct/indirect transmission, depending on the time between samples. Findings We detected extensive local transmission. 281/1061(26%) Brighton cases were indistinguishable (0 SNPs) to ≥1 previous case(s), and 786(74%) had evidence of a sampled direct or indirect Brighton source. There was evidence of sustained transmission of some lineages. We observed multiple related samples across geographic locations. Of 1273 infections in Brighton, 225(18%) were linked to another case from elsewhere in the UK, and 115(9%) to a case from the USA. Four lineages initially identified in Brighton could be linked to 70 USA sequences, including 61 from a lineage carrying the mosaic penA XXXIV associated with reduced cefixime susceptibility. Interpretation We present a WGS-based tool for genomic contact tracing of N. gonorrhoeae and demonstrate local, national and international transmission. WGS can be applied across geographical boundaries to investigate gonorrhoea transmission and to track antimicrobial resistance. Funding Oxford NIHR Health Protection Research Unit and Biomedical Research Centre. PMID:27427203

Thin Film Research. Volume 2

DTIC Science & Technology

1985-05-30

consisting of quarterwave layers by detecting the -- extrema of transmission or reflectance at a particular wavelength. This method is extremely stable for the...technique, which is based on an envelope method , and gives some experimental *results. L"( iL -2- I. Introduction The refractive index and the...constants determination :ecnnique by computer simulation, we have applied the method to various layers of titanium dioxide. This technique can then

Electron transport in electrically biased inverse parabolic double-barrier structure

NASA Astrophysics Data System (ADS)

M, Bati; S, Sakiroglu; I, Sokmen

2016-05-01

A theoretical study of resonant tunneling is carried out for an inverse parabolic double-barrier structure subjected to an external electric field. Tunneling transmission coefficient and density of states are analyzed by using the non-equilibrium Green’s function approach based on the finite difference method. It is found that the resonant peak of the transmission coefficient, being unity for a symmetrical case, reduces under the applied electric field and depends strongly on the variation of the structure parameters.

A study on measuring occlusal contact area using silicone impression materials: an application of this method to the bite force measurement system using the pressure-sensitive sheet.

PubMed

Ando, Katsuya; Kurosawa, Masahiro; Fuwa, Yuji; Kondo, Takamasa; Goto, Shigemi

2007-11-01

The aim of this study was to establish an objective and quantitative method of measuring occlusal contact areas. To this end, bite records were taken with a silicone impression material and a light transmission device was used to read the silicone impression material. To examine the effectiveness of this novel method, the occlusal contact area of the silicone impression material and its thickness limit of readable range were measured. Results of this study suggested that easy and highly accurate measurements of occlusal contact area could be obtained by selecting an optimal applied voltage of the light transmission device and an appropriate color of the silicone impression material.

Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deymier, Martin J., E-mail: mdeymie@emory.edu; Claiborne, Daniel T., E-mail: dclaibo@emory.edu; Ende, Zachary, E-mail: zende@emory.edu

The high genetic diversity of HIV-1 impedes high throughput, large-scale sequencing and full-length genome cloning by common restriction enzyme based methods. Applying novel methods that employ a high-fidelity polymerase for amplification and an unbiased fusion-based cloning strategy, we have generated several HIV-1 full-length genome infectious molecular clones from an epidemiologically linked transmission pair. These clones represent the transmitted/founder virus and phylogenetically diverse non-transmitted variants from the chronically infected individual's diverse quasispecies near the time of transmission. We demonstrate that, using this approach, PCR-induced mutations in full-length clones derived from their cognate single genome amplicons are rare. Furthermore, all eight non-transmittedmore » genomes tested produced functional virus with a range of infectivities, belying the previous assumption that a majority of circulating viruses in chronic HIV-1 infection are defective. Thus, these methods provide important tools to update protocols in molecular biology that can be universally applied to the study of human viral pathogens. - Highlights: • Our novel methodology demonstrates accurate amplification and cloning of full-length HIV-1 genomes. • A majority of plasma derived HIV variants from a chronically infected individual are infectious. • The transmitted/founder was more infectious than the majority of the variants from the chronically infected donor.« less

Design of UAV high resolution image transmission system

NASA Astrophysics Data System (ADS)

Gao, Qiang; Ji, Ming; Pang, Lan; Jiang, Wen-tao; Fan, Pengcheng; Zhang, Xingcheng

2017-02-01

In order to solve the problem of the bandwidth limitation of the image transmission system on UAV, a scheme with image compression technology for mini UAV is proposed, based on the requirements of High-definition image transmission system of UAV. The video codec standard H.264 coding module and key technology was analyzed and studied for UAV area video communication. Based on the research of high-resolution image encoding and decoding technique and wireless transmit method, The high-resolution image transmission system was designed on architecture of Android and video codec chip; the constructed system was confirmed by experimentation in laboratory, the bit-rate could be controlled easily, QoS is stable, the low latency could meets most applied requirement not only for military use but also for industrial applications.

The global transmission network of HIV-1.

PubMed

Wertheim, Joel O; Leigh Brown, Andrew J; Hepler, N Lance; Mehta, Sanjay R; Richman, Douglas D; Smith, Davey M; Kosakovsky Pond, Sergei L

2014-01-15

Human immunodeficiency virus type 1 (HIV-1) is pandemic, but its contemporary global transmission network has not been characterized. A better understanding of the properties and dynamics of this network is essential for surveillance, prevention, and eventual eradication of HIV. Here, we apply a simple and computationally efficient network-based approach to all publicly available HIV polymerase sequences in the global database, revealing a contemporary picture of the spread of HIV-1 within and between countries. This approach automatically recovered well-characterized transmission clusters and extended other clusters thought to be contained within a single country across international borders. In addition, previously undescribed transmission clusters were discovered. Together, these clusters represent all known modes of HIV transmission. The extent of international linkage revealed by our comprehensive approach demonstrates the need to consider the global diversity of HIV, even when describing local epidemics. Finally, the speed of this method allows for near-real-time surveillance of the pandemic's progression.

Estimation of the transmissivity of thin leaky-confined aquifers from single-well pumping tests

NASA Astrophysics Data System (ADS)

Worthington, Paul F.

1981-01-01

Data from the quasi-equilibrium phases of a step-drawdown test are used to evaluate the coefficient of non-linear head losses subject to the assumption of a constant effective well radius. After applying a well-loss correction to the observed drawdowns of the first step, an approximation method is used to estimate a pseudo-transmissivity of the aquifer from a single value of time-variant drawdown. The pseudo-transmissivities computed for each of a sequence of values of time pass through a minimum when there is least manifestation of casing-storage and leakage effects, phenomena to which pumping-test data of this kind are particularly susceptible. This minimum pseudo-transmissivity, adjusted for partial penetration effects where appropriate, constitutes the best possible estimate of aquifer transmissivity. The ease of application of the overall procedure is illustrated by a practical example.

Data-Driven Risk Assessment from Small Scale Epidemics: Estimation and Model Choice for Spatio-Temporal Data with Application to a Classical Swine Fever Outbreak

PubMed Central

Gamado, Kokouvi; Marion, Glenn; Porphyre, Thibaud

2017-01-01

Livestock epidemics have the potential to give rise to significant economic, welfare, and social costs. Incursions of emerging and re-emerging pathogens may lead to small and repeated outbreaks. Analysis of the resulting data is statistically challenging but can inform disease preparedness reducing potential future losses. We present a framework for spatial risk assessment of disease incursions based on data from small localized historic outbreaks. We focus on between-farm spread of livestock pathogens and illustrate our methods by application to data on the small outbreak of Classical Swine Fever (CSF) that occurred in 2000 in East Anglia, UK. We apply models based on continuous time semi-Markov processes, using data-augmentation Markov Chain Monte Carlo techniques within a Bayesian framework to infer disease dynamics and detection from incompletely observed outbreaks. The spatial transmission kernel describing pathogen spread between farms, and the distribution of times between infection and detection, is estimated alongside unobserved exposure times. Our results demonstrate inference is reliable even for relatively small outbreaks when the data-generating model is known. However, associated risk assessments depend strongly on the form of the fitted transmission kernel. Therefore, for real applications, methods are needed to select the most appropriate model in light of the data. We assess standard Deviance Information Criteria (DIC) model selection tools and recently introduced latent residual methods of model assessment, in selecting the functional form of the spatial transmission kernel. These methods are applied to the CSF data, and tested in simulated scenarios which represent field data, but assume the data generation mechanism is known. Analysis of simulated scenarios shows that latent residual methods enable reliable selection of the transmission kernel even for small outbreaks whereas the DIC is less reliable. Moreover, compared with DIC, model choice based on latent residual assessment correlated better with predicted risk. PMID:28293559

Automated grain mapping using wide angle convergent beam electron diffraction in transmission electron microscope for nanomaterials.

PubMed

Kumar, Vineet

2011-12-01

The grain size statistics, commonly derived from the grain map of a material sample, are important microstructure characteristics that greatly influence its properties. The grain map for nanomaterials is usually obtained manually by visual inspection of the transmission electron microscope (TEM) micrographs because automated methods do not perform satisfactorily. While the visual inspection method provides reliable results, it is a labor intensive process and is often prone to human errors. In this article, an automated grain mapping method is developed using TEM diffraction patterns. The presented method uses wide angle convergent beam diffraction in the TEM. The automated technique was applied on a platinum thin film sample to obtain the grain map and subsequently derive grain size statistics from it. The grain size statistics obtained with the automated method were found in good agreement with the visual inspection method.

Splice assembly tool and method of splicing

DOEpatents

Silva, Frank A.

1980-01-01

A splice assembly tool for assembling component parts of an electrical conductor while producing a splice connection between electrical cables therewith, comprises a first structural member adaptable for supporting force applying means thereon, said force applying means enabling a rotary force applied manually thereto to be converted to a longitudinal force for subsequent application against a first component part of said electrical connection, a second structural member adaptable for engaging a second component part in a manner to assist said first structural member in assembling the component parts relative to one another and transmission means for conveying said longitudinal force between said first and said second structural members, said first and said second structural members being coupled to one another by said transmission means, wherein at least one of said component parts comprises a tubular elastomeric sleeve and said force applying means provides a relatively high mechanical advantage when said rotary force is applied thereto so as to facilitate assembly of said at least one tubular elastomeric sleeve about said other component part in an interference fit manner.

Soil compaction: Evaluation of stress transmission and resulting soil structure

NASA Astrophysics Data System (ADS)

Naveed, Muhammad; Schjønning, Per; Keller, Thomas; Lamande, Mathieu

2016-04-01

Accurate estimation of stress transmission and resultant deformation in soil profiles is a prerequisite for the development of predictive models and decision support tools for preventing soil compaction. Numerous studies have been carried out on the effects of soil compaction, whilst relatively few studies have focused on the cause (mode of stress transmission in the soil). We have coupled both cause and effects together in the present study by carrying out partially confined compression tests on (1) wet aggregates, (2) air dry aggregates, and (3) intact soils to quantify stress transmission and compaction-resulted soil structure at the same time. Stress transmission was quantified using both X-ray CT and Tactilus sensor mat, and soil-pore structure was quantified using X-ray CT. Our results imply that stress transmission through soil highly depends on the magnitude of applied load and aggregate strength. As soon as the applied load is lower than the aggregate strength, the mode of stress transmission is discrete as stresses were mainly transmitted through chain of aggregates. With increasing applied load soil aggregates start deforming that transformed heterogeneous soil into homogenous, as a result stress transmission mode was shifted from discrete towards more like a continuum. Continuum-like stress transmission mode was better simulated with Boussinesq (1885) model based on theory of elasticity compared to discrete. The soil-pore structure was greatly affected by increasing applied stresses. Total porosity was reduced 5-16% and macroporosity 50-85% at 620 kPa applied stress for the intact soils. Similarly, significant changes in the morphological indices of the macropore space were also observed with increasing applied stresses.

Simulating trait evolution for cross-cultural comparison.

PubMed

Nunn, Charles L; Arnold, Christian; Matthews, Luke; Borgerhoff Mulder, Monique

2010-12-12

Cross-cultural anthropologists have increasingly used phylogenetic methods to study cultural variation. Because cultural behaviours can be transmitted horizontally among socially defined groups, however, it is important to assess whether phylogeny-based methods--which were developed to study vertically transmitted traits among biological taxa--are appropriate for studying group-level cultural variation. Here, we describe a spatially explicit simulation model that can be used to generate data with known degrees of horizontal donation. We review previous results from this model showing that horizontal transmission increases the type I error rate of phylogenetically independent contrasts in studies of correlated evolution. These conclusions apply to cases in which two traits are transmitted as a pair, but horizontal transmission may be less problematic when traits are unlinked. We also use the simulation model to investigate whether measures of homology (the consistency index and the retention index) can detect horizontal transmission of cultural traits. Higher rates of evolutionary change have a stronger depressive impact on measures of homology than higher rates of horizontal transmission; thus, low consistency or retention indices are not necessarily indicative of 'ethnogenesis'. Collectively, these studies demonstrate the importance of using simulations to assess the validity of methods in cross-cultural research.

High-Throughput Assay and Discovery of Small Molecules that Interrupt Malaria Transmission

PubMed Central

Plouffe, David M.; Wree, Melanie; Du, Alan Y.; Meister, Stephan; Li, Fengwu; Patra, Kailash; Lubar, Aristea; Okitsu, Shinji L.; Flannery, Erika L.; Kato, Nobutaka; Tanaseichuk, Olga; Comer, Eamon; Zhou, Bin; Kuhen, Kelli; Zhou, Yingyao; Leroy, Didier; Schreiber, Stuart L.; Scherer, Christina A.; Vinetz, Joseph; Winzeler, Elizabeth A.

2016-01-01

Summary Preventing transmission is an important element of malaria control. However, most of the current available methods to assay for malaria transmission blocking are relatively low throughput and cannot be applied to large chemical libraries. We have developed a high-throughput and cost-effective assay, the Saponin-lysis Sexual Stage Assay (SaLSSA), for identifying small molecules with transmission-blocking capacity. SaLSSA analysis of 13,983 unique compounds uncovered that >90% of well-characterized antimalarials, including endoperoxides and 4-aminoquinolines, as well as compounds active against asexual blood stages, lost most of their killing activity when parasites developed into metabolically quiescent stage V gametocytes. On the other hand, we identified compounds with consistent low nanomolar transmission-blocking activity, some of which showed cross-reactivity against asexual blood and liver stages. The data clearly emphasize substantial physiological differences between sexual and asexual parasites and provide a tool and starting points for the discovery and development of transmission-blocking drugs. PMID:26749441

Acoustic contributions of a sound absorbing blanket placed in a double panel structure: absorption versus transmission.

PubMed

Doutres, Olivier; Atalla, Noureddine

2010-08-01

The objective of this paper is to propose a simple tool to estimate the absorption vs. transmission loss contributions of a multilayered blanket unbounded in a double panel structure and thus guide its optimization. The normal incidence airborne sound transmission loss of the double panel structure, without structure-borne connections, is written in terms of three main contributions; (i) sound transmission loss of the panels, (ii) sound transmission loss of the blanket and (iii) sound absorption due to multiple reflections inside the cavity. The method is applied to four different blankets frequently used in automotive and aeronautic applications: a non-symmetric multilayer made of a screen in sandwich between two porous layers and three symmetric porous layers having different pore geometries. It is shown that the absorption behavior of the blanket controls the acoustic behavior of the treatment at low and medium frequencies and its transmission loss at high frequencies. Acoustic treatment having poor sound absorption behavior can affect the performance of the double panel structure.

Analysis of longitudinal multivariate outcome data from couples cohort studies: application to HPV transmission dynamics

PubMed Central

Kong, Xiangrong; Wang, Mei-Cheng; Gray, Ronald

2014-01-01

We consider a specific situation of correlated data where multiple outcomes are repeatedly measured on each member of a couple. Such multivariate longitudinal data from couples may exhibit multi-faceted correlations which can be further complicated if there are polygamous partnerships. An example is data from cohort studies on human papillomavirus (HPV) transmission dynamics in heterosexual couples. HPV is a common sexually transmitted disease with 14 known oncogenic types causing anogenital cancers. The binary outcomes on the multiple types measured in couples over time may introduce inter-type, intra-couple, and temporal correlations. Simple analysis using generalized estimating equations or random effects models lacks interpretability and cannot fully utilize the available information. We developed a hybrid modeling strategy using Markov transition models together with pairwise composite likelihood for analyzing such data. The method can be used to identify risk factors associated with HPV transmission and persistence, estimate difference in risks between male-to-female and female-to-male HPV transmission, compare type-specific transmission risks within couples, and characterize the inter-type and intra-couple associations. Applying the method to HPV couple data collected in a Ugandan male circumcision (MC) trial, we assessed the effect of MC and the role of gender on risks of HPV transmission and persistence. PMID:26195849

Donor-Recipient Identification in Para- and Poly-phyletic Trees Under Alternative HIV-1 Transmission Hypotheses Using Approximate Bayesian Computation

PubMed Central

Romero-Severson, Ethan O.; Bulla, Ingo; Hengartner, Nick; Bártolo, Inês; Abecasis, Ana; Azevedo-Pereira, José M.; Taveira, Nuno; Leitner, Thomas

2017-01-01

Diversity of the founding population of Human Immunodeficiency Virus Type 1 (HIV-1) transmissions raises many important biological, clinical, and epidemiological issues. In up to 40% of sexual infections, there is clear evidence for multiple founding variants, which can influence the efficacy of putative prevention methods, and the reconstruction of epidemiologic histories. To infer who-infected-whom, and to compute the probability of alternative transmission scenarios while explicitly taking phylogenetic uncertainty into account, we created an approximate Bayesian computation (ABC) method based on a set of statistics measuring phylogenetic topology, branch lengths, and genetic diversity. We applied our method to a suspected heterosexual transmission case involving three individuals, showing a complex monophyletic-paraphyletic-polyphyletic phylogenetic topology. We detected that seven phylogenetic lineages had been transmitted between two of the individuals based on the available samples, implying that many more unsampled lineages had also been transmitted. Testing whether the lineages had been transmitted at one time or over some length of time suggested that an ongoing superinfection process over several years was most likely. While one individual was found unlinked to the other two, surprisingly, when evaluating two competing epidemiological priors, the donor of the two that did infect each other was not identified by the host root-label, and was also not the primary suspect in that transmission. This highlights that it is important to take epidemiological information into account when analyzing support for one transmission hypothesis over another, as results may be nonintuitive and sensitive to details about sampling dates relative to possible infection dates. Our study provides a formal inference framework to include information on infection and sampling times, and to investigate ancestral node-label states, transmission direction, transmitted genetic diversity, and frequency of transmission. PMID:28912340

Applying AI systems in the T and D arena. [Artificial Intelligence, Transmission and Distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkata, S.S.; Liu, Chenching; Sumic, Z.

1993-04-01

The power engineering community has capitalized on various computer technologies since the early 1960s, with most successful application to solving well-defined problems that are capable of being modeled. Although computing methods have made notable progress in the power engineering arena, there is still a class of problems that is not easy to define or formulate to apply conventional computerized methods. In addition to being difficult to express in a closed mathematical form, these problems are often characterized by the absence of one or both of the following features: a predetermined decision path from the initial state to goal (ill-structured problem);more » a well-defined criteria for whether an obtained solution is acceptable (open-ended problem). Power engineers have been investigating the application of AI-based methodologies to power system problems. Most of the work in the past has been geared towards the development of expert systems as an operator's aid in energy control centers for bulk power transmission systems operating under abnormal conditions. Alarm processing, fault diagnosis, system restoration, and voltage/var control are a few key areas where significant research work has progressed to date. Results of this research have effected more than 100 prototype expert systems for power systems throughout the US, Japan, and Europe. The objectives of this article are to: expose engineers to the benefits of using AI methods for a host of transmission and distribution (T and D) problems that need immediate attention; identify problems that could be solved more effectively by applying AI approaches; summarize recent developments and successful AI applications in T and D.« less

Modelling of Rail Vehicles and Track for Calculation of Ground-Vibration Transmission Into Buildings

NASA Astrophysics Data System (ADS)

Hunt, H. E. M.

1996-05-01

A methodology for the calculation of vibration transmission from railways into buildings is presented. The method permits existing models of railway vehicles and track to be incorporated and it has application to any model of vibration transmission through the ground. Special attention is paid to the relative phasing between adjacent axle-force inputs to the rail, so that vibration transmission may be calculated as a random process. The vehicle-track model is used in conjunction with a building model of infinite length. The tracking and building are infinite and parallel to each other and forces applied are statistically stationary in space so that vibration levels at any two points along the building are the same. The methodology is two-dimensional for the purpose of application of random process theory, but fully three-dimensional for calculation of vibration transmission from the track and through the ground into the foundations of the building. The computational efficiency of the method will interest engineers faced with the task of reducing vibration levels in buildings. It is possible to assess the relative merits of using rail pads, under-sleeper pads, ballast mats, floating-slab track or base isolation for particular applications.

Controlling sound radiation through an opening with secondary loudspeakers along its boundaries.

PubMed

Wang, Shuping; Tao, Jiancheng; Qiu, Xiaojun

2017-10-17

We propose a virtual sound barrier system that blocks sound transmission through openings without affecting access, light and air circulation. The proposed system applies active control technique to cancel sound transmission with a double layered loudspeaker array at the edge of the opening. Unlike traditional transparent glass windows, recently invented double-glazed ventilation windows and planar active sound barriers or any other metamaterials designed to reduce sound transmission, secondary loudspeakers are put only along the boundaries of the opening, which provides the possibility to make it invisible. Simulation and experimental results demonstrate its feasibility for broadband sound control, especially for low frequency sound which is usually hard to attenuate with existing methods.

Chiral tunneling modulated by a time-periodic potential on the surface states of a topological insulator

PubMed Central

Li, Yuan; Jalil, Mansoor B. A.; Tan, S. G.; Zhao, W.; Bai, R.; Zhou, G. H.

2014-01-01

Time-periodic perturbation can be used to modify the transport properties of the surface states of topological insulators, specifically their chiral tunneling property. Using the scattering matrix method, we study the tunneling transmission of the surface states of a topological insulator under the influence of a time-dependent potential and finite gate bias voltage. It is found that perfect transmission is obtained for electrons which are injected normally into the time-periodic potential region in the absence of any bias voltage. However, this signature of Klein tunneling is destroyed when a bias voltage is applied, with the transmission probability of normally incident electrons decreasing with increasing gate bias voltage. Likewise, the overall conductance of the system decreases significantly when a gate bias voltage is applied. The characteristic left-handed helicity of the transmitted spin polarization is also broken by the finite gate bias voltage. In addition, the time-dependent potential modifies the large-angle transmission profile, which exhibits an oscillatory or resonance-like behavior. Finally, time-dependent transport modes (with oscillating potential in the THz frequency) can result in enhanced overall conductance, irrespective of the presence or absence of the gate bias voltage. PMID:24713634

Cavity enhancement by controlled directional scattering

NASA Astrophysics Data System (ADS)

Winston, R.

1980-01-01

A method for designing cavity enclosures is presented that can be applied to the design of a nonimaging concentrator. The method maintains high transmission at the expense of some concentration in the presence of a gap between the reflector and the receiver. The slight loss of concentration may be partly offset by enhanced absorption of radiation by the receiver, resulting from the cavity effect.

Prefixed-threshold real-time selection method in free-space quantum key distribution

NASA Astrophysics Data System (ADS)

Wang, Wenyuan; Xu, Feihu; Lo, Hoi-Kwong

2018-03-01

Free-space quantum key distribution allows two parties to share a random key with unconditional security, between ground stations, between mobile platforms, and even in satellite-ground quantum communications. Atmospheric turbulence causes fluctuations in transmittance, which further affect the quantum bit error rate and the secure key rate. Previous postselection methods to combat atmospheric turbulence require a threshold value determined after all quantum transmission. In contrast, here we propose a method where we predetermine the optimal threshold value even before quantum transmission. Therefore, the receiver can discard useless data immediately, thus greatly reducing data storage requirements and computing resources. Furthermore, our method can be applied to a variety of protocols, including, for example, not only single-photon BB84 but also asymptotic and finite-size decoy-state BB84, which can greatly increase its practicality.

Transmission loss of plates with embedded acoustic black holes.

PubMed

Feurtado, Philip A; Conlon, Stephen C

2017-09-01

In recent years acoustic black holes (ABHs) have been developed and demonstrated as an effective method for developing lightweight, high loss structures for noise and vibration control. ABHs employ a local thickness change to tailor the speed and amplitude of flexural bending waves and create concentrated regions of high strain energy which can be effectively dissipated through conventional damping treatments. These regions act as energy sinks which allow for effective broadband vibration absorption with minimal use of applied damping material. This, combined with the reduced mass from the thickness tailoring, results in a treated structure with higher loss and less mass than the original. In this work, the transmission loss (TL) of plates with embedded ABHs was investigated using experimental and numerical methods in order to assess the usefulness of ABH systems for TL applications. The results demonstrated that damped ABH plates offer improved performance compared to a uniform plate despite having less mass. The result will be useful for applying ABHs and ABH systems to practical noise and vibration control problems.

Simultaneous orientation and thickness mapping in transmission electron microscopy

DOE PAGES

Tyutyunnikov, Dmitry; Özdöl, V. Burak; Koch, Christoph T.

2014-12-04

In this paper we introduce an approach for simultaneous thickness and orientation mapping of crystalline samples by means of transmission electron microscopy. We show that local thickness and orientation values can be extracted from experimental dark-field (DF) image data acquired at different specimen tilts. The method has been implemented to automatically acquire the necessary data and then map thickness and crystal orientation for a given region of interest. We have applied this technique to a specimen prepared from a commercial semiconductor device, containing multiple 22 nm technology transistor structures. The performance and limitations of our method are discussed and comparedmore » to those of other techniques available.« less

Research on a lubricating grease print process for cylindrical cylinder

NASA Astrophysics Data System (ADS)

Yang, Liu; Zhang, Xuan; Wang, XianYan; Tan, XiaoYan

2017-09-01

In vehicle braking system and clutch system of transmission, there is always a kind of cylindrical component dose reciprocating motion. The main working method is the reciprocating motion between the rubber sealing parts and cylindrical parts, the main factor affects the service life of the product is the lubricating performance of the moving parts. So the lubricating performance between cylinders and rubber sealing rings is particularly important, same as the quality of the grease applies on the surface of the surface of cylinder. Traditional method of manually applying grease has some defects such as applying unevenly, applying tools like brush and cloth easily falls off and affect the cleanness of products, contact skin easily cause allergy, waste grease due to the uncontrollable of grease quantity using in applying, low efficiency of manual operation. An automatic, quantitative and high pressure applying equipment is introduced in this document to replace the traditional manually applying method, which can guarantee the applying quality of the grease which are painted on the surface of cylinder and bring economic benefits to the company.

Design for a broad non-transmission band gap of three-color filters using photonic heterostructures

NASA Astrophysics Data System (ADS)

Li, Hongfei; Guan, Huihuan; Han, Peide; Li, Yuping; Zhang, Caili

2013-01-01

The bandgap characteristics of one-dimensional (1D) photonic crystal (PC) heterostructures containing defects are studied using the transfer matrix method. The key is to search for the best combination style for different 1D PCs to form heterostructures containing Si/MgF2 multilayer films. The non-transmission range over the entire visible range can be enlarged substantially, and the phenomenon of three-color PC filters in blue-green-red light can be realized by adjusting the repeat cycle counts of various PCs. With perfect omnidirectional and high peak transmission three-color filters for the electric magnetic (TE) mode, this optimization design opens a promising way to fabricate three-color PC filters with a wide non-transmission range in the visible range, which can be applied to white LEDs.

Electromagnetic Tunneling and Resonances in Pseudochiral Omega Slabs

PubMed Central

Razzaz, Faroq; Alkanhal, Majeed A. S.

2017-01-01

This paper presents theoretical investigation of the electromagnetic wave tunneling and anomalous transmission around the trapped modes in a pseudochiral omega slab. The dispersion relation, the conditions of the trapped modes, and the evanescent wave coupling and tunneling in two different reciprocal pseudochiral omega slab structures are derived. The Berreman’s matrix method is applied to obtain the transmission coefficients across the pseudochiral omega slab. When the structure is perturbed, a resonance phenomenon is detected around the trapped modes. This resonance results in transmission anomalies (total transmission and total reflection) and dramatic field amplifications around the trapped modes. The number of the discrete trapped modes and then the resonance frequencies are prescribed by the parameters of the pseudochiral omega slab such as the value of the omega parameter and its orientation and the slab thickness. PMID:28165058

RD Optimized, Adaptive, Error-Resilient Transmission of MJPEG2000-Coded Video over Multiple Time-Varying Channels

NASA Astrophysics Data System (ADS)

Bezan, Scott; Shirani, Shahram

2006-12-01

To reliably transmit video over error-prone channels, the data should be both source and channel coded. When multiple channels are available for transmission, the problem extends to that of partitioning the data across these channels. The condition of transmission channels, however, varies with time. Therefore, the error protection added to the data at one instant of time may not be optimal at the next. In this paper, we propose a method for adaptively adding error correction code in a rate-distortion (RD) optimized manner using rate-compatible punctured convolutional codes to an MJPEG2000 constant rate-coded frame of video. We perform an analysis on the rate-distortion tradeoff of each of the coding units (tiles and packets) in each frame and adapt the error correction code assigned to the unit taking into account the bandwidth and error characteristics of the channels. This method is applied to both single and multiple time-varying channel environments. We compare our method with a basic protection method in which data is either not transmitted, transmitted with no protection, or transmitted with a fixed amount of protection. Simulation results show promising performance for our proposed method.

Transmission effects in unfolding electronic-vibrational electron-molecule energy-loss spectra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Shiyang; Khakoo, Murtadha A.; Johnson, Paul V.

2006-03-15

The results of an investigation concerning the sensitivity of conventional unfolding methods applied to electronic-vibrational electron-energy-loss spectra to the transmission efficiency of electron spectrometers are presented. This investigation was made in an effort to understand differences in the differential cross sections for excitation of low-lying electronic states determined experimentally by various groups using electronic-vibrational energy-loss spectra of N{sub 2}. In these experiments, very similar spectral unfolding methods were used, which relied on similar Franck-Condon factors. However, the overall analyses of the electron scattering spectra (by the individual groups) resulted in large differences among the differential cross sections determined from thesemore » energy-loss spectra. The transmission response of the experimental apparatus to different-energy scattered electrons has often been discussed as a key factor that caused these disagreements. The present investigation shows in contrast that the effect of transmission is smaller than that required to independently explain such differences, implying that other systematic effects are responsible for the existing differences between measurements.« less

Transmission properties of C60 ions through micro- and nano-capillaries

NASA Astrophysics Data System (ADS)

Tsuchida, Hidetsugu; Majima, Takuya; Tomita, Shigeo; Sasa, Kimikazu; Narumi, Kazumasa; Saitoh, Yuichi; Chiba, Atsuya; Yamada, Keisuke; Hirata, Koichi; Shibata, Hiromi; Itoh, Akio

2013-11-01

We apply the capillary beam-focusing method for the C60 fullerene projectiles in the velocity range between 0.14 and 0.2 a.u. We study the C60 transmission properties through two different types of capillaries: (1) borosilicate glass microcapillary with an outlet diameter of 5.5 μm, and (2) Al2O3 multi-capillary foil with a pore size of about 70 nm and a high aspect ratio of about 750. We measured the transmitted particle composition by using the electrostatic deflection method combined with the microchannel plate imaging technique. For the experiments with the single microcapillary, the main transmission component is found to be primary C60 beams that are focused in the area equal to the capillary outlet diameter. Minor components are charge-exchanged C60 ions and charged or neutral fragments (fullerene-like C60-2m and small Cn particles), and their fractions decrease with decreasing the projectile velocity. It is concluded that the C60 transmission fraction is considerably high for both types of the capillaries in the present velocity range.

[Accuracy of attenuation coefficient obtained by 137Cs single-transmission scanning in PET: comparison with conventional germanium line source].

PubMed

Matsumoto, Keiichi; Kitamura, Keishi; Mizuta, Tetsuro; Shimizu, Keiji; Murase, Kenya; Senda, Michio

2006-02-20

Transmission scanning can be successfully performed with a Cs-137 single-photon-emitting point source for three-dimensional PET imaging. This method was effective for postinjection transmission scanning because of differences in physical energy. However, scatter contamination in the transmission data lowers measured attenuation coefficients. The purpose of this study was to investigate the accuracy of the influence of object scattering by measuring the attenuation coefficients on the transmission images. We also compared the results with the conventional germanium line source method. Two different types of PET scanner, the SET-3000 G/X (Shimadzu Corp.) and ECAT EXACT HR(+) (Siemens/CTI) , were used. For the transmission scanning, the SET-3000 G/X and ECAT HR(+) were the Cs-137 point source and Ge-68/Ga-68 line source, respectively. With the SET-3000 G/X, we performed transmission measurement at two energy gate settings, the standard 600-800 keV as well as 500-800 keV. The energy gate setting of the ECAT HR(+) was 350-650 keV. The effects of scattering in a uniform phantom with different cross-sectional areas ranging from 201 cm(2) to 314 cm(2) to 628 cm(2) (apposition of the two 20 cm diameter phantoms) and 943 cm(2) (stacking of the three 20 cm diameter phantoms) were acquired without emission activity. First, we evaluated the attenuation coefficients of the two different types of transmission scanning using region of interest (ROI) analysis. In addition, we evaluated the attenuation coefficients with and without segmentation for Cs-137 transmission images using the same analysis. The segmentation method was a histogram-based soft-tissue segmentation process that can also be applied to reconstructed transmission images. In the Cs-137 experiment, the maximum underestimation was 3% without segmentation, which was reduced to less than 1% with segmentation at the center of the largest phantom. In the Ge-68/Ga-68 experiment, the difference in mean attenuation coefficients was stable with all phantoms. We evaluated the accuracy of attenuation coefficients of Cs-137 single-transmission scans. The results for Cs-137 suggest that scattered photons depend on object size. Although Cs-137 single-transmission scans contained scattered photons, attenuation coefficient error could be reduced using by the segmentation method.

Investigation on Periodically Surface-Corrugated Long-Period Gratings Inscribed on Photonic Crystal Fibers

NASA Astrophysics Data System (ADS)

Han, Young-Geun

2017-04-01

Transmission characteristics of periodically surface-corrugated long-period gratings (LPGs) inscribed on photonic crystal fibers (PCFs) using a wet-etching technique were experimentally investigated. A conventional wet method was implemented to periodically engrave the silica cladding region of the PCFs resulting in the periodic surface corrugation in the PCF. After applying the external strain to the PCF with the periodic surface micro-ridges, periodic modulation of refractive index based on the photoelastic effect is induced resulting in the formation of the PCF-based LPG. Increasing the applied strain successfully improves the extinction ratio of the resonant peak of the PCF-based LPG without the resonant wavelength shift. We also measured the transmission characteristics of the PCF-based LPG with variations in temperature and ambient index.

Proposed design procedure for transmission shafting under fatigue loading

NASA Technical Reports Server (NTRS)

Loewenthal, S. H.

1978-01-01

The B106 American National Standards Committee is currently preparing a new standard for the design of transmission shafting. A design procedure, proposed for use in the new standard, for computing the diameter of rotating solid steel shafts under combined cyclic bending and steady torsion is presented. The formula is based on an elliptical variation of endurance strength with torque exhibited by combined stress fatigue data. Fatigue factors are cited to correct specimen bending endurance strength data for use in the shaft formula. A design example illustrates how the method is to be applied.

Quantitative study of mammalian cells by scanning transmission soft X-ray microscopy

NASA Astrophysics Data System (ADS)

Shinohara, K.; Ohigashi, T.; Toné, S.; Kado, M.; Ito, A.

2017-06-01

Molecular distribution in mammalian cells was studied by soft X-ray scanning transmission microscopy with respect to the quantitative aspect of analysis. NEXAFS profiles at the C, N and O K-absorption edges were combined and used for the analysis. For the estimation of quantity for nucleic acids and proteins, NEXAFS profiles of DNA and bovine serum albumin (BSA) at the N K-absorption edge were applied assuming that those were their representatives. The method has a potential to explore the other molecular components than nucleic acids and proteins.

Contamination mitigation strategies for scanning transmission electron microscopy.

PubMed

Mitchell, D R G

2015-06-01

Modern scanning transmission electron microscopy (STEM) enables imaging and microanalysis at very high magnification. In the case of aberration-corrected STEM, atomic resolution is readily achieved. However, the electron fluxes used may be up to three orders of magnitude greater than those typically employed in conventional STEM. Since specimen contamination often increases with electron flux, specimen cleanliness is a critical factor in obtaining meaningful data when carrying out high magnification STEM. A range of different specimen cleaning methods have been applied to a variety of specimen types. The contamination rate has been measured quantitatively to assess the effectiveness of cleaning. The methods studied include: baking, cooling, plasma cleaning, beam showering and UV/ozone exposure. Of the methods tested, beam showering is rapid, experimentally convenient and very effective on a wide range of specimens. Oxidative plasma cleaning is also very effective and can be applied to specimens on carbon support films, albeit with some care. For electron beam-sensitive materials, cooling may be the method of choice. In most cases, preliminary removal of the bulk of the contamination by methods such as baking or plasma cleaning, followed by beam showering, where necessary, can result in a contamination-free specimen suitable for extended atomic scale imaging and analysis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reverberation Modelling Using a Parabolic Equation Method

DTIC Science & Technology

2012-10-01

the limits of their applicability. Results: Transmission loss estimates produced by the PECan parabolic equation acoustic model were used in...environments is possible when used in concert with a parabolic equation passive acoustic model . Future plans: The authors of this report recommend further...technique using other types of acoustic models should be undertaken. Furthermore, as the current method when applied as-is results in estimates that reflect

Combining epidemiological and genetic networks signifies the importance of early treatment in HIV-1 transmission.

PubMed

Zarrabi, Narges; Prosperi, Mattia; Belleman, Robert G; Colafigli, Manuela; De Luca, Andrea; Sloot, Peter M A

2012-01-01

Inferring disease transmission networks is important in epidemiology in order to understand and prevent the spread of infectious diseases. Reconstruction of the infection transmission networks requires insight into viral genome data as well as social interactions. For the HIV-1 epidemic, current research either uses genetic information of patients' virus to infer the past infection events or uses statistics of sexual interactions to model the network structure of viral spreading. Methods for a reliable reconstruction of HIV-1 transmission dynamics, taking into account both molecular and societal data are still lacking. The aim of this study is to combine information from both genetic and epidemiological scales to characterize and analyse a transmission network of the HIV-1 epidemic in central Italy.We introduce a novel filter-reduction method to build a network of HIV infected patients based on their social and treatment information. The network is then combined with a genetic network, to infer a hypothetical infection transmission network. We apply this method to a cohort study of HIV-1 infected patients in central Italy and find that patients who are highly connected in the network have longer untreated infection periods. We also find that the network structures for homosexual males and heterosexual populations are heterogeneous, consisting of a majority of 'peripheral nodes' that have only a few sexual interactions and a minority of 'hub nodes' that have many sexual interactions. Inferring HIV-1 transmission networks using this novel combined approach reveals remarkable correlations between high out-degree individuals and longer untreated infection periods. These findings signify the importance of early treatment and support the potential benefit of wide population screening, management of early diagnoses and anticipated antiretroviral treatment to prevent viral transmission and spread. The approach presented here for reconstructing HIV-1 transmission networks can have important repercussions in the design of intervention strategies for disease control.

Economic analysis for transmission operation and planning

NASA Astrophysics Data System (ADS)

Zhou, Qun

2011-12-01

Restructuring of the electric power industry has caused dramatic changes in the use of transmission system. The increasing congestion conditions as well as the necessity of integrating renewable energy introduce new challenges and uncertainties to transmission operation and planning. Accurate short-term congestion forecasting facilitates market traders in bidding and trading activities. Cost sharing and recovery issue is a major impediment for long-term transmission investment to integrate renewable energy. In this research, a new short-term forecasting algorithm is proposed for predicting congestion, LMPs, and other power system variables based on the concept of system patterns. The advantage of this algorithm relative to standard statistical forecasting methods is that structural aspects underlying power market operations are exploited to reduce the forecasting error. The advantage relative to previously proposed structural forecasting methods is that data requirements are substantially reduced. Forecasting results based on a NYISO case study demonstrate the feasibility and accuracy of the proposed algorithm. Moreover, a negotiation methodology is developed to guide transmission investment for integrating renewable energy. Built on Nash Bargaining theory, the negotiation of investment plans and payment rate can proceed between renewable generation and transmission companies for cost sharing and recovery. The proposed approach is applied to Garver's six bus system. The numerical results demonstrate fairness and efficiency of the approach, and hence can be used as guidelines for renewable energy investors. The results also shed light on policy-making of renewable energy subsidies.

Reconstruction of disease transmission rates: Applications to measles, dengue, and influenza.

PubMed

Lange, Alexander

2016-07-07

Transmission rates are key in understanding the spread of infectious diseases. Using the framework of compartmental models, we introduce a simple method to reconstruct time series of transmission rates directly from incidence or disease-related mortality data. The reconstruction employs differential equations, which model the time evolution of infective stages and strains. Being sensitive to initial values, the method produces asymptotically correct solutions. The computations are fast, with time complexity being quadratic. We apply the reconstruction to data of measles (England and Wales, 1948-1967), dengue (Thailand, 1982-1999), and influenza (U.S., 1910-1927). The Measles example offers comparison with earlier work. Here we re-investigate reporting corrections, include and exclude demographic information. The dengue example deals with the failure of vector-control measures in reducing dengue hemorrhagic fever (DHF) in Thailand. Two competing mechanisms have been held responsible: strain interaction and demographic transitions. Our reconstruction reveals that both explanations are possible, showing that the increase in DHF cases is consistent with decreasing transmission rates resulting from reduced vector counts. The flu example focuses on the 1918/1919 pandemic, examining the transmission rate evolution for an invading strain. Our analysis indicates that the pandemic strain could have circulated in the population for many months before the pandemic was initiated by an event of highly increased transmission. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection limits for nanoparticles in solution with classical turbidity spectra

NASA Astrophysics Data System (ADS)

Le Blevennec, G.

2013-09-01

Detection of nanoparticles in solution is required to manage safety and environmental problems. Spectral transmission turbidity method has now been known for a long time. It is derived from the Mie Theory and can be applied to any number of spheres, randomly distributed and separated by large distance compared to wavelength. Here, we describe a method for determination of size, distribution and concentration of nanoparticles in solution using UV-Vis transmission measurements. The method combines Mie and Beer Lambert computation integrated in a best fit approximation. In a first step, a validation of the approach is completed on silver nanoparticles solution. Verification of results is realized with Transmission Electronic Microscopy measurements for size distribution and an Inductively Coupled Plasma Mass Spectrometry for concentration. In view of the good agreement obtained, a second step of work focuses on how to manage the concentration to be the most accurate on the size distribution. Those efficient conditions are determined by simple computation. As we are dealing with nanoparticles, one of the key points is to know what the size limits reachable are with that kind of approach based on classical electromagnetism. In taking into account the transmission spectrometer accuracy limit we determine for several types of materials, metals, dielectrics, semiconductors the particle size limit detectable by such a turbidity method. These surprising results are situated at the quantum physics frontier.

Prioritization of Companion Animal Transmissible Diseases for Policy Intervention in Europe.

PubMed

Cito, F; Rijks, J; Rantsios, A T; Cunningham, A A; Baneth, G; Guardabassi, L; Kuiken, T; Giovannini, A

2016-07-01

A number of papers have been published on the prioritization of transmissible diseases in farm animals and wildlife, based either on semiquantitative or truly quantitative methods, but there is no published literature on the prioritization of transmissible diseases in companion animals. In this study, available epidemiological data for diseases transmissible from companion animals to man were analysed with the aim of developing a procedure suitable for their prioritization within a European framework. A new method and its associated questionnaire and scoring system were designed based on methods described by the World Organisation for Animal Health (OIE). Modifications were applied to allow for the paucity of specific information on companion animal transmissible diseases. The OIE method was also adapted to the subject and to the regional scope of the interprofessional network addressing zoonotic diseases transmitted via companion animals in Europe: the Companion Animals multisectoriaL interprofessionaL Interdisciplinary Strategic Think tank On zoonoses (CALLISTO). Adaptations were made based on information collected from expert groups on viral, bacterial and parasitic diseases using a structured questionnaire, in which all questions were closed-ended. The expert groups were asked to select the most appropriate answer for each question taking into account the relevance and reliability of the data available in the scientific literature. Subsequently, the scoring of the answers obtained for each disease covered by the questionnaire was analysed to obtain two final overall scores, one for human health impact and one for agricultural economic impact. The adapted method was then applied to select the 15 most important pathogens (five for each pathogen group: viral, bacterial and parasitic) on the basis of their overall impact on public health and agriculture. The result of the prioritization exercise was a joint priority list (available at www.callistoproject.eu) of relevant pathogens according to these two criteria. As the scope of CALLISTO was comprehensive in terms of geographical area, animal species involved and impact of the diseases, the list of prioritized diseases had to accommodate the realities in different European countries and the differences in biology and animal-human relationships in a wide range of species including cats and dogs, pet pigs and sheep as well as captive reptiles. The methodology presented in this paper can be used to generate accurate priority lists according to narrower and more specific objectives. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Optimal topologies for maximizing network transmission capacity

NASA Astrophysics Data System (ADS)

Chen, Zhenhao; Wu, Jiajing; Rong, Zhihai; Tse, Chi K.

2018-04-01

It has been widely demonstrated that the structure of a network is a major factor that affects its traffic dynamics. In this work, we try to identify the optimal topologies for maximizing the network transmission capacity, as well as to build a clear relationship between structural features of a network and the transmission performance in terms of traffic delivery. We propose an approach for designing optimal network topologies against traffic congestion by link rewiring and apply them on the Barabási-Albert scale-free, static scale-free and Internet Autonomous System-level networks. Furthermore, we analyze the optimized networks using complex network parameters that characterize the structure of networks, and our simulation results suggest that an optimal network for traffic transmission is more likely to have a core-periphery structure. However, assortative mixing and the rich-club phenomenon may have negative impacts on network performance. Based on the observations of the optimized networks, we propose an efficient method to improve the transmission capacity of large-scale networks.

Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

PubMed

Bibby, Chris; Hodgson, Murray

2017-01-01

The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

The possibility of applying spectral redundancy in DWDM systems on existing long-distance FOCLs for increasing the data transmission rate and decreasing nonlinear effects and double Rayleigh scattering without changes in the communication channel

NASA Astrophysics Data System (ADS)

Nekuchaev, A. O.; Shuteev, S. A.

2014-04-01

A new method of data transmission in DWDM systems along existing long-distance fiber-optic communication lines is proposed. The existing method, e.g., uses 32 wavelengths in the NRZ code with an average power of 16 conventional units (16 units and 16 zeros on the average) and transmission of 32 bits/cycle. In the new method, one of 124 wavelengths with a duration of one cycle each (at any time instant, no more than 16 obligatory different wavelengths) and capacity of 4 bits with an average power of 15 conventional units and rate of 64 bits/cycle is transmitted at every instant of a 1/16 cycle. The cross modulation and double Rayleigh scattering are significantly decreased owing to uniform distribution of power over time at different wavelengths. The time redundancy (forward error correction (FEC)) is about 7% and allows one to achieve a coding enhancement of about 6 dB by detecting and removing deletions and errors simultaneously.

Threshold Assessment of Gear Diagnostic Tools on Flight and Test Rig Data

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Mosher, Marianne; Huff, Edward M.

2003-01-01

A method for defining thresholds for vibration-based algorithms that provides the minimum number of false alarms while maintaining sensitivity to gear damage was developed. This analysis focused on two vibration based gear damage detection algorithms, FM4 and MSA. This method was developed using vibration data collected during surface fatigue tests performed in a spur gearbox rig. The thresholds were defined based on damage progression during tests with damage. The thresholds false alarm rates were then evaluated on spur gear tests without damage. Next, the same thresholds were applied to flight data from an OH-58 helicopter transmission. Results showed that thresholds defined in test rigs can be used to define thresholds in flight to correctly classify the transmission operation as normal.

An Estimation Method of System Voltage Sag Profile using Recorded Sag Data

NASA Astrophysics Data System (ADS)

Tanaka, Kazuyuki; Sakashita, Tadashi

The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.

A Comparative Study of Distribution System Parameter Estimation Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Yannan; Williams, Tess L.; Gourisetti, Sri Nikhil Gup

2016-07-17

In this paper, we compare two parameter estimation methods for distribution systems: residual sensitivity analysis and state-vector augmentation with a Kalman filter. These two methods were originally proposed for transmission systems, and are still the most commonly used methods for parameter estimation. Distribution systems have much lower measurement redundancy than transmission systems. Therefore, estimating parameters is much more difficult. To increase the robustness of parameter estimation, the two methods are applied with combined measurement snapshots (measurement sets taken at different points in time), so that the redundancy for computing the parameter values is increased. The advantages and disadvantages of bothmore » methods are discussed. The results of this paper show that state-vector augmentation is a better approach for parameter estimation in distribution systems. Simulation studies are done on a modified version of IEEE 13-Node Test Feeder with varying levels of measurement noise and non-zero error in the other system model parameters.« less

Preventing HIV transmission in Chinese internal migrants: a behavioral approach.

PubMed

Liu, Xiaona; Erasmus, Vicki; Sun, Xinying; Cai, Rui; Shi, Yuhui; Richardus, Jan Hendrik

2014-01-01

This study is a step towards a behavioral intervention to prevent HIV transmission among Chinese internal migrants. To explore important and changeable determinants of condom use and inspect effective and feasible methods to increase condom use for the target population, we conducted a three-round web-based Delphi study among a panel of 62 experts between October 2012 and March 2013. The panelists were purposely selected using a stepwise procedure to represent topic-related areas of expertise. The response rate per round ranges from 21% to 81%. The panelists identified 19 possible determinants of condom use and reported 16 intervention methods they considered successful. They agreed that attitude towards condom use was the most important and changeable determinant, while applying behavioral theory, increasing sexual education and condom access, performing worksite health promotion, detecting risk factors, and working closely with relevant organizations and the government were effective and feasible methods to increase condom use among internal migrants in China. In conclusion, results of this study highlight the importance of attitude in changing condom use and underscore the need to apply behavior theory and integrate multiple educational approaches for developing behavioral HIV prevention interventions targeting internal migrants in China.

2D strain mapping using scanning transmission electron microscopy Moiré interferometry and geometrical phase analysis.

PubMed

Pofelski, A; Woo, S Y; Le, B H; Liu, X; Zhao, S; Mi, Z; Löffler, S; Botton, G A

2018-04-01

A strain characterization technique based on Moiré interferometry in a scanning transmission electron microscope (STEM) and geometrical phase analysis (GPA) method is demonstrated. The deformation field is first captured in a single STEM Moiré hologram composed of multiple sets of periodic fringes (Moiré patterns) generated from the interference between the periodic scanning grating, fixing the positions of the electron probe on the sample, and the crystal structure. Applying basic principles from sampling theory, the Moiré patterns arrangement is then simulated using a STEM electron micrograph reference to convert the experimental STEM Moiré hologram into information related to the crystal lattice periodicities. The GPA method is finally applied to extract the 2D relative strain and rotation fields. The STEM Moiré interferometry enables the local information to be de-magnified to a large length scale, comparable to what can be achieved in dark-field electron holography. The STEM Moiré GPA method thus extends the conventional high-resolution STEM GPA capabilities by providing comparable quantitative 2D strain mapping with a larger field of view (up to a few microns). Copyright © 2017 Elsevier B.V. All rights reserved.

Finite element probabilistic risk assessment of transmission line insulation flashovers caused by lightning strokes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacvarov, D.C.

1981-01-01

A new method for probabilistic risk assessment of transmission line insulation flashovers caused by lightning strokes is presented. The utilized approach of applying the finite element method for probabilistic risk assessment is demonstrated to be very powerful. The reasons for this are two. First, the finite element method is inherently suitable for analysis of three dimensional spaces where the parameters, such as three variate probability densities of the lightning currents, are non-uniformly distributed. Second, the finite element method permits non-uniform discretization of the three dimensional probability spaces thus yielding high accuracy in critical regions, such as the area of themore » low probability events, while at the same time maintaining coarse discretization in the non-critical areas to keep the number of grid points and the size of the problem to a manageable low level. The finite element probabilistic risk assessment method presented here is based on a new multidimensional search algorithm. It utilizes an efficient iterative technique for finite element interpolation of the transmission line insulation flashover criteria computed with an electro-magnetic transients program. Compared to other available methods the new finite element probabilistic risk assessment method is significantly more accurate and approximately two orders of magnitude computationally more efficient. The method is especially suited for accurate assessment of rare, very low probability events.« less

Automated Design of a High-Velocity Channel

DTIC Science & Technology

2006-05-01

using Newton’s method. 2.2.2 Groundwater Applications Optimization methods are also very useful for solving groundwater problems. Townley et al... Townley 85] apply present computational algorithms to steady and transient models for groundwater °ow. The aquifer storage coe±cients, transmissivities...Reliability Analysis", Water Resources Research, Vol. 28, No. 12, December 1992, pp. 3269-3280. [ Townley 85] Townley , L. R. and Wilson, J. L

HIV Epidemic Appraisals for Assisting in the Design of Effective Prevention Programmes: Shifting the Paradigm Back to Basics

PubMed Central

Mishra, Sharmistha; Sgaier, Sema K.; Thompson, Laura H.; Moses, Stephen; Ramesh, B. M.; Alary, Michel; Wilson, David; Blanchard, James F.

2012-01-01

Background To design HIV prevention programmes, it is critical to understand the temporal and geographic aspects of the local epidemic and to address the key behaviours that drive HIV transmission. Two methods have been developed to appraise HIV epidemics and guide prevention strategies. The numerical proxy method classifies epidemics based on current HIV prevalence thresholds. The Modes of Transmission (MOT) model estimates the distribution of incidence over one year among risk-groups. Both methods focus on the current state of an epidemic and provide short-term metrics which may not capture the epidemiologic drivers. Through a detailed analysis of country and sub-national data, we explore the limitations of the two traditional methods and propose an alternative approach. Methods and Findings We compared outputs of the traditional methods in five countries for which results were published, and applied the numeric and MOT model to India and six districts within India. We discovered three limitations of the current methods for epidemic appraisal: (1) their results failed to identify the key behaviours that drive the epidemic; (2) they were difficult to apply to local epidemics with heterogeneity across district-level administrative units; and (3) the MOT model was highly sensitive to input parameters, many of which required extraction from non-regional sources. We developed an alternative decision-tree framework for HIV epidemic appraisals, based on a qualitative understanding of epidemiologic drivers, and demonstrated its applicability in India. The alternative framework offered a logical algorithm to characterize epidemics; it required minimal but key data. Conclusions Traditional appraisals that utilize the distribution of prevalent and incident HIV infections in the short-term could misguide prevention priorities and potentially impede efforts to halt the trajectory of the HIV epidemic. An approach that characterizes local transmission dynamics provides a potentially more effective tool with which policy makers can design intervention programmes. PMID:22396756

Unsupervised Fault Diagnosis of a Gear Transmission Chain Using a Deep Belief Network

PubMed Central

He, Jun; Yang, Shixi; Gan, Chunbiao

2017-01-01

Artificial intelligence (AI) techniques, which can effectively analyze massive amounts of fault data and automatically provide accurate diagnosis results, have been widely applied to fault diagnosis of rotating machinery. Conventional AI methods are applied using features selected by a human operator, which are manually extracted based on diagnostic techniques and field expertise. However, developing robust features for each diagnostic purpose is often labour-intensive and time-consuming, and the features extracted for one specific task may be unsuitable for others. In this paper, a novel AI method based on a deep belief network (DBN) is proposed for the unsupervised fault diagnosis of a gear transmission chain, and the genetic algorithm is used to optimize the structural parameters of the network. Compared to the conventional AI methods, the proposed method can adaptively exploit robust features related to the faults by unsupervised feature learning, thus requires less prior knowledge about signal processing techniques and diagnostic expertise. Besides, it is more powerful at modelling complex structured data. The effectiveness of the proposed method is validated using datasets from rolling bearings and gearbox. To show the superiority of the proposed method, its performance is compared with two well-known classifiers, i.e., back propagation neural network (BPNN) and support vector machine (SVM). The fault classification accuracies are 99.26% for rolling bearings and 100% for gearbox when using the proposed method, which are much higher than that of the other two methods. PMID:28677638

Unsupervised Fault Diagnosis of a Gear Transmission Chain Using a Deep Belief Network.

PubMed

He, Jun; Yang, Shixi; Gan, Chunbiao

2017-07-04

Artificial intelligence (AI) techniques, which can effectively analyze massive amounts of fault data and automatically provide accurate diagnosis results, have been widely applied to fault diagnosis of rotating machinery. Conventional AI methods are applied using features selected by a human operator, which are manually extracted based on diagnostic techniques and field expertise. However, developing robust features for each diagnostic purpose is often labour-intensive and time-consuming, and the features extracted for one specific task may be unsuitable for others. In this paper, a novel AI method based on a deep belief network (DBN) is proposed for the unsupervised fault diagnosis of a gear transmission chain, and the genetic algorithm is used to optimize the structural parameters of the network. Compared to the conventional AI methods, the proposed method can adaptively exploit robust features related to the faults by unsupervised feature learning, thus requires less prior knowledge about signal processing techniques and diagnostic expertise. Besides, it is more powerful at modelling complex structured data. The effectiveness of the proposed method is validated using datasets from rolling bearings and gearbox. To show the superiority of the proposed method, its performance is compared with two well-known classifiers, i.e., back propagation neural network (BPNN) and support vector machine (SVM). The fault classification accuracies are 99.26% for rolling bearings and 100% for gearbox when using the proposed method, which are much higher than that of the other two methods.

