NASA Astrophysics Data System (ADS)
Reuter, Matthew; Tschudi, Stephen
When investigating the electrical response properties of molecules, experiments often measure conductance whereas computation predicts transmission probabilities. Although the Landauer-Büttiker theory relates the two in the limit of coherent scattering through the molecule, a direct comparison between experiment and computation can still be difficult. Experimental data (specifically that from break junctions) is statistical and computational results are deterministic. Many studies compare the most probable experimental conductance with computation, but such an analysis discards almost all of the experimental statistics. In this work we develop tools to decipher the Landauer-Büttiker transmission function directly from experimental statistics and then apply them to enable a fairer comparison between experimental and computational results.
NASA Astrophysics Data System (ADS)
Sallah, M.
2014-03-01
The problem of monoenergetic radiative transfer in a finite planar stochastic atmospheric medium with polarized (vector) Rayleigh scattering is proposed. The solution is presented for an arbitrary absorption and scattering cross sections. The extinction function of the medium is assumed to be a continuous random function of position, with fluctuations about the mean taken as Gaussian distributed. The joint probability distribution function of these Gaussian random variables is used to calculate the ensemble-averaged quantities, such as reflectivity and transmissivity, for an arbitrary correlation function. A modified Gaussian probability distribution function is also used to average the solution in order to exclude the probable negative values of the optical variable. Pomraning-Eddington approximation is used, at first, to obtain the deterministic analytical solution for both the total intensity and the difference function used to describe the polarized radiation. The problem is treated with specular reflecting boundaries and angular-dependent externally incident flux upon the medium from one side and with no flux from the other side. For the sake of comparison, two different forms of the weight function, which introduced to force the boundary conditions to be fulfilled, are used. Numerical results of the average reflectivity and average transmissivity are obtained for both Gaussian and modified Gaussian probability density functions at the different degrees of polarization.
Lethal exposure: An integrated approach to pathogen transmission via environmental reservoirs.
Turner, Wendy C; Kausrud, Kyrre L; Beyer, Wolfgang; Easterday, W Ryan; Barandongo, Zoë R; Blaschke, Elisabeth; Cloete, Claudine C; Lazak, Judith; Van Ert, Matthew N; Ganz, Holly H; Turnbull, Peter C B; Stenseth, Nils Chr; Getz, Wayne M
2016-06-06
To mitigate the effects of zoonotic diseases on human and animal populations, it is critical to understand what factors alter transmission dynamics. Here we assess the risk of exposure to lethal concentrations of the anthrax bacterium, Bacillus anthracis, for grazing animals in a natural system over time through different transmission mechanisms. We follow pathogen concentrations at anthrax carcass sites and waterholes for five years and estimate infection risk as a function of grass, soil or water intake, age of carcass sites, and the exposure required for a lethal infection. Grazing, not drinking, seems the dominant transmission route, and transmission is more probable from grazing at carcass sites 1-2 years of age. Unlike most studies of virulent pathogens that are conducted under controlled conditions for extrapolation to real situations, we evaluate exposure risk under field conditions to estimate the probability of a lethal dose, showing that not all reservoirs with detectable pathogens are significant transmission pathways.
A Statistical Framework for Microbial Source Attribution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Velsko, S P; Allen, J E; Cunningham, C T
2009-04-28
This report presents a general approach to inferring transmission and source relationships among microbial isolates from their genetic sequences. The outbreak transmission graph (also called the transmission tree or transmission network) is the fundamental structure which determines the statistical distributions relevant to source attribution. The nodes of this graph are infected individuals or aggregated sub-populations of individuals in which transmitted bacteria or viruses undergo clonal expansion, leading to a genetically heterogeneous population. Each edge of the graph represents a transmission event in which one or a small number of bacteria or virions infects another node thus increasing the size ofmore » the transmission network. Recombination and re-assortment events originate in nodes which are common to two distinct networks. In order to calculate the probability that one node was infected by another, given the observed genetic sequences of microbial isolates sampled from them, we require two fundamental probability distributions. The first is the probability of obtaining the observed mutational differences between two isolates given that they are separated by M steps in a transmission network. The second is the probability that two nodes sampled randomly from an outbreak transmission network are separated by M transmission events. We show how these distributions can be obtained from the genetic sequences of isolates obtained by sampling from past outbreaks combined with data from contact tracing studies. Realistic examples are drawn from the SARS outbreak of 2003, the FMDV outbreak in Great Britain in 2001, and HIV transmission cases. The likelihood estimators derived in this report, and the underlying probability distribution functions required to calculate them possess certain compelling general properties in the context of microbial forensics. These include the ability to quantify the significance of a sequence 'match' or 'mismatch' between two isolates; the ability to capture non-intuitive effects of network structure on inferential power, including the 'small world' effect; the insensitivity of inferences to uncertainties in the underlying distributions; and the concept of rescaling, i.e. ability to collapse sub-networks into single nodes and examine transmission inferences on the rescaled network.« less
Lethal exposure: An integrated approach to pathogen transmission via environmental reservoirs
Turner, Wendy C.; Kausrud, Kyrre L.; Beyer, Wolfgang; Easterday, W. Ryan; Barandongo, Zoë R.; Blaschke, Elisabeth; Cloete, Claudine C.; Lazak, Judith; Van Ert, Matthew N.; Ganz, Holly H.; Turnbull, Peter C. B.; Stenseth, Nils Chr.; Getz, Wayne M.
2016-01-01
To mitigate the effects of zoonotic diseases on human and animal populations, it is critical to understand what factors alter transmission dynamics. Here we assess the risk of exposure to lethal concentrations of the anthrax bacterium, Bacillus anthracis, for grazing animals in a natural system over time through different transmission mechanisms. We follow pathogen concentrations at anthrax carcass sites and waterholes for five years and estimate infection risk as a function of grass, soil or water intake, age of carcass sites, and the exposure required for a lethal infection. Grazing, not drinking, seems the dominant transmission route, and transmission is more probable from grazing at carcass sites 1–2 years of age. Unlike most studies of virulent pathogens that are conducted under controlled conditions for extrapolation to real situations, we evaluate exposure risk under field conditions to estimate the probability of a lethal dose, showing that not all reservoirs with detectable pathogens are significant transmission pathways. PMID:27265371
Assessing wildland fire risk transmission to communities in northern Spain
Fermín J. Alcasena; Michele Salis; Alan A. Ager; Rafael Castell; Cristina Vega-García
2017-01-01
We assessed potential economic losses and transmission to residential houses from wildland fires in a rural area of central Navarra (Spain). Expected losses were quantified at the individual structure level (n = 306) in 14 rural communities by combining fire model predictions of burn probability and fire intensity with susceptibility functions derived from expert...
A Comprehensive Breath Plume Model for Disease Transmission via Expiratory Aerosols
Halloran, Siobhan K.; Wexler, Anthony S.; Ristenpart, William D.
2012-01-01
The peak in influenza incidence during wintertime in temperate regions represents a longstanding, unresolved scientific question. One hypothesis is that the efficacy of airborne transmission via aerosols is increased at lower humidities and temperatures, conditions that prevail in wintertime. Recent work with a guinea pig model by Lowen et al. indicated that humidity and temperature do modulate airborne influenza virus transmission, and several investigators have interpreted the observed humidity dependence in terms of airborne virus survivability. This interpretation, however, neglects two key observations: the effect of ambient temperature on the viral growth kinetics within the animals, and the strong influence of the background airflow on transmission. Here we provide a comprehensive theoretical framework for assessing the probability of disease transmission via expiratory aerosols between test animals in laboratory conditions. The spread of aerosols emitted from an infected animal is modeled using dispersion theory for a homogeneous turbulent airflow. The concentration and size distribution of the evaporating droplets in the resulting “Gaussian breath plume” are calculated as functions of position, humidity, and temperature. The overall transmission probability is modeled with a combination of the time-dependent viral concentration in the infected animal and the probability of droplet inhalation by the exposed animal downstream. We demonstrate that the breath plume model is broadly consistent with the results of Lowen et al., without invoking airborne virus survivability. The results also suggest that, at least for guinea pigs, variation in viral kinetics within the infected animals is the dominant factor explaining the increased transmission probability observed at lower temperatures. PMID:22615902
The effect of timing errors in optical digital systems.
NASA Technical Reports Server (NTRS)
Gagliardi, R. M.
1972-01-01
The use of digital transmission with narrow light pulses appears attractive for data communications, but carries with it a stringent requirement on system bit timing. The effects of imperfect timing in direct-detection (noncoherent) optical binary systems are investigated using both pulse-position modulation and on-off keying for bit transmission. Particular emphasis is placed on specification of timing accuracy and an examination of system degradation when this accuracy is not attained. Bit error probabilities are shown as a function of timing errors from which average error probabilities can be computed for specific synchronization methods. Of significance is the presence of a residual or irreducible error probability in both systems, due entirely to the timing system, which cannot be overcome by the data channel.
Chappell, Thomas M; Kennedy, George G
2018-06-21
Imidacloprid is widely used to manage tomato spotted wilt disease (TSW) in tobacco, tomato, and pepper, caused by Tomato spotted wilt orthotospovirus (TSWV) and spread by the tobacco thrips, Frankliniella fusca Hinds (Thysanoptera: Thripidae). Imidacloprid suppresses transmission of TSWV by reducing probing and feeding by adult thrips on treated plants, thereby reducing the probability of transmission by infectious thrips. Because imidacloprid does not reduce probing and feeding on treated plants to zero, the reduction in transmission probability per viruliferous thrips can be offset by an increase in the number of viruliferous thrips challenging treated plants. A composite of these effects which we call 'pathogen pressure' experienced by plants is a function of thrips population size, the proportion of those thrips that are viruliferous, and the probability that viruliferous thrips successfully inoculate plants. To better understand the relationship between imidacloprid's effect on virus transmission, pathogen pressure, and TSW incidence in tobacco, we modeled TSW incidence as a function of the two most important variables affecting components of pathogen pressure, temperature, and precipitation, and the dependence of imidacloprid's effect on pathogen pressure. A model incorporating imidacloprid's effect as a reduction in pathogen pressure was found to be more descriptive than models incorporating the effect as a reduction in TSW incidence. Results reveal maximum proportional reduction in TSW incidence resulting from imidacloprid use is associated with minimal potential TSW incidence. As pathogen pressure increases, potential TSW incidence approaches 100%, and the benefits of imidacloprid use are highest at intermediate levels of pathogen pressure.
IGM CONSTRAINTS FROM THE SDSS-III/BOSS DR9 Lyα FOREST TRANSMISSION PROBABILITY DISTRIBUTION FUNCTION
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Khee-Gan; Hennawi, Joseph F.; Spergel, David N.
2015-02-01
The Lyα forest transmission probability distribution function (PDF) is an established probe of the intergalactic medium (IGM) astrophysics, especially the temperature-density relationship of the IGM. We measure the transmission PDF from 3393 Baryon Oscillations Spectroscopic Survey (BOSS) quasars from Sloan Digital Sky Survey Data Release 9, and compare with mock spectra that include careful modeling of the noise, continuum, and astrophysical uncertainties. The BOSS transmission PDFs, measured at (z) = [2.3, 2.6, 3.0], are compared with PDFs created from mock spectra drawn from a suite of hydrodynamical simulations that sample the IGM temperature-density relationship, γ, and temperature at mean density,more » T {sub 0}, where T(Δ) = T {sub 0}Δ{sup γ} {sup –} {sup 1}. We find that a significant population of partial Lyman-limit systems (LLSs) with a column-density distribution slope of β{sub pLLS} ∼ – 2 are required to explain the data at the low-transmission end of transmission PDF, while uncertainties in the mean Lyα forest transmission affect the high-transmission end. After modeling the LLSs and marginalizing over mean transmission uncertainties, we find that γ = 1.6 best describes the data over our entire redshift range, although constraints on T {sub 0} are affected by systematic uncertainties. Within our model framework, isothermal or inverted temperature-density relationships (γ ≤ 1) are disfavored at a significance of over 4σ, although this could be somewhat weakened by cosmological and astrophysical uncertainties that we did not model.« less
A Comprehensive Breath Plume Model for Disease Transmission via Expiratory Aerosols
NASA Astrophysics Data System (ADS)
Halloran, S. K.; Wexler, A. S.; Ristenpart, W. D.
2012-11-01
The peak in influenza incidence during wintertime represents a longstanding unresolved scientific question. One hypothesis is that the efficacy of airborne transmission via aerosols is increased at low humidity and temperature, conditions that prevail in wintertime. Recent experiments with guinea pigs suggest that transmission is indeed maximized at low humidity and temperature, a finding which has been widely interpreted in terms of airborne influenza virus survivability. This interpretation, however, neglects the effect of the airflow on the transmission probability. Here we provide a comprehensive model for assessing the probability of disease transmission via expiratory aerosols between test animals in laboratory conditions. The spread of aerosols emitted from an infected animal is modeled using dispersion theory for a homogeneous turbulent airflow. The concentration and size distribution of the evaporating droplets in the resulting ``Gaussian breath plume'' are calculated as functions of downstream position. We demonstrate that the breath plume model is broadly consistent with the guinea pig experiments, without invoking airborne virus survivability. Moreover, the results highlight the need for careful characterization of the airflow in airborne transmission experiments.
Sainudiin, Raazesh; Welch, David
2016-12-07
We derive a combinatorial stochastic process for the evolution of the transmission tree over the infected vertices of a host contact network in a susceptible-infected (SI) model of an epidemic. Models of transmission trees are crucial to understanding the evolution of pathogen populations. We provide an explicit description of the transmission process on the product state space of (rooted planar ranked labelled) binary transmission trees and labelled host contact networks with SI-tags as a discrete-state continuous-time Markov chain. We give the exact probability of any transmission tree when the host contact network is a complete, star or path network - three illustrative examples. We then develop a biparametric Beta-splitting model that directly generates transmission trees with exact probabilities as a function of the model parameters, but without explicitly modelling the underlying contact network, and show that for specific values of the parameters we can recover the exact probabilities for our three example networks through the Markov chain construction that explicitly models the underlying contact network. We use the maximum likelihood estimator (MLE) to consistently infer the two parameters driving the transmission process based on observations of the transmission trees and use the exact MLE to characterize equivalence classes over the space of contact networks with a single initial infection. An exploratory simulation study of the MLEs from transmission trees sampled from three other deterministic and four random families of classical contact networks is conducted to shed light on the relation between the MLEs of these families with some implications for statistical inference along with pointers to further extensions of our models. The insights developed here are also applicable to the simplest models of "meme" evolution in online social media networks through transmission events that can be distilled from observable actions such as "likes", "mentions", "retweets" and "+1s" along with any concomitant comments. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
A generating function approach to HIV transmission with dynamic contact rates
Romero-Severson, Ethan O.; Meadors, Grant D.; Volz, Erik M.
2014-04-24
The basic reproduction number, R 0, is often defined as the average number of infections generated by a newly infected individual in a fully susceptible population. The interpretation, meaning, and derivation of R 0 are controversial. However, in the context of mean field models, R 0 demarcates the epidemic threshold below which the infected population approaches zero in the limit of time. In this manner, R 0 has been proposed as a method for understanding the relative impact of public health interventions with respect to disease eliminations from a theoretical perspective. The use of R 0 is made more complexmore » by both the strong dependency of R 0 on the model form and the stochastic nature of transmission. A common assumption in models of HIV transmission that have closed form expressions for R 0 is that a single individual’s behavior is constant over time. For this research, we derive expressions for both R 0 and probability of an epidemic in a finite population under the assumption that people periodically change their sexual behavior over time. We illustrate the use of generating functions as a general framework to model the effects of potentially complex assumptions on the number of transmissions generated by a newly infected person in a susceptible population. In conclusion, we find that the relationship between the probability of an epidemic and R 0 is not straightforward, but, that as the rate of change in sexual behavior increases both R 0 and the probability of an epidemic also decrease.« less
A generating function approach to HIV transmission with dynamic contact rates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romero-Severson, Ethan O.; Meadors, Grant D.; Volz, Erik M.
The basic reproduction number, R 0, is often defined as the average number of infections generated by a newly infected individual in a fully susceptible population. The interpretation, meaning, and derivation of R 0 are controversial. However, in the context of mean field models, R 0 demarcates the epidemic threshold below which the infected population approaches zero in the limit of time. In this manner, R 0 has been proposed as a method for understanding the relative impact of public health interventions with respect to disease eliminations from a theoretical perspective. The use of R 0 is made more complexmore » by both the strong dependency of R 0 on the model form and the stochastic nature of transmission. A common assumption in models of HIV transmission that have closed form expressions for R 0 is that a single individual’s behavior is constant over time. For this research, we derive expressions for both R 0 and probability of an epidemic in a finite population under the assumption that people periodically change their sexual behavior over time. We illustrate the use of generating functions as a general framework to model the effects of potentially complex assumptions on the number of transmissions generated by a newly infected person in a susceptible population. In conclusion, we find that the relationship between the probability of an epidemic and R 0 is not straightforward, but, that as the rate of change in sexual behavior increases both R 0 and the probability of an epidemic also decrease.« less
Park, Andrew W.; Magori, Krisztian; White, Brad A.; Stallknecht, David E.
2013-01-01
The assumed straightforward connection between transmission intensity and disease occurrence impacts surveillance and control efforts along with statistical methodology, including parameter inference and niche modeling. Many infectious disease systems have the potential for this connection to be more complicated–although demonstrating this in any given disease system has remained elusive. Hemorrhagic disease (HD) is one of the most important diseases of white-tailed deer and is caused by viruses in the Orbivirus genus. Like many infectious diseases, the probability or severity of disease increases with age (after loss of maternal antibodies) and the probability of disease is lower upon re-infection compared to first infection (based on cross-immunity between virus strains). These broad criteria generate a prediction that disease occurrence is maximized at intermediate levels of transmission intensity. Using published US field data, we first fit a statistical model to predict disease occurrence as a function of seroprevalence (a proxy for transmission intensity), demonstrating that states with intermediate seroprevalence have the highest level of case reporting. We subsequently introduce an independently parameterized mechanistic model supporting the theory that high case reporting should come from areas with intermediate levels of transmission. This is the first rigorous demonstration of this phenomenon and illustrates that variation in transmission rate (e.g. along an ecologically-controlled transmission gradient) can create cryptic refuges for infectious diseases. PMID:23579922
Kennedy, Paula L; Woodbury, Allan D
2002-01-01
In ground water flow and transport modeling, the heterogeneous nature of porous media has a considerable effect on the resulting flow and solute transport. Some method of generating the heterogeneous field from a limited dataset of uncertain measurements is required. Bayesian updating is one method that interpolates from an uncertain dataset using the statistics of the underlying probability distribution function. In this paper, Bayesian updating was used to determine the heterogeneous natural log transmissivity field for a carbonate and a sandstone aquifer in southern Manitoba. It was determined that the transmissivity in m2/sec followed a natural log normal distribution for both aquifers with a mean of -7.2 and - 8.0 for the carbonate and sandstone aquifers, respectively. The variograms were calculated using an estimator developed by Li and Lake (1994). Fractal nature was not evident in the variogram from either aquifer. The Bayesian updating heterogeneous field provided good results even in cases where little data was available. A large transmissivity zone in the sandstone aquifer was created by the Bayesian procedure, which is not a reflection of any deterministic consideration, but is a natural outcome of updating a prior probability distribution function with observations. The statistical model returns a result that is very reasonable; that is homogeneous in regions where little or no information is available to alter an initial state. No long range correlation trends or fractal behavior of the log-transmissivity field was observed in either aquifer over a distance of about 300 km.
NASA Astrophysics Data System (ADS)
Khalaf, E.; Skvortsov, M. A.; Ostrovsky, P. M.
2016-03-01
We study electron transport at the edge of a generic disordered two-dimensional topological insulator, where some channels are topologically protected from backscattering. Assuming the total number of channels is large, we consider the edge as a quasi-one-dimensional quantum wire and describe it in terms of a nonlinear sigma model with a topological term. Neglecting localization effects, we calculate the average distribution function of transmission probabilities as a function of the sample length. We mainly focus on the two experimentally relevant cases: a junction between two quantum Hall (QH) states with different filling factors (unitary class) and a relatively thick quantum well exhibiting quantum spin Hall (QSH) effect (symplectic class). In a QH sample, the presence of topologically protected modes leads to a strong suppression of diffusion in the other channels already at scales much shorter than the localization length. On the semiclassical level, this is accompanied by the formation of a gap in the spectrum of transmission probabilities close to unit transmission, thereby suppressing shot noise and conductance fluctuations. In the case of a QSH system, there is at most one topologically protected edge channel leading to weaker transport effects. In order to describe `topological' suppression of nearly perfect transparencies, we develop an exact mapping of the semiclassical limit of the one-dimensional sigma model onto a zero-dimensional sigma model of a different symmetry class, allowing us to identify the distribution of transmission probabilities with the average spectral density of a certain random-matrix ensemble. We extend our results to other symmetry classes with topologically protected edges in two dimensions.
NASA Astrophysics Data System (ADS)
Gilmanshin, I. R.; Kirpichnikov, A. P.
2017-09-01
In the result of study of the algorithm of the functioning of the early detection module of excessive losses, it is proven the ability to model it by using absorbing Markov chains. The particular interest is in the study of probability characteristics of early detection module functioning algorithm of losses in order to identify the relationship of indicators of reliability of individual elements, or the probability of occurrence of certain events and the likelihood of transmission of reliable information. The identified relations during the analysis allow to set thresholds reliability characteristics of the system components.
2010-03-01
uses all available resources in some optimized manner. By further exploiting the design flexibility and computational efficiency of Orthogonal Frequency...in the following sections. 3.2.1 Estimation of PU Signal Statistics. The Estimate PU Signal Statis- tics function of Fig 3.4 is used to compute the...consecutive PU transmissions, and 4) the probability of transitioning from one transmission state to another. These statistics are then used to compute the
Glucose and lactate as metabolic constraints on presynaptic transmission at an excitatory synapse.
Lucas, Sarah J; Michel, Christophe B; Marra, Vincenzo; Smalley, Joshua L; Hennig, Matthias H; Graham, Bruce P; Forsythe, Ian D
2018-05-01
Synapses have high energy demands which increase during intense activity. We show that presynaptic terminals can utilise extracellular glucose or lactate to generate energy to maintain synaptic transmission. Reducing energy substrates induces a metabolic stress: presynaptic ATP depletion impaired synaptic transmission through a reduction in the number of functional synaptic vesicle release sites and a slowing of vesicle pool replenishment, without a consistent change in release probability. Metabolic function is compromised in many pathological conditions (e.g. stroke, traumatic brain injury and neurodegeneration). Knowledge of how synaptic transmission is constrained by metabolic stress, especially during intense brain activity, will provide insights to improve cognition following pathological insults. The synapse has high energy demands, which increase during intense activity. Presynaptic ATP production depends on substrate availability and usage will increase during activity, which in turn could influence transmitter release and information transmission. We investigated transmitter release at the mouse calyx of Held synapse using glucose or lactate (10, 1 or 0 mm) as the extracellular substrates while inducing metabolic stress. High-frequency stimulation (HFS) and recovery paradigms evoked trains of EPSCs monitored under voltage-clamp. Whilst postsynaptic intracellular ATP was stabilised by diffusion from the patch pipette, depletion of glucose increased EPSC depression during HFS and impaired subsequent recovery. Computational modelling of these data demonstrated a reduction in the number of functional release sites and slowed vesicle pool replenishment during metabolic stress, with little change in release probability. Directly depleting presynaptic terminal ATP impaired transmitter release in an analogous manner to glucose depletion. In the absence of glucose, presynaptic terminal metabolism could utilise lactate from the aCSF and this was blocked by inhibition of monocarboxylate transporters (MCTs). MCT inhibitors significantly suppressed transmission in low glucose, implying that lactate is a presynaptic substrate. Additionally, block of glycogenolysis accelerated synaptic transmission failure in the absence of extracellular glucose, consistent with supplemental supply of lactate by local astrocytes. We conclude that both glucose and lactate support presynaptic metabolism and that limited availability, exacerbated by high-intensity firing, constrains presynaptic ATP, impeding transmission through a reduction in functional presynaptic release sites as vesicle recycling slows when ATP levels are low. © 2018 The Authors. The Journal of Physiology © 2018 The Physiological Society.
Probability theory for 3-layer remote sensing in ideal gas law environment.
Ben-David, Avishai; Davidson, Charles E
2013-08-26
We extend the probability model for 3-layer radiative transfer [Opt. Express 20, 10004 (2012)] to ideal gas conditions where a correlation exists between transmission and temperature of each of the 3 layers. The effect on the probability density function for the at-sensor radiances is surprisingly small, and thus the added complexity of addressing the correlation can be avoided. The small overall effect is due to (a) small perturbations by the correlation on variance population parameters and (b) cancellation of perturbation terms that appear with opposite signs in the model moment expressions.
Calculation of transmission probability by solving an eigenvalue problem
NASA Astrophysics Data System (ADS)
Bubin, Sergiy; Varga, Kálmán
2010-11-01
The electron transmission probability in nanodevices is calculated by solving an eigenvalue problem. The eigenvalues are the transmission probabilities and the number of nonzero eigenvalues is equal to the number of open quantum transmission eigenchannels. The number of open eigenchannels is typically a few dozen at most, thus the computational cost amounts to the calculation of a few outer eigenvalues of a complex Hermitian matrix (the transmission matrix). The method is implemented on a real space grid basis providing an alternative to localized atomic orbital based quantum transport calculations. Numerical examples are presented to illustrate the efficiency of the method.
Mapping the Transmission Functions of Single-Molecule Junctions
Capozzi, Brian; Low, Jonathan Z.; Xia, Jianlong; ...
2016-06-08
Charge transport characteristics of single-molecule junctions are often governed by a transmission function that dictates the probability of electrons or holes tunneling across the junction. Here, we present a new and simple technique for measuring the transmission function of molecular junctions in the coherent tunneling limit, over an energy range of 2 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different areas exposed, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junctionmore » Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction’s transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed ab initio. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.« less
Mapping the Transmission Functions of Single-Molecule Junctions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Capozzi, Brian; Low, Jonathan Z.; Xia, Jianlong
Charge transport characteristics of single-molecule junctions are often governed by a transmission function that dictates the probability of electrons or holes tunneling across the junction. Here, we present a new and simple technique for measuring the transmission function of molecular junctions in the coherent tunneling limit, over an energy range of 2 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different areas exposed, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junctionmore » Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction’s transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed ab initio. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.« less
Mapping the Transmission Functions of Single-Molecule Junctions.
Capozzi, Brian; Low, Jonathan Z; Xia, Jianlong; Liu, Zhen-Fei; Neaton, Jeffrey B; Campos, Luis M; Venkataraman, Latha
2016-06-08
Charge transport phenomena in single-molecule junctions are often dominated by tunneling, with a transmission function dictating the probability that electrons or holes tunnel through the junction. Here, we present a new and simple technique for measuring the transmission functions of molecular junctions in the coherent tunneling limit, over an energy range of 1.5 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different exposed areas, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junction Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction's transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed from first principles. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.
Stacking dependence of carrier transport properties in multilayered black phosphorous
NASA Astrophysics Data System (ADS)
Sengupta, A.; Audiffred, M.; Heine, T.; Niehaus, T. A.
2016-02-01
We present the effect of different stacking orders on carrier transport properties of multi-layer black phosphorous. We consider three different stacking orders AAA, ABA and ACA, with increasing number of layers (from 2 to 6 layers). We employ a hierarchical approach in density functional theory (DFT), with structural simulations performed with generalized gradient approximation (GGA) and the bandstructure, carrier effective masses and optical properties evaluated with the meta-generalized gradient approximation (MGGA). The carrier transmission in the various black phosphorous sheets was carried out with the non-equilibrium green’s function (NEGF) approach. The results show that ACA stacking has the highest electron and hole transmission probabilities. The results show tunability for a wide range of band-gaps, carrier effective masses and transmission with a great promise for lattice engineering (stacking order and layers) in black phosphorous.
Bacterial adhesion forces to Ag-impregnated contact lens cases and transmission to contact lenses.
Qu, Wenwen; Busscher, Henk J; van der Mei, Henny C; Hooymans, Johanna M M
2013-03-01
To measure adhesion forces of Pseudomonas aeruginosa, Staphylococcus aureus, and Serratia marcescens to a rigid contact lens (CL), standard polypropylene, and Ag-impregnated lens cases using atomic force microscopy and determine bacterial transmission from lens case to CL. Adhesion forces of bacterial strains to Ag-impregnated and polypropylene lens cases and a rigid CL were measured using atomic force microscopy. Adhesion forces were used to calculate Weibull distributions, from which transmission probabilities from lens case to CL were derived. Transmission probabilities were compared with actual transmission of viable bacteria from a lens case to the CL in 0.9% NaCl and in an antimicrobial lens care solution. Bacterial transmission probabilities from polypropylene lens cases based on force analysis coincided well for all strains with actual transmission in 0.9% NaCl. Bacterial adhesion forces on Ag-impregnated lens cases were much smaller than that on polypropylene and CLs, yielding a high probability of transmission. Comparison with actual bacterial transmission indicated bacterial killing due to Ag ions during colony-forming unit transmission from an Ag-impregnated lens case, especially for P. aeruginosa. Transmission of viable bacteria from Ag-impregnated lens cases could be further decreased by use of an antimicrobial lens care solution instead of 0.9% NaCl. Bacterial transmission probabilities are higher from Ag-impregnated lens cases than from polypropylene lens cases because of small adhesion forces, but this is compensated for by enhanced bacterial killing due to Ag impregnation, especially when in combination with an antimicrobial lens care solution. This calls for a balanced combination of antimicrobial lens care solutions and surface properties of a lens case and CL.
Inelastic cotunneling with energy-dependent contact transmission
NASA Astrophysics Data System (ADS)
Blok, S.; Agundez Mojarro, R. R.; Maduro, L. A.; Blaauboer, M.; Van Der Molen, S. J.
2017-03-01
We investigate inelastic cotunneling in a model system where the charging island is connected to the leads through molecules with energy-dependent transmission functions. To study this problem, we propose two different approaches. The first is a pragmatic approach that assumes Lorentzian-like transmission functions that determine the transmission probability to the island. Using this model, we calculate current versus voltage (IV) curves for increasing resonance level positions of the molecule. We find that shifting the resonance energy of the molecule away from the Fermi energy of the contacts leads to a decreased current at low bias, but as bias increases, this difference decreases and eventually inverses. This is markedly different from IV behavior outside the cotunneling regime. The second approach involves multiple cotunneling where also the molecules are considered to be in the Coulomb blockade regime. We find here that when Ec≫eV ,kBT , the IV behavior approaches the original cotunneling behavior proposed by Averin and Nazarov [Phys. Rev. Lett. 65, 2446-2449 (1990)].
Mustafa, Tariq; Horton, David R.; Cooper, W. Rodney; Swisher, Kylie D.; Zack, Richard S.; Pappu, Hanu R.; Munyaneza, Joseph E.
2015-01-01
The potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae), is a vector of the phloem-limited bacterium ‘Candidatus Liberibacter solanacearum’ (Lso), the putative causal agent of zebra chip disease of potato. Little is known about how potato psyllid transmits Lso to potato. We used electrical penetration graph (EPG) technology to compare stylet probing behaviors and efficiency of Lso transmission of three haplotypes of potato psyllid (Central, Western, Northwestern). All haplotypes exhibited the full suite of stylet behaviors identified in previous studies with this psyllid, including intercellular penetration and secretion of the stylet pathway, xylem ingestion, and phloem activities, the latter comprising salivation and ingestion. The three haplotypes exhibited similar frequency and duration of probing behaviors, with the exception of salivation into phloem, which was of higher duration by psyllids of the Western haplotype. We manipulated how long psyllids were allowed access to potato (“inoculation access period”, or IAP) to examine the relationship between phloem activities and Lso transmission. Between 25 and 30% of psyllids reached and salivated into phloem at an IAP of 1 hr, increasing to almost 80% of psyllids as IAP was increased to 24 h. Probability of Lso-transmission was lower across all IAP levels than probability of phloem salivation, indicating that a percentage of infected psyllids which salivated into the phloem failed to transmit Lso. Logistic regression showed that probability of transmission increased as a function of time spent salivating into the phloem; transmission occurred as quickly as 5 min following onset of salivation. A small percentage of infected psyllids showed extremely long salivation events but nonetheless failed to transmit Lso, for unknown reasons. Information from these studies increases our understanding of Lso transmission by potato psyllid, and demonstrates the value of EPG technology in exploring questions of vector efficiency. PMID:26407093
NASA Astrophysics Data System (ADS)
Bellentani, Laura; Beggi, Andrea; Bordone, Paolo; Bertoni, Andrea
2018-05-01
We present a numerical study of a multichannel electronic Mach-Zehnder interferometer, based on magnetically driven noninteracting edge states. The electron path is defined by a full-scale potential landscape on the two-dimensional electron gas at filling factor 2, assuming initially only the first Landau level as filled. We tailor the two beamsplitters with 50 % interchannel mixing and measure Aharonov-Bohm oscillations in the transmission probability of the second channel. We perform time-dependent simulations by solving the electron Schrödinger equation through a parallel implementation of the split-step Fourier method, and we describe the charge-carrier wave function as a Gaussian wave packet of edge states. We finally develop a simplified theoretical model to explain the features observed in the transmission probability, and we propose possible strategies to optimize gate performances.
RAPTOR Transmissivity and Cloud Climatology Study. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eis, K.E.; Vonder Haar, T.H.; Forsythe, J.
1993-01-01
The RAPTOR Transmissivity Study (RTS) was funded by Lawrence Livermore National Laboratory (LLNL) under a sub contract to support the U.S. Army`s RAPTOR program. The intent of the study is to answer two questions: (1) What are the typical transmission levels of clouds as a function of target altitude for two locations and wavelengths of interest? (2) What is the probability that a cloud will intervene between sensor and target for a given target altitude, range, wavelength and location? This was addressed for Iraq and Korea. Answers to both questions are treated using existing software and data sources where possiblemore » due to the limited funding and scope of the contract.« less
Double Barriers and Magnetic Field in Bilayer Graphene
NASA Astrophysics Data System (ADS)
Redouani, Ilham; Jellal, Ahmed; Bahlouli, Hocine
2015-12-01
We study the transmission probability in an AB-stacked bilayer graphene of Dirac fermions scattered by a double-barrier structure in the presence of a magnetic field. We take into account the full four bands structure of the energy spectrum and use the suitable boundary conditions to determine the transmission probability. Our numerical results show that for energies higher than the interlayer coupling, four ways for transmission are possible while for energies less than the height of the barrier, Dirac fermions exhibit transmission resonances and only one transmission channel is available. We show that, for AB-stacked bilayer graphene, there is no Klein tunneling at normal incidence. We find that the transmission displays sharp peaks inside the transmission gap around the Dirac point within the barrier regions while they are absent around the Dirac point in the well region. The effect of the magnetic field, interlayer electrostatic potential, and various barrier geometry parameters on the transmission probabilities is also discussed.
Characteristics of white LED transmission through a smoke screen
NASA Astrophysics Data System (ADS)
Zheng, Yunfei; Yang, Aiying; Feng, Lihui; Guo, Peng
2018-01-01
The characteristics of white LED transmission through a smoke screen is critical for visible light communication through a smoke screen. Based on the Mie scattering theory, the Monte Carlo transmission model is established. Based on the probability density function, the white LED sampling model is established according to the measured spectrum of a white LED and the distribution angle of the lambert model. The sampling model of smoke screen particle diameter is also established according to its distribution. We simulate numerically the influence the smoke thickness, the smoke concentration and the angle of irradiance of white LED on transmittance of the white LED. We construct a white LED smoke transmission experiment system. The measured result on the light transmittance and the smoke concentration agreed with the simulated result, and demonstrated the validity of simulation model for visible light transmission channel through a smoke screen.
Noradrenergic modulation of risk/reward decision making.
Montes, David R; Stopper, Colin M; Floresco, Stan B
2015-08-01
Catecholamine transmission modulates numerous cognitive and reward-related processes that can subserve more complex functions such as cost/benefit decision making. Dopamine has been shown to play an integral role in decisions involving reward uncertainty, yet there is a paucity of research investigating the contributions of noradrenaline (NA) transmission to these functions. The present study was designed to elucidate the contribution of NA to risk/reward decision making in rats, assessed with a probabilistic discounting task. We examined the effects of reducing noradrenergic transmission with the α2 agonist clonidine (10-100 μg/kg), and increasing activity at α2A receptor sites with the agonist guanfacine (0.1-1 mg/kg), the α2 antagonist yohimbine (1-3 mg/kg), and the noradrenaline transporter (NET) inhibitor atomoxetine (0.3-3 mg/kg) on probabilistic discounting. Rats chose between a small/certain reward and a larger/risky reward, wherein the probability of obtaining the larger reward either decreased (100-12.5 %) or increased (12.5-100 %) over a session. In well-trained rats, clonidine reduced risky choice by decreasing reward sensitivity, whereas guanfacine did not affect choice behavior. Yohimbine impaired adjustments in decision biases as reward probability changed within a session by altering negative feedback sensitivity. In a subset of rats that displayed prominent discounting of probabilistic rewards, the lowest dose of atomoxetine increased preference for the large/risky reward when this option had greater long-term utility. These data highlight an important and previously uncharacterized role for noradrenergic transmission in mediating different aspects of risk/reward decision making and mediating reward and negative feedback sensitivity.
Which nanowire couples better electrically to a metal contact: Armchair or zigzag nanotube?
NASA Technical Reports Server (NTRS)
Anantram, M. P.; Biegel, Bryan (Technical Monitor)
2001-01-01
The fundamental question of how chirality affects tile electronic coupling of a nanotube to metal contacts is important for tile application of nanotubes as nanowires. We show that metallic-zigzag nanotubes are superior to armchair nanotubes as nanowires, by modeling the metal-nanotube interface. More specifically, we show that as a function of coupling strength, the total electron transmission of armchair nanotubes increases and tends to be pinned close to unity for a metal with Fermi wave vector close to that of gold. In contrast, the transmission probability of zigzag nanotubes increases to the maximum possible value of two. The origin of these effects lies in the details of the wave function, which is explained.
Performance Analysis of Cluster Formation in Wireless Sensor Networks.
Montiel, Edgar Romo; Rivero-Angeles, Mario E; Rubino, Gerardo; Molina-Lozano, Heron; Menchaca-Mendez, Rolando; Menchaca-Mendez, Ricardo
2017-12-13
Clustered-based wireless sensor networks have been extensively used in the literature in order to achieve considerable energy consumption reductions. However, two aspects of such systems have been largely overlooked. Namely, the transmission probability used during the cluster formation phase and the way in which cluster heads are selected. Both of these issues have an important impact on the performance of the system. For the former, it is common to consider that sensor nodes in a clustered-based Wireless Sensor Network (WSN) use a fixed transmission probability to send control data in order to build the clusters. However, due to the highly variable conditions experienced by these networks, a fixed transmission probability may lead to extra energy consumption. In view of this, three different transmission probability strategies are studied: optimal, fixed and adaptive. In this context, we also investigate cluster head selection schemes, specifically, we consider two intelligent schemes based on the fuzzy C-means and k-medoids algorithms and a random selection with no intelligence. We show that the use of intelligent schemes greatly improves the performance of the system, but their use entails higher complexity and selection delay. The main performance metrics considered in this work are energy consumption, successful transmission probability and cluster formation latency. As an additional feature of this work, we study the effect of errors in the wireless channel and the impact on the performance of the system under the different transmission probability schemes.
Performance Analysis of Cluster Formation in Wireless Sensor Networks
Montiel, Edgar Romo; Rivero-Angeles, Mario E.; Rubino, Gerardo; Molina-Lozano, Heron; Menchaca-Mendez, Rolando; Menchaca-Mendez, Ricardo
2017-01-01
Clustered-based wireless sensor networks have been extensively used in the literature in order to achieve considerable energy consumption reductions. However, two aspects of such systems have been largely overlooked. Namely, the transmission probability used during the cluster formation phase and the way in which cluster heads are selected. Both of these issues have an important impact on the performance of the system. For the former, it is common to consider that sensor nodes in a clustered-based Wireless Sensor Network (WSN) use a fixed transmission probability to send control data in order to build the clusters. However, due to the highly variable conditions experienced by these networks, a fixed transmission probability may lead to extra energy consumption. In view of this, three different transmission probability strategies are studied: optimal, fixed and adaptive. In this context, we also investigate cluster head selection schemes, specifically, we consider two intelligent schemes based on the fuzzy C-means and k-medoids algorithms and a random selection with no intelligence. We show that the use of intelligent schemes greatly improves the performance of the system, but their use entails higher complexity and selection delay. The main performance metrics considered in this work are energy consumption, successful transmission probability and cluster formation latency. As an additional feature of this work, we study the effect of errors in the wireless channel and the impact on the performance of the system under the different transmission probability schemes. PMID:29236065
NASA Astrophysics Data System (ADS)
Wieczorek, Andrzej N.; Kruk, Radosław
2016-03-01
In correctly functioning maintenance systems it is most important to prevent possible failures. A reduction of the vibroacoustic effects accompanying the operation of machines and equipment, including transmissions, is among the factors that lower the probability of a failure. The paper presents the results of the research on the impact of operational factors on vibroacoustic conditions of transmissions. The factors covered by the analysis included a change in the mating conditions of gear wheels associated with the wear of tooth surfaces, operation of transmissions in subharmonic conditions of the main resonance and the temperature of the lubricating oil. The study demonstrated that it was possible to reduce the vibroacoustic effects generated by gear transmissions by changing the conditions of their operation. Based on the results obtained, it has been found that the operation of gear transmissions in accordance with the sustainable development principles requires technical services to take active measures consisting in the search for optimal operating conditions in terms of the vibroacoustic conditions.
Conductance of three-terminal molecular bridge based on tight-binding theory
NASA Astrophysics Data System (ADS)
Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada
2005-05-01
The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.
Bit-Wise Arithmetic Coding For Compression Of Data
NASA Technical Reports Server (NTRS)
Kiely, Aaron
1996-01-01
Bit-wise arithmetic coding is data-compression scheme intended especially for use with uniformly quantized data from source with Gaussian, Laplacian, or similar probability distribution function. Code words of fixed length, and bits treated as being independent. Scheme serves as means of progressive transmission or of overcoming buffer-overflow or rate constraint limitations sometimes arising when data compression used.
Wave theory of turbulence in compressible media (acoustic theory of turbulence)
NASA Technical Reports Server (NTRS)
Kentzer, C. P.
1975-01-01
The generation and the transmission of sound in turbulent flows are treated as one of the several aspects of wave propagation in turbulence. Fluid fluctuations are decomposed into orthogonal Fourier components, with five interacting modes of wave propagation: two vorticity modes, one entropy mode, and two acoustic modes. Wave interactions, governed by the inhomogeneous and nonlinear terms of the perturbed Navier-Stokes equations, are modeled by random functions which give the rates of change of wave amplitudes equal to the averaged interaction terms. The statistical framework adopted is a quantum-like formulation in terms of complex distribution functions. The spatial probability distributions are given by the squares of the absolute values of the complex characteristic functions. This formulation results in nonlinear diffusion-type transport equations for the probability densities of the five modes of wave propagation.
Silver, R Angus; Momiyama, Akiko; Cull-Candy, Stuart G
1998-01-01
EPSCs were recorded under whole-cell voltage clamp at room temperature from Purkinje cells in slices of cerebellum from 12- to 14-day-old rats. EPSCs from individual climbing fibre (CF) inputs were identified on the basis of their large size, paired-pulse depression and all-or-none appearance in response to a graded stimulus. Synaptic transmission was investigated over a wide range of experimentally imposed release probabilities by analysing fluctuations in the peak of the EPSC. Release probability was manipulated by altering the extracellular [Ca2+] and [Mg2+]. Quantal parameters were estimated from plots of coefficient of variation (CV) or variance against mean conductance by fitting a multinomial model that incorporated both spatial variation in quantal size and non-uniform release probability. This ‘multiple-probability fluctuation’ (MPF) analysis gave an estimate of 510 ± 50 for the number of functional release sites (N) and a quantal size (q) of 0.5 ± 0.03 nS (n = 6). Control experiments, and simulations examining the effects of non-uniform release probability, indicate that MPF analysis provides a reliable estimate of quantal parameters. Direct measurement of quantal amplitudes in the presence of 5 mm Sr2+, which gave asynchronous release, yielded distributions with a mean quantal size of 0.55 ± 0.01 nS and a CV of 0.37 ± 0.01 (n = 4). Similar estimates of q were obtained in 2 mm Ca2+ when release probability was lowered with the calcium channel blocker Cd2+. The non-NMDA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX; 1 μm) reduced both the evoked current and the quantal size (estimated with MPF analysis) to a similar degree, but did not affect the estimate of N. We used MPF analysis to identify those quantal parameters that change during frequency-dependent depression at climbing fibre-Purkinje cell synaptic connections. At low stimulation frequencies, the mean release probability (P¯r) was unusually high (0.90 ± 0.03 at 0.033 Hz, n = 5), but as the frequency of stimulation was increased, pr fell dramatically (0.02 ± 0.01 at 10 Hz, n = 4) with no apparent change in either q or N. This indicates that the observed 50-fold depression in EPSC amplitude is presynaptic in origin. Presynaptic frequency-dependent depression was investigated with double-pulse and multiple-pulse protocols. EPSC recovery, following simultaneous release at practically all sites, was slow, being well fitted by the sum of two exponential functions (time constants of 0.35 ± 0.09 and 3.2 ± 0.4 s, n = 5). EPSC recovery following sustained stimulation was even slower. We propose that presynaptic depression at CF synapses reflects a slow recovery of release probability following release of each quantum of transmitter. The large number of functional release sites, relatively large quantal size, and unusual dynamics of transmitter release at the CF synapse appear specialized to ensure highly reliable olivocerebellar transmission at low frequencies but to limit transmission at higher frequencies. PMID:9660900
Very High-Frequency (VHF) ionospheric scintillation fading measurements at Lima, Peru
NASA Technical Reports Server (NTRS)
Blank, H. A.; Golden, T. S.
1972-01-01
During the spring equinox of 1970, scintillating signals at VHF (136.4 MHz) were observed at Lima, Peru. The transmission originated from ATS 3 and was observed through a pair of antennas spaced 1200 feet apart on an east-west baseline. The empirical data were digitized, reduced, and analyzed. The results include amplitude probability density and distribution functions, time autocorrelation functions, cross correlation functions for the spaced antennas, and appropriate spectral density functions. Results show estimates of the statistics of the ground diffraction pattern to gain insight into gross ionospheric irregularity size, and irregularity velocity in the antenna planes.
An epidemiological model of virus transmission in salmonid fishes of the Columbia River Basin
Ferguson, Paige F. B.; Breyta, Rachel; Brito, Ilana L.; Kurath, Gael; LaDeau, Shannon L.
2018-01-01
We have developed a dynamic epidemiological model informed by records of viral presence and genotypes to evaluate potential transmission routes maintaining a viral pathogen in economically and culturally important anadromous fish populations. In the Columbia River Basin, infectious hematopoietic necrosis virus (IHNV) causes severe disease, predominantly in juvenile steelhead trout (Oncorhynchus mykiss) and less frequently in Chinook salmon (O. tshawytscha). Mortality events following IHNV infection can be devastating for individual hatchery programs. Despite reports of high local mortality and extensive surveillance efforts, there are questions about how viral transmission is maintained. Modeling this system offers important insights into disease transmission in natural aquatic systems, as well as about the data requirements for generating accurate estimates about transmission routes and infection probabilities. We simulated six scenarios in which testing rates and the relative importance of different transmission routes varied. The simulations demonstrated that the model accurately identified routes of transmission and inferred infection probabilities accurately when there was testing of all cohort-sites. When testing records were incomplete, the model accurately inferred which transmission routes exposed particular cohort-sites but generated biased infection probabilities given exposure. After validating the model and generating guidelines for result interpretation, we applied the model to data from 14 annual cohorts (2000–2013) at 24 focal sites in a sub-region of the Columbia River Basin, the lower Columbia River (LCR), to quantify the relative importance of potential transmission routes in this focal sub-region. We demonstrate that exposure to IHNV via the return migration of adult fish is an important route for maintaining IHNV in the LCR sub-region, and the probability of infection following this exposure was relatively high at 0.16. Although only 1% of cohort-sites experienced self-exposure by infected juvenile fish, this transmission route had the greatest probability of infection (0.22). Increased testing and/or determining whether transmission can occur from cohort-sites without testing records (e.g., determining there was no testing record because there were no fish at the cohort-site) are expected to improve inference about infection probabilities. Increased use of secure water supplies and continued use of biosecurity protocols may reduce IHNV transmission from adult fish and juvenile fish within the site, respectively, to juvenile salmonids at hatcheries. Models and conclusions from this study are potentially relevant to understanding the relative importance of transmission routes for other important aquatic pathogens in salmonids, including the agents of bacterial kidney disease and coldwater disease, and the basic approach may be useful for other pathogens and hosts in other geographic regions.