Monte Carlo simulations for 20 MV X-ray spectrum reconstruction of a linear induction accelerator

NASA Astrophysics Data System (ADS)

Wang, Yi; Li, Qin; Jiang, Xiao-Guo

2012-09-01

To study the spectrum reconstruction of the 20 MV X-ray generated by the Dragon-I linear induction accelerator, the Monte Carlo method is applied to simulate the attenuations of the X-ray in the attenuators of different thicknesses and thus provide the transmission data. As is known, the spectrum estimation from transmission data is an ill-conditioned problem. The method based on iterative perturbations is employed to derive the X-ray spectra, where initial guesses are used to start the process. This algorithm takes into account not only the minimization of the differences between the measured and the calculated transmissions but also the smoothness feature of the spectrum function. In this work, various filter materials are put to use as the attenuator, and the condition for an accurate and robust solution of the X-ray spectrum calculation is demonstrated. The influences of the scattering photons within different intervals of emergence angle on the X-ray spectrum reconstruction are also analyzed.

Genomic Infectious Disease Epidemiology in Partially Sampled and Ongoing Outbreaks

PubMed Central

Didelot, Xavier; Fraser, Christophe; Gardy, Jennifer; Colijn, Caroline

2017-01-01

Abstract Genomic data are increasingly being used to understand infectious disease epidemiology. Isolates from a given outbreak are sequenced, and the patterns of shared variation are used to infer which isolates within the outbreak are most closely related to each other. Unfortunately, the phylogenetic trees typically used to represent this variation are not directly informative about who infected whom—a phylogenetic tree is not a transmission tree. However, a transmission tree can be inferred from a phylogeny while accounting for within-host genetic diversity by coloring the branches of a phylogeny according to which host those branches were in. Here we extend this approach and show that it can be applied to partially sampled and ongoing outbreaks. This requires computing the correct probability of an observed transmission tree and we herein demonstrate how to do this for a large class of epidemiological models. We also demonstrate how the branch coloring approach can incorporate a variable number of unique colors to represent unsampled intermediates in transmission chains. The resulting algorithm is a reversible jump Monte–Carlo Markov Chain, which we apply to both simulated data and real data from an outbreak of tuberculosis. By accounting for unsampled cases and an outbreak which may not have reached its end, our method is uniquely suited to use in a public health environment during real-time outbreak investigations. We implemented this transmission tree inference methodology in an R package called TransPhylo, which is freely available from https://github.com/xavierdidelot/TransPhylo. PMID:28100788

Application of the remote-sensing communication model to a time-sensitive wildfire remote-sensing system

Treesearch

Christopher D. Lippitt; Douglas A. Stow; Philip J. Riggan

2016-01-01

Remote sensing for hazard response requires a priori identification of sensor, transmission, processing, and distribution methods to permit the extraction of relevant information in timescales sufficient to allow managers to make a given time-sensitive decision. This study applies and demonstrates the utility of the Remote Sensing Communication...

Couples at risk for transmission of alcoholism: protective influences.

PubMed

Bennett, L A; Wolin, S J; Reiss, D; Teitelbaum, M A

1987-03-01

A two-generation, sociocultural model of the transmission of alcoholism in families was operationalized and tested. Sixty-eight married children of alcoholic parents and their spouses were interviewed regarding dinner-time and holiday ritual practices in their families of origin, and heritage and ritual practices in the couples' current generation. Coders rated transcribed interviews along 14 theory-derived predictor variables, nine for the family of origin and five for the current nuclear family. Multiple regression analysis was applied in a two-step hierarchical method, with the dependent variable being transmission of alcoholism to the couple. The 14 predictor variables contributed significantly (p less than .01) to the couple's alcoholism outcome. A general theme of selective disengagement and reengagement for couples in families at risk for alcoholism recurrence is discussed.

Role of Semen on Vaginal HIV-1 Transmission and Maraviroc Protection

PubMed Central

Council, Olivia D.; Swanson, Michael D.; Spagnuolo, Rae Ann

2015-01-01

We used bone marrow/liver/thymus (BLT) humanized mice to establish the effect of semen on vaginal HIV infection and on the efficacy of topically applied maraviroc. Our results demonstrate that vaginal transmission of cell-free HIV occurs efficiently in the presence of semen and that topically applied maraviroc efficiently prevents HIV transmission in the presence of semen. We also show that semen has no significant effect on the transmission of transmitted/founder viruses or cell-associated viruses. PMID:26392489

Hybrid transfer-matrix FDTD method for layered periodic structures.

PubMed

Deinega, Alexei; Belousov, Sergei; Valuev, Ilya

2009-03-15

A hybrid transfer-matrix finite-difference time-domain (FDTD) method is proposed for modeling the optical properties of finite-width planar periodic structures. This method can also be applied for calculation of the photonic bands in infinite photonic crystals. We describe the procedure of evaluating the transfer-matrix elements by a special numerical FDTD simulation. The accuracy of the new method is tested by comparing computed transmission spectra of a 32-layered photonic crystal composed of spherical or ellipsoidal scatterers with the results of direct FDTD and layer-multiple-scattering calculations.

Evaluation of Noninvasive Measurement Methods and Systems for Application in Vital Signs Detection. Part 1. Literature Review.

DTIC Science & Technology

1986-03-01

radiations from the body in the infrared spectrum of light energy provides a passive, noninvasive method of measuring and recording a subject’s relative... a minimum during each test. In transmission radiography, dosage (or dose rate) is a measure of the * energy of the applied radiation . X-ray energy is... a function of frequency (E *hi) and is expressed in electron volts

Reducing microwave absorption with fast frequency modulation.

PubMed

Qin, Juehang; Hubler, A

2017-05-01

We study the response of a two-level quantum system to a chirp signal, using both numerical and analytical methods. The numerical method is based on numerical solutions of the Schrödinger solution of the two-level system, while the analytical method is based on an approximate solution of the same equations. We find that when two-level systems are perturbed by a chirp signal, the peak population of the initially unpopulated state exhibits a high sensitivity to frequency modulation rate. We also find that the aforementioned sensitivity depends on the strength of the forcing, and weaker forcings result in a higher sensitivity, where the frequency modulation rate required to produce the same reduction in peak population would be lower. We discuss potential applications of this result in the field of microwave power transmission, as it shows applying fast frequency modulation to transmitted microwaves used for power transmission could decrease unintended absorption of microwaves by organic tissue.

Characteristics of absorption and frequency filtration of ULF electromagnetic waves in the ionosphere

NASA Astrophysics Data System (ADS)

Prikner, K.

A statistical method for interpreting data from experimental investigations of vertically-propagating electromagnetic ULF waves in the inhomogeneous magnetoactive ionosphere is considered theoretically. Values are obtained for the transmission, reflection and absorption characteristics of ULF waves in a limited ionospheric layer, in order to describe the relation between the frequency of a wave generated at the earth surface and that of a total wave propagating above the ionospheric layer. This relation is used to express the frequency-selective amplitude filtration of ULF waves in the layer. The method is applied to a model of the night ionosphere of mid-geomagnetic latitudes in the form of a plate 1000 km thick. It is found that the relative characteristics of transmission and amplitude loss in the wave adequately describe the frequency selectiveness and wave filtration capacity of the ionosphere. The method is recommended for studies of the structural changes of wave parameters in ionospheric models.

Characterization of Artifacts Introduced by the Empirical Volcano-Scan Atmospheric Correction Commonly Applied to CRISM and OMEGA Near-Infrared Spectra

NASA Technical Reports Server (NTRS)

Wiseman, S.M.; Arvidson, R.E.; Wolff, M. J.; Smith, M. D.; Seelos, F. P.; Morgan, F.; Murchie, S. L.; Mustard, J. F.; Morris, R. V.; Humm, D.;

Characterization of artifacts introduced by the empirical volcano-scan atmospheric correction commonly applied to CRISM and OMEGA near-infrared spectra

NASA Astrophysics Data System (ADS)

Wiseman, S. M.; Arvidson, R. E.; Wolff, M. J.; Smith, M. D.; Seelos, F. P.; Morgan, F.; Murchie, S. L.; Mustard, J. F.; Morris, R. V.; Humm, D.; McGuire, P. C.

2016-05-01

The empirical 'volcano-scan' atmospheric correction is widely applied to martian near infrared CRISM and OMEGA spectra between ∼1000 and ∼2600 nm to remove prominent atmospheric gas absorptions with minimal computational investment. This correction method employs division by a scaled empirically-derived atmospheric transmission spectrum that is generated from observations of the martian surface in which different path lengths through the atmosphere were measured and transmission calculated using the Beer-Lambert Law. Identifying and characterizing both artifacts and residual atmospheric features left by the volcano-scan correction is important for robust interpretation of CRISM and OMEGA volcano-scan corrected spectra. In order to identify and determine the cause of spectral artifacts introduced by the volcano-scan correction, we simulated this correction using a multiple scattering radiative transfer algorithm (DISORT). Simulated transmission spectra that are similar to actual CRISM- and OMEGA-derived transmission spectra were generated from modeled Olympus Mons base and summit spectra. Results from the simulations were used to investigate the validity of assumptions inherent in the volcano-scan correction and to identify artifacts introduced by this method of atmospheric correction. We found that the most prominent artifact, a bowl-shaped feature centered near 2000 nm, is caused by the inaccurate assumption that absorption coefficients of CO2 in the martian atmosphere are independent of column density. In addition, spectral albedo and slope are modified by atmospheric aerosols. Residual atmospheric contributions that are caused by variable amounts of dust aerosols, ice aerosols, and water vapor are characterized by the analysis of CRISM volcano-scan corrected spectra from the same location acquired at different times under variable atmospheric conditions.

Method and apparatus for minimizing multiple degree of freedom vibration transmission between two regions of a structure

NASA Technical Reports Server (NTRS)

Silcox, Richard J. (Inventor); Fuller, Chris R. (Inventor); Gibbs, Gary P. (Inventor)

1992-01-01

Arrays of actuators are affixed to structural elements to impede the transmission of vibrational energy. A single pair is used to provide control of bending and extensional waves and two pairs are used to control torsional motion. The arrays are applied to a wide variety of structural elements such as a beam structure that is part of a larger framework that may or may not support a rigid or non-rigid skin. Electrical excitation is applied to the actuators that generate forces on the structure. These electrical inputs may be adjusted in their amplitude and phase by a controller in communication with appropriate vibrational wave sensors to impede the flow of vibrational power in all of the above mentioned wave forms beyond the actuator location. Additional sensor elements can be used to monitor the performance and adjust the electrical inputs to maximize the attenuation of vibrational energy.

Viral Linkage in HIV-1 Seroconverters and Their Partners in an HIV-1 Prevention Clinical Trial

PubMed Central

Campbell, Mary S.; Mullins, James I.; Hughes, James P.; Celum, Connie; Wong, Kim G.; Raugi, Dana N.; Sorensen, Stefanie; Stoddard, Julia N.; Zhao, Hong; Deng, Wenjie; Kahle, Erin; Panteleeff, Dana; Baeten, Jared M.; McCutchan, Francine E.; Albert, Jan; Leitner, Thomas; Wald, Anna; Corey, Lawrence; Lingappa, Jairam R.

2011-01-01

Background Characterization of viruses in HIV-1 transmission pairs will help identify biological determinants of infectiousness and evaluate candidate interventions to reduce transmission. Although HIV-1 sequencing is frequently used to substantiate linkage between newly HIV-1 infected individuals and their sexual partners in epidemiologic and forensic studies, viral sequencing is seldom applied in HIV-1 prevention trials. The Partners in Prevention HSV/HIV Transmission Study (ClinicalTrials.gov #NCT00194519) was a prospective randomized placebo-controlled trial that enrolled serodiscordant heterosexual couples to determine the efficacy of genital herpes suppression in reducing HIV-1 transmission; as part of the study analysis, HIV-1 sequences were examined for genetic linkage between seroconverters and their enrolled partners. Methodology/Principal Findings We obtained partial consensus HIV-1 env and gag sequences from blood plasma for 151 transmission pairs and performed deep sequencing of env in some cases. We analyzed sequences with phylogenetic techniques and developed a Bayesian algorithm to evaluate the probability of linkage. For linkage, we required monophyletic clustering between enrolled partners' sequences and a Bayesian posterior probability of ≥50%. Adjudicators classified each seroconversion, finding 108 (71.5%) linked, 40 (26.5%) unlinked, and 3 (2.0%) indeterminate transmissions, with linkage determined by consensus env sequencing in 91 (84%). Male seroconverters had a higher frequency of unlinked transmissions than female seroconverters. The likelihood of transmission from the enrolled partner was related to time on study, with increasing numbers of unlinked transmissions occurring after longer observation periods. Finally, baseline viral load was found to be significantly higher among linked transmitters. Conclusions/Significance In this first use of HIV-1 sequencing to establish endpoints in a large clinical trial, more than one-fourth of transmissions were unlinked to the enrolled partner, illustrating the relevance of these methods in the design of future HIV-1 prevention trials in serodiscordant couples. A hierarchy of sequencing techniques, analysis methods, and expert adjudication contributed to the linkage determination process. PMID:21399681

Detection of Mixed Infection from Bacterial Whole Genome Sequence Data Allows Assessment of Its Role in Clostridium difficile Transmission

PubMed Central

Eyre, David W.; Cule, Madeleine L.; Griffiths, David; Crook, Derrick W.; Peto, Tim E. A.

2013-01-01

Bacterial whole genome sequencing offers the prospect of rapid and high precision investigation of infectious disease outbreaks. Close genetic relationships between microorganisms isolated from different infected cases suggest transmission is a strong possibility, whereas transmission between cases with genetically distinct bacterial isolates can be excluded. However, undetected mixed infections—infection with ≥2 unrelated strains of the same species where only one is sequenced—potentially impairs exclusion of transmission with certainty, and may therefore limit the utility of this technique. We investigated the problem by developing a computationally efficient method for detecting mixed infection without the need for resource-intensive independent sequencing of multiple bacterial colonies. Given the relatively low density of single nucleotide polymorphisms within bacterial sequence data, direct reconstruction of mixed infection haplotypes from current short-read sequence data is not consistently possible. We therefore use a two-step maximum likelihood-based approach, assuming each sample contains up to two infecting strains. We jointly estimate the proportion of the infection arising from the dominant and minor strains, and the sequence divergence between these strains. In cases where mixed infection is confirmed, the dominant and minor haplotypes are then matched to a database of previously sequenced local isolates. We demonstrate the performance of our algorithm with in silico and in vitro mixed infection experiments, and apply it to transmission of an important healthcare-associated pathogen, Clostridium difficile. Using hospital ward movement data in a previously described stochastic transmission model, 15 pairs of cases enriched for likely transmission events associated with mixed infection were selected. Our method identified four previously undetected mixed infections, and a previously undetected transmission event, but no direct transmission between the pairs of cases under investigation. These results demonstrate that mixed infections can be detected without additional sequencing effort, and this will be important in assessing the extent of cryptic transmission in our hospitals. PMID:23658511

The qualitative f-ratio method applied to electron channelling-induced x-ray imaging with an annular silicon drift detector in a scanning electron microscope in the transmission mode.

PubMed

Brodusch, Nicolas; Gauvin, Raynald

2017-09-01

Electron channelling is known to affect the x-ray production when an accelerated electron beam is applied to a crystalline material and is highly dependent on the local crystal orientation. This effect, unless very long counting time are used, is barely noticeable on x-ray energy spectra recorded with conventional silicon drift detectors (SDD) located at a small elevation angle. However, the very high count rates provided by the new commercially available annular SDDs permit now to observe this effect routinely and may, in some circumstances, hide the true elemental x-ray variations due to the local true specimen composition. To circumvent this issue, the recently developed f-ratio method was applied to display qualitatively the true net intensity x-ray variations in a thin specimen of a Ti-6Al-4V alloy in a scanning electron microscope in transmission mode. The diffraction contrast observed in the x-ray images was successfully cancelled through the use of f-ratios and the true composition variations at the grain boundaries could be observed in relation to the dislocation alignment prior to the β-phase nucleation. The qualitative effectiveness in removing channelling effects demonstrated in this work makes the f-ratio, in its quantitative form, a possible alternative to the ZAF method in channelling conditions. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

Transmission losses, infiltration and groundwater recharge through ephemeral and intermittent streambeds: A review of applied methods

NASA Astrophysics Data System (ADS)

Shanafield, Margaret; Cook, Peter G.

2014-04-01

Aquifer recharge through ephemeral streambeds is believed to be a major source of groundwater recharge in arid areas; however, comparatively few studies quantify this streamflow recharge. This review synthesizes the available field-based aquifer recharge literature from arid regions around the world. Seven methods for quantifying ephemeral and intermittent stream infiltration and aquifer recharge are reviewed; controlled infiltration experiments, monitoring changes in water content, heat as a tracer of infiltration, reach length water balances, floodwave front tracking, groundwater mounding, and groundwater dating. The pertinent temporal and spatial scales, as well as the advantages and limitations of each method are illustrated with examples from the literature. Comparisons between the methods are used to highlight appropriate uses of each field method, with emphasis on the advantages of using multiple methods within a study in order to avoid the potential drawbacks inherent in any single method. Research needs are identified, including: quantitative uncertainty analysis, long-term data collection and analysis, understanding of the role of riparian vegetation, and reconciliation of transmission losses and infiltration estimates with actual aquifer recharge.

A New Method to Measure the Post-reionization Ionizing Background from the Joint Distribution of Lyα and Lyβ Forest Transmission

NASA Astrophysics Data System (ADS)

Davies, Frederick B.; Hennawi, Joseph F.; Eilers, Anna-Christina; Lukić, Zarija

2018-03-01

The amplitude of the ionizing background that pervades the intergalactic medium (IGM) at the end of the epoch of reionization provides a valuable constraint on the emissivity of the sources that reionized the universe. While measurements of the ionizing background at lower redshifts rely on a simulation-calibrated mapping between the photoionization rate and the mean transmission of the Lyα forest, at z ≳ 6 the IGM becomes increasingly opaque and transmission arises solely in narrow spikes separated by saturated Gunn–Peterson troughs. In this regime, the traditional approach of measuring the average transmission over large ∼50 Mpc/h regions is less sensitive and suboptimal. In addition, the five times smaller oscillator strength of the Lyβ transition implies that the Lyβ forest is considerably more transparent at z ≳ 6, even in the presence of contamination by foreground z ∼ 5 Lyα forest absorption. In this work we present a novel statistical approach to analyze the joint distribution of transmission spikes in the cospatial z ∼ 6 Lyα and Lyβ forests. Our method relies on approximate Bayesian computation (ABC), which circumvents the necessity of computing the intractable likelihood function describing the highly correlated Lyα and Lyβ transmission. We apply ABC to mock data generated from a large-volume hydrodynamical simulation combined with a state-of-the-art model of ionizing background fluctuations in the post-reionization IGM and show that it is sensitive to higher IGM neutral hydrogen fractions than previous techniques. As a proof of concept, we apply this methodology to a real spectrum of a z = 6.54 quasar and measure the ionizing background from 5.4 ≤ z ≤ 6.4 along this sightline with ∼0.2 dex statistical uncertainties. Some of the data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

Evidence of transmission of Mycobacterium tuberculosis by random amplified polymorphic DNA (RAPD) fingerprinting in Taipei City, Taiwan.

PubMed Central

Harn, H J; Shen, K L; Ho, L I; Yu, K W; Liu, G C; Yueh, K C; Lee, J H

1997-01-01

AIMS: To determine, by strain identification of Mycobacterium tuberculosis, whether transmission has occurred between individuals or whether new strains are present. METHODS: A rapid protocol for random amplified polymorphic DNA (RAPD) analysis was developed. This protocol was applied to 64 strains of M tuberculosis that had been confirmed by culture and microbiological methods. RESULTS: There are five groups of M tuberculosis prevalent in Taipei city, Taiwan. The major types are groups I and III. Groups I and II had been prevalent until the end of last year when, according to our group analysis, they had been eradicated. However, group III was continuously present from the middle of 1995 to the middle of 1996, and group IV was present at the end of both years, which indicated that both groups were transmitted continuously. These clustered strains had demographic characteristics consistent with a finding of transmission tuberculosis. Also, there were 13 of 64 strains with unique RAPD fingerprints that were inferred to be due primarily to the reactivation of infection. In the drug resistance analysis, the major type represented included group III and part of group IV. CONCLUSIONS: Our preliminary data imply, not only that the prevalence of M tuberculosis in Taipei city is due to transmission rather than reactivation, but that drug resistance also may play a role in tuberculosis transmission. Images PMID:9378819

Channel Transmission Loss Studies During Ephemeral Flow Events: ER-5-3 Channel and Cambric Ditch, Nevada Test Site, Nye County, Nevada

DOE Office of Scientific and Technical Information (OSTI.GOV)

J.J. Miller; S.A. Mizell; R.H. French

2005-10-01

Transmission losses along ephemeral channels are an important, yet poorly understood, aspect of rainfall-runoff prediction. Losses occur as flow infiltrates channel bed, banks, and floodplains. Estimating transmission losses in arid environments is difficult because of the variability of surficial geomorphic characteristics and infiltration capacities of soils and near-surface low-permeability geologic layers (e.g., calcrete). Transmission losses in ephemeral channels are nonlinear functions of discharge and time (Lane, 1972), and vary spatially along the channel reach and with soil antecedent moisture conditions (Sharma and Murthy, 1994). Rainfall-runoff models used to estimate peak discharge and runoff volume for flood hazard assessment are notmore » designed specifically for ephemeral channels, where transmission loss can be significant because of the available storage volume in channel soils. Accuracy of the flow routing and rainfall-runoff models is dependent on the transmission loss estimate. Transmission loss rate is the most uncertain parameter in flow routing through ephemeral channels. This research, sponsored by the U.S. Department of Energy, National Nuclear Security Administration (DOE/NNSA) and conducted at the Nevada Test Site (NTS), is designed to improve understanding of the impact of transmission loss on ephemeral flood modeling and compare various methodologies for predicting runoff from rainfall events. Various applications of this research to DOE projects include more site-specific accuracy in runoff prediction; possible reduction in size of flood mitigation structures at the NTS; and a better understanding of expected infiltration from runoff losses into landfill covers. Two channel transmission loss field experiments were performed on the NTS between 2001 and 2003: the first was conducted in the ER-5-3 channel (Miller et al., 2003), between March and June 2001, and the second was conducted in the Cambric Ditch (Mizell et al., 2005), between April and July 2003. Both studies used water discharged from unrelated drilling activities during well development and aquifer pump tests. Discharge measurements at several flumes located along the channels were used to directly measure transmission losses. Flume locations were chosen in relation to geomorphic surface types and ages, vegetative cover and types, subsurface indurated layers (calcrete), channel slopes, etc. Transmission losses were quantified using three different analysis methods. Method 1 uses Lane's Method (Lane, 1983) for estimating flood magnitude in ephemeral channels. Method 2 uses heat as a subsurface tracer for infiltration. Numerical modeling, using HYDRUS-2D (Simunek et al., 1999), a finite-element-based flow and transport code, was applied to estimate infiltration from soil temperature data. Method 3 uses hydraulic gradient and water content in a Darcy's Law approach (Freeze and Cherry, 1979) to calculate one-dimensional flow rates. Heat dissipation and water content data were collected for this analysis.« less

A Hybrid Data Compression Scheme for Power Reduction in Wireless Sensors for IoT.

PubMed

Deepu, Chacko John; Heng, Chun-Huat; Lian, Yong

2017-04-01

This paper presents a novel data compression and transmission scheme for power reduction in Internet-of-Things (IoT) enabled wireless sensors. In the proposed scheme, data is compressed with both lossy and lossless techniques, so as to enable hybrid transmission mode, support adaptive data rate selection and save power in wireless transmission. Applying the method to electrocardiogram (ECG), the data is first compressed using a lossy compression technique with a high compression ratio (CR). The residual error between the original data and the decompressed lossy data is preserved using entropy coding, enabling a lossless restoration of the original data when required. Average CR of 2.1 × and 7.8 × were achieved for lossless and lossy compression respectively with MIT/BIH database. The power reduction is demonstrated using a Bluetooth transceiver and is found to be reduced to 18% for lossy and 53% for lossless transmission respectively. Options for hybrid transmission mode, adaptive rate selection and system level power reduction make the proposed scheme attractive for IoT wireless sensors in healthcare applications.

Real-time transmission of full-motion echocardiography over a high-speed data network: impact of data rate and network quality of service

NASA Technical Reports Server (NTRS)

Main, M. L.; Foltz, D.; Firstenberg, M. S.; Bobinsky, E.; Bailey, D.; Frantz, B.; Pleva, D.; Baldizzi, M.; Meyers, D. P.; Jones, K.;

A program to calculate pulse transmission responses through transversely isotropic media

NASA Astrophysics Data System (ADS)

Li, Wei; Schmitt, Douglas R.; Zou, Changchun; Chen, Xiwei

2018-05-01

We provide a program (AOTI2D) to model responses of ultrasonic pulse transmission measurements through arbitrarily oriented transversely isotropic rocks. The program is built with the distributed point source method that treats the transducers as a series of point sources. The response of each point source is calculated according to the ray-tracing theory of elastic plane waves. The program could offer basic wave parameters including phase and group velocities, polarization, anisotropic reflection coefficients and directivity patterns, and model the wave fields, static wave beam, and the observed signals for pulse transmission measurements considering the material's elastic stiffnesses and orientations, sample dimensions, and the size and positions of the transmitters and the receivers. The program could be applied to exhibit the ultrasonic beam behaviors in anisotropic media, such as the skew and diffraction of ultrasonic beams, and analyze its effect on pulse transmission measurements. The program would be a useful tool to help design the experimental configuration and interpret the results of ultrasonic pulse transmission measurements through either isotropic or transversely isotropic rock samples.

Reprint of “Performance analysis of a model-sized superconducting DC transmission system based VSC-HVDC transmission technologies using RTDS”

NASA Astrophysics Data System (ADS)

Dinh, Minh-Chau; Ju, Chang-Hyeon; Kim, Sung-Kyu; Kim, Jin-Geun; Park, Minwon; Yu, In-Keun

2013-01-01

The combination of a high temperature superconducting DC power cable and a voltage source converter based HVDC (VSC-HVDC) creates a new option for transmitting power with multiple collection and distribution points for long distance and bulk power transmissions. It offers some greater advantages compared with HVAC or conventional HVDC transmission systems, and it is well suited for the grid integration of renewable energy sources in existing distribution or transmission systems. For this reason, a superconducting DC transmission system based HVDC transmission technologies is planned to be set up in the Jeju power system, Korea. Before applying this system to a real power system on Jeju Island, system analysis should be performed through a real time test. In this paper, a model-sized superconducting VSC-HVDC system, which consists of a small model-sized VSC-HVDC connected to a 2 m YBCO HTS DC model cable, is implemented. The authors have performed the real-time simulation method that incorporates the model-sized superconducting VSC-HVDC system into the simulated Jeju power system using Real Time Digital Simulator (RTDS). The performance analysis of the superconducting VSC-HVDC systems has been verified by the proposed test platform and the results were discussed in detail.

Performance analysis of a model-sized superconducting DC transmission system based VSC-HVDC transmission technologies using RTDS

NASA Astrophysics Data System (ADS)

Dinh, Minh-Chau; Ju, Chang-Hyeon; Kim, Sung-Kyu; Kim, Jin-Geun; Park, Minwon; Yu, In-Keun

2012-08-01

The combination of a high temperature superconducting DC power cable and a voltage source converter based HVDC (VSC-HVDC) creates a new option for transmitting power with multiple collection and distribution points for long distance and bulk power transmissions. It offers some greater advantages compared with HVAC or conventional HVDC transmission systems, and it is well suited for the grid integration of renewable energy sources in existing distribution or transmission systems. For this reason, a superconducting DC transmission system based HVDC transmission technologies is planned to be set up in the Jeju power system, Korea. Before applying this system to a real power system on Jeju Island, system analysis should be performed through a real time test. In this paper, a model-sized superconducting VSC-HVDC system, which consists of a small model-sized VSC-HVDC connected to a 2 m YBCO HTS DC model cable, is implemented. The authors have performed the real-time simulation method that incorporates the model-sized superconducting VSC-HVDC system into the simulated Jeju power system using Real Time Digital Simulator (RTDS). The performance analysis of the superconducting VSC-HVDC systems has been verified by the proposed test platform and the results were discussed in detail.

Comparison of various decentralised structural and cavity feedback control strategies for transmitted noise reduction through a double panel structure

NASA Astrophysics Data System (ADS)

Ho, Jen-Hsuan; Berkhoff, Arthur

2014-03-01

This paper compares various decentralised control strategies, including structural and acoustic actuator-sensor configuration designs, to reduce noise transmission through a double panel structure. The comparison is based on identical control stability indexes. The double panel structure consists of two panels with air in between and offers the advantages of low sound transmission at high frequencies, low heat transmission, and low weight. The double panel structure is widely used, such as in the aerospace and automotive industries. Nevertheless, the resonance of the cavity and the poor sound transmission loss at low frequencies limit the double panel's noise control performance. Applying active structural acoustic control to the panels or active noise control to the cavity has been discussed in many papers. In this paper, the resonances of the panels and the cavity are considered simultaneously to further reduce the transmitted noise through an existing double panel structure. A structural-acoustic coupled model is developed to investigate and compare various structural control and cavity control methods. Numerical analysis and real-time control results show that structural control should be applied to both panels. Three types of cavity control sources are presented and compared. The results indicate that the largest noise reduction is obtained with cavity control by loudspeakers modified to operate as incident pressure sources.

Modern Focused-Ion-Beam-Based Site-Specific Specimen Preparation for Atom Probe Tomography.

PubMed

Prosa, Ty J; Larson, David J

2017-04-01

Approximately 30 years after the first use of focused ion beam (FIB) instruments to prepare atom probe tomography specimens, this technique has grown to be used by hundreds of researchers around the world. This past decade has seen tremendous advances in atom probe applications, enabled by the continued development of FIB-based specimen preparation methodologies. In this work, we provide a short review of the origin of the FIB method and the standard methods used today for lift-out and sharpening, using the annular milling method as applied to atom probe tomography specimens. Key steps for enabling correlative analysis with transmission electron-beam backscatter diffraction, transmission electron microscopy, and atom probe tomography are presented, and strategies for preparing specimens for modern microelectronic device structures are reviewed and discussed in detail. Examples are used for discussion of the steps for each of these methods. We conclude with examples of the challenges presented by complex topologies such as nanowires, nanoparticles, and organic materials.

Improved analytical techniques of sulfur isotopic composition in nanomole quantities by MC-ICP-MS.

PubMed

Yu, Tsai-Luen; Wang, Bo-Shian; Shen, Chuan-Chou; Wang, Pei-Ling; Yang, Tsanyao Frank; Burr, George S; Chen, Yue-Gau

2017-10-02

We propose an improved method for precise sulfur isotopic measurements by multi-collector inductively coupled plasma mass spectrometry (MC-ICP-MS) in conjunction with a membrane desolvation nebulization system. The problems of sulfur loss through the membrane desolvation apparatus are carefully quantified and resolved. The method overcomes low intrinsic sulfur transmission through the instrument, which was initially 1% when operating at a desolvation temperature of 160 °C. Sulfur loss through the membrane desolvation apparatus was resolved by doping with sodium. A Na/S ratio of 2 mol mol -1 produced sulfur transmissions with 98% recovery. Samples of 3 nmol (100 ng) sulfur achieved an external precision of ±0.18‰ (2 SD) for δ 34 S and ±0.10‰ (2 SD) for Δ 33 S (uppercase delta expresses the extent of mass-independent isotopic fractionation). Measurements made on certified reference materials and in-house standards demonstrate analytical accuracy and reproducibility. We applied the method to examine microbial-induced sulfur transformation in marine sediment pore waters from the sulfate-methane transition zone. The technique is quite versatile, and can be applied to a range of materials, including natural waters and minerals. Copyright © 2017 Elsevier B.V. All rights reserved.

Towards 5G: A Photonic Based Millimeter Wave Signal Generation for Applying in 5G Access Fronthaul.

PubMed

Alavi, S E; Soltanian, M R K; Amiri, I S; Khalily, M; Supa'at, A S M; Ahmad, H

2016-01-27

5G communications require a multi Gb/s data transmission in its small cells. For this purpose millimeter wave (mm-wave) RF signals are the best solutions to be utilized for high speed data transmission. Generation of these high frequency RF signals is challenging in electrical domain therefore photonic generation of these signals is more studied. In this work, a photonic based simple and robust method for generating millimeter waves applicable in 5G access fronthaul is presented. Besides generating of the mm-wave signal in the 60 GHz frequency band the radio over fiber (RoF) system for transmission of orthogonal frequency division multiplexing (OFDM) with 5 GHz bandwidth is presented. For the purpose of wireless transmission for 5G application the required antenna is designed and developed. The total system performance in one small cell was studied and the error vector magnitude (EVM) of the system was evaluated.

Towards 5G: A Photonic Based Millimeter Wave Signal Generation for Applying in 5G Access Fronthaul

PubMed Central

Alavi, S. E.; Soltanian, M. R. K.; Amiri, I. S.; Khalily, M.; Supa’at, A. S. M.; Ahmad, H.

2016-01-01

5G communications require a multi Gb/s data transmission in its small cells. For this purpose millimeter wave (mm-wave) RF signals are the best solutions to be utilized for high speed data transmission. Generation of these high frequency RF signals is challenging in electrical domain therefore photonic generation of these signals is more studied. In this work, a photonic based simple and robust method for generating millimeter waves applicable in 5G access fronthaul is presented. Besides generating of the mm-wave signal in the 60 GHz frequency band the radio over fiber (RoF) system for transmission of orthogonal frequency division multiplexing (OFDM) with 5 GHz bandwidth is presented. For the purpose of wireless transmission for 5G application the required antenna is designed and developed. The total system performance in one small cell was studied and the error vector magnitude (EVM) of the system was evaluated. PMID:26814621

Towards 5G: A Photonic Based Millimeter Wave Signal Generation for Applying in 5G Access Fronthaul

NASA Astrophysics Data System (ADS)

Alavi, S. E.; Soltanian, M. R. K.; Amiri, I. S.; Khalily, M.; Supa'At, A. S. M.; Ahmad, H.

2016-01-01

5G communications require a multi Gb/s data transmission in its small cells. For this purpose millimeter wave (mm-wave) RF signals are the best solutions to be utilized for high speed data transmission. Generation of these high frequency RF signals is challenging in electrical domain therefore photonic generation of these signals is more studied. In this work, a photonic based simple and robust method for generating millimeter waves applicable in 5G access fronthaul is presented. Besides generating of the mm-wave signal in the 60 GHz frequency band the radio over fiber (RoF) system for transmission of orthogonal frequency division multiplexing (OFDM) with 5 GHz bandwidth is presented. For the purpose of wireless transmission for 5G application the required antenna is designed and developed. The total system performance in one small cell was studied and the error vector magnitude (EVM) of the system was evaluated.

Assessing evidence for behaviour change affecting the course of HIV epidemics: a new mathematical modelling approach and application to data from Zimbabwe.

PubMed

Hallett, Timothy B; Gregson, Simon; Mugurungi, Owen; Gonese, Elizabeth; Garnett, Geoff P

2009-06-01

Determining whether interventions to reduce HIV transmission have worked is essential, but complicated by the potential for generalised epidemics to evolve over time without individuals changing risk behaviour. We aimed to develop a method to evaluate evidence for changes in risk behaviour altering the course of an HIV epidemic. We developed a mathematical model of HIV transmission, incorporating the potential for natural changes in the epidemic as it matures and the introduction of antiretroviral treatment, and applied a Bayesian Melding framework, in which the model and observed trends in prevalence can be compared. We applied the model to Zimbabwe, using HIV prevalence estimates from antenatal clinic surveillance and house-hold based surveys, and basing model parameters on data from sexual behaviour surveys. There was strong evidence for reductions in risk behaviour stemming HIV transmission. We estimate these changes occurred between 1999 and 2004 and averted 660,000 (95% credible interval: 460,000-860,000) infections by 2008. The model and associated analysis framework provide a robust way to evaluate the evidence for changes in risk behaviour affecting the course of HIV epidemics, avoiding confounding by the natural evolution of HIV epidemics.

Stereoscopic construction and practice of optoelectronic technology textbook

NASA Astrophysics Data System (ADS)

Zhou, Zigang; Zhang, Jinlong; Wang, Huili; Yang, Yongjia; Han, Yanling

2017-08-01

It is a professional degree course textbook for the Nation-class Specialty—Optoelectronic Information Science and Engineering, and it is also an engineering practice textbook for the cultivation of photoelectric excellent engineers. The book seeks to comprehensively introduce the theoretical and applied basis of optoelectronic technology, and it's closely linked to the current development of optoelectronic industry frontier and made up of following core contents, including the laser source, the light's transmission, modulation, detection, imaging and display. At the same time, it also embodies the features of the source of laser, the transmission of the waveguide, the electronic means and the optical processing methods.

An Encoding Method for Compressing Geographical Coordinates in 3d Space

NASA Astrophysics Data System (ADS)

Qian, C.; Jiang, R.; Li, M.

2017-09-01

This paper proposed an encoding method for compressing geographical coordinates in 3D space. By the way of reducing the length of geographical coordinates, it helps to lessen the storage size of geometry information. In addition, the encoding algorithm subdivides the whole space according to octree rules, which enables progressive transmission and loading. Three main steps are included in this method: (1) subdividing the whole 3D geographic space based on octree structure, (2) resampling all the vertices in 3D models, (3) encoding the coordinates of vertices with a combination of Cube Index Code (CIC) and Geometry Code. A series of geographical 3D models were applied to evaluate the encoding method. The results showed that this method reduced the storage size of most test data by 90 % or even more under the condition of a speed of encoding and decoding. In conclusion, this method achieved a remarkable compression rate in vertex bit size with a steerable precision loss. It shall be of positive meaning to the web 3d map storing and transmission.

Design of the high voltage isolation transmission module with low delay for ECRH system on J-TEXT

NASA Astrophysics Data System (ADS)

Haiyan, MA; Donghui, XIA; Zhijiang, WANG; Fangtai, CUI; Zhenxiong, YU; Yikun, JIN; Changhai, LIU

2018-02-01

As a flexible auxiliary heating method, the electron cyclotron resonance heating (ECRH) has been widely used in many tokamaks and also will be applied for the J-TEXT tokamak. To meet requirements of protection and fault analysis for the ECRH system on J-TEXT, signals of gyrotrons such as the cathode voltage and current, the anode voltage and current, etc should be transmitted to the control and data acquisition system. Considering the high voltage environment of gyrotrons, isolation transmission module based on FPGA and optical fiber communication has been designed and tested. The test results indicate that the designed module has strong anti-noise ability, low error rate and high transmission speed. The delay of the module is no more than 5 μs which can fulfill the requirements.

Identifying and managing radiation damage during in situ transmission x-ray microscopy of Li-ion batteries

NASA Astrophysics Data System (ADS)

Nelson, Johanna; Yang, Yuan; Misra, Sumohan; Andrews, Joy C.; Cui, Yi; Toney, Michael F.

2013-09-01

Radiation damage is a topic typically sidestepped in formal discussions of characterization techniques utilizing ionizing radiation. Nevertheless, such damage is critical to consider when planning and performing experiments requiring large radiation doses or radiation sensitive samples. High resolution, in situ transmission X-ray microscopy of Li-ion batteries involves both large X-ray doses and radiation sensitive samples. To successfully identify changes over time solely due to an applied current, the effects of radiation damage must be identified and avoided. Although radiation damage is often significantly sample and instrument dependent, the general procedure to identify and minimize damage is transferable. Here we outline our method of determining and managing the radiation damage observed in lithium sulfur batteries during in situ X-ray imaging on the transmission X-ray microscope at Stanford Synchrotron Radiation Lightsource.

Optimal Control of Malaria Transmission using Insecticide Treated Nets and Spraying

NASA Astrophysics Data System (ADS)

Athina, D.; Bakhtiar, T.; Jaharuddin

2017-03-01

In this paper, we consider a model of the transmission of malaria which was developed by Silva and Torres equipped with two control variables, namely the use of insecticide treated nets (ITN) to reduce the number of human beings infected and spraying to reduce the number of mosquitoes. Pontryagin maximum principle was applied to derive the differential equation system as optimality conditions which must be satisfied by optimal control variables. The Mangasarian sufficiency theorem shows that Pontryagin maximum principle is necessary as well as sufficient conditions for optimization problem. The 4th-order Runge Kutta method was then performed to solve the differential equations system. The numerical results show that both controls given at once can reduce the number of infected individuals as well as the number of mosquitoes which reduce the impact of malaria transmission.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wendt, Joel Robert; Hadley, G. Ronald; Samora, Sally

Plasmonic structures open up new opportunities in photonic devices, sometimes offering an alternate method to perform a function and sometimes offering capabilities not possible with standard optics. In this LDRD we successfully demonstrated metal coatings on optical surfaces that do not adversely affect the transmission of those surfaces at the design frequency. This technology could be applied as an RF noise blocking layer across an optical aperture or as a method to apply an electric field to an active electro-optic device without affecting optical performance. We also demonstrated thin optical absorbers using similar patterned surfaces. These infrared optical antennas showmore » promise as a method to improve performance in mercury cadmium telluride detectors. Furthermore, these structures could be coupled with other components to lead to direct rectification of infrared radiation. This possibility leads to a new method for infrared detection and energy harvesting of infrared radiation.« less

Multi-ball and one-ball geolocation

NASA Astrophysics Data System (ADS)

Nelson, D. J.; Townsend, J. L.

2017-05-01

We present analysis methods that may be used to geolocate emitters using one or more moving receivers. While some of the methods we present may apply to a broader class of signals, our primary interest is locating and tracking ships from short pulsed transmissions, such as the maritime Automatic Identification System (AIS.) The AIS signal is difficult to process and track since the pulse duration is only 25 milliseconds, and the pulses may only be transmitted every six to ten seconds. In this article, we address several problems including accurate TDOA and FDOA estimation methods that do not require searching a two dimensional surface such as the cross-ambiguity surface. As an example, we apply these methods to identify and process AIS pulses from a single emitter, making it possible to geolocate the AIS signal using a single moving receiver.

Measurement and Prediction of Field Transmission Loss as a Diagnostic Tool in Evaluation of Emergency Evacuation Signal Propagation in a Dormitory Facility

NASA Astrophysics Data System (ADS)

Robinson, Donald Arthur

1984-06-01

A method is presented to predict airborne and barrier transmission loss of an audible signal as it travels from a corridor based octave band sound source to a room based receiver location. Flanking pathways are not considered in the prediction model. Although the central focus of the research is on the propagation of the signal, a comprehensive review of the source, path and receiver are presented as related to emergency audible signal propagation. Linear attenuation of the signal and end wall reflection is applied along the corridor path incorporating research conducted by T. L. Redmore of Essex, England. Classical room acoustics are applied to establish the onset of linear attenuation beyond the near field. The "coincidence effect" is applied to the transmission loss through the room door barrier. A constant barrier door transmission loss from corridor-to-room is applied throughout the 250 - 8000 Hertz octave bands. In situ measurements were conducted in two separate dormitories on the University of Massachusetts Amherst campus to verify the validity of the approach. All of the experimental data points follow the corresponding points predicted by the model with all correlations exceeding 0.9. The 95 percent confidence intervals for the absolute difference between predicted and measured values ranged from 0.76 dB to 4.5 dB based on five Leq dB levels taken at each octave band along the length of the corridor. For the corridor to room attenuation in the six test rooms, with the door closed and edge sealed, the predicted minus measured levels ranged from an interval of 0.54 to 2.90 dB Leq at octave bands from 250 to 8000 Hertz. Given the inherent difficulty of in situ tests compared to laboratory or modeling approaches the confidence intervals obtained confirm the usefulness of the prediction model presented.

Retrospective application of Program to Access and Review Trending iNformation and Evaluate coRrelation to Symptoms in patients with Heart Failure criteria for the remote management of patients with cardiac resynchronisation therapy.

PubMed

Brasca, Francesco Ma; Franzetti, Jessica; Rella, Valeria; Malfatto, Gabriella; Brambilla, Roberto; Facchini, Mario; Parati, Gianfranco; Perego, Giovanni B

2017-05-01

Aim The Program to Access and Review Trending iNformation and Evaluate coRrelation to Symptoms in patients with Heart Failure (PARTNERS HF) trial elaborated a multiparametric model for prediction of acute decompensation in advanced heart failure patients, based on periodical in office data download from cardiac resynchronisation devices. In this study, we evaluated the ability of the PARTNERS HF criteria to detect initial decompensation in a population of moderate heart failure patients under remote monitoring. Methods We retrospectively applied the PARTNERS HF criteria to 1860 transmissions from 104 patients (median follow up 21 months; range 1-67 months), who were enrolled in our programme of telemedicine after cardiac resynchronisation therapy. We tested the ability of a score based on these criteria to predict any acute clinical decompensation occurring in the 15 days following a transmission. Results In 441 cases, acute heart failure was diagnosed after the index transmission. The area under the curve (AUC) of the score for the diagnosis of acute decompensation was 0.752 (confidence interval (CI) 95% 0.728-0.777). The best score cut-off was consistent with the results of PARTNERS HF: with a score ≥2, sensitivity was 75% and specificity 68%. The odds ratio for events was 6.24 (CI 95% 4.90-7.95; p < 0.001). Conclusions When retrospectively applied to remote monitoring transmissions and arranged in a score, PARTNERS HF criteria could identify HF patients who subsequently developed acute decompensation. These results warrant prospective studies applying PARTNERS HF criteria to remote monitoring.

Visualization of Data Regarding Infections Using Eye Tracking Techniques.

PubMed

Yoon, Sunmoo; Cohen, Bevin; Cato, Kenrick D; Liu, Jianfang; Larson, Elaine L

2016-05-01

To evaluate ease of use and usefulness for nurses of visualizations of infectious disease transmission in a hospital. An observational study was used to evaluate perceptions of several visualizations of data extracted from electronic health records designed using a participatory approach. Twelve nurses in the master's program in an urban research-intensive nursing school participated in May 2015. A convergent parallel mixed method was used to evaluate nurses' perceptions on ease of use and usefulness of five visualization conveying trends in hospital infection transmission applying think-aloud, interview, and eye-tracking techniques. Subjective data from the interview and think-aloud techniques indicated that participants preferred the traditional line graphs in simple data representation due to their familiarity, clarity, and easiness to read. An objective quantitative measure of eye movement analysis (444,421 gaze events) identified a high degree of participants' attention span in infographics in all three scenarios. All participants responded with the correct answer within 1 min in comprehensive tests. A user-centric approach was effective in developing and evaluating visualizations for hospital infection transmission. For the visualizations designed by the users, the participants were easily able to comprehend the infection visualizations on both line graphs and infographics for simple visualization. The findings from the objective comprehension test and eye movement and subjective attitudes support the feasibility of integrating user-centric visualization designs into electronic health records, which may inspire clinicians to be mindful of hospital infection transmission. Future studies are needed to investigate visualizations and motivation, and the effectiveness of visualization on infection rate. This study designed visualization images using clinical data from electronic health records applying a user-centric approach. The design insights can be applied for visualizing patient data in electronic health records. © 2016 Sigma Theta Tau International.

Method of transmission of dynamic multibit digital images from micro-unmanned aerial vehicles

NASA Astrophysics Data System (ADS)

Petrov, E. P.; Kharina, N. L.

2018-01-01

In connection with successful usage of nanotechnologies in remote sensing great attention is paid to the systems in micro-unmanned aerial vehicles (MUAVs) capable to provide high spatial resolution of dynamic multibit digital images (MDI). Limited energy resources on board the MUAV do not allow transferring a large amount of video information in the shortest possible time. It keeps back the broad development of MUAV. The search for methods to shorten the transmission time of dynamic MDIs from MUAV over the radio channel leads to the methods of MDI compression without computational operations onboard the MUAV. The known compression codecs of video information can not be applied because of the limited energy resources. In this paper we propose a method for reducing the transmission time of dynamic MDIs without computational operations and distortions onboard the MUAV. To develop the method a mathematical apparatus of the theory of conditional Markov processes with discrete arguments was used. On its basis a mathematical model for the transformation of the MDI represented by binary images (BI) in the MDI, consisting of groups of neighboring BIs (GBI) transmitted by multiphase (MP) signals, is constructed. The algorithm for multidimensional nonlinear filtering of MP signals is synthesized, realizing the statistical redundancy of the MDI to compensate for the noise stability losses caused by the use of MP signals.

Dynamic Network Selection for Multicast Services in Wireless Cooperative Networks

NASA Astrophysics Data System (ADS)

Chen, Liang; Jin, Le; He, Feng; Cheng, Hanwen; Wu, Lenan

In next generation mobile multimedia communications, different wireless access networks are expected to cooperate. However, it is a challenging task to choose an optimal transmission path in this scenario. This paper focuses on the problem of selecting the optimal access network for multicast services in the cooperative mobile and broadcasting networks. An algorithm is proposed, which considers multiple decision factors and multiple optimization objectives. An analytic hierarchy process (AHP) method is applied to schedule the service queue and an artificial neural network (ANN) is used to improve the flexibility of the algorithm. Simulation results show that by applying the AHP method, a group of weight ratios can be obtained to improve the performance of multiple objectives. And ANN method is effective to adaptively adjust weight ratios when users' new waiting threshold is generated.

Calculation of AC loss in two-layer superconducting cable with equal currents in the layers

NASA Astrophysics Data System (ADS)

Erdogan, Muzaffer

2016-12-01

A new method for calculating AC loss of two-layer SC power transmission cables using the commercial software Comsol Multiphysics, relying on the approach of the equal partition of current between the layers is proposed. Applying the method to calculate the AC-loss in a cable composed of two coaxial cylindrical SC tubes, the results are in good agreement with the analytical ones of duoblock model. Applying the method to calculate the AC-losses of a cable composed of a cylindrical copper former, surrounded by two coaxial cylindrical layers of superconducting tapes embedded in an insulating medium with tape-on-tape and tape-on-gap configurations are compared. A good agreement between the duoblock model and the numerical results for the tape-on-gap cable is observed.

Probabilistic model of nonlinear penalties due to collision-induced timing jitter for calculation of the bit error ratio in wavelength-division-multiplexed return-to-zero systems

NASA Astrophysics Data System (ADS)

Sinkin, Oleg V.; Grigoryan, Vladimir S.; Menyuk, Curtis R.

2006-12-01

We introduce a fully deterministic, computationally efficient method for characterizing the effect of nonlinearity in optical fiber transmission systems that utilize wavelength-division multiplexing and return-to-zero modulation. The method accurately accounts for bit-pattern-dependent nonlinear distortion due to collision-induced timing jitter and for amplifier noise. We apply this method to calculate the error probability as a function of channel spacing in a prototypical multichannel return-to-zero undersea system.

Tunneling calculations for GaAs-Al(x)Ga(1-x) as graded band-gap sawtooth superlattices. Thesis

NASA Technical Reports Server (NTRS)

Forrest, Kathrine A.; Meijer, Paul H. E.

1991-01-01

Quantum mechanical tunneling calculations for sawtooth (linearly graded band-gap) and step-barrier AlGaAs superlattices were performed by means of a transfer matrix method, within the effective mass approximation. The transmission coefficient and tunneling current versus applied voltage were computed for several representative structures. Particular consideration was given to effective mass variations. The tunneling properties of step and sawtooth superlattices show some qualitative similarities. Both structures exhibit resonant tunneling, however, because they deform differently under applied fields, the J-V curves differ.

The transmission or scattering of elastic waves by an inhomogeneity of simple geometry: A comparison of theories

NASA Technical Reports Server (NTRS)

Sheu, Y. C.; Fu, L. S.

1982-01-01

The extended method of equivalent inclusion developed is applied to study the specific wave problems of the transmission of elastic waves in an infinite medium containing a layer of inhomogeneity, and of the scattering of elastic waves in an infinite medium containing a perfect spherical inhomogeneity. The eigenstrains are expanded as a geometric series and the method of integration for the inhomogeneous Helmholtz operator given by Fu and Mura is adopted. The results obtained by using a limited number of terms in the eigenstrain expansion are compared with exact solutions for the layer problem and for a perfect sphere. Two parameters are singled out for this comparison: the ratio of elastic moduli, and the ratio of the mass densities. General trends for three different situations are shown.

Atomic-resolution transmission electron microscopy of electron beam–sensitive crystalline materials

NASA Astrophysics Data System (ADS)

Zhang, Daliang; Zhu, Yihan; Liu, Lingmei; Ying, Xiangrong; Hsiung, Chia-En; Sougrat, Rachid; Li, Kun; Han, Yu

2018-02-01

High-resolution imaging of electron beam–sensitive materials is one of the most difficult applications of transmission electron microscopy (TEM). The challenges are manifold, including the acquisition of images with extremely low beam doses, the time-constrained search for crystal zone axes, the precise image alignment, and the accurate determination of the defocus value. We develop a suite of methods to fulfill these requirements and acquire atomic-resolution TEM images of several metal organic frameworks that are generally recognized as highly sensitive to electron beams. The high image resolution allows us to identify individual metal atomic columns, various types of surface termination, and benzene rings in the organic linkers. We also apply our methods to other electron beam–sensitive materials, including the organic-inorganic hybrid perovskite CH3NH3PbBr3.

Transmission and Reproduction of Force Sensation by Bilateral Control

NASA Astrophysics Data System (ADS)

Katsura, Seiichiro; Ohnishi, Kouhei

Minimally invasive surgery (MIS) which thinks a great deal of patient’s quality of life (QOL) has attracted attention during about ten years. In this paper, it aims at development of the technology for transmitting force sensation required in medical treatment especially through surgical instruments, such as forceps. In bilateral control, it is a problem how master and slave robots realize the law of action and reaction to the environment. Mechanism of contact with environment and bilateral controller based on stiffness are shown. Master arm in contact with human and slave arm in contact with environment are given compliance, and stable contact with environment can be realized. The proposed method is applied to 3-link master-slave manipulators. As a result, transmission and reproduction of force sensation can be realized. The experimental results show viability of the proposed method.

Generation of gear tooth surfaces by application of CNC machines

NASA Technical Reports Server (NTRS)

Litvin, F. L.; Chen, N. X.

1994-01-01

This study will demonstrate the importance of application of computer numerically controlled (CNC) machines in generation of gear tooth surfaces with new topology. This topology decreases gear vibration and will extend the gear capacity and service life. A preliminary investigation by a tooth contact analysis (TCA) program has shown that gear tooth surfaces in line contact (for instance, involute helical gears with parallel axes, worm gear drives with cylindrical worms, etc.) are very sensitive to angular errors of misalignment that cause edge contact and an unfavorable shape of transmission errors and vibration. The new topology of gear tooth surfaces is based on the localization of bearing contact, and the synthesis of a predesigned parabolic function of transmission errors that is able to absorb a piecewise linear function of transmission errors caused by gear misalignment. The report will describe the following topics: description of kinematics of CNC machines with six degrees of freedom that can be applied for generation of gear tooth surfaces with new topology. A new method for grinding of gear tooth surfaces by a cone surface or surface of revolution based on application of CNC machines is described. This method provides an optimal approximation of the ground surface to the given one. This method is especially beneficial when undeveloped ruled surfaces are to be ground. Execution of motions of the CNC machine is also described. The solution to this problem can be applied as well for the transfer of machine tool settings from a conventional generator to the CNC machine. The developed theory required the derivation of a modified equation of meshing based on application of the concept of space curves, space curves represented on surfaces, geodesic curvature, surface torsion, etc. Condensed information on these topics of differential geometry is provided as well.

Measuring and correcting wobble in large-scale transmission radiography.

PubMed

Rogers, Thomas W; Ollier, James; Morton, Edward J; Griffin, Lewis D

2017-01-01

Large-scale transmission radiography scanners are used to image vehicles and cargo containers. Acquired images are inspected for threats by a human operator or a computer algorithm. To make accurate detections, it is important that image values are precise. However, due to the scale (∼5 m tall) of such systems, they can be mechanically unstable, causing the imaging array to wobble during a scan. This leads to an effective loss of precision in the captured image. We consider the measurement of wobble and amelioration of the consequent loss of image precision. Following our previous work, we use Beam Position Detectors (BPDs) to measure the cross-sectional profile of the X-ray beam, allowing for estimation, and thus correction, of wobble. We propose: (i) a model of image formation with a wobbling detector array; (ii) a method of wobble correction derived from this model; (iii) methods for calibrating sensor sensitivities and relative offsets; (iv) a Random Regression Forest based method for instantaneous estimation of detector wobble; and (v) using these estimates to apply corrections to captured images of difficult scenes. We show that these methods are able to correct for 87% of image error due wobble, and when applied to difficult images, a significant visible improvement in the intensity-windowed image quality is observed. The method improves the precision of wobble affected images, which should help improve detection of threats and the identification of different materials in the image.

Construction of the influenza A virus transmission tree in a college-based population: co-transmission and interactions between influenza A viruses.

PubMed

Zhang, Xu-Sheng; De Angelis, Daniela

2016-01-29

Co-infection of different influenza A viruses is known to occur but how viruses interact within co-infection remains unknown. An outbreak in a college campus during the 2009 pandemic involved two subtypes of influenza A: persons infected with pandemic A/H1N1; persons infected with seasonal A/H3N2 viruses; and persons infected with both at the same time (co-infection). This provides data to analyse the possible interaction between influenza A viruses within co-infection. We extend a statistical inference method designed for outbreaks caused by one virus to that caused by two viruses. The method uses knowledge of which subtype each case is infected with (and whether they were co-infected), contact information and symptom onset date of each case in the influenza outbreak. We then apply it to construct the most likely transmission tree during the outbreak in the college campus. Analysis of the constructed transmission tree shows that the simultaneous presence of the two influenza viruses increases the infectivity and the transmissibility of A/H1N1 virus but whether it changes the infectivity of A/H3N2 is unclear. The estimation also shows that co-transmission of both subtypes from co-infection is low and therefore co-infection cannot be sustained on its own. This study suggests that influenza A viruses within co-infected patients can interact in some ways rather than transmit independently, and this can enhance the spread of influenza A virus infection.

Force transmissibility versus displacement transmissibility

NASA Astrophysics Data System (ADS)

Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

2014-10-01

It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this novel approach significantly decreases the computational effort when compared to conventional approaches, as it requires only local information of the sets of coordinates involved. Numerical simulations and experimental examples are presented and discussed, to illustrate the proposed developments.

Analisis parametrico de las variables que influyen en el comportamiento adherente de las armaduras pretesas en el hormigon

NASA Astrophysics Data System (ADS)

Arbelaez Jaramillo, Cesar Augusto

Prestressed concrete technique through the use of prestressed reinforcement is extended in the precast concrete industry. This technique consists on casting a concrete element over a previously prestressed reinforcement, proceeding to release once the concrete has reached a determined strength so the prestressed stress introduced to the reinforcement be transmitted, by bond, to concrete. The bond behaviour of prestressed reinforcement includes two phenomena: prestress transmission from the reinforcement to concrete and anchorage of the reinforcement. This bond behaviour is characterized by mean of two lengths: transmission length and anchorage length. The good design of these lengths is a basic and fundamental aspect in the project of precast prestressed concrete elements to guaranty the appropriate transmission of prestress and to allow the anchorage of the reinforcement along the structural element service life. The influence of the parameters related to the concrete dosage on the transmission and anchorage lengths of prestressing strands have been analyzed. The ECADA test method has been applied. With this method the operations of transmission of prestress and anchorage of the reinforcement are sequentially done. The transmission and anchorage lengths are determined from the force control supported by the reinforcement testing series of specimens with different embedment lengths. The differentiation of the concepts of anchorage length without slips and with slips has been proposed. The relationship of the parameters of dosage with the bond stress and the registered slips during the processes of transmission and anchorage has been studied. Expressions to value the slips distribution of the reinforcement in the transmission zone and in the anchorage zone have been proposed. A study on the determination of the transmission length from the free reinforcement slip end has been done and the viability to experimentally determine the transmission length from the slips sequence in the pull-out end as a function of the embedment length has been verified. The experimental results have been compared with results and predictions from other authors and standards, and an expression to calculate the transmission length have been proposed. Finally, the bond behaviour of self-compacting concretes has been compared with the bond behaviour of traditional concretes.

49 CFR Appendix E to Part 192 - Guidance on Determining High Consequence Areas and on Carrying out Requirements in the Integrity...

Code of Federal Regulations, 2010 CFR

2010-10-01

... addressing time dependent and independent threats for a transmission pipeline operating below 30% SMYS not in... pipeline system are covered for purposes of the integrity management program requirements, an operator must... system, or an operator may apply one method to individual portions of the pipeline system. (Refer to...

Research on the detection system of liquid concentration base on birefringence light transmission method

NASA Astrophysics Data System (ADS)

Li, Tianze; Zhang, Xia; Hou, Luan; Jiang, Chuan

2010-10-01

The characteristics of the beam transmitting in the optical fiber and the liquid medium are analyzed in this paper. On this basis, a new type of semiconductor optical position sensitive detector is used for a receiving device, a light transmission method of birefringence is presented,and a set of opto-electrical detection system which is applied to detect liquid concentration is designed. The system is mainly composed of semiconductor lasers,optical systems, Psd signal conditioning circuit, Single-chip System, A/D conversion circuit and display circuit. Through theoretical analysis and experimental simulations, the accuracy of this system has been verified. Some main factors affecting the test results are analyzed detailedly in this paper. The experiments show that the temperature drift and the light intensity have a very small impact on this system. The system has some advantages, such as the simple structure, high sensitivity, good stability, fast response time, high degree of automation, and so on. It also can achieve the real-time detection of liquid concentration conveniently and accurately. The system can be widely applied in chemical, food, pharmacy and many other industries. It has broad prospects of application.

Dynamics of a split torque helicopter transmission

NASA Astrophysics Data System (ADS)

Krantz, Timothy L.

1994-06-01

Split torque designs, proposed as alternatives to traditional planetary designs for helicopter main rotor transmissions, can save weight and be more reliable than traditional designs. This report presents the results of an analytical study of the system dynamics and performance of a split torque gearbox that uses a balance beam mechanism for load sharing. The Lagrange method was applied to develop a system of equations of motion. The mathematical model includes time-varying gear mesh stiffness, friction, and manufacturing errors. Cornell's method for calculating the stiffness of spur gear teeth was extended and applied to helical gears. The phenomenon of sidebands spaced at shaft frequencies about gear mesh fundamental frequencies was simulated by modeling total composite gear errors as sinusoid functions. Although the gearbox has symmetric geometry, the loads and motions of the two power paths differ. Friction must be considered to properly evaluate the balance beam mechanism. For the design studied, the balance beam is not an effective device for load sharing unless the coefficient of friction is less than 0.003. The complete system stiffness as represented by the stiffness matrix used in this analysis must be considered to precisely determine the optimal tooth indexing position.

Dynamics of a split torque helicopter transmission. M.S. Thesis - Cleveland State Univ.

NASA Technical Reports Server (NTRS)

Krantz, Timothy L.

1994-01-01

Split torque designs, proposed as alternatives to traditional planetary designs for helicopter main rotor transmissions, can save weight and be more reliable than traditional designs. This report presents the results of an analytical study of the system dynamics and performance of a split torque gearbox that uses a balance beam mechanism for load sharing. The Lagrange method was applied to develop a system of equations of motion. The mathematical model includes time-varying gear mesh stiffness, friction, and manufacturing errors. Cornell's method for calculating the stiffness of spur gear teeth was extended and applied to helical gears. The phenomenon of sidebands spaced at shaft frequencies about gear mesh fundamental frequencies was simulated by modeling total composite gear errors as sinusoid functions. Although the gearbox has symmetric geometry, the loads and motions of the two power paths differ. Friction must be considered to properly evaluate the balance beam mechanism. For the design studied, the balance beam is not an effective device for load sharing unless the coefficient of friction is less than 0.003. The complete system stiffness as represented by the stiffness matrix used in this analysis must be considered to precisely determine the optimal tooth indexing position.

Analysis of the static magnetic field-dependent optical transmission of Ni nanorod colloidal suspensions

NASA Astrophysics Data System (ADS)

Krämer, Florian; Gratz, Micha; Tschöpe, Andreas

2016-07-01

The magnetic field-dependent optical transmission of dilute Ni nanorod aqueous suspensions was investigated. A series of four samples of nanorods were synthesized using the AAO template method and processed to stable colloids. The distributions of their length and diameter were characterized by analysis of TEM images and revealed average diameters of ˜25 nm and different lengths in the range of 60 nm-1100 nm. The collinear magnetic and optical anisotropy was studied by static field-dependent transmission measurements of linearly polarized light parallel and perpendicular to the magnetic field direction. The experimental results were modelled assuming the field-dependent orientation distribution function of a superparamagnetic ensemble for the uniaxial ferromagnetic nanorods in liquid dispersion and extinction cross sections for longitudinal and transversal optical polarization derived from different approaches, including the electrostatic approximation and the separation of variables method, both applied to spheroidal particles, as well as finite element method simulations of spheroids and capped cylindrical particles. The extinction cross sections were compared to reveal the differences associated with the approximations of homogeneous polarization and/or particle shape. The consequences of these approximations for the quantitative analysis of magnetic field-dependent optical transmission measurements were investigated and a reliable protocol derived. Furthermore, the changes in optical cross sections induced by electromagnetic interaction between two nanorods in parallel end-to-end and side-by-side configuration as a function of their separation were studied.

Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

2008-01-01

Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

Nanoscale deformation analysis with high-resolution transmission electron microscopy and digital image correlation

DOE PAGES

Wang, Xueju; Pan, Zhipeng; Fan, Feifei; ...

2015-09-10

We present an application of the digital image correlation (DIC) method to high-resolution transmission electron microscopy (HRTEM) images for nanoscale deformation analysis. The combination of DIC and HRTEM offers both the ultrahigh spatial resolution and high displacement detection sensitivity that are not possible with other microscope-based DIC techniques. We demonstrate the accuracy and utility of the HRTEM-DIC technique through displacement and strain analysis on amorphous silicon. Two types of error sources resulting from the transmission electron microscopy (TEM) image noise and electromagnetic-lens distortions are quantitatively investigated via rigid-body translation experiments. The local and global DIC approaches are applied for themore » analysis of diffusion- and reaction-induced deformation fields in electrochemically lithiated amorphous silicon. As a result, the DIC technique coupled with HRTEM provides a new avenue for the deformation analysis of materials at the nanometer length scales.« less

Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

2009-01-01

Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

Noise correlation in PET, CT, SPECT and PET/CT data evaluated using autocorrelation function: a phantom study on data, reconstructed using FBP and OSEM.

PubMed

Razifar, Pasha; Sandström, Mattias; Schnieder, Harald; Långström, Bengt; Maripuu, Enn; Bengtsson, Ewert; Bergström, Mats

2005-08-25

Positron Emission Tomography (PET), Computed Tomography (CT), PET/CT and Single Photon Emission Tomography (SPECT) are non-invasive imaging tools used for creating two dimensional (2D) cross section images of three dimensional (3D) objects. PET and SPECT have the potential of providing functional or biochemical information by measuring distribution and kinetics of radiolabelled molecules, whereas CT visualizes X-ray density in tissues in the body. PET/CT provides fused images representing both functional and anatomical information with better precision in localization than PET alone. Images generated by these types of techniques are generally noisy, thereby impairing the imaging potential and affecting the precision in quantitative values derived from the images. It is crucial to explore and understand the properties of noise in these imaging techniques. Here we used autocorrelation function (ACF) specifically to describe noise correlation and its non-isotropic behaviour in experimentally generated images of PET, CT, PET/CT and SPECT. Experiments were performed using phantoms with different shapes. In PET and PET/CT studies, data were acquired in 2D acquisition mode and reconstructed by both analytical filter back projection (FBP) and iterative, ordered subsets expectation maximisation (OSEM) methods. In the PET/CT studies, different magnitudes of X-ray dose in the transmission were employed by using different mA settings for the X-ray tube. In the CT studies, data were acquired using different slice thickness with and without applied dose reduction function and the images were reconstructed by FBP. SPECT studies were performed in 2D, reconstructed using FBP and OSEM, using post 3D filtering. ACF images were generated from the primary images, and profiles across the ACF images were used to describe the noise correlation in different directions. The variance of noise across the images was visualised as images and with profiles across these images. The most important finding was that the pattern of noise correlation is rotation symmetric or isotropic, independent of object shape in PET and PET/CT images reconstructed using the iterative method. This is, however, not the case in FBP images when the shape of phantom is not circular. Also CT images reconstructed using FBP show the same non-isotropic pattern independent of slice thickness and utilization of care dose function. SPECT images show an isotropic correlation of the noise independent of object shape or applied reconstruction algorithm. Noise in PET/CT images was identical independent of the applied X-ray dose in the transmission part (CT), indicating that the noise from transmission with the applied doses does not propagate into the PET images showing that the noise from the emission part is dominant. The results indicate that in human studies it is possible to utilize a low dose in transmission part while maintaining the noise behaviour and the quality of the images. The combined effect of noise correlation for asymmetric objects and a varying noise variance across the image field significantly complicates the interpretation of the images when statistical methods are used, such as with statistical estimates of precision in average values, use of statistical parametric mapping methods and principal component analysis. Hence it is recommended that iterative reconstruction methods are used for such applications. However, it is possible to calculate the noise analytically in images reconstructed by FBP, while it is not possible to do the same calculation in images reconstructed by iterative methods. Therefore for performing statistical methods of analysis which depend on knowing the noise, FBP would be preferred.

Multiwavelet packet entropy and its application in transmission line fault recognition and classification.

PubMed

Liu, Zhigang; Han, Zhiwei; Zhang, Yang; Zhang, Qiaoge

2014-11-01

Multiwavelets possess better properties than traditional wavelets. Multiwavelet packet transformation has more high-frequency information. Spectral entropy can be applied as an analysis index to the complexity or uncertainty of a signal. This paper tries to define four multiwavelet packet entropies to extract the features of different transmission line faults, and uses a radial basis function (RBF) neural network to recognize and classify 10 fault types of power transmission lines. First, the preprocessing and postprocessing problems of multiwavelets are presented. Shannon entropy and Tsallis entropy are introduced, and their difference is discussed. Second, multiwavelet packet energy entropy, time entropy, Shannon singular entropy, and Tsallis singular entropy are defined as the feature extraction methods of transmission line fault signals. Third, the plan of transmission line fault recognition using multiwavelet packet entropies and an RBF neural network is proposed. Finally, the experimental results show that the plan with the four multiwavelet packet energy entropies defined in this paper achieves better performance in fault recognition. The performance with SA4 (symmetric antisymmetric) multiwavelet packet Tsallis singular entropy is the best among the combinations of different multiwavelet packets and the four multiwavelet packet entropies.

Application of the Risk-Based Early Warning Method in a Fracture-Karst Water Source, North China.

PubMed

Guo, Yongli; Wu, Qing; Li, Changsuo; Zhao, Zhenhua; Sun, Bin; He, Shiyi; Jiang, Guanghui; Zhai, Yuanzheng; Guo, Fang

2018-03-01

  The paper proposes a risk-based early warning considering characteristics of fracture-karst aquifer in North China and applied it in a super-large fracture-karst water source. Groundwater vulnerability, types of land use, water abundance, transmissivity and spatial temporal variation of groundwater quality were chosen as indexes of the method. Weights of factors were obtained by using AHP method based on relative importance of factors, maps of factors were zoned by GIS, early warning map was conducted based on extension theory with the help of GIS, ENVI+IDL. The early warning map fused five factors very well, serious and tremendous warning areas are mainly located in northwest and east with high or relatively high transmissivity and groundwater pollutant loading, and obviously deteriorated or deteriorated trend of petroleum. The early warning map warns people where more attention should be paid, and the paper guides decision making to take appropriate protection actions in different warning levels areas.

Reflection and transmission coefficients for guided waves reflected by defects in viscoelastic material plates.

PubMed

Hosten, Bernard; Moreau, Ludovic; Castaings, Michel

2007-06-01

The paper presents a Fourier transform-based signal processing procedure for quantifying the reflection and transmission coefficients and mode conversion of guided waves diffracted by defects in plates made of viscoelastic materials. The case of the S(0) Lamb wave mode incident on a notch in a Perspex plate is considered. The procedure is applied to numerical data produced by a finite element code that simulates the propagation of attenuated guided modes and their diffraction by the notch, including mode conversion. Its validity and precision are checked by the way of the energy balance computation and by comparison with results obtained using an orthogonality relation-based processing method.

General aviation aircraft interior noise problem: Some suggested solutions

NASA Technical Reports Server (NTRS)

Roskam, J.; Navaneethan, R.

1984-01-01

Laboratory investigation of sound transmission through panels and the use of modern data analysis techniques applied to actual aircraft is used to determine methods to reduce general aviation interior noise. The experimental noise reduction characteristics of stiffened flat and curved panels with damping treatment are discussed. The experimental results of double-wall panels used in the general aviation industry are given. The effects of skin panel material, fiberglass insulation and trim panel material on the noise reduction characteristics of double-wall panels are investigated. With few modifications, the classical sound transmission theory can be used to design the interior noise control treatment of aircraft. Acoustic intensity and analysis procedures are included.

Experience with Geared Propeller Drives for Aviation Engines

NASA Technical Reports Server (NTRS)

Kutzbach, K

1920-01-01

I. The development of the gear wheels: (a) bending stresses; (b) compressive stresses; (c) heating; (d) precision of manufacture. II. General arrangement of the gearing. III. Vibration in the shaft transmission. An overview is given of experience with geared propeller drives for aviation engines. The development of gear wheels is discussed with emphasis upon bending stresses, compressive stresses, heating, and precision in manufacturing. With respect to the general arrangement of gear drives for airplanes, some principal rules of mechanical engineering that apply with special force are noted. The primary vibrations in the shaft transmission are discussed. With respect to vibration, various methods for computing vibration frequency and the influence of elastic couplings are discussed.

History matching of a complex epidemiological model of human immunodeficiency virus transmission by using variance emulation.

PubMed

Andrianakis, I; Vernon, I; McCreesh, N; McKinley, T J; Oakley, J E; Nsubuga, R N; Goldstein, M; White, R G

2017-08-01

Complex stochastic models are commonplace in epidemiology, but their utility depends on their calibration to empirical data. History matching is a (pre)calibration method that has been applied successfully to complex deterministic models. In this work, we adapt history matching to stochastic models, by emulating the variance in the model outputs, and therefore accounting for its dependence on the model's input values. The method proposed is applied to a real complex epidemiological model of human immunodeficiency virus in Uganda with 22 inputs and 18 outputs, and is found to increase the efficiency of history matching, requiring 70% of the time and 43% fewer simulator evaluations compared with a previous variant of the method. The insight gained into the structure of the human immunodeficiency virus model, and the constraints placed on it, are then discussed.

Knowledge and beliefs about malaria transmission and practices for vector control in southern Mexico.

PubMed

Rodríguez, Américo David; Penilla, Rosa Patricia; Henry-Rodríguez, Mario; Hemingway, Janet; Francisco Betanzos, Angel; Hernández-Avila, Juan Eugenio

2003-01-01

To investigate the knowledge and beliefs about malaria transmission and practices for vector control in eight villages on the coastal plain of Chiapas, Mexico. A cross-sectional survey was conducted during May and June 1995 in Chiapas, Mexico. A questionnaire to investigate family structure, knowledge on malaria transmission, preventive measures and attitudes towards seeking treatment was applied to both family heads of a sample of households. Associations were analyzed by estimating odds ratios with confidence intervals and p values, using bivariate and multivariate logistic regression methods. Malaria knowledge was poor and only 48% associated malaria with mosquito bites. The perceived benefit of indoor residual spraying was associated to a reduction of mosquitoes, a reduction in the numbers of cockroaches and rats, but only 3% associated it directly with the prevention of malaria transmission. Most villagers (97.6%) agreed with the indoor residual spraying of insecticides. Ninety nine percent of villagers had mosquito bednets, 75.7% used them all year round. Other measures used by villagers to prevent mosquito bites were smoke and mosquito coils. Above 40% of villagers self-medicated when any member of the family had a fever episode, but 51% attended proper health services (community dispensary, private physician, health worker). About 61% used pesticides for agricultural or livestock purposes and 55% applied themselves. Women had a greater participation as family health promoters, with 70% of the housewives being in charge of the application of self-protection preventive measures. Educational programs aimed at increasing awareness on the participation of mosquitoes on malaria transmission could promote community participation in malaria control in the region. The English version of this paper is available too at: http://www.insp.mx/salud/index.html.

An integrated risk and vulnerability assessment framework for climate change and malaria transmission in East Africa.

PubMed

Onyango, Esther Achieng; Sahin, Oz; Awiti, Alex; Chu, Cordia; Mackey, Brendan

2016-11-11

Malaria is one of the key research concerns in climate change-health relationships. Numerous risk assessments and modelling studies provide evidence that the transmission range of malaria will expand with rising temperatures, adversely impacting on vulnerable communities in the East African highlands. While there exist multiple lines of evidence for the influence of climate change on malaria transmission, there is insufficient understanding of the complex and interdependent factors that determine the risk and vulnerability of human populations at the community level. Moreover, existing studies have had limited focus on the nature of the impacts on vulnerable communities or how well they are prepared to cope. In order to address these gaps, a systems approach was used to present an integrated risk and vulnerability assessment framework for studies of community level risk and vulnerability to malaria due to climate change. Drawing upon published literature on existing frameworks, a systems approach was applied to characterize the factors influencing the interactions between climate change and malaria transmission. This involved structural analysis to determine influential, relay, dependent and autonomous variables in order to construct a detailed causal loop conceptual model that illustrates the relationships among key variables. An integrated assessment framework that considers indicators of both biophysical and social vulnerability was proposed based on the conceptual model. A major conclusion was that this integrated assessment framework can be implemented using Bayesian Belief Networks, and applied at a community level using both quantitative and qualitative methods with stakeholder engagement. The approach enables a robust assessment of community level risk and vulnerability to malaria, along with contextually relevant and targeted adaptation strategies for dealing with malaria transmission that incorporate both scientific and community perspectives.

An enhanced multi-channel bacterial foraging optimization algorithm for MIMO communication system

NASA Astrophysics Data System (ADS)

Palanimuthu, Senthilkumar Jayalakshmi; Muthial, Chandrasekaran

2017-04-01

Channel estimation and optimisation are the main challenging tasks in Multi Input Multi Output (MIMO) wireless communication systems. In this work, a Multi-Channel Bacterial Foraging Optimization Algorithm approach is proposed for the selection of antenna in a transmission area. The main advantage of this method is, it reduces the loss of bandwidth during data transmission effectively. Here, we considered the channel estimation and optimisation for improving the transmission speed and reducing the unused bandwidth. Initially, the message is given to the input of the communication system. Then, the symbol mapping process is performed for converting the message into signals. It will be encoded based on the space-time encoding technique. Here, the single signal is divided into multiple signals and it will be given to the input of space-time precoder. Hence, the multiplexing is applied to transmission channel estimation. In this paper, the Rayleigh channel is selected based on the bandwidth range. This is the Gaussian distribution type channel. Then, the demultiplexing is applied on the obtained signal that is the reverse function of multiplexing, which splits the combined signal arriving from a medium into the original information signal. Furthermore, the long-term evolution technique is used for scheduling the time to channels during transmission. Here, the hidden Markov model technique is employed to predict the status information of the channel. Finally, the signals are decoded and the reconstructed signal is obtained after performing the scheduling process. The experimental results evaluate the performance of the proposed MIMO communication system in terms of bit error rate, mean squared error, average throughput, outage capacity and signal to interference noise ratio.

Immersion transmission ellipsometry (ITE) for the determination of orientation gradients in photoalignment layers

NASA Astrophysics Data System (ADS)

Jung, C. C.; Stumpe, J.

2014-09-01

The capability of the method of immersion transmission ellipsometry (ITE) (Jung et al. Int Patent WO, 2004/109260) to not only determine three-dimensional refractive indices in anisotropic thin films (which was already possible in the past), but even their gradients along the z-direction (perpendicular to the film plane) is investigated in this paper. It is shown that the determination of orientation gradients in deep-sub-μm films becomes possible by applying ITE in combination with reflection ellipsometry. The technique is supplemented by atomic force microscopy for measuring the film thickness. For a photo-oriented thin film, no gradient was found, as expected. For a photo-oriented film, which was subsequently annealed in a nematic liquid crystalline phase, an order was found similar to the one applied in vertically aligned nematic displays, with a tilt angle varying along the z-direction. For fresh films, gradients were only detected for the refractive index perpendicular to the film plane, as expected.

Transverse strain measurements using fiber optic grating based sensors

NASA Technical Reports Server (NTRS)

Udd, Eric (Inventor)

1998-01-01

A system and method to sense the application of transverse stress to an optical fiber which includes a light source that producing a relatively wide spectrum light beam. The light beam is reflected or transmitted off of an optical grating in the core of an optical fiber that is transversely stressed either directly or by the exposure to pressure when the fiber is bifringent so that the optical fiber responds to the pressure to transversely stress its core. When transversely stressed, the optical grating produces a reflection or transmission from the light beam that has two peaks or minimums in its frequency spectrum whose spacing and/or spread are indicative of the forces applied to the fiber. One or more detectors sense the reflection or transmissions from the optical grating to produce an output representative of the applied force. Multiple optical gratings and detectors may be employed to simultaneously measure temperature or the forces at different locations along the fiber.

Molluscicide for the control of schistosomiasis in irrigation schemes: a study in Southern Rhodesia.

PubMed

Shiff, C J; Clarke, V de V; Evans, A C; Barnish, G

1973-01-01

The development of large areas of irrigation farming in the south-eastern lowveld of Southern Rhodesia has produced the risk of severe transmission of schistosomiasis over an extent of some 30 000 ha. Control measures instituted by the Ministry of Health were primarily directed against the large and widely distributed snail populations by using molluscicides. The chemical was applied to the irrigation water by drip-feed methods once every 6-8 months. The drains, however, were treated routinely by pairs of rangers searching for snails and applying chemical where they were found. The efficacy of control operations has been assessed by longitudinal studies in children free from infection to determine the incidence of infection. The results indicate that transmission of both Schistosoma haematobium and S. mansoni has been reduced to a level below that measured in areas of the country where irrigation is not practised. The total annual cost for this work was US$ 54 800-55 500.

Morphological characterization of diesel soot agglomerates based on the Beer-Lambert law

NASA Astrophysics Data System (ADS)

Lapuerta, Magín; Martos, Francisco J.; José Expósito, Juan

2013-03-01

A new method is proposed for the determination of the number of primary particles composing soot agglomerates emitted from diesel engines as well as their individual fractal dimension. The method is based on the Beer-Lambert law and it is applied to micro-photographs taken in high resolution transmission electron microscopy. Differences in the grey levels of the images lead to a more accurate estimation of the geometry of the agglomerate (in this case radius of gyration) than other methods based exclusively on the planar projections of the agglomerates. The method was validated by applying it to different images of the same agglomerate observed from different angles of incidence, and proving that the effect of the angle of incidence is minor, contrary to other methods. Finally, the comparisons with other methods showed that the size, number of primary particles and fractal dimension (the latter depending on the particle size) are usually underestimated when only planar projections of the agglomerates are considered.

Wave Propagation in Discontinuous Media by the Scattering Matrix Method

NASA Astrophysics Data System (ADS)

Perino, A.; Orta, R.; Barla, G.

2012-09-01

Propagation of elastic waves in discontinuous media is studied in this paper by the scattering matrix method (SMM). An electromagnetic transmission line analogy is also used to set up the mathematical model. The SMM operates in the frequency domain and allows for all wave polarizations (P, SV and SH). Rock masses are examples of discontinuous media in which the discontinuities (fractures or joints) influence wave propagation. Both elastic and viscoelastic joints are considered and the latter are described by Kelvin-Voigt, Maxwell and Burgers models. Rock joints with Coulomb slip behavior are also analyzed, by applying the averaging principle of Caughy (J Appl Mech 27:640-643, 1960). The evaluation of the effects of periodic discontinuities in a homogeneous medium is presented by introducing the concept of Bloch waves. The dispersion curves of these waves are useful to explain the existence of frequency bands of strong attenuation, also in the case of lossless (perfectly elastic) structures. Simple expressions of transmission and reflection coefficients are obtained. Finally, the SMM results are compared with those computed via the distinct element method (DEM). The comparisons are performed on a medium with joints with Coulomb slip behavior and the agreement is satisfactory, although the SMM must be applied in conjunction with the equivalent linearization technique. Even if the DEM is much more general, the SMM in these simple cases is extremely faster and provides a higher physical insight.

Local sample thickness determination via scanning transmission electron microscopy defocus series.

PubMed

Beyer, A; Straubinger, R; Belz, J; Volz, K

2016-05-01

The usable aperture sizes in (scanning) transmission electron microscopy ((S)TEM) have significantly increased in the past decade due to the introduction of aberration correction. In parallel with the consequent increase of convergence angle the depth of focus has decreased severely and optical sectioning in the STEM became feasible. Here we apply STEM defocus series to derive the local sample thickness of a TEM sample. To this end experimental as well as simulated defocus series of thin Si foils were acquired. The systematic blurring of high resolution high angle annular dark field images is quantified by evaluating the standard deviation of the image intensity for each image of a defocus series. The derived dependencies exhibit a pronounced maximum at the optimum defocus and drop to a background value for higher or lower values. The full width half maximum (FWHM) of the curve is equal to the sample thickness above a minimum thickness given by the size of the used aperture and the chromatic aberration of the microscope. The thicknesses obtained from experimental defocus series applying the proposed method are in good agreement with the values derived from other established methods. The key advantages of this method compared to others are its high spatial resolution and that it does not involve any time consuming simulations. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

Orthogonal Pilot Channel Using Combination of FDMA and CDMA in Single-Carrier FDMA-Based Evolved UTRA Uplink

NASA Astrophysics Data System (ADS)

Kawamura, Teruo; Kishiyama, Yoshihisa; Higuchi, Kenichi; Sawahashi, Mamoru

In the Evolved UTRA (UMTS Terrestrial Radio Access) uplink, single-carrier frequency division multiple access (SC-FDMA) radio access was adopted owing to its advantageous low peak-to-average power ratio (PAPR) feature, which leads to wide coverage area provisioning with limited peak transmission power of user equipments. This paper proposes orthogonal pilot channel generation using the combination of FDMA and CDMA in the SC-FDMA-based Evolved UTRA uplink. In the proposed method, we employ distributed FDMA transmission for simultaneous accessing users with different transmission bandwidths, and employ CDMA transmission for simultaneous accessing users with identical transmission bandwidth. Moreover, we apply a code sequence with a good auto-correlation property such as a Constant Amplitude Zero Auto-Correlation (CAZAC) sequence employing a cyclic shift to increase the number of sequences. Simulation results show that the average packet error rate performance using an orthogonal pilot channel with the combination of FDMA and CDMA in a six-user environment, i. e., four users each with a 1.25-MHz transmission bandwidth and two users each with a 5-MHz transmission bandwidth, employing turbo coding with the coding r of R=1/2 and QPSK and 16QAM data modulation coincides well with that in a single-user environment with the same transmission bandwidth. We show that the proposed orthogonal pilot channel structure using the combination of distributed FDMA and CDMA transmissions and the application of the CAZAC sequence is effective in the SC-FDMA-based Evolved UTRA uplink.

Transmitted wavefront testing with large dynamic range based on computer-aided deflectometry

NASA Astrophysics Data System (ADS)

Wang, Daodang; Xu, Ping; Gong, Zhidong; Xie, Zhongmin; Liang, Rongguang; Xu, Xinke; Kong, Ming; Zhao, Jun

2018-06-01

The transmitted wavefront testing technique is demanded for the performance evaluation of transmission optics and transparent glass, in which the achievable dynamic range is a key issue. A computer-aided deflectometric testing method with fringe projection is proposed for the accurate testing of transmitted wavefronts with a large dynamic range. Ray tracing of the modeled testing system is carried out to achieve the virtual ‘null’ testing of transmitted wavefront aberrations. The ray aberration is obtained from the ray tracing result and measured slope, with which the test wavefront aberration can be reconstructed. To eliminate testing system modeling errors, a system geometry calibration based on computer-aided reverse optimization is applied to realize accurate testing. Both numerical simulation and experiments have been carried out to demonstrate the feasibility and high accuracy of the proposed testing method. The proposed testing method can achieve a large dynamic range compared with the interferometric method, providing a simple, low-cost and accurate way for the testing of transmitted wavefronts from various kinds of optics and a large amount of industrial transmission elements.

Value Transmissions between Parents and Children: Gender and Developmental Phase as Transmission Belts

ERIC Educational Resources Information Center

Roest, Annette M. C.; Dubas, Judith Semon; Gerris, Jan R. M.

2010-01-01

This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and…

On the structural origins of ferroelectricity in HfO{sub 2} thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sang, Xiahan; Grimley, Everett D.; LeBeau, James M.

2015-04-20

Here, we present a structural study on the origin of ferroelectricity in Gd doped HfO{sub 2} thin films. We apply aberration corrected high-angle annular dark-field scanning transmission electron microscopy to directly determine the underlying lattice type using projected atom positions and measured lattice parameters. Furthermore, we apply nanoscale electron diffraction methods to visualize the crystal symmetry elements. Combined, the experimental results provide unambiguous evidence for the existence of a non-centrosymmetric orthorhombic phase that can support spontaneous polarization, resolving the origin of ferroelectricity in HfO{sub 2} thin films.

High-speed autofocusing of a cell using diffraction pattern

NASA Astrophysics Data System (ADS)

Oku, Hiromasa; Ishikawa, Masatoshi; Theodorus; Hashimoto, Koichi

2006-05-01

This paper proposes a new autofocusing method for observing cells under a transmission illumination. The focusing method uses a quick and simple focus estimation technique termed “depth from diffraction,” which is based on a diffraction pattern in a defocused image of a biological specimen. Since this method can estimate the focal position of the specimen from only a single defocused image, it can easily realize high-speed autofocusing. To demonstrate the method, it was applied to continuous focus tracking of a swimming paramecium, in combination with two-dimensional position tracking. Three-dimensional tracking of the paramecium for 70 s was successfully demonstrated.

Determination of dextrose in peritoneal dialysis solution by localized surface plasmon resonance technique based on silver nanoparticles formation

NASA Astrophysics Data System (ADS)

Masrournia, Mahboube; Montazarolmahdi, Maliheh; Sani, Faramarz Aliasghari

2017-07-01

Determination of dextrose in peritoneal dialysis with a method based on silver nanoparticles (AgNPs) formation was investigated. In a green chemistry method, silver nanoparticles (AgNPs) were synthesized in the natural polymeric matrix of gelatin. The nanoparticles were characterized with UV-Vis spectroscopy and transmission electron microscopy (TEM). Absorbance signal of AgNPs could be applied to determine the various concentrations of dextrose solutions. Drop wise and ultrasonic methods were used and compared with each other. The dynamic range of methods with limit of detection and relative standard deviations were obtained. Results for real sample (peritoneal dialysis) were satisfied.

Measurement of absorption and dispersion from check shot surveys

NASA Astrophysics Data System (ADS)

Ganley, D. C.; Kanasewich, E. R.

1980-10-01

The spectral ratio method for measuring absorption and also dispersion from seismic data has been examined. Corrections for frequency-dependent losses due to reflections and transmissions have been shown to be an important step in the method. Synthetic examples have been used to illustrate the method, and the method has been applied to one real data case from a sedimentary basin in the Beaufort Sea. Measured Q values were 43±2 for a depth interval of 549-1193 m and 67±6 for a depth interval of 945-1311 m. Dispersion was also measured in the data and is consistent with Futterman's model.

Dynamics of Mechanical Signal Transmission through Prestressed Stress Fibers

PubMed Central

Hwang, Yongyun; Barakat, Abdul I.

2012-01-01

Transmission of mechanical stimuli through the actin cytoskeleton has been proposed as a mechanism for rapid long-distance mechanotransduction in cells; however, a quantitative understanding of the dynamics of this transmission and the physical factors governing it remains lacking. Two key features of the actin cytoskeleton are its viscoelastic nature and the presence of prestress due to actomyosin motor activity. We develop a model of mechanical signal transmission through prestressed viscoelastic actin stress fibers that directly connect the cell surface to the nucleus. The analysis considers both temporally stationary and oscillatory mechanical signals and accounts for cytosolic drag on the stress fibers. To elucidate the physical parameters that govern mechanical signal transmission, we initially focus on the highly simplified case of a single stress fiber. The results demonstrate that the dynamics of mechanical signal transmission depend on whether the applied force leads to transverse or axial motion of the stress fiber. For transverse motion, mechanical signal transmission is dominated by prestress while fiber elasticity has a negligible effect. Conversely, signal transmission for axial motion is mediated uniquely by elasticity due to the absence of a prestress restoring force. Mechanical signal transmission is significantly delayed by stress fiber material viscosity, while cytosolic damping becomes important only for longer stress fibers. Only transverse motion yields the rapid and long-distance mechanical signal transmission dynamics observed experimentally. For simple networks of stress fibers, mechanical signals are transmitted rapidly to the nucleus when the fibers are oriented largely orthogonal to the applied force, whereas the presence of fibers parallel to the applied force slows down mechanical signal transmission significantly. The present results suggest that cytoskeletal prestress mediates rapid mechanical signal transmission and allows temporally oscillatory signals in the physiological frequency range to travel a long distance without significant decay due to material viscosity and/or cytosolic drag. PMID:22514731

Discussion of the Investigation Method on the Reaction Kinetics of Metallurgical Reaction Engineering

NASA Astrophysics Data System (ADS)

Du, Ruiling; Wu, Keng; Zhang, Jiazhi; Zhao, Yong

Reaction kinetics of metallurgical physical chemistry which was successfully applied in metallurgy (as ferrous metallurgy, non-ferrous metallurgy) became an important theoretical foundation for subject system of traditional metallurgy. Not only the research methods were very perfect, but also the independent structures and systems of it had been formed. One of the important tasks of metallurgical reaction engineering was the simulation of metallurgical process. And then, the mechanism of reaction process and the conversion time points of different control links should be obtained accurately. Therefore, the research methods and results of reaction kinetics in metallurgical physical chemistry were not very suitable for metallurgical reaction engineering. In order to provide the definite conditions of transmission, reaction kinetics parameters and the conversion time points of different control links for solving the transmission and reaction equations in metallurgical reaction engineering, a new method for researching kinetics mechanisms in metallurgical reaction engineering was proposed, which was named stepwise attempt method. Then the comparison of results between the two methods and the further development of stepwise attempt method were discussed in this paper. As a new research method for reaction kinetics in metallurgical reaction engineering, stepwise attempt method could not only satisfy the development of metallurgical reaction engineering, but also provide necessary guarantees for establishing its independent subject system.

Light modulating device

DOEpatents

Rauh, R. David; Goldner, Ronald B.

1989-01-01

In a device for transmitting light, means for controlling the transmissivity of the device, including a ceramic, reversibly electrochromic, crystalline element having a highly reflective state when injected with electrons and charge compensating ions and a highly transmissive state when the electrons and ions are removed, the crystalline element being characterized as having a reflectivity of at least 50% in the reflective state and not greater than 10% in the transmissive state, and means for modulating the crystalline element between the reflective and transmissive states by injecting ions into the crystalline element in response to an applied electrical current of a first polarity and removing the ions in response to an applied electrical current of a second polarity.

Light modulating device

DOEpatents

Rauh, R.D.; Goldner, R.B.

1989-12-26

In a device for transmitting light, means for controlling the transmissivity of the device, including a ceramic, reversibly electrochromic, crystalline element having a highly reflective state when injected with electrons and charge compensating ions and a highly transmissive state when the electrons and ions are removed, the crystalline element being characterized as having a reflectivity of at least 50% in the reflective state and not greater than 10% in the transmissive state, and means for modulating the crystalline element between the reflective and transmissive states by injecting ions into the crystalline element in response to an applied electrical current of a first polarity and removing the ions in response to an applied electrical current of a second polarity are disclosed. 1 fig.

SURVIVAL AND TRANSMISSION OF PATHOGENS IN THE ENVIRONMENT

EPA Science Inventory

To provide and apply scientific knowledge regarding the survival and transmission of pathogens in the clinical setting to their potential survival and transmission in the natural environment. Similar to the hospital environment where pathogens reside in organic debris treated wi...

Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

PubMed

Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

2016-08-05

Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV).

A modular neural network scheme applied to fault diagnosis in electric power systems.

PubMed

Flores, Agustín; Quiles, Eduardo; García, Emilio; Morant, Francisco; Correcher, Antonio

2014-01-01

This work proposes a new method for fault diagnosis in electric power systems based on neural modules. With this method the diagnosis is performed by assigning a neural module for each type of component comprising the electric power system, whether it is a transmission line, bus or transformer. The neural modules for buses and transformers comprise two diagnostic levels which take into consideration the logic states of switches and relays, both internal and back-up, with the exception of the neural module for transmission lines which also has a third diagnostic level which takes into account the oscillograms of fault voltages and currents as well as the frequency spectrums of these oscillograms, in order to verify if the transmission line had in fact been subjected to a fault. One important advantage of the diagnostic system proposed is that its implementation does not require the use of a network configurator for the system; it does not depend on the size of the power network nor does it require retraining of the neural modules if the power network increases in size, making its application possible to only one component, a specific area, or the whole context of the power system.

A Modular Neural Network Scheme Applied to Fault Diagnosis in Electric Power Systems

PubMed Central

Flores, Agustín; Morant, Francisco

2014-01-01

This work proposes a new method for fault diagnosis in electric power systems based on neural modules. With this method the diagnosis is performed by assigning a neural module for each type of component comprising the electric power system, whether it is a transmission line, bus or transformer. The neural modules for buses and transformers comprise two diagnostic levels which take into consideration the logic states of switches and relays, both internal and back-up, with the exception of the neural module for transmission lines which also has a third diagnostic level which takes into account the oscillograms of fault voltages and currents as well as the frequency spectrums of these oscillograms, in order to verify if the transmission line had in fact been subjected to a fault. One important advantage of the diagnostic system proposed is that its implementation does not require the use of a network configurator for the system; it does not depend on the size of the power network nor does it require retraining of the neural modules if the power network increases in size, making its application possible to only one component, a specific area, or the whole context of the power system. PMID:25610897

Decomposition of Composite Electric Field in a Three-Phase D-Dot Voltage Transducer Measuring System

PubMed Central

Hu, Xueqi; Wang, Jingang; Wei, Gang; Deng, Xudong

2016-01-01

In line with the wider application of non-contact voltage transducers in the engineering field, transducers are required to have better performance for different measuring environments. In the present study, the D-dot voltage transducer is further improved based on previous research in order to meet the requirements for long-distance measurement of electric transmission lines. When measuring three-phase electric transmission lines, problems such as synchronous data collection and composite electric field need to be resolved. A decomposition method is proposed with respect to the superimposed electric field generated between neighboring phases. The charge simulation method is utilized to deduce the decomposition equation of the composite electric field and the validity of the proposed method is verified by simulation calculation software. With the deduced equation as the algorithm foundation, this paper improves hardware circuits, establishes a measuring system and constructs an experimental platform for examination. Under experimental conditions, a 10 kV electric transmission line was tested for steady-state errors, and the measuring results of the transducer and the high-voltage detection head were compared. Ansoft Maxwell Stimulation Software was adopted to obtain the electric field intensity in different positions under transmission lines; its values and the measuring values of the transducer were also compared. Experimental results show that the three-phase transducer is characterized by a relatively good synchronization for data measurement, measuring results with high precision, and an error ratio within a prescribed limit. Therefore, the proposed three-phase transducer can be broadly applied and popularized in the engineering field. PMID:27754340

Sound transmission through triple-panel structures lined with poroelastic materials

NASA Astrophysics Data System (ADS)

Liu, Yu

2015-03-01

In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying appropriate types of boundary conditions for these configurations. The transmission loss of the triple-panel structures in a diffuse sound field is calculated as a function of frequency and compared with that of corresponding double-panel structures. Generally, the triple-panel structure with poroelastic linings has superior acoustic performance to the double-panel counterpart, remarkably in the mid-high frequency range and possibly at low frequencies, by selecting appropriate configurations in which those with two air gaps in the structure exhibit the best overall performance over the entire frequency range. The poroelastic lining significantly lowers the cut-on frequency above which the triple-panel structure exhibits noticeably higher transmission loss. Compared with a double-panel structure, the wider range of system parameters for a triple-panel structure due to the additional partition provides more design space for tuning the sound insulation performance. Despite the increased structural complexity, the triple-panel structure lined with poroelastic materials has the obvious advantages in sound transmission loss while without the penalties in weight and volume, and is hence a promising replacement for the widely used double-panel sandwich structure.

A novel variable baseline visibility detection system and its measurement method

NASA Astrophysics Data System (ADS)

Li, Meng; Jiang, Li-hui; Xiong, Xing-long; Zhang, Guizhong; Yao, JianQuan

2017-10-01

As an important meteorological observation instrument, the visibility meter can ensure the safety of traffic operation. However, due to the optical system contamination as well as sample error, the accuracy and stability of the equipment are difficult to meet the requirement in the low-visibility environment. To settle this matter, a novel measurement equipment was designed based upon multiple baseline, which essentially acts as an atmospheric transmission meter with movable optical receiver, applying weighted least square method to process signal. Theoretical analysis and experiments in real atmosphere environment support this technique.

Research requirements to reduce civil helicopter life cycle cost

NASA Technical Reports Server (NTRS)

Blewitt, S. J.

1978-01-01

The problem of the high cost of helicopter development, production, operation, and maintenance is defined and the cost drivers are identified. Helicopter life cycle costs would decrease by about 17 percent if currently available technology were applied. With advanced technology, a reduction of about 30 percent in helicopter life cycle costs is projected. Technological and managerial deficiencies which contribute to high costs are examined, basic research and development projects which can reduce costs include methods for reduced fuel consumption; improved turbine engines; airframe and engine production methods; safety; rotor systems; and advanced transmission systems.

A method for the detection of the refractive index of irregular shape solid pigments in light absorbing liquid matrix.

PubMed

Niskanen, Ilpo; Räty, Jukka; Peiponen, Kai-Erik

2010-06-15

The immersion liquid method is powerful for the measurement of the refractive index of solid particles in a liquid matrix. However, this method applies best for cases when the liquid matrix is transparent. A problem is usually how to assess the refractive index of a pigment when it is in a colored host liquid. In this article we introduce a method, and show that by combining so-called multifunction spectrophotometer, immersion liquid method and detection of light transmission and reflection we can assess the refractive index of a pigment in a colored liquid, and also the extinction or absorption coefficient of the host liquid.

Large-scale Scanning Transmission Electron Microscopy (Nanotomy) of Healthy and Injured Zebrafish Brain.

PubMed

Kuipers, Jeroen; Kalicharan, Ruby D; Wolters, Anouk H G; van Ham, Tjakko J; Giepmans, Ben N G

2016-05-25

Large-scale 2D electron microscopy (EM), or nanotomy, is the tissue-wide application of nanoscale resolution electron microscopy. Others and we previously applied large scale EM to human skin pancreatic islets, tissue culture and whole zebrafish larvae(1-7). Here we describe a universally applicable method for tissue-scale scanning EM for unbiased detection of sub-cellular and molecular features. Nanotomy was applied to investigate the healthy and a neurodegenerative zebrafish brain. Our method is based on standardized EM sample preparation protocols: Fixation with glutaraldehyde and osmium, followed by epoxy-resin embedding, ultrathin sectioning and mounting of ultrathin-sections on one-hole grids, followed by post staining with uranyl and lead. Large-scale 2D EM mosaic images are acquired using a scanning EM connected to an external large area scan generator using scanning transmission EM (STEM). Large scale EM images are typically ~ 5 - 50 G pixels in size, and best viewed using zoomable HTML files, which can be opened in any web browser, similar to online geographical HTML maps. This method can be applied to (human) tissue, cross sections of whole animals as well as tissue culture(1-5). Here, zebrafish brains were analyzed in a non-invasive neuronal ablation model. We visualize within a single dataset tissue, cellular and subcellular changes which can be quantified in various cell types including neurons and microglia, the brain's macrophages. In addition, nanotomy facilitates the correlation of EM with light microscopy (CLEM)(8) on the same tissue, as large surface areas previously imaged using fluorescent microscopy, can subsequently be subjected to large area EM, resulting in the nano-anatomy (nanotomy) of tissues. In all, nanotomy allows unbiased detection of features at EM level in a tissue-wide quantifiable manner.

Large-scale Scanning Transmission Electron Microscopy (Nanotomy) of Healthy and Injured Zebrafish Brain

PubMed Central

Kuipers, Jeroen; Kalicharan, Ruby D.; Wolters, Anouk H. G.

2016-01-01

Large-scale 2D electron microscopy (EM), or nanotomy, is the tissue-wide application of nanoscale resolution electron microscopy. Others and we previously applied large scale EM to human skin pancreatic islets, tissue culture and whole zebrafish larvae1-7. Here we describe a universally applicable method for tissue-scale scanning EM for unbiased detection of sub-cellular and molecular features. Nanotomy was applied to investigate the healthy and a neurodegenerative zebrafish brain. Our method is based on standardized EM sample preparation protocols: Fixation with glutaraldehyde and osmium, followed by epoxy-resin embedding, ultrathin sectioning and mounting of ultrathin-sections on one-hole grids, followed by post staining with uranyl and lead. Large-scale 2D EM mosaic images are acquired using a scanning EM connected to an external large area scan generator using scanning transmission EM (STEM). Large scale EM images are typically ~ 5 - 50 G pixels in size, and best viewed using zoomable HTML files, which can be opened in any web browser, similar to online geographical HTML maps. This method can be applied to (human) tissue, cross sections of whole animals as well as tissue culture1-5. Here, zebrafish brains were analyzed in a non-invasive neuronal ablation model. We visualize within a single dataset tissue, cellular and subcellular changes which can be quantified in various cell types including neurons and microglia, the brain's macrophages. In addition, nanotomy facilitates the correlation of EM with light microscopy (CLEM)8 on the same tissue, as large surface areas previously imaged using fluorescent microscopy, can subsequently be subjected to large area EM, resulting in the nano-anatomy (nanotomy) of tissues. In all, nanotomy allows unbiased detection of features at EM level in a tissue-wide quantifiable manner. PMID:27285162

Comparison of direct and indirect methods of measuring airborne chrysotile fibre concentration.

PubMed

Eypert-Blaison, Celine; Veissiere, Sylvie; Rastoix, Olivier; Kauffer, Edmond

2010-01-01

Transmission electron microscopy observations most frequently form a basis for estimating asbestos fibre concentration in the environment and in buildings with asbestos-containing materials. Sampled fibres can be transferred to microscope grids by applying either a direct [ISO (1995) Draft International ISO/DIS 10312. Ambient air. Determination of asbestos fibres. Direct transfer transmission electron microscopy procedure. Geneva, Switzerland: International Standardization Organization] or an indirect [AFNOR (1996) Détermination de la concentration en fibres d'amiante par microscopie électronique à transmission-Méthode indirecte. Cedex, France: AFNOR, p. 42; ISO (1997) Draft International ISO/DIS 13794. Ambient air. Determination of asbestos fibres. Indirect-transfer transmission electron microscopy procedure. Geneva, Switzerland: International Standardization Organization] method. In the latter case, ISO Standard 13794 recommends filtering calcination residues either on a polycarbonate (PC) filter (PC indirect method) or on a cellulose ester (CE) membrane (CE indirect method). The PC indirect method requires that fibres deposited on a PC filter be covered by a carbon layer, whereas in the CE indirect method, the CE membrane has to be directly processed using a method described in ISO Standard 10312. The purpose of this study was to compare results obtained using, on the one hand, direct preparation methods and, on the other hand, PC indirect or CE indirect methods, for counting asbestos fibres deposited on filters as a result of liquid filtration or air sampling. In direct method-based preparation, we observed that an etching time of 6-14 min does not affect the measured densities, except for fibres <1 microm deposited by liquid filtration. Moreover, in all cases, the direct method gives higher densities than the PC indirect method because of possible fibre disappearance when using the carbon evaporator implemented in the PC indirect method. The CE membrane used for sample preparation in the CE indirect method is collapsed prior to passing it through the carbon evaporator, so the fibres are less likely to disappear at this stage. We then note that the resulting fibre densities for chrysotile-loaded filters prepared using the direct method are close to those obtained with filters prepared using the CE indirect method. Our study therefore shows that, under the implemented experimental conditions, the PC and CE indirect preparation methods described in ISO Standard 13794 are not equivalent.

Measuring changes in transmission of neglected tropical diseases, malaria, and enteric pathogens from quantitative antibody levels

PubMed Central

van der Laan, Mark J.; Hubbard, Alan E.; Steel, Cathy; Kubofcik, Joseph; Hamlin, Katy L.; Moss, Delynn M.; Nutman, Thomas B.; Priest, Jeffrey W.; Lammie, Patrick J.

2017-01-01

Background Serological antibody levels are a sensitive marker of pathogen exposure, and advances in multiplex assays have created enormous potential for large-scale, integrated infectious disease surveillance. Most methods to analyze antibody measurements reduce quantitative antibody levels to seropositive and seronegative groups, but this can be difficult for many pathogens and may provide lower resolution information than quantitative levels. Analysis methods have predominantly maintained a single disease focus, yet integrated surveillance platforms would benefit from methodologies that work across diverse pathogens included in multiplex assays. Methods/Principal findings We developed an approach to measure changes in transmission from quantitative antibody levels that can be applied to diverse pathogens of global importance. We compared age-dependent immunoglobulin G curves in repeated cross-sectional surveys between populations with differences in transmission for multiple pathogens, including: lymphatic filariasis (Wuchereria bancrofti) measured before and after mass drug administration on Mauke, Cook Islands, malaria (Plasmodium falciparum) before and after a combined insecticide and mass drug administration intervention in the Garki project, Nigeria, and enteric protozoans (Cryptosporidium parvum, Giardia intestinalis, Entamoeba histolytica), bacteria (enterotoxigenic Escherichia coli, Salmonella spp.), and viruses (norovirus groups I and II) in children living in Haiti and the USA. Age-dependent antibody curves fit with ensemble machine learning followed a characteristic shape across pathogens that aligned with predictions from basic mechanisms of humoral immunity. Differences in pathogen transmission led to shifts in fitted antibody curves that were remarkably consistent across pathogens, assays, and populations. Mean antibody levels correlated strongly with traditional measures of transmission intensity, such as the entomological inoculation rate for P. falciparum (Spearman’s rho = 0.75). In both high- and low transmission settings, mean antibody curves revealed changes in population mean antibody levels that were masked by seroprevalence measures because changes took place above or below the seropositivity cutoff. Conclusions/Significance Age-dependent antibody curves and summary means provided a robust and sensitive measure of changes in transmission, with greatest sensitivity among young children. The method generalizes to pathogens that can be measured in high-throughput, multiplex serological assays, and scales to surveillance activities that require high spatiotemporal resolution. Our results suggest quantitative antibody levels will be particularly useful to measure differences in exposure for pathogens that elicit a transient antibody response or for monitoring populations with very high- or very low transmission, when seroprevalence is less informative. The approach represents a new opportunity to conduct integrated serological surveillance for neglected tropical diseases, malaria, and other infectious diseases with well-defined antigen targets. PMID:28542223

A Numerical Method for Obtaining Monoenergetic Neutron Flux Distributions and Transmissions in Multiple-Region Slabs

NASA Technical Reports Server (NTRS)

Schneider, Harold

1959-01-01

This method is investigated for semi-infinite multiple-slab configurations of arbitrary width, composition, and source distribution. Isotropic scattering in the laboratory system is assumed. Isotropic scattering implies that the fraction of neutrons scattered in the i(sup th) volume element or subregion that will make their next collision in the j(sup th) volume element or subregion is the same for all collisions. These so-called "transfer probabilities" between subregions are calculated and used to obtain successive-collision densities from which the flux and transmission probabilities directly follow. For a thick slab with little or no absorption, a successive-collisions technique proves impractical because an unreasonably large number of collisions must be followed in order to obtain the flux. Here the appropriate integral equation is converted into a set of linear simultaneous algebraic equations that are solved for the average total flux in each subregion. When ordinary diffusion theory applies with satisfactory precision in a portion of the multiple-slab configuration, the problem is solved by ordinary diffusion theory, but the flux is plotted only in the region of validity. The angular distribution of neutrons entering the remaining portion is determined from the known diffusion flux and the remaining region is solved by higher order theory. Several procedures for applying the numerical method are presented and discussed. To illustrate the calculational procedure, a symmetrical slab ia vacuum is worked by the numerical, Monte Carlo, and P(sub 3) spherical harmonics methods. In addition, an unsymmetrical double-slab problem is solved by the numerical and Monte Carlo methods. The numerical approach proved faster and more accurate in these examples. Adaptation of the method to anisotropic scattering in slabs is indicated, although no example is included in this paper.

Tetrahedral node for Transmission-Line Modeling (TLM) applied to Bio-heat Transfer.

PubMed

Milan, Hugo F M; Gebremedhin, Kifle G

2016-12-01

Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, parallelepipeds are used to discretize three-dimensional problems. The drawback in using parallelepiped shapes is that instead of refining only the domain of interest, a large additional domain would also have to be refined, which results in increased computational time and memory space. In this paper, we developed a tetrahedral node for TLM applied to bio-heat transfer that does not have the drawback associated with the parallelepiped node. The model includes heat source, blood perfusion, boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. The predicted temperature and heat flux were compared against results from an analytical solution and the results agreed within 2% for a mesh size of 69,941 nodes and a time step of 5ms. The method was further validated against published results of maximum skin-surface temperature difference in a breast with and without tumor and the results agreed within 6%. The published results were obtained from a model that used parallelepiped TLM node. An open source software, TLMBHT, was written using the theory developed herein and is available for download free-of-charge. Copyright © 2016 Elsevier Ltd. All rights reserved.

Estimating Drivers of Autochthonous Transmission of Chikungunya Virus in its Invasion of the Americas

PubMed Central

Perkins, T. Alex; Metcalf, C. Jessica E.; Grenfell, Bryan T.; Tatem, Andrew J.