Stability of excitons in double quantum well: Through electron and holes transmission probabilities
NASA Astrophysics Data System (ADS)
Vignesh, G.; Nithiananthi, P.
2017-05-01
Stability of excitons has been analyzed using the transmission probability of its constituent particles in GaAs/Al0.3Ga0.7As Double Quantum Well (DQW) structure by varying well and barrier layer thickness. The effective mass approximation is used and anisotropy in material properties are also considered to get realistic situations. It is observed that tuning barrier layer avails many resonance peaks for the transmission and tuning well width admits maximum transmission at narrow well widths. Every saddle point of the observed transmission coefficients decides the formation, strength and transportation of excitons in DQW.
Heat current through an artificial Kondo impurity beyond linear response
NASA Astrophysics Data System (ADS)
Sierra, Miguel A.; Sánchez, David
2018-03-01
We investigate the heat current of a strongly interacting quantum dot in the presence of a voltage bias in the Kondo regime. Using the slave-boson mean-field theory, we discuss the behavior of the energy flow and the Joule heating. We find that both contributions to the heat current display interesting symmetry properties under reversal of the applied dc bias. We show that the symmetries arise from the behavior of the dot transmission function. Importantly, the transmission probability is a function of both energy and voltage. This allows us to analyze the heat current in the nonlinear regime of transport. We observe that nonlinearities appear already for voltages smaller than the Kondo temperature. Finally, we suggest to use the contact and electric symmetry coefficients as a way to measure pure energy currents.
Scattering of charged particles on two spatially separated time-periodic optical fields
NASA Astrophysics Data System (ADS)
Szabó, Lóránt Zs.; Benedict, Mihály G.; Földi, Péter
2017-12-01
We consider a monoenergetic beam of moving charged particles interacting with two separated oscillating electric fields. Time-periodic linear potential is assumed to model the light-particle interaction using a nonrelativistic, quantum mechanical description based on Gordon-Volkov states. Applying Floquet theory, we calculate transmission probabilities as a function of the laser field parameters. The transmission resonances in this Ramsey-like setup are interpreted as if they originated from a corresponding static double-potential barrier with heights equal to the ponderomotive potential resulting from the oscillating field. Due to the opening of new "Floquet channels," the resonances are repeated at input energies when the corresponding frequency is shifted by an integer multiple of the exciting frequency. These narrow resonances can be used as precise energy filters. The fine structure of the transmission spectra is determined by the phase difference between the two oscillating light fields, allowing for the optical control of the transmission.
Percha, Bethany; Newman, M. E. J.; Foxman, Betsy
2012-01-01
Group B Streptococcus (GBS) remains a major cause of neonatal sepsis and is an emerging cause of invasive bacterial infections. The 9 known serotypes vary in virulence, and there is little cross-immunity. Key parameters for planning an effective vaccination strategy, such as average length of immunity and transmission probabilities by serotype, are unknown. We simulated GBS spread in a population using a computational model with parameters derived from studies of GBS sexual transmission in a college dormitory. Here we provide estimates of the duration of immunity relative to the transmission probabilities for the 3 GBS serotypes most associated with invasive disease: Ia, III, and V. We also place upper limits on the durations of immunity for serotype Ia (570 days), III (1125 days) and V (260 days). Better transmission estimates are required to establish the epidemiological parameters of GBS infection and determine the best vaccination strategies to prevent GBS disease. PMID:21605704
Tuberculosis in a South African prison – a transmission modelling analysis
Johnstone-Robertson, Simon; Lawn, Stephen D; Welte, Alex; Bekker, Linda-Gail; Wood, Robin
2015-01-01
Background Prisons are recognised internationally as institutions with very high tuberculosis (TB) burdens where transmission is predominantly determined by contact between infectious and susceptible prisoners. A recent South African court case described the conditions under which prisoners awaiting trial were kept. With the use of these data, a mathematical model was developed to explore the interactions between incarceration conditions and TB control measures. Methods Cell dimensions, cell occupancy, lock-up time, TB incidence and treatment delays were derived from court evidence and judicial reports. Using the Wells-Riley equation and probability analyses of contact between prisoners, we estimated the current TB transmission probability within prison cells, and estimated transmission probabilities of improved levels of case finding in combination with implementation of national and international minimum standards for incarceration. Results Levels of overcrowding (230%) in communal cells and poor TB case finding result in annual TB transmission risks of 90% per annum. Implementing current national or international cell occupancy recommendations would reduce TB transmission probabilities by 30% and 50%, respectively. Improved passive case finding, modest ventilation increase or decreased lock-up time would minimally impact on transmission if introduced individually. However, active case finding together with implementation of minimum national and international standards of incarceration could reduce transmission by 50% and 94%, respectively. Conclusions Current conditions of detention for awaiting-trial prisoners are highly conducive for spread of drug-sensitive and drug-resistant TB. Combinations of simple well-established scientific control measures should be implemented urgently. PMID:22272961
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Review. Neurobiology of nicotine dependence.
Markou, Athina
2008-10-12
Nicotine is a psychoactive ingredient in tobacco that significantly contributes to the harmful tobacco smoking habit. Nicotine dependence is more prevalent than dependence on any other substance. Preclinical research in animal models of the various aspects of nicotine dependence suggests a critical role of glutamate, gamma-aminobutyric acid (GABA), cholinergic and dopamine neurotransmitter interactions in the ventral tegmental area and possibly other brain sites, such as the central nucleus of the amygdala and the prefrontal cortex, in the effects of nicotine. Specifically, decreasing glutamate transmission or increasing GABA transmission with pharmacological manipulations decreased the rewarding effects of nicotine and cue-induced reinstatement of nicotine seeking. Furthermore, early nicotine withdrawal is characterized by decreased function of presynaptic inhibitory metabotropic glutamate 2/3 receptors and increased expression of postsynaptic glutamate receptor subunits in limbic and frontal brain sites, while protracted abstinence may be associated with increased glutamate response to stimuli associated with nicotine administration. Finally, adaptations in nicotinic acetylcholine receptor function are also involved in nicotine dependence. These neuroadaptations probably develop to counteract the decreased glutamate and cholinergic transmission that is hypothesized to characterize early nicotine withdrawal. In conclusion, glutamate, GABA and cholinergic transmission in limbic and frontal brain sites are critically involved in nicotine dependence.
Solution of the finite Milne problem in stochastic media with RVT Technique
NASA Astrophysics Data System (ADS)
Slama, Howida; El-Bedwhey, Nabila A.; El-Depsy, Alia; Selim, Mustafa M.
2017-12-01
This paper presents the solution to the Milne problem in the steady state with isotropic scattering phase function. The properties of the medium are considered as stochastic ones with Gaussian or exponential distributions and hence the problem treated as a stochastic integro-differential equation. To get an explicit form for the radiant energy density, the linear extrapolation distance, reflectivity and transmissivity in the deterministic case the problem is solved using the Pomraning-Eddington method. The obtained solution is found to be dependent on the optical space variable and thickness of the medium which are considered as random variables. The random variable transformation (RVT) technique is used to find the first probability density function (1-PDF) of the solution process. Then the stochastic linear extrapolation distance, reflectivity and transmissivity are calculated. For illustration, numerical results with conclusions are provided.
Stochastic Models of Emerging Infectious Disease Transmission on Adaptive Random Networks
Pipatsart, Navavat; Triampo, Wannapong
2017-01-01
We presented adaptive random network models to describe human behavioral change during epidemics and performed stochastic simulations of SIR (susceptible-infectious-recovered) epidemic models on adaptive random networks. The interplay between infectious disease dynamics and network adaptation dynamics was investigated in regard to the disease transmission and the cumulative number of infection cases. We found that the cumulative case was reduced and associated with an increasing network adaptation probability but was increased with an increasing disease transmission probability. It was found that the topological changes of the adaptive random networks were able to reduce the cumulative number of infections and also to delay the epidemic peak. Our results also suggest the existence of a critical value for the ratio of disease transmission and adaptation probabilities below which the epidemic cannot occur. PMID:29075314
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Qu, Wenwen; Hooymans, Johanna M M; Qiu, Jun; de-Bont, Nik; Gelling, Onko-Jan; van der Mei, Henny C; Busscher, Henk J
2013-05-01
Surface properties of lens cases are determinant for their cleanability and for microbial transmission from lens cases to contact lenses (CLs). PEG-polymer-brush-coatings are known to decrease microbial adhesion more than other surface-coatings. Here, we applied a robust, silica nanoparticles-based brush-coating to polypropylene cases to evaluate their ease of cleaning and probability of bacterial transmission to CLs. Adhesion forces of nine bacterial strains (Pseudomonas, Staphylococci, and Serratia) to rigid CLs, polypropylene, and silica nanoparticles-based brush-coated polypropylene were measured using atomic-force-microscopy and subjected to Weibull analyses to yield bacterial transmission probabilities. Biofilms of each strain were grown in coated and uncoated cases and rinsed with a NaCl or antimicrobial lens care solution. Residual, viable organisms were quantified. Bacterial adhesion forces of all strains were significantly, up to tenfold smaller on brush-coated than on uncoated polypropylene. This yielded, higher transmission probabilities to a CL, but mild-rinsing yielded 10-100 fold higher removal of bacteria from brush-coated than from polypropylene cases. Moreover, due to weak adhesion forces, bacteria on brush-coated cases were two-to-three fold more susceptible to an antimicrobial lens care solution than on polypropylene cases. Therewith, the design of lens case surfaces is a compromise between ease of cleaning and transmission probability to CLs. Copyright © 2013 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Ngampitipan, Tritos; Boonserm, Petarpa; Chatrabhuti, Auttakit; Visser, Matt
2016-06-01
Hawking radiation is the evidence for the existence of black hole. What an observer can measure through Hawking radiation is the transmission probability. In the laboratory, miniature black holes can successfully be generated. The generated black holes are, most commonly, Myers-Perry black holes. In this paper, we will derive the rigorous bounds on the transmission probabilities for massless scalar fields of non-negative-angular-momentum modes emitted from a generated Myers-Perry black hole in six, seven, and eight dimensions. The results show that for low energy, the rigorous bounds increase with the increase in the energy of emitted particles. However, for high energy, the rigorous bounds decrease with the increase in the energy of emitted particles. When the black holes spin faster, the rigorous bounds decrease. For dimension dependence, the rigorous bounds also decrease with the increase in the number of extra dimensions. Furthermore, as comparison to the approximate transmission probability, the rigorous bound is proven to be useful.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ngampitipan, Tritos, E-mail: tritos.ngampitipan@gmail.com; Particle Physics Research Laboratory, Department of Physics, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330; Boonserm, Petarpa, E-mail: petarpa.boonserm@gmail.com
Hawking radiation is the evidence for the existence of black hole. What an observer can measure through Hawking radiation is the transmission probability. In the laboratory, miniature black holes can successfully be generated. The generated black holes are, most commonly, Myers-Perry black holes. In this paper, we will derive the rigorous bounds on the transmission probabilities for massless scalar fields of non-negative-angular-momentum modes emitted from a generated Myers-Perry black hole in six, seven, and eight dimensions. The results show that for low energy, the rigorous bounds increase with the increase in the energy of emitted particles. However, for high energy,more » the rigorous bounds decrease with the increase in the energy of emitted particles. When the black holes spin faster, the rigorous bounds decrease. For dimension dependence, the rigorous bounds also decrease with the increase in the number of extra dimensions. Furthermore, as comparison to the approximate transmission probability, the rigorous bound is proven to be useful.« less
Wang, Dawei; Ren, Pinyi; Du, Qinghe; Sun, Li; Wang, Yichen
2016-01-01
The rapid proliferation of independently-designed and -deployed wireless sensor networks extremely crowds the wireless spectrum and promotes the emergence of cognitive radio sensor networks (CRSN). In CRSN, the sensor node (SN) can make full use of the unutilized licensed spectrum, and the spectrum efficiency is greatly improved. However, inevitable spectrum sensing errors will adversely interfere with the primary transmission, which may result in primary transmission outage. To compensate the adverse effect of spectrum sensing errors, we propose a reciprocally-benefited secure transmission strategy, in which SN’s interference to the eavesdropper is employed to protect the primary confidential messages while the CRSN is also rewarded with a loose spectrum sensing error probability constraint. Specifically, according to the spectrum sensing results and primary users’ activities, there are four system states in this strategy. For each state, we analyze the primary secrecy rate and the SN’s transmission rate by taking into account the spectrum sensing errors. Then, the SN’s transmit power is optimally allocated for each state so that the average transmission rate of CRSN is maximized under the constraint of the primary maximum permitted secrecy outage probability. In addition, the performance tradeoff between the transmission rate of CRSN and the primary secrecy outage probability is investigated. Moreover, we analyze the primary secrecy rate for the asymptotic scenarios and derive the closed-form expression of the SN’s transmission outage probability. Simulation results show that: (1) the performance of the SN’s average throughput in the proposed strategy outperforms the conventional overlay strategy; (2) both the primary network and CRSN benefit from the proposed strategy. PMID:27897988
Romi, R; Boccolini, D; Menegon, M; Rezza, G
2012-11-29
We describe two cases of probable autochthonous introduced Plasmodium vivax malaria that occurred in 2009 and 2011 in two sites of South-Central Italy. Although the sources of the infections were not detected, local transmission could not be disproved and therefore the cases were classified as autochthonous. Sporadic P. vivax cases transmitted by indigenous vectors may be considered possible in some areas of the country where vector abundance and environmental conditions are favourable to malaria transmission.
NASA Astrophysics Data System (ADS)
Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.
2016-09-01
Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.
Effect of tornado loads on transmission lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishac, M.F.; White, H.B.
Of all the populated areas in Canada, southwestern Ontario has experienced the highest tornado incidence and faces the greatest tornado damage. About 1 or 2 tornadoes per 10,000 km{sup 2} can be expected there annually. The probability of a tornado strike at a given point is very small but the probability of a transmission line being crossed by a tornado is significant. The purpose of this paper is to review the literature related to tornadoes in Ontario and to investigate the effect of tornado loads on transmission lines. Based on this investigation a design basis tornado loading for transmission towersmore » is proposed.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stuyver, T.; Fias, S., E-mail: sfias@vub.ac.be; De Proft, F.
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based onmore » the atom-atom polarizability.« less
Effect of tornado loads on transmission lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishac, M.F.; White, H.B.
1994-12-31
Of all the populated areas in Canada, southwestern Ontario has experienced the highest tornado incidence and faces the greatest tornado damage. About 1 or 2 tornadoes per 10,000 km{sup 2} can be expected there annually. The probability of a tornado strike at a given point is very small but the probability of a transmission line being crossed by a tornado is significant. The purpose of this paper is to review the literature related to tornadoes in Ontario and to investigate the effect of tornado loads on transmission lines. Based on this investigation a design basis tornado loading for transmission towersmore » is proposed.« less
Canetta, S; Bolkan, S; Padilla-Coreano, N; Song, L J; Sahn, R; Harrison, N L; Gordon, J A; Brown, A; Kellendonk, C
2016-07-01
Abnormalities in prefrontal gamma aminobutyric acid (GABA)ergic transmission, particularly in fast-spiking interneurons that express parvalbumin (PV), are hypothesized to contribute to the pathophysiology of multiple psychiatric disorders, including schizophrenia, bipolar disorder, anxiety disorders and depression. While primarily histological abnormalities have been observed in patients and in animal models of psychiatric disease, evidence for abnormalities in functional neurotransmission at the level of specific interneuron populations has been lacking in animal models and is difficult to establish in human patients. Using an animal model of a psychiatric disease risk factor, prenatal maternal immune activation (MIA), we found reduced functional GABAergic transmission in the medial prefrontal cortex (mPFC) of adult MIA offspring. Decreased transmission was selective for interneurons expressing PV, resulted from a decrease in release probability and was not observed in calretinin-expressing neurons. This deficit in PV function in MIA offspring was associated with increased anxiety-like behavior and impairments in attentional set shifting, but did not affect working memory. Furthermore, cell-type specific optogenetic inhibition of mPFC PV interneurons was sufficient to impair attentional set shifting and enhance anxiety levels. Finally, we found that in vivo mPFC gamma oscillations, which are supported by PV interneuron function, were linearly correlated with the degree of anxiety displayed in adult mice, and that this correlation was disrupted in MIA offspring. These results demonstrate a selective functional vulnerability of PV interneurons to MIA, leading to affective and cognitive symptoms that have high relevance for schizophrenia and other psychiatric disorders.
Cross, Paul C.; Maichak, Eric J.; Rogerson, Jared D.; Irvine, Kathryn M.; Jones, Jennifer D; Heisey, Dennis M.; Edwards, William H.; Scurlock, Brandon M.
2015-01-01
Understanding the seasonal timing of disease transmission can lead to more effective control strategies, but the seasonality of transmission is often unknown for pathogens transmitted directly. We inserted vaginal implant transmitters (VITs) in 575 elk (Cervus elaphus canadensis) from 2006 to 2014 to assess when reproductive failures (i.e., abortions or still births) occur, which is the primary transmission route of Brucella abortus, the causative agent of brucellosis in the Greater Yellowstone Ecosystem. Using a survival analysis framework, we developed a Bayesian hierarchical model that simultaneously estimated the total baseline hazard of a reproductive event as well as its 2 mutually exclusive parts (abortions or live births). Approximately, 16% (95% CI = 0.10, 0.23) of the pregnant seropositive elk had reproductive failures, whereas 2% (95% CI = 0.01, 0.04) of the seronegative elk had probable abortions. Reproductive failures could have occurred as early as 13 February and as late as 10 July, peaking from March through May. Model results suggest that less than 5% of likely abortions occurred after 6 June each year and abortions were approximately 5 times more likely in March, April, or May compared to February or June. In western Wyoming, supplemental feeding of elk begins in December and ends during the peak of elk abortions and brucellosis transmission (i.e., Mar and Apr). Years with more snow may enhance elk-to-elk transmission on supplemental feeding areas because elk are artificially aggregated for the majority of the transmission season. Elk-to-cattle transmission will depend on the transmission period relative to the end of the supplemental feeding season, elk seroprevalence, population size, and the amount of commingling. Our statistical approach allowed us to estimate the probability density function of different event types over time, which may be applicable to other cause-specific survival analyses. It is often challenging to assess the cause of death, or in this case whether the reproductive event was an abortion or live birth. Accounting for uncertainty in the event type is an important future addition to our methodological approach.
Beyond statistical inference: A decision theory for science
KILLEEN, PETER R.
2008-01-01
Traditional null hypothesis significance testing does not yield the probability of the null or its alternative and, therefore, cannot logically ground scientific decisions. The decision theory proposed here calculates the expected utility of an effect on the basis of (1) the probability of replicating it and (2) a utility function on its size. It takes significance tests—which place all value on the replicability of an effect and none on its magnitude—as a special case, one in which the cost of a false positive is revealed to be an order of magnitude greater than the value of a true positive. More realistic utility functions credit both replicability and effect size, integrating them for a single index of merit. The analysis incorporates opportunity cost and is consistent with alternate measures of effect size, such as r2 and information transmission, and with Bayesian model selection criteria. An alternate formulation is functionally equivalent to the formal theory, transparent, and easy to compute. PMID:17201351
Beyond statistical inference: a decision theory for science.
Killeen, Peter R
2006-08-01
Traditional null hypothesis significance testing does not yield the probability of the null or its alternative and, therefore, cannot logically ground scientific decisions. The decision theory proposed here calculates the expected utility of an effect on the basis of (1) the probability of replicating it and (2) a utility function on its size. It takes significance tests--which place all value on the replicability of an effect and none on its magnitude--as a special case, one in which the cost of a false positive is revealed to be an order of magnitude greater than the value of a true positive. More realistic utility functions credit both replicability and effect size, integrating them for a single index of merit. The analysis incorporates opportunity cost and is consistent with alternate measures of effect size, such as r2 and information transmission, and with Bayesian model selection criteria. An alternate formulation is functionally equivalent to the formal theory, transparent, and easy to compute.
Saviane, Chiara; Silver, R Angus
2006-06-15
Synapses play a crucial role in information processing in the brain. Amplitude fluctuations of synaptic responses can be used to extract information about the mechanisms underlying synaptic transmission and its modulation. In particular, multiple-probability fluctuation analysis can be used to estimate the number of functional release sites, the mean probability of release and the amplitude of the mean quantal response from fits of the relationship between the variance and mean amplitude of postsynaptic responses, recorded at different probabilities. To determine these quantal parameters, calculate their uncertainties and the goodness-of-fit of the model, it is important to weight the contribution of each data point in the fitting procedure. We therefore investigated the errors associated with measuring the variance by determining the best estimators of the variance of the variance and have used simulations of synaptic transmission to test their accuracy and reliability under different experimental conditions. For central synapses, which generally have a low number of release sites, the amplitude distribution of synaptic responses is not normal, thus the use of a theoretical variance of the variance based on the normal assumption is not a good approximation. However, appropriate estimators can be derived for the population and for limited sample sizes using a more general expression that involves higher moments and introducing unbiased estimators based on the h-statistics. Our results are likely to be relevant for various applications of fluctuation analysis when few channels or release sites are present.
Isotope analysis in the transmission electron microscope.
Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani
2016-10-10
The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.
Hydraulic characteristics of, and ground-water flow in, coal-bearing rocks of southwestern Virginia
Harlow, George E.; LeCain, Gary D.
1993-01-01
This report presents the results of a study by the U.S Geological Survey, in cooperation with the Virginia Department of Mines, Minerals, and Energy, Division of Mined Land Reclamation, and the Powell River Project, to describe the hydraulic characteristics of major water-bearing zones in the coal-bearing rocks of southwestern Virginia and to develop a conceptual model of the ground-water-flow system. Aquifer testing in1987 and 1988 of 9-ft intervals in coal-exploration coreholes indicates that transmissivity decreases with increasing depth. Most rock types are permeable to a depth of approximately 100 ft; however, only coal seams are consistently permeable (transmissivity greater than 0.001 ft/d) at depths greater than 200 ft . Constant-head injection testing of rock intervals adjacent to coal seams usually indicated lower values of transmissivity than those values obtained when coal seams were isolated within the test interval; thus, large values of horizontal hydraulic conductivity at depth are associated with coal seams. Potentiometric-head measurements indicate that high topographic areas (ridges) function as recharge areas; water infiltrates through the surface, percolates into regolith, and flows downward and laterally through fractures in the shallow bedrock. Hydraulic conductivity decreases with increasing depth, and ground water flows primarily in the lateral direction along fractures or bedding planes or through coal seams. If vertical hydraulic conductivity is negligible, ground water continues to flow laterally, discharging as springs or seeps on hill slopes. Where vertical hydraulic conductivity is appreciable, groundwater follows a stair step path through the regolith, fractures, bedding planes, and coal seams, discharging to streams and (or) recharging coal seams at depth. Permeable coal seams probably underlie valleys in the region; however, aquifer-test data indicate that the horizontal hydraulic conductivity of coal is a function of depth and probably decreases under ridges because of increased overburden pressures. Ground water beneath valleys that does not discharge to streams probably flows down gradient as underflow beneath the streams. Topographic relief in the area provides large hydraulic-head differences (greater than 300 ft in some instances) for the ground-water-flow system. Transmissivity data from the range of depths tested during this study indicate that most ground-water flow takes place at moderate depths (less than 300 ft) and that little deep regional ground-water flow occurs.
Estimating transmission probability in schools for the 2009 H1N1 influenza pandemic in Italy.
Clamer, Valentina; Dorigatti, Ilaria; Fumanelli, Laura; Rizzo, Caterina; Pugliese, Andrea
2016-10-12
Epidemic models are being extensively used to understand the main pathways of spread of infectious diseases, and thus to assess control methods. Schools are well known to represent hot spots for epidemic spread; hence, understanding typical patterns of infection transmission within schools is crucial for designing adequate control strategies. The attention that was given to the 2009 A/H1N1pdm09 flu pandemic has made it possible to collect detailed data on the occurrence of influenza-like illness (ILI) symptoms in two primary schools of Trento, Italy. The data collected in the two schools were used to calibrate a discrete-time SIR model, which was designed to estimate the probabilities of influenza transmission within the classes, grades and schools using Markov Chain Monte Carlo (MCMC) methods. We found that the virus was mainly transmitted within class, with lower levels of transmission between students in the same grade and even lower, though not significantly so, among different grades within the schools. We estimated median values of R 0 from the epidemic curves in the two schools of 1.16 and 1.40; on the other hand, we estimated the average number of students infected by the first school case to be 0.85 and 1.09 in the two schools. The discrepancy between the values of R 0 estimated from the epidemic curve or from the within-school transmission probabilities suggests that household and community transmission played an important role in sustaining the school epidemics. The high probability of infection between students in the same class confirms that targeting within-class transmission is key to controlling the spread of influenza in school settings and, as a consequence, in the general population.
The myth of maternal transmission of spongiform encephalopathy.
Ridley, R. M.; Baker, H. F.
1995-01-01
It has long been accepted that the pattern of occurrence of scrapie--the form of spongiform encephalopathy associated with sheep--is determined mainly by maternal transmission, and this view has had a profound influence on policy decisions in the control of bovine spongiform encephalopathy and on public concern over the risk to human health form this disease. The occurrence of maternal transmission is, however, not predicted by modern knowledge of the aetiology of spongiform encephalopathy, and even though claims of maternal transmission have been reiterated frequently in the literature, re-examination of the source data reveals that these data are extremely scanty, unreplicated, and probably subject to ascertainment bias. The probability of maternal transmission of spongiform encephalopathy in any species should be viewed with the greatest scepticism. Images p1073-a PMID:7580668
Probable Tiger-to-Tiger Transmission of Avian Influenza H5N1
Thanawongnuwech, Roongroje; Amonsin, Alongkorn; Tantilertcharoen, Rachod; Damrongwatanapokin, Sudarat; Theamboonlers, Apiradee; Payungporn, Sunchai; Nanthapornphiphat, Kamonchart; Ratanamungklanon, Somchuan; Tunak, Eakchai; Songserm, Thaweesak; Vivatthanavanich, Veravit; Lekdumrongsak, Thawat; Kesdangsakonwut, Sawang; Tunhikorn, Schwann
2005-01-01
During the second outbreak of avian influenza H5N1 in Thailand, probable horizontal transmission among tigers was demonstrated in the tiger zoo. Sequencing and phylogenetic analysis of those viruses showed no differences from the first isolate obtained in January 2004. This finding has implications for influenza virus epidemiology and pathogenicity in mammals. PMID:15890122
Conduction of molecular electronic devices: qualitative insights through atom-atom polarizabilities.
Stuyver, T; Fias, S; De Proft, F; Fowler, P W; Geerlings, P
2015-03-07
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based on the atom-atom polarizability.
Electrostatic and magnetic fields in bilayer graphene
NASA Astrophysics Data System (ADS)
Jellal, Ahmed; Redouani, Ilham; Bahlouli, Hocine
2015-08-01
We compute the transmission probability through rectangular potential barriers and p-n junctions in the presence of a magnetic and electric fields in bilayer graphene taking into account contributions from the full four bands of the energy spectrum. For energy E higher than the interlayer coupling γ1 (E >γ1) two propagation modes are available for transport giving rise to four possible ways for transmission and reflection coefficients. However, when the energy is less than the height of the barrier the Dirac fermions exhibit transmission resonances and only one mode of propagation is available for transport. We study the effect of the interlayer electrostatic potential denoted by δ and variations of different barrier geometry parameters on the transmission probability.
NASA Astrophysics Data System (ADS)
Blazejewski, Jacob; Schultz, Chase; Mazzuca, James
2015-03-01
Many biological systems utilize water chains to transfer charge over long distances by means of an excess proton. This study examines how quantum effects impact these reactions in a small model system. The model consists of a water molecule situated between an imidazole donor and acceptor group, which simulate a fixed amino acid backbone. A one dimensional energy profile is evaluated using density functional theory at the 6-31G*/B3LYP level, which generates a barrier with a width of 0.6 Å and a height of 20.7 kcal/mol. Quantum transmission probability is evaluated by solving the time dependent Schrödinger equation on a grid. Isotopic effects are examined by performing calculations with both hydrogen and deuterium. The ratio of hydrogen over the deuterium shows a 130-fold increase in transmission probability at low temperatures. This indicates a substantial quantum tunneling effect. The study of higher dimensional systems as well as increasing the number of water molecules in the chain will be necessary to fully describe the proton transfer process. Alma College Provost's Office.
Moretti, David; Thomas, Len; Marques, Tiago; Harwood, John; Dilley, Ashley; Neales, Bert; Shaffer, Jessica; McCarthy, Elena; New, Leslie; Jarvis, Susan; Morrissey, Ronald
2014-01-01
There is increasing concern about the potential effects of noise pollution on marine life in the world's oceans. For marine mammals, anthropogenic sounds may cause behavioral disruption, and this can be quantified using a risk function that relates sound exposure to a measured behavioral response. Beaked whales are a taxon of deep diving whales that may be particularly susceptible to naval sonar as the species has been associated with sonar-related mass stranding events. Here we derive the first empirical risk function for Blainville's beaked whales (Mesoplodon densirostris) by combining in situ data from passive acoustic monitoring of animal vocalizations and navy sonar operations with precise ship tracks and sound field modeling. The hydrophone array at the Atlantic Undersea Test and Evaluation Center, Bahamas, was used to locate vocalizing groups of Blainville's beaked whales and identify sonar transmissions before, during, and after Mid-Frequency Active (MFA) sonar operations. Sonar transmission times and source levels were combined with ship tracks using a sound propagation model to estimate the received level (RL) at each hydrophone. A generalized additive model was fitted to data to model the presence or absence of the start of foraging dives in 30-minute periods as a function of the corresponding sonar RL at the hydrophone closest to the center of each group. This model was then used to construct a risk function that can be used to estimate the probability of a behavioral change (cessation of foraging) the individual members of a Blainville's beaked whale population might experience as a function of sonar RL. The function predicts a 0.5 probability of disturbance at a RL of 150 dBrms re µPa (CI: 144 to 155) This is 15dB lower than the level used historically by the US Navy in their risk assessments but 10 dB higher than the current 140 dB step-function.
Moretti, David; Thomas, Len; Marques, Tiago; Harwood, John; Dilley, Ashley; Neales, Bert; Shaffer, Jessica; McCarthy, Elena; New, Leslie; Jarvis, Susan; Morrissey, Ronald
2014-01-01
There is increasing concern about the potential effects of noise pollution on marine life in the world’s oceans. For marine mammals, anthropogenic sounds may cause behavioral disruption, and this can be quantified using a risk function that relates sound exposure to a measured behavioral response. Beaked whales are a taxon of deep diving whales that may be particularly susceptible to naval sonar as the species has been associated with sonar-related mass stranding events. Here we derive the first empirical risk function for Blainville’s beaked whales (Mesoplodon densirostris) by combining in situ data from passive acoustic monitoring of animal vocalizations and navy sonar operations with precise ship tracks and sound field modeling. The hydrophone array at the Atlantic Undersea Test and Evaluation Center, Bahamas, was used to locate vocalizing groups of Blainville’s beaked whales and identify sonar transmissions before, during, and after Mid-Frequency Active (MFA) sonar operations. Sonar transmission times and source levels were combined with ship tracks using a sound propagation model to estimate the received level (RL) at each hydrophone. A generalized additive model was fitted to data to model the presence or absence of the start of foraging dives in 30-minute periods as a function of the corresponding sonar RL at the hydrophone closest to the center of each group. This model was then used to construct a risk function that can be used to estimate the probability of a behavioral change (cessation of foraging) the individual members of a Blainville’s beaked whale population might experience as a function of sonar RL. The function predicts a 0.5 probability of disturbance at a RL of 150dBrms re µPa (CI: 144 to 155) This is 15dB lower than the level used historically by the US Navy in their risk assessments but 10 dB higher than the current 140 dB step-function. PMID:24465477
NASA Astrophysics Data System (ADS)
Siettos, Constantinos I.; Anastassopoulou, Cleo; Russo, Lucia; Grigoras, Christos; Mylonakis, Eleftherios
2016-06-01
Based on multiscale agent-based computations we estimated the per-contact probability of transmission by age of the Ebola virus disease (EVD) that swept through Liberia from May 2014 to March 2015. For the approximation of the epidemic dynamics we have developed a detailed agent-based model with small-world interactions between individuals categorized by age. For the estimation of the structure of the evolving contact network as well as the per-contact transmission probabilities by age group we exploited the so called Equation-Free framework. Model parameters were fitted to official case counts reported by the World Health Organization (WHO) as well as to recently published data of key epidemiological variables, such as the mean time to death, recovery and the case fatality rate.
Wang, Xiao-Sheng; Peng, Chun-Zi; Cai, Wei-Jun; Xia, Jian; Jin, Daozhong; Dai, Yuqiao; Luo, Xue-Gang; Klyachko, Vitaly A.; Deng, Pan-Yue
2014-01-01
Transcriptional silencing of the Fmr1 gene encoding fragile X mental retardation protein (FMRP) causes Fragile X Syndrome (FXS), the most common form of inherited intellectual disability and the leading genetic cause of autism. FMRP has been suggested to play important roles in regulating neurotransmission and short-term synaptic plasticity at excitatory hippocampal and cortical synapses. However, the origins and the mechanisms of these FMRP actions remain incompletely understood, and the role of FMRP in regulating synaptic release probability and presynaptic function remains debated. Here we used variance-mean analysis and peak scaled nonstationary variance analysis to examine changes in both pre- and postsynaptic parameters during repetitive activity at excitatory CA3-CA1 hippocampal synapses in a mouse model of FXS. Our analyses revealed that loss of FMRP did not affect the basal release probability or basal synaptic transmission, but caused an abnormally elevated release probability specifically during repetitive activity. These abnormalities were not accompanied by changes in EPSC kinetics, quantal size or postsynaptic AMPA receptor conductance. Our results thus indicate that FMRP regulates neurotransmission at excitatory hippocampal synapses specifically during repetitive activity via modulation of release probability in a presynaptic manner. Our study suggests that FMRP function in regulating neurotransmitter release is an activity-dependent phenomenon that may contribute to the pathophysiology of FXS. PMID:24646437
Syphilis transmission: a review of the current evidence
Stoltey, Juliet E.; Cohen, Stephanie E.
2018-01-01
Syphilis remains widespread worldwide, with increasing rates among men who have sex with men. This paper reviews available evidence regarding syphilis transmission, including data on: sexual transmission (transmission probability per sexual partnership), vertical transmission, transmission via blood products and organ donation, and other rare modes of transmission. In addition, host susceptibility to syphilis infection is discussed. Syphilis screening and treatment, condoms and risk-reduction counselling and how they modify syphilis transmission dynamics are considered. PMID:25702043
NASA Astrophysics Data System (ADS)
Leray, S.; De Dreuzy, J.; Aquilina, L.; Labasque, T.; Bour, O.
2011-12-01
While groundwater age data have been classically used to determine aquifer hydraulic properties such as recharge and/or porosity, we show here that they contain more valuable information on aquifer structure in complex hard rock contexts. Our numerical modeling study is based on the developed crystalline aquifer of Ploemeur (Brittany, France) characterized by two transmissive structures: the interface between an intruding granite and overlying micaschists dipping moderately to the North and a steeply dipping fault striking North 20. We explore the definition and evolution of the supplying volume to the pumping well of the Ploemeur medium under steady-state conditions. We first show that, with the help of general observations on the site, hydraulic data, such as piezometric levels or transmissivity derived from pumping tests, can be used to refine recharge spatial distribution and rate and bulk aquifer transmissivity. We then model the effect of aquifer porosity and thickness on environmental tracer concentrations. Porosity gives the range of the mean residence time, shifting the probability density function of residence times along the time axis whereas aquifer thickness affects the shape of the residence times distribution. It also modifies the mean concentration of CFCs taken as the convolution product of the atmospheric tracer concentration with the probability density function of residence times. Because porosity may be estimated by petrologic and gravimetric investigations, the thickness of the aquifer can be advantageously constrained by groundwater ages and then compared to other results from inversion of geophysical data. More generally, we advocate using groundwater age data at the aquifer discharge locations to constrain complex aquifer structures when recharge and porosity can be fixed by other means.
Nouvellet, Pierre; Dumonteil, Eric; Gourbière, Sébastien
2013-11-01
Chagas disease has a major impact on human health in Latin America and is becoming of global concern due to international migrations. Trypanosoma cruzi, the etiological agent of the disease, is one of the rare human parasites transmitted by the feces of its vector, as it is unable to reach the salivary gland of the insect. This stercorarian transmission is notoriously poorly understood, despite its crucial role in the ecology and evolution of the pathogen and the disease. The objective of this study was to quantify the probability of T. cruzi vectorial transmission to humans, and to use such an estimate to predict human prevalence from entomological data. We developed several models of T. cruzi transmission to estimate the probability of transmission from vector to host. Using datasets from the literature, we estimated the probability of transmission per contact with an infected triatomine to be 5.8 × 10(-4) (95%CI: [2.6 ; 11.0] × 10(-4)). This estimate was consistent across triatomine species, robust to variations in other parameters, and corresponded to 900-4,000 contacts per case. Our models subsequently allowed predicting human prevalence from vector abundance and infection rate in 7/10 independent datasets covering various triatomine species and epidemiological situations. This low probability of T. cruzi transmission reflected well the complex and unlikely mechanism of transmission via insect feces, and allowed predicting human prevalence from basic entomological data. Although a proof of principle study would now be valuable to validate our models' predictive ability in an even broader range of entomological and ecological settings, our quantitative estimate could allow switching the evaluation of disease risk and vector control program from purely entomological indexes to parasitological measures, as commonly done for other major vector borne diseases. This might lead to different quantitative perspectives as these indexes are well known not to be proportional one to another.
An economic evaluation of home management of malaria in Uganda: an interactive Markov model.
Lubell, Yoel; Mills, Anne J; Whitty, Christopher J M; Staedke, Sarah G
2010-08-27
Home management of malaria (HMM), promoting presumptive treatment of febrile children in the community, is advocated to improve prompt appropriate treatment of malaria in Africa. The cost-effectiveness of HMM is likely to vary widely in different settings and with the antimalarial drugs used. However, no data on the cost-effectiveness of HMM programmes are available. A Markov model was constructed to estimate the cost-effectiveness of HMM as compared to conventional care for febrile illnesses in children without HMM. The model was populated with data from Uganda, but is designed to be interactive, allowing the user to adjust certain parameters, including the antimalarials distributed. The model calculates the cost per disability adjusted life year averted and presents the incremental cost-effectiveness ratio compared to a threshold value. Model output is stratified by level of malaria transmission and the probability that a child would receive appropriate care from a health facility, to indicate the circumstances in which HMM is likely to be cost-effective. The model output suggests that the cost-effectiveness of HMM varies with malaria transmission, the probability of appropriate care, and the drug distributed. Where transmission is high and the probability of appropriate care is limited, HMM is likely to be cost-effective from a provider perspective. Even with the most effective antimalarials, HMM remains an attractive intervention only in areas of high malaria transmission and in medium transmission areas with a lower probability of appropriate care. HMM is generally not cost-effective in low transmission areas, regardless of which antimalarial is distributed. Considering the analysis from the societal perspective decreases the attractiveness of HMM. Syndromic HMM for children with fever may be a useful strategy for higher transmission settings with limited health care and diagnosis, but is not appropriate for all settings. HMM may need to be tailored to specific settings, accounting for local malaria transmission intensity and availability of health services.
Nouvellet, Pierre; Dumonteil, Eric; Gourbière, Sébastien
2013-01-01
Chagas disease has a major impact on human health in Latin America and is becoming of global concern due to international migrations. Trypanosoma cruzi, the etiological agent of the disease, is one of the rare human parasites transmitted by the feces of its vector, as it is unable to reach the salivary gland of the insect. This stercorarian transmission is notoriously poorly understood, despite its crucial role in the ecology and evolution of the pathogen and the disease. The objective of this study was to quantify the probability of T. cruzi vectorial transmission to humans, and to use such an estimate to predict human prevalence from entomological data. We developed several models of T. cruzi transmission to estimate the probability of transmission from vector to host. Using datasets from the literature, we estimated the probability of transmission per contact with an infected triatomine to be 5.8×10−4 (95%CI: [2.6 ; 11.0]×10−4). This estimate was consistent across triatomine species, robust to variations in other parameters, and corresponded to 900–4,000 contacts per case. Our models subsequently allowed predicting human prevalence from vector abundance and infection rate in 7/10 independent datasets covering various triatomine species and epidemiological situations. This low probability of T. cruzi transmission reflected well the complex and unlikely mechanism of transmission via insect feces, and allowed predicting human prevalence from basic entomological data. Although a proof of principle study would now be valuable to validate our models' predictive ability in an even broader range of entomological and ecological settings, our quantitative estimate could allow switching the evaluation of disease risk and vector control program from purely entomological indexes to parasitological measures, as commonly done for other major vector borne diseases. This might lead to different quantitative perspectives as these indexes are well known not to be proportional one to another. PMID:24244766
State-space modeling to support management of brucellosis in the Yellowstone bison population
Hobbs, N. Thompson; Geremia, Chris; Treanor, John; Wallen, Rick; White, P.J.; Hooten, Mevin B.; Rhyan, Jack C.
2015-01-01
The bison (Bison bison) of the Yellowstone ecosystem, USA, exemplify the difficulty of conserving large mammals that migrate across the boundaries of conservation areas. Bison are infected with brucellosis (Brucella abortus) and their seasonal movements can expose livestock to infection. Yellowstone National Park has embarked on a program of adaptive management of bison, which requires a model that assimilates data to support management decisions. We constructed a Bayesian state-space model to reveal the influence of brucellosis on the Yellowstone bison population. A frequency-dependent model of brucellosis transmission was superior to a density-dependent model in predicting out-of-sample observations of horizontal transmission probability. A mixture model including both transmission mechanisms converged on frequency dependence. Conditional on the frequency-dependent model, brucellosis median transmission rate was 1.87 yr−1. The median of the posterior distribution of the basic reproductive ratio (R0) was 1.75. Seroprevalence of adult females varied around 60% over two decades, but only 9.6 of 100 adult females were infectious. Brucellosis depressed recruitment; estimated population growth rate λ averaged 1.07 for an infected population and 1.11 for a healthy population. We used five-year forecasting to evaluate the ability of different actions to meet management goals relative to no action. Annually removing 200 seropositive female bison increased by 30-fold the probability of reducing seroprevalence below 40% and increased by a factor of 120 the probability of achieving a 50% reduction in transmission probability relative to no action. Annually vaccinating 200 seronegative animals increased the likelihood of a 50% reduction in transmission probability by fivefold over no action. However, including uncertainty in the ability to implement management by representing stochastic variation in the number of accessible bison dramatically reduced the probability of achieving goals using interventions relative to no action. Because the width of the posterior predictive distributions of future population states expands rapidly with increases in the forecast horizon, managers must accept high levels of uncertainty. These findings emphasize the necessity of iterative, adaptive management with relatively short-term commitment to action and frequent reevaluation in response to new data and model forecasts. We believe our approach has broad applications.
NASA Astrophysics Data System (ADS)
El-Wakil, S. A.; Sallah, M.; El-Hanbaly, A. M.
2015-10-01
The stochastic radiative transfer problem is studied in a participating planar finite continuously fluctuating medium. The problem is considered for specular- and diffusly-reflecting boundaries with linear anisotropic scattering. Random variable transformation (RVT) technique is used to get the complete average for the solution functions, that are represented by the probability-density function (PDF) of the solution process. In the RVT algorithm, a simple integral transformation to the input stochastic process (the extinction function of the medium) is applied. This linear transformation enables us to rewrite the stochastic transport equations in terms of the optical random variable (x) and the optical random thickness (L). Then the transport equation is solved deterministically to get a closed form for the solution as a function of x and L. So, the solution is used to obtain the PDF of the solution functions applying the RVT technique among the input random variable (L) and the output process (the solution functions). The obtained averages of the solution functions are used to get the complete analytical averages for some interesting physical quantities, namely, reflectivity and transmissivity at the medium boundaries. In terms of the average reflectivity and transmissivity, the average of the partial heat fluxes for the generalized problem with internal source of radiation are obtained and represented graphically.
Transmission of Actinobacillus pleuropneumoniae among weaned piglets on endemically infected farms.
Tobias, T J; Bouma, A; van den Broek, J; van Nes, A; Daemen, A J J M; Wagenaar, J A; Stegeman, J A; Klinkenberg, D
2014-11-01
Clinical outbreaks due to Actinobacillus pleuropneumoniae occur recurrently, despite the wide-scale use of antimicrobials or vaccination. Therefore, new approaches for the prevention and control of these outbreaks are necessary. For the development of alternative measures, more insight into the transmission of the bacterium on farms is necessary. The aim of this cohort study was to quantify transmission of A. pleuropneumoniae amongst weaned piglets on farms. We investigated three possible transmission routes: (i) indirect transmission by infected piglets within the same compartment, (ii) transmission by infected pigs in adjacent pens and (iii) transmission by direct contact within pens. Additionally, we evaluated the effect of independent litter characteristics on the probability of infection. Two farms participated in our study. Serum and tonsil brush samples were collected from sows pre-farrowing. Serum was analysed for antibodies against Apx toxins and Omp. Subsequently, tonsil brush samples were collected from all piglets from these dams (N=542) in three cohorts, 3 days before weaning and 6 weeks later. Tonsil samples were analysed by qPCR for the presence of the apxIVA gene of A. pleuropneumoniae. Before weaning, 25% of the piglets tested positive; 6 weeks later 47% tested positive. Regression and stochastic transmission models were used to assess the contribution of each of the three transmission routes and to estimate transmission rates. Transmission between piglets in adjacent pens did not differ significantly from that between non-adjacent pens. The transmission rate across pens was estimated to be 0.0058 day(-1) (95% CI: 0.0030-0.010), whereas the transmission rate within pens was ten times higher 0.059 day(-1) (95% CI: 0.048-0.072). Subsequently, the effects of parity and serological response of the dam and litter age at weaning on the probability of infection of pigs were evaluated by including these into the regression model. A higher dam ApxII antibody level was associated with a lower probability of infection of the pig after weaning; age at weaning was associated with a higher probability of infection of the pig after weaning. Finally, transmission rate estimates were used in a scenario study in which the litters within a compartment were mixed across pens at weaning instead of raising litter mates together in a pen. The results showed that the proportion of infected piglets increased to 69% if litters were mixed at weaning, indicating that farm management measures may affect spread of A. pleuropneumoniae. Copyright © 2014 Elsevier B.V. All rights reserved.
System life and reliability modeling for helicopter transmissions
NASA Technical Reports Server (NTRS)
Savage, M.; Brikmanis, C. K.
1986-01-01
A computer program which simulates life and reliability of helicopter transmissions is presented. The helicopter transmissions may be composed of spiral bevel gear units and planetary gear units - alone, in series or in parallel. The spiral bevel gear units may have either single or dual input pinions, which are identical. The planetary gear units may be stepped or unstepped and the number of planet gears carried by the planet arm may be varied. The reliability analysis used in the program is based on the Weibull distribution lives of the transmission components. The computer calculates the system lives and dynamic capacities of the transmission components and the transmission. The system life is defined as the life of the component or transmission at an output torque at which the probability of survival is 90 percent. The dynamic capacity of a component or transmission is defined as the output torque which can be applied for one million output shaft cycles for a probability of survival of 90 percent. A complete summary of the life and dynamic capacity results is produced by the program.
Atom-counting in High Resolution Electron Microscopy:TEM or STEM - That's the question.