2015-01-01

Background Chikungunya is an emerging arbovirus that has caused explosive outbreaks in Africa and Asia for decades and invaded the Americas just over a year ago. During this ongoing invasion, it has spread to 45 countries where it has been transmitted autochthonously, infecting nearly 1.3 million people in total. Methods Here, we made use of weekly, country-level case reports to infer relationships between transmission and two putative climatic drivers: temperature and precipitation averaged across each country on a monthly basis. To do so, we used a TSIR model that enabled us to infer a parametric relationship between climatic drivers and transmission potential, and we applied a new method for incorporating a probabilistic description of the serial interval distribution into the TSIR framework. Results We found significant relationships between transmission and linear and quadratic terms for temperature and precipitation and a linear term for log incidence during the previous pathogen generation. The lattermost suggests that case numbers three to four weeks ago are largely predictive of current case numbers. This effect is quite nonlinear at the country level, however, due to an estimated mixing parameter of 0.74. Relationships between transmission and the climatic variables that we estimated were biologically plausible and in line with expectations. Conclusions Our analysis suggests that autochthonous transmission of Chikungunya in the Americas can be correlated successfully with putative climatic drivers, even at the coarse scale of countries and using long-term average climate data. Overall, this provides a preliminary suggestion that successfully forecasting the future trajectory of a Chikungunya outbreak and the receptivity of virgin areas may be possible. Our results also provide tentative estimates of timeframes and areas of greatest risk, and our extension of the TSIR model provides a novel tool for modeling vector-borne disease transmission. PMID:25737803

Host species heterogeneity in the epidemiology of Nesopora caninum

PubMed Central

Pomeroy, Laura W.; Moritz, Mark; Saville, William; Wolfe, Barbara; Garabed, Rebecca

2017-01-01

Pathogen transmission across species drives disease emergence; however, mechanisms by which multi-host pathogens cross species boundaries are not well identified. This knowledge gap prevents integrated and targeted control in an epidemiologically continuous ecosystem. Our goal is to describe the impact of host species heterogeneity on the epidemiology of Neospora caninum circulating between livestock and wildlife in southeastern Ohio. We collected biological samples from Père David’s deer (Elaphurus davidianus) located at an outdoor wildlife conservation center; from cattle raised at farms adjacent to the center; and from wild white-tailed deer that roamed across farm and center boundaries. We designed nested infectious disease models of competing hypotheses about transmission and used collected data to fit the models, thereby estimating important immunological and transmission quantities which describe the species-specific contribution to the persistence of this pathogen in the community. We applied these data and models to suggest appropriate species-specific disease control methods. Results show that immunity in cattle and Pére David’s deer wanes over time, while in white-tailed deer immunity appears to be lifelong. Transmission quantities for cattle were estimated at values below the threshold for an outbreak (Rt < 1), meaning that chains of transmission are not maintained within this population and infections must occur due to reintroduction from an outside source. Pére David’s deer and white-tailed deer both could maintain continuous chains of transmission within their group (Rt > 1). Therefore, we propose that control of contact with outside sources will be useful for disease control in cattle; boosting immunity with vaccines might be an avenue to prevent infection in cattle and Père David’s deer. White-tailed deer are a potential maintenance host for infection and require further study to determine optimal control methods. Community-level investigations like this allow us to better evaluate heterogeneities in transmission processes that ultimately guide targeted control. PMID:28850580

Thermoelastic stress analysis to validate tibial fixation technique in total ankle prostheses - a pilot study.

PubMed

Ficklscherer, Andreas; Wegener, Bernd; Niethammer, Thomas; Pietschmann, Matthias F; Müller, Peter E; Jansson, Volkmar; Trouillier, Hans-Heinrich

2013-03-01

Recent literature has shown a persistently high rate of aseptic loosening of the tibial component in total ankle prostheses. We analyzed the interface between the tibial bone and tibial component with a thermoelastic stress analysis to demonstrate load transmission onto the distal tibia. In this regard, we used two established ankle prostheses, which were implanted in two human cadaveric and in two third-generation composite tibia bones (Sawbones®, Sweden). Subsequently, the bones were attached to a hydropulser and a sinusoidal load of 700 N was applied. Both prostheses had an inhomogeneous load transmission onto the distal tibia. Instead of distributing load equally to the subarticular bone, forces were focused around the bolting stem, accumulating as stress maxima with forces up to 90 MPa. Furthermore, we were able to demonstrate load transmission into the metaphysis of the bone. As demonstrated in this study, anchoring systems with stems used in all established total ankle prostheses lead to an inhomogeneous load transmission onto the distal tibia, and furthermore, to a distribution of load into the weaker metaphyseal bone. For these reasons, we favor a prosthetic design with minimal bone resection and without any stem or stem-like anchoring system, which facilitates a homogeneous load transmission onto the distal tibia. Thermoelastic stress analysis proved to be a fast and easy-to-perform method to visualize load transmission.

Multiband tissue classification for ultrasonic transmission tomography using spectral profile detection

NASA Astrophysics Data System (ADS)

Jeong, Jeong-Won; Kim, Tae-Seong; Shin, Dae-Chul; Do, Synho; Marmarelis, Vasilis Z.

2004-04-01

Recently it was shown that soft tissue can be differentiated with spectral unmixing and detection methods that utilize multi-band information obtained from a High-Resolution Ultrasonic Transmission Tomography (HUTT) system. In this study, we focus on tissue differentiation using the spectral target detection method based on Constrained Energy Minimization (CEM). We have developed a new tissue differentiation method called "CEM filter bank". Statistical inference on the output of each CEM filter of a filter bank is used to make a decision based on the maximum statistical significance rather than the magnitude of each CEM filter output. We validate this method through 3-D inter/intra-phantom soft tissue classification where target profiles obtained from an arbitrary single slice are used for differentiation in multiple tomographic slices. Also spectral coherence between target and object profiles of an identical tissue at different slices and phantoms is evaluated by conventional cross-correlation analysis. The performance of the proposed classifier is assessed using Receiver Operating Characteristic (ROC) analysis. Finally we apply our method to classify tiny structures inside a beef kidney such as Styrofoam balls (~1mm), chicken tissue (~5mm), and vessel-duct structures.

A Comparison of Ultrasound Tomography Methods in Circular Geometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leach, R R; Azevedo, S G; Berryman, J G

2002-01-24

Extremely high quality data was acquired using an experimental ultrasound scanner developed at Lawrence Livermore National Laboratory using a 2D ring geometry with up to 720 transmitter/receiver transducer positions. This unique geometry allows reflection and transmission modes and transmission imaging and quantification of a 3D volume using 2D slice data. Standard image reconstruction methods were applied to the data including straight-ray filtered back projection, reflection tomography, and diffraction tomography. Newer approaches were also tested such as full wave, full wave adjoint method, bent-ray filtered back projection, and full-aperture tomography. A variety of data sets were collected including a formalin-fixed humanmore » breast tissue sample, a commercial ultrasound complex breast phantom, and cylindrical objects with and without inclusions. The resulting reconstruction quality of the images ranges from poor to excellent. The method and results of this study are described including like-data reconstructions produced by different algorithms with side-by-side image comparisons. Comparisons to medical B-scan and x-ray CT scan images are also shown. Reconstruction methods with respect to image quality using resolution, noise, and quantitative accuracy, and computational efficiency metrics will also be discussed.« less

Use of an ultrasonic-acoustic technique for nondestructive evaluation of fiber composite strength

NASA Technical Reports Server (NTRS)

Vary, A.; Bowles, K. J.

1978-01-01

Details of the method used to measure the stress wave factor are described. Frequency spectra of the stress waves are analyzed in order to clarify the nature of the wave phenomena involved. The stress wave factor was measured with simple contact probes requiring only one-side access to a part. This is beneficial in nondestructive evaluations because the waves can run parallel to fiber directions and thus measure material properties in directions assumed by actual loads. The technique can be applied where conventional through transmission techniques are impractical or where more quantitative data are required. The stress wave factor was measured for a series of graphite/polyimide composite panels, and results obtained are compared with through transmission immersion ultrasonic scans.

Transmission clustering among newly diagnosed HIV patients in Chicago, 2008 to 2011: using phylogenetics to expand knowledge of regional HIV transmission patterns

PubMed Central

Lubelchek, Ronald J.; Hoehnen, Sarah C.; Hotton, Anna L.; Kincaid, Stacey L.; Barker, David E.; French, Audrey L.

2014-01-01

Introduction HIV transmission cluster analyses can inform HIV prevention efforts. We describe the first such assessment for transmission clustering among HIV patients in Chicago. Methods We performed transmission cluster analyses using HIV pol sequences from newly diagnosed patients presenting to Chicago’s largest HIV clinic between 2008 and 2011. We compared sequences via progressive pairwise alignment, using neighbor joining to construct an un-rooted phylogenetic tree. We defined clusters as >2 sequences among which each sequence had at least one partner within a genetic distance of ≤ 1.5%. We used multivariable regression to examine factors associated with clustering and used geospatial analysis to assess geographic proximity of phylogenetically clustered patients. Results We compared sequences from 920 patients; median age 35 years; 75% male; 67% Black, 23% Hispanic; 8% had a Rapid Plasma Reagin (RPR) titer ≥ 1:16 concurrent with their HIV diagnosis. We had HIV transmission risk data for 54%; 43% identified as men who have sex with men (MSM). Phylogenetic analysis demonstrated 123 patients (13%) grouped into 26 clusters, the largest having 20 members. In multivariable regression, age < 25, Black race, MSM status, male gender, higher HIV viral load, and RPR ≥ 1:16 associated with clustering. We did not observe geographic grouping of genetically clustered patients. Discussion Our results demonstrate high rates of HIV transmission clustering, without local geographic foci, among young Black MSM in Chicago. Applied prospectively, phylogenetic analyses could guide prevention efforts and help break the cycle of transmission. PMID:25321182

Coupled microstrip line transverse electromagnetic resonator model for high-field magnetic resonance imaging.

PubMed

Bogdanov, G; Ludwig, R

2002-03-01

The performance modeling of RF resonators at high magnetic fields of 4.7 T and more requires a physical approach that goes beyond conventional lumped circuit concepts. The treatment of voltages and currents as variables in time and space leads to a coupled transmission line model, whereby the electric and magnetic fields are assumed static in planes orthogonal to the length of the resonator, but wave-like along its longitudinal axis. In this work a multiconductor transmission line (MTL) model is developed and successfully applied to analyze a 12-element unloaded and loaded microstrip line transverse electromagnetic (TEM) resonator coil for animal studies. The loading involves a homogeneous cylindrical dielectric insert of variable radius and length. This model formulation is capable of estimating the resonance spectrum, field distributions, and certain types of losses in the coil, while requiring only modest computational resources. The boundary element method is adopted to compute all relevant transmission line parameters needed to set up the transmission line matrices. Both the theoretical basis and its engineering implementation are discussed and the resulting model predictions are placed in context with measurements. A comparison between a conventional lumped circuit model and this distributed formulation is conducted, showing significant departures in the resonance response at higher frequencies. This MTL model is applied to simulate two small-bore animal systems: one of 7.5-cm inner diameter, tuned to 200 MHz (4.7 T for proton imaging), and one of 13.36-cm inner diameter, tuned to both 200 and 300 MHz (7 T). Copyright 2002 Wiley-Liss, Inc.

Malaria transmission rates estimated from serological data.

PubMed Central

Burattini, M. N.; Massad, E.; Coutinho, F. A.

1993-01-01

A mathematical model was used to estimate malaria transmission rates based on serological data. The model is minimally stochastic and assumes an age-dependent force of infection for malaria. The transmission rates estimated were applied to a simple compartmental model in order to mimic the malaria transmission. The model has shown a good retrieving capacity for serological and parasite prevalence data. PMID:8270011

Analysis of the transmission of Trypanosoma cruzi infection through hosts and vectors.

PubMed

Fabrizio, María C; Schweigmann, Nicolás J; Bartoloni, Norberto J

2016-08-01

Calculating epidemiological measures of infection by Trypanosoma cruzi, the causative agent of Chagas disease, is complex, because it involves several species, different stages of infection in humans and multiple transmission routes. Using the next-generation matrix method, we analysed a model which considers the three stages of human infection, triatomines and dogs (the main domestic reservoirs of T. cruzi when triatomines are present) and the main transmission routes. We derived R 0 and type-reproduction numbers T. We deduced formulas for the number of new infections generated through each transmission route by each infected individual. We applied our findings in Argentine Gran Chaco. The expressions achieved allowed quantifying the high infectivity of dogs and emphasizing the epidemiological importance of the long and asymptomatic chronic indeterminate stage in humans in the spread of the infection. According to the model, it is expected that one infected human infects 21 triatomines, that 100 infected triatomines are necessary to infect one human and 34 to infect a dog, and that each dog infects on average one triatomine per day. Our results may allow quantifying the effect of control measures on infected humans, triatomines and dogs (or other highly infected vertebrate) or on a specific route of transmission, in other scenarios.

Effects of external and gap mean flows on sound transmission through a double-wall sandwich panel

NASA Astrophysics Data System (ADS)

Liu, Yu; Sebastian, Alexis

2015-05-01

This paper studies analytically the effects of an external mean flow and an internal gap mean flow on sound transmission through a double-wall sandwich panel lined with poroelastic materials. Biot's theory is employed to describe wave propagation in poroelastic materials, and the transfer matrix method with three types of boundary conditions is applied to solve the system simultaneously. The random incidence transmission loss in a diffuse field is calculated numerically, and the limiting angle of incidence due to total internal reflection is discussed in detail. The numerical predictions suggest that the sound insulation performance of such a double-wall panel is enhanced considerably by both external and gap mean flows particularly in the high-frequency range. Similar effects on transmission loss are observed for the two mean flows. It is shown that the effect of the gap mean flow depends on flow velocity, flow direction, gap depth and fluid properties and also that the fluid properties within the gap appear to influence the transmission loss more effectively than the gap flow. Despite the implementation difficulty in practice, an internal gap flow provides more design space for tuning the sound insulation performance of a double-wall sandwich panel and has great potential for active/passive noise control.

No Substantial Evidence for Sexual Transmission of Minority HIV Drug Resistance Mutations in Men Who Have Sex with Men.

PubMed

Chaillon, Antoine; Nakazawa, Masato; Wertheim, Joel O; Little, Susan J; Smith, Davey M; Mehta, Sanjay R; Gianella, Sara

2017-11-01

During primary HIV infection, the presence of minority drug resistance mutations (DRM) may be a consequence of sexual transmission, de novo mutations, or technical errors in identification. Baseline blood samples were collected from 24 HIV-infected antiretroviral-naive, genetically and epidemiologically linked source and recipient partners shortly after the recipient's estimated date of infection. An additional 32 longitudinal samples were available from 11 recipients. Deep sequencing of HIV reverse transcriptase (RT) was performed (Roche/454), and the sequences were screened for nucleoside and nonnucleoside RT inhibitor DRM. The likelihood of sexual transmission and persistence of DRM was assessed using Bayesian-based statistical modeling. While the majority of DRM (>20%) were consistently transmitted from source to recipient, the probability of detecting a minority DRM in the recipient was not increased when the same minority DRM was detected in the source (Bayes factor [BF] = 6.37). Longitudinal analyses revealed an exponential decay of DRM (BF = 0.05) while genetic diversity increased. Our analysis revealed no substantial evidence for sexual transmission of minority DRM (BF = 0.02). The presence of minority DRM during early infection, followed by a rapid decay, is consistent with the "mutation-selection balance" hypothesis, in which deleterious mutations are more efficiently purged later during HIV infection when the larger effective population size allows more efficient selection. Future studies using more recent sequencing technologies that are less prone to single-base errors should confirm these results by applying a similar Bayesian framework in other clinical settings. IMPORTANCE The advent of sensitive sequencing platforms has led to an increased identification of minority drug resistance mutations (DRM), including among antiretroviral therapy-naive HIV-infected individuals. While transmission of DRM may impact future therapy options for newly infected individuals, the clinical significance of the detection of minority DRM remains controversial. In the present study, we applied deep-sequencing techniques within a Bayesian hierarchical framework to a cohort of 24 transmission pairs to investigate whether minority DRM detected shortly after transmission were the consequence of (i) sexual transmission from the source, (ii) de novo emergence shortly after infection followed by viral selection and evolution, or (iii) technical errors/limitations of deep-sequencing methods. We found no clear evidence to support the sexual transmission of minority resistant variants, and our results suggested that minor resistant variants may emerge de novo shortly after transmission, when the small effective population size limits efficient purge by natural selection. Copyright © 2017 American Society for Microbiology.

Simultaneous compression and encryption for secure real-time secure transmission of sensitive video transmission

NASA Astrophysics Data System (ADS)

Al-Hayani, Nazar; Al-Jawad, Naseer; Jassim, Sabah A.

2014-05-01

Video compression and encryption became very essential in a secured real time video transmission. Applying both techniques simultaneously is one of the challenges where the size and the quality are important in multimedia transmission. In this paper we proposed a new technique for video compression and encryption. Both encryption and compression are based on edges extracted from the high frequency sub-bands of wavelet decomposition. The compression algorithm based on hybrid of: discrete wavelet transforms, discrete cosine transform, vector quantization, wavelet based edge detection, and phase sensing. The compression encoding algorithm treats the video reference and non-reference frames in two different ways. The encryption algorithm utilized A5 cipher combined with chaotic logistic map to encrypt the significant parameters and wavelet coefficients. Both algorithms can be applied simultaneously after applying the discrete wavelet transform on each individual frame. Experimental results show that the proposed algorithms have the following features: high compression, acceptable quality, and resistance to the statistical and bruteforce attack with low computational processing.

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 47 Telecommunication 5 2011-10-01 2011-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 47 Telecommunication 5 2010-10-01 2010-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 47 Telecommunication 5 2012-10-01 2012-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 47 Telecommunication 5 2014-10-01 2014-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 47 Telecommunication 5 2013-10-01 2013-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

A new approach for beam hardening correction based on the local spectrum distributions

NASA Astrophysics Data System (ADS)

Rasoulpour, Naser; Kamali-Asl, Alireza; Hemmati, Hamidreza

2015-09-01

Energy dependence of material absorption and polychromatic nature of x-ray beams in the Computed Tomography (CT) causes a phenomenon which called "beam hardening". The purpose of this study is to provide a novel approach for Beam Hardening (BH) correction. This approach is based on the linear attenuation coefficients of Local Spectrum Distributions (LSDs) in the various depths of a phantom. The proposed method includes two steps. Firstly, the hardened spectra in various depths of the phantom (or LSDs) are estimated based on the Expectation Maximization (EM) algorithm for arbitrary thickness interval of known materials in the phantom. The performance of LSD estimation technique is evaluated by applying random Gaussian noise to transmission data. Then, the linear attenuation coefficients with regarding to the mean energy of LSDs are obtained. Secondly, a correction function based on the calculated attenuation coefficients is derived in order to correct polychromatic raw data. Since a correction function has been used for the conversion of the polychromatic data to the monochromatic data, the effect of BH in proposed reconstruction must be reduced in comparison with polychromatic reconstruction. The proposed approach has been assessed in the phantoms which involve less than two materials, but the correction function has been extended for using in the constructed phantoms with more than two materials. The relative mean energy difference in the LSDs estimations based on the noise-free transmission data was less than 1.5%. Also, it shows an acceptable value when a random Gaussian noise is applied to the transmission data. The amount of cupping artifact in the proposed reconstruction method has been effectively reduced and proposed reconstruction profile is uniform more than polychromatic reconstruction profile.

Parallel transmit beamforming using orthogonal frequency division multiplexing applied to harmonic imaging--a feasibility study.

PubMed

Demi, Libertario; Verweij, Martin D; Van Dongen, Koen W A

2012-11-01

Real-time 2-D or 3-D ultrasound imaging systems are currently used for medical diagnosis. To achieve the required data acquisition rate, these systems rely on parallel beamforming, i.e., a single wide-angled beam is used for transmission and several narrow parallel beams are used for reception. When applied to harmonic imaging, the demand for high-amplitude pressure wave fields, necessary to generate the harmonic components, conflicts with the use of a wide-angled beam in transmission because this results in a large spatial decay of the acoustic pressure. To enhance the amplitude of the harmonics, it is preferable to do the reverse: transmit several narrow parallel beams and use a wide-angled beam in reception. Here, this concept is investigated to determine whether it can be used for harmonic imaging. The method proposed in this paper relies on orthogonal frequency division multiplexing (OFDM), which is used to create distinctive parallel beams in transmission. To test the proposed method, a numerical study has been performed, in which the transmit, receive, and combined beam profiles generated by a linear array have been simulated for the second-harmonic component. Compared with standard parallel beamforming, application of the proposed technique results in a gain of 12 dB for the main beam and in a reduction of the side lobes. Experimental verification in water has also been performed. Measurements obtained with a single-element emitting transducer and a hydrophone receiver confirm the possibility of exciting a practical ultrasound transducer with multiple Gaussian modulated pulses, each having a different center frequency, and the capability to generate distinguishable second-harmonic components.

Continental-scale, data-driven predictive assessment of eliminating the vector-borne disease, lymphatic filariasis, in sub-Saharan Africa by 2020.

PubMed

Michael, Edwin; Singh, Brajendra K; Mayala, Benjamin K; Smith, Morgan E; Hampton, Scott; Nabrzyski, Jaroslaw

2017-09-27

There are growing demands for predicting the prospects of achieving the global elimination of neglected tropical diseases as a result of the institution of large-scale nation-wide intervention programs by the WHO-set target year of 2020. Such predictions will be uncertain due to the impacts that spatial heterogeneity and scaling effects will have on parasite transmission processes, which will introduce significant aggregation errors into any attempt aiming to predict the outcomes of interventions at the broader spatial levels relevant to policy making. We describe a modeling platform that addresses this problem of upscaling from local settings to facilitate predictions at regional levels by the discovery and use of locality-specific transmission models, and we illustrate the utility of using this approach to evaluate the prospects for eliminating the vector-borne disease, lymphatic filariasis (LF), in sub-Saharan Africa by the WHO target year of 2020 using currently applied or newly proposed intervention strategies. METHODS AND RESULTS: We show how a computational platform that couples site-specific data discovery with model fitting and calibration can allow both learning of local LF transmission models and simulations of the impact of interventions that take a fuller account of the fine-scale heterogeneous transmission of this parasitic disease within endemic countries. We highlight how such a spatially hierarchical modeling tool that incorporates actual data regarding the roll-out of national drug treatment programs and spatial variability in infection patterns into the modeling process can produce more realistic predictions of timelines to LF elimination at coarse spatial scales, ranging from district to country to continental levels. Our results show that when locally applicable extinction thresholds are used, only three countries are likely to meet the goal of LF elimination by 2020 using currently applied mass drug treatments, and that switching to more intensive drug regimens, increasing the frequency of treatments, or switching to new triple drug regimens will be required if LF elimination is to be accelerated in Africa. The proportion of countries that would meet the goal of eliminating LF by 2020 may, however, reach up to 24/36 if the WHO 1% microfilaremia prevalence threshold is used and sequential mass drug deliveries are applied in countries. We have developed and applied a data-driven spatially hierarchical computational platform that uses the discovery of locally applicable transmission models in order to predict the prospects for eliminating the macroparasitic disease, LF, at the coarser country level in sub-Saharan Africa. We show that fine-scale spatial heterogeneity in local parasite transmission and extinction dynamics, as well as the exact nature of intervention roll-outs in countries, will impact the timelines to achieving national LF elimination on this continent.

Hybrid particle traps and conditioning procedure for gas insulated transmission lines

DOEpatents

Dale, Steinar J.; Cookson, Alan H.

1982-01-01

A gas insulated transmission line includes an outer sheath, an inner condor within the outer sheath, insulating supports supporting the inner conductor within the outer sheath, and an insulating gas electrically insulating the inner conductor from the outer sheath. An apertured particle trapping ring is disposed within the outer sheath, and the trapping ring has a pair of dielectric members secured at each longitudinal end thereof, with the dielectric members extending outwardly from the trapping ring along an arc. A support sheet having an adhesive coating thereon is secured to the trapping ring and disposed on the outer sheath within the low field region formed between the trapping ring and the outer sheath. A conditioning method used to condition the transmission line prior to activation in service comprises applying an AC voltage to the inner conductor in a plurality of voltage-time steps, with the voltage-time steps increasing in voltage magnitude while decreasing in time duration.

Strain-specific estimation of epidemic success provides insights into the transmission dynamics of tuberculosis

PubMed Central

Rasigade, Jean-Philippe; Barbier, Maxime; Dumitrescu, Oana; Pichat, Catherine; Carret, Gérard; Ronnaux-Baron, Anne-Sophie; Blasquez, Ghislaine; Godin-Benhaim, Christine; Boisset, Sandrine; Carricajo, Anne; Jacomo, Véronique; Fredenucci, Isabelle; Pérouse de Montclos, Michèle; Flandrois, Jean-Pierre; Ader, Florence; Supply, Philip; Lina, Gérard; Wirth, Thierry

2017-01-01

The transmission dynamics of tuberculosis involves complex interactions of socio-economic and, possibly, microbiological factors. We describe an analytical framework to infer factors of epidemic success based on the joint analysis of epidemiological, clinical and pathogen genetic data. We derive isolate-specific, genetic distance-based estimates of epidemic success, and we represent success-related time-dependent concepts, namely epidemicity and endemicity, by restricting analysis to specific time scales. The method is applied to analyze a surveillance-based cohort of 1,641 tuberculosis patients with minisatellite-based isolate genotypes. Known predictors of isolate endemicity (older age, native status) and epidemicity (younger age, sputum smear positivity) were identified with high confidence (P < 0.001). Long-term epidemic success also correlated with the ability of Euro-American and Beijing MTBC lineages to cause active pulmonary infection, independent of patient age and country of origin. Our results demonstrate how important insights into the transmission dynamics of tuberculosis can be gained from active surveillance data. PMID:28349973

Development of Control System for Hydrolysis Crystallization Process

NASA Astrophysics Data System (ADS)

Wan, Feng; Shi, Xiao-Ming; Feng, Fang-Fang

2016-05-01

Sulfate method for producing titanium dioxide is commonly used in China, but the determination of crystallization time is artificially which leads to a big error and is harmful to the operators. In this paper a new method for determining crystallization time is proposed. The method adopts the red laser as the light source, uses the silicon photocell as reflection light receiving component, using optical fiber as the light transmission element, differential algorithm is adopted in the software to realize the determination of the crystallizing time. The experimental results show that the method can realize the determination of crystallization point automatically and accurately, can replace manual labor and protect the health of workers, can be applied to practice completely.

MTF measurement of LCDs by a linear CCD imager: I. Monochrome case

NASA Astrophysics Data System (ADS)

Kim, Tae-hee; Choe, O. S.; Lee, Yun Woo; Cho, Hyun-Mo; Lee, In Won

1997-11-01

We construct the modulation transfer function (MTF) measurement system of a LCD using a linear charge-coupled device (CCD) imager. The MTF used in optical system can not describe in the effect of both resolution and contrast on the image quality of display. Thus we present the new measurement method based on the transmission property of a LCD. While controlling contrast and brightness levels, the MTF is measured. From the result, we show that the method is useful for describing of the image quality. A ne measurement method and its condition are described. To demonstrate validity, the method is applied for comparison of the performance of two different LCDs.

Calling depths of baleen whales from single sensor data: development of an autocorrelation method using multipath localization.

PubMed

Valtierra, Robert D; Glynn Holt, R; Cholewiak, Danielle; Van Parijs, Sofie M

2013-09-01

Multipath localization techniques have not previously been applied to baleen whale vocalizations due to difficulties in application to tonal vocalizations. Here it is shown that an autocorrelation method coupled with the direct reflected time difference of arrival localization technique can successfully resolve location information. A derivation was made to model the autocorrelation of a direct signal and its overlapping reflections to illustrate that an autocorrelation may be used to extract reflection information from longer duration signals containing a frequency sweep, such as some calls produced by baleen whales. An analysis was performed to characterize the difference in behavior of the autocorrelation when applied to call types with varying parameters (sweep rate, call duration). The method's feasibility was tested using data from playback transmissions to localize an acoustic transducer at a known depth and location. The method was then used to estimate the depth and range of a single North Atlantic right whale (Eubalaena glacialis) and humpback whale (Megaptera novaeangliae) from two separate experiments.

Control of Plasmodium knowlesi malaria

NASA Astrophysics Data System (ADS)

Abdullahi, Mohammed Baba; Hasan, Yahya Abu; Abdullah, Farah Aini

2015-10-01

The most significant and efficient measures against Plasmodium knowlesi outbreaks are efficient anti malaria drug, biological control in form of predatory mosquitoes and culling control strategies. In this paper optimal control theory is applied to a system of ordinary differential equation. It describes the disease transmission and Pontryagin's Maximum Principle is applied for analysis of the control. To this end, three control strategies representing biological control, culling and treatment were incorporated into the disease transmission model. The simulation results show that the implementation of the combination strategy during the epidemic is the most cost-effective strategy for disease transmission.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogura, Toshihiko, E-mail: t-ogura@aist.go.jp

Highlights: • We developed a high-sensitive frequency transmission electric-field (FTE) system. • The output signal was highly enhanced by applying voltage to a metal layer on SiN. • The spatial resolution of new FTE method is 41 nm. • New FTE system enables observation of the intact bacteria and virus in water. - Abstract: The high-resolution structural analysis of biological specimens by scanning electron microscopy (SEM) presents several advantages. Until now, wet bacterial specimens have been examined using atmospheric sample holders. However, images of unstained specimens in water using these holders exhibit very poor contrast and heavy radiation damage. Recently,more » we developed the frequency transmission electric-field (FTE) method, which facilitates the SEM observation of biological specimens in water without radiation damage. However, the signal detection system presents low sensitivity. Therefore, a high EB current is required to generate clear images, and thus reducing spatial resolution and inducing thermal damage to the samples. Here a high-sensitivity detection system is developed for the FTE method, which enhances the output signal amplitude by hundredfold. The detection signal was highly enhanced when voltage was applied to the metal layer on silicon nitride thin film. This enhancement reduced the EB current and improved the spatial resolution as well as the signal-to-noise ratio. The spatial resolution of a high-sensitive FTE system is 41 nm, which is considerably higher than previous FTE system. New FTE system can easily be utilised to examine various unstained biological specimens in water, such as living bacteria and viruses.« less

Computational fluid dynamics and frequency-dependent finite-difference time-domain method coupling for the interaction between microwaves and plasma in rocket plumes

NASA Astrophysics Data System (ADS)

Kinefuchi, K.; Funaki, I.; Shimada, T.; Abe, T.

2012-10-01

Under certain conditions during rocket flights, ionized exhaust plumes from solid rocket motors may interfere with radio frequency transmissions. To understand the relevant physical processes involved in this phenomenon and establish a prediction process for in-flight attenuation levels, we attempted to measure microwave attenuation caused by rocket exhaust plumes in a sea-level static firing test for a full-scale solid propellant rocket motor. The microwave attenuation level was calculated by a coupling simulation of the inviscid-frozen-flow computational fluid dynamics of an exhaust plume and detailed analysis of microwave transmissions by applying a frequency-dependent finite-difference time-domain method with the Drude dispersion model. The calculated microwave attenuation level agreed well with the experimental results, except in the case of interference downstream the Mach disk in the exhaust plume. It was concluded that the coupling estimation method based on the physics of the frozen plasma flow with Drude dispersion would be suitable for actual flight conditions, although the mixing and afterburning in the plume should be considered depending on the flow condition.

Transmission overhaul estimates for partial and full replacement at repair

NASA Technical Reports Server (NTRS)

Savage, M.; Lewicki, D. G.

1991-01-01

Timely transmission overhauls increase in-flight service reliability greater than the calculated design reliabilities of the individual aircraft transmission components. Although necessary for aircraft safety, transmission overhauls contribute significantly to aircraft expense. Predictions of a transmission's maintenance needs at the design stage should enable the development of more cost effective and reliable transmissions in the future. The frequency is estimated of overhaul along with the number of transmissions or components needed to support the overhaul schedule. Two methods based on the two parameter Weibull statistical distribution for component life are used to estimate the time between transmission overhauls. These methods predict transmission lives for maintenance schedules which repair the transmission with a complete system replacement or repair only failed components of the transmission. An example illustrates the methods.

Implementation of Particle Swarm Optimization Method for Voltage Stability Analysis in 150 kV Sub System Grati – Paiton East Java

NASA Astrophysics Data System (ADS)

Kusumaningtyas, A. B.; Hidayat, M. N.; Ronilaya, F.

2018-04-01

Based on the data from State Electric Company on 15 January 2013, the undistributed power in the 150 kV sub system Grati-Paiton Region IV, that consist of 26 bus 150 kV and 2 bus generation 500 kV system, was recorded 3.286,00 MW. At the same time, the frequency of the system was down to 49 Hz. This lead to a deficit generation and unstable voltage condition in the system. Fast Voltage Stability Index (FVSI) method is used in this research to analyze the voltage stability of the buses. For buses with unstable voltage condition, reactive power will be injected through capacitor installation. The site where the capacitor will be installed is determined using the Fast Voltage Stability Index (FVSI) method while the size of the capacitor is determined using the Particle Swarm Optimization (PSO) method. The PSO method has been applied in some researches, such as to determine optimal placement and sizing in radial distribution network as well as in transmission network.. In this research, the PSO method is used to find the Qloss of an interconnection transmission system, which in turn, the value of the Qloss is used to determine the capacitance of the capacitor needed by the system.

Dynamic Transmit-Receive Beamforming by Spatial Matched Filtering for Ultrasound Imaging with Plane Wave Transmission.

PubMed

Chen, Yuling; Lou, Yang; Yen, Jesse

2017-07-01

During conventional ultrasound imaging, the need for multiple transmissions for one image and the time of flight for a desired imaging depth limit the frame rate of the system. Using a single plane wave pulse during each transmission followed by parallel receive processing allows for high frame rate imaging. However, image quality is degraded because of the lack of transmit focusing. Beamforming by spatial matched filtering (SMF) is a promising method which focuses ultrasonic energy using spatial filters constructed from the transmit-receive impulse response of the system. Studies by other researchers have shown that SMF beamforming can provide dynamic transmit-receive focusing throughout the field of view. In this paper, we apply SMF beamforming to plane wave transmissions (PWTs) to achieve both dynamic transmit-receive focusing at all imaging depths and high imaging frame rate (>5000 frames per second). We demonstrated the capability of the combined method (PWT + SMF) of achieving two-way focusing mathematically through analysis based on the narrowband Rayleigh-Sommerfeld diffraction theory. Moreover, the broadband performance of PWT + SMF was quantified in terms of lateral resolution and contrast from both computer simulations and experimental data. Results were compared between SMF beamforming and conventional delay-and-sum (DAS) beamforming in both simulations and experiments. At an imaging depth of 40 mm, simulation results showed a 29% lateral resolution improvement and a 160% contrast improvement with PWT + SMF. These improvements were 17% and 48% for experimental data with noise.

Reciprocity principle for scattered fields from discontinuities in waveguides.

PubMed

Pau, Annamaria; Capecchi, Danilo; Vestroni, Fabrizio

2015-01-01

This study investigates the scattering of guided waves from a discontinuity exploiting the principle of reciprocity in elastodynamics, written in a form that applies to waveguides. The coefficients of reflection and transmission for an arbitrary mode can be derived as long as the principle of reciprocity is satisfied at the discontinuity. Two elastodynamic states are related by the reciprocity. One is the response of the waveguide in the presence of the discontinuity, with the scattered fields expressed as a superposition of wave modes. The other state is the response of the waveguide in the absence of the discontinuity oscillating according to an arbitrary mode. The semi-analytical finite element method is applied to derive the needed dispersion relation and wave mode shapes. An application to a solid cylinder with a symmetric double change of cross-section is presented. This model is assumed to be representative of a damaged rod. The coefficients of reflection and transmission of longitudinal waves are investigated for selected values of notch length and varying depth. Copyright © 2014 Elsevier B.V. All rights reserved.

Power flow as a complement to statistical energy analysis and finite element analysis

NASA Technical Reports Server (NTRS)

Cuschieri, J. M.

1987-01-01

Present methods of analysis of the structural response and the structure-borne transmission of vibrational energy use either finite element (FE) techniques or statistical energy analysis (SEA) methods. The FE methods are a very useful tool at low frequencies where the number of resonances involved in the analysis is rather small. On the other hand SEA methods can predict with acceptable accuracy the response and energy transmission between coupled structures at relatively high frequencies where the structural modal density is high and a statistical approach is the appropriate solution. In the mid-frequency range, a relatively large number of resonances exist which make finite element method too costly. On the other hand SEA methods can only predict an average level form. In this mid-frequency range a possible alternative is to use power flow techniques, where the input and flow of vibrational energy to excited and coupled structural components can be expressed in terms of input and transfer mobilities. This power flow technique can be extended from low to high frequencies and this can be integrated with established FE models at low frequencies and SEA models at high frequencies to form a verification of the method. This method of structural analysis using power flo and mobility methods, and its integration with SEA and FE analysis is applied to the case of two thin beams joined together at right angles.

Electrically tunable superconducting terahertz metamaterial with low insertion loss and high switchable ratios

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Chun; Zhang, Caihong, E-mail: chzhang@nju.edu.cn; Hu, Guoliang

2016-07-11

With the emergence and development of artificially structured electromagnetic materials, active terahertz (THz) metamaterial devices have attracted significant attention in recent years. Tunability of transmission is desirable for many applications. For example, short-range wireless THz communications and ultrafast THz interconnects require switches and modulators. However, the tunable range of transmission amplitude of existing THz metamaterial devices is not satisfactory. In this article, we experimentally demonstrate an electrically tunable superconducting niobium nitride metamaterial device and employ a hybrid coupling model to analyze its optical transmission characteristics. The maximum transmission coefficient at 0.507 THz is 0.98 and decreases to 0.19 when themore » applied voltage increases to 0.9 V. A relative transmittance change of 80.6% is observed, making this device an efficient narrowband THz switch. Additionally, the frequency of the peak is red shifted from 0.507 to 0.425 THz, which means that the device can be used to select the frequency. This study offers an alternative tuning method to existing optical, thermal, magnetic-field, and electric-field tuning, delivering a promising approach for designing active and miniaturized THz devices.« less

Interspecific social networks promote information transmission in wild songbirds.

PubMed

Farine, Damien R; Aplin, Lucy M; Sheldon, Ben C; Hoppitt, William

2015-03-22

Understanding the functional links between social structure and population processes is a central aim of evolutionary ecology. Multiple types of interactions can be represented by networks drawn for the same population, such as kinship, dominance or affiliative networks, but the relative importance of alternative networks in modulating population processes may not be clear. We illustrate this problem, and a solution, by developing a framework for testing the importance of different types of association in facilitating the transmission of information. We apply this framework to experimental data from wild songbirds that form mixed-species flocks, recording the arrival (patch discovery) of individuals to novel foraging sites. We tested whether intraspecific and interspecific social networks predicted the spread of information about novel food sites, and found that both contributed to transmission. The likelihood of acquiring information per unit of connection to knowledgeable individuals increased 22-fold for conspecifics, and 12-fold for heterospecifics. We also found that species varied in how much information they produced, suggesting that some species play a keystone role in winter foraging flocks. More generally, these analyses demonstrate that this method provides a powerful approach, using social networks to quantify the relative transmission rates across different social relationships.

Multivariable Time Series Prediction for the Icing Process on Overhead Power Transmission Line

PubMed Central

Li, Peng; Zhao, Na; Zhou, Donghua; Cao, Min; Li, Jingjie; Shi, Xinling

2014-01-01

The design of monitoring and predictive alarm systems is necessary for successful overhead power transmission line icing. Given the characteristics of complexity, nonlinearity, and fitfulness in the line icing process, a model based on a multivariable time series is presented here to predict the icing load of a transmission line. In this model, the time effects of micrometeorology parameters for the icing process have been analyzed. The phase-space reconstruction theory and machine learning method were then applied to establish the prediction model, which fully utilized the history of multivariable time series data in local monitoring systems to represent the mapping relationship between icing load and micrometeorology factors. Relevant to the characteristic of fitfulness in line icing, the simulations were carried out during the same icing process or different process to test the model's prediction precision and robustness. According to the simulation results for the Tao-Luo-Xiong Transmission Line, this model demonstrates a good accuracy of prediction in different process, if the prediction length is less than two hours, and would be helpful for power grid departments when deciding to take action in advance to address potential icing disasters. PMID:25136653

An efficient and cost-effective method for preparing transmission electron microscopy samples from powders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wen, Haiming; Lin, Yaojun; Seidman, David N.

The preparation of transmission electron microcopy (TEM) samples from powders with particle sizes larger than ~100 nm poses a challenge. The existing methods are complicated and expensive, or have a low probability of success. Herein, we report a modified methodology for preparation of TEM samples from powders, which is efficient, cost-effective, and easy to perform. This method involves mixing powders with an epoxy on a piece of weighing paper, curing the powder–epoxy mixture to form a bulk material, grinding the bulk to obtain a thin foil, punching TEM discs from the foil, dimpling the discs, and ion milling the dimpledmore » discs to electron transparency. Compared with the well established and robust grinding–dimpling–ion-milling method for TEM sample preparation for bulk materials, our modified approach for preparing TEM samples from powders only requires two additional simple steps. In this article, step-by-step procedures for our methodology are described in detail, and important strategies to ensure success are elucidated. Furthermore, our methodology has been applied successfully for preparing TEM samples with large thin areas and high quality for many different mechanically milled metallic powders.« less

An efficient and cost-effective method for preparing transmission electron microscopy samples from powders

DOE PAGES

Wen, Haiming; Lin, Yaojun; Seidman, David N.; ...

2015-09-09

The preparation of transmission electron microcopy (TEM) samples from powders with particle sizes larger than ~100 nm poses a challenge. The existing methods are complicated and expensive, or have a low probability of success. Herein, we report a modified methodology for preparation of TEM samples from powders, which is efficient, cost-effective, and easy to perform. This method involves mixing powders with an epoxy on a piece of weighing paper, curing the powder–epoxy mixture to form a bulk material, grinding the bulk to obtain a thin foil, punching TEM discs from the foil, dimpling the discs, and ion milling the dimpledmore » discs to electron transparency. Compared with the well established and robust grinding–dimpling–ion-milling method for TEM sample preparation for bulk materials, our modified approach for preparing TEM samples from powders only requires two additional simple steps. In this article, step-by-step procedures for our methodology are described in detail, and important strategies to ensure success are elucidated. Furthermore, our methodology has been applied successfully for preparing TEM samples with large thin areas and high quality for many different mechanically milled metallic powders.« less

[Focus on the role of ventilation and ultraviolet rays in preventing nosocomial transmission of tuberculosis in health care facilities. Groupe de travail sur la prévention de la transmission nosocomiale de la tuberculose (Direction Générale de la Santé)].

PubMed

Desenclos, J C; Abiteboul, D; Bouvet, E; Brucker, G; Demeulemester, R; Haury, B; Huré, P; Leprince, A; Macrez, A; Mayaud, C

1995-01-01

Recent episodes of nosocomial tuberculosis, sometimes due to multiresistant strains, in HIV infected patients in the USA has led to the need for new prevention measures against the transmission of Mycobacterium tuberculosis in health care facilities. Tuberculosis is transmitted in Pflügge droplets generated when contagious persons cough. After drying, the droplets become aerosolized solid particles which are rapidly dispersed by air flow within the patient's room. People exposed to the same air are thus at high risk of being contaminated. If the air pressure in the patient's room is higher than the rest of the facility, the air coming form the room may contaminate personnel and other patients elsewhere in the facility. Infecting particles can be eliminated rapidly if the room air is ventilated outdoors. If the ventilation is strong enough so that air constantly circulates from the corridor into the room, infecting particles can no longer diffuse to the rest of the ward. It is also possible to use ultraviolet C light to disinfect the air, either within the room or within the ventilation system. These two basically simple systems are the fundamental environmental and prevention measures needed to limit tuberculosis spread in health care facilities. These methods are however technically complex, costly and require constant evaluation and maintenance by specialized personnel. In addition the potential side effects of ultraviolet waves could considerably reduce their application. These environmental methods, which are complementary methods, only have a meaning if the elementary measures for preventing the transmission of tuberculosis are correctly applied.(ABSTRACT TRUNCATED AT 250 WORDS)

Spectral response model for a multibin photon-counting spectral computed tomography detector and its applications.

PubMed

Liu, Xuejin; Persson, Mats; Bornefalk, Hans; Karlsson, Staffan; Xu, Cheng; Danielsson, Mats; Huber, Ben

2015-07-01

Variations among detector channels in computed tomography can lead to ring artifacts in the reconstructed images and biased estimates in projection-based material decomposition. Typically, the ring artifacts are corrected by compensation methods based on flat fielding, where transmission measurements are required for a number of material-thickness combinations. Phantoms used in these methods can be rather complex and require an extensive number of transmission measurements. Moreover, material decomposition needs knowledge of the individual response of each detector channel to account for the detector inhomogeneities. For this purpose, we have developed a spectral response model that binwise predicts the response of a multibin photon-counting detector individually for each detector channel. The spectral response model is performed in two steps. The first step employs a forward model to predict the expected numbers of photon counts, taking into account parameters such as the incident x-ray spectrum, absorption efficiency, and energy response of the detector. The second step utilizes a limited number of transmission measurements with a set of flat slabs of two absorber materials to fine-tune the model predictions, resulting in a good correspondence with the physical measurements. To verify the response model, we apply the model in two cases. First, the model is used in combination with a compensation method which requires an extensive number of transmission measurements to determine the necessary parameters. Our spectral response model successfully replaces these measurements by simulations, saving a significant amount of measurement time. Second, the spectral response model is used as the basis of the maximum likelihood approach for projection-based material decomposition. The reconstructed basis images show a good separation between the calcium-like material and the contrast agents, iodine and gadolinium. The contrast agent concentrations are reconstructed with more than 94% accuracy.

Spectral response model for a multibin photon-counting spectral computed tomography detector and its applications

PubMed Central

Liu, Xuejin; Persson, Mats; Bornefalk, Hans; Karlsson, Staffan; Xu, Cheng; Danielsson, Mats; Huber, Ben

2015-01-01

Abstract. Variations among detector channels in computed tomography can lead to ring artifacts in the reconstructed images and biased estimates in projection-based material decomposition. Typically, the ring artifacts are corrected by compensation methods based on flat fielding, where transmission measurements are required for a number of material-thickness combinations. Phantoms used in these methods can be rather complex and require an extensive number of transmission measurements. Moreover, material decomposition needs knowledge of the individual response of each detector channel to account for the detector inhomogeneities. For this purpose, we have developed a spectral response model that binwise predicts the response of a multibin photon-counting detector individually for each detector channel. The spectral response model is performed in two steps. The first step employs a forward model to predict the expected numbers of photon counts, taking into account parameters such as the incident x-ray spectrum, absorption efficiency, and energy response of the detector. The second step utilizes a limited number of transmission measurements with a set of flat slabs of two absorber materials to fine-tune the model predictions, resulting in a good correspondence with the physical measurements. To verify the response model, we apply the model in two cases. First, the model is used in combination with a compensation method which requires an extensive number of transmission measurements to determine the necessary parameters. Our spectral response model successfully replaces these measurements by simulations, saving a significant amount of measurement time. Second, the spectral response model is used as the basis of the maximum likelihood approach for projection-based material decomposition. The reconstructed basis images show a good separation between the calcium-like material and the contrast agents, iodine and gadolinium. The contrast agent concentrations are reconstructed with more than 94% accuracy. PMID:26839904

Comparisons of NIF convergent ablation simulations with radiograph data.

PubMed

Olson, R E; Hicks, D G; Meezan, N B; Koch, J A; Landen, O L

2012-10-01

A technique for comparing simulation results directly with radiograph data from backlit capsule implosion experiments will be discussed. Forward Abel transforms are applied to the kappa*rho profiles of the simulation. These provide the transmission ratio (optical depth) profiles of the simulation. Gaussian and top hat blurs are applied to the simulated transmission ratio profiles in order to account for the motion blurring and imaging slit resolution of the experimental measurement. Comparisons between the simulated transmission ratios and the radiograph data lineouts are iterated until a reasonable backlighter profile is obtained. This backlighter profile is combined with the blurred, simulated transmission ratios to obtain simulated intensity profiles that can be directly compared with the radiograph data. Examples will be shown from recent convergent ablation (backlit implosion) experiments at the NIF.

Monitoring the fitness of antiviral-resistant influenza strains during an epidemic: A mathematical modeling study

PubMed Central

Leung, Kathy; Lipsitch, Marc; Yuen, Kwok Yung; Wu, Joseph T

2017-01-01

Summary Background Antivirals (e.g. oseltamivir) are important for mitigating influenza epidemics. In 2007, an oseltamivir-resistant seasonal A(H1N1) strain emerged and spread to global fixation within one year. This showed that antiviral-resistant (AVR) strains can be intrinsically more transmissible than their contemporaneous antiviral-sensitive (AVS) counterpart. Surveillance of AVR fitness is therefore essential. Methods We define the fitness of AVR strains as their reproductive number relative to their co-circulating AVS counterparts. We develop a simple method for real-time estimation of AVR fitness from surveillance data. This method requires only information on generation time without other specific details regarding transmission dynamics. We first use simulations to validate this method by showing that it yields unbiased and robust fitness estimates in most epidemic scenarios. We then apply this method to two retrospective case studies and one hypothetical case study. Findings We estimate that (i) the oseltamivir-resistant A(H1N1) strain that emerged in 2007 was 4% (3–5%) more transmissible than its oseltamivir-sensitive predecessor and (ii) the oseltamivir-resistant pandemic A(H1N1) strain that emerged and circulated in Japan during 2013–2014 was 24% (17–30%) less transmissible than its oseltamivir-sensitive counterpart. We show that in the event of large-scale antiviral interventions during a pandemic with co-circulation of AVS and AVR strains, our method can be used to inform optimal use of antivirals by monitoring intrinsic AVR fitness and drug pressure on the AVS strain. Conclusions We have developed a simple method that can be easily integrated into contemporary influenza surveillance systems to provide reliable estimates of AVR fitness in real time. Funding Research Fund for the Control of Infectious Disease (09080792) and a commissioned grant from the Health and Medical Research Fund from the Government of the Hong Kong Special Administrative Region, Harvard Center for Communicable Disease Dynamics from the National Institute of General Medical Sciences (grant no. U54 GM088558), Area of Excellence Scheme of the Hong Kong University Grants Committee (grant no. AoE/M-12/06). PMID:27914853

THE REAL McCOIL: A method for the concurrent estimation of the complexity of infection and SNP allele frequency for malaria parasites

PubMed Central

Chang, Hsiao-Han; Worby, Colin J.; Yeka, Adoke; Nankabirwa, Joaniter; Kamya, Moses R.; Staedke, Sarah G.; Hubbart, Christina; Amato, Roberto; Kwiatkowski, Dominic P.

2017-01-01

As many malaria-endemic countries move towards elimination of Plasmodium falciparum, the most virulent human malaria parasite, effective tools for monitoring malaria epidemiology are urgent priorities. P. falciparum population genetic approaches offer promising tools for understanding transmission and spread of the disease, but a high prevalence of multi-clone or polygenomic infections can render estimation of even the most basic parameters, such as allele frequencies, challenging. A previous method, COIL, was developed to estimate complexity of infection (COI) from single nucleotide polymorphism (SNP) data, but relies on monogenomic infections to estimate allele frequencies or requires external allele frequency data which may not available. Estimates limited to monogenomic infections may not be representative, however, and when the average COI is high, they can be difficult or impossible to obtain. Therefore, we developed THE REAL McCOIL, Turning HEterozygous SNP data into Robust Estimates of ALelle frequency, via Markov chain Monte Carlo, and Complexity Of Infection using Likelihood, to incorporate polygenomic samples and simultaneously estimate allele frequency and COI. This approach was tested via simulations then applied to SNP data from cross-sectional surveys performed in three Ugandan sites with varying malaria transmission. We show that THE REAL McCOIL consistently outperforms COIL on simulated data, particularly when most infections are polygenomic. Using field data we show that, unlike with COIL, we can distinguish epidemiologically relevant differences in COI between and within these sites. Surprisingly, for example, we estimated high average COI in a peri-urban subregion with lower transmission intensity, suggesting that many of these cases were imported from surrounding regions with higher transmission intensity. THE REAL McCOIL therefore provides a robust tool for understanding the molecular epidemiology of malaria across transmission settings. PMID:28125584

Immunogold Staining of Ultrathin Thawed Cryosections for Transmission Electron Microscopy (TEM).

PubMed

Skepper, Jeremy N; Powell, Janet M

2008-06-01

INTRODUCTIONA pre-embedding method of immunochemical staining is used if antigens are damaged by resin embedding, or if the best preservation of membranes is required. Applying immunogold reagents to sections of lightly fixed tissue, free of embedding medium, can be a very sensitive method of immunochemical staining. Cells or tissues are fixed as strongly as possible and then treated with a cryoprotectant, which is usually a mixture of sucrose and polyvinylpyrrolidone (PVP). They are frozen onto pins in liquid nitrogen and sectioned at approximately -100°C. The frozen sections are thaw-mounted on to Formvar/nickel film grids and the cryoprotectant is removed by floating the grids on drops of phosphate-buffered saline (PBS). The immunogold staining is performed on the unembedded sections, which are subsequently contrast counterstained and infiltrated with a mixture of methylcellulose and uranyl acetate. In this protocol, samples are sectioned at low temperature, thaw-mounted onto film grids, immunochemically stained, contrast counterstained, and embedded/encapsulated in situ on the grid before viewing by transmission electron microscopy (TEM).

Optimal methodologies for terahertz time-domain spectroscopic analysis of traditional pigments in powder form

NASA Astrophysics Data System (ADS)

Ha, Taewoo; Lee, Howon; Sim, Kyung Ik; Kim, Jonghyeon; Jo, Young Chan; Kim, Jae Hoon; Baek, Na Yeon; Kang, Dai-ill; Lee, Han Hyoung

2017-05-01

We have established optimal methods for terahertz time-domain spectroscopic analysis of highly absorbing pigments in powder form based on our investigation of representative traditional Chinese pigments, such as azurite [blue-based color pigment], Chinese vermilion [red-based color pigment], and arsenic yellow [yellow-based color pigment]. To accurately extract the optical constants in the terahertz region of 0.1 - 3 THz, we carried out transmission measurements in such a way that intense absorption peaks did not completely suppress the transmission level. This required preparation of pellet samples with optimized thicknesses and material densities. In some cases, mixing the pigments with polyethylene powder was required to minimize absorption due to certain peak features. The resulting distortion-free terahertz spectra of the investigated set of pigment species exhibited well-defined unique spectral fingerprints. Our study will be useful to future efforts to establish non-destructive analysis methods of traditional pigments, to construct their spectral databases, and to apply these tools to restoration of cultural heritage materials.

Contagious equine metritis: artificial reproduction changes the epidemiologic paradigm.

PubMed

Schulman, Martin Lance; May, Catherine Edith; Keys, Bronwyn; Guthrie, Alan John

2013-11-29

Recent CEM outbreak reports reflect a novel epidemiologic manifestation with a markedly different risk association for transmission via artificial reproduction and subsequent to inadvertent importation of unapparent carrier stallions. Artificial breeding has an increased association with horizontal or fomite-associated transmission. Reported risk factors include inadequate biosecurity protocols at centralised breeding facilities associated with stallion management and methods of semen collection, processing and transport. Detection of carriers is based on traditional bacteriology from genital swabs and despite limitations inherent to Taylorella equigenitalis is currently the gold standard applied in all international trade and movement protocols. These limitations are reported to be overcome by PCR assays improving diagnostic sensitivity and specificity, practicality, turn-around times, through-put and cost efficacy. Molecular methods have increased understanding of the Taylorelleae, facilitate epidemiologic surveillance and outbreak control strategies. Validation and international regulatory acceptance of a robust PCR-based assay and the undefined risks in association with cryopreserved semen and embryos are future areas warranting further investigation. Copyright © 2013 Elsevier B.V. All rights reserved.

Prediction of sound transmission loss through multilayered panels by using Gaussian distribution of directional incident energy

PubMed

Kang; Ih; Kim; Kim

2000-03-01

In this study, a new prediction method is suggested for sound transmission loss (STL) of multilayered panels of infinite extent. Conventional methods such as random or field incidence approach often given significant discrepancies in predicting STL of multilayered panels when compared with the experiments. In this paper, appropriate directional distributions of incident energy to predict the STL of multilayered panels are proposed. In order to find a weighting function to represent the directional distribution of incident energy on the wall in a reverberation chamber, numerical simulations by using a ray-tracing technique are carried out. Simulation results reveal that the directional distribution can be approximately expressed by the Gaussian distribution function in terms of the angle of incidence. The Gaussian function is applied to predict the STL of various multilayered panel configurations as well as single panels. The compared results between the measurement and the prediction show good agreements, which validate the proposed Gaussian function approach.

Electrical method and apparatus for impelling the extruded ejection of high-velocity material jets

DOEpatents

Weingart, Richard C.