Gonnissen, J; De Backer, A; den Dekker, A J; Sijbers, J; Van Aert, S
2017-03-01
In this work, a recently developed quantitative approach based on the principles of detection theory is used in order to determine the possibilities and limitations of High Resolution Scanning Transmission Electron Microscopy (HR STEM) and HR TEM for atom-counting. So far, HR STEM has been shown to be an appropriate imaging mode to count the number of atoms in a projected atomic column. Recently, it has been demonstrated that HR TEM, when using negative spherical aberration imaging, is suitable for atom-counting as well. The capabilities of both imaging techniques are investigated and compared using the probability of error as a criterion. It is shown that for the same incoming electron dose, HR STEM outperforms HR TEM under common practice standards, i.e. when the decision is based on the probability function of the peak intensities in HR TEM and of the scattering cross-sections in HR STEM. If the atom-counting decision is based on the joint probability function of the image pixel values, the dependence of all image pixel intensities as a function of thickness should be known accurately. Under this assumption, the probability of error may decrease significantly for atom-counting in HR TEM and may, in theory, become lower as compared to HR STEM under the predicted optimal experimental settings. However, the commonly used standard for atom-counting in HR STEM leads to a high performance and has been shown to work in practice. Copyright © 2017 Elsevier B.V. All rights reserved.
Understanding disease mechanisms with models of signaling pathway activities.
Sebastian-Leon, Patricia; Vidal, Enrique; Minguez, Pablo; Conesa, Ana; Tarazona, Sonia; Amadoz, Alicia; Armero, Carmen; Salavert, Francisco; Vidal-Puig, Antonio; Montaner, David; Dopazo, Joaquín
2014-10-25
Understanding the aspects of the cell functionality that account for disease or drug action mechanisms is one of the main challenges in the analysis of genomic data and is on the basis of the future implementation of precision medicine. Here we propose a simple probabilistic model in which signaling pathways are separated into elementary sub-pathways or signal transmission circuits (which ultimately trigger cell functions) and then transforms gene expression measurements into probabilities of activation of such signal transmission circuits. Using this model, differential activation of such circuits between biological conditions can be estimated. Thus, circuit activation statuses can be interpreted as biomarkers that discriminate among the compared conditions. This type of mechanism-based biomarkers accounts for cell functional activities and can easily be associated to disease or drug action mechanisms. The accuracy of the proposed model is demonstrated with simulations and real datasets. The proposed model provides detailed information that enables the interpretation disease mechanisms as a consequence of the complex combinations of altered gene expression values. Moreover, it offers a framework for suggesting possible ways of therapeutic intervention in a pathologically perturbed system.
Household Transmission of Clostridium difficile to Family Members and Domestic Pets.
Loo, Vivian G; Brassard, Paul; Miller, Mark A
2016-11-01
OBJECTIVE To determine the risk of Clostridium difficile transmission from index cases with C. difficile infection (CDI) to their household contacts and domestic pets. DESIGN A prospective study from April 2011 to June 2013. SETTING Patients with CDI from Canadian tertiary care centers. PARTICIPANTS Patients with CDI, their household human contacts, and pets. METHODS Epidemiologic information and stool or rectal swabs were collected from participants at enrollment and monthly for up to 4 months. Pulsed-field gel electrophoresis (PFGE) was performed on C. difficile isolates. Probable transmission was defined as the conversion of a C. difficile culture-negative contact to C. difficile culture-positive contact with a PFGE pattern indistinguishable or closely related to the index case. Possible transmission was defined as a contact with a positive C. difficile culture at baseline with a strain indistinguishable or closely related to the index case. RESULTS A total of 51 patients with CDI participated in this study; 67 human contacts and 15 pet contacts were included. Overall, 9 human contacts (13.4%) were C. difficile culture positive; 1 contact (1.5%) developed CDI; and 8 contacts were asymptomatic. Of 67 human contacts, probable transmission occurred in 1 human contact (1.5%) and possible transmission occurred in 5 human contacts (7.5%). Of 15 pet contacts, probable transmission occurred in 3 (20%) and possible transmission occurred in 1 (6.7%). CONCLUSIONS There was a high proportion of C. difficile culture positivity at 13.4% among human contacts and asymptomatic carriage of domestic pets reached 26.7%. These results suggest that household transmission of C. difficile may be a source of community-associated cases. Infect Control Hosp Epidemiol 2016;1-7.
Synaptic transmission and the susceptibility of HIV infection to anti-viral drugs
NASA Astrophysics Data System (ADS)
Komarova, Natalia L.; Levy, David N.; Wodarz, Dominik
2013-07-01
Cell-to-cell viral transmission via virological synapses has been argued to reduce susceptibility of the virus population to anti-viral drugs through multiple infection of cells, contributing to low-level viral persistence during therapy. Using a mathematical framework, we examine the role of synaptic transmission in treatment susceptibility. A key factor is the relative probability of individual virions to infect a cell during free-virus and synaptic transmission, a currently unknown quantity. If this infection probability is higher for free-virus transmission, then treatment susceptibility is lowest if one virus is transferred per synapse, and multiple infection of cells increases susceptibility. In the opposite case, treatment susceptibility is minimized for an intermediate number of virions transferred per synapse. Hence, multiple infection via synapses does not simply lower treatment susceptibility. Without further experimental investigations, one cannot conclude that synaptic transmission provides an additional mechanism for the virus to persist at low levels during anti-viral therapy.
NASA Astrophysics Data System (ADS)
Walker, Ernest L.
1994-05-01
This paper presents results of a theoretical investigation to evaluate the performance of code division multiple access communications over multimode optical fiber channels in an asynchronous, multiuser communication network environment. The system is evaluated using Gold sequences for spectral spreading of the baseband signal from each user employing direct-sequence biphase shift keying and intensity modulation techniques. The transmission channel model employed is a lossless linear system approximation of the field transfer function for the alpha -profile multimode optical fiber. Due to channel model complexity, a correlation receiver model employing a suboptimal receive filter was used in calculating the peak output signal at the ith receiver. In Part 1, the performance measures for the system, i.e., signal-to-noise ratio and bit error probability for the ith receiver, are derived as functions of channel characteristics, spectral spreading, number of active users, and the bit energy to noise (white) spectral density ratio. In Part 2, the overall system performance is evaluated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bezák, Viktor, E-mail: bezak@fmph.uniba.sk
Quantum theory of the non-harmonic oscillator defined by the energy operator proposed by Yurke and Buks (2006) is presented. Although these authors considered a specific problem related to a model of transmission lines in a Kerr medium, our ambition is not to discuss the physical substantiation of their model. Instead, we consider the problem from an abstract, logically deductive, viewpoint. Using the Yurke–Buks energy operator, we focus attention on the imaginary-time propagator. We derive it as a functional of the Mehler kernel and, alternatively, as an exact series involving Hermite polynomials. For a statistical ensemble of identical oscillators defined bymore » the Yurke–Buks energy operator, we calculate the partition function, average energy, free energy and entropy. Using the diagonal element of the canonical density matrix of this ensemble in the coordinate representation, we define a probability density, which appears to be a deformed Gaussian distribution. A peculiarity of this probability density is that it may reveal, when plotted as a function of the position variable, a shape with two peaks located symmetrically with respect to the central point.« less
Gomez-Lazaro, Emilio; Bueso, Maria C.; Kessler, Mathieu; ...
2016-02-02
Here, the Weibull probability distribution has been widely applied to characterize wind speeds for wind energy resources. Wind power generation modeling is different, however, due in particular to power curve limitations, wind turbine control methods, and transmission system operation requirements. These differences are even greater for aggregated wind power generation in power systems with high wind penetration. Consequently, models based on one-Weibull component can provide poor characterizations for aggregated wind power generation. With this aim, the present paper focuses on discussing Weibull mixtures to characterize the probability density function (PDF) for aggregated wind power generation. PDFs of wind power datamore » are firstly classified attending to hourly and seasonal patterns. The selection of the number of components in the mixture is analyzed through two well-known different criteria: the Akaike information criterion (AIC) and the Bayesian information criterion (BIC). Finally, the optimal number of Weibull components for maximum likelihood is explored for the defined patterns, including the estimated weight, scale, and shape parameters. Results show that multi-Weibull models are more suitable to characterize aggregated wind power data due to the impact of distributed generation, variety of wind speed values and wind power curtailment.« less
Cetacean population density estimation from single fixed sensors using passive acoustics.
Küsel, Elizabeth T; Mellinger, David K; Thomas, Len; Marques, Tiago A; Moretti, David; Ward, Jessica
2011-06-01
Passive acoustic methods are increasingly being used to estimate animal population density. Most density estimation methods are based on estimates of the probability of detecting calls as functions of distance. Typically these are obtained using receivers capable of localizing calls or from studies of tagged animals. However, both approaches are expensive to implement. The approach described here uses a MonteCarlo model to estimate the probability of detecting calls from single sensors. The passive sonar equation is used to predict signal-to-noise ratios (SNRs) of received clicks, which are then combined with a detector characterization that predicts probability of detection as a function of SNR. Input distributions for source level, beam pattern, and whale depth are obtained from the literature. Acoustic propagation modeling is used to estimate transmission loss. Other inputs for density estimation are call rate, obtained from the literature, and false positive rate, obtained from manual analysis of a data sample. The method is applied to estimate density of Blainville's beaked whales over a 6-day period around a single hydrophone located in the Tongue of the Ocean, Bahamas. Results are consistent with those from previous analyses, which use additional tag data. © 2011 Acoustical Society of America
Pathogen Transmission from Humans to Great Apes is a Growing Threat to Primate Conservation.
Dunay, Emily; Apakupakul, Kathleen; Leard, Stephen; Palmer, Jamie L; Deem, Sharon L
2018-01-23
All six great ape species are listed as endangered or critically endangered by the IUCN and experiencing decreasing population trends. One of the threats to these non-human primates is the transmission of pathogens from humans. We conducted a literature review on occurrences of pathogen transmission from humans to great apes to highlight this often underappreciated issue. In total, we found 33 individual occurrences of probable or confirmed pathogen transmission from humans to great apes: 23 involved both pathogen and disease transmission, 7 pathogen transmission only, 2 positive antibody titers to zoonotic pathogens, and 1 pathogen transmission with probable disease. Great ape populations were categorized into captive, semi-free-living, and free-living conditions. The majority of occurrences involved chimpanzees (Pan troglodytes) (n = 23) or mountain gorillas (Gorilla beringei beringei) (n = 8). These findings have implications for conservation efforts and management of endangered great ape populations. Future efforts should focus on monitoring and addressing zoonotic pathogen and disease transmission between humans, great ape species, and other taxa to ensure the health of humans, wild and domestic animals, and the ecosystems we share.
Outage analysis of relay-assisted underwater wireless optical communication systems
NASA Astrophysics Data System (ADS)
Tabeshnezhad, Azadeh; Pourmina, Mohammad Ali
2017-12-01
In this paper, we theoretically evaluate the outage probabilities of underwater wireless optical communication (UWOC) systems. Our derivations are general as the channel model under consideration takes into account all of the channel degrading effects, namely absorption, scattering, and turbulence-induced fading. We numerically show that the UWOC systems, due to the severe channel impairments, cannot typically support longer link ranges than 100 m. Therefore, in this paper, in order to increase the transmission reliability and hence extend the viable communication range of UWOC systems, we apply decode-and-forward (DF) relay-assisted communications either in the form of multi-hop transmission, where multiple intermediate relays are serially employed between the source and destination, or parallel relaying in which multiple DF relays are distributed among the source-to-destination path to cooperate in the end-to-end transmission. Our numerical results reveal that multi-hop transmission, owing to the distance-dependency of all of the channel degrading effects, can tremendously improve the end-to-end outage probability and increase the accessible link ranges to hundreds of meter. For example, a dual-hop transmission in a 45 m coastal water link can provide up to 41 dB performance improvement at the outage probability of 10-9.
Interference Information Based Power Control for Cognitive Radio with Multi-Hop Cooperative Sensing
NASA Astrophysics Data System (ADS)
Yu, Youngjin; Murata, Hidekazu; Yamamoto, Koji; Yoshida, Susumu
Reliable detection of other radio systems is crucial for systems that share the same frequency band. In wireless communication channels, there is uncertainty in the received signal level due to multipath fading and shadowing. Cooperative sensing techniques in which radio stations share their sensing information can improve the detection probability of other systems. In this paper, a new cooperative sensing scheme that reduces the false detection probability while maintaining the outage probability of other systems is investigated. In the proposed system, sensing information is collected using multi-hop transmission from all sensing stations that detect other systems, and transmission decisions are based on the received sensing information. The proposed system also controls the transmit power based on the received CINRs from the sensing stations. Simulation results reveal that the proposed system can reduce the outage probability of other systems, or improve its link success probability.
Zhu, Shufen; Guo, Wenlong; Sheng, Pengcheng; Wang, Zunmin; Zhao, Changliang; Zhao, Qingyou; Zhu, Ruiliang
2012-01-01
Contaminated vaccine is one unexpected and potential origin of virus infection. In order to investigate the most likely cause of disease in a broiler breeder company of Shandong Province, all 17 batches of live-virus vaccines used in the affected flocks and 478 tissue samples were tested by dot-blot hybridization, nested PCR, and IFA. The results suggested the outbreak of disease was most probably due to the vaccination of REV-contaminated MD-CVI988/Rispens vaccines and ND-LaSota+IB-H120 vaccines. Furthermore, the REV was probably transmitted to the commercial chickens through congenital transmission. PMID:22912872
Transmissibility of Variant Influenza From Swine to Humans: A Modeling Approach
Wong, Karen K.; Gambhir, Manoj; Finelli, Lyn; Swerdlow, David L.; Ostroff, Stephen; Reed, Carrie
2015-01-01
Background Respiratory illness was reported among humans and swine at an agricultural fair in 2011; 3 human infections with an influenza A(H3N2) variant (H3N2v) virus were confirmed. Using epidemiologic investigation data, we sought to estimate H3N2v transmissibility from swine to humans. Methods We developed a model of H3N2v transmission among swine and humans and fit it to data from a cohort of 100 agricultural club members reporting swine contact to estimate transmissibility. A sensitivity analysis was performed varying H3N2v prevalence in the club cohort. Using the best-fit transmission probability, we simulated the number of swine-acquired infections among all fair attendees. Results We estimated the best-fit probability of swine-to-human H3N2v transmission per minute of swine contact. Applying this probability to 14 910 people with swine contact at the fair, we estimate that there were 80 (95% confidence interval [CI], 40–133) H3N2v infections among persons aged <20 years and 58 (95% CI, 29–96) H3N2v infections among person aged ≥20 years. Conclusions Using early data from investigation of a new virus with unclear transmission properties, we estimated the transmissibility of H3N2v from swine to humans and the burden of H3N2v among fair attendees. Although the risk of H3N2v virus infection is small for fair attendees with minimal swine contact, large populations attend agricultural events each year, and human cases will likely occur when infected swine are present. PMID:23794727
NASA transmission research and its probable effects on helicopter transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Coy, J. J.; Townsend, D. P.
1983-01-01
Transmissions studied for application to helicopters in addition to the more conventional geared transmissions include hybrid (traction/gear), bearingless planetary, and split torque transmissions. Research is being performed to establish the validity of analysis and computer codes developed to predict the performance, efficiency, life, and reliability of these transmissions. Results of this research should provide the transmission designer with analytical tools to design for minimum weight and noise with maximum life and efficiency. In addition, the advantages and limitations of drive systems as well as the more conventional systems will be defined.
NASA transmission research and its probable effects on helicopter transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Coy, J. J.; Townsend, D. P.
1984-01-01
Transmissions studied for application to helicopters in addition to the more conventional geared transmissions include hybrid (traction/gear), bearingless planetary, and split torque transmissions. Research is being performed to establish the validity of analysis and computer codes developed to predict the performance, efficiency, life, and reliability of these transmissions. Results of this research should provide the transmission designer with analytical tools to design for minimum weight and noise with maximum life and efficiency. In addition, the advantages and limitations of drive systems as well as the more conventional systems will be defined.
Lahodny, G E; Gautam, R; Ivanek, R
2015-01-01
Indirect transmission through the environment, pathogen shedding by infectious hosts, replication of free-living pathogens within the environment, and environmental decontamination are suspected to play important roles in the spread and control of environmentally transmitted infectious diseases. To account for these factors, the classic Susceptible-Infectious-Recovered-Susceptible epidemic model is modified to include a compartment representing the amount of free-living pathogen within the environment. The model accounts for host demography, direct and indirect transmission, replication of free-living pathogens in the environment, and removal of free-living pathogens by natural death or environmental decontamination. Based on the assumptions of the deterministic model, a continuous-time Markov chain model is developed. An estimate for the probability of disease extinction or a major outbreak is obtained by approximating the Markov chain with a multitype branching process. Numerical simulations illustrate important differences between the deterministic and stochastic counterparts, relevant for outbreak prevention, that depend on indirect transmission, pathogen shedding by infectious hosts, replication of free-living pathogens, and environmental decontamination. The probability of a major outbreak is computed for salmonellosis in a herd of dairy cattle as well as cholera in a human population. An explicit expression for the probability of disease extinction or a major outbreak in terms of the model parameters is obtained for systems with no direct transmission or replication of free-living pathogens.
Models of epidemics: when contact repetition and clustering should be included
Smieszek, Timo; Fiebig, Lena; Scholz, Roland W
2009-01-01
Background The spread of infectious disease is determined by biological factors, e.g. the duration of the infectious period, and social factors, e.g. the arrangement of potentially contagious contacts. Repetitiveness and clustering of contacts are known to be relevant factors influencing the transmission of droplet or contact transmitted diseases. However, we do not yet completely know under what conditions repetitiveness and clustering should be included for realistically modelling disease spread. Methods We compare two different types of individual-based models: One assumes random mixing without repetition of contacts, whereas the other assumes that the same contacts repeat day-by-day. The latter exists in two variants, with and without clustering. We systematically test and compare how the total size of an outbreak differs between these model types depending on the key parameters transmission probability, number of contacts per day, duration of the infectious period, different levels of clustering and varying proportions of repetitive contacts. Results The simulation runs under different parameter constellations provide the following results: The difference between both model types is highest for low numbers of contacts per day and low transmission probabilities. The number of contacts and the transmission probability have a higher influence on this difference than the duration of the infectious period. Even when only minor parts of the daily contacts are repetitive and clustered can there be relevant differences compared to a purely random mixing model. Conclusion We show that random mixing models provide acceptable estimates of the total outbreak size if the number of contacts per day is high or if the per-contact transmission probability is high, as seen in typical childhood diseases such as measles. In the case of very short infectious periods, for instance, as in Norovirus, models assuming repeating contacts will also behave similarly as random mixing models. If the number of daily contacts or the transmission probability is low, as assumed for MRSA or Ebola, particular consideration should be given to the actual structure of potentially contagious contacts when designing the model. PMID:19563624
Václav, Radovan; Kalúz, Stanislav
2014-03-01
Oribatid mites may be of epidemiological and medical importance because several species have been shown to serve as intermediate hosts for anoplocephalid tapeworms of wild and domestic animals. Despite their economic and conservation significance, relatively few studies examined factors influencing the effective number of oribatid mites that can serve as intermediate hosts. We examined variation in the structure of the edaphic arthropod community in functionally different territory parts of the Alpine marmot (Marmota marmota latirostris), a known definitive host of a prevalent anoplocephalid tapeworm, Ctenotaenia marmotae. We used a field experiment to test whether the abundance of oribatid mites in marmot pastures is affected by the presence of fresh herbivore faeces. We found that the abundance of soil and litter dwelling oribatid mites in marmot pastures did not change shortly after faeces addition. In contrast, numbers of other predominant soil-litter and phoretic microarthropods increased after faeces addition. The abundance of the two predominant phoretic mites colonizing the faeces was inversely related to the abundance of oribatid mites. In contrast, the abundance of a ubiquitous soil-litter mesostigmatid mite was a positive function of oribatid numbers. Although absolute numbers of oribatid mites did not change after faeces addition, our study suggests that, depending on soil quality or type, the probability of tapeworm egg ingestion by oribatid mites can be reduced due to increased interspecific prey-predatory and trophic interactions. Latrine site selection in Alpine marmots is consistent with a reduced probability of tapeworm transmission by oribatids.
Statistical analysis of dislocations and dislocation boundaries from EBSD data.
Moussa, C; Bernacki, M; Besnard, R; Bozzolo, N
2017-08-01
Electron BackScatter Diffraction (EBSD) is often used for semi-quantitative analysis of dislocations in metals. In general, disorientation is used to assess Geometrically Necessary Dislocations (GNDs) densities. In the present paper, we demonstrate that the use of disorientation can lead to inaccurate results. For example, using the disorientation leads to different GND density in recrystallized grains which cannot be physically justified. The use of disorientation gradients allows accounting for measurement noise and leads to more accurate results. Misorientation gradient is then used to analyze dislocations boundaries following the same principle applied on TEM data before. In previous papers, dislocations boundaries were defined as Geometrically Necessary Boundaries (GNBs) and Incidental Dislocation Boundaries (IDBs). It has been demonstrated in the past, through transmission electron microscopy data, that the probability density distribution of the disorientation of IDBs and GNBs can be described with a linear combination of two Rayleigh functions. Such function can also describe the probability density of disorientation gradient obtained through EBSD data as reported in this paper. This opens the route for determining IDBs and GNBs probability density distribution functions separately from EBSD data, with an increased statistical relevance as compared to TEM data. The method is applied on deformed Tantalum where grains exhibit dislocation boundaries, as observed using electron channeling contrast imaging. Copyright © 2017 Elsevier B.V. All rights reserved.
Drivers of Tuberculosis Transmission.
Mathema, Barun; Andrews, Jason R; Cohen, Ted; Borgdorff, Martien W; Behr, Marcel; Glynn, Judith R; Rustomjee, Roxana; Silk, Benjamin J; Wood, Robin
2017-11-03
Measuring tuberculosis transmission is exceedingly difficult, given the remarkable variability in the timing of clinical disease after Mycobacterium tuberculosis infection; incident disease can result from either a recent (ie, weeks to months) or a remote (ie, several years to decades) infection event. Although we cannot identify with certainty the timing and location of tuberculosis transmission for individuals, approaches for estimating the individual probability of recent transmission and for estimating the fraction of tuberculosis cases due to recent transmission in populations have been developed. Data used to estimate the probable burden of recent transmission include tuberculosis case notifications in young children and trends in tuberculin skin test and interferon γ-release assays. More recently, M. tuberculosis whole-genome sequencing has been used to estimate population levels of recent transmission, identify the distribution of specific strains within communities, and decipher chains of transmission among culture-positive tuberculosis cases. The factors that drive the transmission of tuberculosis in communities depend on the burden of prevalent tuberculosis; the ways in which individuals live, work, and interact (eg, congregate settings); and the capacity of healthcare and public health systems to identify and effectively treat individuals with infectious forms of tuberculosis. Here we provide an overview of these factors, describe tools for measurement of ongoing transmission, and highlight knowledge gaps that must be addressed. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Qu, Wenwen; Busscher, Henk J; Hooymans, Johanna M M; van der Mei, Henny C
2011-06-15
Contact lens induced microbial keratitis results from bacterial transmission from one surface to another. We investigated the adhesion forces of Pseudomonas aeruginosa, Staphylococci and Serratia to different contact lenses, lens cases and corneal surfaces using AFM, and applied a Weibull analysis on these adhesion forces to calculate bacterial transmission probabilities from lens case to corneas with a contact lens as an intermediate. Also a new surface thermodynamic parameter was introduced, the interfacial free energy of transmission, which in essence compares the interfacial free energies of bacterial adhesion, calculated from measured contact angles with liquids on the donating and receiving surfaces in the transmission process. Bacterial adhesion forces were generally strongest among all eight strains for the lens case (-6.5 to -12.0 nN) and corneas (-3.5 to -11.5 nN), while contact lenses (-0.6 to -13.1 nN) exerted slightly smaller adhesion forces. Consequently, bacterial transmission from lens case to contact lens yielded a smaller contribution in the final transmission than from contact lens to cornea. Bacterial transmission probabilities as derived from force analyses were higher when the interfacial free energies of transmission were more negative, which is in line with surface thermodynamic principles. Therewith this parameter could provide useful in analyzing other bacterial transmission phenomena between donating and receiving surfaces as well. Copyright © 2011 Elsevier Inc. All rights reserved.
A Weighted Configuration Model and Inhomogeneous Epidemics
NASA Astrophysics Data System (ADS)
Britton, Tom; Deijfen, Maria; Liljeros, Fredrik
2011-12-01
A random graph model with prescribed degree distribution and degree dependent edge weights is introduced. Each vertex is independently equipped with a random number of half-edges and each half-edge is assigned an integer valued weight according to a distribution that is allowed to depend on the degree of its vertex. Half-edges with the same weight are then paired randomly to create edges. An expression for the threshold for the appearance of a giant component in the resulting graph is derived using results on multi-type branching processes. The same technique also gives an expression for the basic reproduction number for an epidemic on the graph where the probability that a certain edge is used for transmission is a function of the edge weight (reflecting how closely `connected' the corresponding vertices are). It is demonstrated that, if vertices with large degree tend to have large (small) weights on their edges and if the transmission probability increases with the edge weight, then it is easier (harder) for the epidemic to take off compared to a randomized epidemic with the same degree and weight distribution. A recipe for calculating the probability of a large outbreak in the epidemic and the size of such an outbreak is also given. Finally, the model is fitted to three empirical weighted networks of importance for the spread of contagious diseases and it is shown that R 0 can be substantially over- or underestimated if the correlation between degree and weight is not taken into account.
Multi-Agent Cooperative Target Search
Hu, Jinwen; Xie, Lihua; Xu, Jun; Xu, Zhao
2014-01-01
This paper addresses a vision-based cooperative search for multiple mobile ground targets by a group of unmanned aerial vehicles (UAVs) with limited sensing and communication capabilities. The airborne camera on each UAV has a limited field of view and its target discriminability varies as a function of altitude. First, by dividing the whole surveillance region into cells, a probability map can be formed for each UAV indicating the probability of target existence within each cell. Then, we propose a distributed probability map updating model which includes the fusion of measurement information, information sharing among neighboring agents, information decay and transmission due to environmental changes such as the target movement. Furthermore, we formulate the target search problem as a multi-agent cooperative coverage control problem by optimizing the collective coverage area and the detection performance. The proposed map updating model and the cooperative control scheme are distributed, i.e., assuming that each agent only communicates with its neighbors within its communication range. Finally, the effectiveness of the proposed algorithms is illustrated by simulation. PMID:24865884
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marseguerra, M.; Pauli, G.
1958-07-01
The kinetic behavior of thermal neutrons in a time-offlight spectrometer is examined. An analytical method for obtaining the expressions for the probability for slow neutron transmission through a revolving slit (the general case of a curved slit is considered) is presented and discussed in detail. (auth)
Gene-culture coevolution in whales and dolphins.
Whitehead, Hal
2017-07-24
Whales and dolphins (Cetacea) have excellent social learning skills as well as a long and strong mother-calf bond. These features produce stable cultures, and, in some species, sympatric groups with different cultures. There is evidence and speculation that this cultural transmission of behavior has affected gene distributions. Culture seems to have driven killer whales into distinct ecotypes, which may be incipient species or subspecies. There are ecotype-specific signals of selection in functional genes that correspond to cultural foraging behavior and habitat use by the different ecotypes. The five species of whale with matrilineal social systems have remarkably low diversity of mtDNA. Cultural hitchhiking, the transmission of functionally neutral genes in parallel with selective cultural traits, is a plausible hypothesis for this low diversity, especially in sperm whales. In killer whales the ecotype divisions, together with founding bottlenecks, selection, and cultural hitchhiking, likely explain the low mtDNA diversity. Several cetacean species show habitat-specific distributions of mtDNA haplotypes, probably the result of mother-offspring cultural transmission of migration routes or destinations. In bottlenose dolphins, remarkable small-scale differences in haplotype distribution result from maternal cultural transmission of foraging methods, and large-scale redistributions of sperm whale cultural clans in the Pacific have likely changed mitochondrial genetic geography. With the acceleration of genomics new results should come fast, but understanding gene-culture coevolution will be hampered by the measured pace of research on the socio-cultural side of cetacean biology.
Gene–culture coevolution in whales and dolphins
Whitehead, Hal
2017-01-01
Whales and dolphins (Cetacea) have excellent social learning skills as well as a long and strong mother–calf bond. These features produce stable cultures, and, in some species, sympatric groups with different cultures. There is evidence and speculation that this cultural transmission of behavior has affected gene distributions. Culture seems to have driven killer whales into distinct ecotypes, which may be incipient species or subspecies. There are ecotype-specific signals of selection in functional genes that correspond to cultural foraging behavior and habitat use by the different ecotypes. The five species of whale with matrilineal social systems have remarkably low diversity of mtDNA. Cultural hitchhiking, the transmission of functionally neutral genes in parallel with selective cultural traits, is a plausible hypothesis for this low diversity, especially in sperm whales. In killer whales the ecotype divisions, together with founding bottlenecks, selection, and cultural hitchhiking, likely explain the low mtDNA diversity. Several cetacean species show habitat-specific distributions of mtDNA haplotypes, probably the result of mother–offspring cultural transmission of migration routes or destinations. In bottlenose dolphins, remarkable small-scale differences in haplotype distribution result from maternal cultural transmission of foraging methods, and large-scale redistributions of sperm whale cultural clans in the Pacific have likely changed mitochondrial genetic geography. With the acceleration of genomics new results should come fast, but understanding gene–culture coevolution will be hampered by the measured pace of research on the socio-cultural side of cetacean biology. PMID:28739936
Napp, S; Allepuz, A; García-Bocanegra, I; Alba, A; Vilar, M J; Casal, J
2011-03-15
Given that bluetongue (BT) may potentially be transmitted by semen, that the disease has significantly expanded in recent years, and that millions of doses of cattle semen are annually traded throughout the world, the transmission of bluetongue virus (BTV) by semen could have severe consequences in the cattle industry. The hypothesis that infected bulls could excrete BTV in their semen led to restrictions on international trade of ruminant semen and the establishment of measures to prevent BTV transmission by semen. However, neither the risk of BTV transmission by semen nor the effectiveness of these measures was estimated quantitatively. The objective of the study was to assess, in case of introduction of BTV into a bovine semen collection centre (SCC), both the risk of BTV transmission by bovine semen and the risk reduction achieved by some of the preventive measures, by means of a stochastic risk assessment model. The model was applied to different scenarios, depending on for example the type of diagnostic test and the interval between the controls (testing) of donor bulls, or the rate of BTV spread within the SCC. Enzyme-linked immunosorbant assay (ELISA) controls of donor bulls every 60 days seemed to be an ineffective method for reducing the risk of BTV transmission in contrast to polymerase chain reaction (PCR) tests every 28 days. An increase in the rate of spread within the SCC resulted in a reduced risk of BTV transmission by semen. The storage of semen for 30 days prior to dispatch seemed to be an efficient way of reducing the risk of transmission by semen. The sensitivity analysis identified the probability of BTV shedding in semen as a crucial parameter in the probability of BTV transmission by semen. However, there is a great degree of uncertainty associated with this parameter, with significant differences depending on the BTV serotype. Copyright © 2011 Elsevier Inc. All rights reserved.
An optical channel modeling of a single mode fiber
NASA Astrophysics Data System (ADS)
Nabavi, Neda; Liu, Peng; Hall, Trevor James
2018-05-01
The evaluation of the optical channel model that accurately describes the single mode fibre as a coherent transmission medium is reviewed through analytical, numerical and experimental analysis. We used the numerical modelling of the optical transmission medium and experimental measurements to determine the polarization drift as a function of time for a fixed length of fibre. The probability distribution of the birefringence vector was derived, which is associated to the 'Poole' equation. The theory and experimental evidence that has been disclosed in the literature in the context of polarization mode dispersion - Stokes & Jones formulations and solutions for key statistics by integration of stochastic differential equations has been investigated. Besides in-depth definition of the single-mode fibre-optic channel, the modelling which concerns an ensemble of fibres each with a different instance of environmental perturbation has been analysed.
SLEEPLESS is a bi-functional regulator of excitability and cholinergic synaptic transmission
Wu, Meilin; Robinson, James E.; Joiner, William J.
2014-01-01
Summary Background Although sleep is conserved throughout evolution, the molecular basis of its control is still largely a mystery. We previously showed that the quiver/sleepless (qvr/sss) gene encodes a membrane-tethered protein that is required for normal sleep in Drosophila. SLEEPLESS (SSS) protein functions, at least in part, by upregulating the levels and open probability of Shaker (Sh) potassium channels to suppress neuronal excitability and enable sleep. Consistent with this proposed mechanism, loss-of-function mutations in Sh phenocopy qvr/sss null mutants. However, sleep is more genetically modifiable in Sh than in qvr/sss mutants, suggesting that sss may regulate additional molecules to influence sleep. Results Here we show that SSS also antagonizes nicotinic acetylcholine receptors (nAChRs) to reduce synaptic transmission and promote sleep. Mimicking this antagonism with the nAChR inhibitor mecamylamine or by RNAi knockdown of specific nAChR subunits is sufficient to restore sleep to qvr/sss mutants. Regulation of nAChR activity by SSS occurs post-transcriptionally since the levels of nAChR mRNAs are unchanged in qvr/sss mutants. Regulation of nAChR activity by SSS may in fact be direct, since SSS forms a stable complex with and antagonizes fly nAChR function in transfected cells. Intriguingly, lynx1, a mammalian homolog of SSS, can partially restore normal sleep to qvr/sss mutants, and lynx1 can form stable complexes with Shaker-type channels and nAChRs. Conclusions Together, our data point to an evolutionarily conserved, bi-functional role for SSS and its homologs in controlling excitability and synaptic transmission in fundamental processes of the nervous system such as sleep. PMID:24613312
Interleaved Training and Training-Based Transmission Design for Hybrid Massive Antenna Downlink
NASA Astrophysics Data System (ADS)
Zhang, Cheng; Jing, Yindi; Huang, Yongming; Yang, Luxi
2018-06-01
In this paper, we study the beam-based training design jointly with the transmission design for hybrid massive antenna single-user (SU) and multiple-user (MU) systems where outage probability is adopted as the performance measure. For SU systems, we propose an interleaved training design to concatenate the feedback and training procedures, thus making the training length adaptive to the channel realization. Exact analytical expressions are derived for the average training length and the outage probability of the proposed interleaved training. For MU systems, we propose a joint design for the beam-based interleaved training, beam assignment, and MU data transmissions. Two solutions for the beam assignment are provided with different complexity-performance tradeoff. Analytical results and simulations show that for both SU and MU systems, the proposed joint training and transmission designs achieve the same outage performance as the traditional full-training scheme but with significant saving in the training overhead.
Variability of Acoustic Transmissions in a Shallow Water Area,
1981-05-01
as changes in the probability density and distribution functions, and the 17 PEILChJ4WO AA Aw i-m--t SACLANTCEN SR-46 test is sensitive to these...transducer on the bottom, i.e. no delay variations, and another with a lot of movements. The left parts of the figure show projections of spreading...change a lot from one ping group (matrix) to the next (see Figs. 9c and TOc). Comparing the runs tests (Figs. 9a and lOa) we see that there is a lot
1994-12-07
Suite 1204, Arlington, VA 22202-4302, and to the Office of Management and Budget. Paperwork Reduction Project (0704-0188), Washington, DC 20603. 1...adjustment made to Oi never violates this constraint. Observe that the mean waiting 2; de Wi is a function of the probability that stream i is assigned a...to transmission set i. Let F k -(-) be the kth Fibonacci number, where -1 = (/•(5) - 1)/2 • 0.618034. Then, let N’, i = 1,..-, M be integers such that
Detection of non-Gaussian fluctuations in a quantum point contact.
Gershon, G; Bomze, Yu; Sukhorukov, E V; Reznikov, M
2008-07-04
An experimental study of current fluctuations through a tunable transmission barrier, a quantum point contact, is reported. We measure the probability distribution function of transmitted charge with precision sufficient to extract the first three cumulants. To obtain the intrinsic quantities, corresponding to voltage-biased barrier, we employ a procedure that accounts for the response of the external circuit and the amplifier. The third cumulant, obtained with a high precision, is found to agree with the prediction for the statistics of transport in the non-Poissonian regime.
Detection of Non-Gaussian Fluctuations in a Quantum Point Contact
NASA Astrophysics Data System (ADS)
Gershon, G.; Bomze, Yu.; Sukhorukov, E. V.; Reznikov, M.
2008-07-01
An experimental study of current fluctuations through a tunable transmission barrier, a quantum point contact, is reported. We measure the probability distribution function of transmitted charge with precision sufficient to extract the first three cumulants. To obtain the intrinsic quantities, corresponding to voltage-biased barrier, we employ a procedure that accounts for the response of the external circuit and the amplifier. The third cumulant, obtained with a high precision, is found to agree with the prediction for the statistics of transport in the non-Poissonian regime.
Electron-phonon interaction in quantum transport through quantum dots and molecular systems
NASA Astrophysics Data System (ADS)
Ojeda, J. H.; Duque, C. A.; Laroze, D.
2016-12-01
The quantum transport and effects of decoherence properties are studied in quantum dots systems and finite homogeneous chains of aromatic molecules connected to two semi-infinite leads. We study these systems based on the tight-binding approach through Green's function technique within a real space renormalization and polaron transformation schemes. In particular, we calculate the transmission probability following the Landauer-Büttiker formalism, the I - V characteristics and the noise power of current fluctuations taken into account the decoherence. Our results may explain the inelastic effects through nanoscopic systems.
NASA Astrophysics Data System (ADS)
Sinkin, Oleg V.; Grigoryan, Vladimir S.; Menyuk, Curtis R.
2006-12-01
We introduce a fully deterministic, computationally efficient method for characterizing the effect of nonlinearity in optical fiber transmission systems that utilize wavelength-division multiplexing and return-to-zero modulation. The method accurately accounts for bit-pattern-dependent nonlinear distortion due to collision-induced timing jitter and for amplifier noise. We apply this method to calculate the error probability as a function of channel spacing in a prototypical multichannel return-to-zero undersea system.
Improving receiver performance of diffusive molecular communication with enzymes.
Noel, Adam; Cheung, Karen C; Schober, Robert
2014-03-01
This paper studies the mitigation of intersymbol interference in a diffusive molecular communication system using enzymes that freely diffuse in the propagation environment. The enzymes form reaction intermediates with information molecules and then degrade them so that they cannot interfere with future transmissions. A lower bound expression on the expected number of molecules measured at the receiver is derived. A simple binary receiver detection scheme is proposed where the number of observed molecules is sampled at the time when the maximum number of molecules is expected. Insight is also provided into the selection of an appropriate bit interval. The expected bit error probability is derived as a function of the current and all previously transmitted bits. Simulation results show the accuracy of the bit error probability expression and the improvement in communication performance by having active enzymes present.
Optimal Information Processing in Biochemical Networks
NASA Astrophysics Data System (ADS)
Wiggins, Chris
2012-02-01
A variety of experimental results over the past decades provide examples of near-optimal information processing in biological networks, including in biochemical and transcriptional regulatory networks. Computing information-theoretic quantities requires first choosing or computing the joint probability distribution describing multiple nodes in such a network --- for example, representing the probability distribution of finding an integer copy number of each of two interacting reactants or gene products while respecting the `intrinsic' small copy number noise constraining information transmission at the scale of the cell. I'll given an overview of some recent analytic and numerical work facilitating calculation of such joint distributions and the associated information, which in turn makes possible numerical optimization of information flow in models of noisy regulatory and biochemical networks. Illustrating cases include quantification of form-function relations, ideal design of regulatory cascades, and response to oscillatory driving.
Transmission characteristics of MERS and SARS in the healthcare setting: a comparative study.
Chowell, Gerardo; Abdirizak, Fatima; Lee, Sunmi; Lee, Jonggul; Jung, Eunok; Nishiura, Hiroshi; Viboud, Cécile
2015-09-03
The Middle East respiratory syndrome (MERS) coronavirus has caused recurrent outbreaks in the Arabian Peninsula since 2012. Although MERS has low overall human-to-human transmission potential, there is occasional amplification in the healthcare setting, a pattern reminiscent of the dynamics of the severe acute respiratory syndrome (SARS) outbreaks in 2003. Here we provide a head-to-head comparison of exposure patterns and transmission dynamics of large hospital clusters of MERS and SARS, including the most recent South Korean outbreak of MERS in 2015. To assess the unexpected nature of the recent South Korean nosocomial outbreak of MERS and estimate the probability of future large hospital clusters, we compared exposure and transmission patterns for previously reported hospital clusters of MERS and SARS, based on individual-level data and transmission tree information. We carried out simulations of nosocomial outbreaks of MERS and SARS using branching process models rooted in transmission tree data, and inferred the probability and characteristics of large outbreaks. A significant fraction of MERS cases were linked to the healthcare setting, ranging from 43.5 % for the nosocomial outbreak in Jeddah, Saudi Arabia, in 2014 to 100 % for both the outbreak in Al-Hasa, Saudi Arabia, in 2013 and the outbreak in South Korea in 2015. Both MERS and SARS nosocomial outbreaks are characterized by early nosocomial super-spreading events, with the reproduction number dropping below 1 within three to five disease generations. There was a systematic difference in the exposure patterns of MERS and SARS: a majority of MERS cases occurred among patients who sought care in the same facilities as the index case, whereas there was a greater concentration of SARS cases among healthcare workers throughout the outbreak. Exposure patterns differed slightly by disease generation, however, especially for SARS. Moreover, the distributions of secondary cases per single primary case varied highly across individual hospital outbreaks (Kruskal-Wallis test; P < 0.0001), with significantly higher transmission heterogeneity in the distribution of secondary cases for MERS than SARS. Simulations indicate a 2-fold higher probability of occurrence of large outbreaks (>100 cases) for SARS than MERS (2 % versus 1 %); however, owing to higher transmission heterogeneity, the largest outbreaks of MERS are characterized by sharper incidence peaks. The probability of occurrence of MERS outbreaks larger than the South Korean cluster (n = 186) is of the order of 1 %. Our study suggests that the South Korean outbreak followed a similar progression to previously described hospital clusters involving coronaviruses, with early super-spreading events generating a disproportionately large number of secondary infections, and the transmission potential diminishing greatly in subsequent generations. Differences in relative exposure patterns and transmission heterogeneity of MERS and SARS could point to changes in hospital practices since 2003 or differences in transmission mechanisms of these coronaviruses.
Detection of isolated protein-bound metal ions by single-particle cryo-STEM.
Elad, Nadav; Bellapadrona, Giuliano; Houben, Lothar; Sagi, Irit; Elbaum, Michael
2017-10-17
Metal ions play essential roles in many aspects of biological chemistry. Detecting their presence and location in proteins and cells is important for understanding biological function. Conventional structural methods such as X-ray crystallography and cryo-transmission electron microscopy can identify metal atoms on protein only if the protein structure is solved to atomic resolution. We demonstrate here the detection of isolated atoms of Zn and Fe on ferritin, using cryogenic annular dark-field scanning transmission electron microscopy (cryo-STEM) coupled with single-particle 3D reconstructions. Zn atoms are found in a pattern that matches precisely their location at the ferroxidase sites determined earlier by X-ray crystallography. By contrast, the Fe distribution is smeared along an arc corresponding to the proposed path from the ferroxidase sites to the mineral nucleation sites along the twofold axes. In this case the single-particle reconstruction is interpreted as a probability distribution function based on the average of individual locations. These results establish conditions for detection of isolated metal atoms in the broader context of electron cryo-microscopy and tomography.
Stress Transmission and Failure in Disordered Porous Media
NASA Astrophysics Data System (ADS)
Laubie, Hadrien; Radjai, Farhang; Pellenq, Roland; Ulm, Franz-Josef
2017-08-01
By means of extensive lattice-element simulations, we investigate stress transmission and its relation with failure properties in increasingly disordered porous systems. We observe a non-Gaussian broadening of stress probability density functions under tensile loading with increasing porosity and disorder, revealing a gradual transition from a state governed by single-pore stress concentration to a state controlled by multipore interactions and metric disorder. This effect is captured by the excess kurtosis of stress distributions and shown to be nicely correlated with the second moment of local porosity fluctuations, which appears thus as a (dis)order parameter for the system. By generating statistical ensembles of porous textures with varying porosity and disorder, we derive a general expression for the fracture stress as a decreasing function of porosity and disorder. Focusing on critical sites where the local stress is above the global fracture threshold, we also analyze the transition to failure in terms of a coarse-graining length. These findings provide a general framework which can also be more generally applied to multiphase and structural heterogeneous materials.
Detection of isolated protein-bound metal ions by single-particle cryo-STEM
Elad, Nadav; Bellapadrona, Giuliano; Houben, Lothar; Sagi, Irit; Elbaum, Michael
2017-01-01
Metal ions play essential roles in many aspects of biological chemistry. Detecting their presence and location in proteins and cells is important for understanding biological function. Conventional structural methods such as X-ray crystallography and cryo-transmission electron microscopy can identify metal atoms on protein only if the protein structure is solved to atomic resolution. We demonstrate here the detection of isolated atoms of Zn and Fe on ferritin, using cryogenic annular dark-field scanning transmission electron microscopy (cryo-STEM) coupled with single-particle 3D reconstructions. Zn atoms are found in a pattern that matches precisely their location at the ferroxidase sites determined earlier by X-ray crystallography. By contrast, the Fe distribution is smeared along an arc corresponding to the proposed path from the ferroxidase sites to the mineral nucleation sites along the twofold axes. In this case the single-particle reconstruction is interpreted as a probability distribution function based on the average of individual locations. These results establish conditions for detection of isolated metal atoms in the broader context of electron cryo-microscopy and tomography. PMID:28973937
Liat, L B; Betterton, C
1977-01-01
Examination of naturally infected felids and viverrids in Malaysia confirmed previously published records which indicated that P. westermani occurred only in felid cats. Felis planiceps and F. temnickli were reported as new host records. Analysis of stomach contents revealed no crab remains in either family of cats, but confirmed that felids were strictly carnivorous while viverrids were often omnivorous. In feeding experiments, only viverrids ate the host crabs Potomiscus johorensis and Parathelphusa maculata. The probable transmission of P. westermani to felids via paratenic hosts was discussed.
Hetem, D J; Pekelharing, M; Thijsen, S F T
2013-08-16
We report a highly probable case of transmission of a Yersinia enterocolitica from a pet puppy dog, adopted from a Spanish asylum, to a 1-year-old girl. After several weeks of diarrhoea, a PCR detecting enteropathogenic bacteria was performed on the faeces, revealing Y enterocolitica. Following cultures yielded a Y enterocolitica biotype 4, serotype O:3 in the faeces of the girl as well as puppy dog. Despite antibiotic treatment, symptoms and shedding of the organism in the faeces endured during a 2 month period.
Conductance spectra of asymmetric ferromagnet/ferromagnet/ferromagnet junctions
NASA Astrophysics Data System (ADS)
Pasanai, K.
2017-01-01
A theory of tunneling spectroscopy of ferromagnet/ferromagnet/ferromagnet junctions was studied. We applied a delta-functional approximation for the interface scattering properties under a one-dimensional system of a free electron approach. The reflection and transmission probabilities were calculated in the ballistic regime, and the conductance spectra were then calculated using the Landauer formulation. The magnetization directions were set to be either parallel (P) or anti-parallel (AP) alignments, for comparison. We found that the conductance spectra was suppressed when increasing the interfacial scattering at the interfaces. Moreover, the electron could exhibit direct transmission when the thickness was rather thin. Thus, there was no oscillation in this case. However, in the case of a thick layer the conductance spectra oscillated, and this oscillation was most prominent when the middle layer thickness increased. In the case of direct transmission, the conductance spectra of P and AP systems were definitely suppressed with increased exchange energy of the middle ferromagnet. This also refers to an increase in the magnetoresistance of the junction. In the case of oscillatory behavior, the positions of the resonance peaks were changed as the exchange energy was changed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, S.; Li, Y.; Liu, C.