1989-01-01

A method and apparatus (10, 40) for producing high-velocity material jets provided. An electric current pulse generator (14, 42) is attached to an end of a coaxial two-conductor transmission line (16, 44) having an outer cylindrical conductor (18), an inner cylindrical conductor (20), and a solid plastic or ceramic insulator (21) therebetween. A coxial, thin-walled metal structure (22, 30) is conductively joined to the two conductors (18, 20) of the transmission line (16, 44). An electrical current pulse applies magnetic pressure to and possibly explosively vaporizes metal structure (22), thereby collapsing it and impelling the extruded ejection of a high-velocity material jet therefrom. The jet is comprised of the metal of the structure (22), together with the material that comprises any covering layers (32, 34) disposed on the structure. An electric current pulse generator of the explosively driven magnetic flux compression type or variety (42) may be advantageously used in the practice of this invention.

Inference of R 0 and Transmission Heterogeneity from the Size Distribution of Stuttering Chains

PubMed Central

Blumberg, Seth; Lloyd-Smith, James O.

2013-01-01

For many infectious disease processes such as emerging zoonoses and vaccine-preventable diseases, and infections occur as self-limited stuttering transmission chains. A mechanistic understanding of transmission is essential for characterizing the risk of emerging diseases and monitoring spatio-temporal dynamics. Thus methods for inferring and the degree of heterogeneity in transmission from stuttering chain data have important applications in disease surveillance and management. Previous researchers have used chain size distributions to infer , but estimation of the degree of individual-level variation in infectiousness (as quantified by the dispersion parameter, ) has typically required contact tracing data. Utilizing branching process theory along with a negative binomial offspring distribution, we demonstrate how maximum likelihood estimation can be applied to chain size data to infer both and the dispersion parameter that characterizes heterogeneity. While the maximum likelihood value for is a simple function of the average chain size, the associated confidence intervals are dependent on the inferred degree of transmission heterogeneity. As demonstrated for monkeypox data from the Democratic Republic of Congo, this impacts when a statistically significant change in is detectable. In addition, by allowing for superspreading events, inference of shifts the threshold above which a transmission chain should be considered anomalously large for a given value of (thus reducing the probability of false alarms about pathogen adaptation). Our analysis of monkeypox also clarifies the various ways that imperfect observation can impact inference of transmission parameters, and highlights the need to quantitatively evaluate whether observation is likely to significantly bias results. PMID:23658504

Transmissibility of Variant Influenza From Swine to Humans: A Modeling Approach

PubMed Central

Wong, Karen K.; Gambhir, Manoj; Finelli, Lyn; Swerdlow, David L.; Ostroff, Stephen; Reed, Carrie

2015-01-01

Background Respiratory illness was reported among humans and swine at an agricultural fair in 2011; 3 human infections with an influenza A(H3N2) variant (H3N2v) virus were confirmed. Using epidemiologic investigation data, we sought to estimate H3N2v transmissibility from swine to humans. Methods We developed a model of H3N2v transmission among swine and humans and fit it to data from a cohort of 100 agricultural club members reporting swine contact to estimate transmissibility. A sensitivity analysis was performed varying H3N2v prevalence in the club cohort. Using the best-fit transmission probability, we simulated the number of swine-acquired infections among all fair attendees. Results We estimated the best-fit probability of swine-to-human H3N2v transmission per minute of swine contact. Applying this probability to 14 910 people with swine contact at the fair, we estimate that there were 80 (95% confidence interval [CI], 40–133) H3N2v infections among persons aged <20 years and 58 (95% CI, 29–96) H3N2v infections among person aged ≥20 years. Conclusions Using early data from investigation of a new virus with unclear transmission properties, we estimated the transmissibility of H3N2v from swine to humans and the burden of H3N2v among fair attendees. Although the risk of H3N2v virus infection is small for fair attendees with minimal swine contact, large populations attend agricultural events each year, and human cases will likely occur when infected swine are present. PMID:23794727

Transmission of vibration through glove materials: effects of contact force.

PubMed

Md Rezali, Khairil Anas; Griffin, Michael J

2018-04-26

This study investigated effects of applied force on the apparent mass of the hand, the dynamic stiffness of glove materials and the transmission of vibration through gloves to the hand. For 10 subjects, 3 glove materials and 3 contact forces, apparent masses and glove transmissibilities were measured at the palm and at a finger at frequencies in the range 5-300 Hz. The dynamic stiffnesses of the materials were also measured. With increasing force, the dynamic stiffnesses of the materials increased, the apparent mass at the palm increased at frequencies greater than the resonance and the apparent mass at the finger increased at low frequencies. The effects of force on transmissibilities therefore differed between materials and depended on vibration frequency, but changes in apparent mass and dynamic stiffness had predictable effects on material transmissibility. Depending on the glove material, the transmission of vibration through a glove can be increased or decreased when increasing the applied force. Practitioner summary: Increasing the contact force (i.e. push force or grip force) can increase or decrease the transmission of vibration through a glove. The vibration transmissibilities of gloves should be assessed with a range of contact forces to understand their likely influence on the exposure of the hand and fingers to vibration.

Movement Correction Method for Human Brain PET Images: Application to Quantitative Analysis of Dynamic [18F]-FDDNP Scans

PubMed Central

Wardak, Mirwais; Wong, Koon-Pong; Shao, Weber; Dahlbom, Magnus; Kepe, Vladimir; Satyamurthy, Nagichettiar; Small, Gary W.; Barrio, Jorge R.; Huang, Sung-Cheng

2010-01-01

Head movement during a PET scan (especially, dynamic scan) can affect both the qualitative and quantitative aspects of an image, making it difficult to accurately interpret the results. The primary objective of this study was to develop a retrospective image-based movement correction (MC) method and evaluate its implementation on dynamic [18F]-FDDNP PET images of cognitively intact controls and patients with Alzheimer’s disease (AD). Methods Dynamic [18F]-FDDNP PET images, used for in vivo imaging of beta-amyloid plaques and neurofibrillary tangles, were obtained from 12 AD and 9 age-matched controls. For each study, a transmission scan was first acquired for attenuation correction. An accurate retrospective MC method that corrected for transmission-emission misalignment as well as emission-emission misalignment was applied to all studies. No restriction was assumed for zero movement between the transmission scan and first emission scan. Logan analysis with cerebellum as the reference region was used to estimate various regional distribution volume ratio (DVR) values in the brain before and after MC. Discriminant analysis was used to build a predictive model for group membership, using data with and without MC. Results MC improved the image quality and quantitative values in [18F]-FDDNP PET images. In this subject population, medial temporal (MTL) did not show a significant difference between controls and AD before MC. However, after MC, significant differences in DVR values were seen in frontal, parietal, posterior cingulate (PCG), MTL, lateral temporal (LTL), and global between the two groups (P < 0.05). In controls and AD, the variability of regional DVR values (as measured by the coefficient of variation) decreased on average by >18% after MC. Mean DVR separation between controls and ADs was higher in frontal, MTL, LTL and global after MC. Group classification by discriminant analysis based on [18F]-FDDNP DVR values was markedly improved after MC. Conclusion The streamlined and easy to use MC method presented in this work significantly improves the image quality and the measured tracer kinetics of [18F]-FDDNP PET images. The proposed MC method has the potential to be applied to PET studies on patients having other disorders (e.g., Down syndrome and Parkinson’s disease) and to brain PET scans with other molecular imaging probes. PMID:20080894

A judging principle of crucial vibrational transmission paths in plates

NASA Astrophysics Data System (ADS)

Wang, Bin; Li, Dong-Xu; Jiang, Jian-Ping; Liao, Yi-Huan

2016-10-01

This paper developed a judging principle of crucial vibrational transmission path (VTP) in plates. Novel generalized definitions of VTPs are given referred to the meaning of streamlines. And by comparing governing equations, the similarity between energy flow and fluid motion is firstly found so that an analytic method of VTPs in plates is proposed by analogy with fluid motion. Hereafter, the crucial VTP is defined for energy flows at objective points and relative judging criteria is given. Finally, based on two numerical experiments of passive control, the judging principle is indirectly verified by comparing the reduction effects of energy flows at focused points and relative judgment results of crucial VTPs. This paper is meaningful for analyzing and applying the VTPs in plates to guide the control design in future.

Quantum transport of the single metallocene molecule

NASA Astrophysics Data System (ADS)

Yu, Jing-Xin; Chang, Jing; Wei, Rong-Kai; Liu, Xiu-Ying; Li, Xiao-Dong

2016-10-01

The Quantum transport of three single metallocene molecule is investigated by performing theoretical calculations using the non-equilibrium Green's function method combined with density functional theory. We find that the three metallocen molecules structure become stretched along the transport direction, the distance between two Cp rings longer than the other theory and experiment results. The lager conductance is found in nickelocene molecule, the main transmission channel is the electron coupling between molecule and the electrodes is through the Ni dxz and dyz orbitals and the s, dxz, dyz of gold. This is also confirmed by the highest occupied molecular orbital resonance at Fermi level. In addition, negative differential resistance effect is found in the ferrocene, cobaltocene molecules, this is also closely related with the evolution of the transmission spectrum under applied bias.

[Medical application of nano-materials].

PubMed

Jiang, Hui-qing; Chen, Yi-fei

2002-11-01

To review the research progress and medical application of nano-materials. The literature review and comprehensive analysis, methods were used in this study. The Nanotechnology is a typical crossing knowledge. It could be extensively applied in the fields of novel biomaterials, effective transmission of bioactive factor; the detection of functions for all vital organ systems, vascular circulation condition, the control of repair of burn trauma wounds will be monitored by the varied methods of nano technology combined with molecular biological engineering. The application of Nanotechnology will play important roles in clinical medicine, wound repair and basic research for the traditional Chinese medicine.

Transmission measurement based on STM observation to detect the penetration depth of low-energy heavy ions in botanic samples.

PubMed

Liu, Feng; Wang, Yugang; Xue, Jianming; Wang, Sixue; Du, Guanhua; Zhao, Weijiang

2003-02-01

The penetration depth of low-energy heavy ions in botanic samples was detected with a new transmission measurement. In the measurement, highly oriented pyrolytic graphite (HOPG) pieces were placed behind the botanic samples with certain thickness. During the irradiation of heavy ions with energy of tens of keV, the energetic particles transmitted from those samples were received by the HOPG pieces. After irradiation, scanning tunneling microscope (STM) was applied to observe protrusion-like damage induced by these transmitted ions on the surface of the HOPG. The statistical average number density of protrusions and the minimum transmission rate of the low-energy heavy ions can be obtained. The detection efficiency of the new method for low-energy heavy ions was about 0.1-1 and the background in the measurement can be reduced to as low as 1.0 x 10(8) protrusions/cm2. With this method, the penetration depth of the energetic particles was detected to be no less than 60 micrometers in kidney bean slices when the slices were irradiated by 100 keVAr+ ion at the fluence of 5 x 10(16) ions/cm2. c2002 Elsevier Science Ltd. All rights reserved.

A Comparison of Vibration and Oil Debris Gear Damage Detection Methods Applied to Pitting Damage

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.

2000-01-01

Helicopter Health Usage Monitoring Systems (HUMS) must provide reliable, real-time performance monitoring of helicopter operating parameters to prevent damage of flight critical components. Helicopter transmission diagnostics are an important part of a helicopter HUMS. In order to improve the reliability of transmission diagnostics, many researchers propose combining two technologies, vibration and oil monitoring, using data fusion and intelligent systems. Some benefits of combining multiple sensors to make decisions include improved detection capabilities and increased probability the event is detected. However, if the sensors are inaccurate, or the features extracted from the sensors are poor predictors of transmission health, integration of these sensors will decrease the accuracy of damage prediction. For this reason, one must verify the individual integrity of vibration and oil analysis methods prior to integrating the two technologies. This research focuses on comparing the capability of two vibration algorithms, FM4 and NA4, and a commercially available on-line oil debris monitor to detect pitting damage on spur gears in the NASA Glenn Research Center Spur Gear Fatigue Test Rig. Results from this research indicate that the rate of change of debris mass measured by the oil debris monitor is comparable to the vibration algorithms in detecting gear pitting damage.

Transmission measurement based on STM observation to detect the penetration depth of low-energy heavy ions in botanic samples

NASA Technical Reports Server (NTRS)

Liu, Feng; Wang, Yugang; Xue, Jianming; Wang, Sixue; Du, Guanhua; Zhao, Weijiang

2003-01-01

The penetration depth of low-energy heavy ions in botanic samples was detected with a new transmission measurement. In the measurement, highly oriented pyrolytic graphite (HOPG) pieces were placed behind the botanic samples with certain thickness. During the irradiation of heavy ions with energy of tens of keV, the energetic particles transmitted from those samples were received by the HOPG pieces. After irradiation, scanning tunneling microscope (STM) was applied to observe protrusion-like damage induced by these transmitted ions on the surface of the HOPG. The statistical average number density of protrusions and the minimum transmission rate of the low-energy heavy ions can be obtained. The detection efficiency of the new method for low-energy heavy ions was about 0.1-1 and the background in the measurement can be reduced to as low as 1.0 x 10(8) protrusions/cm2. With this method, the penetration depth of the energetic particles was detected to be no less than 60 micrometers in kidney bean slices when the slices were irradiated by 100 keVAr+ ion at the fluence of 5 x 10(16) ions/cm2. c2002 Elsevier Science Ltd. All rights reserved.

Optimal Policy of Cross-Layer Design for Channel Access and Transmission Rate Adaptation in Cognitive Radio Networks

NASA Astrophysics Data System (ADS)

He, Hao; Wang, Jun; Zhu, Jiang; Li, Shaoqian

2010-12-01

In this paper, we investigate the cross-layer design of joint channel access and transmission rate adaptation in CR networks with multiple channels for both centralized and decentralized cases. Our target is to maximize the throughput of CR network under transmission power constraint by taking spectrum sensing errors into account. In centralized case, this problem is formulated as a special constrained Markov decision process (CMDP), which can be solved by standard linear programming (LP) method. As the complexity of finding the optimal policy by LP increases exponentially with the size of action space and state space, we further apply action set reduction and state aggregation to reduce the complexity without loss of optimality. Meanwhile, for the convenience of implementation, we also consider the pure policy design and analyze the corresponding characteristics. In decentralized case, where only local information is available and there is no coordination among the CR users, we prove the existence of the constrained Nash equilibrium and obtain the optimal decentralized policy. Finally, in the case that the traffic load parameters of the licensed users are unknown for the CR users, we propose two methods to estimate the parameters for two different cases. Numerical results validate the theoretic analysis.

Ultra-wideband electronics, design methods, algorithms, and systems for dielectric spectroscopy of isolated B16 tumor cells in liquid medium

NASA Astrophysics Data System (ADS)

Maxwell, Erick N.

Quantifying and characterizing isolated tumor cells (ITCs) is of interest in surgical pathology and cytology for its potential to provide data for cancer staging, classification, and treatment. Although the independent prognostic significance of circulating ITCs has not been proven, their presence is gaining clinical relevance as an indicator. However, researchers have not established an optimal method for detecting ITCs. Consequently, this Ph.D. dissertation is concerned with the development and evaluation of dielectric spectroscopy as a low-cost method for cell characterization and quantification. In support of this goal, ultra-wideband (UWB), microwave pulse generator circuits, coaxial transmission line fixtures, permittivity extraction algorithms, and dielectric spectroscopy measurement systems were developed for evaluating the capacity to quantify B16-F10 tumor cells in suspension. First, this research addressed challenges in developing tunable UWB circuits for pulse generation. In time-domain dielectric spectroscopy, a tunable UWB pulse generator facilitates exploration of microscopic dielectric mechanisms, which contribute to dispersion characteristics. Conventional approaches to tunable pulse generator design have resulted in complex circuit topologies and unsymmetrical waveform morphologies. In this research, a new design approach for low-complexity, tunable, sub-nanosecond and UWB pulse generator was developed. This approach was applied to the development of a novel generator that produces symmetrical waveforms (patent pending 60/597,746). Next, this research addressed problems with transmission-reflection (T/R) measurement of cell suspensions. In T/R measurement, coaxial transmission line fixtures have historically required an elaborate sample holder for containing liquids, resulting in high cost and complexity. Furthermore, the algorithms used to extract T/R dielectric properties have suffered from myriad problems including local minima and halfwavelength resonance. In this dissertation, a simple coaxial transmission line fixture for holding liquids by dispensing with the air-core assumption inherent in previous designs was developed (patent pending 60/916,042). In addition, a genetic algorithm was applied towards extracting dielectric properties from measurement data to circumvent problems of local minima and half wavelength resonance. Finally, in this research the capacity for using dielectric properties to quantify isolated B16-F10 tumor cells in McCoy's liquid medium was investigated. In so doing, the utility of the Maxwell-Wagner mixture formula for cell quantification was demonstrated by measuring distinct dielectric properties for differing volumes of cell suspensions using frequency- and time-domain dielectric spectroscopy.

Monolithic high voltage nonlinear transmission line fabrication process

DOEpatents

Cooper, Gregory A.

1994-01-01

A process for fabricating sequential inductors and varactor diodes of a monolithic, high voltage, nonlinear, transmission line in GaAs is disclosed. An epitaxially grown laminate is produced by applying a low doped active n-type GaAs layer to an n-plus type GaAs substrate. A heavily doped p-type GaAs layer is applied to the active n-type layer and a heavily doped n-type GaAs layer is applied to the p-type layer. Ohmic contacts are applied to the heavily doped n-type layer where diodes are desired. Multiple layers are then either etched away or Oxygen ion implanted to isolate individual varactor diodes. An insulator is applied between the diodes and a conductive/inductive layer is thereafter applied on top of the insulator layer to complete the process.

Continuous variable transmission and regenerative braking devices in bicycles utilizing magnetorheological fluids

NASA Astrophysics Data System (ADS)

Cheung, Wai Ming; Liao, Wei-Hsin

2013-04-01

The use of magnetorheological (MR) fluids in vehicles has been gaining popular recently due to its controllable nature, which gives automotive designers more dimensions of freedom in functional designs. However, not much attention has been paid to apply it to bicycles. This paper is aimed to study the feasibility of applying MR fluids in different dynamic parts of a bicycle such as the transmission and braking systems. MR continuous variable transmission (CVT) and power generator assisted in braking systems were designed and analyzed. Both prototypes were fabricated and tested to evaluate their performances. Experimental results showed that the proposed designs are promising to be used in bicycles.

Rapid quantification of viable Legionella in nuclear cooling tower waters using filter cultivation, fluorescent in situ hybridization and solid-phase cytometry.

PubMed

Baudart, J; Guillaume, C; Mercier, A; Lebaron, P; Binet, M

2015-05-01

To develop a rapid and sensitive method to quantify viable Legionella spp. in cooling tower water samples. A rapid, culture-based method capable of quantifying as few as 600 Legionella microcolonies per litre within 2 days in industrial waters was developed. The method combines a short cultivation step of microcolonies on GVPC agar plate, specific detection of Legionella cells by a fluorescent in situ hybridization (FISH) approach, and a sensitive enumeration using a solid-phase cytometer. Following optimization of the cultivation conditions, the qualitative and quantitative performance of the method was assessed and the method was applied to 262 nuclear power plant cooling water samples. The performance of this method was in accordance with the culture method (NF-T 90-431) for Legionella enumeration. The rapid detection of viable Legionella in water is a major concern to the effective monitoring of this pathogenic bacterium in the main water sources involved in the transmission of legionellosis infection (Legionnaires' disease). The new method proposed here appears to be a robust, efficient and innovative means for rapidly quantifying cultivable Legionella in cooling tower water samples within 48 h. © 2015 The Society for Applied Microbiology.

Compact wavelength-insensitive fabrication-tolerant silicon-on-insulator beam splitter.

PubMed

Rasigade, Gilles; Le Roux, Xavier; Marris-Morini, Delphine; Cassan, Eric; Vivien, Laurent

2010-11-01

A star coupler-based beam splitter for rib waveguides is reported. A design method is presented and applied in the case of silicon-on-insulator rib waveguides. Experimental results are in good agreement with simulations. Excess loss lower than 1 dB is experimentally obtained for star coupler lengths from 0.5 to 1 μm. Output balance is better than 1 dB, which is the measurement accuracy, and broadband transmission is obtained over 90 nm.

Implementation of dipolar direct current (DDC) collision-induced dissociation in storage and transmission modes on a quadrupole/time-of-flight tandem mass spectrometer.

PubMed

Webb, Ian K; Londry, Frank A; McLuckey, Scott A

2011-09-15

Means for effecting dipolar direct current collision-induced dissociation (DDC CID) on a quadrupole/time-of-flight in a mass spectrometer have been implemented for the broadband dissociation of a wide range of analyte ions. The DDC fragmentation method in electrodynamic storage and transmission devices provides a means for inducing fragmentation of ions over a large mass-to-charge range simultaneously. It can be effected within an ion storage step in a quadrupole collision cell that is operated as a linear ion trap or as ions are continuously transmitted through the collision cell. A DDC potential is applied across one pair of rods in the quadrupole collision cell of a QqTOF hybrid mass spectrometer to effect fragmentation. In this study, ions derived from a small drug molecule, a model peptide, a small protein, and an oligonucleotide were subjected to the DDC CID method in either an ion trapping or an ion transmission mode (or both). Several key experimental parameters that affect DDC CID results, such as time, voltage, low mass cutoff, and bath gas pressure, are illustrated with protonated leucine enkephalin. The DDC CID dissociation method gives a readily tunable, broadband tool for probing the primary structures of a wide range of analyte ions. The method provides an alternative to the narrow resonance conditions of conventional ion trap CID and it can access more extensive sequential fragmentation, depending upon conditions. The DDC CID approach constitutes a collision analog to infrared multiphoton dissociation (IRMPD). Copyright © 2011 John Wiley & Sons, Ltd.

Circularly-symmetric complex normal ratio distribution for scalar transmissibility functions. Part III: Application to statistical modal analysis

NASA Astrophysics Data System (ADS)

Yan, Wang-Ji; Ren, Wei-Xin

2018-01-01

This study applies the theoretical findings of circularly-symmetric complex normal ratio distribution Yan and Ren (2016) [1,2] to transmissibility-based modal analysis from a statistical viewpoint. A probabilistic model of transmissibility function in the vicinity of the resonant frequency is formulated in modal domain, while some insightful comments are offered. It theoretically reveals that the statistics of transmissibility function around the resonant frequency is solely dependent on 'noise-to-signal' ratio and mode shapes. As a sequel to the development of the probabilistic model of transmissibility function in modal domain, this study poses the process of modal identification in the context of Bayesian framework by borrowing a novel paradigm. Implementation issues unique to the proposed approach are resolved by Lagrange multiplier approach. Also, this study explores the possibility of applying Bayesian analysis in distinguishing harmonic components and structural ones. The approaches are verified through simulated data and experimentally testing data. The uncertainty behavior due to variation of different factors is also discussed in detail.

Measuring changes in transmission of neglected tropical diseases, malaria, and enteric pathogens from quantitative antibody levels.

PubMed

Arnold, Benjamin F; van der Laan, Mark J; Hubbard, Alan E; Steel, Cathy; Kubofcik, Joseph; Hamlin, Katy L; Moss, Delynn M; Nutman, Thomas B; Priest, Jeffrey W; Lammie, Patrick J

2017-05-01

Serological antibody levels are a sensitive marker of pathogen exposure, and advances in multiplex assays have created enormous potential for large-scale, integrated infectious disease surveillance. Most methods to analyze antibody measurements reduce quantitative antibody levels to seropositive and seronegative groups, but this can be difficult for many pathogens and may provide lower resolution information than quantitative levels. Analysis methods have predominantly maintained a single disease focus, yet integrated surveillance platforms would benefit from methodologies that work across diverse pathogens included in multiplex assays. We developed an approach to measure changes in transmission from quantitative antibody levels that can be applied to diverse pathogens of global importance. We compared age-dependent immunoglobulin G curves in repeated cross-sectional surveys between populations with differences in transmission for multiple pathogens, including: lymphatic filariasis (Wuchereria bancrofti) measured before and after mass drug administration on Mauke, Cook Islands, malaria (Plasmodium falciparum) before and after a combined insecticide and mass drug administration intervention in the Garki project, Nigeria, and enteric protozoans (Cryptosporidium parvum, Giardia intestinalis, Entamoeba histolytica), bacteria (enterotoxigenic Escherichia coli, Salmonella spp.), and viruses (norovirus groups I and II) in children living in Haiti and the USA. Age-dependent antibody curves fit with ensemble machine learning followed a characteristic shape across pathogens that aligned with predictions from basic mechanisms of humoral immunity. Differences in pathogen transmission led to shifts in fitted antibody curves that were remarkably consistent across pathogens, assays, and populations. Mean antibody levels correlated strongly with traditional measures of transmission intensity, such as the entomological inoculation rate for P. falciparum (Spearman's rho = 0.75). In both high- and low transmission settings, mean antibody curves revealed changes in population mean antibody levels that were masked by seroprevalence measures because changes took place above or below the seropositivity cutoff. Age-dependent antibody curves and summary means provided a robust and sensitive measure of changes in transmission, with greatest sensitivity among young children. The method generalizes to pathogens that can be measured in high-throughput, multiplex serological assays, and scales to surveillance activities that require high spatiotemporal resolution. Our results suggest quantitative antibody levels will be particularly useful to measure differences in exposure for pathogens that elicit a transient antibody response or for monitoring populations with very high- or very low transmission, when seroprevalence is less informative. The approach represents a new opportunity to conduct integrated serological surveillance for neglected tropical diseases, malaria, and other infectious diseases with well-defined antigen targets.

A mechanistic spatio-temporal framework for modelling individual-to-individual transmission-With an application to the 2014-2015 West Africa Ebola outbreak.

PubMed

Lau, Max S Y; Gibson, Gavin J; Adrakey, Hola; McClelland, Amanda; Riley, Steven; Zelner, Jon; Streftaris, George; Funk, Sebastian; Metcalf, Jessica; Dalziel, Benjamin D; Grenfell, Bryan T

2017-10-01

In recent years there has been growing availability of individual-level spatio-temporal disease data, particularly due to the use of modern communicating devices with GPS tracking functionality. These detailed data have been proven useful for inferring disease transmission to a more refined level than previously. However, there remains a lack of statistically sound frameworks to model the underlying transmission dynamic in a mechanistic manner. Such a development is particularly crucial for enabling a general epidemic predictive framework at the individual level. In this paper we propose a new statistical framework for mechanistically modelling individual-to-individual disease transmission in a landscape with heterogeneous population density. Our methodology is first tested using simulated datasets, validating our inferential machinery. The methodology is subsequently applied to data that describes a regional Ebola outbreak in Western Africa (2014-2015). Our results show that the methods are able to obtain estimates of key epidemiological parameters that are broadly consistent with the literature, while revealing a significantly shorter distance of transmission. More importantly, in contrast to existing approaches, we are able to perform a more general model prediction that takes into account the susceptible population. Finally, our results show that, given reasonable scenarios, the framework can be an effective surrogate for susceptible-explicit individual models which are often computationally challenging.

Determination of the protection efficacy and homogeneity of the distribution of sunscreens applied onto skin pre-treated with cosmetic products.

PubMed

Weigmann, Hans-Jürgen; de Sainte Claire, Maude Suisse; Schanzer, Sabine; Patzelt, Alexa; Meinke, Martina; Antoniou, Christina; Sterry, Wolfram; Lademann, Jürgen

2012-05-01

The efficacy of sunscreens depends decisively on the homogeneity of its distribution on the skin surface, which is sensitively reflected by two spectroscopic data - the factor of inhomogeneity and the sum transmission - measured after tape stripping. The aim of this study was to investigate the influence of a skin pre-treatment with body lotion on the layout of the formulations. Six healthy volunteers were pre-treated using the body lotion, Nivea Body (Beiersdorf AG, Hamburg, Germany). The sunscreen was an oil/water (o/w) emulsion, Roc SPF 8 (RoC SA, Paris, France). The tape stripped tesa films were measured with a modified UV/VIS spectrometer Lambda 5 (PerkinElmer, Frankfurt/Main, Germany), the data of which were used to calculate both measurands. The obtained results made clear that the original spectroscopic data must be corrected taking into account the changed amounts of horny layer particles removed with the individual tape strips after pre-treatment. As a consequence of the correction, the factors of inhomogeneity as well as the sum transmissions confirm a more homogeneous distribution of the applied sunscreen. The findings confirm that the applied method is well suited to obtain information on the distribution of topically applied substances, and furthermore that the influence of the pre-treatment of the skin with the body lotion enhances the homogeneity of distribution and thus the sunscreen efficacy. © 2011 John Wiley & Sons A/S.

Estimating age-specific reproductive numbers-A comparison of methods.

PubMed

Moser, Carlee B; White, Laura F

2016-01-01

Large outbreaks, such as those caused by influenza, put a strain on resources necessary for their control. In particular, children have been shown to play a key role in influenza transmission during recent outbreaks, and targeted interventions, such as school closures, could positively impact the course of emerging epidemics. As an outbreak is unfolding, it is important to be able to estimate reproductive numbers that incorporate this heterogeneity and to use surveillance data that is routinely collected to more effectively target interventions and obtain an accurate understanding of transmission dynamics. There are a growing number of methods that estimate age-group specific reproductive numbers with limited data that build on methods assuming a homogenously mixing population. In this article, we introduce a new approach that is flexible and improves on many aspects of existing methods. We apply this method to influenza data from two outbreaks, the 2009 H1N1 outbreaks in South Africa and Japan, to estimate age-group specific reproductive numbers and compare it to three other methods that also use existing data from social mixing surveys to quantify contact rates among different age groups. In this exercise, all estimates of the reproductive numbers for children exceeded the critical threshold of one and in most cases exceeded those of adults. We introduce a flexible new method to estimate reproductive numbers that describe heterogeneity in the population.

Nondestructive evaluation of the preservation state of stone columns in the Hospital Real of Granada

NASA Astrophysics Data System (ADS)

Moreno de Jong van Coevorden, C.; Cobos Sánchez, C.; Rubio Bretones, A.; Fernández Pantoja, M.; García, Salvador G.; Gómez Martín, R.

2012-12-01

This paper describes the results of the employment of two nondestructive evaluation methods for the diagnostic of the preservation state of stone elements. The first method is based on ultrasonic (US) pulses while the second method uses short electromagnetic pulses. Specifically, these methods were applied to some columns, some of them previously restored. These columns are part of the architectonic heritage of the University of Granada, in particular they are located at the patio de la capilla del Hospital Real of Granada. The objective of this work was the application of systems based on US pulses (in transmission mode) and the ground-penetrating radar systems (electromagnetic tomography) in the diagnosis and detection of possible faults in the interior of columns.

Properties of nanocrystalline Si layers embedded in structure of solar cell

NASA Astrophysics Data System (ADS)

Jurečka, Stanislav; Imamura, Kentaro; Matsumoto, Taketoshi; Kobayashi, Hikaru

2017-12-01

Suppression of spectral reflectance from the surface of solar cell is necessary for achieving a high energy conversion efficiency. We developed a simple method for forming nanocrystalline layers with ultralow reflectance in a broad range of wavelengths. The method is based on metal assisted etching of the silicon surface. In this work, we prepared Si solar cell structures with embedded nanocrystalline layers. The microstructure of embedded layer depends on the etching conditions. We examined the microstructure of the etched layers by a transmission electron microscope and analysed the experimental images by statistical and Fourier methods. The obtained results provide information on the applied treatment operations and can be used to optimize the solar cell forming procedure.

Plasma in-liquid method for reduction of zinc oxide in zinc nanoparticle synthesis

NASA Astrophysics Data System (ADS)

Amaliyah, Novriany; Mukasa, Shinobu; Nomura, Shinfuku; Toyota, Hiromichi; Kitamae, Tomohide

2015-02-01

Metal air-batteries with high-energy density are expected to be increasingly applied in electric vehicles. This will require a method of recycling air batteries, and reduction of metal oxide by generating plasma in liquid has been proposed as a possible method. Microwave-induced plasma is generated in ethanol as a reducing agent in which zinc oxide is dispersed. Analysis by energy-dispersive x-ray spectrometry (EDS) and x-ray diffraction (XRD) reveals the reduction of zinc oxide. According to images by transmission electron microscopy (TEM), cubic and hexagonal metallic zinc particles are formed in sizes of 30 to 200 nm. Additionally, spherical fiber flocculates approximately 180 nm in diameter are present.

Study of optimum methods of optical communication

NASA Technical Reports Server (NTRS)

Harger, R. O.

1972-01-01

Optimum methods of optical communication accounting for the effects of the turbulent atmosphere and quantum mechanics, both by the semi-classical method and the full-fledged quantum theoretical model are described. A concerted effort to apply the techniques of communication theory to the novel problems of optical communication by a careful study of realistic models and their statistical descriptions, the finding of appropriate optimum structures and the calculation of their performance and, insofar as possible, comparing them to conventional and other suboptimal systems are discussed. In this unified way the bounds on performance and the structure of optimum communication systems for transmission of information, imaging, tracking, and estimation can be determined for optical channels.

Protocol independent transmission method in software defined optical network

NASA Astrophysics Data System (ADS)

Liu, Yuze; Li, Hui; Hou, Yanfang; Qiu, Yajun; Ji, Yuefeng

2016-10-01

With the development of big data and cloud computing technology, the traditional software-defined network is facing new challenges (e.i., ubiquitous accessibility, higher bandwidth, more flexible management and greater security). Using a proprietary protocol or encoding format is a way to improve information security. However, the flow, which carried by proprietary protocol or code, cannot go through the traditional IP network. In addition, ultra- high-definition video transmission service once again become a hot spot. Traditionally, in the IP network, the Serial Digital Interface (SDI) signal must be compressed. This approach offers additional advantages but also bring some disadvantages such as signal degradation and high latency. To some extent, HD-SDI can also be regard as a proprietary protocol, which need transparent transmission such as optical channel. However, traditional optical networks cannot support flexible traffics . In response to aforementioned challenges for future network, one immediate solution would be to use NFV technology to abstract the network infrastructure and provide an all-optical switching topology graph for the SDN control plane. This paper proposes a new service-based software defined optical network architecture, including an infrastructure layer, a virtualization layer, a service abstract layer and an application layer. We then dwell on the corresponding service providing method in order to implement the protocol-independent transport. Finally, we experimentally evaluate that proposed service providing method can be applied to transmit the HD-SDI signal in the software-defined optical network.

A low delay transmission method of multi-channel video based on FPGA

NASA Astrophysics Data System (ADS)

Fu, Weijian; Wei, Baozhi; Li, Xiaobin; Wang, Quan; Hu, Xiaofei

2018-03-01

In order to guarantee the fluency of multi-channel video transmission in video monitoring scenarios, we designed a kind of video format conversion method based on FPGA and its DMA scheduling for video data, reduces the overall video transmission delay.In order to sace the time in the conversion process, the parallel ability of FPGA is used to video format conversion. In order to improve the direct memory access (DMA) writing transmission rate of PCIe bus, a DMA scheduling method based on asynchronous command buffer is proposed. The experimental results show that this paper designs a low delay transmission method based on FPGA, which increases the DMA writing transmission rate by 34% compared with the existing method, and then the video overall delay is reduced to 23.6ms.

Monolithic high voltage nonlinear transmission line fabrication process

DOEpatents

Cooper, G.A.

1994-10-04

A process for fabricating sequential inductors and varistor diodes of a monolithic, high voltage, nonlinear, transmission line in GaAs is disclosed. An epitaxially grown laminate is produced by applying a low doped active n-type GaAs layer to an n-plus type GaAs substrate. A heavily doped p-type GaAs layer is applied to the active n-type layer and a heavily doped n-type GaAs layer is applied to the p-type layer. Ohmic contacts are applied to the heavily doped n-type layer where diodes are desired. Multiple layers are then either etched away or Oxygen ion implanted to isolate individual varistor diodes. An insulator is applied between the diodes and a conductive/inductive layer is thereafter applied on top of the insulator layer to complete the process. 6 figs.

Preparation of three-dimensional mesoporous polymer in situ polymerization solid phase microextraction fiber and its application to the determination of seven chlorophenols.

PubMed

Wang, Xuemei; Wang, Huan; Huang, Pengfei; Ma, Xiaomin; Lu, Xiaoquan; Du, Xinzhen

2017-01-06

A superior solid-phase microextraction (SPME) fiber-coating material, three dimensional order mesoporous polymers with Ia-3d bicontinuous cubic structure (3D-OMPs) was in situ coated on a stainless steel wire by solvent evaporation induced self-assembly (EISA) and thermo-polymerization. Fourier-transform infrared spectrometry (FTIR), transmission electron microscopy (TEM), scanning electron microscopy (SEM), small-angel X-ray diffraction (SAXRD), N 2 adsorption-desorption transmission, and thermogravimetry analysis (TGA) were applied to the characterization of the synthesized 3D-OMPs coating. The performance and feasibility of the homemade fiber was evaluated through direct immersion (DI) SPME followed by high-performance liquid chromatography-UV detector (HPLC-UV) for the simultaneous extraction of seven chlorophenols in water samples. Under the optimum conditions, the prepared fiber exhibited excellent extraction properties as compared to three commercial fibers, the DI-SPME-HPLC-UV method showed low limits of detection (0.32-1.85μgL -1 ), wide linear ranges (5.0-1000μgL -1 ), and acceptable reproducibility (relative standard deviation, RSD<7.6% for one fiber, RSD<8.9% for fiber to fiber). Moreover, the method was further successfully applied to the analysis of seven CPs in real samples with good recoveries (80.5-99.5%) and satisfactory precisions (RSD<9.2%). It was confirmed that the proposed method has high sensitivity, outstanding selectivity and good reproducibility to the determination of trace CPs in the environmental water. Copyright © 2016 Elsevier B.V. All rights reserved.

A reusability and efficiency oriented software design method for mobile land inspection

NASA Astrophysics Data System (ADS)

Cai, Wenwen; He, Jun; Wang, Qing

2008-10-01

Aiming at the requirement from the real-time land inspection domain, a land inspection handset system was presented in this paper. In order to increase the reusability of the system, a design pattern based framework was presented. Encapsulation for command like actions by applying COMMAND pattern was proposed for the problem of complex UI interactions. Integrating several GPS-log parsing engines into a general parsing framework was archived by introducing STRATEGY pattern. A network transmission module based network middleware was constructed. For mitigating the high coupling of complex network communication programs, FACTORY pattern was applied to facilitate the decoupling. Moreover, in order to efficiently manipulate huge GIS datasets, a VISITOR pattern and Quad-tree based multi-scale representation method was presented. It had been proved practically that these design patterns reduced the coupling between the subsystems, and improved the expansibility.

Applied photo interpretation for airbrush cartography

NASA Technical Reports Server (NTRS)

Inge, J. L.; Bridges, P. M.

1976-01-01

Lunar and planetary exploration has required the development of new techniques of cartographic portrayal. Conventional photo-interpretive methods employing size, shape, shadow, tone, pattern, and texture are applied to computer-processed satellite television images. Comparative judgements are affected by illumination, resolution, variations in surface coloration, and transmission or processing artifacts. The portrayal of tonal densities in a relief illustration is performed using a unique airbrush technique derived from hill-shading of contour maps. The control of tone and line quality is essential because the mid-gray to dark tone densities must be finalized prior to the addition of highlights to the drawing. This is done with an electric eraser until the drawing is completed. The drawing density is controlled with a reflectance-reading densitometer to meet certain density guidelines. The versatility of planetary photo-interpretive methods for airbrushed map portrayals is demonstrated by the application of these techniques to the synthesis of nonrelief data.

A methodology for using borehole temperature-depth profiles under ambient, single and cross-borehole pumping conditions to estimate fracture hydraulic properties

NASA Astrophysics Data System (ADS)

Klepikova, Maria V.; Le Borgne, Tanguy; Bour, Olivier; Davy, Philippe

2011-09-01

SummaryTemperature profiles in the subsurface are known to be sensitive to groundwater flow. Here we show that they are also strongly related to vertical flow in the boreholes themselves. Based on a numerical model of flow and heat transfer at the borehole scale, we propose a method to invert temperature measurements to derive borehole flow velocities. This method is applied to an experimental site in fractured crystalline rocks. Vertical flow velocities deduced from the inversion of temperature measurements are compared with direct heat-pulse flowmeter measurements showing a good agreement over two orders of magnitudes. Applying this methodology under ambient, single and cross-borehole pumping conditions allows us to estimate fracture hydraulic head and local transmissivity, as well as inter-borehole fracture connectivity. Thus, these results provide new insights on how to include temperature profiles in inverse problems for estimating hydraulic fracture properties.

Differences in the Selection Bottleneck between Modes of Sexual Transmission Influence the Genetic Composition of the HIV-1 Founder Virus

PubMed Central

Tully, Damien C.; Ogilvie, Colin B.; Batorsky, Rebecca E.; Bean, David J.; Power, Karen A.; Ghebremichael, Musie; Bedard, Hunter E.; Gladden, Adrianne D.; Seese, Aaron M.; Amero, Molly A.; Lane, Kimberly; McGrath, Graham; Bazner, Suzane B.; Tinsley, Jake; Lennon, Niall J.; Henn, Matthew R.; Brumme, Zabrina L.; Norris, Philip J.; Rosenberg, Eric S.; Mayer, Kenneth H.; Jessen, Heiko; Kosakovsky Pond, Sergei L.; Walker, Bruce D.; Altfeld, Marcus; Carlson, Jonathan M.; Allen, Todd M.

2016-01-01

Due to the stringent population bottleneck that occurs during sexual HIV-1 transmission, systemic infection is typically established by a limited number of founder viruses. Elucidation of the precise forces influencing the selection of founder viruses may reveal key vulnerabilities that could aid in the development of a vaccine or other clinical interventions. Here, we utilize deep sequencing data and apply a genetic distance-based method to investigate whether the mode of sexual transmission shapes the nascent founder viral genome. Analysis of 74 acute and early HIV-1 infected subjects revealed that 83% of men who have sex with men (MSM) exhibit a single founder virus, levels similar to those previously observed in heterosexual (HSX) transmission. In a metadata analysis of a total of 354 subjects, including HSX, MSM and injecting drug users (IDU), we also observed no significant differences in the frequency of single founder virus infections between HSX and MSM transmissions. However, comparison of HIV-1 envelope sequences revealed that HSX founder viruses exhibited a greater number of codon sites under positive selection, as well as stronger transmission indices possibly reflective of higher fitness variants. Moreover, specific genetic “signatures” within MSM and HSX founder viruses were identified, with single polymorphisms within gp41 enriched among HSX viruses while more complex patterns, including clustered polymorphisms surrounding the CD4 binding site, were enriched in MSM viruses. While our findings do not support an influence of the mode of sexual transmission on the number of founder viruses, they do demonstrate that there are marked differences in the selection bottleneck that can significantly shape their genetic composition. This study illustrates the complex dynamics of the transmission bottleneck and reveals that distinct genetic bottleneck processes exist dependent upon the mode of HIV-1 transmission. PMID:27163788

Differences in the Selection Bottleneck between Modes of Sexual Transmission Influence the Genetic Composition of the HIV-1 Founder Virus.

PubMed

Tully, Damien C; Ogilvie, Colin B; Batorsky, Rebecca E; Bean, David J; Power, Karen A; Ghebremichael, Musie; Bedard, Hunter E; Gladden, Adrianne D; Seese, Aaron M; Amero, Molly A; Lane, Kimberly; McGrath, Graham; Bazner, Suzane B; Tinsley, Jake; Lennon, Niall J; Henn, Matthew R; Brumme, Zabrina L; Norris, Philip J; Rosenberg, Eric S; Mayer, Kenneth H; Jessen, Heiko; Kosakovsky Pond, Sergei L; Walker, Bruce D; Altfeld, Marcus; Carlson, Jonathan M; Allen, Todd M

2016-05-01

Due to the stringent population bottleneck that occurs during sexual HIV-1 transmission, systemic infection is typically established by a limited number of founder viruses. Elucidation of the precise forces influencing the selection of founder viruses may reveal key vulnerabilities that could aid in the development of a vaccine or other clinical interventions. Here, we utilize deep sequencing data and apply a genetic distance-based method to investigate whether the mode of sexual transmission shapes the nascent founder viral genome. Analysis of 74 acute and early HIV-1 infected subjects revealed that 83% of men who have sex with men (MSM) exhibit a single founder virus, levels similar to those previously observed in heterosexual (HSX) transmission. In a metadata analysis of a total of 354 subjects, including HSX, MSM and injecting drug users (IDU), we also observed no significant differences in the frequency of single founder virus infections between HSX and MSM transmissions. However, comparison of HIV-1 envelope sequences revealed that HSX founder viruses exhibited a greater number of codon sites under positive selection, as well as stronger transmission indices possibly reflective of higher fitness variants. Moreover, specific genetic "signatures" within MSM and HSX founder viruses were identified, with single polymorphisms within gp41 enriched among HSX viruses while more complex patterns, including clustered polymorphisms surrounding the CD4 binding site, were enriched in MSM viruses. While our findings do not support an influence of the mode of sexual transmission on the number of founder viruses, they do demonstrate that there are marked differences in the selection bottleneck that can significantly shape their genetic composition. This study illustrates the complex dynamics of the transmission bottleneck and reveals that distinct genetic bottleneck processes exist dependent upon the mode of HIV-1 transmission.

Quantitative assessment of the probability of bluetongue virus transmission by bovine semen and effectiveness of preventive measures.

PubMed

Napp, S; Allepuz, A; García-Bocanegra, I; Alba, A; Vilar, M J; Casal, J

2011-03-15

Given that bluetongue (BT) may potentially be transmitted by semen, that the disease has significantly expanded in recent years, and that millions of doses of cattle semen are annually traded throughout the world, the transmission of bluetongue virus (BTV) by semen could have severe consequences in the cattle industry. The hypothesis that infected bulls could excrete BTV in their semen led to restrictions on international trade of ruminant semen and the establishment of measures to prevent BTV transmission by semen. However, neither the risk of BTV transmission by semen nor the effectiveness of these measures was estimated quantitatively. The objective of the study was to assess, in case of introduction of BTV into a bovine semen collection centre (SCC), both the risk of BTV transmission by bovine semen and the risk reduction achieved by some of the preventive measures, by means of a stochastic risk assessment model. The model was applied to different scenarios, depending on for example the type of diagnostic test and the interval between the controls (testing) of donor bulls, or the rate of BTV spread within the SCC. Enzyme-linked immunosorbant assay (ELISA) controls of donor bulls every 60 days seemed to be an ineffective method for reducing the risk of BTV transmission in contrast to polymerase chain reaction (PCR) tests every 28 days. An increase in the rate of spread within the SCC resulted in a reduced risk of BTV transmission by semen. The storage of semen for 30 days prior to dispatch seemed to be an efficient way of reducing the risk of transmission by semen. The sensitivity analysis identified the probability of BTV shedding in semen as a crucial parameter in the probability of BTV transmission by semen. However, there is a great degree of uncertainty associated with this parameter, with significant differences depending on the BTV serotype. Copyright © 2011 Elsevier Inc. All rights reserved.

Modeling the effects of weather and climate change on malaria transmission.

PubMed

Parham, Paul Edward; Michael, Edwin

2010-05-01

In recent years, the impact of climate change on human health has attracted considerable attention; the effects on malaria have been of particular interest because of its disease burden and its transmission sensitivity to environmental conditions. We investigated and illustrated the role that dynamic process-based mathematical models can play in providing strategic insights into the effects of climate change on malaria transmission. We evaluated a relatively simple model that permitted valuable and novel insights into the simultaneous effects of rainfall and temperature on mosquito population dynamics, malaria invasion, persistence and local seasonal extinction, and the impact of seasonality on transmission. We illustrated how large-scale climate simulations and infectious disease systems may be modeled and analyzed and how these methods may be applied to predicting changes in the basic reproduction number of malaria across Tanzania. We found extinction to be more strongly dependent on rainfall than on temperature and identified a temperature window of around 32-33 degrees C where endemic transmission and the rate of spread in disease-free regions is optimized. This window was the same for Plasmodium falciparum and P. vivax, but mosquito density played a stronger role in driving the rate of malaria spread than did the Plasmodium species. The results improved our understanding of how temperature shifts affect the global distribution of at-risk regions, as well as how rapidly malaria outbreaks take off within vulnerable populations. Disease emergence, extinction, and transmission all depend strongly on climate. Mathematical models offer powerful tools for understanding geographic shifts in incidence as climate changes. Nonlinear dependences of transmission on climate necessitates consideration of both changing climate trends and variability across time scales of interest.

Adaptive social learning strategies in temporally and spatially varying environments : how temporal vs. spatial variation, number of cultural traits, and costs of learning influence the evolution of conformist-biased transmission, payoff-biased transmission, and individual learning.

PubMed

Nakahashi, Wataru; Wakano, Joe Yuichiro; Henrich, Joseph

2012-12-01

Long before the origins of agriculture human ancestors had expanded across the globe into an immense variety of environments, from Australian deserts to Siberian tundra. Survival in these environments did not principally depend on genetic adaptations, but instead on evolved learning strategies that permitted the assembly of locally adaptive behavioral repertoires. To develop hypotheses about these learning strategies, we have modeled the evolution of learning strategies to assess what conditions and constraints favor which kinds of strategies. To build on prior work, we focus on clarifying how spatial variability, temporal variability, and the number of cultural traits influence the evolution of four types of strategies: (1) individual learning, (2) unbiased social learning, (3) payoff-biased social learning, and (4) conformist transmission. Using a combination of analytic and simulation methods, we show that spatial-but not temporal-variation strongly favors the emergence of conformist transmission. This effect intensifies when migration rates are relatively high and individual learning is costly. We also show that increasing the number of cultural traits above two favors the evolution of conformist transmission, which suggests that the assumption of only two traits in many models has been conservative. We close by discussing how (1) spatial variability represents only one way of introducing the low-level, nonadaptive phenotypic trait variation that so favors conformist transmission, the other obvious way being learning errors, and (2) our findings apply to the evolution of conformist transmission in social interactions. Throughout we emphasize how our models generate empirical predictions suitable for laboratory testing.

A multiple reflection model for the investigation of infrared transmission of a graphene/substrate system

NASA Astrophysics Data System (ADS)

Zhang, Jie; Ding, Lan; Liang, Changneng; Xiao, Yiming; Xu, Wen

2017-11-01

We develop a multiple reflection model (MRM) for the examination of infrared transmission properties of a graphene/substrate system. The incident angle and the multiple reflection beams in the substrate with finite thickness are taken into consideration. The model can be applied to predict the optical responses of graphene/substrate systems or to extract the real part of the optical conductance of graphene from the experimental measurement. As an example, we calculate the relative transmittance of graphene/quartz and graphene/sapphire systems by using MRM and provide an experimental verification in the near-infrared range. The measured results show good agreement with the calculated ones. Our method can be easily extended to accurately and non-invasively identify the layer numbers of other 2D materials, and assess the quality of them.

A laboratory 8 keV transmission full-field x-ray microscope with a polycapillary as condenser for bright and dark field imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baumbach, S., E-mail: baumbach@rheinahrcampus.de; Wilhein, T.; Kanngießer, B.

2015-08-15

This article introduces a laboratory setup of a transmission full-field x-ray microscope at 8 keV photon energy. The microscope operates in bright and dark field imaging mode with a maximum field of view of 50 μm. Since the illumination geometry determines whether the sample is illuminated homogeneously and moreover, if different imaging methods can be applied, the condenser optic is one of the most significant parts. With a new type of x-ray condenser, a polycapillary optic, we realized bright field imaging and for the first time dark field imaging at 8 keV photon energy in a laboratory setup. A detectormore » limited spatial resolution of 210 nm is measured on x-ray images of Siemens star test patterns.« less

A laboratory 8 keV transmission full-field x-ray microscope with a polycapillary as condenser for bright and dark field imaging.

PubMed

Baumbach, S; Kanngießer, B; Malzer, W; Stiel, H; Wilhein, T

2015-08-01

This article introduces a laboratory setup of a transmission full-field x-ray microscope at 8 keV photon energy. The microscope operates in bright and dark field imaging mode with a maximum field of view of 50 μm. Since the illumination geometry determines whether the sample is illuminated homogeneously and moreover, if different imaging methods can be applied, the condenser optic is one of the most significant parts. With a new type of x-ray condenser, a polycapillary optic, we realized bright field imaging and for the first time dark field imaging at 8 keV photon energy in a laboratory setup. A detector limited spatial resolution of 210 nm is measured on x-ray images of Siemens star test patterns.

Determination of nongeometric effects: equivalence between Artmann's and Tamir's generalized methods.

PubMed

Perez, Liliana I; Echarri, Rodolfo M; Garea, María T; Santiago, Guillermo D

2011-03-01

This work shows that all first- and second-order nongeometric effects on propagation, total or partial reflection, and transmission can be understood and evaluated considering the superposition of two plane waves. It also shows that this description yields results that are qualitatively and quantitatively compatible with those obtained by Fourier analysis of beams with Gaussian intensity distribution in any type of interface. In order to show this equivalence, we start by describing the first- and second-order nongeometric effects, and we calculate them analytically by superposing two plane waves. Finally, these results are compared with those obtained for the nongeometric effects of Gaussian beams in isotropic interfaces and are applied to different types of interfaces. A simple analytical expression for the angular shift is obtained considering the transmission of an extraordinary beam in a uniaxial-isotropic interface.

Continuously Variable Transmission

NASA Technical Reports Server (NTRS)

Grana, D. C.

1985-01-01

Chain slides along two cones, in novel transmission concept. Transmission includes chain drive between two splined shafts. Chain sprockets follow surfaces of two cones. As one chain sprocket moves toward smaller diameter other chain sprocket moves toward larger diameter, thereby changing "gear" ratio. Movement initiated by tension applied to chain by planetary gear mechanism. Device positive, simple, and efficient over wide range of speed ratios.

Variable ratio regenerative braking device

DOEpatents

Hoppie, Lyle O.

1981-12-15

Disclosed is a regenerative braking device (10) for an automotive vehicle. The device includes an energy storage assembly (12) having a plurality of rubber rollers (26, 28) mounted for rotation between an input shaft (36) and an output shaft (42), clutches (38, 46) and brakes (40, 48) associated with each shaft, and a continuously variable transmission (22) connectable to a vehicle drivetrain and to the input and output shafts by the respective clutches. The rubber rollers are torsionally stressed to accumulate energy from the vehicle when the input shaft is clutched to the transmission while the brake on the output shaft is applied, and are torsionally relaxed to deliver energy to the vehicle when the output shaft is clutched to the transmission while the brake on the input shaft is applied. The transmission ratio is varied to control the rate of energy accumulation and delivery for a given rotational speed of the vehicle drivetrain.

Geometrical optics in the near field: local plane-interface approach with evanescent waves.

PubMed

Bose, Gaurav; Hyvärinen, Heikki J; Tervo, Jani; Turunen, Jari

2015-01-12

We show that geometrical models may provide useful information on light propagation in wavelength-scale structures even if evanescent fields are present. We apply a so-called local plane-wave and local plane-interface methods to study a geometry that resembles a scanning near-field microscope. We show that fair agreement between the geometrical approach and rigorous electromagnetic theory can be achieved in the case where evanescent waves are required to predict any transmission through the structure.

Location of laccase in ordered mesoporous materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Location of laccase in ordered mesoporous materials

NASA Astrophysics Data System (ADS)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Asymmetrical external effects on transmission, conductance and giant tunneling magnetoresistance in silicene

NASA Astrophysics Data System (ADS)

Oubram, O.; Navarro, O.; Guzmán, E. J.; Rodríguez-Vargas, I.

2018-01-01

Electron transport in a silicene structure, composed of a pair of magnetic gates, is studied in a ferromagnetic and antiferromagnetic configuration. The transport properties are investigated for asymmetrical external effects like an electrostatic potential, a magnetic field and for asymmetrical geometric structure. This theoretical study, has been done using the matrix transfer method to calculate the transmission, the conductance for parallel and antiparallel magnetic alignment and the tunneling magnetoresistance (TMR). In Particular, we have found that the transmission, conductance and magnetoresistance oscillate as a function of the width of barriers. It is also found that a best control and high values of TMR spectrum are achieved by an asymmetrical application of the contact voltage. Besides, we have shown that the TMR is enhanced several orders of magnitude by the combined asymmetrical magnetization effect with an adequate applied electrostatic potential. Whereby, the asymmetrical external effects play an important role to improve TMR than symmetrical ones. Finally, the giant TMR can be flexibly modulated by incident energy and a specific asymmetrical application of control voltage. These results could be useful to design filters and digital nanodevices.

Generation of noncircular gears for variable motion of the crank-slider mechanism

NASA Astrophysics Data System (ADS)

Niculescu, M.; Andrei, L.; Cristescu, A.

2016-08-01

The paper proposes a modified kinematics for the crank-slider mechanism of a nails machine. The variable rotational motion of the driven gear allows to slow down the velocity of the slider in the head forming phase and increases the period for the forming forces to be applied, improving the quality of the final product. The noncircular gears are designed based on a hybrid function for the gear transmission ratio whose parameters enable multiple variations of the noncircular driven gears and crack-slider mechanism kinematics, respectively. The AutoCAD graphical and programming facilities are used (i) to analyse and optimize the slider-crank mechanism output functions, in correlation with the predefined noncircular gears transmission ratio, (ii) to generate the noncircular centrodes using the kinematics hypothesis, (iii) to generate the variable geometry of the gear teeth profiles, based on the rolling method, and (iv) to produce the gears solid virtual models. The study highlights the benefits/limits that the noncircular gears transmission ratio defining hybrid functions have on both crank-slider mechanism kinematics and gears geometry.

Securing electronic medical record in Near Field Communication using Advanced Encryption Standard (AES).