2015-08-15
This paper presents a statistical theory for the initial onset of multipactor breakdown in coaxial transmission lines, taking both the nonuniform electric field and random electron emission velocity into account. A general numerical method is first developed to construct the joint probability density function based on the approximate equation of the electron trajectory. The nonstationary dynamics of the multipactor process on both surfaces of coaxial lines are modelled based on the probability of various impacts and their corresponding secondary emission. The resonant assumption of the classical theory on the independent double-sided and single-sided impacts is replaced by the consideration ofmore » their interaction. As a result, the time evolutions of the electron population for exponential growth and absorption on both inner and outer conductor, in response to the applied voltage above and below the multipactor breakdown level, are obtained to investigate the exact mechanism of multipactor discharge in coaxial lines. Furthermore, the multipactor threshold predictions of the presented model are compared with experimental results using measured secondary emission yield of the tested samples which shows reasonable agreement. Finally, the detailed impact scenario reveals that single-surface multipactor is more likely to occur with a higher outer to inner conductor radius ratio.« less
Intrinsically shunted Josephson junctions for electronics applications
NASA Astrophysics Data System (ADS)
Belogolovskii, M.; Zhitlukhina, E.; Lacquaniti, V.; De Leo, N.; Fretto, M.; Sosso, A.
2017-07-01
Conventional Josephson metal-insulator-metal devices are inherently underdamped and exhibit hysteretic current-voltage response due to a very high subgap resistance compared to that in the normal state. At the same time, overdamped junctions with single-valued characteristics are needed for most superconducting digital applications. The usual way to overcome the hysteretic behavior is to place an external low-resistance normal-metal shunt in parallel with each junction. Unfortunately, such solution results in a considerable complication of the circuitry design and introduces parasitic inductance through the junction. This paper provides a concise overview of some generic approaches that have been proposed in order to realize internal shunting in Josephson heterostructures with a barrier that itself contains the desired resistive component. The main attention is paid to self-shunted devices with local weak-link transmission probabilities that are so strongly disordered in the interface plane that transmission probabilities are tiny for the main part of the transition region between two super-conducting electrodes, while a small part of the interface is well transparent. We discuss the possibility of realizing a universal bimodal distribution function and emphasize advantages of such junctions that can be considered as a new class of self-shunted Josephson devices promising for practical applications in superconducting electronics operating at 4.2 K.
Spin-dependent Seebeck effects in a graphene superlattice p-n junction with different shapes
NASA Astrophysics Data System (ADS)
Zhou, Benhu; Zhou, Benliang; Yao, Yagang; Zhou, Guanghui; Hu, Ming
2017-10-01
We theoretically calculate the spin-dependent transmission probability and spin Seebeck coefficient for a zigzag-edge graphene nanoribbon p-n junction with periodically attached stubs under a perpendicular magnetic field and a ferromagnetic insulator. By using the nonequilibrium Green’s function method combining with the tight-binding Hamiltonian, it is demonstrated that the spin-dependent transmission probability and spin Seebeck coefficient for two types of superlattices can be modulated by the potential drop, the magnetization strength, the number of periods of the superlattice, the strength of the perpendicular magnetic field, and the Anderson disorder strength. Interestingly, a metal to semiconductor transition occurs as the number of the superlattice for a crossed superlattice p-n junction increases, and its spin Seebeck coefficient is much larger than that for the T-shaped one around the zero Fermi energy. Furthermore, the spin Seebeck coefficient for crossed systems can be much pronounced and their maximum absolute value can reach 528 μV K-1 by choosing optimized parameters. Besides, the spin Seebeck coefficient for crossed p-n junction is strongly enhanced around the zero Fermi energy for a weak magnetic field. Our results provide theoretical references for modulating the thermoelectric properties of a graphene superlattice p-n junction by tuning its geometric structure and physical parameters.
Characterizing risk of Ebola transmission based on frequency and type of case–contact exposures
Fallah, Mosoka P.; Gaffney, Stephen G.; Yaari, Rami; Yamin, Dan; Huppert, Amit; Bawo, Luke; Nyenswah, Tolbert; Galvani, Alison P.
2017-01-01
During the initial months of the 2013–2016 Ebola epidemic, rapid geographical dissemination and intense transmission challenged response efforts across West Africa. Contextual behaviours associated with increased risk of exposure included travel to high-transmission settings, caring for sick and preparing the deceased for traditional funerals. Although such behaviours are widespread in West Africa, high-transmission pockets were observed. Superspreading and clustering are typical phenomena in infectious disease outbreaks, as a relatively small number of transmission chains are often responsible for the majority of events. Determining the characteristics of contacts at greatest risk of developing disease and of cases with greatest transmission potential could therefore help curb propagation of infection. Our analysis of contact tracing data from Montserrado County, Liberia, suggested that the probability of transmission was 4.5 times higher for individuals who were reported as having contact with multiple cases. The probability of individuals developing disease was not significantly associated with age or sex of their source case but was higher when they were in the same household as the infectious case. Surveillance efforts for rapidly identifying symptomatic individuals and effectively messaged campaigns encouraging household members to bring the sick to designated treatment centres without administration of home care could mitigate transmission. This article is part of the themed issue ‘The 2013–2016 West African Ebola epidemic: data, decision-making and disease control’. PMID:28396472
NASA Astrophysics Data System (ADS)
Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; Lambrakos, Samuel G.; Moody, Nathan A.; Petillo, John J.; Yamaguchi, Hisato; Liu, Fangze
2018-01-01
Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al. [Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated by an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quantum yield, emittance, and emission models needed by beam optics codes are discussed.
Tan, Can Ozan; Bullock, Daniel
2008-10-01
Recently, dopamine (DA) neurons of the substantia nigra pars compacta (SNc) were found to exhibit sustained responses related to reward uncertainty, in addition to the phasic responses related to reward-prediction errors (RPEs). Thus, cue-dependent anticipations of the timing, magnitude, and uncertainty of rewards are learned and reflected in components of DA signals. Here we simulate a local circuit model to show how learned uncertainty responses are generated, along with phasic RPE responses, on single trials. Both types of simulated DA responses exhibit the empirically observed dependencies on conditional probability, expected value of reward, and time since onset of the reward-predicting cue. The model's three major pathways compute expected values of cues, timed predictions of reward magnitudes, and uncertainties associated with these predictions. The first two pathways' computations refine those modeled by Brown et al. (1999). The third, newly modeled, pathway involves medium spiny projection neurons (MSPNs) of the striatal matrix, whose axons corelease GABA and substance P, both at synapses with GABAergic neurons in the substantia nigra pars reticulata (SNr) and with distal dendrites (in SNr) of DA neurons whose somas are located in ventral SNc. Corelease enables efficient computation of uncertainty responses that are a nonmonotonic function of the conditional probability of reward, and variability in striatal cholinergic transmission can explain observed individual differences in the amplitudes of uncertainty responses. The involvement of matricial MSPNs and cholinergic transmission within the striatum implies a relation between uncertainty in cue-reward contingencies and action-selection functions of the basal ganglia.
Inference of R 0 and Transmission Heterogeneity from the Size Distribution of Stuttering Chains
Blumberg, Seth; Lloyd-Smith, James O.
2013-01-01
For many infectious disease processes such as emerging zoonoses and vaccine-preventable diseases, and infections occur as self-limited stuttering transmission chains. A mechanistic understanding of transmission is essential for characterizing the risk of emerging diseases and monitoring spatio-temporal dynamics. Thus methods for inferring and the degree of heterogeneity in transmission from stuttering chain data have important applications in disease surveillance and management. Previous researchers have used chain size distributions to infer , but estimation of the degree of individual-level variation in infectiousness (as quantified by the dispersion parameter, ) has typically required contact tracing data. Utilizing branching process theory along with a negative binomial offspring distribution, we demonstrate how maximum likelihood estimation can be applied to chain size data to infer both and the dispersion parameter that characterizes heterogeneity. While the maximum likelihood value for is a simple function of the average chain size, the associated confidence intervals are dependent on the inferred degree of transmission heterogeneity. As demonstrated for monkeypox data from the Democratic Republic of Congo, this impacts when a statistically significant change in is detectable. In addition, by allowing for superspreading events, inference of shifts the threshold above which a transmission chain should be considered anomalously large for a given value of (thus reducing the probability of false alarms about pathogen adaptation). Our analysis of monkeypox also clarifies the various ways that imperfect observation can impact inference of transmission parameters, and highlights the need to quantitatively evaluate whether observation is likely to significantly bias results. PMID:23658504
Luo, Fei; Zheng, Jian; Sun, Xuan; Tang, Hua
2017-02-01
The functions of prefrontal cortex (PFC) are sensitive to norepinephrine (NE). Endogenously released NE influences synaptic transmission through activation of different subtypes of adrenergic receptors in PFC including α 1 , α 2 , β 1 or β 2 -adrenoceptor. Our recent study has revealed that β 1 -adrenoceptor (β 1 -AR) activation modulates glutamatergic transmission in the PFC, whereas the roles of β 1 -AR in GABAergic transmission are elusive. In the current study, we probed the effects of the β 1 -AR agonist dobutamine (Dobu) on GABAergic transmission onto pyramidal neurons in the PFC of juvenile rats. Dobu increased both the frequency and amplitude of miniature IPSCs (mIPSCs). Ca 2+ influx through T-type voltage-gated Ca 2+ channel was required for Dobu-enhanced mIPSC frequency. We also found that Dobu facilitated GABA release probability and the number of releasable vesicles through regulating T-type Ca 2+ channel. Dobu depolarized GABAergic fast-spiking (FS) interneurons with no effects on the firing rate of action potentials (APs) of interneurons. Dobu-induced depolarization of FS interneurons required inward rectifier K + channel (Kir). Our results suggest that Dobu increase GABA release via inhibition of Kir, which further depolarizes FS interneurons resulting in Ca 2+ influx via T-type Ca 2+ channel. Copyright © 2016 Elsevier Inc. All rights reserved.
Developmental plasticity in schistosomes and other helminths
Davies, Stephen J.; McKerrow, James H.
2010-01-01
Developmental plasticity in helminth life cycles serves, in most cases, to increase the probability of transmission between hosts, suggesting that the necessity to achieve transmission is a prominent selective pressure in the evolution of this phenomenon. Some evidence suggests that digenean trematodes from the genus Schistosoma are also capable of limited developmental responses to host factors. Here we review the currently available data on this phenomenon and attempt to draw comparisons with similar processes in the life cycles of other helminths. At present the biological significance of developmental responses by schistosomes under laboratory conditions remains unclear. Further work is needed to determine whether developmental plasticity plays any role in increasing the probability of schistosome transmission and life cycle propagation under adverse conditions, as it does in other helminth life cycles. PMID:13678642
Timing and Order of Transmission Events Is Not Directly Reflected in a Pathogen Phylogeny
Romero-Severson, Ethan; Skar, Helena; Bulla, Ingo; Albert, Jan; Leitner, Thomas
2014-01-01
Pathogen phylogenies are often used to infer spread among hosts. There is, however, not an exact match between the pathogen phylogeny and the host transmission history. Here, we examine in detail the limitations of this relationship. First, all splits in a pathogen phylogeny of more than 1 host occur within hosts, not at the moment of transmission, predating the transmission events as described by the pretransmission interval. Second, the order in which nodes in a phylogeny occur may be reflective of the within-host dynamics rather than epidemiologic relationships. To investigate these phenomena, motivated by within-host diversity patterns, we developed a two-phase coalescent model that includes a transmission bottleneck followed by linear outgrowth to a maximum population size followed by either stabilization or decline of the population. The model predicts that the pretransmission interval shrinks compared with predictions based on constant population size or a simple transmission bottleneck. Because lineages coalesce faster in a small population, the probability of a pathogen phylogeny to resemble the transmission history depends on when after infection a donor transmits to a new host. We also show that the probability of inferring the incorrect order of multiple transmissions from the same host is high. Finally, we compare time of HIV-1 infection informed by genetic distances in phylogenies to independent biomarker data, and show that, indeed, the pretransmission interval biases phylogeny-based estimates of when transmissions occurred. We describe situations where caution is needed not to misinterpret which parts of a phylogeny that may indicate outbreaks and tight transmission clusters. PMID:24874208
Quantum-shutter approach to tunneling time scales with wave packets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamada, Norifumi; Garcia-Calderon, Gaston; Villavicencio, Jorge
2005-07-15
The quantum-shutter approach to tunneling time scales [G. Garcia-Calderon and A. Rubio, Phys. Rev. A 55, 3361 (1997)], which uses a cutoff plane wave as the initial condition, is extended to consider certain type of wave packet initial conditions. An analytical expression for the time-evolved wave function is derived. The time-domain resonance, the peaked structure of the probability density (as the function of time) at the exit of the barrier, originally found with the cutoff plane wave initial condition, is studied with the wave packet initial conditions. It is found that the time-domain resonance is not very sensitive to themore » width of the packet when the transmission process occurs in the tunneling regime.« less
NASA Technical Reports Server (NTRS)
Tucker, C. J.; Garratt, M. W.
1977-01-01
A stochastic leaf radiation model based upon physical and physiological properties of dicot leaves has been developed. The model accurately predicts the absorbed, reflected, and transmitted radiation of normal incidence as a function of wavelength resulting from the leaf-irradiance interaction over the spectral interval of 0.40-2.50 micron. The leaf optical system has been represented as Markov process with a unique transition matrix at each 0.01-micron increment between 0.40 micron and 2.50 micron. Probabilities are calculated at every wavelength interval from leaf thickness, structure, pigment composition, and water content. Simulation results indicate that this approach gives accurate estimations of actual measured values for dicot leaf absorption, reflection, and transmission as a function of wavelength.
Differential Roles of Postsynaptic Density-93 Isoforms in Regulating Synaptic Transmission
Krüger, Juliane M.; Favaro, Plinio D.; Liu, Mingna; Kitlińska, Agata; Huang, Xiaojie; Raabe, Monika; Akad, Derya S.; Liu, Yanling; Urlaub, Henning; Dong, Yan; Xu, Weifeng
2013-01-01
In the postsynaptic density of glutamatergic synapses, the discs large (DLG)-membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins coordinates a multiplicity of signaling pathways to maintain and regulate synaptic transmission. Postsynaptic density-93 (PSD-93) is the most variable paralog in this family; it exists in six different N-terminal isoforms. Probably because of the structural and functional variability of these isoforms, the synaptic role of PSD-93 remains controversial. To accurately characterize the synaptic role of PSD-93, we quantified the expression of all six isoforms in the mouse hippocampus and examined them individually in hippocampal synapses. Using molecular manipulations, including overexpression, gene knockdown, PSD-93 knock-out mice combined with biochemical assays, and slice electrophysiology both in rat and mice, we demonstrate that PSD-93 is required at different developmental synaptic states to maintain the strength of excitatory synaptic transmission. This strength is differentially regulated by the six isoforms of PSD-93, including regulations of α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor-active and inactive synapses, and activity-dependent modulations. Collectively, these results demonstrate that alternative combinations of N-terminal PSD-93 isoforms and DLG-MAGUK paralogs can fine-tune signaling scaffolds to adjust synaptic needs to regulate synaptic transmission. PMID:24068818
Fine, Amanda E.; O'Brien, Daniel J.; Winterstein, Scott R.; Kaneene, John B.
2011-01-01
Deer movements on cattle farms, wildlife feeding, and livestock management practices in Michigan are thought to create opportunities for indirect transmission of Mycobacterium bovis via environmental substrates. To confirm the presence of viable M. bovis in the environment, substrates were collected from 13 farms with culture-confirmed M. bovis in cattle and 5 sites with high prevalence of M. bovis in free-ranging deer. None of the samples processed for mycobacterial culture were positive for M. bovis. Agent, host, and landscape-level factors decrease the probability of detecting M. bovis in the environment using conventional mycobacterial culture. Molecular techniques that increase the probability of M. bovis detection in environmental substrates should be applied to known sites of M. bovis transmission in Michigan. In the interim, epidemiological investigations informed by experimental studies will be most effective in characterizing M. bovis persistence in the environment and its role in the indirect interspecies transmission of M. bovis. PMID:23738108
Effect of a gap opening on the conductance of graphene with magnetic barrier structures
NASA Astrophysics Data System (ADS)
Esmailpour, Mohammad
2018-04-01
In the present study Klein tunneling in a single-layer gapped graphene was investigated by transfer matrix method under normal magnetic field for one and two magnetic barriers. Calculations show that electron transmission through a magnetic barrier is deflected to positive angles and reduces as the magnitude of magnetic field and especially the energy gap increases. This reduction is even more significant in larger fields so that after reaching a specific value of energy gap, an effective confinement for fermions and suppression of Klein tunneling is reached particularly in normal incidence and the conductance becomes zero. Unlike one barrier, the process of tunneling through two magnetic barriers induces symmetric transmission probability versus the incident angle; even, for lower energy gaps, electron transmission probability increases which in turn reduces total conductance via proper changes in the value of the magnetic field and energy gap. In general, it is concluded that confining electrons in asymmetric transmission through one barrier is conducted better than two barriers.
Hayden, Todd A.; Holbrook, Christopher M.; Binder, Thomas; Dettmers, John M.; Cooke, Steven J.; Vandergoot, Christopher S.; Krueger, Charles C.
2016-01-01
BackgroundAdvances in acoustic telemetry technology have led to an improved understanding of the spatial ecology of many freshwater and marine fish species. Understanding the performance of acoustic receivers is necessary to distinguish between tagged fish that may have been present but not detected and from those fish that were absent from the area. In this study, two stationary acoustic transmitters were deployed 250 m apart within each of four acoustic receiver lines each containing at least 10 receivers (i.e., eight acoustic transmitters) located in Saginaw Bay and central Lake Huron for nearly 2 years to determine whether the probability of detecting an acoustic transmission varied as a function of time (i.e., season), location, and distance between acoustic transmitter and receiver. Distances between acoustic transmitters and receivers ranged from 200 m to >10 km in each line. The daily observed probability of detecting an acoustic transmission was used in simulation models to estimate the probability of detecting a moving acoustic transmitter on a line of receivers.ResultsThe probability of detecting an acoustic transmitter on a receiver 1000 m away differed by month for different receiver lines in Lake Huron and Saginaw Bay but was similar for paired acoustic transmitters deployed 250 m apart within the same line. Mean probability of detecting an acoustic transmitter at 1000 m calculated over the study period varied among acoustic transmitters 250 m apart within a line and differed among receiver lines in Lake Huron and Saginaw Bay. The simulated probability of detecting a moving acoustic transmitter on a receiver line was characterized by short periods of time with decreased detection. Although increased receiver spacing and higher fish movement rates decreased simulated detection probability, the location of the simulated receiver line in Lake Huron had the strongest effect on simulated detection probability.ConclusionsPerformance of receiver lines in Lake Huron varied across a range of spatiotemporal scales and was inconsistent among receiver lines. Our simulations indicated that if 69 kHz acoustic transmitters operating at 158 dB in 10–30 m of freshwater were being used, then receivers should be placed 1000 m apart to ensure that all fish moving at 1 m s−1 or less will be detected 90% of days over a 2-year period. Whereas these results can be used as general guidelines for designing new studies, the irregular variation in acoustic transmitter detection probabilities we observed among receiver line locations in Lake Huron makes designing receiver lines in similar systems challenging and emphasizes the need to conduct post hoc analyses of acoustic transmitter detection probabilities.
The global dynamics for a stochastic SIS epidemic model with isolation
NASA Astrophysics Data System (ADS)
Chen, Yiliang; Wen, Buyu; Teng, Zhidong
2018-02-01
In this paper, we investigate the dynamical behavior for a stochastic SIS epidemic model with isolation which is as an important strategy for the elimination of infectious diseases. It is assumed that the stochastic effects manifest themselves mainly as fluctuation in the transmission coefficient, the death rate and the proportional coefficient of the isolation of infective. It is shown that the extinction and persistence in the mean of the model are determined by a threshold value R0S . That is, if R0S < 1, then disease dies out with probability one, and if R0S > 1, then the disease is stochastic persistent in the means with probability one. Furthermore, the existence of a unique stationary distribution is discussed, and the sufficient conditions are established by using the Lyapunov function method. Finally, some numerical examples are carried out to confirm the analytical results.
Manlove, Kezia R.; Cassirer, E. Frances; Plowright, Raina K.; Cross, Paul C.; Hudson, Peter J.
2018-01-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife.We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia.We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections.Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs.Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit.This analysis demonstrates a simple logistic regression approach for testing a priori hypotheses about variation in the odds of transmission given contact for free-ranging hosts, and may be broadly applicable for investigations in wildlife disease ecology. PMID:28317104
Manlove, Kezia R; Cassirer, E Frances; Plowright, Raina K; Cross, Paul C; Hudson, Peter J
2017-07-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife. We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia. We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections. Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs. Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit. This analysis demonstrates a simple logistic regression approach for testing a priori hypotheses about variation in the odds of transmission given contact for free-ranging hosts, and may be broadly applicable for investigations in wildlife disease ecology. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.
Manlove, Kezia R.; Cassirer, E. Frances; Plowright, Raina K.; Cross, Paul C.; Hudson, Peter J.
2017-01-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife.We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia.We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections.Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs.Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit.This analysis demonstrates a simple logistic regression approach for testing a priorihypotheses about variation in the odds of transmission given contact for free-ranging hosts, and may be broadly applicable for investigations in wildlife disease ecology.
Real-time first-principles simulations of thermionic emission from N-doped diamond surfaces
NASA Astrophysics Data System (ADS)
Shinozaki, Tomoki; Hagiwara, Satoshi; Morioka, Naoya; Kimura, Yuji; Watanabe, Kazuyuki
2018-06-01
We investigate thermionic emission from N-doped C(100) surfaces terminated with H or Li atoms using finite-temperature real-time density functional theory simulations. The current–temperature characteristics are found to follow the Richardson–Dushman (RD) equation, which was derived from a semiclassical theory. However, the Richardson constants are two orders of magnitude smaller than the ideal values from the RD theory. This considerable reduction is attributed primarily to the extremely low transmission probability of electrons from the surfaces toward the vacuum. The present method enables straightforward evaluation of the ideal efficiency of a thermionic energy converter.
Aanen, Duur K.; Spelbrink, Johannes N.; Beekman, Madeleine
2014-01-01
The peculiar biology of mitochondrial DNA (mtDNA) potentially has detrimental consequences for organismal health and lifespan. Typically, eukaryotic cells contain multiple mitochondria, each with multiple mtDNA genomes. The high copy number of mtDNA implies that selection on mtDNA functionality is relaxed. Furthermore, because mtDNA replication is not strictly regulated, within-cell selection may favour mtDNA variants with a replication advantage, but a deleterious effect on cell fitness. The opportunities for selfish mtDNA mutations to spread are restricted by various organism-level adaptations, such as uniparental transmission, germline mtDNA bottlenecks, germline selection and, during somatic growth, regular alternation between fusion and fission of mitochondria. These mechanisms are all hypothesized to maintain functional mtDNA. However, the strength of selection for maintenance of functional mtDNA progressively declines with age, resulting in age-related diseases. Furthermore, organismal adaptations that most probably evolved to restrict the opportunities for selfish mtDNA create secondary problems. Owing to predominantly maternal mtDNA transmission, recombination among mtDNA from different individuals is highly restricted or absent, reducing the scope for repair. Moreover, maternal inheritance precludes selection against mtDNA variants with male-specific effects. We finish by discussing the consequences of life-history differences among taxa with respect to mtDNA evolution and make a case for the use of microorganisms to experimentally manipulate levels of selection. PMID:24864309
Transmission of electrons inside the cryogenic pumps of ITER injector.
Veltri, P; Sartori, E
2016-02-01
Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particle trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.
NASA Astrophysics Data System (ADS)
Binder, T.; Boldini, P. C.; Romano, F.; Herdrich, G.; Fasoulas, S.
2016-11-01
Atmosphere-Breathing Electric Propulsion systems (ABEP) are currently investigated to utilize the residual atmosphere as propellant for drag-compensating thrusters on spacecraft in (very) low orbits. The key concept for an efficient intake of such a system is to feed a large fraction of the incoming flow to the thruster by a high transmission probability Θ for the inflow while Θ for the backflow should be as low as possible. This is the case for rarefied flows through tube-like structures of arbitrary cross section when assuming diffuse wall reflections inside and after these ducts, and entrance velocities u larger than thermal velocities vt h∝√{kBT /m } . The theory of transmission for free molecular flow through cylinders is well known for u = 0, but less research results are available for u > 0. In this paper, the desired theoretical characteristics of intakes for ABEP are pointed out, a short review of transmission probabilities is given, and results of Monte Carlo simulations concerning Θ are presented. Based on simple algebraic relations, an intake can be optimized in terms of collection efficiency by choosing optimal ducts. It is shown that Θ depends only on non-dimensional values of the duct geometry combined with vth and u. The simulation results of a complete exemplary ABEP configuration illustrate the influence of modeling quality in terms of inflow conditions and inter-particle collisions.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-28
... bring together experts from diverse backgrounds and experiences including electric system operators... transmission switching; AC optimal power flow modeling; and use of active and dynamic transmission ratings. In... variability of the system, including forecast error? [cir] How can outage probability be captured in...
Cluster of Nipah virus infection, Kushtia District, Bangladesh, 2007.
Homaira, Nusrat; Rahman, Mahmudur; Hossain, M Jahangir; Nahar, Nazmun; Khan, Rasheda; Rahman, Mostafizur; Podder, Goutam; Nahar, Kamrun; Khan, Dawlat; Gurley, Emily S; Rollin, Pierre E; Comer, James A; Ksiazek, Thomas G; Luby, Stephen P
2010-10-21
In March 2007, we investigated a cluster of Nipah encephalitis to identify risk factors for Nipah infection in Bangladesh. We defined confirmed Nipah cases by the presence of IgM and IgG antibodies against Nipah virus in serum. Case-patients, who resided in the same village during the outbreak period but died before serum could be collected, were classified as probable cases. We identified three confirmed and five probable Nipah cases. There was a single index case. Five of the secondary cases came in close physical contact to the index case when she was ill. Case-patients were more likely to have physical contact with the index case (71% cases versus 0% controls, p = <0.001). The index case, on her third day of illness, and all the subsequent cases attended the same religious gathering. For three probable cases including the index case, we could not identify any known risk factors for Nipah infection such as physical contact with Nipah case-patients, consumption of raw date palm juice, or contact with sick animals or fruit bats. Though person-to-person transmission remains an important mode of transmission for Nipah infection, we could not confirm the source of infection for three of the probable Nipah case-patients. Continued surveillance and outbreak investigations will help better understand the transmission of Nipah virus and develop preventive strategies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacvarov, D.C.
1981-01-01
A new method for probabilistic risk assessment of transmission line insulation flashovers caused by lightning strokes is presented. The utilized approach of applying the finite element method for probabilistic risk assessment is demonstrated to be very powerful. The reasons for this are two. First, the finite element method is inherently suitable for analysis of three dimensional spaces where the parameters, such as three variate probability densities of the lightning currents, are non-uniformly distributed. Second, the finite element method permits non-uniform discretization of the three dimensional probability spaces thus yielding high accuracy in critical regions, such as the area of themore » low probability events, while at the same time maintaining coarse discretization in the non-critical areas to keep the number of grid points and the size of the problem to a manageable low level. The finite element probabilistic risk assessment method presented here is based on a new multidimensional search algorithm. It utilizes an efficient iterative technique for finite element interpolation of the transmission line insulation flashover criteria computed with an electro-magnetic transients program. Compared to other available methods the new finite element probabilistic risk assessment method is significantly more accurate and approximately two orders of magnitude computationally more efficient. The method is especially suited for accurate assessment of rare, very low probability events.« less
Recurrent invasion and extinction of a selfish gene.
Goddard, M R; Burt, A
1999-11-23
Homing endonuclease genes show super-Mendelian inheritance, which allows them to spread in populations even when they are of no benefit to the host organism. To test the idea that regular horizontal transmission is necessary for the long-term persistence of these genes, we surveyed 20 species of yeasts for the omega-homing endonuclease gene and associated group I intron. The status of omega could be categorized into three states (functional, nonfunctional, or absent), and status was not clustered on the host phylogeny. Moreover, the phylogeny of omega differed significantly from that of the host, strong evidence of horizontal transmission. Further analyses indicate that horizontal transmission is more common than transposition, and that it occurs preferentially between closely related species. Parsimony analysis and coalescent theory suggest that there have been 15 horizontal transmission events in the ancestry of our yeast species, through simulations indicate that this value is probably an underestimate. Overall, the data support a cyclical model of invasion, degeneration, and loss, followed by reinvasion, and each of these transitions is estimated to occur about once every 2 million years. The data are thus consistent with the idea that frequent horizontal transmission is necessary for the long-term persistence of homing endonuclease genes, and further, that this requirement limits these genes to organisms with easily accessible germ lines. The data also show that mitochondrial DNA sequences are transferred intact between yeast species; if other genes do not show such high levels of horizontal transmission, it would be due to lack of selection, rather than lack of opportunity.
NASA Astrophysics Data System (ADS)
Selim, M. M.; Bezák, V.
2003-06-01
The one-dimensional version of the radiative transfer problem (i.e. the so-called rod model) is analysed with a Gaussian random extinction function (x). Then the optical length X = 0 Ldx(x) is a Gaussian random variable. The transmission and reflection coefficients, T(X) and R(X), are taken as infinite series. When these series (and also when the series representing T 2(X), T 2(X), R(X)T(X), etc.) are averaged, term by term, according to the Gaussian statistics, the series become divergent after averaging. As it was shown in a former paper by the authors (in Acta Physica Slovaca (2003)), a rectification can be managed when a `modified' Gaussian probability density function is used, equal to zero for X > 0 and proportional to the standard Gaussian probability density for X > 0. In the present paper, the authors put forward an alternative, showing that if the m.s.r. of X is sufficiently small in comparison with & $bar X$ ; , the standard Gaussian averaging is well functional provided that the summation in the series representing the variable T m-j (X)R j (X) (m = 1,2,..., j = 1,...,m) is truncated at a well-chosen finite term. The authors exemplify their analysis by some numerical calculations.
Manjarrez, E; Rojas-Piloni, J G; Jimenez, I; Rudomin, P
2000-12-01
We examined, in the anaesthetised cat, the influence of the neuronal ensembles producing spontaneous negative cord dorsum potentials (nCDPs) on segmental pathways mediating primary afferent depolarisation (PAD) of cutaneous and group I muscle afferents and on Ia monosynaptic activation of spinal motoneurones. The intraspinal distribution of the field potentials associated with the spontaneous nCDPs indicated that the neuronal ensembles involved in the generation of these potentials were located in the dorsal horn of lumbar segments, in the same region of termination of low-threshold cutaneous afferents. During the occurrence of spontaneous nCDPs, transmission from low-threshold cutaneous afferents to second order neurones in laminae III-VI, as well as transmission along pathways mediating PAD of cutaneous and Ib afferents, was facilitated. PAD of Ia afferents was instead inhibited. Monosynaptic reflexes of flexors and extensors were facilitated during the spontaneous nCDPs. The magnitude of the facilitation was proportional to the amplitude of the 'conditioning' spontaneous nCDPs. This led to a high positive correlation between amplitude fluctuations of spontaneous nCDPs and fluctuations of monosynaptic reflexes. Stimulation of low-threshold cutaneous afferents transiently reduced the probability of occurrence of spontaneous nCDPs as well as the fluctuations of monosynaptic reflexes. It is concluded that the spontaneous nCDPs were produced by the activation of a population of dorsal horn neurones that shared the same functional pathways and involved the same set of neurones as those responding monosynaptically to stimulation of large cutaneous afferents. The spontaneous activity of these neurones was probably the main cause of the fluctuations of the monosynaptic reflexes observed under anaesthesia and could provide a dynamic linkage between segmental sensory and motor pathways.
Theta frequency background tunes transmission but not summation of spiking responses.
Parameshwaran, Dhanya; Bhalla, Upinder S
2013-01-01
Hippocampal neurons are known to fire as a function of frequency and phase of spontaneous network rhythms, associated with the animal's behaviour. This dependence is believed to give rise to precise rate and temporal codes. However, it is not well understood how these periodic membrane potential fluctuations affect the integration of synaptic inputs. Here we used sinusoidal current injection to the soma of CA1 pyramidal neurons in the rat brain slice to simulate background oscillations in the physiologically relevant theta and gamma frequency range. We used a detailed compartmental model to show that somatic current injection gave comparable results to more physiological synaptically driven theta rhythms incorporating excitatory input in the dendrites, and inhibitory input near the soma. We systematically varied the phase of synaptic inputs with respect to this background, and recorded changes in response and summation properties of CA1 neurons using whole-cell patch recordings. The response of the cell was dependent on both the phase of synaptic inputs and frequency of the background input. The probability of the cell spiking for a given synaptic input was up to 40% greater during the depolarized phases between 30-135 degrees of theta frequency current injection. Summation gain on the other hand, was not affected either by the background frequency or the phasic afferent inputs. This flat summation gain, coupled with the enhanced spiking probability during depolarized phases of the theta cycle, resulted in enhanced transmission of summed inputs during the same phase window of 30-135 degrees. Overall, our study suggests that although oscillations provide windows of opportunity to selectively boost transmission and EPSP size, summation of synaptic inputs remains unaffected during membrane oscillations.
Wang, Xueying; Gautam, Raju; Pinedo, Pablo J; Allen, Linda J S; Ivanek, Renata
2014-08-01
Many infectious agents transmitting through a contaminated environment are able to persist in the environment depending on the temperature and sanitation determined rates of their replication and clearance, respectively. There is a need to elucidate the effect of these factors on the infection transmission dynamics in terms of infection outbreaks and extinction while accounting for the random nature of the process. Also, it is important to distinguish between the true and apparent extinction, where the former means pathogen extinction in both the host and the environment while the latter means extinction only in the host population. This study proposes a stochastic-differential equation model as an approximation to a Markov jump process model, using Escherichia coli O157:H7 in cattle as a model system. In the model, the host population infection dynamics are described using the standard susceptible-infected-susceptible framework, and the E. coli O157:H7 population in the environment is represented by an additional variable. The backward Kolmogorov equations that determine the probability distribution and the expectation of the first passage time are provided in a general setting. The outbreak and apparent extinction of infection are investigated by numerically solving the Kolmogorov equations for the probability density function of the associated process and the expectation of the associated stopping time. The results provide insight into E. coli O157:H7 transmission and apparent extinction, and suggest ways for controlling the spread of infection in a cattle herd. Specifically, this study highlights the importance of ambient temperature and sanitation, especially during summer.
Kerkhofs, Amber; Xavier, Ana C.; da Silva, Beatriz S.; Canas, Paula M.; Idema, Sander; Baayen, Johannes C.; Ferreira, Samira G.; Cunha, Rodrigo A.; Mansvelder, Huibert D.
2018-01-01
Caffeine is the most widely used psychoactive drug, bolstering attention and normalizing mood and cognition, all functions involving cerebral cortical circuits. Whereas studies in rodents showed that caffeine acts through the antagonism of inhibitory A1 adenosine receptors (A1R), neither the role of A1R nor the impact of caffeine on human cortical neurons is known. We here provide the first characterization of the impact of realistic concentrations of caffeine experienced by moderate coffee drinkers (50 μM) on excitability of pyramidal neurons and excitatory synaptic transmission in the human temporal cortex. Moderate concentrations of caffeine disinhibited several of the inhibitory A1R-mediated effects of adenosine, similar to previous observations in the rodent brain. Thus, caffeine restored the adenosine-induced decrease of both intrinsic membrane excitability and excitatory synaptic transmission in the human pyramidal neurons through antagonism of post-synaptic A1R. Indeed, the A1R-mediated effects of endogenous adenosine were more efficient to inhibit synaptic transmission than neuronal excitability. This was associated with a distinct affinity of caffeine for synaptic versus extra-synaptic human cortical A1R, probably resulting from a different molecular organization of A1R in human cortical synapses. These findings constitute the first neurophysiological description of the impact of caffeine on pyramidal neuron excitability and excitatory synaptic transmission in the human temporal cortex, providing adequate ground for the effects of caffeine on cognition in humans. PMID:29354052
Yakimovich, Artur; Gumpert, Heidi; Burckhardt, Christoph J; Lütschg, Verena A; Jurgeit, Andreas; Sbalzarini, Ivo F; Greber, Urs F
2012-09-01
Viruses spread between cells, tissues, and organisms by cell-free and cell-cell transmissions. Both mechanisms enhance disease development, but it is difficult to distinguish between them. Here, we analyzed the transmission mode of human adenovirus (HAdV) in monolayers of epithelial cells by wet laboratory experimentation and a computer simulation. Using live-cell fluorescence microscopy and replication-competent HAdV2 expressing green fluorescent protein, we found that the spread of infection invariably occurred after cell lysis. It was affected by convection and blocked by neutralizing antibodies but was independent of second-round infections. If cells were overlaid with agarose, convection was blocked and round plaques developed around lytic infected cells. Infected cells that did not lyse did not give rise to plaques, highlighting the importance of cell-free transmission. Key parameters for cell-free virus transmission were the time from infection to lysis, the dose of free viruses determining infection probability, and the diffusion of single HAdV particles in aqueous medium. With these parameters, we developed an in silico model using multiscale hybrid dynamics, cellular automata, and particle strength exchange. This so-called white box model is based on experimentally determined parameters and reproduces viral infection spreading as a function of the local concentration of free viruses. These analyses imply that the extent of lytic infections can be determined by either direct plaque assays or can be predicted by calculations of virus diffusion constants and modeling.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew
Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less
Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; ...
2018-01-28
Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less
Towards flash-flood prediction in the dry Dead Sea region utilizing radar rainfall information
NASA Astrophysics Data System (ADS)
Morin, Efrat; Jacoby, Yael; Navon, Shilo; Bet-Halachmi, Erez
2009-07-01
Flash-flood warning models can save lives and protect various kinds of infrastructure. In dry climate regions, rainfall is highly variable and can be of high-intensity. Since rain gauge networks in such areas are sparse, rainfall information derived from weather radar systems can provide useful input for flash-flood models. This paper presents a flash-flood warning model which utilizes radar rainfall data and applies it to two catchments that drain into the dry Dead Sea region. Radar-based quantitative precipitation estimates (QPEs) were derived using a rain gauge adjustment approach, either on a daily basis (allowing the adjustment factor to change over time, assuming available real-time gauge data) or using a constant factor value (derived from rain gauge data) over the entire period of the analysis. The QPEs served as input for a continuous hydrological model that represents the main hydrological processes in the region, namely infiltration, flow routing and transmission losses. The infiltration function is applied in a distributed mode while the routing and transmission loss functions are applied in a lumped mode. Model parameters were found by calibration based on the 5 years of data for one of the catchments. Validation was performed for a subsequent 5-year period for the same catchment and then for an entire 10-year record for the second catchment. The probability of detection and false alarm rates for the validation cases were reasonable. Probabilistic flash-flood prediction is presented applying Monte Carlo simulations with an uncertainty range for the QPEs and model parameters. With low probability thresholds, one can maintain more than 70% detection with no more than 30% false alarms. The study demonstrates that a flash-flood warning model is feasible for catchments in the area studied.
Towards flash flood prediction in the dry Dead Sea region utilizing radar rainfall information
NASA Astrophysics Data System (ADS)
Morin, E.; Jacoby, Y.; Navon, S.; Bet-Halachmi, E.
2009-04-01
Flash-flood warning models can save lives and protect various kinds of infrastructure. In dry climate regions, rainfall is highly variable and can be of high-intensity. Since rain gauge networks in such areas are sparse, rainfall information derived from weather radar systems can provide useful input for flash-flood models. This paper presents a flash-flood warning model utilizing radar rainfall data and applies it to two catchments that drain into the dry Dead Sea region. Radar-based quantitative precipitation estimates (QPEs) were derived using a rain gauge adjustment approach, either on a daily basis (allowing the adjustment factor to change over time, assuming available real-time gauge data) or using a constant factor value (derived from rain gauge data) over the entire period of the analysis. The QPEs served as input for a continuous hydrological model that represents the main hydrological processes in the region, namely infiltration, flow routing and transmission losses. The infiltration function is applied in a distributed mode while the routing and transmission loss functions are applied in a lumped mode. Model parameters were found by calibration based on five years of data for one of the catchments. Validation was performed for a subsequent five-year period for the same catchment and then for an entire ten year record for the second catchment. The probability of detection and false alarm rates for the validation cases were reasonable. Probabilistic flash-flood prediction is presented applying Monte Carlo simulations with an uncertainty range for the QPEs and model parameters. With low probability thresholds, one can maintain more than 70% detection with no more than 30% false alarms. The study demonstrates that a flash-flood-warning model is feasible for catchments in the area studied.
18 CFR 358.5 - Independent functioning rule.
Code of Federal Regulations, 2010 CFR
2010-04-01
... its marketing function employees. (b) Separation of functions. (1) A transmission provider is prohibited from permitting its marketing function employees to: (i) Conduct transmission functions; or (ii... differs in any way from the access available to other transmission customers. (2) A transmission provider...
Andreo, Verónica; Glass, Gregory; Shields, Timothy; Provensal, Cecilia; Polop, Jaime
2011-09-01
We constructed a model to predict the potential distribution of Oligoryzomys longicaudatus, the reservoir of Andes virus (Genus: Hantavirus), in Argentina. We developed an extensive database of occurrence records from published studies and our own surveys and compared two methods to model the probability of O. longicaudatus presence; logistic regression and MaxEnt algorithm. The environmental variables used were tree, grass and bare soil cover from MODIS imagery and, altitude and 19 bioclimatic variables from WorldClim database. The models performances were evaluated and compared both by threshold dependent and independent measures. The best models included tree and grass cover, mean diurnal temperature range, and precipitation of the warmest and coldest seasons. The potential distribution maps for O. longicaudatus predicted the highest occurrence probabilities along the Andes range, from 32°S and narrowing southwards. They also predicted high probabilities for the south-central area of Argentina, reaching the Atlantic coast. The Hantavirus Pulmonary Syndrome cases coincided with mean occurrence probabilities of 95 and 77% for logistic and MaxEnt models, respectively. HPS transmission zones in Argentine Patagonia matched the areas with the highest probability of presence. Therefore, colilargos presence probability may provide an approximate risk of transmission and act as an early tool to guide control and prevention plans.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marsequerra, M.; Pauli, G.
1958-12-01
On the basis of the results obtained in Part I (CNC-1), expressions are derived for the transmission probability through a revolving curved slit for neutrons having a velocity distribution f(v), the distribution shown by the neutrons after the flight, and the uncertainty in the energy of neutrons detected in an infinitesimal time interval. (auth)
The potential for sexual transmission to compromise control of Ebola virus outbreaks.
Vinson, John E; Drake, John M; Rohani, Pejman; Park, Andrew W
2016-06-01
Recent evidence suggests that sexual contact may give rise to transmission of Ebola virus long after infection has been cleared from blood. We develop a simple mathematical model that incorporates contact transmission and sexual transmission parametrized from data relating to the 2013-2015 West African Ebola epidemic. The model explores scenarios where contact transmission is reduced following infection events, capturing behaviour change, and quantifies how these actions reducing transmission may be compromised by sexual transmission in terms of increasing likelihood, size and duration of outbreaks. We characterize the extent to which sexual transmission operates in terms of the probability of initial infection resolving to sexual infectiousness and the sexual transmission rate, and relate these parameters to the overall case burden. We find that sexual transmission can have large effects on epidemic dynamics (increasing attack ratios from 25% in scenarios without sexual transmission but with contact-transmission-reducing behaviour, up to 80% in equivalent scenarios with sexual transmission). © 2016 The Author(s).
Cambon, Karine; Hansen, Stine M; Venero, Cesar; Herrero, A Isabel; Skibo, Galina; Berezin, Vladimir; Bock, Elisabeth; Sandi, Carmen
2004-04-28
The neural cell adhesion molecule (NCAM) plays a critical role in development and plasticity of the nervous system and is involved in the mechanisms of learning and memory. Here, we show that intracerebroventricular administration of the FG loop (FGL), a synthetic 15 amino acid peptide corresponding to the binding site of NCAM for the fibroblast growth factor receptor 1 (FGFR1), immediately after training rats in fear conditioning or water maze learning, induced a long-lasting improvement of memory. In primary cultures of hippocampal neurons, FGL enhanced the presynaptic function through activation of FGFR1 and promoted synapse formation. These results provide the first evidence for a memory-facilitating effect resulting from a treatment that mimics NCAM function. They suggest that increased efficacy of synaptic transmission and formation of new synapses probably mediate the cognition-enhancing properties displayed by the peptide.
Transmission of electrons inside the cryogenic pumps of ITER injector
DOE Office of Scientific and Technical Information (OSTI.GOV)
Veltri, P., E-mail: pierluigi.veltri@igi.cnr.it; Sartori, E.
2016-02-15
Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particlemore » trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.« less
Analytical study of nano-scale logical operations
NASA Astrophysics Data System (ADS)
Patra, Moumita; Maiti, Santanu K.
2018-07-01
A complete analytical prescription is given to perform three basic (OR, AND, NOT) and two universal (NAND, NOR) logic gates at nano-scale level using simple tailor made geometries. Two different geometries, ring-like and chain-like, are taken into account where in each case the bridging conductor is coupled to a local atomic site through a dangling bond whose site energy can be controlled by means of external gate electrode. The main idea is that when injecting electron energy matches with site energy of local atomic site transmission probability drops exactly to zero, whereas the junction exhibits finite transmission for other energies. Utilizing this prescription we perform logical operations, and, we strongly believe that the proposed results can be verified in laboratory. Finally, we numerically compute two-terminal transmission probability considering general models and the numerical results match exactly well with our analytical findings.
NASA Astrophysics Data System (ADS)
Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.
2011-04-01
One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.
Potential for Zika Virus to Establish a Sylvatic Transmission Cycle in the Americas
Althouse, Benjamin M.; Vasilakis, Nikos; Sall, Amadou A.; Diallo, Mawlouth; Weaver, Scott C.; Hanley, Kathryn A.
2016-01-01
Zika virus (ZIKV) originated and continues to circulate in a sylvatic transmission cycle between non-human primate hosts and arboreal mosquitoes in tropical Africa. Recently ZIKV invaded the Americas, where it poses a threat to human health, especially to pregnant women and their infants. Here we examine the risk that ZIKV will establish a sylvatic cycle in the Americas, focusing on Brazil. We review the natural history of sylvatic ZIKV and present a mathematical dynamic transmission model to assess the probability of establishment of a sylvatic ZIKV transmission cycle in non-human primates and/or other mammals and arboreal mosquito vectors in Brazil. Brazil is home to multiple species of primates and mosquitoes potentially capable of ZIKV transmission, though direct assessment of host competence (ability to mount viremia sufficient to infect a feeding mosquito) and vector competence (ability to become infected with ZIKV and disseminate and transmit upon subsequent feedings) of New World species is lacking. Modeling reveals a high probability of establishment of sylvatic ZIKV across a large range of biologically plausible parameters. Probability of establishment is dependent on host and vector population sizes, host birthrates, and ZIKV force of infection. Research on the host competence of New World monkeys or other small mammals to ZIKV, on vector competence of New World Aedes, Sabethes, and Haemagogus mosquitoes for ZIKV, and on the geographic range of potential New World hosts and vectors is urgently needed. A sylvatic cycle of ZIKV would make future elimination efforts in the Americas practically impossible, and paints a dire picture for the epidemiology of ZIKV and our ability to end the ongoing outbreak of congenital Zika syndrome. PMID:27977671
Hui, B; Fairley, C K; Chen, M; Grulich, A; Hocking, J; Prestage, G; Walker, S; Law, M; Regan, D
2015-08-01
Despite early treatment of urethral infection, gonorrhoea is endemic in urban populations of men who have sex with men (MSM) in Australia. By contrast, gonorrhoea is not common in urban heterosexual populations. Sexual activities among MSM usually involve anal or oral sex, and as these behaviours are becoming increasingly common among heterosexuals, there is a need to investigate their roles in transmission of gonorrhoea. We developed individual-based models of transmission of gonorrhoea in MSM and heterosexuals that incorporate anatomical site-specific transmission of gonorrhoea. We estimated the probabilities of transmission for anal sex and oral sex by calibrating an MSM model against prevalence of gonorrhoea and sexual activity data. These probabilities were then applied to a heterosexual model in order to examine whether gonorrhoea can persist in a heterosexual population through the addition of anal sex and oral sex. In the MSM model, gonorrhoea can persist despite prompt treatment of urethral infections. The probability of gonorrhoea persisting is reduced if use of condom for oral sex is increased to more than 15% of acts. Assuming that treatment of symptomatic infections is prompt, gonorrhoea is unlikely to persist in a heterosexual population even with the addition of anal and oral sex. Our models suggest that oral sex has an important role in sustaining gonorrhoea in a population of MSM by providing a pool of untreated asymptomatic infection. The importance of anal sex or oral sex in sustaining gonorrhoea in a heterosexual population remains uncertain due to the lack of information linking different types of sex acts and transmissibility. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
The neutron channeling phenomenon.