PubMed

Renardi, Mikhael Bagus; Basjaruddin, Noor Cholis; Rakhman, Edi

2018-01-01

Doctors usually require patients' medical records before medical examinations. Nevertheless, obtaining such records may take time. Hence, Near Field Communication (NFC) could be used to store and send medical records between doctors and patients. Another issue is that there could be a threat such as, Man In The Middle Attack and eavesdropping, thus, a security method is required to secure the data. Furthermore, the information regarding the key and initialisation vector in NFC cannot be sent using one data package, hence, the data transmission should be done several times. Therefore, the initialisation vector that changed in each transmission is implemented, and the key utilised is based on the component agreed by both parties. This study aims at applying the cryptography process that does disturb and hinder the speed of data transmission. The result demonstrated that the data transmitted could be secured and the encryption process did not hinder data exchange. Also, different number of characters in plaintexts required different amount of time for encryption and decryption. It could be affected by the specifications of the devices used and the processes happening in the devices.

Physical mechanisms of active control of sound transmission through rib stiffened double-panel structure

NASA Astrophysics Data System (ADS)

Ma, Xiyue; Chen, Kean; Ding, Shaohu; Yu, Haoxin

2016-06-01

This paper presents an analytical investigation on physical mechanisms of actively controlling sound transmission through a rib stiffened double-panel structure using point source in the cavity. The combined modal expansion and vibro-acoustic coupling methods are applied to establish the theoretical model of such active structure. Under the condition of minimizing radiated power of the radiating ribbed plate, the physical mechanisms are interpreted in detail from the point of view of modal couplings similar as that used in existed literatures. Results obtained demonstrate that the rule of sound energy transmission and the physical mechanisms for the rib stiffened double-panel structure are all changed, and affected by the coupling effects of the rib when compared with the analytical results obtained for unribbed double-panel case. By taking the coupling effects of the rib into considerations, the cavity modal suppression and rearrangement mechanisms obtained in existed investigations are modified and supplemented for the ribbed plate case, which gives a clear interpretation for the physical nature involved in the active rib stiffened double-panel structure.

Sound Transmission through Cylindrical Shell Structures Excited by Boundary Layer Pressure Fluctuations

NASA Technical Reports Server (NTRS)

Tang, Yvette Y.; Silcox, Richard J.; Robinson, Jay H.

1996-01-01

This paper examines sound transmission into two concentric cylindrical sandwich shells subject to turbulent flow on the exterior surface of the outer shell. The interior of the shells is filled with fluid medium and there is an airgap between the shells in the annular space. The description of the pressure field is based on the cross-spectral density formulation of Corcos, Maestrello, and Efimtsov models of the turbulent boundary layer. The classical thin shell theory and the first-order shear deformation theory are applied for the inner and outer shells, respectively. Modal expansion and the Galerkin approach are used to obtain closed-form solutions for the shell displacements and the radiation and transmission pressures in the cavities including both the annular space and the interior. The average spectral density of the structural responses and the transmitted interior pressures are expressed explicitly in terms of the summation of the cross-spectral density of generalized force induced by the boundary layer turbulence. The effects of acoustic and hydrodynamic coincidences on the spectral density are observed. Numerical examples are presented to illustrate the method for both subsonic and supersonic flows.

An evaluation method of computer usability based on human-to-computer information transmission model.

PubMed

Ogawa, K

1992-01-01

This paper proposes a new evaluation and prediction method for computer usability. This method is based on our two previously proposed information transmission measures created from a human-to-computer information transmission model. The model has three information transmission levels: the device, software, and task content levels. Two measures, called the device independent information measure (DI) and the computer independent information measure (CI), defined on the software and task content levels respectively, are given as the amount of information transmitted. Two information transmission rates are defined as DI/T and CI/T, where T is the task completion time: the device independent information transmission rate (RDI), and the computer independent information transmission rate (RCI). The method utilizes the RDI and RCI rates to evaluate relatively the usability of software and device operations on different computer systems. Experiments using three different systems, in this case a graphical information input task, confirm that the method offers an efficient way of determining computer usability.

Statistical analysis of donation--transfusion data with complex correlation.

PubMed

Reilly, Marie; Szulkin, Robert

2007-12-30

Blood-borne transmission of disease is estimated from linked data records from blood donors and transfusion recipients. However, such data are characterized by complex correlation due to donors typically contributing many donations and recipients being transfused with multiple units of blood product. In this paper, we present a method for analysing such data, by using a modification of a nested case-control design. For recipients who develop the disease of interest (cases) and their matched controls, all donors who contributed blood to these individuals define clusters or 'families' of related individuals. Using a Cox regression model for the hazard of the individuals within clusters of donors, we estimate the risk of transmission, and a bootstrap step provides valid standard errors provided the clusters are independent. As an illustration, we apply the method to the analysis of a large database of Swedish donor and recipient records linked to the population cancer register. We investigate whether there is an increased risk of cancer in recipients transfused with blood from donors who develop cancer after donating. Our method provides a powerful alternative to the small 'look-back' studies typical of transfusion medicine and can make an important contribution to haemovigilance efforts. Copyright (c) 2007 John Wiley & Sons, Ltd.

Genetic markers, genotyping methods & next generation sequencing in Mycobacterium tuberculosis

PubMed Central

Desikan, Srinidhi; Narayanan, Sujatha

2015-01-01

Molecular epidemiology (ME) is one of the main areas in tuberculosis research which is widely used to study the transmission epidemics and outbreaks of tubercle bacilli. It exploits the presence of various polymorphisms in the genome of the bacteria that can be widely used as genetic markers. Many DNA typing methods apply these genetic markers to differentiate various strains and to study the evolutionary relationships between them. The three widely used genotyping tools to differentiate Mycobacterium tuberculosis strains are IS6110 restriction fragment length polymorphism (RFLP), spacer oligotyping (Spoligotyping), and mycobacterial interspersed repeat units - variable number of tandem repeats (MIRU-VNTR). A new prospect towards ME was introduced with the development of whole genome sequencing (WGS) and the next generation sequencing (NGS) methods, where the entire genome is sequenced that not only helps in pointing out minute differences between the various sequences but also saves time and the cost. NGS is also found to be useful in identifying single nucleotide polymorphisms (SNPs), comparative genomics and also various aspects about transmission dynamics. These techniques enable the identification of mycobacterial strains and also facilitate the study of their phylogenetic and evolutionary traits. PMID:26205019

Computational fluid dynamics and frequency-dependent finite-difference time-domain method coupling for the interaction between microwaves and plasma in rocket plumes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kinefuchi, K.; Funaki, I.; Shimada, T.

Under certain conditions during rocket flights, ionized exhaust plumes from solid rocket motors may interfere with radio frequency transmissions. To understand the relevant physical processes involved in this phenomenon and establish a prediction process for in-flight attenuation levels, we attempted to measure microwave attenuation caused by rocket exhaust plumes in a sea-level static firing test for a full-scale solid propellant rocket motor. The microwave attenuation level was calculated by a coupling simulation of the inviscid-frozen-flow computational fluid dynamics of an exhaust plume and detailed analysis of microwave transmissions by applying a frequency-dependent finite-difference time-domain method with the Drude dispersion model.more » The calculated microwave attenuation level agreed well with the experimental results, except in the case of interference downstream the Mach disk in the exhaust plume. It was concluded that the coupling estimation method based on the physics of the frozen plasma flow with Drude dispersion would be suitable for actual flight conditions, although the mixing and afterburning in the plume should be considered depending on the flow condition.« less

An analytical method to determine ground water supply well network designs.

PubMed

MacMillan, Gordon James

2009-01-01

An analytical method is provided where the ground water practitioner can quickly determine the size (number of wells) and spacing of a well network capable of meeting a known ground water demand. In order to apply the method, two new parameters are derived that relate theoretical drawdown to the maximum drawdown that is achievable without mining the aquifer. The size of a well network is shown to be proportional to the ground water demand and inversely proportional to the transmissivity and available head. The spacing between wells in a supply well network is shown to be most sensitive to a derived parameter r(HA/3) , which is related to the available head and the propagation of drawdown away from a theoretical well if the total ground water demand was applied to that well. The method can be used to quickly determine the required spacing between wells in well networks of various sizes that are completed in confined aquifers with no leakance. Copyright © 2009 The Author(s). Journal Compilation © 2009 National Ground Water Association.

DNA based random key generation and management for OTP encryption.

PubMed

Zhang, Yunpeng; Liu, Xin; Sun, Manhui

2017-09-01

One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

Average Dielectric Property Analysis of Complex Breast Tissue with Microwave Transmission Measurements

PubMed Central

Garrett, John D.; Fear, Elise C.

2015-01-01

Prior information about the average dielectric properties of breast tissue can be implemented in microwave breast imaging techniques to improve the results. Rapidly providing this information relies on acquiring a limited number of measurements and processing these measurement with efficient algorithms. Previously, systems were developed to measure the transmission of microwave signals through breast tissue, and simplifications were applied to estimate the average properties. These methods provided reasonable estimates, but they were sensitive to multipath. In this paper, a new technique to analyze the average properties of breast tissues while addressing multipath is presented. Three steps are used to process transmission measurements. First, the effects of multipath were removed. In cases where multipath is present, multiple peaks were observed in the time domain. A Tukey window was used to time-gate a single peak and, therefore, select a single path through the breast. Second, the antenna response was deconvolved from the transmission coefficient to isolate the response from the tissue in the breast interior. The antenna response was determined through simulations. Finally, the complex permittivity was estimated using an iterative approach. This technique was validated using simulated and physical homogeneous breast models and tested with results taken from a recent patient study. PMID:25585106

The molecular epidemiology of HIV-1 in the Comunidad Valenciana (Spain): analysis of transmission clusters.

PubMed

Patiño-Galindo, Juan Ángel; Torres-Puente, Manoli; Bracho, María Alma; Alastrué, Ignacio; Juan, Amparo; Navarro, David; Galindo, María José; Ocete, Dolores; Ortega, Enrique; Gimeno, Concepción; Belda, Josefina; Domínguez, Victoria; Moreno, Rosario; González-Candelas, Fernando

2017-09-14

HIV infections are still a very serious concern for public heath worldwide. We have applied molecular evolution methods to study the HIV-1 epidemics in the Comunidad Valenciana (CV, Spain) from a public health surveillance perspective. For this, we analysed 1804 HIV-1 sequences comprising protease and reverse transcriptase (PR/RT) coding regions, sampled between 2004 and 2014. These sequences were subtyped and subjected to phylogenetic analyses in order to detect transmission clusters. In addition, univariate and multinomial comparisons were performed to detect epidemiological differences between HIV-1 subtypes, and risk groups. The HIV epidemic in the CV is dominated by subtype B infections among local men who have sex with men (MSM). 270 transmission clusters were identified (>57% of the dataset), 12 of which included ≥10 patients; 11 of subtype B (9 affecting MSMs) and one (n = 21) of CRF14, affecting predominately intravenous drug users (IDUs). Dated phylogenies revealed these large clusters to have originated from the mid-80s to the early 00 s. Subtype B is more likely to form transmission clusters than non-B variants and MSMs to cluster than other risk groups. Multinomial analyses revealed an association between non-B variants, which are not established in the local population yet, and different foreign groups.

Performance improvement of continuous-variable quantum key distribution with an entangled source in the middle via photon subtraction

NASA Astrophysics Data System (ADS)

Guo, Ying; Liao, Qin; Wang, Yijun; Huang, Duan; Huang, Peng; Zeng, Guihua

2017-03-01

A suitable photon-subtraction operation can be exploited to improve the maximal transmission of continuous-variable quantum key distribution (CVQKD) in point-to-point quantum communication. Unfortunately, the photon-subtraction operation faces solving the improvement transmission problem of practical quantum networks, where the entangled source is located in the third part, which may be controlled by a malicious eavesdropper, instead of in one of the trusted parts, controlled by Alice or Bob. In this paper, we show that a solution can come from using a non-Gaussian operation, in particular, the photon-subtraction operation, which provides a method to enhance the performance of entanglement-based (EB) CVQKD. Photon subtraction not only can lengthen the maximal transmission distance by increasing the signal-to-noise rate but also can be easily implemented with existing technologies. Security analysis shows that CVQKD with an entangled source in the middle (ESIM) from applying photon subtraction can well increase the secure transmission distance in both direct and reverse reconciliations of the EB-CVQKD scheme, even if the entangled source originates from an untrusted part. Moreover, it can defend against the inner-source attack, which is a specific attack by an untrusted entangled source in the framework of ESIM.

On increasing the spectral efficiency and transmissivity in the data transmission channel on the spacecraft-ground tracking station line

NASA Astrophysics Data System (ADS)

Andrianov, M. N.; Kostenko, V. I.; Likhachev, S. F.

2018-01-01

The algorithms for achieving a practical increase in the rate of data transmission on the space-craft-ground tracking station line has been considered. This increase is achieved by applying spectral-effective modulation techniques, the technology of orthogonal frequency compression of signals using millimeterrange radio waves. The advantages and disadvantages of each of three algorithms have been revealed. A significant advantage of data transmission in the millimeter range has been indicated.

Welding-fume-induced transmission loss in tapered optical fibers

NASA Astrophysics Data System (ADS)

Yi, Ji-Haeng

2015-09-01

This paper presents a method for sensing welding fumes in real time. This method is based on the results of nanoparticle-induced optical-fiber loss experiments that show that the losses are determined by the nanoparticle density and the taper waist. The tapered fiber is obtained by applying heat radiated from hot quartz, and monitoring is done in real time. First, the durability of the tapered fiber during the welding process is proven. Then, the loss is categorized by using the sizes of welding fume particles. The sensitivity to welding fumes increases with increasing size of the particles; consequently, the dimension of the taper waist decreases.

The narrow pass band filter of tunable 1D phononic crystals with a dielectric elastomer layer

NASA Astrophysics Data System (ADS)

Wu, Liang-Yu; Wu, Mei-Ling; Chen, Lien-Wen

2009-01-01

In this paper, we study the defect bands of a 1D phononic crystal consisting of aluminum (Al) and polymethyl methacrylate (PMMA) layers with a dielectric elastomer (DE) defect layer. The plane wave expansion (PWE) method and supercell calculation are used to calculate the band structure and the defect bands. The transmission spectra are obtained using the finite element method (FEM). Since the thickness of the dielectric elastomer defect layer is controlled by applying an electric voltage, the frequencies of the defect bands can be tuned. A narrow pass band filter can be developed and designed by using the dielectric elastomer.

Airborne sound transmission loss characteristics of wood-frame construction

NASA Astrophysics Data System (ADS)

Rudder, F. F., Jr.

1985-03-01

This report summarizes the available data on the airborne sound transmission loss properties of wood-frame construction and evaluates the methods for predicting the airborne sound transmission loss. The first part of the report comprises a summary of sound transmission loss data for wood-frame interior walls and floor-ceiling construction. Data bases describing the sound transmission loss characteristics of other building components, such as windows and doors, are discussed. The second part of the report presents the prediction of the sound transmission loss of wood-frame construction. Appropriate calculation methods are described both for single-panel and for double-panel construction with sound absorption material in the cavity. With available methods, single-panel construction and double-panel construction with the panels connected by studs may be adequately characterized. Technical appendices are included that summarize laboratory measurements, compare measurement with theory, describe details of the prediction methods, and present sound transmission loss data for common building materials.

A short-range optical wireless transmission method based on LED

NASA Astrophysics Data System (ADS)

Miao, Meiyuan; Chen, Ailin; Zhu, Mingxing; Li, Ping; Gao, Yingming; Zou, Nianyu

2016-10-01

As to electromagnetic wave interfere and only one to one transmission problem of Bluetooth, a short-range LED optical wireless transmission method is proposed to be complementary technology in this paper. Furthermore achieved image transmission through this method. The system makes C52 to be the mater controller, transmitter got data from terminals by USB and sends modulated signals with LED. Optical signal is detected by PD, through amplified, filtered with shaping wave from, and demodulated on receiver. Then send to terminals like PC and reverted back to original image. Analysis the performance from peak power and average power, power consumption of transmitter, relationship of bit error rate and modulation mode, and influence of ambient light, respectively. The results shows that image can be received accurately which uses this method. The most distant transmission distance can get to 1m with transmitter LED source of 1w, and the transfer rate is 14.4Kbit/s with OOK modulation mode on stabilization system, the ambient light effect little to LED transmission system in normal light environment. The method is a convenient to carry LED wireless short range transmission for mobile transmission equipment as a supplement of Bluetooth short-range transmission for its ISM band interfere, and the analysis method in this paper can be a reference for other similar systems. It also proves the system is feasibility for next study.

Identifying Nodes of Transmission in Disease Diffusion Through Social Media

NASA Astrophysics Data System (ADS)

Lamb, David Sebastian

The spread of infectious diseases can be described in terms of three interrelated components: interaction, movement, and scale. Transmission between individuals requires some form of interaction, which is dependent on the pathogen, to occur. Diseases spread through the movement of their hosts; they spread across many spatial scales from local neighborhoods to countries, or temporal scales from days to years, or periodic intervals. Prior research into the spread of disease have examined diffusion processes retrospectively at regional or country levels, or developed differential equation or simulation models of the dynamics of disease transmission. While some of the more recent models incorporate all three components, they are limited in the way they understand where interactions occur. The focus has been on home or work, including contact with family or coworkers. The models reflect a lack of knowledge about how transmissions are made at specific locations in time, so-called nodes of transmission. That is, how individuals' intersections in time and space function in disease transmission. This project sought to use the three factors of interaction, movement, and scale to better understand the spread of disease in terms of the place of interaction called the node of transmission. The overarching objective of this research was: how can nodes of transmission be identified through individual activity spaces incorporating the three factors of infectious disease spread: interaction, movement, and scale?. This objective fed into three main sub-objectives: defining nodes of transmission, developing an appropriate methodology to identifying nodes of transmission, and applying it using geotagged social media data from Twitter. To develop an appropriate framework, this research relied on time geography, and traditional disease. This particularly relied on the idea of bundling to create the nodes, and a nesting effect that integrated scale. The data source used to identify nodes of transmission was collected from Twitter for the Los Angeles County, USA, area from October 2015 to February 2016. Automated text classification was used to identify messages where users self-reported an influenza-like-illness. Different groupings were created that combined both the syndrome and the symptoms of influenza, and applied to the automated classification. The use of Twitter for small-area health analysis was evaluated along with different text classification methodologies. A space-time hierarchical clustering technique was adapted to be applied towards the twitter data in both identifying nodes of transmission and identifying spatiotemporal contact networks. This clustering data was applied to the classified Twitter data to look at where interaction between the classified users were occurring. This pointed to six nodes that were typically densely populated areas that saw the merging of large groups of people in Los Angeles (e.g. Disneyland and Hollywood Boulevard).The movement of these individuals were also examined by using a edit distance to compare their visits to different clusters and nodes.

Three-dimensional image signals: processing methods

NASA Astrophysics Data System (ADS)

Schiopu, Paul; Manea, Adrian; Craciun, Anca-Ileana; Craciun, Alexandru

2010-11-01

Over the years extensive studies have been carried out to apply coherent optics methods in real-time processing, communications and transmission image. This is especially true when a large amount of information needs to be processed, e.g., in high-resolution imaging. The recent progress in data-processing networks and communication systems has considerably increased the capacity of information exchange. We describe the results of literature investigation research of processing methods for the signals of the three-dimensional images. All commercially available 3D technologies today are based on stereoscopic viewing. 3D technology was once the exclusive domain of skilled computer-graphics developers with high-end machines and software. The images capture from the advanced 3D digital camera can be displayed onto screen of the 3D digital viewer with/ without special glasses. For this is needed considerable processing power and memory to create and render the complex mix of colors, textures, and virtual lighting and perspective necessary to make figures appear three-dimensional. Also, using a standard digital camera and a technique called phase-shift interferometry we can capture "digital holograms." These are holograms that can be stored on computer and transmitted over conventional networks. We present some research methods to process "digital holograms" for the Internet transmission and results.

78 FR 46560 - Pipeline Safety: Class Location Requirements

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... DEPARTMENT OF TRANSPORTATION Pipeline and Hazardous Materials Safety Administration 49 CFR Part... class location requirements for gas transmission pipelines. Section 5 of the Pipeline Safety, Regulatory... and, with respect to gas transmission pipeline facilities, whether applying IMP requirements to...

Evaluation of power system security and development of transmission pricing method

NASA Astrophysics Data System (ADS)

Kim, Hyungchul

The electric power utility industry is presently undergoing a change towards the deregulated environment. This has resulted in unbundling of generation, transmission and distribution services. The introduction of competition into unbundled electricity services may lead system operation closer to its security boundaries resulting in smaller operating safety margins. The competitive environment is expected to lead to lower price rates for customers and higher efficiency for power suppliers in the long run. Under this deregulated environment, security assessment and pricing of transmission services have become important issues in power systems. This dissertation provides new methods for power system security assessment and transmission pricing. In power system security assessment, the following issues are discussed (1) The description of probabilistic methods for power system security assessment; (2) The computation time of simulation methods; (3) on-line security assessment for operation. A probabilistic method using Monte-Carlo simulation is proposed for power system security assessment. This method takes into account dynamic and static effects corresponding to contingencies. Two different Kohonen networks, Self-Organizing Maps and Learning Vector Quantization, are employed to speed up the probabilistic method. The combination of Kohonen networks and Monte-Carlo simulation can reduce computation time in comparison with straight Monte-Carlo simulation. A technique for security assessment employing Bayes classifier is also proposed. This method can be useful for system operators to make security decisions during on-line power system operation. This dissertation also suggests an approach for allocating transmission transaction costs based on reliability benefits in transmission services. The proposed method shows the transmission transaction cost of reliability benefits when transmission line capacities are considered. The ratio between allocation by transmission line capacity-use and allocation by reliability benefits is computed using the probability of system failure.

The Efficiency of Noni (Morinda citrifolia L.) Essential Oil on the Control of Leaf Spot Caused by Exserohilum turcicum in Maize Culture.

PubMed

Silva, Janaina Costa E; Mourão, Dalmarcia de Sousa Carlos; Lima, Fabia Silva de Oliveira; Sarmento, Renato de Almeida; Dalcin, Mateus Sunti; Aguiar, Raimundo Wagner de Souza; Santos, Gil Rodrigues Dos

2017-08-14

The objective of this work was to evaluate the efficiency of noni essential oil on the control of Exserohilum turcicum , a causative agent of Exserohilum spot in maize culture. In the sanitary test 400 seeds were incubated using the blotter test method. For the transmissibility test, the fragments of damaged leaves of seedlings were removed and put into a potato, dextrose and agar (PDA) culture environment. To verify the pathogenicity, Koch´s postulates were performed. In the phytotoxicity test different concentrations of noni oil were applied in maize seedlings. E. turcicum conidia were submitted to different concentrations of noni oil. In the preventive and curative tests noni essential oils were applied before and after the conidia inoculation, respectively. The results revealed the presence of fungi of the genres Aspergillus , Penicillium , Rhizopus , Fusarium , and Exserohilum in the maize seeds. The pathogenicity of E. turcicum and also the transmission of this fungus from the seeds to the maize seedlings was confirmed. The inhibition of conidia germination was proportional to the concentration increase. The preventive application of noni essential oil was the most efficient on the control of Exserohilum spot.

The Efficiency of Noni (Morinda citrifolia L.) Essential Oil on the Control of Leaf Spot Caused by Exserohilum turcicum in Maize Culture

PubMed Central

Silva, Janaina Costa E; Mourão, Dalmarcia de Sousa Carlos; Lima, Fabia Silva de Oliveira; Sarmento, Renato de Almeida; Dalcin, Mateus Sunti; Aguiar, Raimundo Wagner de Souza

2017-01-01

The objective of this work was to evaluate the efficiency of noni essential oil on the control of Exserohilum turcicum, a causative agent of Exserohilum spot in maize culture. In the sanitary test 400 seeds were incubated using the blotter test method. For the transmissibility test, the fragments of damaged leaves of seedlings were removed and put into a potato, dextrose and agar (PDA) culture environment. To verify the pathogenicity, Koch´s postulates were performed. In the phytotoxicity test different concentrations of noni oil were applied in maize seedlings. E. turcicum conidia were submitted to different concentrations of noni oil. In the preventive and curative tests noni essential oils were applied before and after the conidia inoculation, respectively. The results revealed the presence of fungi of the genres Aspergillus, Penicillium, Rhizopus, Fusarium, and Exserohilum in the maize seeds. The pathogenicity of E. turcicum and also the transmission of this fungus from the seeds to the maize seedlings was confirmed. The inhibition of conidia germination was proportional to the concentration increase. The preventive application of noni essential oil was the most efficient on the control of Exserohilum spot. PMID:28930274

Estimating tuberculosis incidence from primary survey data: a mathematical modeling approach.

PubMed

Pandey, S; Chadha, V K; Laxminarayan, R; Arinaminpathy, N

2017-04-01

There is an urgent need for improved estimations of the burden of tuberculosis (TB). To develop a new quantitative method based on mathematical modelling, and to demonstrate its application to TB in India. We developed a simple model of TB transmission dynamics to estimate the annual incidence of TB disease from the annual risk of tuberculous infection and prevalence of smear-positive TB. We first compared model estimates for annual infections per smear-positive TB case using previous empirical estimates from China, Korea and the Philippines. We then applied the model to estimate TB incidence in India, stratified by urban and rural settings. Study model estimates show agreement with previous empirical estimates. Applied to India, the model suggests an annual incidence of smear-positive TB of 89.8 per 100 000 population (95%CI 56.8-156.3). Results show differences in urban and rural TB: while an urban TB case infects more individuals per year, a rural TB case remains infectious for appreciably longer, suggesting the need for interventions tailored to these different settings. Simple models of TB transmission, in conjunction with necessary data, can offer approaches to burden estimation that complement those currently being used.

Improvement in thrust force estimation of solenoid valve considering minor hysteresis loop

NASA Astrophysics Data System (ADS)

Yoon, Myung-Hwan; Choi, Yun-Yong; Hong, Jung-Pyo

2017-05-01

Solenoid valve is a very important hydraulic actuator for an automatic transmission in terms of shift quality. The same form of pressure for the clutch and the input current are required for an ideal control. However, the gap between a pressure and a current can occur which brings a delay in a transmission and a decrease in quality. This problem is caused by hysteresis phenomenon. As the ascending or descending magnetic field is applied to the solenoid, different thrust forces are generated. This paper suggests the calculation method of the thrust force considering the hysteresis phenomenon and consequently the accurate force can be obtained. Such hysteresis occurs in ferromagnetic materials, however the hysteresis phenomenon includes a minor hysteresis loop which begins with an initial magnetization curve and is generated by DC biased field density. As the core of the solenoid is ferromagnetic material, an accurate thrust force is obtained by applying the minor hysteresis loop compared to the force calculated by considering only the initial magnetization curve. An analytical background and the detailed explanation of measuring the minor hysteresis loop are presented. Furthermore experimental results and finite element analysis results are compared for the verification.

Applying shot boundary detection for automated crystal growth analysis during in situ transmission electron microscope experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeglein, W. A.; Griswold, R.; Mehdi, B. L.

In-situ (scanning) transmission electron microscopy (S/TEM) is being developed for numerous applications in the study of nucleation and growth under electrochemical driving forces. For this type of experiment, one of the key parameters is to identify when nucleation initiates. Typically the process of identifying the moment that crystals begin to form is a manual process requiring the user to perform an observation and respond accordingly (adjust focus, magnification, translate the stage etc.). However, as the speed of the cameras being used to perform these observations increases, the ability of a user to “catch” the important initial stage of nucleation decreasesmore » (there is more information that is available in the first few milliseconds of the process). Here we show that video shot boundary detection (SBD) can automatically detect frames where a change in the image occurs. We show that this method can be applied to quickly and accurately identify points of change during crystal growth. This technique allows for automated segmentation of a digital stream for further analysis and the assignment of arbitrary time stamps for the initiation of processes that are independent of the user’s ability to observe and react.« less

Triangular node for Transmission-Line Modeling (TLM) applied to bio-heat transfer.

PubMed

Milan, Hugo F M; Gebremedhin, Kifle G

2016-12-01

Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, rectangles are used to discretize two-dimensional problems. The drawback in using rectangular shapes is that instead of refining only the domain of interest, a large additional domain will also be refined in the x and y axes, which results in increased computational time and memory space. In this paper, we developed a triangular node for TLM applied to bio-heat transfer that does not have the drawback associated with the rectangular nodes. The model includes heat source, blood perfusion (advection), boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. A matrix equation for TLM, which simplifies the solution of time-domain problems or solves steady-state problems, was also developed. The predicted results were compared against results obtained from the solution of a simplified two-dimensional problem, and they agreed within 1% for a mesh length of triangular faces of 59µm±9µm (mean±standard deviation) and a time step of 1ms. Copyright © 2016 Elsevier Ltd. All rights reserved.

Pulse transmission transceiver architecture for low power communications

DOEpatents

Dress, Jr., William B.; Smith, Stephen F.

2003-08-05

Systems and methods for pulse-transmission low-power communication modes are disclosed. A method of pulse transmission communications includes: generating a modulated pulse signal waveform; transforming said modulated pulse signal waveform into at least one higher-order derivative waveform; and transmitting said at least one higher-order derivative waveform as an emitted pulse. The systems and methods significantly reduce lower-frequency emissions from pulse transmission spread-spectrum communication modes, which reduces potentially harmful interference to existing radio frequency services and users and also simultaneously permit transmission of multiple data bits by utilizing specific pulse shapes.

International consultation on the criminalization of HIV transmission: 31 October-2 November 2007, Geneva, Switzerland. Joint United Nations Programme on HIV/AIDS (UNAIDS) Geneva, United Nations Development Programme (UNDP), New York, 2007.

PubMed

2009-11-01

Since the beginning of the HIV epidemic, some jurisdictions have applied criminal law to the transmission of HIV. In 2002, UNAIDS issued a policy options paper on this issue. In light of renewed calls for the application of criminal law to HIV transmission and concerns raised in this regard by the UNAIDS Reference Group on HIV and Humans Rights and others, UNDP and the UNAIDS Secretariat decided to bring together a number of legal experts and other concerned stakeholders to discuss this issue in the context of an effective human rights and public health response to HIV. The discussion would inform a UNAIDS/UNDP policy brief on this subject. It was clarified that the consultation would focus primarily on HIV transmission through sexual contact, although it was noted that concerns exist in relation to applying criminal law to HIV transmission in other contexts. This Bookshelf article consists of excerpts from the report of the meeting.

Well-posed and stable transmission problems

NASA Astrophysics Data System (ADS)

Nordström, Jan; Linders, Viktor

2018-07-01

We introduce the notion of a transmission problem to describe a general class of problems where different dynamics are coupled in time. Well-posedness and stability are analysed for continuous and discrete problems using both strong and weak formulations, and a general transmission condition is obtained. The theory is applied to the coupling of fluid-acoustic models, multi-grid implementations, adaptive mesh refinements, multi-block formulations and numerical filtering.

Method of testing gear wheels in impact bending

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tikhonov, A.K.; Palagin, Y.M.

1995-05-01

Chemicothermal treatment processes are widely used in engineering to improve the working lives of important components, of which the most common is nitrocementation. That process has been applied at the Volga Automobile Plant mainly to sprockets in gear transmissions, which need high hardness and wear resistance in the surfaces with relatively ductile cores. Although various forms of chemicothermal treatment are widely used, there has been no universal method of evaluating the strengths of gear wheels. Standard methods of estimating strength ({sigma}{sub u}, {sigma}{sub t}, {sigma}{sub b}, and hardness) have a major shortcoming: They can determine only the characteristics of themore » cores for case-hardened materials. Here we consider a method of impact bending test, which enables one to evaluate the actual strength of gear teeth.« less

Method of optimum channel switching in equipment of infocommunication network in conditions of cyber attacks to their telecommunication infrastructure.

NASA Astrophysics Data System (ADS)

Kochedykov, S. S.; Noev, A. N.; Dushkin, A. V.; Gubin, I. A.

2018-05-01

On the basis of the mathematical graph theory, the method of optimum switching of infocommunication networks in the conditions of cyber attacks is developed. The idea of representation of a set of possible ways on the graph in the form of the multilevel tree ordered by rules of algebra of a logic theory is the cornerstone of a method. As a criterion of optimization, the maximum of network transmission capacity to which assessment Ford- Falkerson's theorem is applied is used. The method is realized in the form of a numerical algorithm, which can be used not only for design, but also for operational management of infocommunication networks in conditions of violation of the functioning of their switching centers.

Fatigue crack identification method based on strain amplitude changing

NASA Astrophysics Data System (ADS)

Guo, Tiancai; Gao, Jun; Wang, Yonghong; Xu, Youliang

2017-09-01

Aiming at the difficulties in identifying the location and time of crack initiation in the castings of helicopter transmission system during fatigue tests, by introducing the classification diagnostic criteria of similar failure mode to find out the similarity of fatigue crack initiation among castings, an engineering method and quantitative criterion for detecting fatigue cracks based on strain amplitude changing is proposed. This method is applied on the fatigue test of a gearbox housing, whose results indicates: during the fatigue test, the system alarms when SC strain meter reaches the quantitative criterion. The afterwards check shows that a fatigue crack less than 5mm is found at the corresponding location of SC strain meter. The test result proves that the method can provide accurate test data for strength life analysis.

Chagas disease vector blood meal sources identified by protein mass spectrometry

PubMed Central

Keller, Judith I.; Ballif, Bryan A.; St. Clair, Riley M.; Vincent, James J.; Monroy, M. Carlota

2017-01-01

Chagas disease is a complex vector borne parasitic disease involving blood feeding Triatominae (Hemiptera: Reduviidae) insects, also known as kissing bugs, and the vertebrates they feed on. This disease has tremendous impacts on millions of people and is a global health problem. The etiological agent of Chagas disease, Trypanosoma cruzi (Kinetoplastea: Trypanosomatida: Trypanosomatidae), is deposited on the mammalian host in the insect’s feces during a blood meal, and enters the host’s blood stream through mucous membranes or a break in the skin. Identifying the blood meal sources of triatomine vectors is critical in understanding Chagas disease transmission dynamics, can lead to identification of other vertebrates important in the transmission cycle, and aids management decisions. The latter is particularly important as there is little in the way of effective therapeutics for Chagas disease. Several techniques, mostly DNA-based, are available for blood meal identification. However, further methods are needed, particularly when sample conditions lead to low-quality DNA or to assess the risk of human cross-contamination. We demonstrate a proteomics-based approach, using liquid chromatography tandem mass spectrometry (LC-MS/MS) to identify host-specific hemoglobin peptides for blood meal identification in mouse blood control samples and apply LC-MS/MS for the first time to Triatoma dimidiata insect vectors, tracing blood sources to species. In contrast to most proteins, hemoglobin, stabilized by iron, is incredibly stable even being preserved through geologic time. We compared blood stored with and without an anticoagulant and examined field-collected insect specimens stored in suboptimal conditions such as at room temperature for long periods of time. To our knowledge, this is the first study using LC-MS/MS on field-collected arthropod disease vectors to identify blood meal composition, and where blood meal identification was confirmed with more traditional DNA-based methods. We also demonstrate the potential of synthetic peptide standards to estimate relative amounts of hemoglobin acquired when insects feed on multiple blood sources. These LC-MS/MS methods can contribute to developing Ecohealth control strategies for Chagas disease transmission and can be applied to other arthropod disease vectors. PMID:29232402

A wearable wireless ECG monitoring system with dynamic transmission power control for long-term homecare.

PubMed

Wang, Yishan; Doleschel, Sammy; Wunderlich, Ralf; Heinen, Stefan

2015-03-01

This paper presents a wearable wireless ECG monitoring system based on novel 3-Lead electrode placements for long-term homecare. The experiment for novel 3-Lead electrode placements is carried out, and the results show that the distance between limb electrodes can be significantly reduced. Based on the new electrode position, a small size sensor node, which is powered by a rechargeable battery, is designed to detect, amplify, filter and transmit the ECG signals. The coordinator receives the data and sends it to PC. Finally the signals are displayed on the GUI. In order to control the power consumption of sensor node, a dynamic power adjustment method is applied to automatically adjust the transmission power of the sensor node according to the received signal strength indicator (RSSI), which is related to the distance and obstacle between sensor node and coordinator. The system is evaluated when the user, who wears the sensor, is walking and running. A promising performance is achieved even under body motion. The power consumption can be significantly reduced with this dynamic power adjustment method.

A Thermal Infrared Radiation Parameterization for Atmospheric Studies

NASA Technical Reports Server (NTRS)

Chou, Ming-Dah; Suarez, Max J.; Liang, Xin-Zhong; Yan, Michael M.-H.; Cote, Charles (Technical Monitor)

2001-01-01

This technical memorandum documents the longwave radiation parameterization developed at the Climate and Radiation Branch, NASA Goddard Space Flight Center, for a wide variety of weather and climate applications. Based on the 1996-version of the Air Force Geophysical Laboratory HITRAN data, the parameterization includes the absorption due to major gaseous absorption (water vapor, CO2, O3) and most of the minor trace gases (N2O, CH4, CFCs), as well as clouds and aerosols. The thermal infrared spectrum is divided into nine bands. To achieve a high degree of accuracy and speed, various approaches of computing the transmission function are applied to different spectral bands and gases. The gaseous transmission function is computed either using the k-distribution method or the table look-up method. To include the effect of scattering due to clouds and aerosols, the optical thickness is scaled by the single-scattering albedo and asymmetry factor. The parameterization can accurately compute fluxes to within 1% of the high spectral-resolution line-by-line calculations. The cooling rate can be accurately computed in the region extending from the surface to the 0.01-hPa level.

[Study on brand traceability of vinegar based on near infrared spectroscopy technology].

PubMed

Guan, Xiao; Liu, Jing; Gu, Fang-Qing; Yang, Yong-Jian

2014-09-01

In the present paper, 152 vinegar samples with four different brands were chosen as research targets, and their near infrared spectra were collected by diffusion reflection mode and transmission mode, respectively. Furthermore, the brand traceability models for edible vinegar were constructed. The effects of the collection mode and pretreatment methods of spectrum on the precision of traceability models were investigated intensively. The models constructed by PLS1-DA modeling method using spectrum data of 114 training samples were applied to predict 38 test samples, and R2, RMSEC and RMSEP of the model based on transmission mode data were 0.92, 0.113 and 0.127, respectively, with recognition rate of 76.32%, and those based on diffusion reflection mode data were 0.97, 0.102 and 0.119, with recognition rate of 86.84%. The results demonstrated that the near infrared spectrum combined with PLS1-DA can be used to establish the brand traceability models for edible vinegar, and diffuse reflection mode is more beneficial for predictive ability of the model.

10 CFR 205.320 - Who shall apply.

Code of Federal Regulations, 2010 CFR

2010-01-01

... OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and Reports... entity who operates an electric power transmission or distribution facility crossing the border of the... Construction, Connection, Operation, and Maintenance of Facilities for Transmission of Electric Energy at...

10 CFR 205.320 - Who shall apply.

Code of Federal Regulations, 2011 CFR

2011-01-01

... OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and Reports... Construction, Connection, Operation, and Maintenance of Facilities for Transmission of Electric Energy at... United States, for the transmission of electric energy between the United States and a foreign country...

X-ray peak profile analysis of zinc oxide nanoparticles formed by simple precipitation method

NASA Astrophysics Data System (ADS)

Pelicano, Christian Mark; Rapadas, Nick Joaquin; Magdaluyo, Eduardo

2017-12-01

Zinc oxide (ZnO) nanoparticles were successfully synthesized by a simple precipitation method using zinc acetate and tetramethylammonium hydroxide. The synthesized ZnO nanoparticles were characterized by X-ray Diffraction analysis (XRD) and Transmission Electron Microscopy (TEM). The XRD result revealed a hexagonal wurtzite structure for the ZnO nanoparticles. The TEM image showed spherical nanoparticles with an average crystallite size of 6.70 nm. For x-ray peak analysis, Williamson-Hall (W-H) and Size-Strain Plot (SSP) methods were applied to examine the effects of crystallite size and lattice strain on the peak broadening of the ZnO nanoparticles. Based on the calculations, the estimated crystallite sizes and lattice strains obtained are in good agreement with each other.

Method for bonding a transmission line to a downhole tool

DOEpatents

Hall, David R.; Fox, Joe

2007-11-06

An apparatus for bonding a transmission line to the central bore of a downhole tool includes a pre-formed interface for bonding a transmission line to the inside diameter of a downhole tool. The pre-formed interface includes a first surface that substantially conforms to the outside contour of a transmission line and a second surface that substantially conforms to the inside diameter of a downhole tool. In another aspect of the invention, a method for bonding a transmission line to the inside diameter of a downhole tool includes positioning a transmission line near the inside wall of a downhole tool and placing a mold near the transmission line and the inside wall. The method further includes injecting a bonding material into the mold and curing the bonding material such that the bonding material bonds the transmission line to the inside wall.

Electromagnetic Launch Vehicle Fairing and Acoustic Blanket Model of Received Power Using FEKO

NASA Technical Reports Server (NTRS)

Trout, Dawn H.; Stanley, James E.; Wahid, Parveen F.

2011-01-01

Evaluating the impact of radio frequency transmission in vehicle fairings is important to electromagnetically sensitive spacecraft. This study employs the multilevel fast multipole method (MLFMM) from a commercial electromagnetic tool, FEKO, to model the fairing electromagnetic environment in the presence of an internal transmitter with improved accuracy over industry applied techniques. This fairing model includes material properties representative of acoustic blanketing commonly used in vehicles. Equivalent surface material models within FEKO were successfully applied to simulate the test case. Finally, a simplified model is presented using Nicholson Ross Weir derived blanket material properties. These properties are implemented with the coated metal option to reduce the model to one layer within the accuracy of the original three layer simulation.

Applied photo interpretation for airbrush cartography

NASA Technical Reports Server (NTRS)

Inge, J. L.; Bridges, P. M.

1976-01-01

New techniques of cartographic portrayal have been developed for the compilation of maps of lunar and planetary surfaces. Conventional photo interpretation methods utilizing size, shape, shadow, tone, pattern, and texture are applied to computer processed satellite television images. The variety of the image data allows the illustrator to interpret image details by inter-comparison and intra-comparison of photographs. Comparative judgements are affected by illumination, resolution, variations in surface coloration, and transmission or processing artifacts. The validity of the interpretation process is tested by making a representational drawing by an airbrush portrayal technique. Production controls insure the consistency of a map series. Photo interpretive cartographic portrayal skills are used to prepare two kinds of map series and are adaptable to map products of different kinds and purposes.

8760-Based Method for Representing Variable Generation Capacity Value in Capacity Expansion Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frew, Bethany A

Capacity expansion models (CEMs) are widely used to evaluate the least-cost portfolio of electricity generators, transmission, and storage needed to reliably serve load over many years or decades. CEMs can be computationally complex and are often forced to estimate key parameters using simplified methods to achieve acceptable solve times or for other reasons. In this paper, we discuss one of these parameters -- capacity value (CV). We first provide a high-level motivation for and overview of CV. We next describe existing modeling simplifications and an alternate approach for estimating CV that utilizes hourly '8760' data of load and VG resources.more » We then apply this 8760 method to an established CEM, the National Renewable Energy Laboratory's (NREL's) Regional Energy Deployment System (ReEDS) model (Eurek et al. 2016). While this alternative approach for CV is not itself novel, it contributes to the broader CEM community by (1) demonstrating how a simplified 8760 hourly method, which can be easily implemented in other power sector models when data is available, more accurately captures CV trends than a statistical method within the ReEDS CEM, and (2) providing a flexible modeling framework from which other 8760-based system elements (e.g., demand response, storage, and transmission) can be added to further capture important dynamic interactions, such as curtailment.« less

The Circuit Theory Behind Coupled-Mode Magnetic Resonance-Based Wireless Power Transmission.

PubMed

Kiani, Mehdi; Ghovanloo, Maysam

2012-09-01

Inductive coupling is a viable scheme to wirelessly energize devices with a wide range of power requirements from nanowatts in radio frequency identification tags to milliwatts in implantable microelectronic devices, watts in mobile electronics, and kilowatts in electric cars. Several analytical methods for estimating the power transfer efficiency (PTE) across inductive power transmission links have been devised based on circuit and electromagnetic theories by electrical engineers and physicists, respectively. However, a direct side-by-side comparison between these two approaches is lacking. Here, we have analyzed the PTE of a pair of capacitively loaded inductors via reflected load theory (RLT) and compared it with a method known as coupled-mode theory (CMT). We have also derived PTE equations for multiple capacitively loaded inductors based on both RLT and CMT. We have proven that both methods basically result in the same set of equations in steady state and either method can be applied for short- or midrange coupling conditions. We have verified the accuracy of both methods through measurements, and also analyzed the transient response of a pair of capacitively loaded inductors. Our analysis shows that the CMT is only applicable to coils with high quality factor ( Q ) and large coupling distance. It simplifies the analysis by reducing the order of the differential equations by half compared to the circuit theory.

The Circuit Theory Behind Coupled-Mode Magnetic Resonance-Based Wireless Power Transmission

PubMed Central

Kiani, Mehdi; Ghovanloo, Maysam

2014-01-01

Inductive coupling is a viable scheme to wirelessly energize devices with a wide range of power requirements from nanowatts in radio frequency identification tags to milliwatts in implantable microelectronic devices, watts in mobile electronics, and kilowatts in electric cars. Several analytical methods for estimating the power transfer efficiency (PTE) across inductive power transmission links have been devised based on circuit and electromagnetic theories by electrical engineers and physicists, respectively. However, a direct side-by-side comparison between these two approaches is lacking. Here, we have analyzed the PTE of a pair of capacitively loaded inductors via reflected load theory (RLT) and compared it with a method known as coupled-mode theory (CMT). We have also derived PTE equations for multiple capacitively loaded inductors based on both RLT and CMT. We have proven that both methods basically result in the same set of equations in steady state and either method can be applied for short- or midrange coupling conditions. We have verified the accuracy of both methods through measurements, and also analyzed the transient response of a pair of capacitively loaded inductors. Our analysis shows that the CMT is only applicable to coils with high quality factor (Q) and large coupling distance. It simplifies the analysis by reducing the order of the differential equations by half compared to the circuit theory. PMID:24683368

Model-independent Exoplanet Transit Spectroscopy

NASA Astrophysics Data System (ADS)

Aronson, Erik; Piskunov, Nikolai

2018-05-01

We propose a new data analysis method for obtaining transmission spectra of exoplanet atmospheres and brightness variation across the stellar disk from transit observations. The new method is capable of recovering exoplanet atmosphere absorption spectra and stellar specific intensities without relying on theoretical models of stars and planets. We simultaneously fit both stellar specific intensity and planetary radius directly to transit light curves. This allows stellar models to be removed from the data analysis. Furthermore, we use a data quality weighted filtering technique to achieve an optimal trade-off between spectral resolution and reconstruction fidelity homogenizing the signal-to-noise ratio across the wavelength range. Such an approach is more efficient than conventional data binning onto a low-resolution wavelength grid. We demonstrate that our analysis is capable of reproducing results achieved by using an explicit quadratic limb-darkening equation and that the filtering technique helps eliminate spurious spectral features in regions with strong telluric absorption. The method is applied to the VLT FORS2 observations of the exoplanets GJ 1214 b and WASP-49 b, and our results are in agreement with previous studies. Comparisons between obtained stellar specific intensity and numerical models indicates that the method is capable of accurately reconstructing the specific intensity. The proposed method enables more robust characterization of exoplanetary atmospheres by separating derivation of planetary transmission and stellar specific intensity spectra (that is model-independent) from chemical and physical interpretation.

Transmission Kikuchi diffraction and transmission electron forescatter imaging of electropolished and FIB manufactured TEM specimens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zieliński, W., E-mail: wiziel@inmat.pw.edu.pl; Płociński, T.; Kurzydłowski, K.J.

2015-06-15

We present a study of the efficiency of the utility of scanning electron microscope (SEM)-based transmission methods for characterizing grain structure in thinned bulk metals. Foils of type 316 stainless steel were prepared by two methods commonly used for transmission electron microscopy — double-jet electropolishing and focused ion beam milling. A customized holder allowed positioning of the foils in a configuration appropriate for both transmission electron forward scatter diffraction, and for transmission imaging by the use of a forescatter detector with two diodes. We found that both crystallographic orientation maps and dark-field transmitted images could be obtained for specimens preparedmore » by either method. However, for both methods, preparation-induced artifacts may affect the quality or accuracy of transmission SEM data, especially those acquired by the use of transmission Kikuchi diffraction. Generally, the quality of orientation data was better for specimens prepared by electropolishing, due to the absence of ion-induced damage. - Highlights: • The transmission imaging and diffraction techniques are emerging in scanning electron microscopy (SEM) as promising new field of materials characterization. • The manuscript titled: “Transmission Kikuchi Diffraction and Transmission Electron Forescatter Imaging of Electropolished and FIB Manufactured TEM Specimens” documents how different specimen thinning procedures can effect efficiency of transmission Kikuchi diffraction and transmission electron forescatter imaging. • The abilities to make precision crystallographic orientation maps and dark-field images in transmission was studied on electropolished versus focus ion beam manufactured TEM specimens. • Depending on the need, electropolished and focused ion beam technique may produce suitable specimens for transmission imaging and diffraction in SEM.« less

Mitigating reentry radio blackout by using a traveling magnetic field

NASA Astrophysics Data System (ADS)

Zhou, Hui; Li, Xiaoping; Xie, Kai; Liu, Yanming; Yu, Yuanyuan

2017-10-01

A hypersonic flight or a reentry vehicle is surrounded by a plasma layer that prevents electromagnetic wave transmission, which results in radio blackout. The magnetic-window method is considered a promising means to mitigate reentry communication blackout. However, the real application of this method is limited because of the need for strong magnetic fields. To reduce the required magnetic field strength, a novel method that applies a traveling magnetic field (TMF) is proposed in this study. A mathematical model based on magneto-hydrodynamic theory is adopted to analyze the effect of TMF on plasma. The mitigating effects of the TMF on the blackout of typical frequency bands, including L-, S-, and C-bands, are demonstrated. Results indicate that a significant reduction of plasma density occurs in the magnetic-window region by applying a TMF, and the reduction ratio is positively correlated with the velocity of the TMF. The required traveling velocities for eliminating the blackout of the Global Positioning System (GPS) and the typical telemetry system are also discussed. Compared with the constant magnetic-window method, the TMF method needs lower magnetic field strength and is easier to realize in the engineering field.

A standards-based method for compositional analysis by energy dispersive X-ray spectrometry using multivariate statistical analysis: application to multicomponent alloys.

PubMed

Rathi, Monika; Ahrenkiel, S P; Carapella, J J; Wanlass, M W

2013-02-01

Given an unknown multicomponent alloy, and a set of standard compounds or alloys of known composition, can one improve upon popular standards-based methods for energy dispersive X-ray (EDX) spectrometry to quantify the elemental composition of the unknown specimen? A method is presented here for determining elemental composition of alloys using transmission electron microscopy-based EDX with appropriate standards. The method begins with a discrete set of related reference standards of known composition, applies multivariate statistical analysis to those spectra, and evaluates the compositions with a linear matrix algebra method to relate the spectra to elemental composition. By using associated standards, only limited assumptions about the physical origins of the EDX spectra are needed. Spectral absorption corrections can be performed by providing an estimate of the foil thickness of one or more reference standards. The technique was applied to III-V multicomponent alloy thin films: composition and foil thickness were determined for various III-V alloys. The results were then validated by comparing with X-ray diffraction and photoluminescence analysis, demonstrating accuracy of approximately 1% in atomic fraction.

Quality optimization of H.264/AVC video transmission over noisy environments using a sparse regression framework

NASA Astrophysics Data System (ADS)

Pandremmenou, K.; Tziortziotis, N.; Paluri, S.; Zhang, W.; Blekas, K.; Kondi, L. P.; Kumar, S.

2015-03-01

We propose the use of the Least Absolute Shrinkage and Selection Operator (LASSO) regression method in order to predict the Cumulative Mean Squared Error (CMSE), incurred by the loss of individual slices in video transmission. We extract a number of quality-relevant features from the H.264/AVC video sequences, which are given as input to the LASSO. This method has the benefit of not only keeping a subset of the features that have the strongest effects towards video quality, but also produces accurate CMSE predictions. Particularly, we study the LASSO regression through two different architectures; the Global LASSO (G.LASSO) and Local LASSO (L.LASSO). In G.LASSO, a single regression model is trained for all slice types together, while in L.LASSO, motivated by the fact that the values for some features are closely dependent on the considered slice type, each slice type has its own regression model, in an e ort to improve LASSO's prediction capability. Based on the predicted CMSE values, we group the video slices into four priority classes. Additionally, we consider a video transmission scenario over a noisy channel, where Unequal Error Protection (UEP) is applied to all prioritized slices. The provided results demonstrate the efficiency of LASSO in estimating CMSE with high accuracy, using only a few features. les that typically contain high-entropy data, producing a footprint that is far less conspicuous than existing methods. The system uses a local web server to provide a le system, user interface and applications through an web architecture.

Seasonal forecast of St. Louis encephalitis virus transmission, Florida.

PubMed

Shaman, Jeffrey; Day, Jonathan F; Stieglitz, Marc; Zebiak, Stephen; Cane, Mark

2004-05-01

Disease transmission forecasts can help minimize human and domestic animal health risks by indicating where disease control and prevention efforts should be focused. For disease systems in which weather-related variables affect pathogen proliferation, dispersal, or transmission, the potential for disease forecasting exists. We present a seasonal forecast of St. Louis encephalitis virus transmission in Indian River County, Florida. We derive an empiric relationship between modeled land surface wetness and levels of SLEV transmission in humans. We then use these data to forecast SLEV transmission with a seasonal lead. Forecast skill is demonstrated, and a real-time seasonal forecast of epidemic SLEV transmission is presented. This study demonstrates how weather and climate forecast skill-verification analyses may be applied to test the predictability of an empiric disease forecast model.

Seasonal Forecast of St. Louis Encephalitis Virus Transmission, Florida

PubMed Central

Day, Jonathan F.; Stieglitz, Marc; Zebiak, Stephen; Cane, Mark

2004-01-01

Disease transmission forecasts can help minimize human and domestic animal health risks by indicating where disease control and prevention efforts should be focused. For disease systems in which weather-related variables affect pathogen proliferation, dispersal, or transmission, the potential for disease forecasting exists. We present a seasonal forecast of St. Louis encephalitis virus transmission in Indian River County, Florida. We derive an empirical relationship between modeled land surface wetness and levels of SLEV transmission in humans. We then use these data to forecast SLEV transmission with a seasonal lead. Forecast skill is demonstrated, and a real-time seasonal forecast of epidemic SLEV transmission is presented. This study demonstrates how weather and climate forecast skill verification analyses may be applied to test the predictability of an empirical disease forecast model. PMID:15200812

Applying the seismic interferometry method to vertical seismic profile data using tunnel excavation noise as source

NASA Astrophysics Data System (ADS)

Jurado, Maria Jose; Teixido, Teresa; Martin, Elena; Segarra, Miguel; Segura, Carlos

2013-04-01

In the frame of the research conducted to develop efficient strategies for investigation of rock properties and fluids ahead of tunnel excavations the seismic interferometry method was applied to analyze the data acquired in boreholes instrumented with geophone strings. The results obtained confirmed that seismic interferometry provided an improved resolution of petrophysical properties to identify heterogeneities and geological structures ahead of the excavation. These features are beyond the resolution of other conventional geophysical methods but can be the cause severe problems in the excavation of tunnels. Geophone strings were used to record different types of seismic noise generated at the tunnel head during excavation with a tunnelling machine and also during the placement of the rings covering the tunnel excavation. In this study we show how tunnel construction activities have been characterized as source of seismic signal and used in our research as the seismic source signal for generating a 3D reflection seismic survey. The data was recorded in vertical water filled borehole with a borehole seismic string at a distance of 60 m from the tunnel trace. A reference pilot signal was obtained from seismograms acquired close the tunnel face excavation in order to obtain best signal-to-noise ratio to be used in the interferometry processing (Poletto et al., 2010). The seismic interferometry method (Claerbout 1968) was successfully applied to image the subsurface geological structure using the seismic wave field generated by tunneling (tunnelling machine and construction activities) recorded with geophone strings. This technique was applied simulating virtual shot records related to the number of receivers in the borehole with the seismic transmitted events, and processing the data as a reflection seismic survey. The pseudo reflective wave field was obtained by cross-correlation of the transmitted wave data. We applied the relationship between the transmission response and the reflection response for a 1D multilayer structure, and next 3D approach (Wapenaar 2004). As a result of this seismic interferometry experiment the 3D reflectivity model (frequencies and resolution ranges) was obtained. We proved also that the seismic interferometry approach can be applied in asynchronous seismic auscultation. The reflections detected in the virtual seismic sections are in agreement with the geological features encountered during the excavation of the tunnel and also with the petrophysical properties and parameters measured in previous geophysical borehole logging. References Claerbout J.F., 1968. Synthesis of a layered medium from its acoustic transmision response. Geophysics, 33, 264-269 Flavio Poletto, Piero Corubolo and Paolo Comeli.2010. Drill-bit seismic interferometry whith and whitout pilot signals. Geophysical Prospecting, 2010, 58, 257-265. Wapenaar, K., J. Thorbecke, and D. Draganov, 2004, Relations between reflection and transmission responses of three-dimensional inhomogeneous media: Geophysical Journal International, 156, 179-194.