Khanouchi, A; Sabir, A; Boulkheir, M; Ichaoui, R; Ghassoun, J; Jehouani, A
1997-01-01
Shields, used for protection against radiation, are often pierced with vacuum channels for passing cables and other instruments for measurements. The neutron transmission through these shields is an unavoidable phenomenon. In this work we study and discuss the effect of channels on neutron transmission through shields. We consider an infinite homogeneous slab, with a fixed thickness (20 lambda, with lambda the mean free path of the neutron in the slab), which contains a vacuum channel. This slab is irradiated with an infinite source of neutrons on the left side and on the other side (right side) many detectors with windows equal to 2 lambda are placed in order to evaluate the neutron transmission probabilities (Khanouchi, A., Aboubekr, A., Ghassoun, J. and Jehouani, A. (1994) Rencontre Nationale des Jeunes Chercheurs en Physique. Casa Blanca Maroc; Khanouchi, A., Sabir, A., Ghassoun, J. and Jehouani, A. (1995) Premier Congré International des Intéractions Rayonnements Matière. Eljadida Maroc). The neutron history within the slab is simulated by the Monte Carlo method (Booth, T. E. and Hendricks, J. S. (1994) Nuclear Technology 5) and using the exponential biasing technique in order to improve the Monte Carlo calculation (Levitt, L. B. (1968) Nuclear Science and Engineering 31, 500-504; Jehouani, A., Ghassoun, J. and Aboubker, A. (1994) In Proceedings of the 6th International Symposium on Radiation Physics, Rabat, Morocco). Then different geometries of the vacuum channel have been studied. For each geometry we have determined the detector response and calculated the neutron transmission probability for different detector positions. This neutron transmission probability presents a peak for the detectors placed in front of the vacuum channel. This study allowed us to clearly identify the neutron channeling phenomenon. One application of our study is to detect vacuum defects in materials.
Potential for Zika Virus to Establish a Sylvatic Transmission Cycle in the Americas.
Althouse, Benjamin M; Vasilakis, Nikos; Sall, Amadou A; Diallo, Mawlouth; Weaver, Scott C; Hanley, Kathryn A
2016-12-01
Zika virus (ZIKV) originated and continues to circulate in a sylvatic transmission cycle between non-human primate hosts and arboreal mosquitoes in tropical Africa. Recently ZIKV invaded the Americas, where it poses a threat to human health, especially to pregnant women and their infants. Here we examine the risk that ZIKV will establish a sylvatic cycle in the Americas, focusing on Brazil. We review the natural history of sylvatic ZIKV and present a mathematical dynamic transmission model to assess the probability of establishment of a sylvatic ZIKV transmission cycle in non-human primates and/or other mammals and arboreal mosquito vectors in Brazil. Brazil is home to multiple species of primates and mosquitoes potentially capable of ZIKV transmission, though direct assessment of host competence (ability to mount viremia sufficient to infect a feeding mosquito) and vector competence (ability to become infected with ZIKV and disseminate and transmit upon subsequent feedings) of New World species is lacking. Modeling reveals a high probability of establishment of sylvatic ZIKV across a large range of biologically plausible parameters. Probability of establishment is dependent on host and vector population sizes, host birthrates, and ZIKV force of infection. Research on the host competence of New World monkeys or other small mammals to ZIKV, on vector competence of New World Aedes, Sabethes, and Haemagogus mosquitoes for ZIKV, and on the geographic range of potential New World hosts and vectors is urgently needed. A sylvatic cycle of ZIKV would make future elimination efforts in the Americas practically impossible, and paints a dire picture for the epidemiology of ZIKV and our ability to end the ongoing outbreak of congenital Zika syndrome.
18 CFR 358.6 - No conduit rule.
Code of Federal Regulations, 2010 CFR
2010-04-01
... of an affiliate of a transmission provider that is engaged in marketing functions, is prohibited from disclosing non-public transmission function information to any of the transmission provider's marketing... non-public transmission function information to its marketing function employees. (b) An employee...
Pneumonic Plague Cluster, Uganda, 2004
Asiki, Gershim; Anywaine, Zaccheus; Yockey, Brook; Schriefer, Martin E.; Aleti, Philliam; Ogen-Odoi, Asaph; Staples, J. Erin; Sexton, Christopher; Bearden, Scott W.; Kool, Jacob L.
2006-01-01
The public and clinicians have long-held beliefs that pneumonic plague is highly contagious; inappropriate alarm and panic have occurred during outbreaks. We investigated communicability in a naturally occurring pneumonic plague cluster. We defined a probable pneumonic plague case as an acute-onset respiratory illness with bloody sputum during December 2004 in Kango Subcounty, Uganda. A definite case was a probable case with laboratory evidence of Yersinia pestis infection. The cluster (1 definite and 3 probable cases) consisted of 2 concurrent index patient–caregiver pairs. Direct fluorescent antibody microscopy and polymerase chain reaction testing on the only surviving patient's sputum verified plague infection. Both index patients transmitted pneumonic plague to only 1 caregiver each, despite 23 additional untreated close contacts (attack rate 8%). Person-to-person transmission was compatible with transmission by respiratory droplets, rather than aerosols, and only a few close contacts, all within droplet range, became ill. PMID:16704785
Emergence and maintenance of infectious salmon anaemia virus (ISAV) in Europe: a new hypothesis.
Nylund, A; Devold, M; Plarre, H; Isdal, E; Aarseth, M
2003-08-15
The present study describes the use of molecular methods in studying infectious salmon anaemia virus (ISAV), an important pathogen of farmed salmon in Norway, Scotland, the Faeroe Islands, Canada, USA and Chile. The nucleotide sequences of the haemagglutinin gene (HA) from 70 ISAV isolates have been analysed for phylogenetic relationship and the average mutation rate of nucleotide substitutions calculated. The isolates constitute 2 major groups, 1 European and 1 North American group. The isolate from Chile is closely related to the North American isolates. The European isolates can be further divided into 3 separate groups reflecting geographical distribution, time of collection, and transmission connected with farming activity. Based on existing information about infectious salmon anaemia (ISA) and new information emerging from the present study, it is hypothesised that: (1) ISAV is maintained in wild populations of trout and salmon in Europe; (2) it is transmitted between wild hosts mainly during their freshwater spawning phase in rivers; (3) wild salmonids, mainly trout, possibly carry benign wild-type ISAV isolates; (4) a change (mutation) in virulence probably results from deletions of amino acid segments from the highly polymorphic region (HPR) of benign wild-type isolates; (5) ISA emerges in farmed Atlantic salmon when mutated isolates are transmitted from wild salmonids or, following mutation of benign isolates, in farmed salmon after transmission from wild salmonids; (6) farming activity is an important factor in transmission of ISAV between farming sites in addition to transmission of ISAV from wild salmonids to farmed salmon; (7) transmission of ISAV from farmed to wild salmonids probably occurs less frequently than transmission from wild to farmed fish due to lower frequency of susceptible wild individuals; (8) the frequency of new outbreaks of ISA in farmed salmon probably reflects natural variation in the prevalence of ISAV in wild populations of salmonids.
Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Tall, Ben D; Keys, Christine E; Ziobro, George C
2015-07-31
The mechanical transmission of pathogenic bacteria by synanthropic filth flies is widely recognized. While many studies report the fate and the temporospatial distribution of ingested foodborne bacteria by filth flies, there is little evidence about the transmission dynamics of ingested foodborne bacteria by adult house flies (Musca domestica) to their progeny. In this study, we fed parental house fly adults with food contaminated with low, medium, and high concentrations of Salmonella enterica, Cronobacter sakazakii, Escherichia coli O157:H7, and Listeria monocytogenes and evaluated the probability of transmission of these pathogens to house fly eggs and the surface and the alimentary canal of their first filial (F1) generation adults. All foodborne pathogens were present in samples containing pooled house fly eggs. The probability of transmission was higher after parental house flies ingested food containing medium bacterial loads. Cronobacter sakazakii was 16, 6, and 3 times more likely to be transmitted to house fly eggs than S. enterica, E. coli O157:H7, and L. monocytogenes, respectively. Only S. enterica and C. sakazakii were transmitted to F1 generation adults and their presence was 2.4 times more likely on their body surfaces than in their alimentary canals. The highest probabilities of finding S. enterica (60 %) and C. sakazakii (28 %) on newly emerged F1 adults were observed after parental house flies ingested food containing medium and high levels of these pathogens, respectively. Our study demonstrates that adult house flies that fed from food contaminated with various levels of foodborne bacteria were able to transmit those pathogens to their eggs and some were further transmitted to newly emerged F1 generation adults, enhancing the vector potential of these insects. Understanding the type of associations that synanthropic filth flies establish with foodborne pathogens will help to elucidate transmission mechanisms and possible ways to mitigate the spread of foodborne pathogens.
Neural coding using telegraphic switching of magnetic tunnel junction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suh, Dong Ik; Bae, Gi Yoon; Oh, Heong Sik
2015-05-07
In this work, we present a synaptic transmission representing neural coding with spike trains by using a magnetic tunnel junction (MTJ). Telegraphic switching generates an artificial neural signal with both the applied magnetic field and the spin-transfer torque that act as conflicting inputs for modulating the number of spikes in spike trains. The spiking probability is observed to be weighted with modulation between 27.6% and 99.8% by varying the amplitude of the voltage input or the external magnetic field. With a combination of the reverse coding scheme and the synaptic characteristic of MTJ, an artificial function for the synaptic transmissionmore » is achieved.« less
Potential Impact of Sexual Transmission on Ebola Virus Epidemiology: Sierra Leone as a Case Study.
Abbate, Jessica L; Murall, Carmen Lia; Richner, Heinz; Althaus, Christian L
2016-05-01
Sexual transmission of Ebola virus disease (EVD) 6 months after onset of symptoms has been recently documented, and Ebola virus RNA has been detected in semen of survivors up to 9 months after onset of symptoms. As countries affected by the 2013-2015 epidemic in West Africa, by far the largest to date, are declared free of Ebola virus disease (EVD), it remains unclear what threat is posed by rare sexual transmission events that could arise from survivors. We devised a compartmental mathematical model that includes sexual transmission from convalescent survivors: a SEICR (susceptible-exposed-infectious-convalescent-recovered) transmission model. We fitted the model to weekly incidence of EVD cases from the 2014-2015 epidemic in Sierra Leone. Sensitivity analyses and Monte Carlo simulations showed that a 0.1% per sex act transmission probability and a 3-month convalescent period (the two key unknown parameters of sexual transmission) create very few additional cases, but would extend the epidemic by 83 days [95% CI: 68-98 days] (p < 0.0001) on average. Strikingly, a 6-month convalescent period extended the average epidemic by 540 days (95% CI: 508-572 days), doubling the current length, despite an insignificant rise in the number of new cases generated. Our results show that reductions in the per sex act transmission probability via abstinence and condom use should reduce the number of sporadic sexual transmission events, but will not significantly reduce the epidemic size and may only minimally shorten the length of time the public health community must maintain response preparedness. While the number of infectious survivors is expected to greatly decline over the coming months, our results show that transmission events may still be expected for quite some time as each event results in a new potential cluster of non-sexual transmission. Precise measurement of the convalescent period is thus important for planning ongoing surveillance efforts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brogi, Bharat Bhushan, E-mail: brogi-221179@yahoo.in; Ahluwalia, P. K.; Chand, Shyam
2015-06-24
Theoretical study of the Coulomb blockade effect on transport properties (Transmission Probability and I-V characteristics) for varied configuration of coupled quantum dot system has been studied by using Non Equilibrium Green Function(NEGF) formalism and Equation of Motion(EOM) method in the presence of magnetic flux. The self consistent approach and intra-dot Coulomb interaction is being taken into account. As the key parameters of the coupled quantum dot system such as dot-lead coupling, inter-dot tunneling and magnetic flux threading through the system can be tuned, the effect of asymmetry parameter and magnetic flux on this tuning is being explored in Coulomb blockademore » regime. The presence of the Coulomb blockade due to on-dot Coulomb interaction decreases the width of transmission peak at energy level ε + U and by adjusting the magnetic flux the swapping effect in the Fano peaks in asymmetric and symmetric parallel configuration sustains despite strong Coulomb blockade effect.« less
Neuromuscular transmission and muscle fatigue changes by nanostructured oxygen.
Ivannikov, Maxim V; Sugimori, Mutsuyuki; Llinás, Rodolfo R
2017-04-01
Oxygen (O 2 ) nanobubbles offer a new method for tissue oxygenation. The effects of O 2 nanobubbles on transmission at neuromuscular junctions (NMJs) and muscle function were explored in murine diaphragm. Electrophysiological parameters, NMJ ultrastructure, muscle force, and muscle fatigue were studied during superfusion with solutions with different oxygen levels or oxygen nanobubbles. High frequency nerve stimulation of muscles superfused with O 2 nanobubble solution slowed neurotransmission decline over those with either control or hyperoxic solution. O 2 nanobubble solution increased the amplitude of evoked end plate potentials and quantal content but did not affect spontaneous activity. Electron microscopy of stimulated O 2 nanobubble treated NMJs showed accumulation of large synaptic vesicles and endosome-like structures. O 2 nanobubble solution had no effects on isometric muscle force, but it significantly decreased fatigability and maximum force recovery time in nerve stimulated muscles. O 2 nanobubbles increase neurotransmission and reduce the probability of neurotransmission failure in muscle fatigue. Muscle Nerve 55: 555-563, 2017. © 2016 Wiley Periodicals, Inc.
Benschop, Jackie; Biggs, Patrick J.; Marshall, Jonathan C.; Hayman, David T.S.; Carter, Philip E.; Midwinter, Anne C.; Mather, Alison E.; French, Nigel P.
2017-01-01
During 1998–2012, an extended outbreak of Salmonella enterica serovar Typhimurium definitive type 160 (DT160) affected >3,000 humans and killed wild birds in New Zealand. However, the relationship between DT160 within these 2 host groups and the origin of the outbreak are unknown. Whole-genome sequencing was used to compare 109 Salmonella Typhimurium DT160 isolates from sources throughout New Zealand. We provide evidence that DT160 was introduced into New Zealand around 1997 and rapidly propagated throughout the country, becoming more genetically diverse over time. The genetic heterogeneity was evenly distributed across multiple predicted functional protein groups, and we found no evidence of host group differentiation between isolates collected from human, poultry, bovid, and wild bird sources, indicating ongoing transmission between these host groups. Our findings demonstrate how a comparative genomic approach can be used to gain insight into outbreaks, disease transmission, and the evolution of a multihost pathogen after a probable point-source introduction. PMID:28516864
Ramsey, J M; Salinas, E; Rodríguez, M H
1996-05-01
Naturally acquired transmission-blocking immunity to Plasmodium vivax was studied in three groups of patients from the southern coast of Mexico: primary cases (Group A, 61% of the study population), secondary cases with the prior infection seven or more months earlier (Group B, 23%), and secondary cases with the previous malaria experience within six months of the present study (Group C, 16%). Anopheles albimanus mosquitoes were fed with patients' infected blood cells in the presence of autologous or control serum, with or without heat-inactivation. Patients from all three groups had transmission-blocking immunity, although the quality and quantity of this blocking activity was significantly higher in the two secondary patient groups (B and C). Only primary malaria cases produced transmission-enhancing activity (23% of the cases), which was dependent on heat-labile serum components. The levels of patient group transmission-blocking immunity and mosquito infectivity were used to calculate the probabilities of a mosquito becoming infective after taking a blood meal from a P. vivax-infected patient from any one of the three groups. This probability was 0.025, with Group A patients providing the major source of these infections (92% risk from Group A and 4% risk for Groups B and C).
Potential for Rabies Control through Dog Vaccination in Wildlife-Abundant Communities of Tanzania
Fitzpatrick, Meagan C.; Hampson, Katie; Cleaveland, Sarah; Meyers, Lauren Ancel; Townsend, Jeffrey P.; Galvani, Alison P.
2012-01-01
Canine vaccination has been successful in controlling rabies in diverse settings worldwide. However, concerns remain that coverage levels which have previously been sufficient might be insufficient in systems where transmission occurs both between and within populations of domestic dogs and other carnivores. To evaluate the effectiveness of vaccination targeted at domestic dogs when wildlife also contributes to transmission, we applied a next-generation matrix model based on contract tracing data from the Ngorongoro and Serengeti Districts in northwest Tanzania. We calculated corresponding values of R 0, and determined, for policy purposes, the probabilities that various annual vaccination targets would control the disease, taking into account the empirical uncertainty in our field data. We found that transition rate estimates and corresponding probabilities of vaccination-based control indicate that rabies transmission in this region is driven by transmission within domestic dogs. Different patterns of rabies transmission between the two districts exist, with wildlife playing a more important part in Ngorongoro and leading to higher recommended coverage levels in that district. Nonetheless, our findings indicate that an annual dog vaccination campaign achieving the WHO-recommended target of 70% will control rabies in both districts with a high level of certainty. Our results support the feasibility of controlling rabies in Tanzania through dog vaccination. PMID:22928056
Real-time transmission of digital video using variable-length coding
NASA Technical Reports Server (NTRS)
Bizon, Thomas P.; Shalkhauser, Mary JO; Whyte, Wayne A., Jr.
1993-01-01
Huffman coding is a variable-length lossless compression technique where data with a high probability of occurrence is represented with short codewords, while 'not-so-likely' data is assigned longer codewords. Compression is achieved when the high-probability levels occur so frequently that their benefit outweighs any penalty paid when a less likely input occurs. One instance where Huffman coding is extremely effective occurs when data is highly predictable and differential coding can be applied (as with a digital video signal). For that reason, it is desirable to apply this compression technique to digital video transmission; however, special care must be taken in order to implement a communication protocol utilizing Huffman coding. This paper addresses several of the issues relating to the real-time transmission of Huffman-coded digital video over a constant-rate serial channel. Topics discussed include data rate conversion (from variable to a fixed rate), efficient data buffering, channel coding, recovery from communication errors, decoder synchronization, and decoder architectures. A description of the hardware developed to execute Huffman coding and serial transmission is also included. Although this paper focuses on matters relating to Huffman-coded digital video, the techniques discussed can easily be generalized for a variety of applications which require transmission of variable-length data.
Transmission events revealed in tuberculosis contact investigations in London.
Cavany, Sean M; Vynnycky, Emilia; Sumner, Tom; Macdonald, Neil; Thomas, H Lucy; White, Jacqui; White, Richard G; Maguire, Helen; Anderson, Charlotte
2018-04-27
Contact tracing is a key part of tuberculosis prevention and care, aiming to hasten diagnosis and prevent transmission. The proportion of case-contact pairs for which recent transmission occurred and the typical timespans between the index case and their contact accessing care are not known; we aimed to calculate these. We analysed individual-level TB contact tracing data, collected in London from 20/01/2011-31/12/2015, linked to tuberculosis surveillance and MIRU-VNTR 24-locus strain-typing information. Of pairs of index cases and contacts diagnosed with active tuberculosis, 85/314 (27%) had strain typing data available for both. Of these pairs, 79% (67/85) shared indistinguishable isolates, implying probable recent transmission. Of pairs in which both contact and the index case had a social risk factor, 11/11 (100%) shared indistinguishable isolates, compared to 55/75 (75%) of pairs in which neither had a social risk factor (P = 0.06). The median time interval between the index case and their contact accessing care was 42 days (IQR: 16, 96). As over 20% of pairs did probably not involve recent transmission between index case and contact, the effectiveness of contact tracing is not necessarily limited to those circumstances where the index case has transmitted disease to their close contacts.
2013-01-01
Background Plasmodium infections trigger complex immune reactions from their hosts against several life stages of the parasite, including gametocytes. These immune responses are highly variable, depending on age, genetics, and exposure history of the host as well as species and strain of parasite. Although the effects of host antibodies that act against gamete stages in the mosquito (due to uptake in the blood meal) are well documented, the effects of host immunity upon within-host gametocytes are not as well understood. This report consists of a theoretical population biology-based analysis to determine constraints that host immunity impose upon gametocyte population growth. The details of the mathematical models used for the analysis were guided by published reports of clinical and animal studies, incorporated plausible modalities of immune reactions to parasites, and were tailored to the life cycl es of the two most widespread human malaria pathogens, Plasmodium falciparum and Plasmodium vivax. Results For the same ability to bind and clear a target, the model simulations suggest that an antibody attacking immature gametocytes would tend to lower the overall density of transmissible mature gametocytes more than an antibody attacking the mature forms directly. Transmission of P. falciparum would be especially vulnerable to complete blocking by antibodies to its immature forms since its gametocytes take much longer to reach maturity than those of P. vivax. On the other hand, antibodies attacking the mature gametocytes directly would reduce the time the mature forms can linger in the host. Simulation results also suggest that varying the standard deviation in the time necessary for individual asexual parasites to develop and produce schizonts can affect the efficiency of production of transmissible gametocytes. Conclusions If mature gametocyte density determines the probability of transmission, both Plasmodium species, but especially P. falciparum, could bolster this probability through evasion or suppression of host immune responses against the immature gametocytes. However, if the long term lingering of mature gametocytes at low density in the host is also important to ensure transmission, then evasion or suppression of antibodies against the mature stages would bolster probability of transmission as well. PMID:23767770
NASA Astrophysics Data System (ADS)
Wang, Jixin; Wang, Zhenyu; Yu, Xiangjun; Yao, Mingyao; Yao, Zongwei; Zhang, Erping
2012-09-01
Highly versatile machines, such as wheel loaders, forklifts, and mining haulers, are subject to many kinds of working conditions, as well as indefinite factors that lead to the complexity of the load. The load probability distribution function (PDF) of transmission gears has many distributions centers; thus, its PDF cannot be well represented by just a single-peak function. For the purpose of representing the distribution characteristics of the complicated phenomenon accurately, this paper proposes a novel method to establish a mixture model. Based on linear regression models and correlation coefficients, the proposed method can be used to automatically select the best-fitting function in the mixture model. Coefficient of determination, the mean square error, and the maximum deviation are chosen and then used as judging criteria to describe the fitting precision between the theoretical distribution and the corresponding histogram of the available load data. The applicability of this modeling method is illustrated by the field testing data of a wheel loader. Meanwhile, the load spectra based on the mixture model are compiled. The comparison results show that the mixture model is more suitable for the description of the load-distribution characteristics. The proposed research improves the flexibility and intelligence of modeling, reduces the statistical error and enhances the fitting accuracy, and the load spectra complied by this method can better reflect the actual load characteristic of the gear component.
Tin Whisker Electrical Short Circuit Characteristics. Part 2
NASA Technical Reports Server (NTRS)
Courey, Karim J.; Asfour, Shihab S.; Onar, Arzu; Bayliss, Jon A.; Ludwig, Lawrence L.; Wright, Maria C.
2009-01-01
Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that has an unknown probability associated with it. Note however that due to contact resistance electrical shorts may not occur at lower voltage levels. In our first article we developed an empirical probability model for tin whisker shorting. In this paper, we develop a more comprehensive empirical model using a refined experiment with a larger sample size, in which we studied the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From the resulting data we estimated the probability distribution of an electrical short, as a function of voltage. In addition, the unexpected polycrystalline structure seen in the focused ion beam (FIB) cross section in the first experiment was confirmed in this experiment using transmission electron microscopy (TEM). The FIB was also used to cross section two card guides to facilitate the measurement of the grain size of each card guide's tin plating to determine its finish.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Extinction times of epidemic outbreaks in networks.
Holme, Petter
2013-01-01
In the Susceptible-Infectious-Recovered (SIR) model of disease spreading, the time to extinction of the epidemics happens at an intermediate value of the per-contact transmission probability. Too contagious infections burn out fast in the population. Infections that are not contagious enough die out before they spread to a large fraction of people. We characterize how the maximal extinction time in SIR simulations on networks depend on the network structure. For example we find that the average distances in isolated components, weighted by the component size, is a good predictor of the maximal time to extinction. Furthermore, the transmission probability giving the longest outbreaks is larger than, but otherwise seemingly independent of, the epidemic threshold.
A study of electric transmission lines for use on the lunar surface
NASA Technical Reports Server (NTRS)
Gaustad, Krista L.; Gordon, Lloyd B.; Weber, Jennifer R.
1994-01-01
The sources for electrical power on a lunar base are said to include solar/chemical, nuclear (static conversion), and nuclear (dynamic conversion). The transmission of power via transmission lines is more practical than power beaming or superconducting because of its low cost and reliable, proven technology. Transmission lines must have minimum mass, maximum efficiency, and the ability to operate reliably in the lunar environment. The transmission line design includes conductor material, insulator material, conductor geometry, conductor configuration, line location, waveform, phase selection, and frequency. This presentation oulines the design. Liquid and gaseous dielectrics are undesirable for long term use in the lunar vacuum due to a high probability of loss. Thus, insulation for high voltage transmission line will most likely be solid dielectric or vacuum insulation.
Viral Linkage in HIV-1 Seroconverters and Their Partners in an HIV-1 Prevention Clinical Trial
Campbell, Mary S.; Mullins, James I.; Hughes, James P.; Celum, Connie; Wong, Kim G.; Raugi, Dana N.; Sorensen, Stefanie; Stoddard, Julia N.; Zhao, Hong; Deng, Wenjie; Kahle, Erin; Panteleeff, Dana; Baeten, Jared M.; McCutchan, Francine E.; Albert, Jan; Leitner, Thomas; Wald, Anna; Corey, Lawrence; Lingappa, Jairam R.
2011-01-01
Background Characterization of viruses in HIV-1 transmission pairs will help identify biological determinants of infectiousness and evaluate candidate interventions to reduce transmission. Although HIV-1 sequencing is frequently used to substantiate linkage between newly HIV-1 infected individuals and their sexual partners in epidemiologic and forensic studies, viral sequencing is seldom applied in HIV-1 prevention trials. The Partners in Prevention HSV/HIV Transmission Study (ClinicalTrials.gov #NCT00194519) was a prospective randomized placebo-controlled trial that enrolled serodiscordant heterosexual couples to determine the efficacy of genital herpes suppression in reducing HIV-1 transmission; as part of the study analysis, HIV-1 sequences were examined for genetic linkage between seroconverters and their enrolled partners. Methodology/Principal Findings We obtained partial consensus HIV-1 env and gag sequences from blood plasma for 151 transmission pairs and performed deep sequencing of env in some cases. We analyzed sequences with phylogenetic techniques and developed a Bayesian algorithm to evaluate the probability of linkage. For linkage, we required monophyletic clustering between enrolled partners' sequences and a Bayesian posterior probability of ≥50%. Adjudicators classified each seroconversion, finding 108 (71.5%) linked, 40 (26.5%) unlinked, and 3 (2.0%) indeterminate transmissions, with linkage determined by consensus env sequencing in 91 (84%). Male seroconverters had a higher frequency of unlinked transmissions than female seroconverters. The likelihood of transmission from the enrolled partner was related to time on study, with increasing numbers of unlinked transmissions occurring after longer observation periods. Finally, baseline viral load was found to be significantly higher among linked transmitters. Conclusions/Significance In this first use of HIV-1 sequencing to establish endpoints in a large clinical trial, more than one-fourth of transmissions were unlinked to the enrolled partner, illustrating the relevance of these methods in the design of future HIV-1 prevention trials in serodiscordant couples. A hierarchy of sequencing techniques, analysis methods, and expert adjudication contributed to the linkage determination process. PMID:21399681
Pathogen transmission in relation to duration of attachment by Ixodes scapularis ticks.
Eisen, Lars
2018-03-01
The blacklegged tick, Ixodes scapularis, is the primary vector to humans in the eastern United States of the deer tick virus lineage of Powassan virus (Powassan virus disease); the protozoan parasite Babesia microti (babesiosis); and multiple bacterial disease agents including Anaplasma phagocytophilum (anaplasmosis), Borrelia burgdorferi and Borrelia mayonii (Lyme disease), Borrelia miyamotoi (relapsing fever-like illness, named Borrelia miyamotoi disease), and Ehrlichia muris eauclairensis (a minor causative agent of ehrlichiosis). With the notable exception of Powassan virus, which can be transmitted within minutes after attachment by an infected tick, there is no doubt that the risk of transmission of other I. scapularis-borne pathogens, including Lyme disease spirochetes, increases with the length of time (number of days) infected ticks are allowed to remain attached. This review summarizes data from experimental transmission studies to reinforce the important disease-prevention message that regular (at least daily) tick checks and prompt tick removal has strong potential to reduce the risk of transmission of I. scapularis-borne bacterial and parasitic pathogens from infected attached ticks. The most likely scenario for human exposure to an I. scapularis-borne pathogen is the bite by a single infected tick. However, recent reviews have failed to make a clear distinction between data based on transmission studies where experimental hosts were fed upon by a single versus multiple infected ticks. A summary of data from experimental studies on transmission of Lyme disease spirochetes (Bo. burgdorferi and Bo. mayonii) by I. scapularis nymphs indicates that the probability of transmission resulting in host infection, at time points from 24 to 72 h after nymphal attachment, is higher when multiple infected ticks feed together as compared to feeding by a single infected tick. In the specific context of risk for human infection, the most relevant experimental studies therefore are those where the probability of pathogen transmission at a given point in time after attachment was determined using a single infected tick. The minimum duration of attachment by single infected I. scapularis nymphs required for transmission to result in host infection is poorly defined for most pathogens, but experimental studies have shown that Powassan virus can be transmitted within 15 min of tick attachment and both A. phagocytophilum and Bo. miyamotoi within the first 24 h of attachment. There is no experimental evidence for transmission of Lyme disease spirochetes by single infected I. scapularis nymphs to result in host infection when ticks are attached for only 24 h (despite exposure of nearly 90 experimental rodent hosts across multiple studies) but the probability of transmission resulting in host infection appears to increase to approximately 10% by 48 h and reach 70% by 72 h for Bo. burgdorferi. Caveats to the results from experimental transmission studies, including specific circumstances (such as re-attachment of previously partially fed infected ticks) that may lead to more rapid transmission are discussed. Published by Elsevier GmbH.
Optimal Operation of Energy Storage in Power Transmission and Distribution
NASA Astrophysics Data System (ADS)
Akhavan Hejazi, Seyed Hossein
In this thesis, we investigate optimal operation of energy storage units in power transmission and distribution grids. At transmission level, we investigate the problem where an investor-owned independently-operated energy storage system seeks to offer energy and ancillary services in the day-ahead and real-time markets. We specifically consider the case where a significant portion of the power generated in the grid is from renewable energy resources and there exists significant uncertainty in system operation. In this regard, we formulate a stochastic programming framework to choose optimal energy and reserve bids for the storage units that takes into account the fluctuating nature of the market prices due to the randomness in the renewable power generation availability. At distribution level, we develop a comprehensive data set to model various stochastic factors on power distribution networks, with focus on networks that have high penetration of electric vehicle charging load and distributed renewable generation. Furthermore, we develop a data-driven stochastic model for energy storage operation at distribution level, where the distribution of nodal voltage and line power flow are modelled as stochastic functions of the energy storage unit's charge and discharge schedules. In particular, we develop new closed-form stochastic models for such key operational parameters in the system. Our approach is analytical and allows formulating tractable optimization problems. Yet, it does not involve any restricting assumption on the distribution of random parameters, hence, it results in accurate modeling of uncertainties. By considering the specific characteristics of random variables, such as their statistical dependencies and often irregularly-shaped probability distributions, we propose a non-parametric chance-constrained optimization approach to operate and plan energy storage units in power distribution girds. In the proposed stochastic optimization, we consider uncertainty from various elements, such as solar photovoltaic , electric vehicle chargers, and residential baseloads, in the form of discrete probability functions. In the last part of this thesis we address some other resources and concepts for enhancing the operation of power distribution and transmission systems. In particular, we proposed a new framework to determine the best sites, sizes, and optimal payment incentives under special contracts for committed-type DG projects to offset distribution network investment costs. In this framework, the aim is to allocate DGs such that the profit gained by the distribution company is maximized while each DG unit's individual profit is also taken into account to assure that private DG investment remains economical.
Altered corticospinal function during movement preparation in humans with spinal cord injury.
Federico, Paolo; Perez, Monica A
2017-01-01
In uninjured humans, transmission in the corticospinal pathway changes in a task-dependent manner during movement preparation. We investigated whether this ability is preserved in humans with incomplete chronic cervical spinal cord injury (SCI). Our results show that corticospinal excitability is altered in the preparatory phase of an upcoming movement when there is a need to suppress but not to execute rapid index finger voluntary contractions in individuals with SCI compared with controls. This is probably related to impaired transmission at a cortical and spinal level after SCI. Overall our findings indicate that deficits in corticospinal transmission in humans with chronic incomplete SCI are also present in the preparatory phase of upcoming movements. Corticospinal output is modulated in a task-dependent manner during the preparatory phase of upcoming movements in humans. Whether this ability is preserved after spinal cord injury (SCI) is unknown. In this study, we examined motor evoked potentials elicited by cortical (MEPs) and subcortical (CMEPs) stimulation of corticospinal axons and short-interval intracortical inhibition in the first dorsal interosseous muscle in the preparatory phase of a reaction time task where individuals with chronic incomplete cervical SCI and age-matched controls needed to suppress (NOGO) or initiate (GO) ballistic index finger isometric voluntary contractions. Reaction times were prolonged in SCI participants compared with control subjects and stimulation was provided ∼90 ms prior to movement onset in each group. During NOGO trials, both MEPs and CMEPs remained unchanged compared to baseline in SCI participants but were suppressed in control subjects. Notably, during GO trials, MEPs increased to a similar extent in both groups but CMEPs increased only in controls. The magnitude of short-interval intracortical inhibition increased in controls but not in SCI subjects during NOGO trials and decreased in both groups in GO trials. These novel observations reveal that humans with incomplete cervical SCI have an altered ability to modulate corticospinal excitability during movement preparation when there is a need to suppress but not to execute upcoming rapid finger movements, which is probably related to impaired transmission at a cortical and spinal level. Thus, deficits in corticospinal transmission after human SCI extend to the preparatory phase of upcoming movements. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.
Disease-emergence dynamics and control in a socially-structured wildlife species
NASA Astrophysics Data System (ADS)
Pepin, Kim M.; Vercauteren, Kurt C.
2016-04-01
Once a pathogen is introduced in a population, key factors governing rate of spread include contact structure, supply of susceptible individuals and pathogen life-history. We examined the interplay of these factors on emergence dynamics and efficacy of disease prevention and response. We contrasted transmission dynamics of livestock viruses with different life-histories in hypothetical populations of feral swine with different contact structures (homogenous, metapopulation, spatial and network). Persistence probability was near 0 for the FMDV-like case under a wide range of parameter values and contact structures, while persistence was probable for the CSFV-like case. There were no sets of conditions where the FMDV-like pathogen persisted in every stochastic simulation. Even when population growth rates were up to 300% annually, the FMDV-like pathogen persisted in <25% of simulations regardless of transmission probabilities and contact structure. For networks and spatial contact structure, persistence probability of the FMDV-like pathogen was always <10%. Because of its low persistence probability, even very early response to the FMDV-like pathogen in feral swine was unwarranted while response to the CSFV-like pathogen was generally effective. When pre-emergence culling of feral swine caused population declines, it was effective at decreasing outbreak size of both diseases by ≥80%.
Chicoli, A.; Butail, S.; Lun, Y.; Bak-Coleman, J.; Coombs, S.; Paley, D.A.
2014-01-01
To assess how flow affects school structure and threat detection, startle response rates of solitary and small groups of giant danio Devario aequipinnatus were compared to visual looming stimuli in flow and no-flow conditions. The instantaneous position and heading of each D. aequipinnatus were extracted from high-speed videos. Behavioural results indicate that (1) school structure is altered in flow such that D. aequipinnatus orient upstream while spanning out in a crosswise direction, (2) the probability of at least one D. aequipinnatus detecting the visual looming stimulus is higher in flow than no flow for both solitary D. aequipinnatus and groups of eight D. aequipinnatus, however, (3) the probability of three or more individuals responding is higher in no flow than flow. Taken together, these results indicate a higher probability of stimulus detection in flow but a higher probability of internal transmission of information in no flow. Finally, results were well predicted by a computational model of collective fright response that included the probability of direct detection (based on signal detection theory) and indirect detection (i.e. via interactions between group members) of threatening stimuli. This model provides a new theoretical framework for analysing the collective transfer of information among groups of fishes and other organisms. PMID:24773538
Psychophysics of the probability weighting function
NASA Astrophysics Data System (ADS)
Takahashi, Taiki
2011-03-01
A probability weighting function w(p) for an objective probability p in decision under risk plays a pivotal role in Kahneman-Tversky prospect theory. Although recent studies in econophysics and neuroeconomics widely utilized probability weighting functions, psychophysical foundations of the probability weighting functions have been unknown. Notably, a behavioral economist Prelec (1998) [4] axiomatically derived the probability weighting function w(p)=exp(-() (0<α<1 and w(0)=1,w(
NASA gear research and its probable effect on rotorcraft transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Townsend, D. P.; Coy, J. J.
1979-01-01
The results of the NASA gear research is reviewed as well as those programs which are presently being undertaken. Research programs studying pitting fatigue, gear steels and processing, life prediction methods, gear design and dynamics, elastohydrodynamic lubrication, lubrication methods and gear noise are presented. The impact of advanced gear research technology on rotorcraft transmission design is discussed.
Soler, Juan José; Peralta-Sánchez, Juan Manuel; Flensted-Jensen, Einar; Martín-Platero, Antonio Manuel; Møller, Anders Pape
2011-09-01
Fitness benefits associated with the development of a costly immune system would include not only self-protection against pathogenic microorganisms but also protection of host offspring if it reduces the probability and the rate of vertical transmission of microorganisms. This possibility predicts a negative relationship between probabilities of vertical transmission of symbionts and level of immune response that we here explore inter-specifically. We estimated eggshell bacterial loads by culturing heterotrophic bacteria, Enterococcus, Staphylococcus and Enterobacteriaceae on the eggshells of 29 species of birds as a proxy of vertical transmission of bacteria from mother to offspring. For this pool of species, we also estimated innate immune response (natural antibody and complement (lysis)) of adults, which constitute the main defence against bacterial infection. Multivariate general linear models revealed the predicted negative association between natural antibodies and density of bacteria on the eggshell of 19 species of birds for which we sampled the eggs in more than one nest. Univariate analyses revealed significant associations for heterotrophic bacteria and for Enterobacteriaceae, a group of bacteria that includes important pathogens of avian embryos. Therefore, these results suggest a possible trans-generational benefit of developing a strong immune system by reducing vertical transmission of pathogens.
NASA Astrophysics Data System (ADS)
Soler, Juan José; Peralta-Sánchez, Juan Manuel; Flensted-Jensen, Einar; Martín-Platero, Antonio Manuel; Møller, Anders Pape
2011-09-01
Fitness benefits associated with the development of a costly immune system would include not only self-protection against pathogenic microorganisms but also protection of host offspring if it reduces the probability and the rate of vertical transmission of microorganisms. This possibility predicts a negative relationship between probabilities of vertical transmission of symbionts and level of immune response that we here explore inter-specifically. We estimated eggshell bacterial loads by culturing heterotrophic bacteria, Enterococcus, Staphylococcus and Enterobacteriaceae on the eggshells of 29 species of birds as a proxy of vertical transmission of bacteria from mother to offspring. For this pool of species, we also estimated innate immune response (natural antibody and complement (lysis)) of adults, which constitute the main defence against bacterial infection. Multivariate general linear models revealed the predicted negative association between natural antibodies and density of bacteria on the eggshell of 19 species of birds for which we sampled the eggs in more than one nest. Univariate analyses revealed significant associations for heterotrophic bacteria and for Enterobacteriaceae, a group of bacteria that includes important pathogens of avian embryos. Therefore, these results suggest a possible trans-generational benefit of developing a strong immune system by reducing vertical transmission of pathogens.
Identification of influential nodes in complex networks: Method from spreading probability viewpoint
NASA Astrophysics Data System (ADS)
Bao, Zhong-Kui; Ma, Chuang; Xiang, Bing-Bing; Zhang, Hai-Feng
2017-02-01
The problem of identifying influential nodes in complex networks has attracted much attention owing to its wide applications, including how to maximize the information diffusion, boost product promotion in a viral marketing campaign, prevent a large scale epidemic and so on. From spreading viewpoint, the probability of one node propagating its information to one other node is closely related to the shortest distance between them, the number of shortest paths and the transmission rate. However, it is difficult to obtain the values of transmission rates for different cases, to overcome such a difficulty, we use the reciprocal of average degree to approximate the transmission rate. Then a semi-local centrality index is proposed to incorporate the shortest distance, the number of shortest paths and the reciprocal of average degree simultaneously. By implementing simulations in real networks as well as synthetic networks, we verify that our proposed centrality can outperform well-known centralities, such as degree centrality, betweenness centrality, closeness centrality, k-shell centrality, and nonbacktracking centrality. In particular, our findings indicate that the performance of our method is the most significant when the transmission rate nears to the epidemic threshold, which is the most meaningful region for the identification of influential nodes.
Estimating a mosquito repellent's potential to reduce malaria in communities.
Kiszewski, A E; Darling, S T
2010-12-01
Probability models for assessing a mosquito repellent's potential to reduce malaria transmission are not readily available to public health researchers. To provide a means for estimating the epidemiological efficacy of mosquito repellents in communities, we developed a simple mathematical model. A static probability model is presented to simulate malaria infection in a community during a single transmission season. The model includes five parameters- sporozoite rate, human infection rate, biting pressure, repellent efficacy, and product-acceptance rate. The model assumes that a certain percentage of the population uses a personal mosquito repellent over the course of a seven-month transmission season and that this repellent maintains a constant rate of protective efficacy against the bites of malaria vectors. This model measures the probability of evading infection in circumstances where vector biting pressure, repellent efficacy, and product acceptance may vary. [corrected] Absolute protection using mosquito repellents alone requires high rates of repellent efficacy and product acceptance. [corrected] Using performance data from a highly effective repellent, the model estimates an 88.9% reduction of infections over a seven- month transmission season. A corresponding reduction in the incidence of super-infection in community members not completely evading infection can also be presumed. Thus, the model shows that mass distribution of a repellent with >98% efficacy and >98% product acceptance would suppress new malaria infections to levels lower than those achieved with insecticide treated nets (ITNs). A combination of both interventions could create synergies that result in reductions of disease burden significantly greater than with the use of ITNs alone.
Spatial spread of the West Africa Ebola epidemic.
Kramer, Andrew M; Pulliam, J Tomlin; Alexander, Laura W; Park, Andrew W; Rohani, Pejman; Drake, John M
2016-08-01
Controlling Ebola outbreaks and planning an effective response to future emerging diseases are enhanced by understanding the role of geography in transmission. Here we show how epidemic expansion may be predicted by evaluating the relative probability of alternative epidemic paths. We compared multiple candidate models to characterize the spatial network over which the 2013-2015 West Africa epidemic of Ebola virus spread and estimate the effects of geographical covariates on transmission during peak spread. The best model was a generalized gravity model where the probability of transmission between locations depended on distance, population density and international border closures between Guinea, Liberia and Sierra Leone and neighbouring countries. This model out-performed alternative models based on diffusive spread, the force of infection, mobility estimated from cell phone records and other hypothesized patterns of spread. These findings highlight the importance of integrated geography to epidemic expansion and may contribute to identifying both the most vulnerable unaffected areas and locations of maximum intervention value.
Spatial spread of the West Africa Ebola epidemic
Pulliam, J. Tomlin; Alexander, Laura W.; Rohani, Pejman; Drake, John M.
2016-01-01
Controlling Ebola outbreaks and planning an effective response to future emerging diseases are enhanced by understanding the role of geography in transmission. Here we show how epidemic expansion may be predicted by evaluating the relative probability of alternative epidemic paths. We compared multiple candidate models to characterize the spatial network over which the 2013–2015 West Africa epidemic of Ebola virus spread and estimate the effects of geographical covariates on transmission during peak spread. The best model was a generalized gravity model where the probability of transmission between locations depended on distance, population density and international border closures between Guinea, Liberia and Sierra Leone and neighbouring countries. This model out-performed alternative models based on diffusive spread, the force of infection, mobility estimated from cell phone records and other hypothesized patterns of spread. These findings highlight the importance of integrated geography to epidemic expansion and may contribute to identifying both the most vulnerable unaffected areas and locations of maximum intervention value. PMID:27853607
Local description of a polyenic radical cation
NASA Astrophysics Data System (ADS)
Karafiloglou, P.; Kapsomenos, G.
1995-06-01
The various local electronic events occurring in a radical cation of a linear polyene with even number of centers are investigated by means of the calculation of the expectation values of second quantized density operators, in the framework of the general poly-electron population analysis. Two series of calculations in two limit geometries (a strong alternant and a polaron-like one) are performed by using as analysers both natural AOs in ab initio correlated wave functions, as well as the model orthogonal AOs in PPP + full CI ones. The probabilities of finding simultaneously the positive charge (+) and the radical center (·) follows, in accord with basic chemical intuition, an oscillating (even-odd) law, even at distant AO positions. The probability of having a transmission of the (+) charge through the π-bonds (when the (·) is located in one extremity of the polyene) is greater than this of the transmission of the (·). Comparing the radical cation with the parent polyene, it is shown that oxidation creates an important trend of single-double bond inversion even in strongly alternant geometry; this effect is more pronounced in bonds of the middle. The examination of various CDW structures shows that some of them can have small or negligible contributions; this counterintuitive and cooperative effect is rationalized by means of Moffitt's theorem. All the above effects are not the consequence of the polaron-like geometry, but are controlled from the topology of n-centers linearly disposed and involving ( n-1) electrons.
Dynamical jumping real-time fault-tolerant routing protocol for wireless sensor networks.
Wu, Guowei; Lin, Chi; Xia, Feng; Yao, Lin; Zhang, He; Liu, Bing
2010-01-01
In time-critical wireless sensor network (WSN) applications, a high degree of reliability is commonly required. A dynamical jumping real-time fault-tolerant routing protocol (DMRF) is proposed in this paper. Each node utilizes the remaining transmission time of the data packets and the state of the forwarding candidate node set to dynamically choose the next hop. Once node failure, network congestion or void region occurs, the transmission mode will switch to jumping transmission mode, which can reduce the transmission time delay, guaranteeing the data packets to be sent to the destination node within the specified time limit. By using feedback mechanism, each node dynamically adjusts the jumping probabilities to increase the ratio of successful transmission. Simulation results show that DMRF can not only efficiently reduce the effects of failure nodes, congestion and void region, but also yield higher ratio of successful transmission, smaller transmission delay and reduced number of control packets.
NASA Astrophysics Data System (ADS)
Paul, Ganesh C.; Saha, Arijit
2017-01-01
We theoretically investigate the phenomena of adiabatic quantum charge pumping through a normal-insulator-superconductor-insulator-normal (NISIN) setup of silicene within the scattering matrix formalism. Assuming a thin barrier limit, we consider the strength of the two barriers (χ1 and χ2) as the two pumping parameters in the adiabatic regime. Within this geometry, we obtain crossed Andreev reflection (CAR) with probability unity in the χ1-χ2 plane without concomitant transmission or elastic co-tunneling. Tunability of the band gap at the Dirac point by applying an external electric field perpendicular to the silicene sheet and variation of the chemical potential at the normal silicene region, open up the possibility of achieving either a perfect CAR or transmission process through our setup. This resonant behavior is periodic with the barrier strengths. We analyze the behavior of the pumped charge through the NISIN structure as a function of the pumping strength and angles of the incident electrons. We show that large (Q ˜2 e ) pumped charge can be obtained through our geometry when the pumping contour encloses either the CAR or transmission resonance in the pumping parameter space. We discuss possible experimental feasibility of our theoretical predictions.
Elimination of Ebola Virus Transmission in Liberia - September 3, 2015.