Thermal and Structural Analysis of Helicopter Transmission Housings Using NASTRAN

NASA Technical Reports Server (NTRS)

Howells, R. W.; Sciarra, J. J.; Ng, G. S.

1976-01-01

The application of NASTRAN to improve the design of helicopter transmission housings is described. A finite element model of the complete forward rotor transmission housing for the Boeing Vertol CH-47C helicopter was used to study thermal distortion and stress, stress and deflection due to static and dynamic loads, load paths, and design optimization by the control of structural energy distribution. The analytical results are correlated with test data and used to reduce weight and to improve strength, service life, failsafety, and reliability. The techniques presented, although applied herein to helicopter transmissions, are sufficiently general to be applicable to any power transmission system.

Consolidation of Partially Stabilized ZrO2 in the Presence of a Noncontacting Electric Field

NASA Astrophysics Data System (ADS)

Majidi, Hasti; van Benthem, Klaus

2015-05-01

Electric field-assisted sintering techniques demonstrate accelerated densification at lower temperatures than the conventional sintering methods. However, it is still debated whether the applied field and/or resulting currents are responsible for the densification enhancement. To distinguish the effects of an applied field from current flow, in situ scanning transmission electron microscopy experiments with soft agglomerates of partially stabilized yttria-doped zirconia particles are carried out. A new microelectromechanical system-based sample support is used to heat particle agglomerates while simultaneously exposing them to an externally applied noncontacting electric field. Under isothermal condition at 900 °C , an electric field strength of 500 V /cm shows a sudden threefold enhancement in the shrinkage of the agglomerates. The applied electrostatic potential lowers the activation energy for point defect formation within the space charge zone and therefore promotes consolidation. Obtaining similar magnitudes of shrinkage in the absence of any electric field requires a higher temperature and longer time.

Analyses of the most influential factors for vibration monitoring of planetary power transmissions in pellet mills by adaptive neuro-fuzzy technique

NASA Astrophysics Data System (ADS)

Milovančević, Miloš; Nikolić, Vlastimir; Anđelković, Boban

2017-01-01

Vibration-based structural health monitoring is widely recognized as an attractive strategy for early damage detection in civil structures. Vibration monitoring and prediction is important for any system since it can save many unpredictable behaviors of the system. If the vibration monitoring is properly managed, that can ensure economic and safe operations. Potentials for further improvement of vibration monitoring lie in the improvement of current control strategies. One of the options is the introduction of model predictive control. Multistep ahead predictive models of vibration are a starting point for creating a successful model predictive strategy. For the purpose of this article, predictive models of are created for vibration monitoring of planetary power transmissions in pellet mills. The models were developed using the novel method based on ANFIS (adaptive neuro fuzzy inference system). The aim of this study is to investigate the potential of ANFIS for selecting the most relevant variables for predictive models of vibration monitoring of pellet mills power transmission. The vibration data are collected by PIC (Programmable Interface Controller) microcontrollers. The goal of the predictive vibration monitoring of planetary power transmissions in pellet mills is to indicate deterioration in the vibration of the power transmissions before the actual failure occurs. The ANFIS process for variable selection was implemented in order to detect the predominant variables affecting the prediction of vibration monitoring. It was also used to select the minimal input subset of variables from the initial set of input variables - current and lagged variables (up to 11 steps) of vibration. The obtained results could be used for simplification of predictive methods so as to avoid multiple input variables. It was preferable to used models with less inputs because of overfitting between training and testing data. While the obtained results are promising, further work is required in order to get results that could be directly applied in practice.

Phase noise suppression for coherent optical block transmission systems: a unified framework.

PubMed

Yang, Chuanchuan; Yang, Feng; Wang, Ziyu

2011-08-29

A unified framework for phase noise suppression is proposed in this paper, which could be applied in any coherent optical block transmission systems, including coherent optical orthogonal frequency-division multiplexing (CO-OFDM), coherent optical single-carrier frequency-domain equalization block transmission (CO-SCFDE), etc. Based on adaptive modeling of phase noise, unified observation equations for different coherent optical block transmission systems are constructed, which lead to unified phase noise estimation and suppression. Numerical results demonstrate that the proposal is powerful in mitigating laser phase noise.

Downlink Multihop Transmission Technique for Asymmetric Traffic Accommodation in DS-CDMA/FDD Cellular Communications

NASA Astrophysics Data System (ADS)

Mori, Kazuo; Naito, Katsuhiro; Kobayashi, Hideo

This paper proposes an asymmetric traffic accommodation scheme using a multihop transmission technique for CDMA/FDD cellular communication systems. The proposed scheme exploits the multihop transmission to downlink packet transmissions, which require the large transmission power at their single-hop transmissions, in order to increase the downlink capacity. In these multihop transmissions, vacant uplink band is used for the transmissions from relay stations to destination mobile stations, and this leads more capacity enhancement in the downlink communications. The relay route selection method and power control method for the multihop transmissions are also investigated in the proposed scheme. The proposed scheme is evaluated by computer simulation and the results show that the proposed scheme can achieve better system performance.

Lower richness of small wild mammal species and chagas disease risk.

PubMed

Xavier, Samanta Cristina das Chagas; Roque, André Luiz Rodrigues; Lima, Valdirene dos Santos; Monteiro, Kerla Joeline Lima; Otaviano, Joel Carlos Rodrigues; Ferreira da Silva, Luiz Felipe Coutinho; Jansen, Ana Maria

2012-01-01

A new epidemiological scenario involving the oral transmission of Chagas disease, mainly in the Amazon basin, requires innovative control measures. Geospatial analyses of the Trypanosoma cruzi transmission cycle in the wild mammals have been scarce. We applied interpolation and map algebra methods to evaluate mammalian fauna variables related to small wild mammals and the T. cruzi infection pattern in dogs to identify hotspot areas of transmission. We also evaluated the use of dogs as sentinels of epidemiological risk of Chagas disease. Dogs (n = 649) were examined by two parasitological and three distinct serological assays. kDNA amplification was performed in patent infections, although the infection was mainly sub-patent in dogs. The distribution of T. cruzi infection in dogs was not homogeneous, ranging from 11-89% in different localities. The interpolation method and map algebra were employed to test the associations between the lower richness in mammal species and the risk of exposure of dogs to T. cruzi infection. Geospatial analysis indicated that the reduction of the mammal fauna (richness and abundance) was associated with higher parasitemia in small wild mammals and higher exposure of dogs to infection. A Generalized Linear Model (GLM) demonstrated that species richness and positive hemocultures in wild mammals were associated with T. cruzi infection in dogs. Domestic canine infection rates differed significantly between areas with and without Chagas disease outbreaks (Chi-squared test). Geospatial analysis by interpolation and map algebra methods proved to be a powerful tool in the evaluation of areas of T. cruzi transmission. Dog infection was shown to not only be an efficient indicator of reduction of wild mammalian fauna richness but to also act as a signal for the presence of small wild mammals with high parasitemia. The lower richness of small mammal species is discussed as a risk factor for the re-emergence of Chagas disease.

Large-scale inverse model analyses employing fast randomized data reduction

NASA Astrophysics Data System (ADS)

Lin, Youzuo; Le, Ellen B.; O'Malley, Daniel; Vesselinov, Velimir V.; Bui-Thanh, Tan

2017-08-01

When the number of observations is large, it is computationally challenging to apply classical inverse modeling techniques. We have developed a new computationally efficient technique for solving inverse problems with a large number of observations (e.g., on the order of 107 or greater). Our method, which we call the randomized geostatistical approach (RGA), is built upon the principal component geostatistical approach (PCGA). We employ a data reduction technique combined with the PCGA to improve the computational efficiency and reduce the memory usage. Specifically, we employ a randomized numerical linear algebra technique based on a so-called "sketching" matrix to effectively reduce the dimension of the observations without losing the information content needed for the inverse analysis. In this way, the computational and memory costs for RGA scale with the information content rather than the size of the calibration data. Our algorithm is coded in Julia and implemented in the MADS open-source high-performance computational framework (http://mads.lanl.gov). We apply our new inverse modeling method to invert for a synthetic transmissivity field. Compared to a standard geostatistical approach (GA), our method is more efficient when the number of observations is large. Most importantly, our method is capable of solving larger inverse problems than the standard GA and PCGA approaches. Therefore, our new model inversion method is a powerful tool for solving large-scale inverse problems. The method can be applied in any field and is not limited to hydrogeological applications such as the characterization of aquifer heterogeneity.

Development and Application of a Wireless Sensor for Space Charge Density Measurement in an Ultra-High-Voltage, Direct-Current Environment

PubMed Central

Xin, Encheng; Ju, Yong; Yuan, Haiwen

2016-01-01

A space charge density wireless measurement system based on the idea of distributed measurement is proposed for collecting and monitoring the space charge density in an ultra-high-voltage direct-current (UHVDC) environment. The proposed system architecture is composed of a number of wireless nodes connected with space charge density sensors and a base station. The space charge density sensor based on atmospheric ion counter method is elaborated and developed, and the ARM microprocessor and Zigbee radio frequency module are applied. The wireless network communication quality and the relationship between energy consumption and transmission distance in the complicated electromagnetic environment is tested. Based on the experimental results, the proposed measurement system demonstrates that it can adapt to the complex electromagnetic environment under the UHVDC transmission lines and can accurately measure the space charge density. PMID:27775627

Development and Application of a Wireless Sensor for Space Charge Density Measurement in an Ultra-High-Voltage, Direct-Current Environment.

PubMed

Xin, Encheng; Ju, Yong; Yuan, Haiwen

2016-10-20

A space charge density wireless measurement system based on the idea of distributed measurement is proposed for collecting and monitoring the space charge density in an ultra-high-voltage direct-current (UHVDC) environment. The proposed system architecture is composed of a number of wireless nodes connected with space charge density sensors and a base station. The space charge density sensor based on atmospheric ion counter method is elaborated and developed, and the ARM microprocessor and Zigbee radio frequency module are applied. The wireless network communication quality and the relationship between energy consumption and transmission distance in the complicated electromagnetic environment is tested. Based on the experimental results, the proposed measurement system demonstrates that it can adapt to the complex electromagnetic environment under the UHVDC transmission lines and can accurately measure the space charge density.

Planetary Gearbox Fault Detection Using Vibration Separation Techniques

NASA Technical Reports Server (NTRS)

Lewicki, David G.; LaBerge, Kelsen E.; Ehinger, Ryan T.; Fetty, Jason

2011-01-01

Studies were performed to demonstrate the capability to detect planetary gear and bearing faults in helicopter main-rotor transmissions. The work supported the Operations Support and Sustainment (OSST) program with the U.S. Army Aviation Applied Technology Directorate (AATD) and Bell Helicopter Textron. Vibration data from the OH-58C planetary system were collected on a healthy transmission as well as with various seeded-fault components. Planetary fault detection algorithms were used with the collected data to evaluate fault detection effectiveness. Planet gear tooth cracks and spalls were detectable using the vibration separation techniques. Sun gear tooth cracks were not discernibly detectable from the vibration separation process. Sun gear tooth spall defects were detectable. Ring gear tooth cracks were only clearly detectable by accelerometers located near the crack location or directly across from the crack. Enveloping provided an effective method for planet bearing inner- and outer-race spalling fault detection.

Microresonator and associated method for producing and controlling photonic signals with a photonic bandgap delay apparatus

NASA Technical Reports Server (NTRS)

Fork, Richard Lynn (Inventor); Jones, Darryl Keith (Inventor); Keys, Andrew Scott (Inventor)

2000-01-01

By applying a photonic signal to a microresonator that includes a photonic bandgap delay apparatus having a photonic band edge transmission resonance at the frequency of the photonic signal, the microresonator imparts a predetermined delay to the photonic signal. The photonic bandgap delay apparatus also preferably has a photonic band edge transmission resonance bandwidth which is at least as wide as the bandwidth of the photonic signal such that a uniform delay is imparted over the entire bandwidth of the photonic signal. The microresonator also includes a microresonator cavity, typically defined by a pair of switchable mirrors, within which the photonic bandgap delay apparatus is disposed. By requiring the photonic signal to oscillate within the microresonator cavity so as to pass through the photonic bandgap delay apparatus several times, the microresonator can controllably impart an adjustable delay to the photonic signal.

Solitonlike pulses along a modified Noguchi nonlinear electrical network with second-neighbor interactions: Analytical studies

NASA Astrophysics Data System (ADS)

Kengne, E.; Liu, W. M.

2018-05-01

A modified lossless nonlinear Noguchi transmission network with second-neighbor interactions is considered. In the semidiscrete limit, we apply the reductive perturbation method and show that the dynamics of modulated waves propagating through the network are governed by an NLS equation with linear external potential. Classes of exact solitonic solutions of this network equation are derived, proving possible transmission of both bright and dark solitonlike pulses through the network. The effects of both the coupling second-neighbor parameter L3 and the strength λ of the linear potential on the dynamics of modulated waves through the network are investigated. One of the main results of our work is that with the introduction of the second neighbors in the network, two solitary signals, either two bright solitary signals or one bright and one dark solitary signal, may simultaneously propagate at the same frequency through the network.

Theoretical analysis of the electrical aspects of the basic electro-impulse problem in aircraft de-icing applications

NASA Technical Reports Server (NTRS)

Henderson, Robert A.; Schrag, Robert L.

1987-01-01

A method of modelling a system consisting of a cylindrical coil with its axis perpendicular to a metal plate of finite thickness, and a simple electrical circuit for producing a transient current in the coil, is discussed in the context of using such a system for de-icing aircraft surfaces. A transmission line model of the coil and metal plate is developed as the heart of the system model. It is shown that this transmission model is central to calculation of the coil impedance, the coil current, the magnetic fields established on the surfaces of the metal plate, and the resultant total force between the coil and the plate. FORTRAN algorithms were developed for numerical calculation of each of these quantities, and the algorithms were applied to an experimental prototype system in which these quantities had been measured. Good agreement is seen to exist between the predicted and measured results.

Correlation of microphotoluminescence spectroscopy, scanning transmission electron microscopy, and atom probe tomography on a single nano-object containing an InGaN/GaN multiquantum well system.

PubMed

Rigutti, Lorenzo; Blum, Ivan; Shinde, Deodatta; Hernández-Maldonado, David; Lefebvre, Williams; Houard, Jonathan; Vurpillot, François; Vella, Angela; Tchernycheva, Maria; Durand, Christophe; Eymery, Joël; Deconihout, Bernard

2014-01-08

A single nanoscale object containing a set of InGaN/GaN nonpolar multiple-quantum wells has been analyzed by microphotoluminescence spectroscopy (μPL), high-resolution scanning transmission electron microscopy (HR-STEM) and atom probe tomography (APT). The correlated measurements constitute a rich and coherent set of data supporting the interpretation that the observed μPL narrow emission lines, polarized perpendicularly to the crystal c-axis and with energies in the interval 2.9-3.3 eV, are related to exciton states localized in potential minima induced by the irregular 3D In distribution within the quantum well (QW) planes. This novel method opens up interesting perspectives, as it will be possible to apply it on a wide class of quantum confining emitters and nano-objects.

Computerized Generation and Simulation of Meshing and Contact of New Type of Novikov-Wildhaber Helical Gears

NASA Technical Reports Server (NTRS)

Litvin, Faydor L.; Feng, Pin-Hao; Lagutin, Sergei A.

2000-01-01

In this report, we propose a new geometry for low-noise, increased-strength helical gears of the Novikov-Wildhaber type. Contact stresses are reduced as a result of their convex-concave gear tooth surfaces. The gear tooth surfaces are crowned in the profile direction to localize bearing contact and in the longitudinal direction to obtain a parabolic function of transmission errors. Such a function results in the reduction of noise and vibrations. Methods for the generation of the proposed gear tooth surfaces by grinding and hobbing are considered, and a tooth contact analysis (TCA) computer program to simulate meshing and contact is applied. The report also investigates the influence of misalignment on transmission errors and shift of bearing contact. Numerical examples to illustrate the developed approaches are proposed. The proposed geometry was patented by Ford/UIC (Serial Number 09-340-824, pending) on June 28, 1999.

A Novel Application of Ultrasonic Imaging to Study Smoldering Combustion

NASA Technical Reports Server (NTRS)

Tse, S. D.; Anthenien, R. A.; Fernandez-Pello, A. Carlos; Miyasaka, K.

1997-01-01

An ultrasonic imaging technique has been developed to examine the propagation of a smolder reaction within a porous combustible material. The technique provides information about the location of a propagating smolder front, as well as line-of-sight average permeability variations of the smoldering material. The method utilizes the observation that transmission of an ultrasonic signal through a porous material increases with permeability. Since a propagating smolder reaction leaves behind char with a higher permeability than the original material, ultrasound transmission can be employed to monitor smolder progress. The technique can also be used to track the char evolution as it continues to react. Experiments are presented where the technique is applied to smoldering combustion in a two-dimensional geometry. The results have furthered the understanding of two-dimensional smolder, especially in identifying the controlling mechanisms leading to the transition from smoldering to flaming. The applicability of ultrasonic tomography to smoldering combustion has also been investigated.

Improvement of two-way continuous-variable quantum key distribution with virtual photon subtraction

NASA Astrophysics Data System (ADS)

Zhao, Yijia; Zhang, Yichen; Li, Zhengyu; Yu, Song; Guo, Hong

2017-08-01

We propose a method to improve the performance of two-way continuous-variable quantum key distribution protocol by virtual photon subtraction. The virtual photon subtraction implemented via non-Gaussian post-selection not only enhances the entanglement of two-mode squeezed vacuum state but also has advantages in simplifying physical operation and promoting efficiency. In two-way protocol, virtual photon subtraction could be applied on two sources independently. Numerical simulations show that the optimal performance of renovated two-way protocol is obtained with photon subtraction only used by Alice. The transmission distance and tolerable excess noise are improved by using the virtual photon subtraction with appropriate parameters. Moreover, the tolerable excess noise maintains a high value with the increase in distance so that the robustness of two-way continuous-variable quantum key distribution system is significantly improved, especially at long transmission distance.

Compact photonic crystal circulator with flat-top transmission band created by cascading magneto-optical resonance cavities.

PubMed

Wang, Qiong; Ouyang, Zhengbiao; Lin, Mi; Liu, Qiang

2015-11-20

A new type of compact three-port circulator with flat-top transmission band (FTTB) in a two-dimensional photonic crystal has been proposed, through coupling the cascaded magneto-optical resonance cavities to waveguides. The coupled-mode theory is applied to investigate the coupled structure and analyze the condition to achieve FTTB. According to the theoretical analysis, the structure is further optimized to ensure that the condition for achieving FTTB can be satisfied for both cavity-cavity coupling and cavity-waveguide coupling. Through the finite-element method, it is demonstrated that the design can realize a high quality, nonreciprocal circulating propagation of waves with an insertion loss of 0.023 dB and an isolation of 23.3 dB, covering a wide range of operation frequency. Such a wideband circulator has potential applications in large-scale integrated photonic circuits for guiding or isolating harmful optical reflections from load elements.

Surveillance and Control of Malaria Transmission in Thailand using Remotely Sensed Meteorological and Environmental Parameters

NASA Technical Reports Server (NTRS)

Kiang, Richard K.; Adimi, Farida; Soika, Valerii; Nigro, Joseph

2007-01-01

These slides address the use of remote sensing in a public health application. Specifically, this discussion focuses on the of remote sensing to detect larval habitats to predict current and future endemicity and identify key factors that sustain or promote transmission of malaria in a targeted geographic area (Thailand). In the Malaria Modeling and Surveillance Project, which is part of the NASA Applied Sciences Public Health Applications Program, we have been developing techniques to enhance public health's decision capability for malaria risk assessments and controls. The main objectives are: 1) identification of the potential breeding sites for major vector species; 2) implementation of a risk algorithm to predict the occurrence of malaria and its transmission intensity; 3) implementation of a dynamic transmission model to identify the key factors that sustain or intensify malaria transmission. The potential benefits are: 1) increased warning time for public health organizations to respond to malaria outbreaks; 2) optimized utilization of pesticide and chemoprophylaxis; 3) reduced likelihood of pesticide and drug resistance; and 4) reduced damage to environment. !> Environmental parameters important to malaria transmission include temperature, relative humidity, precipitation, and vegetation conditions. The NASA Earth science data sets that have been used for malaria surveillance and risk assessment include AVHRR Pathfinder, TRMM, MODIS, NSIPP, and SIESIP. Textural-contextual classifications are used to identify small larval habitats. Neural network methods are used to model malaria cases as a function of the remotely sensed parameters. Hindcastings based on these environmental parameters have shown good agreement to epidemiological records. Discrete event simulations are used for modeling the detailed interactions among the vector life cycle, sporogonic cycle and human infection cycle, under the explicit influences of selected extrinsic and intrinsic factors. The output of the model includes the individual infection status and the quantities normally observed in field studies, such as mosquito biting rates, sporozoite infection rates, gametocyte prevalence and incidence. Results are in good agreement with mosquito vector and human malaria data acquired by Coleman et al. over 4.5 years in Kong Mong Tha, a remote village in western Thailand. Application of our models is not restricted to the Greater Mekong Subregion. Our models have been applied to malaria in Indonesia, Korea, and other regions in the world with similar success.

A transaction assessment method for allocation of transmission services

NASA Astrophysics Data System (ADS)

Banunarayanan, Venkatasubramaniam

The purpose of this research is to develop transaction assessment methods for allocating transmission services that are provided by an area/utility to power transactions. Transmission services are the services needed to deliver, or provide the capacity to deliver, real and reactive power from one or more supply points to one or more delivery points. As the number of transactions increase rapidly in the emerging deregulated environment, accurate quantification of the transmission services an area/utility provides to accommodate a transaction is becoming important, because then appropriate pricing schemes can be developed to compensate for the parties that provide these services. The Allocation methods developed are based on the "Fair Resource Allocation Principle" and they determine for each transaction the following: the flowpath of the transaction (both real and reactive power components), generator reactive power support from each area/utility, real power loss support from each area/utility. Further, allocation methods for distributing the cost of relieving congestion on transmission lines caused by transactions are also developed. The main feature of the proposed methods is representation of actual usage of the transmission services by the transactions. The proposed method is tested extensively on a variety of systems. The allocation methods developed in this thesis for allocation of transmission services to transactions is not only useful in studying the impact of transactions on a transmission system in a multi-transaction case, but they are indeed necessary to meet the criteria set forth by FERC with regard to pricing based on actual usage. The "consistency" of the proposed allocation methods has also been investigated and tested.

Easy-to-use phylogenetic analysis system for hepatitis B virus infection.

PubMed

Sugiyama, Masaya; Inui, Ayano; Shin-I, Tadasu; Komatsu, Haruki; Mukaide, Motokazu; Masaki, Naohiko; Murata, Kazumoto; Ito, Kiyoaki; Nakanishi, Makoto; Fujisawa, Tomoo; Mizokami, Masashi

2011-10-01

  The molecular phylogenetic analysis has been broadly applied to clinical and virological study. However, the appropriate settings and application of calculation parameters are difficult for non-specialists of molecular genetics. In the present study, the phylogenetic analysis tool was developed for the easy determination of genotypes and transmission route.   A total of 23 patients of 10 families infected with hepatitis B virus (HBV) were enrolled and expected to undergo intrafamilial transmission. The extracted HBV DNA were amplified and sequenced in a region of the S gene.   The software to automatically classify query sequence was constructed and installed on the Hepatitis Virus Database (HVDB). Reference sequences were retrieved from HVDB, which contained major genotypes from A to H. Multiple-alignments using CLUSTAL W were performed before the genetic distance matrix was calculated with the six-parameter method. The phylogenetic tree was output by the neighbor-joining method. User interface using WWW-browser was also developed for intuitive control. This system was named as the easy-to-use phylogenetic analysis system (E-PAS). Twenty-three sera of 10 families were analyzed to evaluate E-PAS. The queries obtained from nine families were genotype C and were located in one cluster per family. However, one patient of a family was classified into the cluster different from her family, suggesting that E-PAS detected the sample distinct from that of her family on the transmission route.   The E-PAS to output phylogenetic tree was developed since requisite material was sequence data only. E-PAS could expand to determine HBV genotypes as well as transmission routes. © 2011 The Japan Society of Hepatology.

Homeopathic Preparations of Quartz, Sulfur and Copper Sulfate Assessed by UV-Spectroscopy

PubMed Central

Wolf, Ursula; Wolf, Martin; Heusser, Peter; Thurneysen, André; Baumgartner, Stephan

2011-01-01

Homeopathic preparations are used in homeopathy and anthroposophic medicine. Although there is evidence of effectiveness in several clinical studies, including double-blinded randomized controlled trials, their nature and mode of action could not be explained with current scientific approaches yet. Several physical methods have already been applied to investigate homeopathic preparations but it is yet unclear which methods are best suited to identify characteristic physicochemical properties of homeopathic preparations. The aim of this study was to investigate homeopathic preparations with UV-spectroscopy. In a blinded, randomized, controlled experiment homeopathic preparations of copper sulfate (CuSO4; 11c–30c), quartz (SiO2; 10c–30c, i.e., centesimal dilution steps) and sulfur (S; 11×–30×, i.e., decimal dilution steps) and controls (one-time succussed diluent) were investigated using UV-spectroscopy and tested for contamination by inductively coupled plasma mass spectrometry (ICP-MS). The UV transmission for homeopathic preparations of CuSO4 preparations was significantly lower than in controls. The transmission seemed to be also lower for both SiO2 and S, but not significant. The mean effect size (95% confidence interval) was similar for the homeopathic preparations: CuSO4 (pooled data) 0.0544% (0.0260–0.0827%), SiO2 0.0323% (–0.0064% to 0.0710%) and S 0.0281% (–0.0520% to 0.1082%). UV transmission values of homeopathic preparations had a significantly higher variability compared to controls. In none of the samples the concentration of any element analyzed by ICP-MS exceeded 100 ppb. Lower transmission of UV light may indicate that homeopathic preparations are less structured or more dynamic than their succussed pure solvent. PMID:19474239

An analytical method for designing low noise helicopter transmissions

NASA Technical Reports Server (NTRS)

Bossler, R. B., Jr.; Bowes, M. A.; Royal, A. C.

1978-01-01

The development and experimental validation of a method for analytically modeling the noise mechanism in the helicopter geared power transmission systems is described. This method can be used within the design process to predict interior noise levels and to investigate the noise reducing potential of alternative transmission design details. Examples are discussed.

Economic analysis of transmission line engineering based on industrial engineering

NASA Astrophysics Data System (ADS)

Li, Yixuan

2017-05-01

The modern industrial engineering is applied to the technical analysis and cost analysis of power transmission and transformation engineering. It can effectively reduce the cost of investment. First, the power transmission project is economically analyzed. Based on the feasibility study of power transmission and transformation project investment, the proposal on the company system cost management is put forward through the economic analysis of the effect of the system. The cost management system is optimized. Then, through the cost analysis of power transmission and transformation project, the new situation caused by the cost of construction is found. It is of guiding significance to further improve the cost management of power transmission and transformation project. Finally, according to the present situation of current power transmission project cost management, concrete measures to reduce the cost of power transmission project are given from the two aspects of system optimization and technology optimization.

A computationally efficient parallel Levenberg-Marquardt algorithm for highly parameterized inverse model analyses

NASA Astrophysics Data System (ADS)

Lin, Youzuo; O'Malley, Daniel; Vesselinov, Velimir V.

2016-09-01

Inverse modeling seeks model parameters given a set of observations. However, for practical problems because the number of measurements is often large and the model parameters are also numerous, conventional methods for inverse modeling can be computationally expensive. We have developed a new, computationally efficient parallel Levenberg-Marquardt method for solving inverse modeling problems with a highly parameterized model space. Levenberg-Marquardt methods require the solution of a linear system of equations which can be prohibitively expensive to compute for moderate to large-scale problems. Our novel method projects the original linear problem down to a Krylov subspace such that the dimensionality of the problem can be significantly reduced. Furthermore, we store the Krylov subspace computed when using the first damping parameter and recycle the subspace for the subsequent damping parameters. The efficiency of our new inverse modeling algorithm is significantly improved using these computational techniques. We apply this new inverse modeling method to invert for random transmissivity fields in 2-D and a random hydraulic conductivity field in 3-D. Our algorithm is fast enough to solve for the distributed model parameters (transmissivity) in the model domain. The algorithm is coded in Julia and implemented in the MADS computational framework (http://mads.lanl.gov). By comparing with Levenberg-Marquardt methods using standard linear inversion techniques such as QR or SVD methods, our Levenberg-Marquardt method yields a speed-up ratio on the order of ˜101 to ˜102 in a multicore computational environment. Therefore, our new inverse modeling method is a powerful tool for characterizing subsurface heterogeneity for moderate to large-scale problems.

49 CFR 192.903 - What definitions apply to this subpart?

Code of Federal Regulations, 2010 CFR

2010-10-01

... HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) PIPELINE SAFETY TRANSPORTATION OF NATURAL AND OTHER GAS BY PIPELINE: MINIMUM FEDERAL SAFETY STANDARDS Gas Transmission Pipeline... pipeline segment means a segment of gas transmission pipeline located in a high consequence area. The terms...

49 CFR 192.9 - What requirements apply to gathering lines?

Code of Federal Regulations, 2014 CFR

2014-10-01

... gathering line must comply with requirements of this part applicable to transmission lines, except the... onshore gathering line must comply with the requirements of this part applicable to transmission lines... design, installation, construction, initial inspection, and initial testing must be in accordance with...

49 CFR 192.9 - What requirements apply to gathering lines?

Code of Federal Regulations, 2012 CFR

2012-10-01

... gathering line must comply with requirements of this part applicable to transmission lines, except the... onshore gathering line must comply with the requirements of this part applicable to transmission lines... design, installation, construction, initial inspection, and initial testing must be in accordance with...

49 CFR 192.9 - What requirements apply to gathering lines?

Code of Federal Regulations, 2013 CFR

2013-10-01

... gathering line must comply with requirements of this part applicable to transmission lines, except the... onshore gathering line must comply with the requirements of this part applicable to transmission lines... design, installation, construction, initial inspection, and initial testing must be in accordance with...

The potential anesthetic threats, challenges and intensive care considerations in patients with HIV infection

PubMed Central

Bajwa, Sukhminder Jit Singh; Kulshrestha, Ashish

2013-01-01

Acquired immunodeficiency syndrome (AIDS) has become a pandemic with ever looming danger of its transmission in health professionals. The number of AIDS patients has increased tremendously over the last two decades, who present for surgical procedures as well as who get admitted in intensive care unit for their critical condition. As such anesthesiologists and intensivists are exposed to potential risk of disease transmission on a daily basis from such patients. The guidelines and protocols formulated in the western world regarding prevention of disease transmission cannot be applied uniformly in the developing nations, such as India due to various factors and limitations. As such there is a continuous need felt in this arena to prevent the catastrophic consequences of AIDS in our medical fraternity while treating such patients in operation theatres and critical care units. This study reviews the various pathophysiological aspects, anesthetic considerations, intensive care implications, and various areas where current knowledge about AIDS can be applied to prevent its potential transmission in high-risk clinical groups. PMID:23559818

Milk of livestock as a possible transmission route of Helicobacter pylori infection

PubMed Central

Talaei, Ramin; Souod, Negar; Momtaz, Hassan; Dabiri, Hossein

2015-01-01

Aim: The current investigation aimed to evaluate ruminant raw milk as a reservoir source of Helicobacter pylori and analyze the diversity of cagA and vacA genotypes as H. pylori virulence factors to find any relationship between these genotypes in human and animal H. pylori strains. Background: The way of transmission of Helicobacter pylori as one of the most controversial bacteria in the world, which colonizes the human gastric tissue and is responsible for several gastric diseases is still unknown. The possibility of zoonotic transmission of H. pylori is feasible, but is not proven in ruminant reservoirs. Methods: Overall 210 cows, sheep, goats, camels and buffalos’ raw milk samples and 100 human gastric biopsies were collected in this survey. We applied PCR assays to identify H. pylori, vacA and cagA genes. Statistical tests were applied for data analysis. Results: Totally 12(16%) cow, 8(13.79%) sheep, 2 (4.76%) goat, 2(13.33%), buffalo 4(20%) and 82 (82%) of human specimens were confirmed to be H. pylori positive. Among which s1a/m2 genotype was more frequent in isolated H. pylori strains and statistically significant between strains. Based on statistical analyses the s1b allele of sheep had a significant association with human strains. Conclusion: The current survey was prompted by our previous report. According to both results we can conclude that sheep may act as a reservoir for H. pylori and transmit this bacterium to human via its milk. Extended assessments in other geographical regions and other animals are recommended. PMID:26171135

Preparation of viral samples within biocontainment for ultrastructural analysis: Utilization of an innovative processing capsule for negative staining.

PubMed

Monninger, Mitchell K; Nguessan, Chrystal A; Blancett, Candace D; Kuehl, Kathleen A; Rossi, Cynthia A; Olschner, Scott P; Williams, Priscilla L; Goodman, Steven L; Sun, Mei G

2016-12-01

Transmission electron microscopy can be used to observe the ultrastructure of viruses and other microbial pathogens with nanometer resolution. In a transmission electron microscope (TEM), the image is created by passing an electron beam through a specimen with contrast generated by electron scattering from dense elements in the specimen. Viruses do not normally contain dense elements, so a negative stain that places dense heavy metal salts around the sample is added to create a dark border. To prepare a virus sample for a negative stain transmission electron microscopy, a virus suspension is applied to a TEM grid specimen support, which is a 3mm diameter fragile specimen screen coated with a few nanometers of plastic film. Then, deionized (dI) water rinses and a negative stain solution are applied to the grid. All infectious viruses must be handled in a biosafety cabinet (BSC) and many require a biocontainment laboratory environment. Staining viruses in biosafety levels (BSL) 3 and 4 is especially challenging because the support grids are small, fragile, and easily moved by air currents. In this study we evaluated a new device for negative staining viruses called mPrep/g capsule. It is a capsule that holds up to two TEM grids during all processing steps and for storage after staining is complete. This study reports that the mPrep/g capsule method is valid and effective to negative stain virus specimens, especially in high containment laboratory environments. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Quantitative 3D high resolution transmission ultrasound tomography: creating clinically relevant images (Conference Presentation)

NASA Astrophysics Data System (ADS)

Wiskin, James; Klock, John; Iuanow, Elaine; Borup, Dave T.; Terry, Robin; Malik, Bilal H.; Lenox, Mark

2017-03-01

There has been a great deal of research into ultrasound tomography for breast imaging over the past 35 years. Few successful attempts have been made to reconstruct high-resolution images using transmission ultrasound. To this end, advances have been made in 2D and 3D algorithms that utilize either time of arrival or full wave data to reconstruct images with high spatial and contrast resolution suitable for clinical interpretation. The highest resolution and quantitative accuracy result from inverse scattering applied to full wave data in 3D. However, this has been prohibitively computationally expensive, meaning that full inverse scattering ultrasound tomography has not been considered clinically viable. Here we show the results of applying a nonlinear inverse scattering algorithm to 3D data in a clinically useful time frame. This method yields Quantitative Transmission (QT) ultrasound images with high spatial and contrast resolution. We reconstruct sound speeds for various 2D and 3D phantoms and verify these values with independent measurements. The data are fully 3D as is the reconstruction algorithm, with no 2D approximations. We show that 2D reconstruction algorithms can introduce artifacts into the QT breast image which are avoided by using a full 3D algorithm and data. We show high resolution gross and microscopic anatomic correlations comparing cadaveric breast QT images with MRI to establish imaging capability and accuracy. Finally, we show reconstructions of data from volunteers, as well as an objective visual grading analysis to confirm clinical imaging capability and accuracy.

Inference of Transmission Network Structure from HIV Phylogenetic Trees

DOE PAGES

Giardina, Federica; Romero-Severson, Ethan Obie; Albert, Jan; ...

2017-01-13

Phylogenetic inference is an attractive means to reconstruct transmission histories and epidemics. However, there is not a perfect correspondence between transmission history and virus phylogeny. Both node height and topological differences may occur, depending on the interaction between within-host evolutionary dynamics and between-host transmission patterns. To investigate these interactions, we added a within-host evolutionary model in epidemiological simulations and examined if the resulting phylogeny could recover different types of contact networks. To further improve realism, we also introduced patient-specific differences in infectivity across disease stages, and on the epidemic level we considered incomplete sampling and the age of the epidemic.more » Second, we implemented an inference method based on approximate Bayesian computation (ABC) to discriminate among three well-studied network models and jointly estimate both network parameters and key epidemiological quantities such as the infection rate. Our ABC framework used both topological and distance-based tree statistics for comparison between simulated and observed trees. Overall, our simulations showed that a virus time-scaled phylogeny (genealogy) may be substantially different from the between-host transmission tree. This has important implications for the interpretation of what a phylogeny reveals about the underlying epidemic contact network. In particular, we found that while the within-host evolutionary process obscures the transmission tree, the diversification process and infectivity dynamics also add discriminatory power to differentiate between different types of contact networks. We also found that the possibility to differentiate contact networks depends on how far an epidemic has progressed, where distance-based tree statistics have more power early in an epidemic. Finally, we applied our ABC inference on two different outbreaks from the Swedish HIV-1 epidemic.« less

Modelling entomological-climatic interactions of Plasmodium falciparum malaria transmission in two Colombian endemic-regions: contributions to a National Malaria Early Warning System

PubMed Central

Ruiz, Daniel; Poveda, Germán; Vélez, Iván D; Quiñones, Martha L; Rúa, Guillermo L; Velásquez, Luz E; Zuluaga, Juan S

2006-01-01

Background Malaria has recently re-emerged as a public health burden in Colombia. Although the problem seems to be climate-driven, there remain significant gaps of knowledge in the understanding of the complexity of malaria transmission, which have motivated attempts to develop a comprehensive model. Methods The mathematical tool was applied to represent Plasmodium falciparum malaria transmission in two endemic-areas. Entomological exogenous variables were estimated through field campaigns and laboratory experiments. Availability of breeding places was included towards representing fluctuations in vector densities. Diverse scenarios, sensitivity analyses and instabilities cases were considered during experimentation-validation process. Results Correlation coefficients and mean square errors between observed and modelled incidences reached 0.897–0.668 (P > 0.95) and 0.0002–0.0005, respectively. Temperature became the most relevant climatic parameter driving the final incidence. Accordingly, malaria outbreaks are possible during the favourable epochs following the onset of El Niño warm events. Sporogonic and gonotrophic cycles showed to be the entomological key-variables controlling the transmission potential of mosquitoes' population. Simulation results also showed that seasonality of vector density becomes an important factor towards understanding disease transmission. Conclusion The model constitutes a promising tool to deepen the understanding of the multiple interactions related to malaria transmission conducive to outbreaks. In the foreseeable future it could be implemented as a tool to diagnose possible dynamical patterns of malaria incidence under several scenarios, as well as a decision-making tool for the early detection and control of outbreaks. The model will be also able to be merged with forecasts of El Niño events to provide a National Malaria Early Warning System. PMID:16882349

Inference of Transmission Network Structure from HIV Phylogenetic Trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giardina, Federica; Romero-Severson, Ethan Obie; Albert, Jan

Phylogenetic inference is an attractive means to reconstruct transmission histories and epidemics. However, there is not a perfect correspondence between transmission history and virus phylogeny. Both node height and topological differences may occur, depending on the interaction between within-host evolutionary dynamics and between-host transmission patterns. To investigate these interactions, we added a within-host evolutionary model in epidemiological simulations and examined if the resulting phylogeny could recover different types of contact networks. To further improve realism, we also introduced patient-specific differences in infectivity across disease stages, and on the epidemic level we considered incomplete sampling and the age of the epidemic.more » Second, we implemented an inference method based on approximate Bayesian computation (ABC) to discriminate among three well-studied network models and jointly estimate both network parameters and key epidemiological quantities such as the infection rate. Our ABC framework used both topological and distance-based tree statistics for comparison between simulated and observed trees. Overall, our simulations showed that a virus time-scaled phylogeny (genealogy) may be substantially different from the between-host transmission tree. This has important implications for the interpretation of what a phylogeny reveals about the underlying epidemic contact network. In particular, we found that while the within-host evolutionary process obscures the transmission tree, the diversification process and infectivity dynamics also add discriminatory power to differentiate between different types of contact networks. We also found that the possibility to differentiate contact networks depends on how far an epidemic has progressed, where distance-based tree statistics have more power early in an epidemic. Finally, we applied our ABC inference on two different outbreaks from the Swedish HIV-1 epidemic.« less

Method of converting an existing vehicle powertrain to a hybrid powertrain system

DOEpatents

Reed, Jr., Richard G.; Boberg, Evan S.; Lawrie, Robert E.; Castaing, Francois J.

2001-12-25

A method of converting an existing vehicle powertrain including a manual transmission to a hybrid powertrain system with an automated powertrain transmission. The first step in the method of attaching a gear train housing to a housing of said manual transmission, said gear train housing receiving as end of drive shaft of said transmission and rotatably supporting a gear train assembly. Secondly, mounting an electric motor/generator to said gear train housing and attaching a motor/generator drive shaft of said electric motor/generator to said gear train assembly. Lastly, connecting an electro-mechanical clutch actuator to a friction clutch mechanism of said manual transmission.

A Calculation Method of Electric Distance and Subarea Division Application Based on Transmission Impedance

NASA Astrophysics Data System (ADS)

Fang, G. J.; Bao, H.

2017-12-01

The widely used method of calculating electric distances is sensitivity method. The sensitivity matrix is the result of linearization and based on the hypothesis that the active power and reactive power are decoupled, so it is inaccurate. In addition, it calculates the ratio of two partial derivatives as the relationship of two dependent variables, so there is no physical meaning. This paper presents a new method for calculating electrical distance, namely transmission impedance method. It forms power supply paths based on power flow tracing, then establishes generalized branches to calculate transmission impedances. In this paper, the target of power flow tracing is S instead of Q. Q itself has no direction and the grid delivers complex power so that S contains more electrical information than Q. By describing the power transmission relationship of the branch and drawing block diagrams in both forward and reverse directions, it can be found that the numerators of feedback parts of two block diagrams are all the transmission impedances. To ensure the distance is scalar, the absolute value of transmission impedance is defined as electrical distance. Dividing network according to the electric distances and comparing with the results of sensitivity method, it proves that the transmission impedance method can adapt to the dynamic change of system better and reach a reasonable subarea division scheme.

Effective increase in beam emittance by phase-space expansion using asymmetric Bragg diffraction.

PubMed

Chu, Chia-Hung; Tang, Mau-Tsu; Chang, Shih-Lin

2015-08-24

We propose an innovative method to extend the utilization of the phase space downstream of a synchrotron light source for X-ray transmission microscopy. Based on the dynamical theory of X-ray diffraction, asymmetrically cut perfect crystals are applied to reshape the position-angle-wavelength space of the light source, by which the usable phase space of the source can be magnified by over one hundred times, thereby "phase-space-matching" the source with the objective lens of the microscope. The method's validity is confirmed using SHADOW code simulations, and aberration through an optical lens such as a Fresnel zone plate is examined via matrix optics for nano-resolution X-ray images.

Efficient composite broadband polarization retarders and polarization filters

NASA Astrophysics Data System (ADS)

Dimova, E.; Ivanov, S. S.; Popkirov, G.; Vitanov, N. V.

2014-12-01

A new type of broadband polarization half-wave retarder and narrowband polarization filters are described and experimentally tested. Both, the retarders and the filters are designed as composite stacks of standard optical half-wave plates, each of them twisted at specific angles. The theoretical background of the proposed optical devices was obtained by analogy with the method of composite pulses, known from the nuclear and quantum physics. We show that combining two composite filters built from different numbers and types of waveplates, the transmission spectrum is reduced from about 700 nm to about 10 nm width.We experimentally demonstrate that this method can be applied to different types of waveplates (broadband, zero-order, multiple order, etc.).

Studies on the foundation and development of diagnostic ultrasound

PubMed Central

Wagai, Toshio

2007-01-01

In recent years, various types of diagnostic imaging methods, such as CT, MRI, PET and Ultrasound, have been developed rapidly and become indispensable as clinical diagnostic tools. Among these imaging modalities, CT, MRI and PET all apply electromagnetic waves like radiation rays. In contrast, an ultrasound imaging method uses a completely different mechanical pressure wave: “sound”. Ultrasound has various features, including inaudible sound at very high frequencies, which allows its use in medical diagnoses. That is, ultrasound techniques can be applied in transmission, reflection and Doppler methods. Moreover, the sharp directivity of an ultrasound beam can also improve image resolution. Another big advantage of diagnostic ultrasound is that it does not harm the human body or cause any pain to patients. Given these various advantages, diagnostic ultrasound has recently been widely used in diagnosing cancer and cardiovascular disease and scanning fetuses (Fig. 1) as well as routine clinical examinations in hospitals. In this paper, I outline my almost 50-year history of diagnostic ultrasound research, particularly that performed at the early stage from 1950–56. PMID:24367150

3D receiver function Kirchhoff depth migration image of Cascadia subduction slab weak zone

NASA Astrophysics Data System (ADS)

Cheng, C.; Allen, R. M.; Bodin, T.; Tauzin, B.

2016-12-01

We have developed a highly computational efficient algorithm of applying 3D Kirchhoff depth migration to telesismic receiver function data. Combine primary PS arrival with later multiple arrivals we are able to reveal a better knowledge about the earth discontinuity structure (transmission and reflection). This method is highly useful compare with traditional CCP method when dipping structure is met during the imaging process, such as subduction slab. We apply our method to the reginal Cascadia subduction zone receiver function data and get a high resolution 3D migration image, for both primary and multiples. The image showed us a clear slab weak zone (slab hole) in the upper plate boundary under Northern California and the whole Oregon. Compare with previous 2D receiver function image from 2D array(CAFE and CASC93), the position of the weak zone shows interesting conherency. This weak zone is also conherent with local seismicity missing and heat rising, which lead us to think about and compare with the ocean plate stucture and the hydralic fluid process during the formation and migration of the subduction slab.

Numerical simulation of tunneling through arbitrary potential barriers applied on MIM and MIIM rectenna diodes

NASA Astrophysics Data System (ADS)

Abdolkader, Tarek M.; Shaker, Ahmed; Alahmadi, A. N. M.

2018-07-01

With the continuous miniaturization of electronic devices, quantum-mechanical effects such as tunneling become more effective in many device applications. In this paper, a numerical simulation tool is developed under a MATLAB environment to calculate the tunneling probability and current through an arbitrary potential barrier comparing three different numerical techniques: the finite difference method, transfer matrix method, and transmission line method. For benchmarking, the tool is applied to many case studies such as the rectangular single barrier, rectangular double barrier, and continuous bell-shaped potential barrier, each compared to analytical solutions and giving the dependence of the error on the number of mesh points. In addition, a thorough study of the J ‑ V characteristics of MIM and MIIM diodes, used as rectifiers for rectenna solar cells, is presented and simulations are compared to experimental results showing satisfactory agreement. On the undergraduate level, the tool provides a deeper insight for students to compare numerical techniques used to solve various tunneling problems and helps students to choose a suitable technique for a certain application.

Volume holographic elements in Kodak 131 plates processed with SHSG method

NASA Astrophysics Data System (ADS)

Collados, Manuel V.; Atencia, Jesus; Lopez, Ana M.; Quintanilla, Manuel M.

2001-08-01

A SHSG procedure to register volume phase holograms in Kodak 131 plates is presented. We analyze the influence on the diffraction efficiency of the developing step and the temperature of the bleaching bath of usual SHSG processes. Applying a simple 12 steps process to form phase transmission holograms developing with D-19, bleaching with R-10 at 70 degrees C and removing the sensitizing dyes that remain in the emulsion with a diluted methanol bath after the fixation step, we obtain relative efficiencies of 100 percent and effective efficiencies of 70 percent.

An experimental hut study to quantify the effect of DDT and airborne pyrethroids on entomological parameters of malaria transmission

PubMed Central

2014-01-01

Background Current malaria vector control programmes rely on insecticides with rapid contact toxicity. However, spatial repellents can also be applied to reduce man-vector contact, which might ultimately impact malaria transmission. The aim of this study was to quantify effects of airborne pyrethroids from coils and DDT used an indoor residual spray (IRS) on entomological parameters that influence malaria transmission. Methods The effect of Transfluthrin and Metofluthrin coils compared to DDT on house entry, exit and indoor feeding behaviour of Anopheles gambiae sensu lato were measured in experimental huts in the field and in the semi-field. Outcomes were deterrence - reduction in house entry of mosquitoes; irritancy or excito-repellency – induced premature exit of mosquitoes; blood feeding inhibition and effect on mosquito fecundity. Results Transfluthrin coils, Metofluthrin coils and DDT reduced human vector contact through deterrence by 38%, 30% and 8%, respectively and induced half of the mosquitoes to leave huts before feeding (56%, 55% and 48%, respectively). Almost all mosquitoes inside huts with Metofluthrin and Transfluthrin coils and more than three quarters of mosquitoes in the DDT hut did not feed, almost none laid eggs and 67%, 72% and 70% of all mosquitoes collected from Transfluthrin, Metofluthrin and DDT huts, respectively had died after 24 hours. Conclusion This study highlights that airborne pyrethroids and DDT affect a range of anopheline mosquito behaviours that are important parameters in malaria transmission, namely deterrence, irritancy/excito-repellency and blood-feeding inhibition. These effects are in addition to significant toxicity and reduced mosquito fecundity that affect mosquito densities and, therefore, provide community protection against diseases for both users and non-users. Airborne insecticides and freshly applied DDT had similar effects on deterrence, irritancy and feeding inhibition. Therefore, it is suggested that airborne pyrethroids, if delivered in suitable formats, may complement existing mainstream vector control tools. PMID:24693934

Experimental study on an S-band near-field microwave magnetron power transmission system on hundred-watt level

NASA Astrophysics Data System (ADS)

Zhang, Biao; Jiang, Wan; Yang, Yang; Yu, Chengyang; Huang, Kama; Liu, Changjun

2015-11-01

A multi-magnetron microwave source, a metamaterial transmitting antenna, and a large power rectenna array are presented to build a near-field 2.45 GHz microwave power transmission system. The square 1 m2 rectenna array consists of sixteen rectennas with 2048 Schottky diodes for large power microwave rectifying. It receives microwave power and converts them into DC power. The design, structure, and measured performance of a unit rectenna as well as the entail rectenna array are presented in detail. The multi-magnetron microwave power source switches between half and full output power levels, i.e. the half-wave and full-wave modes. The transmission antenna is formed by a double-layer metallic hole array, which is applied to combine the output power of each magnetron. The rectenna array DC output power reaches 67.3 W on a 1.2 Ω DC load at a distance of 5.5 m from the transmission antenna. DC output power is affected by the distance, DC load, and the mode of microwave power source. It shows that conventional low power Schottky diodes can be applied to a microwave power transmission system with simple magnetrons to realise large power microwave rectifying.

77 FR 69615 - Commission Information Collection Activities (FERC-715); Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-20

... transmission planning; A detailed description of the transmission planning reliability criteria used to..., but not limited to, how reliability criteria are applied and the steps taken in [[Page 69616... performance as measured against its stated reliability criteria using its stated assessment practices. The...

40 CFR 86.085-37 - Production vehicles and engines.

Code of Federal Regulations, 2013 CFR

2013-07-01

.... (d) The following definitions apply to this section: (1) Model type means a unique combination of car..., inertia weight, and transmission class. (3) Vehicle configuration means a unique combination of basic engine, engine code, inertia weight, transmission configuration, and axle ratio within a base level. [48...

40 CFR 86.085-37 - Production vehicles and engines.

Code of Federal Regulations, 2012 CFR

2012-07-01

.... (d) The following definitions apply to this section: (1) Model type means a unique combination of car..., inertia weight, and transmission class. (3) Vehicle configuration means a unique combination of basic engine, engine code, inertia weight, transmission configuration, and axle ratio within a base level. [48...

Integration of airborne LiDAR data and voxel-based ray tracing to determine high-resolution solar radiation dynamics at the forest floor: implications for improving stand-scale distributed snowmelt models

NASA Astrophysics Data System (ADS)

Musselman, K. N.; Molotch, N. P.; Margulis, S. A.

2012-12-01

Forest architecture dictates sub-canopy solar irradiance and the resulting patterns can vary seasonally and over short spatial distances. These radiation dynamics are thought to have significant implications on snowmelt processes, regional hydrology, and remote sensing signatures. The variability calls into question many assumptions inherent in traditional canopy models (e.g. Beer's Law) when applied at high resolution (i.e. 1 m). We present a method of estimating solar canopy transmissivity using airborne LiDAR data. The canopy structure is represented in 3-D voxel space (i.e. a cubic discretization of a 3-D domain analogous to a pixel representation of a 2-D space). The solar direct beam canopy transmissivity (DBT) is estimated with a ray-tracing algorithm and the diffuse component is estimated from LiDAR-derived effective LAI. Results from one year at five-minute temporal and 1 m spatial resolutions are presented from Sequoia National Park. Compared to estimates from 28 hemispherical photos, the ray-tracing model estimated daily mean DBT with a 10% average error, while the errors from a Beer's-type DBT estimate exceeded 20%. Compared to the ray-tracing estimates, the Beer's-type transmissivity method was unable to resolve complex spatial patterns resulting from canopy gaps, individual tree canopies and boles, and steep variable terrain. The snowmelt model SNOWPACK was applied at locations of ultrasonic snow depth sensors. Two scenarios were tested; 1) a nominal case where canopy model parameters were obtained from hemispherical photographs, and 2) an explicit scenario where the model was modified to accept LiDAR-derived time-variant DBT. The bulk canopy treatment was generally unable to simulate the sub-canopy snowmelt dynamics observed at the depth sensor locations. The explicit treatment reduced error in the snow disappearance date by one week and both positive and negative melt-season SWE biases were reduced. The results highlight the utility of LiDAR canopy measurements and physically based snowmelt models to simulate spatially distributed stand- and slope-scale snowmelt dynamics at resolutions necessary to capture the inherent underlying variability.iDAR-derived solar direct beam canopy transmissivity computed as the daily average for March 1st and May 1st.

Study on Two-Phase Flow in Heterogeneous Porous Media by Light Transmission Method

NASA Astrophysics Data System (ADS)

Qiao, W.

2015-12-01

The non-aqueous phase liquid (NAPL) released to the subsurface can form residual ganglia and globules occupying pores and also accumulate and form pools, in which multiphase system forms. Determining transient fluid saturations in a multiphase system is essential to understand the flow characteristics of systems and to perform effective remediation strategies. As a non-destructive and non-invasive laboratory technique utilized for the measurement of liquid saturation in porous media, light transmission is of the lowest cost and safe. Utilization of Coupled Charge Device camera in light transmission systems provides a nearly instantaneous high-density array of spatial measurements over a very large dynamic range. The migration of NAPL and air spariging technique applied to remove NAPL in aquifer systems are typically two-phase flow problem. Because of the natural aquifer normally being heterogeneous, two 2-D sandboxes (Length55cm×width1.3cm×hight45cm) are set up to study the migration of gas and DNAPL in heterogeneous porous media based on light transmission method and its application in two-phase flow. Model D for water/gas system developed by Niemet and Selker (2001) and Model NW-A for water/NAPL system developed by Zhang et al. (2014) are applied for the calculation of fluid saturation in the two experiments, respectively. The gas injection experiments show that the gas moves upward in the irregular channels, piling up beneath the low permeability lenses and starting lateral movement. Bypassing the lenses, the gas moves upward and forms continuous distribution in the top of the sandbox. The faster of gas injects, the wider of gas migration will be. The DNAPL infiltration experiment shows that TCE mainly moves downward as the influence of gravity, stopping vertical infiltration when reaching the low permeability lenses because of its failure to overcome the capillary pressure. Then, TCE accumulates on the surface and starts transverse movement. Bypassing the lenses, TCE migrates down again and eventually accumulates at the bottom of the sandbox. The two models of quantification of fluid saturations for water/gas system and water/NAPL system developed in homogenous porous media give comparatively fit results to the observations and can be used to quantify fluid saturations in heterogeneous porous media.

Noninvasive Study of Explosive Materials by Time Domain Spectroscopy and FTIR

NASA Astrophysics Data System (ADS)

Huang, Feng; Federici, John; Gary, Dale; Barat, Robert; Zimdars, David

2005-04-01

Transmission and reflection spectroscopy in the Terahertz (THz) range (˜ 3 to 0.1 mm) is potentially useful for the detection of explosives and biological agents. This paper describes the use of THz time domain spectroscopy (TDS) applied in transmission to the 1,3,5 trinitro-s-triazine (RDX), C4, Amonium Nitrate, etc. Samples were also subjected to Fourier Transform Infrared (FTIR) spectroscopy over the same range for comparison. General agreement confirms the absorption features found. The nature of THz technology applied in the noninvasive detection of such material is discussed.

Quantum information generation, storage and transmission based on nuclear spins

NASA Astrophysics Data System (ADS)

Zaharov, V. V.; Makarov, V. I.