Bawo, Luke; Fallah, Mosoka; Kateh, Francis; Nagbe, Thomas; Clement, Peter; Gasasira, Alex; Mahmoud, Nuha; Musa, Emmanuel; Lo, Terrence Q; Pillai, Satish K; Seeman, Sara; Sunshine, Brittany J; Weidle, Paul J; Nyensweh, Tolbert
2015-09-11
Following 42 days since the last Ebola virus disease (Ebola) patient was discharged from a Liberian Ebola treatment unit (ETU), September 3, 2015, marks the second time in a 4-month period that the World Health Organization (WHO) has declared Liberia free of Ebola virus transmission (1). The first confirmed Ebola cases in West Africa were identified in southeastern Guinea on March 23, 2014, and within 1 week, cases were identified and confirmed in Liberia (1). Since then, Liberia has reported 5,036 confirmed and probable Ebola cases and 4,808 Ebola-related deaths. The epidemic in Liberia peaked in late summer and early fall of 2014, when more than 200 confirmed and probable cases were reported each week .
NASA gear research and its probable effect on rotorcraft transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Townsend, D. P.; Coy, J. J.
1979-01-01
The NASA Lewis Research Center devised a comprehensive gear technology research program beginning in 1969, the results of which are being integrated into the NASA civilian Helicopter Transmission System Technology Program. Attention is given to the results of this gear research and those programs which are presently being undertaken. In addition, research programs studying pitting fatigue, gear steels and processing, life prediction methods, gear design and dynamics, elastohydrodynamic lubrication, lubrication methods and gear noise are presented. Finally, the impact of advanced gear research technology on rotorcraft transmission design is discussed.
Li, Ning; Cürüklü, Baran; Bastos, Joaquim; Sucasas, Victor; Fernandez, Jose Antonio Sanchez; Rodriguez, Jonathan
2017-01-01
The aim of the Smart and Networking Underwater Robots in Cooperation Meshes (SWARMs) project is to make autonomous underwater vehicles (AUVs), remote operated vehicles (ROVs) and unmanned surface vehicles (USVs) more accessible and useful. To achieve cooperation and communication between different AUVs, these must be able to exchange messages, so an efficient and reliable communication network is necessary for SWARMs. In order to provide an efficient and reliable communication network for mission execution, one of the important and necessary issues is the topology control of the network of AUVs that are cooperating underwater. However, due to the specific properties of an underwater AUV cooperation network, such as the high mobility of AUVs, large transmission delays, low bandwidth, etc., the traditional topology control algorithms primarily designed for terrestrial wireless sensor networks cannot be used directly in the underwater environment. Moreover, these algorithms, in which the nodes adjust their transmission power once the current transmission power does not equal an optimal one, are costly in an underwater cooperating AUV network. Considering these facts, in this paper, we propose a Probabilistic Topology Control (PTC) algorithm for an underwater cooperating AUV network. In PTC, when the transmission power of an AUV is not equal to the optimal transmission power, then whether the transmission power needs to be adjusted or not will be determined based on the AUV’s parameters. Each AUV determines their own transmission power adjustment probability based on the parameter deviations. The larger the deviation, the higher the transmission power adjustment probability is, and vice versa. For evaluating the performance of PTC, we combine the PTC algorithm with the Fuzzy logic Topology Control (FTC) algorithm and compare the performance of these two algorithms. The simulation results have demonstrated that the PTC is efficient at reducing the transmission power adjustment ratio while improving the network performance. PMID:28471387
Li, Ning; Cürüklü, Baran; Bastos, Joaquim; Sucasas, Victor; Fernandez, Jose Antonio Sanchez; Rodriguez, Jonathan
2017-05-04
The aim of the Smart and Networking Underwater Robots in Cooperation Meshes (SWARMs) project is to make autonomous underwater vehicles (AUVs), remote operated vehicles (ROVs) and unmanned surface vehicles (USVs) more accessible and useful. To achieve cooperation and communication between different AUVs, these must be able to exchange messages, so an efficient and reliable communication network is necessary for SWARMs. In order to provide an efficient and reliable communication network for mission execution, one of the important and necessary issues is the topology control of the network of AUVs that are cooperating underwater. However, due to the specific properties of an underwater AUV cooperation network, such as the high mobility of AUVs, large transmission delays, low bandwidth, etc., the traditional topology control algorithms primarily designed for terrestrial wireless sensor networks cannot be used directly in the underwater environment. Moreover, these algorithms, in which the nodes adjust their transmission power once the current transmission power does not equal an optimal one, are costly in an underwater cooperating AUV network. Considering these facts, in this paper, we propose a Probabilistic Topology Control (PTC) algorithm for an underwater cooperating AUV network. In PTC, when the transmission power of an AUV is not equal to the optimal transmission power, then whether the transmission power needs to be adjusted or not will be determined based on the AUV's parameters. Each AUV determines their own transmission power adjustment probability based on the parameter deviations. The larger the deviation, the higher the transmission power adjustment probability is, and vice versa. For evaluating the performance of PTC, we combine the PTC algorithm with the Fuzzy logic Topology Control (FTC) algorithm and compare the performance of these two algorithms. The simulation results have demonstrated that the PTC is efficient at reducing the transmission power adjustment ratio while improving the network performance.
NASA Astrophysics Data System (ADS)
de La Casinière, A.; Touré, M. L.; Masserot, D.; Lenoble, J.; Cabot, T.; Pinedo Vega, J. L.
Global UV irradiance spectra we re recorded each half an hour between sunrise and sunset, along the year 2000 in Briançon (1300m asl) at the CEMBREU (Centre Européen Médical Bioclimatique de Recherche et d'Enseignement Universitaire), a site of the French spectral UV network in Southern Alps. From these spectra are retrieved atmospheric transmissivities corresponding to daily doses of various biologically active radiation. A transmissivity is defined as the ratio of the ground level value of a daily dose to the extra -atmospheric value of this daily dose. The daily doses studied relate to UVB, erythema, DNA damage, and plant damage. Multiple linear correlations of the various transmissivities with the three predictors (daily sunshine fraction), µmin (cosine of the daily minimum SZA), and (daily total ozone column) assumed to be independent variables, are done for year 2000. These correlations permit to assess the mean sensitivities of the various transmissivities, to changes in for different cloud cover conditions in Briançon. The variations of each sensitivity is studied as a function of , µmin and . Comparing the results obtained with those given in the literature, we find for = 1 (that is for a strong probability of clear sky conditions) and SZA min = 45°, a radiation amplification factor (RAF) of the erythemal daily dose equal to 1.1 when = 285 DU, and to 1.4 when = 315 DU.
The donor-acceptor approach allows a black-to-transmissive switching polymeric electrochrome
NASA Astrophysics Data System (ADS)
Beaujuge, P. M.; Ellinger, S.; Reynolds, J. R.
2008-10-01
In the context of the fast-growing demand for innovative high-performance display technologies, the perspective of manufacturing low-cost functional materials that can be easily processed over large areas or finely printed into individual pixels, while being mechanically deformable, has motivated the development of novel electronically active organic components fulfilling the requirements for flexible displays and portable applications. Among all technologies relying on a low-power stimulated optical change, non-emissive organic electrochromic devices (ECDs) offer the advantage of being operational under a wide range of viewing angles and lighting conditions spanning direct sunlight as desired for various applications including signage, information tags and electronic paper. Combining mechanical flexibility, high contrast ratios and fast response times, along with colour tunability through structural control, polymeric electrochromes constitute the most attractive organic electronics for tomorrow's reflective/transmissive ECDs and displays. Although red, blue and most recently green electrochromic polymers (ECPs) required for additive primary colour space were investigated, attempts to make saturated black ECPs have not been reported, probably owing to the complexity of designing materials absorbing effectively over the whole visible spectrum. Here, we report on the use of the donor-acceptor approach to make the first neutral-state black polymeric electrochrome. Processable black-to-transmissive ECPs promise to affect the development of both reflective and transmissive ECDs by providing lower fabrication and processing costs through printing, spraying and coating methods, along with good scalability when compared with their traditional inorganic counterparts.
Discrete-time entropy formulation of optimal and adaptive control problems
NASA Technical Reports Server (NTRS)
Tsai, Yweting A.; Casiello, Francisco A.; Loparo, Kenneth A.
1992-01-01
The discrete-time version of the entropy formulation of optimal control of problems developed by G. N. Saridis (1988) is discussed. Given a dynamical system, the uncertainty in the selection of the control is characterized by the probability distribution (density) function which maximizes the total entropy. The equivalence between the optimal control problem and the optimal entropy problem is established, and the total entropy is decomposed into a term associated with the certainty equivalent control law, the entropy of estimation, and the so-called equivocation of the active transmission of information from the controller to the estimator. This provides a useful framework for studying the certainty equivalent and adaptive control laws.
Possibility designing XNOR and NAND molecular logic gates by using single benzene ring
NASA Astrophysics Data System (ADS)
Abbas, Mohammed A.; Hanoon, Falah H.; Al-Badry, Lafy F.
2017-09-01
This study focused on examining electronic transport through single benzene ring and suggested how such ring can be employed to design XNOR and NAND molecular logic gates. The single benzene ring was threaded by a magnetic flux. The magnetic flux and applied gate voltages were considered as the key tuning parameter in the XNOR and NAND gates operation. All the calculations are achieved by using steady-state theoretical model, which is based on the time-dependent Hamiltonian model. The transmission probability and the electric current are calculated as functions of electron energy and bias voltage, respectively. The application of the anticipated results can be a base for the progress of molecular electronics.
Measurement of optical intensity fluctuation over an 11.8 km turbulent path.
Jiang, Yijun; Ma, Jing; Tan, Liying; Yu, Siyuan; Du, Wenhe
2008-05-12
An 11.8km optical link is established to examine the intensity fluctuation of the laser beam transmission through atmosphere turbulence. Probability density function, fade statistic, and high-frequency spectrum are researched based on the analysis of the experimental data collected in each season of a year, including both weak and strong fluctuation cases. Finally, the daily variation curve of scintillation index is given, compared with the variation of refractive-index structure parameter C(n) (2), which is calculated from the experimental data of angle of arrival. This work provides the experimental results that are helpful to the atmospheric propagation research and the free-space optical communication system design.
Discovering network behind infectious disease outbreak
NASA Astrophysics Data System (ADS)
Maeno, Yoshiharu
2010-11-01
Stochasticity and spatial heterogeneity are of great interest recently in studying the spread of an infectious disease. The presented method solves an inverse problem to discover the effectively decisive topology of a heterogeneous network and reveal the transmission parameters which govern the stochastic spreads over the network from a dataset on an infectious disease outbreak in the early growth phase. Populations in a combination of epidemiological compartment models and a meta-population network model are described by stochastic differential equations. Probability density functions are derived from the equations and used for the maximal likelihood estimation of the topology and parameters. The method is tested with computationally synthesized datasets and the WHO dataset on the SARS outbreak.
Orlofske, Sarah A; Flaxman, Samuel M; Joseph, Maxwell B; Fenton, Andy; Melbourne, Brett A; Johnson, Pieter T J
2018-05-01
Understanding pathogen transmission is crucial for predicting and managing disease. Nonetheless, experimental comparisons of alternative functional forms of transmission remain rare, and those experiments that are conducted are often not designed to test the full range of possible forms. To differentiate among 10 candidate transmission functions, we used a novel experimental design in which we independently varied four factors-duration of exposure, numbers of parasites, numbers of hosts and parasite density-in laboratory infection experiments. We used interactions between amphibian hosts and trematode parasites as a model system and all candidate models incorporated parasite depletion. An additional manipulation involving anaesthesia addressed the effects of host behaviour on transmission form. Across all experiments, nonlinear transmission forms involving either a power law or a negative binomial function were the best-fitting models and consistently outperformed the linear density-dependent and density-independent functions. By testing previously published data for two other host-macroparasite systems, we also found support for the same nonlinear transmission forms. Although manipulations of parasite density are common in transmission studies, the comprehensive set of variables tested in our experiments revealed that variation in density alone was least likely to differentiate among competing transmission functions. Across host-pathogen systems, nonlinear functions may often more accurately represent transmission dynamics and thus provide more realistic predictions for infection. © 2017 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.
Faye, Ousmane; Boëlle, Pierre-Yves; Heleze, Emmanuel; Faye, Oumar; Loucoubar, Cheikh; Magassouba, N'Faly; Soropogui, Barré; Keita, Sakoba; Gakou, Tata; Bah, El Hadji Ibrahima; Koivogui, Lamine; Sall, Amadou Alpha; Cauchemez, Simon
2015-03-01
An epidemic of Ebola virus disease of unprecedented size continues in parts of west Africa. For the first time, large urban centres such as Conakry, the capital of Guinea, are affected. We did an observational study of patients with Ebola virus disease in three regions of Guinea, including Conakry, aiming to map the routes of transmission and assess the effect of interventions. Between Feb 10, 2014, and Aug 25, 2014, we obtained data from the linelist of all confirmed and probable cases in Guinea (as of Sept 16, 2014), a laboratory database of information about patients, and interviews with patients and their families and neighbours. With this information, we mapped chains of transmission, identified which setting infections most probably originated from (community, hospitals, or funerals), and computed the context-specific and overall reproduction numbers. Of 193 confirmed and probable cases of Ebola virus disease reported in Conakry, Boffa, and Télimélé, 152 (79%) were positioned in chains of transmission. Health-care workers contributed little to transmission. In March, 2014, individuals with Ebola virus disease who were not health-care workers infected a mean of 2·3 people (95% CI 1·6-3·2): 1·4 (0·9-2·2) in the community, 0·4 (0·1-0·9) in hospitals, and 0·5 (0·2-1·0) at funerals. After the implementation of infection control in April, the reproduction number in hospitals and at funerals reduced to lower than 0·1. In the community, the reproduction number dropped by 50% for patients that were admitted to hospital, but remained unchanged for those that were not. In March, hospital transmissions constituted 35% (seven of 20) of all transmissions and funeral transmissions constituted 15% (three); but from April to the end of the study period, they constituted only 9% (11 of 128) and 4% (five), respectively. 82% (119 of 145) of transmission occurred in the community and 72% (105) between family members. Our simulations show that a 10% increase in hospital admissions could have reduced the length of chains by 26% (95% CI 4-45). In Conakry, interventions had the potential to stop the epidemic, but reintroductions of the disease and poor cooperation of a few families led to prolonged low-level spread, showing the challenges of Ebola virus disease control in large urban centres. Monitoring of chains of transmission is crucial to assess and optimise local control strategies for Ebola virus disease. Labex IBEID, Reacting, PREDEMICS, NIGMS MIDAS initiative, Institut Pasteur de Dakar. Copyright © 2015 Elsevier Ltd. All rights reserved.
Davies, Bethan; Anderson, Sarah-Jane; Turner, Katy M E; Ward, Helen
2014-01-30
Transmission dynamic models linked to economic analyses often form part of the decision making process when introducing new chlamydia screening interventions. Outputs from these transmission dynamic models can vary depending on the values of the parameters used to describe the infection. Therefore these values can have an important influence on policy and resource allocation. The risk of progression from infection to pelvic inflammatory disease has been extensively studied but the parameters which govern the transmission dynamics are frequently neglected. We conducted a systematic review of transmission dynamic models linked to economic analyses of chlamydia screening interventions to critically assess the source and variability of the proportion of infections that are asymptomatic, the duration of infection and the transmission probability. We identified nine relevant studies in Pubmed, Embase and the Cochrane database. We found that there is a wide variation in their natural history parameters, including an absolute difference in the proportion of asymptomatic infections of 25% in women and 75% in men, a six-fold difference in the duration of asymptomatic infection and a four-fold difference in the per act transmission probability. We consider that much of this variation can be explained by a lack of consensus in the literature. We found that a significant proportion of parameter values were referenced back to the early chlamydia literature, before the introduction of nucleic acid modes of diagnosis and the widespread testing of asymptomatic individuals. In conclusion, authors should use high quality contemporary evidence to inform their parameter values, clearly document their assumptions and make appropriate use of sensitivity analysis. This will help to make models more transparent and increase their utility to policy makers.
OH-58 Helicopter Transmission Failure Analysis
1976-01-01
would require rigid stradle mountings in place of the overhung mountings currently on the plane- tary spider. However, there is a probability that...roller bearings with rigid stradle mounting to replace the overhung mounting. This change would re- duce the heat generation in the planet...Weapons System Manager requested NASA-Lewis Research Center’s assistance in upgrading the current OH-58 main rotor transmission in performance and
Modeling infection transmission in primate networks to predict centrality-based risk.
Romano, Valéria; Duboscq, Julie; Sarabian, Cécile; Thomas, Elodie; Sueur, Cédric; MacIntosh, Andrew J J
2016-07-01
Social structure can theoretically regulate disease risk by mediating exposure to pathogens via social proximity and contact. Investigating the role of central individuals within a network may help predict infectious agent transmission as well as implement disease control strategies, but little is known about such dynamics in real primate networks. We combined social network analysis and a modeling approach to better understand transmission of a theoretical infectious agent in wild Japanese macaques, highly social animals which form extended but highly differentiated social networks. We collected focal data from adult females living on the islands of Koshima and Yakushima, Japan. Individual identities as well as grooming networks were included in a Markov graph-based simulation. In this model, the probability that an individual will transmit an infectious agent depends on the strength of its relationships with other group members. Similarly, its probability of being infected depends on its relationships with already infected group members. We correlated: (i) the percentage of subjects infected during a latency-constrained epidemic; (ii) the mean latency to complete transmission; (iii) the probability that an individual is infected first among all group members; and (iv) each individual's mean rank in the chain of transmission with different individual network centralities (eigenvector, strength, betweenness). Our results support the hypothesis that more central individuals transmit infections in a shorter amount of time and to more subjects but also become infected more quickly than less central individuals. However, we also observed that the spread of infectious agents on the Yakushima network did not always differ from expectations of spread on random networks. Generalizations about the importance of observed social networks in pathogen flow should thus be made with caution, since individual characteristics in some real world networks appear less relevant than they are in others in predicting disease spread. Am. J. Primatol. 78:767-779, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Interference-Robust Transmission in Wireless Sensor Networks
Han, Jin-Seok; Lee, Yong-Hwan
2016-01-01
Low-power wireless sensor networks (WSNs) operating in unlicensed spectrum bands may seriously suffer from interference from other coexisting radio systems, such as IEEE 802.11 wireless local area networks. In this paper, we consider the improvement of the transmission performance of low-power WSNs by adjusting the transmission rate and the payload size in response to the change of co-channel interference. We estimate the probability of transmission failure and the data throughput and then determine the payload size to maximize the throughput performance. We investigate that the transmission time maximizing the normalized throughput is not much affected by the transmission rate, but rather by the interference condition. We adjust the transmission rate and the transmission time in response to the change of the channel and interference condition, respectively. Finally, we verify the performance of the proposed scheme by computer simulation. The simulation results show that the proposed scheme significantly improves data throughput compared with conventional schemes while preserving energy efficiency even in the presence of interference. PMID:27854249
Interference-Robust Transmission in Wireless Sensor Networks.
Han, Jin-Seok; Lee, Yong-Hwan
2016-11-14
Low-power wireless sensor networks (WSNs) operating in unlicensed spectrum bands may seriously suffer from interference from other coexisting radio systems, such as IEEE 802.11 wireless local area networks. In this paper, we consider the improvement of the transmission performance of low-power WSNs by adjusting the transmission rate and the payload size in response to the change of co-channel interference. We estimate the probability of transmission failure and the data throughput and then determine the payload size to maximize the throughput performance. We investigate that the transmission time maximizing the normalized throughput is not much affected by the transmission rate, but rather by the interference condition. We adjust the transmission rate and the transmission time in response to the change of the channel and interference condition, respectively. Finally, we verify the performance of the proposed scheme by computer simulation. The simulation results show that the proposed scheme significantly improves data throughput compared with conventional schemes while preserving energy efficiency even in the presence of interference.
Synaptic Effects of Electric Fields
NASA Astrophysics Data System (ADS)
Rahman, Asif
Learning and sensory processing in the brain relies on the effective transmission of information across synapses. The strength and efficacy of synaptic transmission is modifiable through training and can be modulated with noninvasive electrical brain stimulation. Transcranial electrical stimulation (TES), specifically, induces weak intensity and spatially diffuse electric fields in the brain. Despite being weak, electric fields modulate spiking probability and the efficacy of synaptic transmission. These effects critically depend on the direction of the electric field relative to the orientation of the neuron and on the level of endogenous synaptic activity. TES has been used to modulate a wide range of neuropsychiatric indications, for various rehabilitation applications, and cognitive performance in diverse tasks. How can a weak and diffuse electric field, which simultaneously polarizes neurons across the brain, have precise changes in brain function? Designing therapies to maximize desired outcomes and minimize undesired effects presents a challenging problem. A series of experiments and computational models are used to define the anatomical and functional factors leading to specificity of TES. Anatomical specificity derives from guiding current to targeted brain structures and taking advantage of the direction-sensitivity of neurons with respect to the electric field. Functional specificity originates from preferential modulation of neuronal networks that are already active. Diffuse electric fields may recruit connected brain networks involved in a training task and promote plasticity along active synaptic pathways. In vitro, electric fields boost endogenous synaptic plasticity and raise the ceiling for synaptic learning with repeated stimulation sessions. Synapses undergoing strong plasticity are preferentially modulated over weak synapses. Therefore, active circuits that are involved in a task could be more susceptible to stimulation than inactive circuits. Moreover, stimulation polarity has asymmetric effects on synaptic strength making it easier to enhance ongoing plasticity. These results suggest that the susceptibility of brain networks to an electric field depends on the state of synaptic activity. Combining a training task, which activates specific circuits, with TES may lead to functionally-specific effects. Given the simplicity of TES and the complexity of brain function, understanding the mechanisms leading to specificity is fundamental to the rational advancement of TES.
Simulation of the dynamical transmission of several-hundred-keV protons through a conical capillary
NASA Astrophysics Data System (ADS)
Yang, A. X.; Zhu, B. H.; Niu, S. T.; Pan, P.; Han, C. Z.; Song, H. Y.; Shao, J. X.; Chen, X. M.
2018-05-01
The time evolution of the trajectories, angular distributions, and two-dimensional images of intermediate-energy protons being transmitted through a conical capillary was simulated. The simulation results indicate that the charge deposited in the capillary significantly enhances the probability of surface specular scattering and thus greatly enhances the transmission rate. Furthermore, this deposited-charge-assisted specular reflection causes the transmission rate to exhibit an energy dependence proportional to E-1, which is very consistent with the experimental data. After transmission at nonzero tilt angles, the angular distribution of several-hundred-keV protons is far from symmetric, unlike in the case of keV protons.
NASA Astrophysics Data System (ADS)
Kropotov, Y. A.; Belov, A. A.; Proskuryakov, A. Y.; Kolpakov, A. A.
2018-05-01
The paper considers models and methods for estimating signals during the transmission of information messages in telecommunication systems of audio exchange. One-dimensional probability distribution functions that can be used to isolate useful signals, and acoustic noise interference are presented. An approach to the estimation of the correlation and spectral functions of the parameters of acoustic signals is proposed, based on the parametric representation of acoustic signals and the components of the noise components. The paper suggests an approach to improving the efficiency of interference cancellation and highlighting the necessary information when processing signals from telecommunications systems. In this case, the suppression of acoustic noise is based on the methods of adaptive filtering and adaptive compensation. The work also describes the models of echo signals and the structure of subscriber devices in operational command telecommunications systems.
Neuropeptide transmission in brain circuits
van den Pol, Anthony N.
2014-01-01
Neuropeptides are found in many mammalian CNS neurons where they play key roles in modulating neuronal activity. In contrast to amino acid transmitter release at the synapse, neuropeptide release is not restricted to the synaptic specialization, and after release, a neuropeptide may diffuse some distance to exert its action through a G-protein coupled receptor. Some neuropeptides such as hypocretin/orexin are synthesized only in single regions of the brain, and the neurons releasing these peptides probably have similar functional roles. Other peptides such as neuropeptide Y (NPY) are synthesized throughout the brain, and neurons that synthesize the peptide in one region have no anatomical or functional connection with NPY neurons in other brain regions. Here, I review converging data revealing a complex interaction between slow-acting neuromodulator peptides and fast-acting amino acid transmitters in the control of energy homeostasis, drug addiction, mood and motivation, sleep-wake states, and neuroendocrine regulation. PMID:23040809
Canuet, Lucien; Védrenne, Nicolas; Conan, Jean-Marc; Petit, Cyril; Artaud, Geraldine; Rissons, Angelique; Lacan, Jerome
2018-01-01
In the framework of satellite-to-ground laser downlinks, an analytical model describing the variations of the instantaneous coupled flux into a single-mode fiber after correction of the incoming wavefront by partial adaptive optics (AO) is presented. Expressions for the probability density function and the cumulative distribution function as well as for the average fading duration and fading duration distribution of the corrected coupled flux are given. These results are of prime interest for the computation of metrics related to coded transmissions over correlated channels, and they are confronted by end-to-end wave-optics simulations in the case of a geosynchronous satellite (GEO)-to-ground and a low earth orbit satellite (LEO)-to-ground scenario. Eventually, the impact of different AO performances on the aforementioned fading duration distribution is analytically investigated for both scenarios.
Quantum coherence in the reflection of above barrier wavepackets
NASA Astrophysics Data System (ADS)
Petersen, Jakob; Pollak, Eli
2018-02-01
The quantum phenomenon of above barrier reflection is investigated from a time-dependent perspective using Gaussian wavepackets. The transition path time distribution, which in principle is experimentally measurable, is used to study the mean flight times ⟨t⟩R and ⟨t⟩T associated with the reflection and the transmission over the barrier paying special attention to their dependence on the width of the barrier. Both flight times, and their difference Δt, exhibit two distinct regimes depending on the ratio of the spatial width of the incident wavepacket and the length of the barrier. When the ratio is larger than unity, the reflection and transmission dynamics are coherent and dominated by the resonances above the barrier. The flight times ⟨t⟩R/T and the flight time difference Δt oscillate as a function of the barrier width (almost in phase with the transmission probability). These oscillations reflect a momentum filtering effect related to the coherent superposition of the reflected and transmitted waves. For a ratio less than unity, the barrier reflection and transmission dynamics are incoherent and the oscillations are absent. The barrier width which separates the coherent and incoherent regimes is identified analytically. The oscillatory structure of the time difference Δt as a function of the barrier width in the coherent regime is absent when considered in terms of the Wigner phase time delays for reflection and transmission. We conclude that the Wigner phase time does not correctly describe the temporal properties of above barrier reflection. We also find that the structure of the reflected and transmitted wavepackets depends on the coherence of the process. In the coherent regime, the wavepackets can have an overlapping peak structure, but the peaks are not fully resolved. In the incoherent regime, the wavepackets split in time into distinct separated Gaussian like waves, each one reflecting the number of times the wavepacket crosses the barrier region before exiting. A classical Wigner approximation, using classical trajectories which upon reaching an edge of the barrier are reflected or transmitted as if the edge was a step potential, is quantitative in the incoherent regime. The implications of the coherence observed on resonance reactive scattering are discussed.
The brain cytoplasmic RNA BC1 regulates dopamine D2 receptor-mediated transmission in the striatum.
Centonze, Diego; Rossi, Silvia; Napoli, Ilaria; Mercaldo, Valentina; Lacoux, Caroline; Ferrari, Francesca; Ciotti, Maria Teresa; De Chiara, Valentina; Prosperetti, Chiara; Maccarrone, Mauro; Fezza, Filomena; Calabresi, Paolo; Bernardi, Giorgio; Bagni, Claudia
2007-08-15
Dopamine D(2) receptor (D(2)DR)-mediated transmission in the striatum is remarkably flexible, and changes in its efficacy have been heavily implicated in a variety of physiological and pathological conditions. Although receptor-associated proteins are clearly involved in specific forms of synaptic plasticity, the molecular mechanisms regulating the sensitivity of D(2) receptors in this brain area are essentially obscure. We have studied the physiological responses of the D(2)DR stimulations in mice lacking the brain cytoplasmic RNA BC1, a small noncoding dendritically localized RNA that is supposed to play a role in mRNA translation. We show that the efficiency of D(2)-mediated transmission regulating striatal GABA synapses is under the control of BC1 RNA, through a negative influence on D(2) receptor protein level affecting the functional pool of receptors. Ablation of the BC1 gene did not result in widespread dysregulation of synaptic transmission, because the sensitivity of cannabinoid CB(1) receptors was intact in the striatum of BC1 knock-out (KO) mice despite D(2) and CB(1) receptors mediated similar electrophysiological actions. Interestingly, the fragile X mental retardation protein FMRP, one of the multiple BC1 partners, is not involved in the BC1 effects on the D(2)-mediated transmission. Because D(2)DR mRNA is apparently equally translated in the BC1-KO and wild-type mice, whereas the protein level is higher in BC1-KO mice, we suggest that BC1 RNA controls D(2)DR indirectly, probably regulating translation of molecules involved in D(2)DR turnover and/or stability.
NASA Astrophysics Data System (ADS)
Hameer, Sameer
Rotorcraft transmission design is limited by empirical weight trends that are proportional to the power/torque raised to the two-thirds coupled with the relative inexperience industry has with the employment of variable speed transmission to heavy lift helicopters of the order of 100,000 lbs gross weight and 30,000 installed horsepower. The advanced rotorcraft transmission program objectives are to reduce transmission weight by at least 25%, reduce sound pressure levels by at least 10 dB, have a 5000 hr mean time between removal, and also incorporate the use of split torque technology in rotorcraft drivetrains of the future. The major obstacle that challenges rotorcraft drivetrain design is the selection, design, and optimization of a variable speed transmission in the goal of achieving a 50% reduction in rotor speed and its ability to handle high torque with light weight gears, as opposed to using a two-speed transmission which has inherent structural problems and is highly unreliable due to the embodiment of the traction type transmission, complex clutch and brake system. This thesis selects a nontraction pericyclic continuously variable transmission (P-CVT) as the best approach for a single main rotor heavy lift helicopter. The objective is to target and overcome the above mentioned obstacle for drivetrain design. Overcoming this obstacle provides advancement in the state of the art of drivetrain design over existing planetary and split torque transmissions currently used in helicopters. The goal of the optimization process was to decrease weight, decrease noise, increase efficiency, and increase safety and reliability. The objective function utilized the minimization of the weight and the major constraint is the tooth bending stress of the facegears. The most important parameters of the optimization process are weight, maintainability, and reliability which are cross-functionally related to each other, and these parameters are related to the torques and operating speeds. The analysis of the split torque type P-CVT achieved a weight reduction of 42.5% and 40.7% over planetary and split torque transmissions respectively. In addition, a 19.5 dB sound pressure level reduction was achieved using active gear struts, and also the use of fabricated steel truss like housing provided a higher maintainability and reliability, low cost, and low weight over cast magnesium housing currently employed in helicopters. The static finite element analysis of the split torque type P-CVT, both 2-D and 3-D, yielded stresses below the allowable bending stress of the material. The goal of the finite element analysis is to see if the designed product has met its functional requirements. The safety assessment of the split torque type P-CVT yielded a 99% probability of mission success based on a Monte Carlo simulation using stochastic-petri net analysis and a failure hazard analysis. This was followed by an FTA/RBD analysis which yielded an overall system failure rate of 140.35 failures per million hours, and a preliminary certification and time line of certification was performed. The use of spherical facegears and pericyclic kinematics has advanced the state of the art in drivetrain design primarily in the reduction of weight and noise coupled with high safety, reliability, and efficiency.
Larkin, Joshua D; Jenni, Nicole L; Floresco, Stan B
2016-01-01
Dopamine (DA) transmission within cortico-limbic-striatal circuitry is integral in modulating decisions involving reward uncertainty. The basolateral amygdala (BLA) also plays a role in these processes, yet how DA transmission within this nucleus regulates cost/benefit decision making is unknown. We investigated the contribution of DA transmission within the BLA to risk/reward decision making assessed with a probabilistic discounting task. Rats were well-trained to choose between a small/certain reward and a large/risky reward, with the probability of obtaining the larger reward decreasing (100-12.5 %) or increasing (12.5-100 %) over a session. We examined the effects of antagonizing BLA D1 (SCH 23390, 0.1-1 μg) or D2 (eticlopride, 0.1-1 μg) receptors, as well as intra-BLA infusions of agonists for D1 (SKF 81297, 0.1-1 μg) and D2 (quinpirole, 1-10 μg) receptors. We also assessed how DA receptor stimulation may induce differential effects related to baseline levels of risky choice. BLA D1 receptor antagonism reduced risky choice by decreasing reward sensitivity, whereas D2 antagonism did not affect overall choice patterns. Stimulation of BLA D1 receptors optimized decision making in a baseline-dependent manner: in risk-averse rats, infusions of a lower dose of SKF81297 increased risky choice when reward probabilities were high (50 %), whereas in risk-prone rats, this drug reduced risky choice when probabilities were low (12.5 %). Quinpirole reduced risky choice in risk-prone rats, enhancing lose-shift behavior. These data highlight previously uncharacterized roles for BLA DA D1 and D2 receptors in biasing choice during risk/reward decision making through mediation of reward/negative feedback sensitivity.
Cost-effective solutions to maintaining smart grid reliability
NASA Astrophysics Data System (ADS)
Qin, Qiu
As the aging power systems are increasingly working closer to the capacity and thermal limits, maintaining an sufficient reliability has been of great concern to the government agency, utility companies and users. This dissertation focuses on improving the reliability of transmission and distribution systems. Based on the wide area measurements, multiple model algorithms are developed to diagnose transmission line three-phase short to ground faults in the presence of protection misoperations. The multiple model algorithms utilize the electric network dynamics to provide prompt and reliable diagnosis outcomes. Computational complexity of the diagnosis algorithm is reduced by using a two-step heuristic. The multiple model algorithm is incorporated into a hybrid simulation framework, which consist of both continuous state simulation and discrete event simulation, to study the operation of transmission systems. With hybrid simulation, line switching strategy for enhancing the tolerance to protection misoperations is studied based on the concept of security index, which involves the faulted mode probability and stability coverage. Local measurements are used to track the generator state and faulty mode probabilities are calculated in the multiple model algorithms. FACTS devices are considered as controllers for the transmission system. The placement of FACTS devices into power systems is investigated with a criterion of maintaining a prescribed level of control reconfigurability. Control reconfigurability measures the small signal combined controllability and observability of a power system with an additional requirement on fault tolerance. For the distribution systems, a hierarchical framework, including a high level recloser allocation scheme and a low level recloser placement scheme, is presented. The impacts of recloser placement on the reliability indices is analyzed. Evaluation of reliability indices in the placement process is carried out via discrete event simulation. The reliability requirements are described with probabilities and evaluated from the empirical distributions of reliability indices.
MONTEIRO, J.F.G.; ESCUDERO, D.J.; WEINREB, C.; FLANIGAN, T.; GALEA, S.; FRIEDMAN, S.R.; MARSHALL, B.D.L.
2017-01-01
SUMMARY We investigated how different models of HIV transmission, and assumptions regarding the distribution of unprotected sex and syringe-sharing events (‘risk acts’), affect quantitative understanding of HIV transmission process in people who inject drugs (PWID). The individual-based model simulated HIV transmission in a dynamic sexual and injecting network representing New York City. We constructed four HIV transmission models: model 1, constant probabilities; model 2, random number of sexual and parenteral acts; model 3, viral load individual assigned; and model 4, two groups of partnerships (low and high risk). Overall, models with less heterogeneity were more sensitive to changes in numbers risk acts, producing HIV incidence up to four times higher than that empirically observed. Although all models overestimated HIV incidence, micro-simulations with greater heterogeneity in the HIV transmission modelling process produced more robust results and better reproduced empirical epidemic dynamics. PMID:26753627
Estimating malaria transmission from humans to mosquitoes in a noisy landscape
Reiner, Robert C.; Guerra, Carlos; Donnelly, Martin J.; Bousema, Teun; Drakeley, Chris; Smith, David L.
2015-01-01
A basic quantitative understanding of malaria transmission requires measuring the probability a mosquito becomes infected after feeding on a human. Parasite prevalence in mosquitoes is highly age-dependent, and the unknown age-structure of fluctuating mosquito populations impedes estimation. Here, we simulate mosquito infection dynamics, where mosquito recruitment is modelled seasonally with fractional Brownian noise, and we develop methods for estimating mosquito infection rates. We find that noise introduces bias, but the magnitude of the bias depends on the ‘colour' of the noise. Some of these problems can be overcome by increasing the sampling frequency, but estimates of transmission rates (and estimated reductions in transmission) are most accurate and precise if they combine parity, oocyst rates and sporozoite rates. These studies provide a basis for evaluating the adequacy of various entomological sampling procedures for measuring malaria parasite transmission from humans to mosquitoes and for evaluating the direct transmission-blocking effects of a vaccine. PMID:26400195
Carbajo, Aníbal E; Vera, Carolina; González, Paula LM
2009-01-01
Background Oligoryzomys longicaudatus (colilargo) is the rodent responsible for hantavirus pulmonary syndrome (HPS) in Argentine Patagonia. In past decades (1967–1998), trends of precipitation reduction and surface air temperature increase have been observed in western Patagonia. We explore how the potential distribution of the hantavirus reservoir would change under different climate change scenarios based on the observed trends. Methods Four scenarios of potential climate change were constructed using temperature and precipitation changes observed in Argentine Patagonia between 1967 and 1998: Scenario 1 assumed no change in precipitation but a temperature trend as observed; scenario 2 assumed no changes in temperature but a precipitation trend as observed; Scenario 3 included changes in both temperature and precipitation trends as observed; Scenario 4 assumed changes in both temperature and precipitation trends as observed but doubled. We used a validated spatial distribution model of O. longicaudatus as a function of temperature and precipitation. From the model probability of the rodent presence was calculated for each scenario. Results If changes in precipitation follow previous trends, the probability of the colilargo presence would fall in the HPS transmission zone of northern Patagonia. If temperature and precipitation trends remain at current levels for 60 years or double in the future 30 years, the probability of the rodent presence and the associated total area of potential distribution would diminish throughout Patagonia; the areas of potential distribution for colilargos would shift eastwards. These results suggest that future changes in Patagonia climate may lower transmission risk through a reduction in the potential distribution of the rodent reservoir. Conclusion According to our model the rates of temperature and precipitation changes observed between 1967 and 1998 may produce significant changes in the rodent distribution in an equivalent period of time only in certain areas. Given that changes maintain for 60 years or double in 30 years, the hantavirus reservoir Oligoryzomys longicaudatus may contract its distribution in Argentine Patagonia extensively. PMID:19607707
VHF command system study. [spectral analysis of GSFC VHF-PSK and VHF-FSK Command Systems
NASA Technical Reports Server (NTRS)
Gee, T. H.; Geist, J. M.
1973-01-01
Solutions are provided to specific problems arising in the GSFC VHF-PSK and VHF-FSK Command Systems in support of establishment and maintenance of Data Systems Standards. Signal structures which incorporate transmission on the uplink of a clock along with the PSK or FSK data are considered. Strategies are developed for allocating power between the clock and data, and spectral analyses are performed. Bit error probability and other probabilities pertinent to correct transmission of command messages are calculated. Biphase PCM/PM and PCM/FM are considered as candidate modulation techniques on the telemetry downlink, with application to command verification. Comparative performance of PCM/PM and PSK systems is given special attention, including implementation considerations. Gain in bit error performance due to coding is also considered.
Agampodi, Suneth B.; Wickramage, Kolitha
2013-01-01
The fact that yellow fever (YF) has never occurred in Asia remains an “unsolved mystery” in global health. Most countries in Asia with high Aedes aegypti mosquito density are considered “receptive” for YF transmission. Recently, health officials in Sri Lanka issued a public health alert on the potential spread of YF from a migrant group from West Africa. We performed an extensive review of literature pertaining to the risk of YF in Sri Lanka/South Asian region to understand the probability of actual risk and assist health authorities to form evidence informed public health policies/practices. Published data from epidemiological, historical, biological, molecular, and mathematical models were harnessed to assess the risk of YF in Asia. Using this data we examine a number of theories proposed to explain lack of YF in Asia. Considering the evidence available, we conclude that the probable risk of local transmission of YF is extremely low in Sri Lanka and for other South Asian countries despite a high Aedes aegypti density and associated dengue burden. This does not however exclude the future possibility of transmission in Asia, especially considering the rapid influx travelers from endemic areas, as we report, arriving in Sri Lanka. PMID:24367789
Ecological Potential for Rabies Virus Transmission via Scavenging of Dead Bats by Mesocarnivores.
Theimer, Tad C; Dyer, Annie C; Keeley, Brian W; Gilbert, Amy T; Bergman, David L
2017-04-01
Multiple species of bats are reservoirs of rabies virus in the Americas and are occasionally the source of spillover infections into mesocarnivore species. Although rabies transmission generally is assumed to occur via bite, laboratory studies have demonstrated the potential for rabies transmission via ingestion of rabid animals. We investigated the ecological potential for this mode of transmission by assessing mesocarnivore scavenging behavior of dead bats in suburban habitats of Flagstaff, Arizona, US. In autumn 2013, summer 2014, and autumn 2015, we placed 104 rabies-negative bat carcasses either near buildings, in wildland areas, or in residential yards and then monitored them with trail cameras for 5 d. Overall, 52 (50%) bat carcasses were scavenged, with 39 (75%) of those scavenged by striped skunks ( Mephitis mephitis ). Within our study area, striped skunks had a higher ecological potential to contract rabies via ingestion of bat carcasses compared to other mesocarnivore species, due both to a greater number of encounters and a higher probability of ingestion per encounter (91%), and they were significantly more likely to approach bat carcasses in yards than in wildland areas. Raccoons ( Procyon lotor ) and gray foxes ( Urocyon cinereoargenteus ) had fewer encounters (nine and 13, respectively) and lower probability of ingesting bats (33% and 8%, respectively).
Ssematimba, Amos; Elbers, Armin R. W.; Hagenaars, Thomas J.; de Jong, Mart C. M.
2012-01-01
Estimates of the per-contact probability of transmission between farms of Highly Pathogenic Avian Influenza virus of H7N7 subtype during the 2003 epidemic in the Netherlands are important for the design of better control and biosecurity strategies. We used standardized data collected during the epidemic and a model to extract data for untraced contacts based on the daily number of infectious farms within a given distance of a susceptible farm. With these data, we used a maximum likelihood estimation approach to estimate the transmission probabilities by the individual contact types, both traced and untraced. The estimated conditional probabilities, conditional on the contact originating from an infectious farm, of virus transmission were: 0.000057 per infectious farm within 1 km per day, 0.000413 per infectious farm between 1 and 3 km per day, 0.0000895 per infectious farm between 3 and 10 km per day, 0.0011 per crisis organisation contact, 0.0414 per feed delivery contact, 0.308 per egg transport contact, 0.133 per other-professional contact and, 0.246 per rendering contact. We validate these outcomes against literature data on virus genetic sequences for outbreak farms. These estimates can be used to inform further studies on the role that improved biosecurity between contacts and/or contact frequency reduction can play in eliminating between-farm spread of the virus during future epidemics. The findings also highlight the need to; 1) understand the routes underlying the infections without traced contacts and, 2) to review whether the contact-tracing protocol is exhaustive in relation to all the farm’s day-to-day activities and practices. PMID:22808285
Jennings, Katie A.; Platt, Nicola J.; Cragg, Stephanie J.
2015-01-01
Dopamine function is disturbed in Parkinson's disease (PD), but whether and how release of dopamine from surviving neurons is altered has long been debated. Nicotinic acetylcholine receptors (nAChRs) on dopamine axons powerfully govern dopamine release and could be critical contributing factors. We revisited whether fundamental properties of dopamine transmission are changed in a parkinsonian brain and tested the potentially profound masking effects of nAChRs. Using real-time detection of dopamine in mouse striatum after a partial 6-hydroxydopamine lesion and under nAChR inhibition, we reveal that dopamine signals show diminished sensitivity to presynaptic activity. This effect manifested as diminished contrast between DA release evoked by the lowest versus highest frequencies. This reduced activity-dependence was underpinned by loss of short-term facilitation of dopamine release, consistent with an increase in release probability (Pr). With nAChRs active, the reduced activity-dependence of dopamine release after a parkinsonian lesion was masked. Consequently, moment-by-moment variation in activity of nAChRs may lead to dynamic co-variation in dopamine signal impairments in PD. PMID:26117304
Shukla, Sudeep; Arora, Vikas; Jadaun, Alka; Kumar, Jitender; Singh, Nishant; Jain, Vinod Kumar
2015-01-01
Amebiasis, a major health problem in developing countries, is the second most common cause of death due to parasitic infection. Amebiasis is usually transmitted by the ingestion of Entamoeba histolytica cysts through oral–fecal route. Herein, we report on the use of chitosan oligosaccharide-functionalized iron oxide nanoparticles for efficient capture and removal of pathogenic protozoan cysts under the influence of an external magnetic field. These nanoparticles were synthesized through a chemical synthesis process. The synthesized particles were characterized by transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction, and zeta potential analysis. The particles were found to be well dispersed and uniform in size. The capture and removal of pathogenic cysts were demonstrated by fluorescent microscopy, transmission electron microscopy, and scanning electron microscopy (SEM). Three-dimensional modeling of various biochemical components of cyst walls, and thereafter, flexible docking studies demonstrate the probable interaction mechanism of nanoparticles with various components of E. histolytica cyst walls. Results of the present study suggest that E. histolytica cysts can be efficiently captured and removed from contaminated aqueous systems through the application of synthesized nanoparticles. PMID:26261417
Transmission rights and market power
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bushnell, J.
1999-10-01
Most of the concerns about physical transmission rights relate to the ability to implicitly or explicitly remove that transmission capacity from the market-place. Under a very strict form of physical right, owners could simply choose not to sell it if they don't want to use it. Modifications that require the release of spare capacity back into an open market could potentially alleviate this problem but there is concern that such releases would not occur far enough in advance to be of much use to schedulers. Similarly, the transmission capacity that is made available for use by non-rights holders can alsomore » be manipulated by the owners of transmission rights. The alternative form, financial transmission rights, provide to their owners congestion payments, but physical control of transmission paths. In electricity markets such as California's, even financial transmission rights could potentially be utilized to effectively withhold transmission capacity from the marketplace. However, methods for withholding transmission capacity are somewhat more convoluted, and probably more difficult, for owners of financial rights than for owners of physical rights. In this article, the author discusses some of the potential concerns over transmission rights and their use for the exercise of various forms of market power.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Konno, Kohkichi, E-mail: kohkichi@tomakomai-ct.ac.jp; Nagasawa, Tomoaki, E-mail: nagasawa@tomakomai-ct.ac.jp; Takahashi, Rohta, E-mail: takahashi@tomakomai-ct.ac.jp
We consider the scattering of a quantum particle by two independent, successive parity-invariant point interactions in one dimension. The parameter space for the two point interactions is given by the direct product of two tori, which is described by four parameters. By investigating the effects of the two point interactions on the transmission probability of plane wave, we obtain the conditions for the parameter space under which perfect resonant transmission occur. The resonance conditions are found to be described by symmetric and anti-symmetric relations between the parameters.
Karn, Robert C; Laukaitis, Christina M
2014-08-01
In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.
Feng, Jun; Xia, Zhigui; Zhang, Li; Cheng, Siyuan; Wang, Rubo
2016-01-01
The objective of this study was to investigate malaria prevalence after the 2014 earthquakes in Ludian, Yongshan, and Jinggu counties, Yunnan Province, China. We collected and analyzed epidemiological data and made a risk assessment of transmission probability. From January 2005 to July 2015, 87 malaria cases were reported in the three counties, most of which (81.6%) occurred between 2005 and 2009, with five cases reported in Jinggu County between January 2014 and July 2015, of which one case was reported after the earthquake. In addition, no local transmission occurred in the three counties from 2010, and 95.5% of imported malaria occurred in patients who had returned from Myanmar. The townships of Lehong, Qingsheng, and Weiyuan were the main endemic areas in the three counties. The probability of malaria transmission in the three counties was low, but Jinggu County had a higher risk due to the existence of infected patients and an appropriate vector. With sporadic cases reported annually, close monitoring should continue to enhance early detection of a possible malaria outbreak. PMID:26711514
Genetic aspect of Alzheimer disease: Results of complex segregation analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sadonvick, A.D.; Lee, I.M.L.; Bailey-Wilson, J.E.
1994-09-01
The study was designed to evaluate the possibility that a single major locus will explain the segregation of Alzheimer disease (AD). The data were from the population-based AD Genetic Database and consisted of 402 consecutive, unrelated probands, diagnosed to have either `probable` or `autopsy confirmed` AD and their 2,245 first-degree relatives. In this analysis, a relative was considered affected with AD only when there were sufficient medical/autopsy data to support diagnosis of AD being the most likely cause of the dementia. Transmission probability models allowing for a genotype-dependent and logistically distributed age-of-onset were used. The program REGTL in the S.A.G.E.more » computer program package was used for a complex segregation analysis. The models included correction for single ascertainment. Regressive familial effects were not estimated. The data were analyzed to test for single major locus (SML), random transmission and no transmission (environmental) hypotheses. The results of the complex segregation analysis showed that (1) the SML was the best fit, and (2) the non-genetic models could be rejected.« less
Vitamin A supplements for reducing mother-to-child HIV transmission
Wiysonge, Charles S; Ndze, Valantine N; Kongnyuy, Eugene J; Shey, Muki S
2017-01-01
Background Strategies to reduce the risk of mother-to-child transmission of the human immunodeficiency virus (HIV) include lifelong antiretroviral therapy (ART) for HIV-positive women, exclusive breastfeeding from birth for six weeks plus nevirapine or replacement feeding plus nevirapine from birth for four to six weeks, elective Caesarean section delivery, and avoiding giving children chewed food. In some settings, these interventions may not be practical, feasible, or affordable. Simple, inexpensive, and effective interventions (that could potentially be implemented even in the absence of prenatal HIV testing programmes) would be valuable. Vitamin A, which plays a role in immune function, is one low-cost intervention that has been suggested in such settings. Objectives To summarize the effects of giving vitamin A supplements to HIV-positive women during pregnancy and after delivery. Search methods We searched the Cochrane Central Register of Controlled Trials (CENTRAL), PubMed, Embase, and the World Health Organization International Clinical Trials Registry Platform (WHO ICTRP) up to 25 August 2017, and checked the reference lists of relevant articles for eligible studies. Selection criteria We included randomized controlled trials conducted in any setting that compared vitamin A supplements to placebo or no intervention among HIV-positive women during pregnancy or after delivery, or both. Data collection and analysis At least two review authors independently assessed study eligibility and extracted data. We expressed study results as risk ratios (RR) or mean differences (MD) as appropriate, with their 95% confidence intervals (CI), and conducted random-effects meta-analyses. This is an update of a review last published in 2011. Main results Five trials met the inclusion criteria. These were conducted in Malawi, South Africa, Tanzania, and Zimbabwe between 1995 and 2005 and none of the participants received ART. Women allocated to intervention arms received vitamin A supplements at a variety of doses (daily during pregnancy; a single dose immediately after delivery, or daily doses during pregnancy plus a single dose after delivery). Women allocated to comparison arms received identical placebo (6601 women, 4 trials) or no intervention (697 women, 1 trial). Four trials (with 6995 women) had low risk of bias and one trial (with 303 women) had high risk of attrition bias. The trials show that giving vitamin A supplements to HIV-positive women during pregnancy, the immediate postpartum period, or both, probably has little or no effect on mother-to-child transmission of HIV (RR 1.07, 95% CI 0.91 to 1.26; 4428 women, 5 trials, moderate certainty evidence) and may have little or no effect on child death by two years of age (RR 1.06, 95% CI 0.92 to 1.22; 3883 women, 3 trials, low certainty evidence). However, giving vitamin A supplements during pregnancy may increase the mean birthweight (MD 34.12 g, 95% CI −12.79 to 81.02; 2181 women, 3 trials, low certainty evidence) and probably reduces the incidence of low birthweight (RR 0.78, 95% CI 0.63 to 0.97; 1819 women, 3 trials, moderate certainty evidence); but we do not know whether vitamin A supplements affect the risk of preterm delivery (1577 women, 2 trials), stillbirth (2335 women, 3 trials), or maternal death (1267 women, 2 trials). Authors' conclusions Antepartum or postpartum vitamin A supplementation, or both, probably has little or no effect on mother-to-child transmission of HIV in women living with HIV infection and not on antiretroviral drugs. The intervention has largely been superseded by ART which is widely available and effective in preventing vertical transmission. Vitamin A supplements for reducing mother-to-child transmission of HIV infection What is the aim of this review? The main aim of this Cochrane Review was to assess the effects of giving vitamin A supplements to HIV-positive women, during pregnancy or after delivery, or both, on the risk of mother-to-child transmission of HIV infection. Cochrane researchers collected and examined all relevant studies to answer this question and included five trials. This is an update of a review last published in 2011. What is the key message of this review? Giving vitamin A supplements to HIV-positive women, during pregnancy or after delivery, or both, probably makes little or no difference to the risk of mother-to-child transmission of HIV (moderate certainty evidence). What are the main results of the review? Five trials met the inclusion criteria of the review. Two trials were from South Africa and one trial each from Malawi, Tanzania, and Zimbabwe. The trials compared women receiving vitamin A supplements to women not receiving such supplements. None of the participants received antiretroviral therapy (ART). The review shows that in women living with HIV infection and not on ART: - giving vitamin A supplements to HIV-positive women during pregnancy, immediately after delivery, or both, probably has little or no effect on the risk of mother-to-child transmission of HIV (moderate certainty evidence) and may have little or no effect on child death by two years of age (low certainty evidence); - giving vitamin A supplements to HIV-positive women during pregnancy may increase the mean birthweight (low certainty evidence) and probably reduces the number of low birthweight babies (moderate certainty evidence), but it is uncertain whether the intervention has an effect on the number of preterm births, stillbirths, or deaths among the women (very low certainty evidence). The intervention has largely been superseded by ART, which is widely available and effective in preventing mother-to-child transmission of HIV. How up-to-date is this review? The review authors searched for studies up to 25 August 2017. PMID:28880995
Genné, Daniel
2007-10-10
For many centuries, man is fascinated by bats, the only flying mammals. Probably because of their particular immune system, bats can be considered an important reservoir for new emerging viral diseases like SARS-Coronavirus, Marburg fever, Ebola fever and Nipah virus encephalitis. During closer contact, they can transmit rabies and probably other nonviral infectious diseases. Bats get closer to man due to ecological modifications like deforestation, so that transmission of new infectious agents might provoke dramatic epidemics.
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Lee, Hong-Tao
1989-01-01
A new approach for determination of machine-tool settings for spiral bevel gears is proposed. The proposed settings provide a predesigned parabolic function of transmission errors and the desired location and orientation of the bearing contact. The predesigned parabolic function of transmission errors is able to absorb piece-wise linear functions of transmission errors that are caused by the gear misalignment and reduce gear noise. The gears are face-milled by head cutters with conical surfaces or surfaces of revolution. A computer program for simulation of meshing, bearing contact and determination of transmission errors for misaligned gear has been developed.
NASA Astrophysics Data System (ADS)
Jiang, YuXiao; Guo, PengLiang; Gao, ChengYan; Wang, HaiBo; Alzahrani, Faris; Hobiny, Aatef; Deng, FuGuo
2017-12-01
We present an original self-error-rejecting photonic qubit transmission scheme for both the polarization and spatial states of photon systems transmitted over collective noise channels. In our scheme, we use simple linear-optical elements, including half-wave plates, 50:50 beam splitters, and polarization beam splitters, to convert spatial-polarization modes into different time bins. By using postselection in different time bins, the success probability of obtaining the uncorrupted states approaches 1/4 for single-photon transmission, which is not influenced by the coefficients of noisy channels. Our self-error-rejecting transmission scheme can be generalized to hyperentangled n-photon systems and is useful in practical high-capacity quantum communications with photon systems in two degrees of freedom.
Le Menach, Arnaud; Takala, Shannon; McKenzie, F Ellis; Perisse, Andre; Harris, Anthony; Flahault, Antoine; Smith, David L
2007-01-25
Insecticide Treated Nets (ITNs) are an important tool for malaria control. ITNs are effective because they work on several parts of the mosquito feeding cycle, including both adult killing and repelling effects. Using an elaborated description of the classic feeding cycle model, simple formulas have been derived to describe how ITNs change mosquito behaviour and the intensity of malaria transmission, as summarized by vectorial capacity and EIR. The predicted changes are illustrated as a function of the frequency of ITN use for four different vector populations using parameter estimates from the literature. The model demonstrates that ITNs simultaneously reduce mosquitoes' lifespans, lengthen the feeding cycle, and by discouraging human biting divert more bites onto non-human hosts. ITNs can substantially reduce vectorial capacity through small changes to all of these quantities. The total reductions in vectorial capacity differ, moreover, depending on baseline behavior in the absence of ITNs. Reductions in lifespan and vectorial capacity are strongest for vector species with high baseline survival. Anthropophilic and zoophilic species are affected differently by ITNs; the feeding cycle is lengthened more for anthrophilic species, and the proportion of bites that are diverted onto non-human hosts is higher for zoophilic species. This model suggests that the efficacy of ITNs should be measured as a total reduction in transmission intensity, and that the quantitative effects will differ by species and by transmission intensity. At very high rates of ITN use, ITNs can generate large reductions in transmission intensity that could provide very large reductions in transmission intensity, and effective malaria control in some areas, especially when used in combination with other control measures. At high EIR, ITNs will probably not substantially reduce the parasite rate, but when transmission intensity is low, reductions in vectorial capacity combine with reductions in the parasite rate to generate very large reductions in EIR.
Zehender, Gianguglielmo; Frati, Elena Rosanna; Martinelli, Marianna; Bianchi, Silvia; Amendola, Antonella; Ebranati, Erika; Ciccozzi, Massimo; Galli, Massimo; Lai, Alessia; Tanzi, Elisabetta
2016-04-01
A major limitation when reconstructing the origin and evolution of HPV-16 is the lack of reliable substitution rate estimates for the viral genes. On the basis of the hypothesis of human HPV-16 co-divergence, we estimated a mean evolutionary rate of 1.47×10(-7) (95% HPD=0.64-2.47×10(-7)) subs/site/year for the viral LCR region. The results of a Bayesian phylogeographical analysis suggest that the currently circulating HPV-16 most probably originated in Africa about 110 thousand years ago (Kya), before giving rise to four known geographical lineages: the Asian/European lineage, which most probably originated in Asia a mean 38 Kya, and the Asian/American and two African lineages, which probably respectively originated about 33 and 27 Kya. These data closely reflect current hypotheses concerning modern human expansion based on studies of mitochondrial DNA phylogeny. The correlation between ancient human migration and the present HPV phylogeny may be explained by the co-existence of modes of transmission other than sexual transmission. Copyright © 2016. Published by Elsevier B.V.
18 CFR 358.8 - Implementation requirements.
Code of Federal Regulations, 2010 CFR
2010-04-01
... marketing functions. (b) Compliance measures and written procedures. (1) A transmission provider must... procedures referred to in § 358.7(d) to all its transmission function employees, marketing function employees... its Internet Web site. (d) Books and records. A transmission provider must maintain its books of...
Entomologic considerations in the study of onchocerciasis transmission.
Vargas, L; Díaz-Nájera, A
1980-01-01
The entomological resources utilized for a better understanding of Onchocerca volvulus transmission are discussed in this paper. Vector density, anthropohilia, gonotrophic cycyle, parous condition longevity and probability of survival in days after the infectious meal are assessed here in order to integrate an overall picture. The concept of vectorial capacity is developed stressing the quantitative aspects. Parasitism of the black-flies by filariae that are doubtfully identified as O. volvulus is also mentioned here.
MAI statistics estimation and analysis in a DS-CDMA system
NASA Astrophysics Data System (ADS)
Alami Hassani, A.; Zouak, M.; Mrabti, M.; Abdi, F.
2018-05-01
A primary limitation of Direct Sequence Code Division Multiple Access DS-CDMA link performance and system capacity is multiple access interference (MAI). To examine the performance of CDMA systems in the presence of MAI, i.e., in a multiuser environment, several works assumed that the interference can be approximated by a Gaussian random variable. In this paper, we first develop a new and simple approach to characterize the MAI in a multiuser system. In addition to statistically quantifying the MAI power, the paper also proposes a statistical model for both variance and mean of the MAI for synchronous and asynchronous CDMA transmission. We show that the MAI probability density function (PDF) is Gaussian for the equal-received-energy case and validate it by computer simulations.
A Distributed Transmission Rate Adjustment Algorithm in Heterogeneous CSMA/CA Networks
Xie, Shuanglong; Low, Kay Soon; Gunawan, Erry
2015-01-01
Distributed transmission rate tuning is important for a wide variety of IEEE 802.15.4 network applications such as industrial network control systems. Such systems often require each node to sustain certain throughput demand in order to guarantee the system performance. It is thus essential to determine a proper transmission rate that can meet the application requirement and compensate for network imperfections (e.g., packet loss). Such a tuning in a heterogeneous network is difficult due to the lack of modeling techniques that can deal with the heterogeneity of the network as well as the network traffic changes. In this paper, a distributed transmission rate tuning algorithm in a heterogeneous IEEE 802.15.4 CSMA/CA network is proposed. Each node uses the results of clear channel assessment (CCA) to estimate the busy channel probability. Then a mathematical framework is developed to estimate the on-going heterogeneous traffics using the busy channel probability at runtime. Finally a distributed algorithm is derived to tune the transmission rate of each node to accurately meet the throughput requirement. The algorithm does not require modifications on IEEE 802.15.4 MAC layer and it has been experimentally implemented and extensively tested using TelosB nodes with the TinyOS protocol stack. The results reveal that the algorithm is accurate and can satisfy the throughput demand. Compared with existing techniques, the algorithm is fully distributed and thus does not require any central coordination. With this property, it is able to adapt to traffic changes and re-adjust the transmission rate to the desired level, which cannot be achieved using the traditional modeling techniques. PMID:25822140
Weiss, Howard; Elon, Lisa; Si, Wenpei; Norris, Sharon L.
2018-01-01
With over 3 billion airline passengers annually, the inflight transmission of infectious diseases is an important global health concern. Over a dozen cases of inflight transmission of serious infections have been documented, and air travel can serve as a conduit for the rapid spread of newly emerging infections and pandemics. Despite sensational media stories and anecdotes, the risks of transmission of respiratory viruses in an airplane cabin are unknown. Movements of passengers and crew may facilitate disease transmission. On 10 transcontinental US flights, we chronicled behaviors and movements of individuals in the economy cabin on single-aisle aircraft. We simulated transmission during flight based on these data. Our results indicate there is low probability of direct transmission to passengers not seated in close proximity to an infectious passenger. This data-driven, dynamic network transmission model of droplet-mediated respiratory disease is unique. To measure the true pathogen burden, our team collected 229 environmental samples during the flights. Although eight flights were during Influenza season, all qPCR assays for 18 common respiratory viruses were negative. PMID:29555754
NASA Astrophysics Data System (ADS)
Li, Hanshan
2016-04-01
To enhance the stability and reliability of multi-screens testing system, this paper studies multi-screens target optical information transmission link properties and performance in long-distance, sets up the discrete multi-tone modulation transmission model based on geometric model of laser multi-screens testing system and visible light information communication principle; analyzes the electro-optic and photoelectric conversion function of sender and receiver in target optical information communication system; researches target information transmission performance and transfer function of the generalized visible-light communication channel; found optical information communication transmission link light intensity space distribution model and distribution function; derives the SNR model of information transmission communication system. Through the calculation and experiment analysis, the results show that the transmission error rate increases with the increment of transmission rate in a certain channel modulation depth; when selecting the appropriate transmission rate, the bit error rate reach 0.01.
Ferreri, Luca; Perazzo, Silvia; Venturino, Ezio; Giacobini, Mario; Bertolotti, Luigi; Mannelli, Alessandro
2017-08-01
Spirochetes belonging to the Borrelia burgdoferi sensu lato (sl) group cause Lyme Borreliosis (LB), which is the most commonly reported vector-borne zoonosis in Europe. B. burgdorferi sl is maintained in nature in a complex cycle involving Ixodes ricinus ticks and several species of vertebrate hosts. The transmission dynamics of B. burgdorferi sl is complicated by the varying competence of animals for different genospecies of spirochetes that, in turn, vary in their capability of causing disease. In this study, a set of difference equations simplifying the complex interaction between vectors and their hosts (competent and not for Borrelia) is built to gain insights into conditions underlying the dominance of B. lusitaniae (transmitted by lizards to susceptible ticks) and the maintenance of B. afzelii (transmitted by wild rodents) observed in a study area in Tuscany, Italy. Findings, in agreement with field observations, highlight the existence of a threshold for the fraction of larvae feeding on rodents below which the persistence of B. afzelii is not possible. Furthermore, thresholds change as nonlinear functions of the expected number of nymph bites on mice, and the transmission and recovery probabilities. In conclusion, our model provided an insight into mechanisms underlying the relative frequency of different Borrelia genospecies, as observed in field studies. Copyright © 2017 Elsevier Inc. All rights reserved.
Regan, D G; Wood, J G; Benevent, C; Ali, H; Smith, L Watchirs; Robertson, P W; Ferson, M J; Fairley, C K; Donovan, B; Law, M G
2016-05-01
Several outbreaks of hepatitis A in men who have sex with men (MSM) were reported in the 1980s and 1990s in Australia and other countries. An effective hepatitis A virus (HAV) vaccine has been available in Australia since 1994 and is recommended for high-risk groups including MSM. No outbreaks of hepatitis A in Australian MSM have been reported since 1996. In this study, we aimed to estimate HAV transmissibility in MSM populations in order to inform targets for vaccine coverage in such populations. We used mathematical models of HAV transmission in a MSM population to estimate the basic reproduction number (R 0) and the probability of an HAV epidemic occurring as a function of the immune proportion. We estimated a plausible range for R 0 of 1·71-3·67 for HAV in MSM and that sustained epidemics cannot occur once the proportion immune to HAV is greater than ~70%. To our knowledge this is the first estimate of R 0 and the critical population immunity threshold for HAV transmission in MSM. As HAV is no longer endemic in Australia or in most other developed countries, vaccination is the only means of maintaining population immunity >70%. Our findings provide impetus to promote HAV vaccination in high-risk groups such as MSM.
2014-01-01
Background Transmission models can aid understanding of disease dynamics and are useful in testing the efficiency of control measures. The aim of this study was to formulate an appropriate stochastic Susceptible-Infectious-Resistant/Carrier (SIR) model for Salmonella Typhimurium in pigs and thus estimate the transmission parameters between states. Results The transmission parameters were estimated using data from a longitudinal study of three Danish farrow-to-finish pig herds known to be infected. A Bayesian model framework was proposed, which comprised Binomial components for the transition from susceptible to infectious and from infectious to carrier; and a Poisson component for carrier to infectious. Cohort random effects were incorporated into these models to allow for unobserved cohort-specific variables as well as unobserved sources of transmission, thus enabling a more realistic estimation of the transmission parameters. In the case of the transition from susceptible to infectious, the cohort random effects were also time varying. The number of infectious pigs not detected by the parallel testing was treated as unknown, and the probability of non-detection was estimated using information about the sensitivity and specificity of the bacteriological and serological tests. The estimate of the transmission rate from susceptible to infectious was 0.33 [0.06, 1.52], from infectious to carrier was 0.18 [0.14, 0.23] and from carrier to infectious was 0.01 [0.0001, 0.04]. The estimate for the basic reproduction ration (R 0 ) was 1.91 [0.78, 5.24]. The probability of non-detection was estimated to be 0.18 [0.12, 0.25]. Conclusions The proposed framework for stochastic SIR models was successfully implemented to estimate transmission rate parameters for Salmonella Typhimurium in swine field data. R 0 was 1.91, implying that there was dissemination of the infection within pigs of the same cohort. There was significant temporal-cohort variability, especially at the susceptible to infectious stage. The model adequately fitted the data, allowing for both observed and unobserved sources of uncertainty (cohort effects, diagnostic test sensitivity), so leading to more reliable estimates of transmission parameters. PMID:24774444
Investigation of and Response to 2 Plague Cases, Yosemite National Park, California, USA, 2015.
Danforth, Mary; Novak, Mark; Petersen, Jeannine; Mead, Paul; Kingry, Luke; Weinburke, Matthew; Buttke, Danielle; Hacker, Gregory; Tucker, James; Niemela, Michael; Jackson, Bryan; Padgett, Kerry; Liebman, Kelly; Vugia, Duc; Kramer, Vicki
2016-12-01
In August 2015, plague was diagnosed for 2 persons who had visited Yosemite National Park in California, USA. One case was septicemic and the other bubonic. Subsequent environmental investigation identified probable locations of exposure for each patient and evidence of epizootic plague in other areas of the park. Transmission of Yersinia pestis was detected by testing rodent serum, fleas, and rodent carcasses. The environmental investigation and whole-genome multilocus sequence typing of Y. pestis isolates from the patients and environmental samples indicated that the patients had been exposed in different locations and that at least 2 distinct strains of Y. pestis were circulating among vector-host populations in the area. Public education efforts and insecticide applications in select areas to control rodent fleas probably reduced the risk for plague transmission to park visitors and staff.
Continuous-variable quantum key distribution in uniform fast-fading channels
NASA Astrophysics Data System (ADS)
Papanastasiou, Panagiotis; Weedbrook, Christian; Pirandola, Stefano
2018-03-01
We investigate the performance of several continuous-variable quantum key distribution protocols in the presence of uniform fading channels. These are lossy channels whose transmissivity changes according to a uniform probability distribution. We assume the worst-case scenario where an eavesdropper induces a fast-fading process, where she chooses the instantaneous transmissivity while the remote parties may only detect the mean statistical effect. We analyze coherent-state protocols in various configurations, including the one-way switching protocol in reverse reconciliation, the measurement-device-independent protocol in the symmetric configuration, and its extension to a three-party network. We show that, regardless of the advantage given to the eavesdropper (control of the fading), these protocols can still achieve high rates under realistic attacks, within reasonable values for the variance of the probability distribution associated with the fading process.
Detecting a trend change in cross-border epidemic transmission
NASA Astrophysics Data System (ADS)
Maeno, Yoshiharu
2016-09-01
A method for a system of Langevin equations is developed for detecting a trend change in cross-border epidemic transmission. The equations represent a standard epidemiological SIR compartment model and a meta-population network model. The method analyzes a time series of the number of new cases reported in multiple geographical regions. The method is applicable to investigating the efficacy of the implemented public health intervention in managing infectious travelers across borders. It is found that the change point of the probability of travel movements was one week after the WHO worldwide alert on the SARS outbreak in 2003. The alert was effective in managing infectious travelers. On the other hand, it is found that the probability of travel movements did not change at all for the flu pandemic in 2009. The pandemic did not affect potential travelers despite the WHO alert.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lupinetti, F.
1988-01-01
This paper outlines a video communication system capable of non-line-of-sight (NLOS), secure, low-probability of intercept (LPI), antijam, real time transmission and reception of video information in a tactical enviroment. An introduction to a class of ternary PN sequences is presented to familiarize the reader with yet another avenue for spreading and despreading baseband information. The use of the high frequency (HF) band (1.5 to 30 MHz) for real time video transmission is suggested to allow NLOS communication. The spreading of the baseband information by means of multiple nontrivially different ternary pseudonoise (PN) sequence is used in order to assure encryptionmore » of the signal, enhanced security, a good degree of LPI, and good antijam features. 18 refs., 3 figs., 1 tab.« less
Investigation of and Response to 2 Plague Cases, Yosemite National Park, California, USA, 2015
Danforth, Mary; Novak, Mark; Petersen, Jeannine; Mead, Paul; Kingry, Luke; Weinburke, Matthew; Buttke, Danielle; Hacker, Gregory; Tucker, James; Niemela, Michael; Jackson, Bryan; Padgett, Kerry; Liebman, Kelly; Vugia, Duc
2016-01-01
In August 2015, plague was diagnosed for 2 persons who had visited Yosemite National Park in California, USA. One case was septicemic and the other bubonic. Subsequent environmental investigation identified probable locations of exposure for each patient and evidence of epizootic plague in other areas of the park. Transmission of Yersinia pestis was detected by testing rodent serum, fleas, and rodent carcasses. The environmental investigation and whole-genome multilocus sequence typing of Y. pestis isolates from the patients and environmental samples indicated that the patients had been exposed in different locations and that at least 2 distinct strains of Y. pestis were circulating among vector–host populations in the area. Public education efforts and insecticide applications in select areas to control rodent fleas probably reduced the risk for plague transmission to park visitors and staff. PMID:27870634
Johnson, Patrick S; Sweeney, Mary M; Herrmann, Evan S; Johnson, Matthew W
2016-06-01
Alcohol use, especially at binge levels, is associated with sexual HIV risk behavior, but the mechanisms through which alcohol increases sexual risk taking are not well-examined. Delay discounting, that is, devaluation of future consequences as a function of delay to their occurrence, has been implicated in a variety of problem behaviors, including risky sexual behavior. Probability discounting is studied with a similar framework as delay discounting, but is a distinct process in which a consequence is devalued because it is uncertain or probabilistic. Twenty-three, nondependent alcohol users (13 male, 10 female; mean age = 25.3 years old) orally consumed alcohol (1 g/kg) or placebo in 2 separate experimental sessions. During sessions, participants completed tasks examining delay and probability discounting of hypothetical condom-protected sex (Sexual Delay Discounting Task, Sexual Probability Discounting Task) and of hypothetical and real money. Alcohol decreased the likelihood that participants would wait to have condom-protected sex versus having immediate, unprotected sex. Alcohol also decreased the likelihood that participants would use an immediately available condom given a specified level of sexually transmitted infection (STI) risk. Alcohol did not affect delay discounting of money, but it did increase participants' preferences for larger, probabilistic monetary rewards over smaller, certain rewards. Acute, binge-level alcohol intoxication may increase sexual HIV risk by decreasing willingness to delay sex in order to acquire a condom in situations where one is not immediately available, and by decreasing sensitivity to perceived risk of STI contraction. These findings suggest that delay and probability discounting are critical, but heretofore unrecognized, processes that may mediate the relations between alcohol use and HIV risk. Copyright © 2016 by the Research Society on Alcoholism.
Proposal for a transmon-based quantum router.
Sala, Arnau; Blaauboer, M
2016-07-13
We propose an implementation of a quantum router for microwave photons in a superconducting qubit architecture consisting of a transmon qubit, SQUIDs and a nonlinear capacitor. We model and analyze the dynamics of operation of the quantum switch using quantum Langevin equations in a scattering approach and compute the photon reflection and transmission probabilities. For parameters corresponding to up-to-date experimental devices we predict successful operation of the router with probabilities above 94%.
Bintz, Jason; Lenhart, Suzanne; Lanzas, Cristina
2017-01-01
We implement an agent-based model for Clostridium difficile transmission in hospitals that accounts for several processes and individual factors including environmental and antibiotic heterogeneity in order to evaluate the efficacy of various control measures aimed at reducing environmental contamination and mitigating the effects of antibiotic use on transmission. In particular, we account for local contamination levels that contribute to the probability of colonization and we account for both the number and type of antibiotic treatments given to patients. Simulations illustrate the relative efficacy of several strategies for the reduction of nosocomial colonizations and nosocomial diseases. PMID:27826877
Statistical performance evaluation of ECG transmission using wireless networks.
Shakhatreh, Walid; Gharaibeh, Khaled; Al-Zaben, Awad
2013-07-01
This paper presents simulation of the transmission of biomedical signals (using ECG signal as an example) over wireless networks. Investigation of the effect of channel impairments including SNR, pathloss exponent, path delay and network impairments such as packet loss probability; on the diagnosability of the received ECG signal are presented. The ECG signal is transmitted through a wireless network system composed of two communication protocols; an 802.15.4- ZigBee protocol and an 802.11b protocol. The performance of the transmission is evaluated using higher order statistics parameters such as kurtosis and Negative Entropy in addition to the common techniques such as the PRD, RMS and Cross Correlation.
Horizontal transmission of group B streptococcus in a neonatal intensive care unit
Morinis, Julia; Shah, Jay; Murthy, Prashanth; Fulford, Martha
2011-01-01
The incidence of early-onset group B streptococcal (GBS) sepsis in the neonatal population has decreased substantially since the introduction of maternal intrapartum antibiotic prophylaxis and routine prenatal screening. However, these strategies have not reduced the incidence of late-onset GBS infections. Additional research pertaining to the transmission of late-onset GBS infections is required to develop effective preventive methods. The present report describes probable horizontal transmission of late-onset GBS infection among three infants in a neonatal intensive care unit. GBS strain confirmation was based on the microbiological picture, antibiogram and pulsed-field gel electrophoresis. These cases highlight the morbidity associated with late-onset GBS disease and the importance of considering horizontal transmission as an etiological factor in GBS infection in the newborn period. Further studies assessing horizontal transmission in late-onset GBS disease may improve prevention and early intervention. PMID:22654550
Horizontal transmission of group B streptococcus in a neonatal intensive care unit.
Morinis, Julia; Shah, Jay; Murthy, Prashanth; Fulford, Martha
2011-06-01
The incidence of early-onset group B streptococcal (GBS) sepsis in the neonatal population has decreased substantially since the introduction of maternal intrapartum antibiotic prophylaxis and routine prenatal screening. However, these strategies have not reduced the incidence of late-onset GBS infections. Additional research pertaining to the transmission of late-onset GBS infections is required to develop effective preventive methods. The present report describes probable horizontal transmission of late-onset GBS infection among three infants in a neonatal intensive care unit. GBS strain confirmation was based on the microbiological picture, antibiogram and pulsed-field gel electrophoresis. These cases highlight the morbidity associated with late-onset GBS disease and the importance of considering horizontal transmission as an etiological factor in GBS infection in the newborn period. Further studies assessing horizontal transmission in late-onset GBS disease may improve prevention and early intervention.
Ebrahimi, Sahar; Bordbar, Ali; Rastaghi, Ahmad R Esmaeili; Parvizi, Parviz
2016-06-01
Cutaneous leishmaniasis (CL) is a complex vector-borne disease caused by Leishmania parasites that are transmitted by the bite of several species of infected female phlebotomine sand flies. Monthly factor analysis of climatic variables indicated fundamental variables. Principal component-based regionalization was used for recognition of climatic zones using a clustering integrated method that identified five climatic zones based on factor analysis. To investigate spatial distribution of the sand fly species, the kriging method was used as an advanced geostatistical procedure in the ArcGIS modeling system that is beneficial to design measurement plans and to predict the transmission cycle in various regions of Khuzestan province, southwest of Iran. However, more than an 80% probability of P. papatasi was observed in rainy and temperate bio-climatic zones with a high potential of CL transmission. Finding P. sergenti revealed the probability of transmission and distribution patterns of a non-native vector of CL in related zones. These findings could be used as models indicating climatic zones and environmental variables connected to sand fly presence and vector distribution. Furthermore, this information is appropriate for future research efforts into the ecology of Phlebotomine sand flies and for the prevention of CL vector transmission as a public health priority. © 2016 The Society for Vector Ecology.
Estimating malaria transmission from humans to mosquitoes in a noisy landscape.
Reiner, Robert C; Guerra, Carlos; Donnelly, Martin J; Bousema, Teun; Drakeley, Chris; Smith, David L
2015-10-06
A basic quantitative understanding of malaria transmission requires measuring the probability a mosquito becomes infected after feeding on a human. Parasite prevalence in mosquitoes is highly age-dependent, and the unknown age-structure of fluctuating mosquito populations impedes estimation. Here, we simulate mosquito infection dynamics, where mosquito recruitment is modelled seasonally with fractional Brownian noise, and we develop methods for estimating mosquito infection rates. We find that noise introduces bias, but the magnitude of the bias depends on the 'colour' of the noise. Some of these problems can be overcome by increasing the sampling frequency, but estimates of transmission rates (and estimated reductions in transmission) are most accurate and precise if they combine parity, oocyst rates and sporozoite rates. These studies provide a basis for evaluating the adequacy of various entomological sampling procedures for measuring malaria parasite transmission from humans to mosquitoes and for evaluating the direct transmission-blocking effects of a vaccine. © 2015 The Authors.
Wet climate and transportation routes accelerate spread of human plague
Xu, Lei; Stige, Leif Chr.; Kausrud, Kyrre Linné; Ben Ari, Tamara; Wang, Shuchun; Fang, Xiye; Schmid, Boris V.; Liu, Qiyong; Stenseth, Nils Chr.; Zhang, Zhibin
2014-01-01
Currently, large-scale transmissions of infectious diseases are becoming more closely associated with accelerated globalization and climate change, but quantitative analyses are still rare. By using an extensive dataset consisting of date and location of cases for the third plague pandemic from 1772 to 1964 in China and a novel method (nearest neighbour approach) which deals with both short- and long-distance transmissions, we found the presence of major roads, rivers and coastline accelerated the spread of plague and shaped the transmission patterns. We found that plague spread velocity was positively associated with wet conditions (measured by an index of drought and flood events) in China, probably due to flood-driven transmission by people or rodents. Our study provides new insights on transmission patterns and possible mechanisms behind variability in transmission speed, with implications for prevention and control measures. The methodology may also be applicable to studies of disease dynamics or species movement in other systems. PMID:24523275
Effect of advanced component technology on helicopter transmissions
NASA Technical Reports Server (NTRS)
Lewicki, David G.; Townsend, Dennis P.
1989-01-01
Experimental tests were performed on the NASA/Bell Helicopter Textron (BHT) 500 hp advanced technology transmission (ATT) at the NASA Lewis Research Center. The ATT was a retrofit of the OH-58C helicopter 236 kW (317 hp) main rotor transmission, upgraded to 373 kW (500 hp), with a design goal of retaining long life with a minimum increase in cost, weight, and size. Vibration, strain, efficiency, deflection, and temperature experiments were performed and the results were compared to previous experiments on the OH-58A, OH-58C, and UH-60A transmissions. The high-contact-ratio gears and the cantilevered-mounted, flexible ring gear of the ATT reduced vibration compared to that of the OH-58C. The ATT flexible ring gear improved planetary load sharing compared to that of the rigid ring gear of the UH-60A transmission. The ATT mechanical efficiency was lower than that of the OH-58A transmission, probably due to the high-contact-ratio planetary gears.
Wahlstrom-Helgren, Sarah
2016-01-01
Feed-forward inhibitory (FFI) circuits are important for many information-processing functions. FFI circuit operations critically depend on the balance and timing between the excitatory and inhibitory components, which undergo rapid dynamic changes during neural activity due to short-term plasticity (STP) of both components. How dynamic changes in excitation/inhibition (E/I) balance during spike trains influence FFI circuit operations remains poorly understood. In the current study we examined the role of STP in the FFI circuit functions in the mouse hippocampus. Using a coincidence detection paradigm with simultaneous activation of two Schaffer collateral inputs, we found that the spiking probability in the target CA1 neuron was increased while spike precision concomitantly decreased during high-frequency bursts compared with a single spike. Blocking inhibitory synaptic transmission revealed that dynamics of inhibition predominately modulates the spike precision but not the changes in spiking probability, whereas the latter is modulated by the dynamics of excitation. Further analyses combining whole cell recordings and simulations of the FFI circuit suggested that dynamics of the inhibitory circuit component may influence spiking behavior during bursts by broadening the width of excitatory postsynaptic responses and that the strength of this modulation depends on the basal E/I ratio. We verified these predictions using a mouse model of fragile X syndrome, which has an elevated E/I ratio, and found a strongly reduced modulation of postsynaptic response width during bursts. Our results suggest that changes in the dynamics of excitatory and inhibitory circuit components due to STP play important yet distinct roles in modulating the properties of FFI circuits. PMID:27605532
The lymphocytic cholinergic system and its contribution to the regulation of immune activity.
Kawashima, Koichiro; Fujii, Takeshi
2003-12-26
Lymphocytes express most of the cholinergic components found in the nervous system, including acetylcholine (ACh), choline acetyltransferase (ChAT), high affinity choline transporter, muscarinic and nicotinic ACh receptors (mAChRs and nAChRs, respectively), and acetylcholinesterase. Stimulation of T and B cells with ACh or another mAChR agonist elicits intracellular Ca2+ signaling, up-regulation of c-fos expression, increased nitric oxide synthesis and IL-2-induced signal transduction, probably via M3 and M5 mAChR-mediated pathways. Acute stimulation of nAChRs with ACh or nicotine causes rapid and transient Ca2+ signaling in T and B cells, probably via alpha7 nAChR subunit-mediated pathways. Chronic nicotine stimulation, by contrast, down-regulates nAChR expression and suppresses T cell activity. Activation of T cells with phytohemagglutinin or antibodies against cell surface molecules enhances lymphocytic cholinergic transmission by activating expression of ChAT and M5 mAChR, which is suggestive of local cholinergic regulation of immune system activity. This idea is supported by the facts that lymphocytic cholinergic activity reflects well the changes in immune system function seen in animal models of immune deficiency and immune acceleration. Collectively, these data provide a compelling picture in which lymphocytes constitute a cholinergic system that is independent of cholinergic nerves, and which is involved in the regulation of immune function.
Force Transmission Modes of Non-Cohesive and Cohesive Materials at the Critical State.
Wang, Ji-Peng
2017-08-31
This paper investigates the force transmission modes, mainly described by probability density distributions, in non-cohesive dry and cohesive wet granular materials by discrete element modeling. The critical state force transmission patterns are focused on with the contact model effect being analyzed. By shearing relatively dense and loose dry specimens to the critical state in the conventional triaxial loading path, it is observed that there is a unique critical state force transmission mode. There is a universe critical state force distribution pattern for both the normal contact forces and tangential contact forces. Furthermore, it is found that using either the linear Hooke or the non-linear Hertz model does not affect the universe force transmission mode, and it is only related to the grain size distribution. Wet granular materials are also simulated by incorporating a water bridge model. Dense and loose wet granular materials are tested, and the critical state behavior for the wet material is also observed. The critical state strength and void ratio of wet granular materials are higher than those of a non-cohesive material. The critical state inter-particle distribution is altered from that of a non-cohesive material with higher probability in relatively weak forces. Grains in non-cohesive materials are under compressive stresses, and their principal directions are mainly in the axial loading direction. However, for cohesive wet granular materials, some particles are in tension, and the tensile stresses are in the horizontal direction on which the confinement is applied. The additional confinement by the tensile stress explains the macro strength and dilatancy increase in wet samples.
Force Transmission Modes of Non-Cohesive and Cohesive Materials at the Critical State
2017-01-01
This paper investigates the force transmission modes, mainly described by probability density distributions, in non-cohesive dry and cohesive wet granular materials by discrete element modeling. The critical state force transmission patterns are focused on with the contact model effect being analyzed. By shearing relatively dense and loose dry specimens to the critical state in the conventional triaxial loading path, it is observed that there is a unique critical state force transmission mode. There is a universe critical state force distribution pattern for both the normal contact forces and tangential contact forces. Furthermore, it is found that using either the linear Hooke or the non-linear Hertz model does not affect the universe force transmission mode, and it is only related to the grain size distribution. Wet granular materials are also simulated by incorporating a water bridge model. Dense and loose wet granular materials are tested, and the critical state behavior for the wet material is also observed. The critical state strength and void ratio of wet granular materials are higher than those of a non-cohesive material. The critical state inter-particle distribution is altered from that of a non-cohesive material with higher probability in relatively weak forces. Grains in non-cohesive materials are under compressive stresses, and their principal directions are mainly in the axial loading direction. However, for cohesive wet granular materials, some particles are in tension, and the tensile stresses are in the horizontal direction on which the confinement is applied. The additional confinement by the tensile stress explains the macro strength and dilatancy increase in wet samples. PMID:28858238
Short-sighted evolution of virulence in parasitic honeybee workers ( Apis mellifera capensis Esch.)
NASA Astrophysics Data System (ADS)
Moritz, Robin F. A.; Pirk, Christian W. W.; Hepburn, H. Randall; Neumann, Peter
2008-06-01
The short-sighted selection hypothesis for parasite virulence predicts that winners of within-host competition are poorer at transmission to new hosts. Social parasitism by self-replicating, female-producing workers occurs in the Cape honeybee Apis mellifera capensis, and colonies of other honeybee subspecies are susceptible hosts. We found high within-host virulence but low transmission rates in a clone of social parasitic A. m. capensis workers invading the neighbouring subspecies A. m. scutellata. In contrast, parasitic workers from the endemic range of A. m. capensis showed low within-host virulence but high transmission rates. This suggests a short-sighted selection scenario for the host-parasite co-evolution in the invasive range of the Cape honeybee, probably facilitated by beekeeping-assisted parasite transmission in apiaries.
Adaptive decoding of convolutional codes
NASA Astrophysics Data System (ADS)
Hueske, K.; Geldmacher, J.; Götze, J.
2007-06-01
Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.
Outage probability of a relay strategy allowing intra-link errors utilizing Slepian-Wolf theorem
NASA Astrophysics Data System (ADS)
Cheng, Meng; Anwar, Khoirul; Matsumoto, Tad
2013-12-01
In conventional decode-and-forward (DF) one-way relay systems, a data block received at the relay node is discarded, if the information part is found to have errors after decoding. Such errors are referred to as intra-link errors in this article. However, in a setup where the relay forwards data blocks despite possible intra-link errors, the two data blocks, one from the source node and the other from the relay node, are highly correlated because they were transmitted from the same source. In this article, we focus on the outage probability analysis of such a relay transmission system, where source-destination and relay-destination links, Link 1 and Link 2, respectively, are assumed to suffer from the correlated fading variation due to block Rayleigh fading. The intra-link is assumed to be represented by a simple bit-flipping model, where some of the information bits recovered at the relay node are the flipped version of their corresponding original information bits at the source. The correlated bit streams are encoded separately by the source and relay nodes, and transmitted block-by-block to a common destination using different time slots, where the information sequence transmitted over Link 2 may be a noise-corrupted interleaved version of the original sequence. The joint decoding takes place at the destination by exploiting the correlation knowledge of the intra-link (source-relay link). It is shown that the outage probability of the proposed transmission technique can be expressed by a set of double integrals over the admissible rate range, given by the Slepian-Wolf theorem, with respect to the probability density function ( pdf) of the instantaneous signal-to-noise power ratios (SNR) of Link 1 and Link 2. It is found that, with the Slepian-Wolf relay technique, so far as the correlation ρ of the complex fading variation is | ρ|<1, the 2nd order diversity can be achieved only if the two bit streams are fully correlated. This indicates that the diversity order exhibited in the outage curve converges to 1 when the bit streams are not fully correlated. Moreover, the Slepian-Wolf outage probability is proved to be smaller than that of the 2nd order maximum ratio combining (MRC) diversity, if the average SNRs of the two independent links are the same. Exact as well as asymptotic expressions of the outage probability are theoretically derived in the article. In addition, the theoretical outage results are compared with the frame-error-rate (FER) curves, obtained by a series of simulations for the Slepian-Wolf relay system based on bit-interleaved coded modulation with iterative detection (BICM-ID). It is shown that the FER curves exhibit the same tendency as the theoretical results.
Automated manual transmission clutch controller
Lawrie, Robert E.; Reed, Jr., Richard G.; Rausen, David J.
1999-11-30
A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.
Automated manual transmission shift sequence controller
Lawrie, Robert E.; Reed, Richard G.; Rausen, David J.
2000-02-01
A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both, an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.
Automated manual transmission mode selection controller
Lawrie, Robert E.
1999-11-09
A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.
Automated manual transmission controller
Lawrie, Robert E.; Reed, Jr., Richard G.; Bernier, David R.
1999-12-28
A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.
Synaptic UNC13A protein variant causes increased neurotransmission and dyskinetic movement disorder.
Lipstein, Noa; Verhoeven-Duif, Nanda M; Michelassi, Francesco E; Calloway, Nathaniel; van Hasselt, Peter M; Pienkowska, Katarzyna; van Haaften, Gijs; van Haelst, Mieke M; van Empelen, Ron; Cuppen, Inge; van Teeseling, Heleen C; Evelein, Annemieke M V; Vorstman, Jacob A; Thoms, Sven; Jahn, Olaf; Duran, Karen J; Monroe, Glen R; Ryan, Timothy A; Taschenberger, Holger; Dittman, Jeremy S; Rhee, Jeong-Seop; Visser, Gepke; Jans, Judith J; Brose, Nils
2017-03-01
Munc13 proteins are essential regulators of neurotransmitter release at nerve cell synapses. They mediate the priming step that renders synaptic vesicles fusion-competent, and their genetic elimination causes a complete block of synaptic transmission. Here we have described a patient displaying a disorder characterized by a dyskinetic movement disorder, developmental delay, and autism. Using whole-exome sequencing, we have shown that this condition is associated with a rare, de novo Pro814Leu variant in the major human Munc13 paralog UNC13A (also known as Munc13-1). Electrophysiological studies in murine neuronal cultures and functional analyses in Caenorhabditis elegans revealed that the UNC13A variant causes a distinct dominant gain of function that is characterized by increased fusion propensity of synaptic vesicles, which leads to increased initial synaptic vesicle release probability and abnormal short-term synaptic plasticity. Our study underscores the critical importance of fine-tuned presynaptic control in normal brain function. Further, it adds the neuronal Munc13 proteins and the synaptic vesicle priming process that they control to the known etiological mechanisms of psychiatric and neurological synaptopathies.
Synaptic UNC13A protein variant causes increased neurotransmission and dyskinetic movement disorder
Lipstein, Noa; Verhoeven-Duif, Nanda M.; Calloway, Nathaniel; van Hasselt, Peter M.; Pienkowska, Katarzyna; van Haelst, Mieke M.; van Empelen, Ron; Cuppen, Inge; van Teeseling, Heleen C.; Evelein, Annemieke M.V.; Vorstman, Jacob A.; Jahn, Olaf; Duran, Karen J.; Monroe, Glen R.; Ryan, Timothy A.; Taschenberger, Holger; Rhee, Jeong-Seop; Visser, Gepke; Jans, Judith J.
2017-01-01
Munc13 proteins are essential regulators of neurotransmitter release at nerve cell synapses. They mediate the priming step that renders synaptic vesicles fusion-competent, and their genetic elimination causes a complete block of synaptic transmission. Here we have described a patient displaying a disorder characterized by a dyskinetic movement disorder, developmental delay, and autism. Using whole-exome sequencing, we have shown that this condition is associated with a rare, de novo Pro814Leu variant in the major human Munc13 paralog UNC13A (also known as Munc13-1). Electrophysiological studies in murine neuronal cultures and functional analyses in Caenorhabditis elegans revealed that the UNC13A variant causes a distinct dominant gain of function that is characterized by increased fusion propensity of synaptic vesicles, which leads to increased initial synaptic vesicle release probability and abnormal short-term synaptic plasticity. Our study underscores the critical importance of fine-tuned presynaptic control in normal brain function. Further, it adds the neuronal Munc13 proteins and the synaptic vesicle priming process that they control to the known etiological mechanisms of psychiatric and neurological synaptopathies. PMID:28192369
Behavioral connectivity among bighorn sheep suggests potential for disease spread
Borg, Nathan J.; Mitchell, Michael S.; Lukacs, Paul M.; Mack, Curt M.; Waits, Lisette P.; Krausman, Paul R.
2017-01-01
Connectivity is important for population persistence and can reduce the potential for inbreeding depression. Connectivity between populations can also facilitate disease transmission; respiratory diseases are one of the most important factors affecting populations of bighorn sheep (Ovis canadensis). The mechanisms of connectivity in populations of bighorn sheep likely have implications for spread of disease, but the behaviors leading to connectivity between bighorn sheep groups are not well understood. From 2007–2012, we radio-collared and monitored 56 bighorn sheep in the Salmon River canyon in central Idaho. We used cluster analysis to define social groups of bighorn sheep and then estimated connectivity between these groups using a multi-state mark-recapture model. Social groups of bighorn sheep were spatially segregated and linearly distributed along the Salmon River canyon. Monthly probabilities of movement between adjacent male and female groups ranged from 0.08 (±0.004 SE) to 0.76 (±0.068) for males and 0.05 (±0.132) to 0.24 (±0.034) for females. Movements of males were extensive and probabilities of movement were considerably higher during the rut. Probabilities of movement for females were typically smaller than those of males and did not change seasonally. Whereas adjacent groups of bighorn sheep along the Salmon River canyon were well connected, connectivity between groups north and south of the Salmon River was limited. The novel application of a multi-state model to a population of bighorn sheep allowed us to estimate the probability of movement between adjacent social groups and approximate the level of connectivity across the population. Our results suggest high movement rates of males during the rut are the most likely to result in transmission of pathogens among both male and female groups. Potential for disease spread among female groups was smaller but non-trivial. Land managers can plan grazing of domestic sheep for spring and summer months when males are relatively inactive. Removal or quarantine of social groups may reduce probability of disease transmission in populations of bighorn sheep consisting of linearly distributed social groups.