2018-05-01

A new approach to quantum information generation, storage and transmission is proposed. It is shown that quantum information generation and storage using an ensemble of N electron spins encounter unresolvable implementation problems (at least at the present time). As an alternative implementation we discuss two promising radical systems, one with N equivalent nuclear spins and another with N nonequivalent nuclear spins. Detailed analysis shows that only the radical system containing N nonequivalent nuclei is perfectly matched for quantum information generation, storage and transmission. We develop a procedure based on pulsed electron paramagnetic resonance (EPR) and we apply it to the radical system with the set of nonequivalent nuclei. The resulting EPR spectrum contains 2N transition lines, where N is the number of the atoms with the nuclear spin 1/2, and each of these lines may be encoded with a determined qudit sequence. For encoding the EPR lines we propose to submit the radical system to two magnetic pulses in the direction perpendicular to the z axis of the reference frame. As a result, the radical system impulse response may be measured, stored and transmitted through the communications channel. Confirming our development, the ab initio analysis of the system with three anion radicals was done showing matching between the simulations and the theoretical predictions. The developed method may be easily adapted for quantum information generation, storage, processing and transmission in quantum computing and quantum communications applications.

Estimating the variance and integral scale of the transmissivity field using head residual increments

USGS Publications Warehouse

Zheng, Li; Silliman, Stephen E.

2000-01-01

A modification of previously published solutions regarding the spatial variation of hydraulic heads is discussed whereby the semivariogram of increments of head residuals (termed head residual increments HRIs) are related to the variance and integral scale of the transmissivity field. A first‐order solution is developed for the case of a transmissivity field which is isotropic and whose second‐order behavior can be characterized by an exponential covariance structure. The estimates of the variance σY2 and the integral scale λ of the log transmissivity field are then obtained via fitting a theoretical semivariogram for the HRI to its sample semivariogram. This approach is applied to head data sampled from a series of two‐dimensional, simulated aquifers with isotropic, exponential covariance structures and varying degrees of heterogeneity (σY2 = 0.25, 0.5, 1.0, 2.0, and 5.0). The results show that this method provided reliable estimates for both λ and σY2 in aquifers with the value of σY2 up to 2.0, but the errors in those estimates were higher for σY2 equal to 5.0. It is also demonstrated through numerical experiments and theoretical arguments that the head residual increments will provide a sample semivariogram with a lower variance than will the use of the head residuals without calculation of increments.

A mechanistic spatio-temporal framework for modelling individual-to-individual transmission—With an application to the 2014-2015 West Africa Ebola outbreak

PubMed Central

McClelland, Amanda; Zelner, Jon; Streftaris, George; Funk, Sebastian; Metcalf, Jessica; Dalziel, Benjamin D.; Grenfell, Bryan T.

2017-01-01

In recent years there has been growing availability of individual-level spatio-temporal disease data, particularly due to the use of modern communicating devices with GPS tracking functionality. These detailed data have been proven useful for inferring disease transmission to a more refined level than previously. However, there remains a lack of statistically sound frameworks to model the underlying transmission dynamic in a mechanistic manner. Such a development is particularly crucial for enabling a general epidemic predictive framework at the individual level. In this paper we propose a new statistical framework for mechanistically modelling individual-to-individual disease transmission in a landscape with heterogeneous population density. Our methodology is first tested using simulated datasets, validating our inferential machinery. The methodology is subsequently applied to data that describes a regional Ebola outbreak in Western Africa (2014-2015). Our results show that the methods are able to obtain estimates of key epidemiological parameters that are broadly consistent with the literature, while revealing a significantly shorter distance of transmission. More importantly, in contrast to existing approaches, we are able to perform a more general model prediction that takes into account the susceptible population. Finally, our results show that, given reasonable scenarios, the framework can be an effective surrogate for susceptible-explicit individual models which are often computationally challenging. PMID:29084216

A review of advantages of high-efficiency X-ray spectrum imaging for analysis of nanostructured ferritic alloys

DOE PAGES

Parish, Chad M.; Miller, Michael K.

2014-12-09

Nanostructured ferritic alloys (NFAs) exhibit complex microstructures consisting of 100-500 nm ferrite grains, grain boundary solute enrichment, and multiple populations of precipitates and nanoclusters (NCs). Understanding these materials' excellent creep and radiation-tolerance properties requires a combination of multiple atomic-scale experimental techniques. Recent advances in scanning transmission electron microscopy (STEM) hardware and data analysis methods have the potential to revolutionize nanometer to micrometer scale materials analysis. The application of these methods is applied to NFAs as a test case and is compared to both conventional STEM methods as well as complementary methods such as scanning electron microscopy and atom probe tomography.more » In this paper, we review past results and present new results illustrating the effectiveness of latest-generation STEM instrumentation and data analysis.« less

Electro-Optical Modulator Bias Control Using Bipolar Pulses

NASA Technical Reports Server (NTRS)

Farr, William; Kovalik, Joseph

2007-01-01

An improved method has been devised for controlling the DC bias applied to an electro-optical crystal that is part of a Mach-Zehnder modulator that generates low-duty-cycle optical pulses for a pulse-position modulation (PPM) optical data-communication system. In such a system, it is desirable to minimize the transmission of light during the intervals between pulses, and for this purpose, it is necessary to maximize the extinction ratio of the modulator (the ratio between the power transmitted during an "on" period and the power transmitted during an "off" period). The present method is related to prior dither error feedback methods, but unlike in those methods, there is no need for an auxiliary modulation subsystem to generate a dithering signal. Instead, as described below, dither is effected through alternation of the polarity of the modulation signal. The upper part of Figure 1 schematically depicts a Mach-Zehnder modulator. The signal applied to the electro-optical crystal consists of a radio-frequency modulating pulse signal, VRF, superimposed on a DC bias Vbias. Maximum extinction occurs during the off (VRF = 0) period if Vbias is set at a value that makes the two optical paths differ by an odd integer multiple of a half wavelength so that the beams traveling along the two paths interfere destructively at the output beam splitter. Assuming that the modulating pulse signal VRF has a rectangular waveform, maximum transmission occurs during the "on" period if the amplitude of VRF is set to a value, V , that shifts the length of the affected optical path by a half wavelength so that now the two beams interfere constructively at the output beam splitter. The modulating pulse signal is AC-coupled from an amplifier to the electro-optical crystal. Sometimes, two successive pulses occur so close in time that the operating point of the amplifier drifts, one result being that there is not enough time for the signal level to return to ground between pulses. Also, the difference between the optical-path lengths can drift with changes in temperature and other spurious effects. The effects of both types of drift are suppressed in the present method, in which one takes advantage of the fact that when Vbias is set at the value for maximum extinction, equal-magnitude positive and negative pulses applied to the electro-optical crystal produce equal output light pulses.

Verification of three-microphone impedance tube method for measurement of transmission loss in aerogels

NASA Astrophysics Data System (ADS)

Connick, Robert J.

Accurate measurement of normal incident transmission loss is essential for the acoustic characterization of building materials. In this research, a method of measuring normal incidence sound transmission loss proposed by Salissou et al. as a complement to standard E2611-09 of the American Society for Testing and Materials [Standard Test Method for Measurement of Normal Incidence Sound Transmission of Acoustical Materials Based on the Transfer Matrix Method (American Society for Testing and Materials, New York, 2009)] is verified. Two sam- ples from the original literature are used to verify the method as well as a Filtros RTM sample. Following the verification, several nano-material Aerogel samples are measured.

Method and apparatus for wavefront sensing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bahk, Seung-Whan

A method for performing optical wavefront sensing includes providing an amplitude transmission mask having a light input side, a light output side, and an optical transmission axis passing from the light input side to the light output side. The amplitude transmission mask is characterized by a checkerboard pattern having a square unit cell of size .LAMBDA.. The method also includes directing an incident light field having a wavelengthmore » $$ \\lamda $$ to be incident on the light input side and propagating the incident light field through the amplitude transmission mask. The method further includes producing a plurality of diffracted light fields on the light output side and detecting, at a detector disposed a distance L from the amplitude transmission mask, an interferogram associated with the plurality of diffracted light fields.« less

[Design and optimization of wireless power and data transmission for visual prosthesis].

PubMed

Lei, Xuping; Wu, Kaijie; Zhao, Lei; Chai, Xinyu

2013-11-01

Boosting spatial resolution of visual prostheses is an effective method to improve implant subjects' visual perception. However, power consumption of visual implants greatly rises with the increasing number of implanted electrodes. In respond to this trend, visual prostheses need to develop high-efficiency wireless power transmission and high-speed data transmission. This paper presents a review of current research progress on wireless power and data transmission for visual prostheses, analyzes relative principles and requirement, and introduces design methods of power and data transmission.

Transport synthetic acceleration with opposing reflecting boundary conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zika, M.R.; Adams, M.L.

2000-02-01

The transport synthetic acceleration (TSA) scheme is extended to problems with opposing reflecting boundary conditions. This synthetic method employs a simplified transport operator as its low-order approximation. A procedure is developed that allows the use of the conjugate gradient (CG) method to solve the resulting low-order system of equations. Several well-known transport iteration algorithms are cast in a linear algebraic form to show their equivalence to standard iterative techniques. Source iteration in the presence of opposing reflecting boundary conditions is shown to be equivalent to a (poorly) preconditioned stationary Richardson iteration, with the preconditioner defined by the method of iteratingmore » on the incident fluxes on the reflecting boundaries. The TSA method (and any synthetic method) amounts to a further preconditioning of the Richardson iteration. The presence of opposing reflecting boundary conditions requires special consideration when developing a procedure to realize the CG method for the proposed system of equations. The CG iteration may be applied only to symmetric positive definite matrices; this condition requires the algebraic elimination of the boundary angular corrections from the low-order equations. As a consequence of this elimination, evaluating the action of the resulting matrix on an arbitrary vector involves two transport sweeps and a transmission iteration. Results of applying the acceleration scheme to a simple test problem are presented.« less

Study on Remote Monitoring System of Crossing and Spanning Tangent Tower

NASA Astrophysics Data System (ADS)

Chen, Da-bing; Zhang, Nai-long; Zhang, Meng-ge; Wang, Ze-hua; Zhang, Yan

2017-05-01

In order to grasp the vibration state of overhead transmission line and ensure the operational security of transmission line, the remote monitoring system of crossing and spanning tangent tower was studied. By use of this system, the displacement, velocity and acceleration of the tower, and the local weather data are collected automatically, displayed on computer of remote monitoring centre through wireless network, real-time collection and transmission of vibration signals are realized. The applying results show that the system is excellent in reliability and accuracy and so on. The system can be used to remote monitoring of transmission tower of UHV power transmission lines and in large spanning areas.

Influence of undergraduate nursing student teaching methods on learning standard precautions and transmission-based precautions: Experimental research.

PubMed

Kappes Ramirez, Maria Soledad

2018-02-01

An experimental study was performed with undergraduate nursing students in order to determine, between two methodologies, which is the best for learning standard precautions and precautions based on disease transmission mechanisms. Students in the sample are stratified by performance, with the experimental group (49 students) being exposed to self-instruction and clinical simulation on the topic of standard precautions and special precautions according to disease transmission mechanisms. Conventional classes on the same topics were provided to the control group (49 students). The experimental group showed the best performance in the multiple-choice post-test of knowledge (p=0.002) and in the assessment of essay questions (p=0.043), as well as in the evaluation of a simulated scenario, in relation to the control group. This study demonstrates that it is possible to transfer some teaching subjects on the prevention of Healthcare Associated Infections (HAIs) to self-learning by means of virtual teaching strategies with good results. This allows greater efficiency in the allocation of teachers to clinical simulation or learning situations in the laboratory, where students can apply what they have learned in the self-instruction module. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dielectric multilayer beam splitter with differential phase shift on transmission and reflection for division-of-amplitude photopolarimeter.

PubMed

Yuan, Wenjia; Shen, Weidong; Zhang, Yueguang; Liu, Xu

2014-05-05

Dielectric multilayer beam splitter with differential phase shift on transmission and reflection for division-of-amplitude photopolarimeter (DOAP) was presented for the first time to our knowledge. The optimal parameters for the beam splitter are Tp = 78.9%, Ts = 21.1% and Δr - Δt = π/2 at 532nm at an angle of incidence of 45°. Multilayer anti-reflection coating with low phase shift was applied to reduce the backside reflection. Different design strategies that can achieve all optimal targets at the wavelength were tested. Two design methods were presented to optimize the differential phase shift. The samples were prepared by ion beam sputtering (IBS). The experimental results show good agreement with those of the design. The ellipsometric parameters of samples were measured in reflection (ψr, Δr) = (26.5°, 135.1°) and (28.2°, 133.5°), as well as in transmission (ψt, Δt) = (62.5°, 46.1°) and (63.5°, 46°) at 532.6nm. The normalized determinant of instrument matrix to evaluate the performance of samples is respectively 0.998 and 0.991 at 532.6nm.

Kalai-Smorodinsky bargaining solution for optimal resource allocation over wireless DS-CDMA visual sensor networks

NASA Astrophysics Data System (ADS)

Pandremmenou, Katerina; Kondi, Lisimachos P.; Parsopoulos, Konstantinos E.

2012-01-01

Surveillance applications usually require high levels of video quality, resulting in high power consumption. The existence of a well-behaved scheme to balance video quality and power consumption is crucial for the system's performance. In the present work, we adopt the game-theoretic approach of Kalai-Smorodinsky Bargaining Solution (KSBS) to deal with the problem of optimal resource allocation in a multi-node wireless visual sensor network (VSN). In our setting, the Direct Sequence Code Division Multiple Access (DS-CDMA) method is used for channel access, while a cross-layer optimization design, which employs a central processing server, accounts for the overall system efficacy through all network layers. The task assigned to the central server is the communication with the nodes and the joint determination of their transmission parameters. The KSBS is applied to non-convex utility spaces, efficiently distributing the source coding rate, channel coding rate and transmission powers among the nodes. In the underlying model, the transmission powers assume continuous values, whereas the source and channel coding rates can take only discrete values. Experimental results are reported and discussed to demonstrate the merits of KSBS over competing policies.

Analyzing the performance of PROSPECT model inversion based on different spectral information for leaf biochemical properties retrieval

NASA Astrophysics Data System (ADS)

Sun, Jia; Shi, Shuo; Yang, Jian; Du, Lin; Gong, Wei; Chen, Biwu; Song, Shalei

2018-01-01

Leaf biochemical constituents provide useful information about major ecological processes. As a fast and nondestructive method, remote sensing techniques are critical to reflect leaf biochemistry via models. PROSPECT model has been widely applied in retrieving leaf traits by providing hemispherical reflectance and transmittance. However, the process of measuring both reflectance and transmittance can be time-consuming and laborious. Contrary to use reflectance spectrum alone in PROSPECT model inversion, which has been adopted by many researchers, this study proposes to use transmission spectrum alone, with the increasing availability of the latter through various remote sensing techniques. Then we analyzed the performance of PROSPECT model inversion with (1) only transmission spectrum, (2) only reflectance and (3) both reflectance and transmittance, using synthetic datasets (with varying levels of random noise and systematic noise) and two experimental datasets (LOPEX and ANGERS). The results show that (1) PROSPECT-5 model inversion based solely on transmission spectrum is viable with results generally better than that based solely on reflectance spectrum; (2) leaf dry matter can be better estimated using only transmittance or reflectance than with both reflectance and transmittance spectra.

A simple and predictive phenotypic High Content Imaging assay for Plasmodium falciparum mature gametocytes to identify malaria transmission blocking compounds

PubMed Central

Lucantoni, Leonardo; Silvestrini, Francesco; Signore, Michele; Siciliano, Giulia; Eldering, Maarten; Dechering, Koen J.; Avery, Vicky M.; Alano, Pietro

2015-01-01

Plasmodium falciparum gametocytes, specifically the mature stages, are the only malaria parasite stage in humans transmissible to the mosquito vector. Anti-malarial drugs capable of killing these forms are considered essential for the eradication of malaria and tools allowing the screening of large compound libraries with high predictive power are needed to identify new candidates. As gametocytes are not a replicative stage it is difficult to apply the same drug screening methods used for asexual stages. Here we propose an assay, based on high content imaging, combining “classic” gametocyte viability readout based on gametocyte counts with a functional viability readout, based on gametocyte activation and the discrimination of the typical gamete spherical morphology. This simple and rapid assay has been miniaturized to a 384-well format using acridine orange staining of wild type P. falciparum 3D7A sexual forms, and was validated by screening reference antimalarial drugs and the MMV Malaria Box. The assay demonstrated excellent robustness and ability to identify quality hits with high likelihood of confirmation of transmission reducing activity in subsequent mosquito membrane feeding assays. PMID:26553647

A simple and selective resonance Rayleigh scattering-energy transfer spectral method for determination of trace neomycin sulfate using Cu2O particle as probe

NASA Astrophysics Data System (ADS)

Ouyang, Huixiang; Liang, Aihui; Jiang, Zhiliang

2018-02-01

The stable Cu2O nanocubic (Cu2ONC) sol was prepared, based on graphene oxide (GO) catalysis of glucose-Fehling's reagent reaction, and its absorption and resonance Rayleigh scattering (RRS) spectra, transmission electron microscopy (TEM) and energy dispersive spectroscopy (EDS) were examined. Using the as-prepared Cu2ONC as RRS probe, and coupling with the neomycin sulfate (NEO) complex reaction, a new, simple, sensitive and selective RRS-energy transfer (RRS-ET) method was established for detection of neomycin sulfate, with a linear range of 1.4-112 μM and a detection limit of 0.4 μM. The method has been applied to the detection of neomycin sulfate in samples with satisfactory results.

Beam-based calibrations of the BPM offset at C-ADS Injector II

NASA Astrophysics Data System (ADS)

Chen, Wei-Long; Wang, Zhi-Jun; Feng, Chi; Dou, Wei-Ping; Tao, Yue; Jia, Huan; Wang, Wang-Sheng; Liu, Shu-Hui; He, Yuan

2016-07-01

Beam-based BPM offset calibration was carried out for Injector II at the C-ADS demonstration facility at the Institute of Modern Physics (IMP), Chinese Academy of Science (CAS). By using the steering coils integrated in the quadrupoles, the beam orbit can be effectively adjusted and BPM positions recorded at the Medium Energy Beam Transport of the Injector II Linac. The studies were done with a 2 mA, 2.1 MeV proton beam in pulsed mode. During the studies, the “null comparison method” was applied for the calibration. This method is less sensitive to errors compared with the traditional transmission matrix method. In addition, the quadrupole magnet’s center can also be calibrated with this method. Supported by National Natural Science Foundation of China (91426303, 11525523)

The anesthesia and brain monitor (ABM). Concept and performance.

PubMed

Kay, B

1984-01-01

Three integral components of the ABM, the frontalis electromyogram (EMG), the processed unipolar electroencephalogram (EEG) and the neuromuscular transmission monitor (NMT) were compared with standard research methods, and their clinical utility indicated. The EMG was compared with the method of Dundee et al (2) for measuring the induction dose of thiopentone; the EEG was compared with the SLE Galileo E8-b and the NMT was compared with the Medelec MS6. In each case correlation of results was extremely high, and the ABM offered some advantages over the standard research methods. We conclude that each of the integral units of the ABM is simple to apply and interpret, yet as accurate as standard apparatus used for research. In addition the ABM offers excellent display and recording facilities and alarm systems.

Atmospheric pressure matrix-assisted laser desorption ionization as a plume diagnostic tool in laser evaporation methods

NASA Astrophysics Data System (ADS)

Callahan, John H.; Galicia, Marsha C.; Vertes, Akos

2002-09-01

Laser evaporation techniques, including matrix-assisted pulsed laser evaporation (MAPLE), are attracting increasing attention due to their ability to deposit thin layers of undegraded synthetic and biopolymers. Laser evaporation methods can be implemented in reflection geometry with the laser and the substrate positioned on the same side of the target. In some applications (e.g. direct write, DW), however, transmission geometry is used, i.e. the thin target is placed between the laser and the substrate. In this case, the laser pulse perforates the target and transfers some target material to the substrate. In order to optimize evaporation processes it is important to know the composition of the target plume and the material deposited from the plume. We used a recently introduced analytical method, atmospheric pressure matrix-assisted laser desorption ionization (AP-MALDI) to characterize the ionic components of the plume both in reflection and in transmission geometry. This technique can also be used to directly probe materials deposited on surfaces (such as glass slides) by laser evaporation methods. The test compound (small peptides, e.g. Angiotensin I, ATI or Substance P) was mixed with a MALDI matrix (α-cyano-4-hydroxycinnamic acid (CHCA), sinapinic acid (SA) or 2,5-dihydroxybenzoic acid (DHB)) and applied to the stainless steel (reflection geometry) or transparent conducting (transmission geometry) target holder. In addition to the classical dried droplet method, we also used electrospray target deposition to gain better control of crystallite size, thickness and homogeneity. The target was mounted in front of the inlet orifice of an ion trap mass spectrometer (IT-MS) that sampled the ionic components of the plume generated by a nitrogen laser. We studied the effect of several parameters, such as, the orifice to target distance, illumination geometry, extracting voltage distribution and sample preparation on the generated ions. Various analyte-matrix and matrix-matrix cluster ions were observed with relatively low abundance of the matrix ions.

Vertical cultural transmission effects on demic front propagation: Theory and application to the Neolithic transition in Europe

NASA Astrophysics Data System (ADS)

Fort, Joaquim

2011-05-01

It is shown that Lotka-Volterra interaction terms are not appropriate to describe vertical cultural transmission. Appropriate interaction terms are derived and used to compute the effect of vertical cultural transmission on demic front propagation. They are also applied to a specific example, the Neolithic transition in Europe. In this example, it is found that the effect of vertical cultural transmission can be important (about 30%). On the other hand, simple models based on differential equations can lead to large errors (above 50%). Further physical, biophysical, and cross-disciplinary applications are outlined.

75 FR 79374 - Notice of a Regional Project Waiver of Section 1605 (Buy American) of the American Recovery and...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-20

... field and raw water transmission line. This is a project specific waiver and only applies to the use of... specifications as part of the construction of a new bedrock well field and raw water transmission line. Section...

ACHP | Energy Development, Transmission, and Historic Preservation

Science.gov Websites

review process established in Section 106 of the National Historic Preservation Act (NHPA), when applied review process established in Section 106 of the NHPA. Federal agencies reviewing or approving these regarding Coordination in Federal Agency Review of Electric Transmission Facilities on Federal Land Gateway

76 FR 179 - GMPT Warren Transmission, GM Powertrain Division, a Subsidiary of General Motors Company...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-03

... Knight Facilities Management, Warren, MI; Amended Certification Regarding Eligibility To Apply for Worker... Knight Facilities Management were employed on-site at the Warren, Michigan location of the subject firm... Knight Facilities Management working on-site at the Warren, Michigan location of GMPT Warren Transmission...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2010 CFR

2010-01-01

... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... will not be admitted under the Visa Waiver Program unless an appropriate official of the carrier... departure from the United States by sea or air of an alien admitted under the Visa Waiver Program, an...

77 FR 53877 - Commission Information Collection Activities (FERC-715); Comment Request; Extension

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-04

...; A detailed description of the transmission planning reliability criteria used to evaluate system... reliability criteria are applied and the steps taken in performing transmission planning studies); and A... reliability criteria using its stated assessment practices. The FERC-715 enables the Commission to use the...

Transmission loss measurement of acoustic material using time-domain pulse-separation method (L).

PubMed

Sun, Liang; Hou, Hong

2011-04-01

An alternative method for measuring the normal incidence sound transmission loss (nSTL) is presented in this paper based on the time-domain separation of so-called Butterworth pulse with a short-duration time about 1 ms in a standing wave tube. During the generation process of the pulse, inverse filter principle was adopted to compensate the loudspeaker response, besides this, the effect of the characteristics of tube termination can be eliminated through the generation process of the pulse so as to obtain a single plane pulse wave in the standing wave tube which makes the nSTL measurement very simple. A polyurethane foam material with low transmission loss and a kind of rubber material with relatively high transmission loss are used to verify the proposed method. When compared with the traditional two-load method, a relatively good agreement between these two methods can be observed. The main error of this method results from the measuring accuracy of the amplitude of transmission coefficient.

Transgenerational epigenetics: Inheritance of global cytosine methylation and methylation-related epigenetic markers in the shrub Lavandula latifolia.

PubMed

Herrera, Carlos M; Alonso, Conchita; Medrano, Mónica; Pérez, Ricardo; Bazaga, Pilar

2018-04-01

The ecological and evolutionary significance of natural epigenetic variation (i.e., not based on DNA sequence variants) variation will depend critically on whether epigenetic states are transmitted from parents to offspring, but little is known on epigenetic inheritance in nonmodel plants. We present a quantitative analysis of transgenerational transmission of global DNA cytosine methylation (= proportion of all genomic cytosines that are methylated) and individual epigenetic markers (= methylation status of anonymous MSAP markers) in the shrub Lavandula latifolia. Methods based on parent-offspring correlations and parental variance component estimation were applied to epigenetic features of field-growing plants ('maternal parents') and greenhouse-grown progenies. Transmission of genetic markers (AFLP) was also assessed for reference. Maternal parents differed significantly in global DNA cytosine methylation (range = 21.7-36.7%). Greenhouse-grown maternal families differed significantly in global methylation, and their differences were significantly related to maternal origin. Methylation-sensitive amplified polymorphism (MSAP) markers exhibited significant transgenerational transmission, as denoted by significant maternal variance component of marker scores in greenhouse families and significant mother-offspring correlations of marker scores. Although transmission-related measurements for global methylation and MSAP markers were quantitatively lower than those for AFLP markers taken as reference, this study has revealed extensive transgenerational transmission of genome-wide global cytosine methylation and anonymous epigenetic markers in L. latifolia. Similarity of results for global cytosine methylation and epigenetic markers lends robustness to this conclusion, and stresses the value of considering both types of information in epigenetic studies of nonmodel plants. © 2018 Botanical Society of America.

3D Encoding of Musical Score Information and the Playback Method Used by the Cellular Phone

NASA Astrophysics Data System (ADS)

Kubo, Hitoshi; Sugiura, Akihiko

Recently, 3G cellular phone that can take a movie has spread by improving the digital camera function. And, 2Dcode has accurate readout and high operability. And it has spread as an information transmission means. However, the symbol is expanded and complicated when information of 2D codes increases. To solve these, 3D code was proposed. But it need the special equipment for readout, and specializes in the enhancing reality feeling technology. Therefore, it is difficult to apply it to the cellular phone. And so, we propose 3D code that can be recognized by the movie shooting function of the cellular phone. And, score information was encoded. We apply Gray Code to the property of music, and encode it. And the effectiveness was verified.

Quantification of mouse in vivo whole-body vibration amplitude from motion-blur using x-ray imaging.

PubMed

Hu, Zhengyi; Welch, Ian; Yuan, Xunhua; Pollmann, Steven I; Nikolov, Hristo N; Holdsworth, David W

2015-08-21

Musculoskeletal effects of whole-body vibration on animals and humans have become an intensely studied topic recently, due to the potential of applying this method as a non-pharmacological therapy for strengthening bones. It is relatively easy to quantify the transmission of whole-body mechanical vibration through the human skeletal system using accelerometers. However, this is not the case for small-animal pre-clinical studies because currently available accelerometers have a large mass, relative to the mass of the animals, which causes the accelerometers themselves to affect the way vibration is transmitted. Additionally, live animals do not typically remain motionless for long periods, unless they are anesthetized, and they are required to maintain a static standing posture during these studies. These challenges provide the motivation for the development of a method to quantify vibrational transmission in small animals. We present a novel imaging technique to quantify whole-body vibration transmission in small animals using 280 μm diameter tungsten carbide beads implanted into the hind limbs of mice. Employing time-exposure digital x-ray imaging, vibrational amplitude is quantified based on the blurring of the implanted beads caused by the vibrational motion. Our in vivo results have shown this technique is capable of measuring vibration amplitudes as small as 0.1 mm, with precision as small as  ±10 μm, allowing us to distinguish differences in the transmitted vibration at different locations on the hindlimbs of mice.

Bayesian approach for three-dimensional aquifer characterization at the Hanford 300 Area

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murakami, Haruko; Chen, X.; Hahn, Melanie S.

2010-10-21

This study presents a stochastic, three-dimensional characterization of a heterogeneous hydraulic conductivity field within DOE's Hanford 300 Area site, Washington, by assimilating large-scale, constant-rate injection test data with small-scale, three-dimensional electromagnetic borehole flowmeter (EBF) measurement data. We first inverted the injection test data to estimate the transmissivity field, using zeroth-order temporal moments of pressure buildup curves. We applied a newly developed Bayesian geostatistical inversion framework, the method of anchored distributions (MAD), to obtain a joint posterior distribution of geostatistical parameters and local log-transmissivities at multiple locations. The unique aspects of MAD that make it suitable for this purpose are itsmore » ability to integrate multi-scale, multi-type data within a Bayesian framework and to compute a nonparametric posterior distribution. After we combined the distribution of transmissivities with depth-discrete relative-conductivity profile from EBF data, we inferred the three-dimensional geostatistical parameters of the log-conductivity field, using the Bayesian model-based geostatistics. Such consistent use of the Bayesian approach throughout the procedure enabled us to systematically incorporate data uncertainty into the final posterior distribution. The method was tested in a synthetic study and validated using the actual data that was not part of the estimation. Results showed broader and skewed posterior distributions of geostatistical parameters except for the mean, which suggests the importance of inferring the entire distribution to quantify the parameter uncertainty.« less

Quantification of mouse in vivo whole-body vibration amplitude from motion-blur using x-ray imaging

NASA Astrophysics Data System (ADS)

Hu, Zhengyi; Welch, Ian; Yuan, Xunhua; Pollmann, Steven I.; Nikolov, Hristo N.; Holdsworth, David W.

2015-08-01

Musculoskeletal effects of whole-body vibration on animals and humans have become an intensely studied topic recently, due to the potential of applying this method as a non-pharmacological therapy for strengthening bones. It is relatively easy to quantify the transmission of whole-body mechanical vibration through the human skeletal system using accelerometers. However, this is not the case for small-animal pre-clinical studies because currently available accelerometers have a large mass, relative to the mass of the animals, which causes the accelerometers themselves to affect the way vibration is transmitted. Additionally, live animals do not typically remain motionless for long periods, unless they are anesthetized, and they are required to maintain a static standing posture during these studies. These challenges provide the motivation for the development of a method to quantify vibrational transmission in small animals. We present a novel imaging technique to quantify whole-body vibration transmission in small animals using 280 μm diameter tungsten carbide beads implanted into the hind limbs of mice. Employing time-exposure digital x-ray imaging, vibrational amplitude is quantified based on the blurring of the implanted beads caused by the vibrational motion. Our in vivo results have shown this technique is capable of measuring vibration amplitudes as small as 0.1 mm, with precision as small as  ±10 μm, allowing us to distinguish differences in the transmitted vibration at different locations on the hindlimbs of mice.

Oxygen surface exchange kinetics measurement by simultaneous optical transmission relaxation and impedance spectroscopy: Sr(Ti,Fe)O3-x thin film case study.

PubMed

Perry, Nicola H; Kim, Jae Jin; Tuller, Harry L

2018-01-01

We compare approaches to measure oxygen surface exchange kinetics, by simultaneous optical transmission relaxation (OTR) and AC-impedance spectroscopy (AC-IS), on the same mixed conducting SrTi 0.65 Fe 0.35 O 3-x film. Surface exchange coefficients were evaluated as a function of oxygen activity in the film, controlled by gas partial pressure and/or DC bias applied across the ionically conducting yttria-stabilized zirconia substrate. Changes in measured light transmission through the film over time (relaxations) resulted from optical absorption changes in the film corresponding to changes in its oxygen and oxidized Fe (~Fe 4+ ) concentrations; such relaxation profiles were successfully described by the equation for surface exchange-limited kinetics appropriate for the film geometry. The k chem values obtained by OTR were significantly lower than the AC-IS derived k chem values and k q values multiplied by the thermodynamic factor (bulk or thin film), suggesting a possible enhancement in k by the metal current collectors (Pt, Au). Long-term degradation in k chem and k q values obtained by AC-IS was also attributed to deterioration of the porous Pt current collector, while no significant degradation was observed in the optically derived k chem values. The results suggest that, while the current collector might influence measurements by AC-IS, the OTR method offers a continuous, in situ , and contact-free method to measure oxygen exchange kinetics at the native surfaces of thin films.

Oxygen surface exchange kinetics measurement by simultaneous optical transmission relaxation and impedance spectroscopy: Sr(Ti,Fe)O3-x thin film case study

PubMed Central

Perry, Nicola H.; Kim, Jae Jin; Tuller, Harry L.

2018-01-01

Abstract We compare approaches to measure oxygen surface exchange kinetics, by simultaneous optical transmission relaxation (OTR) and AC-impedance spectroscopy (AC-IS), on the same mixed conducting SrTi0.65Fe0.35O3-x film. Surface exchange coefficients were evaluated as a function of oxygen activity in the film, controlled by gas partial pressure and/or DC bias applied across the ionically conducting yttria-stabilized zirconia substrate. Changes in measured light transmission through the film over time (relaxations) resulted from optical absorption changes in the film corresponding to changes in its oxygen and oxidized Fe (~Fe4+) concentrations; such relaxation profiles were successfully described by the equation for surface exchange-limited kinetics appropriate for the film geometry. The kchem values obtained by OTR were significantly lower than the AC-IS derived kchem values and kq values multiplied by the thermodynamic factor (bulk or thin film), suggesting a possible enhancement in k by the metal current collectors (Pt, Au). Long-term degradation in kchem and kq values obtained by AC-IS was also attributed to deterioration of the porous Pt current collector, while no significant degradation was observed in the optically derived kchem values. The results suggest that, while the current collector might influence measurements by AC-IS, the OTR method offers a continuous, in situ, and contact-free method to measure oxygen exchange kinetics at the native surfaces of thin films. PMID:29511391

Roles of neuronal NK1 and NK3 receptors in synaptic transmission during motility reflexes in the guinea-pig ileum

PubMed Central

Johnson, P J; Bornstein, J C; Burcher, E

1998-01-01

The role of NK1 and NK3 receptors in synaptic transmission between myenteric neurons during motility reflexes in the guinea-pig ileum was investigated by recording intracellularly the reflex responses of the circular muscle to distension or compression of the mucosal villi. Experiments were performed in a three-chambered organ bath that enabled drugs to be selectively applied to different sites along the reflex pathways.When applied in the recording chamber, an NK1 receptor antagonist, SR140333 (100 nM), reduced by 40–50% the amplitudes of inhibitory junction potentials (i.j.ps) evoked in the circular muscle by activation of descending reflex pathways. This effect was abolished when synaptic transmission in the stimulus region was blocked with physiological saline containing 0.1 mM Ca2+ plus 10 mM Mg2+, leaving only the component of the descending reflex pathway conducted via long anally directed collaterals of intrinsic sensory neurons.SR140333 (100 nM) had no effect on descending reflex i.j.ps when applied to the stimulus region. Ascending reflexes were also unaffected by SR140333 in the stimulus region or between the stimulus and recording sites.Septide (10 nM), an NK1 receptor agonist, enhanced descending reflexes by 30–60% when in the recording chamber. [Sar9,Met(O2)11]substance P had no effect at 10 nM, but potentiated distension-evoked reflexes at 100 nM.A selective NK3 receptor antagonist, SR142801 (100 nM), when applied to the stimulus region, reduced the amplitude of descending reflex responses to compression by 40%, but had no effect on responses to distension. SR142801 (100 nM) had no effect when applied to other regions of the descending reflex pathways.SR142801 (100 nM) only inhibited ascending reflexes when applied at the recording site. However, after nicotinic transmission in the stimulus region was blocked, SR142801 (100 nM) at this site reduced responses to compression.Contractions of the circular muscle of isolated rings of ileum evoked by low concentrations of septide, but not [Sar9,Met(O2)11]substance P, were potentiated by tetrodotoxin (300 nM).Contractile responses evoked by an NK3 receptor agonist, senktide, were non-competitively inhibited by SR142801. After excitatory neuromuscular transmission was blocked, senktide produced inhibitory responses that were also antagonised by SR142801, but to a lesser extent and in an apparently competitive manner.These results indicate that tachykinins acting via NK1 receptors partly mediate transmission to inhibitory motor neurons. NK3 receptors play a role in transmission from intrinsic sensory neurons and from ascending interneurons to excitatory motor neurons during motility reflexes. PMID:9723948

A new method of linkage analysis using LOD scores for quantitative traits supports linkage of monoamine oxidase activity to D17S250 in the Collaborative Study on the Genetics of Alcoholism pedigrees.

PubMed

Curtis, David; Knight, Jo; Sham, Pak C

2005-09-01

Although LOD score methods have been applied to diseases with complex modes of inheritance, linkage analysis of quantitative traits has tended to rely on non-parametric methods based on regression or variance components analysis. Here, we describe a new method for LOD score analysis of quantitative traits which does not require specification of a mode of inheritance. The technique is derived from the MFLINK method for dichotomous traits. A range of plausible transmission models is constructed, constrained to yield the correct population mean and variance for the trait but differing with respect to the contribution to the variance due to the locus under consideration. Maximized LOD scores under homogeneity and admixture are calculated, as is a model-free LOD score which compares the maximized likelihoods under admixture assuming linkage and no linkage. These LOD scores have known asymptotic distributions and hence can be used to provide a statistical test for linkage. The method has been implemented in a program called QMFLINK. It was applied to data sets simulated using a variety of transmission models and to a measure of monoamine oxidase activity in 105 pedigrees from the Collaborative Study on the Genetics of Alcoholism. With the simulated data, the results showed that the new method could detect linkage well if the true allele frequency for the trait was close to that specified. However, it performed poorly on models in which the true allele frequency was much rarer. For the Collaborative Study on the Genetics of Alcoholism data set only a modest overlap was observed between the results obtained from the new method and those obtained when the same data were analysed previously using regression and variance components analysis. Of interest is that D17S250 produced a maximized LOD score under homogeneity and admixture of 2.6 but did not indicate linkage using the previous methods. However, this region did produce evidence for linkage in a separate data set, suggesting that QMFLINK may have been able to detect a true linkage which was not picked up by the other methods. The application of model-free LOD score analysis to quantitative traits is novel and deserves further evaluation of its merits and disadvantages relative to other methods.

Sound Transmission through Two Concentric Cylindrical Sandwich Shells

NASA Technical Reports Server (NTRS)

Tang, Yvette Y.; Silcox, Richard J.; Robinson, Jay H.

1996-01-01

This paper solves the problem of sound transmission through a system of two infinite concentric cylindrical sandwich shells. The shells are surrounded by external and internal fluid media and there is fluid (air) in the annular space between them. An oblique plane sound wave is incident upon the surface of the outer shell. A uniform flow is moving with a constant velocity in the external fluid medium. Classical thin shell theory is applied to the inner shell and first-order shear deformation theory is applied to the outer shell. A closed form for transmission loss is derived based on modal analysis. Investigations have been made for the impedance of both shells and the transmission loss through the shells from the exterior into the interior. Results are compared for double sandwich shells and single sandwich shells. This study shows that: (1) the impedance of the inner shell is much smaller than that of the outer shell so that the transmission loss is almost the same in both the annular space and the interior cavity of the shells; (2) the two concentric sandwich shells can produce an appreciable increase of transmission loss over single sandwich shells especially in the high frequency range; and (3) design guidelines may be derived with respect to the noise reduction requirement and the pressure in the annular space at a mid-frequency range.

Simultaneous energy harvesting and information processing in wireless multiple relays with multiple antennas

NASA Astrophysics Data System (ADS)

Albaaj, Azhar; Makki, S. Vahab A.; Alabkhat, Qassem; Zahedi, Abdulhamid

2017-07-01

Wireless networks suffer from battery discharging specially in cooperative communications when multiple relays have an important role but they are energy constrained. To overcome this problem, energy harvesting from radio frequency signals is applied to charge the node battery. These intermediate nodes have the ability to harvest energy from the source signal and use the energy harvested to transmit information to the destination. In fact, the node tries to harvest energy and then transmit the data to destination. Division of energy harvesting and data transmission can be done in two algorithms: time-switching-based relaying protocol and power-splitting-based relaying protocol. These two algorithms also can be applied in delay-limited and delay-tolerant transmission systems. The previous works have assumed a single relay for energy harvesting, but in this article, the proposed method is concentrated on improving the outage probability and throughput by using multiple antennas in each relay node instead of using single antenna. According to our simulation results, when using multi-antenna relays, ability of energy harvesting is increased and thus system performance will be improved to great extent. Maximum ratio combining scheme has been used when the destination chooses the best signal of relays and antennas satisfying the required signal-to-noise ratio.

Optimizing Aggregation Scenarios for Integrating Renewable Energy into the U.S. Electric Grid

NASA Astrophysics Data System (ADS)

Corcoran, B. A.; Jacobson, M. Z.

2010-12-01

This study is an analysis of 2006 and 2007 electric load data, wind speed and solar irradiance data, and existing hydroelectric, geothermal, and other power plant data to quantify benefits of aggregating clean electric power from various Federal Energy Regulatory Commission (FERC) regions in the contiguous United States. First, various time series, statistics, and probability methods are applied to the electric load data to determine if there are any desirable demand-side results—specifically reducing variability and/or coincidence of peak events, which could reduce the amount of required carbon-based generators—in combining the electricity demands from geographically and temporally diverse areas. Second, an optimization algorithm is applied to determine the least-cost portfolio of energy resources to meet the electric load for a range of renewable portfolio standards (RPS’s) for each FERC region and for various aggregation scenarios. Finally, the installed capacities, ramp rates, standard deviation, and corresponding generator requirements from these optimization test runs are compared against the transmission requirements to determine the most economical organizational structure of the contiguous U.S. electric grid. Ideally, results from this study will help to justify and identify a possible structure of a federal RPS and offer insight into how to best organize regions for transmission planning.

Extended RF shimming: Sequence‐level parallel transmission optimization applied to steady‐state free precession MRI of the heart

PubMed Central

Price, Anthony N.; Padormo, Francesco; Hajnal, Joseph V.; Malik, Shaihan J.

2017-01-01

Cardiac magnetic resonance imaging (MRI) at high field presents challenges because of the high specific absorption rate and significant transmit field (B 1 +) inhomogeneities. Parallel transmission MRI offers the ability to correct for both issues at the level of individual radiofrequency (RF) pulses, but must operate within strict hardware and safety constraints. The constraints are themselves affected by sequence parameters, such as the RF pulse duration and TR, meaning that an overall optimal operating point exists for a given sequence. This work seeks to obtain optimal performance by performing a ‘sequence‐level’ optimization in which pulse sequence parameters are included as part of an RF shimming calculation. The method is applied to balanced steady‐state free precession cardiac MRI with the objective of minimizing TR, hence reducing the imaging duration. Results are demonstrated using an eight‐channel parallel transmit system operating at 3 T, with an in vivo study carried out on seven male subjects of varying body mass index (BMI). Compared with single‐channel operation, a mean‐squared‐error shimming approach leads to reduced imaging durations of 32 ± 3% with simultaneous improvement in flip angle homogeneity of 32 ± 8% within the myocardium. PMID:28195684

Antimicrobial effect and mode of action of terpeneless cold-pressed Valencia orange essential oil on methicillin-resistant Staphylococcus aureus.

PubMed

Muthaiyan, A; Martin, E M; Natesan, S; Crandall, P G; Wilkinson, B J; Ricke, S C

2012-05-01

The objectives of this study were to evaluate the antistaphylococcal effect and elucidate the mechanism of action of orange essential oil against antibiotic-resistant Staphylococcus aureus strains. The inhibitory effect of commercial orange essential oil (EO) against six Staph. aureus strains was tested using disc diffusion and agar dilution methods. The mechanism of EO action on MRSA was analysed by transcriptional profiling. Morphological changes of EO-treated Staph. aureus were examined using transmission electron microscopy. Results showed that 0·1% of terpeneless cold-pressed Valencia orange oil (CPV) induced the cell wall stress stimulon consistent with the inhibition of cell wall synthesis. Transmission electron microscopic observation revealed cell lysis and suggested a cell wall lysis-related mechanism of CPV. CPV inhibits the growth of Staph. aureus, causes gene expression changes consistent with the inhibition of cell wall synthesis, and triggers cell lysis. Multiple antibiotics resistance is becoming a serious problem in the management of Staph. aureus infections. In this study, the altered expression of cell wall-associated genes and subsequent cell lysis in MRSA caused by CPV suggest that it may be a potential antimicrobial agent to control antibiotic-resistant Staph. aureus. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

Estimating tuberculosis incidence from primary survey data: a mathematical modeling approach

PubMed Central

Chadha, V. K.; Laxminarayan, R.; Arinaminpathy, N.

2017-01-01

SUMMARY BACKGROUND: There is an urgent need for improved estimations of the burden of tuberculosis (TB). OBJECTIVE: To develop a new quantitative method based on mathematical modelling, and to demonstrate its application to TB in India. DESIGN: We developed a simple model of TB transmission dynamics to estimate the annual incidence of TB disease from the annual risk of tuberculous infection and prevalence of smear-positive TB. We first compared model estimates for annual infections per smear-positive TB case using previous empirical estimates from China, Korea and the Philippines. We then applied the model to estimate TB incidence in India, stratified by urban and rural settings. RESULTS: Study model estimates show agreement with previous empirical estimates. Applied to India, the model suggests an annual incidence of smear-positive TB of 89.8 per 100 000 population (95%CI 56.8–156.3). Results show differences in urban and rural TB: while an urban TB case infects more individuals per year, a rural TB case remains infectious for appreciably longer, suggesting the need for interventions tailored to these different settings. CONCLUSIONS: Simple models of TB transmission, in conjunction with necessary data, can offer approaches to burden estimation that complement those currently being used. PMID:28284250

Extended RF shimming: Sequence-level parallel transmission optimization applied to steady-state free precession MRI of the heart.

PubMed

Beqiri, Arian; Price, Anthony N; Padormo, Francesco; Hajnal, Joseph V; Malik, Shaihan J

2017-06-01

Cardiac magnetic resonance imaging (MRI) at high field presents challenges because of the high specific absorption rate and significant transmit field (B 1 + ) inhomogeneities. Parallel transmission MRI offers the ability to correct for both issues at the level of individual radiofrequency (RF) pulses, but must operate within strict hardware and safety constraints. The constraints are themselves affected by sequence parameters, such as the RF pulse duration and TR, meaning that an overall optimal operating point exists for a given sequence. This work seeks to obtain optimal performance by performing a 'sequence-level' optimization in which pulse sequence parameters are included as part of an RF shimming calculation. The method is applied to balanced steady-state free precession cardiac MRI with the objective of minimizing TR, hence reducing the imaging duration. Results are demonstrated using an eight-channel parallel transmit system operating at 3 T, with an in vivo study carried out on seven male subjects of varying body mass index (BMI). Compared with single-channel operation, a mean-squared-error shimming approach leads to reduced imaging durations of 32 ± 3% with simultaneous improvement in flip angle homogeneity of 32 ± 8% within the myocardium. © 2017 The Authors. NMR in Biomedicine published by John Wiley & Sons Ltd.

Metasurface with interfering Fano resonance: manipulating transmission wave with high efficiency.

PubMed

Su, Zhaoxian; Song, Kun; Yin, Jianbo; Zhao, Xiaopeng

2017-06-15

We proposed a novel strategy to design a deep subwavelength metasurface with full 2π transmission phase modulation and high transmission efficiency by applying resonators with interfering Fano resonance. Theoretical investigation demonstrates that the transmission efficiency of the resonators depends on the direct transmission coefficient, direct reflection coefficient, and Q factor. When an impedance layer is added in the resonators, the direct transmission and direct reflection coefficients can be facilely manipulated so that the span of the transmission phase around the resonance frequency can be extended to 2π. As a result, we can continuously adjust the transmission phase from 0 to 2π through changing the geometric parameters of the resonators and construct a deep subwavelength metasurface with the resonators to manipulate the transmission wave with high efficiency. We also find that a layer of grating can be used as the impedance layer to change direct transmission and direct reflection in the actual design of the metasurface. The proposed strategy may provide effective guidance to design a deep subwavelength metasurface for controlling a transmitted wave with high efficiency.

Optimal estimation of spatially variable recharge and transmissivity fields under steady-state groundwater flow. Part 2. Case study

NASA Astrophysics Data System (ADS)

Graham, Wendy D.; Neff, Christina R.

1994-05-01

The first-order analytical solution of the inverse problem for estimating spatially variable recharge and transmissivity under steady-state groundwater flow, developed in Part 1 is applied to the Upper Floridan Aquifer in NE Florida. Parameters characterizing the statistical structure of the log-transmissivity and head fields are estimated from 152 measurements of transmissivity and 146 measurements of hydraulic head available in the study region. Optimal estimates of the recharge, transmissivity and head fields are produced throughout the study region by conditioning on the nearest 10 available transmissivity measurements and the nearest 10 available head measurements. Head observations are shown to provide valuable information for estimating both the transmissivity and the recharge fields. Accurate numerical groundwater model predictions of the aquifer flow system are obtained using the optimal transmissivity and recharge fields as input parameters, and the optimal head field to define boundary conditions. For this case study, both the transmissivity field and the uncertainty of the transmissivity field prediction are poorly estimated, when the effects of random recharge are neglected.

Arsenic sulfide layers for dielectric reflection mirrors prepared from solution

NASA Astrophysics Data System (ADS)

Matějec, Vlastimil; Pedlikova, Jitka; BartoÅ, Ivo; Podrazký, Ondřej

2017-12-01

Chalcogenide materials due to high refractive indices, transparency in the mid-IR spectral region, nonlinear refractive indices, etc, have been employed as fibers and films in different photonic devices such as light amplifiers, optical regenerators, broadband radiation sources. Chalcogenide films can be prepared by physical methods as well as by solution-based techniques in which solutions of chalcogenides in amines are used. This paper presents results on the solution-based fabrication and optical characterization of single arsenic sulfide layers and multilayer stacks containing As2S3 layers together with porous silica layers coated on planar and fiber-optic substrates. Input As2S3 solutions for the layer fabrications were prepared by dissolving As2S3 powder in n-propylamine in a concentration of 0.50 mol/l. These solutions were applied on glass slides by dip-coating method and obtained layers were thermally treated in vacuum at temperatures up to 180 °C. Similar procedure was used for As2S3 layers in multilayer stacks. Such stacks were fabricated by repeating the application of one porous silica layer prepared by the sol-gel method and one As2S3 layer onto glass slides or silica fibers (a diameter of 0.3 mm) by using the dip-coating method. It has been found that the curing process of the applied layers has to be carefully controlled in order to obtain stacks with three pairs of such layers. Single arsenic and porous silica layers were characterized by optical microscopy, and by measuring their transmission spectra in a range of 200-2500 nm. Thicknesses and refractive indices were estimated from the spectra. Transmission spectra of planar multilayer stacks were measured, too. Interference bands have been determined from optical measurements on the multilayer stacks with a minimum transmittance of about 50% which indicates the possibility of using such stacks as reflecting mirrors.

Microsecond-range optical shutter for unpolarized light with chiral nematic liquid crystal

NASA Astrophysics Data System (ADS)

Mohammadimasoudi, Mohammad; Shin, Jungsoon; Lee, Keechang; Neyts, Kristiaan; Beeckman, Jeroen

2015-04-01

A fast electro-optic shutter is fabricated and demonstrated. The device works independently of the polarization state of the incoming light beam. Modulation between 3% transmission and 60% transmission is obtained within a wavelength range of 50 nm with a response time of 20 μs. The device consists of two partly polymerized chiral nematic liquid crystal layers separated by a half wave plate. The transmission modulation is due to a 50 nm wavelength shift of the photonic band gap of the chiral liquid crystal realized by applying an electric field over a mixture of photo-polymerized LC and non-reactive nematic LC containing a chiral dopant. The shutter features high reflectivity in the photonic band gap. We investigate the influence of the amplitude of the applied voltage on the width and the depth of the reflection band.

Evaluation of a load cell model for dynamic calibration of the rotor systems research aircraft

NASA Technical Reports Server (NTRS)

Duval, R. W.; Bahrami, H.; Wellman, B.

1985-01-01

The Rotor Systems Research Aircraft uses load cells to isolate the rotor/transmission system from the fuselage. An analytical model of the relationship between applied rotor loads and the resulting load cell measurements is derived by applying a force-and-moment balance to the isolated rotor/transmission system. The model is then used to estimate the applied loads from measured load cell data, as obtained from a ground-based shake test. Using nominal design values for the parameters, the estimation errors, for the case of lateral forcing, were shown to be on the order of the sensor measurement noise in all but the roll axis. An unmodeled external load appears to be the source of the error in this axis.

Surface plasmon-polariton propagation in piecewise linear chains of composite nanospheres: the role of optical gain and chain layout.

PubMed

Udagedara, Indika B; Rukhlenko, Ivan D; Premaratne, Malin

2011-10-10

The energy transport properties of plasmonic waveguides can be analyzed by solving the dispersion relation for surface plasmon-polaritons (SPPs). We use this approach to derive an approximate analytical expression for SPP propagation length when the waveguide is composed of linearly arranged metallic nanoparticles, while assuming that metal losses are small or partially compensated by gain. Applied to metal-dielectric (composite) nanospheres, the obtained expression allows us to optimize the performance of the waveguide and arrive at a number of practical design rules. Specifically, we show that SPP attenuation can be minimized at a certain interparticle distance for transverse modes, but gradually grows for both longitudinal and transverse modes with the increase of particle separation. We also show that the two basic methods of supplying gain to the system, i.e., embedding the particles into a gain medium or having a metal-gain composition for the particles, do not perform equally well and the former method is more efficient, but the way the two methods affect depends on the polarization of SPPs. To investigate the role of the nanoparticles' arrangement in determining SPP characteristics, we follow a purely numerical approach and consider a two-segment bent waveguide as an example. Analyzing the waveguide's transmission shows that it behaves in an oscillatory manner with respect to the angle between the two segments and is therefore higher for certain angles than for the others. This suggests that, in the design of waveguides with bends, careful attention needs to be paid in order to avoid bend angles that yield low transmission and to choose angles that give maximum transmission.

Cost analysis of an electricity supply chain using modification of price based dynamic economic dispatch in wheeling transaction scheme

NASA Astrophysics Data System (ADS)

Wahyuda; Santosa, Budi; Rusdiansyah, Ahmad

2018-04-01

Deregulation of the electricity market requires coordination between parties to synchronize the optimization on the production side (power station) and the transport side (transmission). Electricity supply chain presented in this article is designed to facilitate the coordination between the parties. Generally, the production side is optimized with price based dynamic economic dispatch (PBDED) model, while the transmission side is optimized with Multi-echelon distribution model. Both sides optimization are done separately. This article proposes a joint model of PBDED and multi-echelon distribution for the combined optimization of production and transmission. This combined optimization is important because changes in electricity demand on the customer side will cause changes to the production side that automatically also alter the transmission path. The transmission will cause two cost components. First, the cost of losses. Second, the cost of using the transmission network (wheeling transaction). Costs due to losses are calculated based on ohmic losses, while the cost of using transmission lines using the MW - mile method. As a result, this method is able to provide best allocation analysis for electrical transactions, as well as emission levels in power generation and cost analysis. As for the calculation of transmission costs, the Reverse MW-mile method produces a cheaper cost than the Absolute MW-mile method

Analysis of ecstasy tablets: comparison of reflectance and transmittance near infrared spectroscopy.

PubMed

Schneider, Ralph Carsten; Kovar, Karl-Artur

2003-07-08

Calibration models for the quantitation of commonly used ecstasy substances have been developed using near infrared spectroscopy (NIR) in diffuse reflectance and in transmission mode by applying seized ecstasy tablets for model building and validation. The samples contained amphetamine, N-methyl-3,4-methylenedioxy-amphetamine (MDMA) and N-ethyl-3,4-methylenedioxy-amphetamine (MDE) in different concentrations. All tablets were analyzed using high performance liquid chromatography (HPLC) with diode array detection as reference method. We evaluated the performance of each NIR measurement method with regard to its ability to predict the content of each tablet with a low root mean square error of prediction (RMSEP). Best calibration models could be generated by using NIR measurement in transmittance mode with wavelength selection and 1/x-transformation of the raw data. The models build in reflectance mode showed higher RMSEPs using as data pretreatment, wavelength selection, 1/x-transformation and a second order Savitzky-Golay derivative with five point smoothing was applied to obtain the best models. To estimate the influence of inhomogeneities in the illegal tablets, a calibration of the destroyed, i.e. triturated samples was build and compared to the corresponding data of the whole tablets. The calibrations using these homogenized tablets showed lower RMSEPs. We can conclude that NIR analysis of ecstasy tablets in transmission mode is more suitable than measurement in diffuse reflectance to obtain quantification models for their active ingredients with regard to low errors of prediction. Inhomogeneities in the samples are equalized when measuring the tablets as powdered samples.

Smaller-loss planar SPP transmission line than conventional microstrip in microwave frequencies.

PubMed

Zhang, Hao Chi; Zhang, Qian; Liu, Jun Feng; Tang, Wenxuan; Fan, Yifeng; Cui, Tie Jun

2016-03-17

Transmission line is a basic component in all passive devices, integrated circuits, and systems. Microstrip is the most popular transmission line in the microwave and millimeter-wave frequencies, and has been widely used in current electronic devices, circuits, and systems. One of the important issues to be solved in such applications is the relatively large transmission loss of microstrip. Here, we propose a method to reduce the loss of microwave transmission line based on the designable wavenumber of spoof surface plasmon polaritons (SPPs). Using this characteristic, we analyze and experimentally demonstrate the low-loss feature of the SPP transmission line through the perturbation method and S-parameter measurements, respectively. Both simulation and experimental results show that the SPP transmission line has much smaller transmission loss than traditional microstrip with the same size in the microwave frequencies. Hence, the spoof SPP transmission line may make a big step forward in the low-loss circuits and systems.