Jacob, C; Viet, A F
2003-03-01
This paper covers the elaboration of a general class of multitype branching processes for modeling in a branching population, the evolution of a disease with horizontal and vertical transmissions. When the size of the population may tend to infinity, normalization must be carried out. As the initial size tends to infinity, the normalized model converges a.s. to a dynamical system the solution of which is the probability law of the state of health for an individual ancestors line. The focal point of this study concerns the transient and asymptotical behaviors of a SIS model with two age classes in a branching population. We will compare the asymptotical probability of extinction on the scale of a finite population and on the scale of an individual in an infinite population: when the rates of transmission are small compared to the rate of renewing the population of susceptibles, the two models lead to a.s. extinction, giving consistent results, which no longer applies to the opposite situation of important transmissions. In that case the size of the population plays a crucial role in the spreading of the disease.
Modulation/demodulation techniques for satellite communications. Part 1: Background
NASA Technical Reports Server (NTRS)
Omura, J. K.; Simon, M. K.
1981-01-01
Basic characteristics of digital data transmission systems described include the physical communication links, the notion of bandwidth, FCC regulations, and performance measurements such as bit rates, bit error probabilities, throughputs, and delays. The error probability performance and spectral characteristics of various modulation/demodulation techniques commonly used or proposed for use in radio and satellite communication links are summarized. Forward error correction with block or convolutional codes is also discussed along with the important coding parameter, channel cutoff rate.
Estimating the Probability of Electrical Short Circuits from Tin Whiskers. Part 2
NASA Technical Reports Server (NTRS)
Courey, Karim J.; Asfour, Shihab S.; Onar, Arzu; Bayliss, Jon A.; Ludwig, Larry L.; Wright, Maria C.
2010-01-01
To comply with lead-free legislation, many manufacturers have converted from tin-lead to pure tin finishes of electronic components. However, pure tin finishes have a greater propensity to grow tin whiskers than tin-lead finishes. Since tin whiskers present an electrical short circuit hazard in electronic components, simulations have been developed to quantify the risk of said short circuits occurring. Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that had an unknown probability associated with it. Note however that due to contact resistance electrical shorts may not occur at lower voltage levels. In our first article we developed an empirical probability model for tin whisker shorting. In this paper, we develop a more comprehensive empirical model using a refined experiment with a larger sample size, in which we studied the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From the resulting data we estimated the probability distribution of an electrical short, as a function of voltage. In addition, the unexpected polycrystalline structure seen in the focused ion beam (FIB) cross section in the first experiment was confirmed in this experiment using transmission electron microscopy (TEM). The FIB was also used to cross section two card guides to facilitate the measurement of the grain size of each card guide's tin plating to determine its finish .
NASA Technical Reports Server (NTRS)
Courey, Karim J.; Asfour, Shihab S.; Onar, Arzu; Bayliss, Jon A.; Ludwig, Larry L.; Wright, Maria C.
2009-01-01
To comply with lead-free legislation, many manufacturers have converted from tin-lead to pure tin finishes of electronic components. However, pure tin finishes have a greater propensity to grow tin whiskers than tin-lead finishes. Since tin whiskers present an electrical short circuit hazard in electronic components, simulations have been developed to quantify the risk of said short circuits occurring. Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that had an unknown probability associated with it. Note however that due to contact resistance electrical shorts may not occur at lower voltage levels. In our first article we developed an empirical probability model for tin whisker shorting. In this paper, we develop a more comprehensive empirical model using a refined experiment with a larger sample size, in which we studied the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From the resulting data we estimated the probability distribution of an electrical short, as a function of voltage. In addition, the unexpected polycrystalline structure seen in the focused ion beam (FIB) cross section in the first experiment was confirmed in this experiment using transmission electron microscopy (TEM). The FIB was also used to cross section two card guides to facilitate the measurement of the grain size of each card guide's tin plating to determine its finish.
Impact of the infectious period on epidemics
NASA Astrophysics Data System (ADS)
Wilkinson, Robert R.; Sharkey, Kieran J.
2018-05-01
The duration of the infectious period is a crucial determinant of the ability of an infectious disease to spread. We consider an epidemic model that is network based and non-Markovian, containing classic Kermack-McKendrick, pairwise, message passing, and spatial models as special cases. For this model, we prove a monotonic relationship between the variability of the infectious period (with fixed mean) and the probability that the infection will reach any given subset of the population by any given time. For certain families of distributions, this result implies that epidemic severity is decreasing with respect to the variance of the infectious period. The striking importance of this relationship is demonstrated numerically. We then prove, with a fixed basic reproductive ratio (R0), a monotonic relationship between the variability of the posterior transmission probability (which is a function of the infectious period) and the probability that the infection will reach any given subset of the population by any given time. Thus again, even when R0 is fixed, variability of the infectious period tends to dampen the epidemic. Numerical results illustrate this but indicate the relationship is weaker. We then show how our results apply to message passing, pairwise, and Kermack-McKendrick epidemic models, even when they are not exactly consistent with the stochastic dynamics. For Poissonian contact processes, and arbitrarily distributed infectious periods, we demonstrate how systems of delay differential equations and ordinary differential equations can provide upper and lower bounds, respectively, for the probability that any given individual has been infected by any given time.
Dolan, Marc C; Breuner, Nicole E; Hojgaard, Andrias; Boegler, Karen A; Hoxmeier, J Charles; Replogle, Adam J; Eisen, Lars
2017-09-01
The recently recognized Lyme disease spirochete, Borrelia mayonii, has been detected in host-seeking Ixodes scapularis Say ticks and is associated with human disease in the Upper Midwest. Although experimentally shown to be vector competent, studies have been lacking to determine the duration of time from attachment of a single B. mayonii-infected I. scapularis nymph to transmission of spirochetes to a host. If B. mayonii spirochetes were found to be transmitted within the first 24 h after tick attachment, in contrast to Borrelia burgdorferi spirochetes (>24 h), then current recommendations for tick checks and prompt tick removal as a way to prevent transmission of Lyme disease spirochetes would need to be amended. We therefore conducted a study to determine the probability of transmission of B. mayonii spirochetes from single infected nymphal I. scapularis ticks to susceptible experimental mouse hosts at three time points postattachment (24, 48, and 72 h) and for a complete feed (>72-96 h). No evidence of infection with or exposure to B. mayonii occurred in mice that were fed upon by a single infected nymph for 24 or 48 h. The probability of transmission by a single infected nymphal tick was 31% after 72 h of attachment and 57% for a complete feed. In addition, due to unintended simultaneous feeding upon some mice by two B. mayonii-infected nymphs, we recorded a single occasion in which feeding for 48 h by two infected nymphs resulted in transmission and viable infection in the mouse. We conclude that the duration of attachment of a single infected nymphal I. scapularis tick required for transmission of B. mayonii appears to be similar to that for B. burgdorferi: transmission is minimal for the first 24 h of attachment, rare up to 48 h, but then increases distinctly by 72 h postattachment. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by US Government employees and is in the public domain in the US.
Carne, Charlotte; Semple, Stuart; Morrogh-Bernard, Helen; Zuberbühler, Klaus; Lehmann, Julia
2014-01-01
All great ape species are endangered, and infectious diseases are thought to pose a particular threat to their survival. As great ape species vary substantially in social organisation and gregariousness, there are likely to be differences in susceptibility to disease types and spread. Understanding the relation between social variables and disease is therefore crucial for implementing effective conservation measures. Here, we simulate the transmission of a range of diseases in a population of orang-utans in Sabangau Forest (Central Kalimantan) and a community of chimpanzees in Budongo Forest (Uganda), by systematically varying transmission likelihood and probability of subsequent recovery. Both species have fission-fusion social systems, but differ considerably in their level of gregariousness. We used long-term behavioural data to create networks of association patterns on which the spread of different diseases was simulated. We found that chimpanzees were generally far more susceptible to the spread of diseases than orang-utans. When simulating different diseases that varied widely in their probability of transmission and recovery, it was found that the chimpanzee community was widely and strongly affected, while in orang-utans even highly infectious diseases had limited spread. Furthermore, when comparing the observed association network with a mean-field network (equal contact probability between group members), we found no major difference in simulated disease spread, suggesting that patterns of social bonding in orang-utans are not an important determinant of susceptibility to disease. In chimpanzees, the predicted size of the epidemic was smaller on the actual association network than on the mean-field network, indicating that patterns of social bonding have important effects on susceptibility to disease. We conclude that social networks are a potentially powerful tool to model the risk of disease transmission in great apes, and that chimpanzees are particularly threatened by infectious disease outbreaks as a result of their social structure.
Carne, Charlotte; Semple, Stuart; Morrogh-Bernard, Helen; Zuberbühler, Klaus; Lehmann, Julia
2014-01-01
All great ape species are endangered, and infectious diseases are thought to pose a particular threat to their survival. As great ape species vary substantially in social organisation and gregariousness, there are likely to be differences in susceptibility to disease types and spread. Understanding the relation between social variables and disease is therefore crucial for implementing effective conservation measures. Here, we simulate the transmission of a range of diseases in a population of orang-utans in Sabangau Forest (Central Kalimantan) and a community of chimpanzees in Budongo Forest (Uganda), by systematically varying transmission likelihood and probability of subsequent recovery. Both species have fission-fusion social systems, but differ considerably in their level of gregariousness. We used long-term behavioural data to create networks of association patterns on which the spread of different diseases was simulated. We found that chimpanzees were generally far more susceptible to the spread of diseases than orang-utans. When simulating different diseases that varied widely in their probability of transmission and recovery, it was found that the chimpanzee community was widely and strongly affected, while in orang-utans even highly infectious diseases had limited spread. Furthermore, when comparing the observed association network with a mean-field network (equal contact probability between group members), we found no major difference in simulated disease spread, suggesting that patterns of social bonding in orang-utans are not an important determinant of susceptibility to disease. In chimpanzees, the predicted size of the epidemic was smaller on the actual association network than on the mean-field network, indicating that patterns of social bonding have important effects on susceptibility to disease. We conclude that social networks are a potentially powerful tool to model the risk of disease transmission in great apes, and that chimpanzees are particularly threatened by infectious disease outbreaks as a result of their social structure. PMID:24740263
No Trend in the Intergenerational Transmission of Divorce
LI, JUI-CHUNG ALLEN; WU, LAWRENCE L.
2008-01-01
Previous studies on trends in the intergenerational transmission of divorce have produced mixed findings, with two studies (McLanahan and Bumpass 1988; Teachman 2002) reporting no trend in divorce transmission and one study (Wolfinger 1999) finding that divorce transmission has weakened substantially. Using a stratified Cox proportional hazard model, we analyze data from the National Survey of Families and Households and find no evidence for any trend in divorce transmission. To reconcile apparent differences in results, we note that the General Social Survey data used by Wolfinger lack information on marital duration, permitting analysis only for whether respondents have divorced by interview. As a result, an apparent decline in divorce transmission could be due to inadequate adjustments for the longer exposures to risk by earlier marriage cohorts, yielding a higher probability of divorce by interview for earlier cohorts relative to more recent cohorts even if divorce risks are identical across all marriage cohorts. We confirm this possibility by using a series of discrete-time hazard logistic regressions to investigate the sensitivity of estimates of trends in divorce transmission to different adjustments for exposure to risk. We conclude that there has been no trend in the intergenerational transmission of divorce. PMID:19110902
Counterfactuality of ‘counterfactual’ communication
NASA Astrophysics Data System (ADS)
Vaidman, L.
2015-11-01
The counterfactuality of the recently proposed protocols for direct quantum communication is analyzed. It is argued that the protocols can be counterfactual only for one value of the transmitted bit. The protocols achieve a reduced probability of detection of the particle in the transmission channel by increasing the number of paths in the channel. However, this probability is not lower than the probability of detecting a particle actually passing through such a multi-path channel, which was found to be surprisingly small. The relation between security and counterfactuality of the protocols is discussed. An analysis of counterfactuality of the protocols in the framework of the Bohmian interpretation is performed.
Williams, David M; Dechen Quinn, Amy C; Porter, William F
2014-01-01
Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05-0.14), to low levels post-parturition through summer (0.00-0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m-7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response.
Nasir, Hina; Javaid, Nadeem; Sher, Muhammad; Qasim, Umar; Khan, Zahoor Ali; Alrajeh, Nabil; Niaz, Iftikhar Azim
2016-01-01
This paper embeds a bi-fold contribution for Underwater Wireless Sensor Networks (UWSNs); performance analysis of incremental relaying in terms of outage and error probability, and based on the analysis proposition of two new cooperative routing protocols. Subject to the first contribution, a three step procedure is carried out; a system model is presented, the number of available relays are determined, and based on cooperative incremental retransmission methodology, closed-form expressions for outage and error probability are derived. Subject to the second contribution, Adaptive Cooperation in Energy (ACE) efficient depth based routing and Enhanced-ACE (E-ACE) are presented. In the proposed model, feedback mechanism indicates success or failure of data transmission. If direct transmission is successful, there is no need for relaying by cooperative relay nodes. In case of failure, all the available relays retransmit the data one by one till the desired signal quality is achieved at destination. Simulation results show that the ACE and E-ACE significantly improves network performance, i.e., throughput, when compared with other incremental relaying protocols like Cooperative Automatic Repeat reQuest (CARQ). E-ACE and ACE achieve 69% and 63% more throughput respectively as compared to CARQ in hard underwater environment. PMID:27420061
Finding the probability of infection in an SIR network is NP-Hard
Shapiro, Michael; Delgado-Eckert, Edgar
2012-01-01
It is the purpose of this article to review results that have long been known to communications network engineers and have direct application to epidemiology on networks. A common approach in epidemiology is to study the transmission of a disease in a population where each individual is initially susceptible (S), may become infective (I) and then removed or recovered (R) and plays no further epidemiological role. Much of the recent work gives explicit consideration to the network of social interactions or disease-transmitting contacts and attendant probability of transmission for each interacting pair. The state of such a network is an assignment of the values {S, I, R} to its members. Given such a network, an initial state and a particular susceptible individual, we would like to compute their probability of becoming infected in the course of an epidemic. It turns out that this and related problems are NP-hard. In particular, it belongs in a class of problems for which no efficient algorithms for their solution are known. Moreover, finding an efficient algorithm for the solution of any problem in this class would entail a major breakthrough in theoretical computer science. PMID:22824138
Causality in time-neutral cosmologies
NASA Astrophysics Data System (ADS)
Kent, Adrian
1999-02-01
Gell-Mann and Hartle (GMH) have recently considered time-neutral cosmological models in which the initial and final conditions are independently specified, and several authors have investigated experimental tests of such models. We point out here that GMH time-neutral models can allow superluminal signaling, in the sense that it can be possible for observers in those cosmologies, by detecting and exploiting regularities in the final state, to construct devices which send and receive signals between space-like separated points. In suitable cosmologies, any single superluminal message can be transmitted with probability arbitrarily close to one by the use of redundant signals. However, the outcome probabilities of quantum measurements generally depend on precisely which past and future measurements take place. As the transmission of any signal relies on quantum measurements, its transmission probability is similarly context dependent. As a result, the standard superluminal signaling paradoxes do not apply. Despite their unusual features, the models are internally consistent. These results illustrate an interesting conceptual point. The standard view of Minkowski causality is not an absolutely indispensable part of the mathematical formalism of relativistic quantum theory. It is contingent on the empirical observation that naturally occurring ensembles can be naturally pre-selected but not post-selected.
Potter, Gail E; Smieszek, Timo; Sailer, Kerstin
2015-09-01
Face-to-face social contacts are potentially important transmission routes for acute respiratory infections, and understanding the contact network can improve our ability to predict, contain, and control epidemics. Although workplaces are important settings for infectious disease transmission, few studies have collected workplace contact data and estimated workplace contact networks. We use contact diaries, architectural distance measures, and institutional structures to estimate social contact networks within a Swiss research institute. Some contact reports were inconsistent, indicating reporting errors. We adjust for this with a latent variable model, jointly estimating the true (unobserved) network of contacts and duration-specific reporting probabilities. We find that contact probability decreases with distance, and that research group membership, role, and shared projects are strongly predictive of contact patterns. Estimated reporting probabilities were low only for 0-5 min contacts. Adjusting for reporting error changed the estimate of the duration distribution, but did not change the estimates of covariate effects and had little effect on epidemic predictions. Our epidemic simulation study indicates that inclusion of network structure based on architectural and organizational structure data can improve the accuracy of epidemic forecasting models.
Potter, Gail E.; Smieszek, Timo; Sailer, Kerstin
2015-01-01
Face-to-face social contacts are potentially important transmission routes for acute respiratory infections, and understanding the contact network can improve our ability to predict, contain, and control epidemics. Although workplaces are important settings for infectious disease transmission, few studies have collected workplace contact data and estimated workplace contact networks. We use contact diaries, architectural distance measures, and institutional structures to estimate social contact networks within a Swiss research institute. Some contact reports were inconsistent, indicating reporting errors. We adjust for this with a latent variable model, jointly estimating the true (unobserved) network of contacts and duration-specific reporting probabilities. We find that contact probability decreases with distance, and that research group membership, role, and shared projects are strongly predictive of contact patterns. Estimated reporting probabilities were low only for 0–5 min contacts. Adjusting for reporting error changed the estimate of the duration distribution, but did not change the estimates of covariate effects and had little effect on epidemic predictions. Our epidemic simulation study indicates that inclusion of network structure based on architectural and organizational structure data can improve the accuracy of epidemic forecasting models. PMID:26634122
Fragility issues of medical video streaming over 802.11e-WLAN m-health environments.
Tan, Yow-Yiong Edwin; Philip, Nada; Istepanian, Robert H
2006-01-01
This paper presents some of the fragility issues of a medical video streaming over 802.11e-WLAN in m-health applications. In particular, we present a medical channel-adaptive fair allocation (MCAFA) scheme for enhanced QoS support for IEEE 802.11 (WLAN), as a modification for the standard 802.11e enhanced distributed coordination function (EDCF) is proposed for enhanced medical data performance. The medical channel-adaptive fair allocation (MCAFA) proposed extends the EDCF, by halving the contention window (CW) after zeta consecutive successful transmissions to reduce the collision probability when channel is busy. Simulation results show that MCAFA outperforms EDCF in-terms of overall performance relevant to the requirements of high throughput of medical data and video streaming traffic in 3G/WLAN wireless environments.
Demystifying the memory effect: A geometrical approach to understanding speckle correlations
NASA Astrophysics Data System (ADS)
Prunty, Aaron C.; Snieder, Roel K.
2017-05-01
The memory effect has seen a surge of research into its fundamental properties and applications since its discovery by Feng et al. [Phys. Rev. Lett. 61, 834 (1988)]. While the wave trajectories for which the memory effect holds are hidden implicitly in the diffusion probability function [Phys. Rev. B 40, 737 (1989)], the physical intuition of why these trajectories satisfy the memory effect has often been masked by the derivation of the memory correlation function itself. In this paper, we explicitly derive the specific trajectories through a random medium for which the memory effect holds. Our approach shows that the memory effect follows from a simple conservation argument, which imposes geometrical constraints on the random trajectories that contribute to the memory effect. We illustrate the time-domain effects of these geometrical constraints with numerical simulations of pulse transmission through a random medium. The results of our derivation and numerical simulations are consistent with established theory and experimentation.
NASA Astrophysics Data System (ADS)
Majumdar, Arun K.; Land, Phillip; Siegenthaler, John
2014-10-01
New results for characterizing laser intensity fluctuation statistics of a laser beam transmitted through a random air-water interface relevant to underwater communications are presented. A laboratory watertank experiment is described to investigate the beam wandering effects of the transmitted beam. Preliminary results from the experiment provide information about histograms of the probability density functions of intensity fluctuations for different wind speeds measured by a CMOS camera for the transmitted beam. Angular displacements of the centroids of the fluctuating laser beam generates the beam wander effects. This research develops a probabilistic model for optical propagation at the random air-water interface for a transmission case under different wind speed conditions. Preliminary results for bit-error-rate (BER) estimates as a function of fade margin for an on-off keying (OOK) optical communication through the air-water interface are presented for a communication system where a random air-water interface is a part of the communication channel.
Stern, Shani; Biron, David; Moses, Elisha
2016-07-11
Down syndrome incidence in humans increases dramatically with maternal age. This is mainly the result of increased meiotic errors, but factors such as differences in abortion rate may play a role as well. Since the meiotic error rate increases almost exponentially after a certain age, its contribution to the overall incidence aneuploidy may mask the contribution of other processes. To focus on such selection mechanisms we investigated transmission in trisomic females, using data from mouse models and from Down syndrome humans. In trisomic females the a-priori probability for trisomy is independent of meiotic errors and thus approximately constant in the early embryo. Despite this, the rate of transmission of the extra chromosome decreases with age in females of the Ts65Dn and, as we show, for the Tc1 mouse models for Down syndrome. Evaluating progeny of 73 Tc1 births and 112 Ts65Dn births from females aged 130 days to 250 days old showed that both models exhibit a 3-fold reduction of the probability to transmit the trisomy with increased maternal ageing. This is concurrent with a 2-fold reduction of litter size with maternal ageing. Furthermore, analysis of previously reported 30 births in Down syndrome women shows a similar tendency with an almost three fold reduction in the probability to have a Down syndrome child between a 20 and 30 years old Down syndrome woman. In the two types of mice models for Down syndrome that were used for this study, and in human Down syndrome, older females have significantly lower probability to transmit the trisomy to the offspring. Our findings, taken together with previous reports of decreased supportive environment of the older uterus, add support to the notion that an older uterus negatively selects the less fit trisomic embryos.
Rosenberg, Nora E; Pettifor, Audrey E; Bruyn, Guy DE; Westreich, Daniel; Delany-Moretlwe, Sinead; Behets, Frieda; Maman, Suzanne; Coetzee, David; Kamupira, Mercy; Miller, William C
2012-01-01
Introduction Effective behavioral HIV prevention is needed for stable HIV-discordant couples at risk for HIV, especially those without access to biomedical prevention. This analysis addressed whether HIV testing and counseling (HTC) with ongoing counseling and condom distribution lead to reduced unprotected sex in HIV-discordant couples. Methods Partners in Prevention HSV/HIV Transmission Study was a randomized trial conducted from 2004–2008 assessing whether acyclovir reduced HIV transmission from HSV-2/HIV-1 co-infected persons to HIV-uninfected sex partners. This analysis relied on self-reported behavioral data from 508 HIV-infected South African participants. The exposure was timing of first HTC: 0–7, 8–14, 15–30, or >30 days before baseline. In each exposure group, predicted probabilities of unprotected sex in the last month were calculated at baseline, month one, and month twelve using generalized estimating equations with a logit link and exchangeable correlation matrix. Results At baseline, participants who knew their HIV status for less time experienced higher predicted probabilities of unprotected sex in the last month: 0–7 days, 0.71; 8–14 days, 0.52; 15–30 days, 0.49; >30 days, 0.26. At month one, once all participants had been aware of being in HIV-discordant relationships for ≥ 1 month, predicted probabilities declined: 0–7 days, 0.08; 8–14 days, 0.08; 15–30 days, 0.15; >30 days, 0.14. Lower predicted probabilities were sustained through month twelve: 0–7 days, 0.08; 8–14 days, 0.11; 15–30 days, 0.05; >30 days, 0.19. Conclusions Unprotected sex declined after HIV-positive diagnosis, and declined further after awareness of HIV-discordance. Identifying HIV-discordant couples for behavioral prevention is important for reducing HIV transmission risk. PMID:23117500
Extra and Intracellular Synthesis of Nickel Oxide Nanoparticles Mediated by Dead Fungal Biomass
Salvadori, Marcia Regina; Ando, Rômulo Augusto; Oller Nascimento, Cláudio Augusto; Corrêa, Benedito
2015-01-01
The use of dead biomass of the fungus Hypocrea lixii as a biological system is a new, effective and environmentally friendly bioprocess for the production and uptake of nickel oxide nanoparticles (NPs), which has become a promising field in nanobiotechnology. Dead biomass of the fungus was successfully used to convert nickel ions into nickel oxide NPs in aqueous solution. These NPs accumulated intracellularly and extracellularly on the cell wall surface through biosorption. The average size, morphology and location of the NPs were characterized by transmission electron microscopy, high-resolution transmission electron microscopy, scanning electron microscopy, and energy dispersive X-ray spectroscopy. The NPs were mainly spherical and extra and intracellular NPs had an average size of 3.8 nm and 1.25 nm, respectively. X-ray photoelectron spectroscopy analysis confirmed the formation of nickel oxide NPs. Infrared spectroscopy detected the presence of functional amide groups, which are probable involved in particle binding to the biomass. The production of the NPs by dead biomass was analyzed by determining physicochemical parameters and equilibrium concentrations. The present study opens new perspectives for the biosynthesis of nanomaterials, which could become a potential biosorbent for the removal of toxic metals from polluted sites. PMID:26043111
Gómez-Galán, Marta; Femenía, Teresa; Åberg, Elin; Graae, Lisette; Van Eeckhaut, Ann; Smolders, Ilse; Brené, Stefan; Lindskog, Maria
2016-01-01
Stress, such as social isolation, is a well-known risk factor for depression, most probably in combination with predisposing genetic factors. Physical exercise on the other hand, is depicted as a wonder-treatment that makes you healthier, happier and live longer. However, the published results on the effects of exercise are ambiguous, especially when it comes to neuropsychiatric disorders. Here we combine a paradigm of social isolation with a genetic rat model of depression, the Flinders Sensitive Line (FSL), already known to have glutamatergic synaptic alterations. Compared to group-housed FSL rats, we found that social isolation further affects synaptic plasticity and increases basal synaptic transmission in hippocampal CA1 pyramidal neurons. These functional synaptic alterations co-exist with changes in hippocampal protein expression levels: social isolation in FSL rats reduce expression of the glial glutamate transporter GLT-1, and increase expression of the GluA2 AMPA-receptor subunit. We further show that physical exercise in form of voluntary running prevents the stress-induced synaptic effects but do not restore the endogenous mechanisms of depression already present in the FSL rat. PMID:27764188
Gómez-Galán, Marta; Femenía, Teresa; Åberg, Elin; Graae, Lisette; Van Eeckhaut, Ann; Smolders, Ilse; Brené, Stefan; Lindskog, Maria
2016-01-01
Stress, such as social isolation, is a well-known risk factor for depression, most probably in combination with predisposing genetic factors. Physical exercise on the other hand, is depicted as a wonder-treatment that makes you healthier, happier and live longer. However, the published results on the effects of exercise are ambiguous, especially when it comes to neuropsychiatric disorders. Here we combine a paradigm of social isolation with a genetic rat model of depression, the Flinders Sensitive Line (FSL), already known to have glutamatergic synaptic alterations. Compared to group-housed FSL rats, we found that social isolation further affects synaptic plasticity and increases basal synaptic transmission in hippocampal CA1 pyramidal neurons. These functional synaptic alterations co-exist with changes in hippocampal protein expression levels: social isolation in FSL rats reduce expression of the glial glutamate transporter GLT-1, and increase expression of the GluA2 AMPA-receptor subunit. We further show that physical exercise in form of voluntary running prevents the stress-induced synaptic effects but do not restore the endogenous mechanisms of depression already present in the FSL rat.
Design and characterization of a cough simulator.
Zhang, Bo; Zhu, Chao; Ji, Zhiming; Lin, Chao-Hsin
2017-02-23
Expiratory droplets from human coughing have always been considered as potential carriers of pathogens, responsible for respiratory infectious disease transmission. To study the transmission of disease by human coughing, a transient repeatable cough simulator has been designed and built. Cough droplets are generated by different mechanisms, such as the breaking of mucus, condensation and high-speed atomization from different depths of the respiratory tract. These mechanisms in coughing produce droplets of different sizes, represented by a bimodal distribution of 'fine' and 'coarse' droplets. A cough simulator is hence designed to generate transient sprays with such bimodal characteristics. It consists of a pressurized gas tank, a nebulizer and an ejector, connected in series, which are controlled by computerized solenoid valves. The bimodal droplet size distribution is characterized for the coarse droplets and fine droplets, by fibrous collection and laser diffraction, respectively. The measured size distributions of coarse and fine droplets are reasonably represented by the Rosin-Rammler and log-normal distributions in probability density function, which leads to a bimodal distribution. To assess the hydrodynamic consequences of coughing including droplet vaporization and polydispersion, a Lagrangian model of droplet trajectories is established, with its ambient flow field predetermined from a computational fluid dynamics simulation.
A game theory-based obstacle avoidance routing protocol for wireless sensor networks.
Guan, Xin; Wu, Huayang; Bi, Shujun
2011-01-01
The obstacle avoidance problem in geographic forwarding is an important issue for location-based routing in wireless sensor networks. The presence of an obstacle leads to several geographic routing problems such as excessive energy consumption and data congestion. Obstacles are hard to avoid in realistic environments. To bypass obstacles, most routing protocols tend to forward packets along the obstacle boundaries. This leads to a situation where the nodes at the boundaries exhaust their energy rapidly and the obstacle area is diffused. In this paper, we introduce a novel routing algorithm to solve the obstacle problem in wireless sensor networks based on a game-theory model. Our algorithm forms a concave region that cannot forward packets to achieve the aim of improving the transmission success rate and decreasing packet transmission delays. We consider the residual energy, out-degree and forwarding angle to determine the forwarding probability and payoff function of forwarding candidates. This achieves the aim of load balance and reduces network energy consumption. Simulation results show that based on the average delivery delay, energy consumption and packet delivery ratio performances our protocol is superior to other traditional schemes.
Deterministic and stochastic CTMC models from Zika disease transmission
NASA Astrophysics Data System (ADS)
Zevika, Mona; Soewono, Edy
2018-03-01
Zika infection is one of the most important mosquito-borne diseases in the world. Zika virus (ZIKV) is transmitted by many Aedes-type mosquitoes including Aedes aegypti. Pregnant women with the Zika virus are at risk of having a fetus or infant with a congenital defect and suffering from microcephaly. Here, we formulate a Zika disease transmission model using two approaches, a deterministic model and a continuous-time Markov chain stochastic model. The basic reproduction ratio is constructed from a deterministic model. Meanwhile, the CTMC stochastic model yields an estimate of the probability of extinction and outbreaks of Zika disease. Dynamical simulations and analysis of the disease transmission are shown for the deterministic and stochastic models.
A Bayesian method for inferring transmission chains in a partially observed epidemic.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marzouk, Youssef M.; Ray, Jaideep
2008-10-01
We present a Bayesian approach for estimating transmission chains and rates in the Abakaliki smallpox epidemic of 1967. The epidemic affected 30 individuals in a community of 74; only the dates of appearance of symptoms were recorded. Our model assumes stochastic transmission of the infections over a social network. Distinct binomial random graphs model intra- and inter-compound social connections, while disease transmission over each link is treated as a Poisson process. Link probabilities and rate parameters are objects of inference. Dates of infection and recovery comprise the remaining unknowns. Distributions for smallpox incubation and recovery periods are obtained from historicalmore » data. Using Markov chain Monte Carlo, we explore the joint posterior distribution of the scalar parameters and provide an expected connectivity pattern for the social graph and infection pathway.« less
Takemura, Kazuhisa; Murakami, Hajime
2016-01-01
A probability weighting function (w(p)) is considered to be a nonlinear function of probability (p) in behavioral decision theory. This study proposes a psychophysical model of probability weighting functions derived from a hyperbolic time discounting model and a geometric distribution. The aim of the study is to show probability weighting functions from the point of view of waiting time for a decision maker. Since the expected value of a geometrically distributed random variable X is 1/p, we formulized the probability weighting function of the expected value model for hyperbolic time discounting as w(p) = (1 - k log p)(-1). Moreover, the probability weighting function is derived from Loewenstein and Prelec's (1992) generalized hyperbolic time discounting model. The latter model is proved to be equivalent to the hyperbolic-logarithmic weighting function considered by Prelec (1998) and Luce (2001). In this study, we derive a model from the generalized hyperbolic time discounting model assuming Fechner's (1860) psychophysical law of time and a geometric distribution of trials. In addition, we develop median models of hyperbolic time discounting and generalized hyperbolic time discounting. To illustrate the fitness of each model, a psychological experiment was conducted to assess the probability weighting and value functions at the level of the individual participant. The participants were 50 university students. The results of individual analysis indicated that the expected value model of generalized hyperbolic discounting fitted better than previous probability weighting decision-making models. The theoretical implications of this finding are discussed.
Computational implications of activity-dependent neuronal processes
NASA Astrophysics Data System (ADS)
Goldman, Mark Steven
Synapses, the connections between neurons, often fail to transmit a large percentage of the action potentials that they receive. I describe several models of synaptic transmission at a single stochastic synapse with an activity-dependent probability of transmission and demonstrate how synaptic transmission failures may increase the efficiency with which a synapse transmits information. Spike trains in the visual cortex of freely viewing monkeys have positive auto correlations that are indicative of a redundant representation of the information they contain. I show how a synapse with activity-dependent transmission failures modeled after those occurring in visual cortical synapses can remove this redundancy by transmitting a decorrelated subset of the spike trains it receives. I suggest that redundancy reduction at individual synapses saves synaptic resources while increasing the sensitivity of the postsynaptic neuron to information arriving along many inputs. For a neuron receiving input from many decorrelating synapses, my analysis leads to a prediction of the number of visual inputs to a neuron and the cross-correlations between these inputs and suggests that the time scale of synaptic dynamics observed in sensory areas corresponds to a fundamental time scale for processing sensory information. Systems with activity-dependent changes in their parameters, or plasticity, often display a wide variability in their individual components that belies the stability of their function, Motivated by experiments demonstrating that identified neurons with stereotyped function can have a large variability in the densities of their ion channels, or ionic conductances, I build a conductance-based model of a single neuron. The neuron's firing activity is relatively insensitive to changes in certain combinations of conductances, but markedly sensitive to changes in other combinations. Using a combined modeling and experimental approach, I show that neuromodulators and regulatory processes target sensitive combinations of conductances. I suggest that the variability observed in conductance measurements occurs along insensitive combinations of conductances and could result from homeostatic processes that allow the neuron's conductances to drift without triggering activity- dependent feedback mechanisms. These results together suggest that plastic systems may have a high degree of flexibility and variability in their components without a loss of robustness in their response properties.
Teleportation of Three-Qubit State via Six-qubit Cluster State
NASA Astrophysics Data System (ADS)
Yu, Li-zhi; Sun, Shao-xin
2015-05-01
A scheme of probabilistic teleportation was proposed. In this scheme, we took a six-qubit nonmaximally cluster state as the quantum channel to teleport an unknown three-qubit entangled state. Based on Bob's three times Bell state measurement (BSM) results, the receiver Bob can by introducing an auxiliary particle and the appropriate transformation to reconstruct the initial state with a certain probability. We found that, the successful transmission probability depend on the absolute value of coefficients of two of six particle cluster state minimum.
Multiple-path model of spectral reflectance of a dyed fabric.
Rogers, Geoffrey; Dalloz, Nicolas; Fournel, Thierry; Hebert, Mathieu
2017-05-01
Experimental results are presented of the spectral reflectance of a dyed fabric as analyzed by a multiple-path model of reflection. The multiple-path model provides simple analytic expressions for reflection and transmission of turbid media by applying the Beer-Lambert law to each path through the medium and summing over all paths, each path weighted by its probability. The path-length probability is determined by a random-walk analysis. The experimental results presented here show excellent agreement with predictions made by the model.
Reciprocal inhibition between motor neurons of the tibialis anterior and triceps surae in humans.
Yavuz, Utku Ş; Negro, Francesco; Diedrichs, Robin; Farina, Dario
2018-05-01
Motor neurons innervating antagonist muscles receive reciprocal inhibitory afferent inputs to facilitate the joint movement in the two directions. The present study investigates the mutual transmission of reciprocal inhibitory afferent inputs between the tibialis anterior (TA) and triceps surae (soleus and medial gastrocnemius) motor units. We assessed this mutual mechanism in large populations of motor units for building a statistical distribution of the inhibition amplitudes during standardized input to the motor neuron pools to minimize the effect of modulatory pathways. Single motor unit activities were identified using high-density surface electromyography (HDsEMG) recorded from the TA, soleus (Sol), and medial gastrocnemius (GM) muscles during isometric dorsi- and plantarflexion. Reciprocal inhibition on the antagonist muscle was elicited by electrical stimulation of the tibial (TN) or common peroneal nerves (CPN). The probability density distributions of reflex strength for each muscle were estimated to examine the strength of mutual transmission of reciprocal inhibitory input. The results showed that the strength of reciprocal inhibition in the TA motor units was fourfold greater than for the GM and the Sol motor units. This suggests an asymmetric transmission of reciprocal inhibition between ankle extensor and flexor muscles. This asymmetry cannot be explained by differences in motor unit type composition between the investigated muscles since we sampled low-threshold motor units in all cases. Therefore, the differences observed for the strength of inhibition are presumably due to a differential reciprocal spindle afferent input and the relative contribution of nonreciprocal inhibitory pathways. NEW & NOTEWORTHY We investigated the mutual transmission of reciprocal inhibition in large samples of motor units using a standardized input (electrical stimulation) to the motor neurons. The results demonstrated that the disynaptic reciprocal inhibition exerted between ankle flexor and extensor muscles is asymmetric. The functional implication of asymmetric transmission may be associated with the neural strategies of postural control.
Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission
Naranjo, David; Wen, Hua; Brehm, Paul
2015-01-01
The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925
NASA Astrophysics Data System (ADS)
Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.
2017-11-01
Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.
Outage Probability Minimization for Energy Harvesting Cognitive Radio Sensor Networks
Zhang, Fan; Jing, Tao; Huo, Yan; Jiang, Kaiwei
2017-01-01
The incorporation of cognitive radio (CR) capability in wireless sensor networks yields a promising network paradigm known as CR sensor networks (CRSNs), which is able to provide spectrum efficient data communication. However, due to the high energy consumption results from spectrum sensing, as well as subsequent data transmission, the energy supply for the conventional sensor nodes powered by batteries is regarded as a severe bottleneck for sustainable operation. The energy harvesting technique, which gathers energy from the ambient environment, is regarded as a promising solution to perpetually power-up energy-limited devices with a continual source of energy. Therefore, applying the energy harvesting (EH) technique in CRSNs is able to facilitate the self-sustainability of the energy-limited sensors. The primary concern of this study is to design sensing-transmission policies to minimize the long-term outage probability of EH-powered CR sensor nodes. We formulate this problem as an infinite-horizon discounted Markov decision process and propose an ϵ-optimal sensing-transmission (ST) policy through using the value iteration algorithm. ϵ is the error bound between the ST policy and the optimal policy, which can be pre-defined according to the actual need. Moreover, for a special case that the signal-to-noise (SNR) power ratio is sufficiently high, we present an efficient transmission (ET) policy and prove that the ET policy achieves the same performance with the ST policy. Finally, extensive simulations are conducted to evaluate the performance of the proposed policies and the impaction of various network parameters. PMID:28125023
Outage Probability Minimization for Energy Harvesting Cognitive Radio Sensor Networks.
Zhang, Fan; Jing, Tao; Huo, Yan; Jiang, Kaiwei
2017-01-24
The incorporation of cognitive radio (CR) capability in wireless sensor networks yields a promising network paradigm known as CR sensor networks (CRSNs), which is able to provide spectrum efficient data communication. However, due to the high energy consumption results from spectrum sensing, as well as subsequent data transmission, the energy supply for the conventional sensor nodes powered by batteries is regarded as a severe bottleneck for sustainable operation. The energy harvesting technique, which gathers energy from the ambient environment, is regarded as a promising solution to perpetually power-up energy-limited devices with a continual source of energy. Therefore, applying the energy harvesting (EH) technique in CRSNs is able to facilitate the self-sustainability of the energy-limited sensors. The primary concern of this study is to design sensing-transmission policies to minimize the long-term outage probability of EH-powered CR sensor nodes. We formulate this problem as an infinite-horizon discounted Markov decision process and propose an ϵ -optimal sensing-transmission (ST) policy through using the value iteration algorithm. ϵ is the error bound between the ST policy and the optimal policy, which can be pre-defined according to the actual need. Moreover, for a special case that the signal-to-noise (SNR) power ratio is sufficiently high, we present an efficient transmission (ET) policy and prove that the ET policy achieves the same performance with the ST policy. Finally, extensive simulations are conducted to evaluate the performance of the proposed policies and the impaction of various network parameters.
Nonlinear detection for a high rate extended binary phase shift keying system.
Chen, Xian-Qing; Wu, Le-Nan
2013-03-28
The algorithm and the results of a nonlinear detector using a machine learning technique called support vector machine (SVM) on an efficient modulation system with high data rate and low energy consumption is presented in this paper. Simulation results showed that the performance achieved by the SVM detector is comparable to that of a conventional threshold decision (TD) detector. The two detectors detect the received signals together with the special impacting filter (SIF) that can improve the energy utilization efficiency. However, unlike the TD detector, the SVM detector concentrates not only on reducing the BER of the detector, but also on providing accurate posterior probability estimates (PPEs), which can be used as soft-inputs of the LDPC decoder. The complexity of this detector is considered in this paper by using four features and simplifying the decision function. In addition, a bandwidth efficient transmission is analyzed with both SVM and TD detector. The SVM detector is more robust to sampling rate than TD detector. We find that the SVM is suitable for extended binary phase shift keying (EBPSK) signal detection and can provide accurate posterior probability for LDPC decoding.
Nonlinear Detection for a High Rate Extended Binary Phase Shift Keying System
Chen, Xian-Qing; Wu, Le-Nan
2013-01-01
The algorithm and the results of a nonlinear detector using a machine learning technique called support vector machine (SVM) on an efficient modulation system with high data rate and low energy consumption is presented in this paper. Simulation results showed that the performance achieved by the SVM detector is comparable to that of a conventional threshold decision (TD) detector. The two detectors detect the received signals together with the special impacting filter (SIF) that can improve the energy utilization efficiency. However, unlike the TD detector, the SVM detector concentrates not only on reducing the BER of the detector, but also on providing accurate posterior probability estimates (PPEs), which can be used as soft-inputs of the LDPC decoder. The complexity of this detector is considered in this paper by using four features and simplifying the decision function. In addition, a bandwidth efficient transmission is analyzed with both SVM and TD detector. The SVM detector is more robust to sampling rate than TD detector. We find that the SVM is suitable for extended binary phase shift keying (EBPSK) signal detection and can provide accurate posterior probability for LDPC decoding. PMID:23539034
An Investigation of the Electrical Short Circuit Characteristics of Tin Whiskers
NASA Technical Reports Server (NTRS)
Courey, Karim J.
2008-01-01
Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that has a currently unknown probability associated with it. Due to contact resistance electrical shorts may not occur at lower voltage levels. In this experiment, we study the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From this data we can estimate the probability of an electrical short, as a function of voltage, given that a free tin whisker has bridged two adjacent exposed electrical conductors. Also, three tin whiskers grown from the same Space Shuttle Orbiter card guide used in the aforementioned experiment were cross-sectioned and studied using a focused ion beam (FIB). The rare polycrystalline structure seen in the FIB cross section was confirmed using transmission electron microscopy (TEM). The FIB was also used to cross section two card guides to facilitate the measurement of the grain size to determine that the tin plating on the card guides had a bright finish.
Johansson, Michael A.; Arana-Vizcarrondo, Neysarí; Biggerstaff, Brad J.; Gallagher, Nancy; Marano, Nina; Staples, J. Erin
2012-01-01
Yellow fever virus (YFV), a mosquito-borne virus endemic to tropical Africa and South America, is capable of causing large urban outbreaks of human disease. With the ease of international travel, urban outbreaks could lead to the rapid spread and subsequent transmission of YFV in distant locations. We designed a stochastic metapopulation model with spatiotemporally explicit transmissibility scenarios to simulate the global spread of YFV from a single urban outbreak by infected airline travelers. In simulations of a 2008 outbreak in Asunción, Paraguay, local outbreaks occurred in 12.8% of simulations and international spread in 2.0%. Using simple probabilistic models, we found that local incidence, travel rates, and basic transmission parameters are sufficient to assess the probability of introduction and autochthonous transmission events. These models could be used to assess the risk of YFV spread during an urban outbreak and identify locations at risk for YFV introduction and subsequent autochthonous transmission. PMID:22302873
CHAKRABORTY, A.; SAZZAD, H. M. S.; HOSSAIN, M. J.; ISLAM, M. S.; PARVEEN, S.; HUSAIN, M.; BANU, S. S.; PODDER, G.; AFROJ, S.; ROLLIN, P. E.; DASZAK, P.; LUBY, S. P.; RAHMAN, M.; GURLEY, E. S.
2015-01-01
SUMMARY Drinking raw date palm sap is the primary route of Nipah virus (NiV) transmission from bats to people in Bangladesh; subsequent person-to-person transmission is common. During December 2010 to March 2011, we investigated NiV epidemiology by interviewing cases using structured questionnaires, in-depth interviews, and group discussions to collect clinical and exposure histories. We conducted a case-control study to identify risk factors for transmission. We identified 43 cases; 23 were laboratory-confirmed and 20 probable. Thirty-eight (88%) cases died. Drinking raw date palm sap and contact with an infected person were major risk factors; one healthcare worker was infected and for another case transmission apparently occurred through contact with a corpse. In absence of these risk factors, apparent routes of transmission included drinking fermented date palm sap. For the first time, a case was detected in eastern Bangladesh. Identification of new epidemiological characteristics emphasizes the importance of continued NiV surveillance and case investigation. PMID:26122675
Chakraborty, A; Sazzad, H M S; Hossain, M J; Islam, M S; Parveen, S; Husain, M; Banu, S S; Podder, G; Afroj, S; Rollin, P E; Daszak, P; Luby, S P; Rahman, M; Gurley, E S
2016-01-01
Drinking raw date palm sap is the primary route of Nipah virus (NiV) transmission from bats to people in Bangladesh; subsequent person-to-person transmission is common. During December 2010 to March 2011, we investigated NiV epidemiology by interviewing cases using structured questionnaires, in-depth interviews, and group discussions to collect clinical and exposure histories. We conducted a case-control study to identify risk factors for transmission. We identified 43 cases; 23 were laboratory-confirmed and 20 probable. Thirty-eight (88%) cases died. Drinking raw date palm sap and contact with an infected person were major risk factors; one healthcare worker was infected and for another case transmission apparently occurred through contact with a corpse. In absence of these risk factors, apparent routes of transmission included drinking fermented date palm sap. For the first time, a case was detected in eastern Bangladesh. Identification of new epidemiological characteristics emphasizes the importance of continued NiV surveillance and case investigation.
Johansson, Michael A; Arana-Vizcarrondo, Neysarí; Biggerstaff, Brad J; Gallagher, Nancy; Marano, Nina; Staples, J Erin
2012-02-01
Yellow fever virus (YFV), a mosquito-borne virus endemic to tropical Africa and South America, is capable of causing large urban outbreaks of human disease. With the ease of international travel, urban outbreaks could lead to the rapid spread and subsequent transmission of YFV in distant locations. We designed a stochastic metapopulation model with spatiotemporally explicit transmissibility scenarios to simulate the global spread of YFV from a single urban outbreak by infected airline travelers. In simulations of a 2008 outbreak in Asunción, Paraguay, local outbreaks occurred in 12.8% of simulations and international spread in 2.0%. Using simple probabilistic models, we found that local incidence, travel rates, and basic transmission parameters are sufficient to assess the probability of introduction and autochthonous transmission events. These models could be used to assess the risk of YFV spread during an urban outbreak and identify locations at risk for YFV introduction and subsequent autochthonous transmission.
Large-scale entomologic assessment of Onchocerca volvulus transmission by poolscreen PCR in Mexico.
Rodríguez-Pérez, Mario A; Katholi, Charles R; Hassan, Hassan K; Unnasch, Thomas R
2006-06-01
To study the impact of mass Mectizan treatment on Onchocerca volvulus transmission in Mexico, entomological surveys were carried out in the endemic foci of Oaxaca, Southern Chiapas, and Northern Chiapas. Collected flies were screened by polymerase chain reaction (PCR) for O. volvulus parasites. The prevalence of infected and infective flies was estimated using the PoolScreen algorithm and with a novel probability-based method. O. volvulus infective larvae were not detected in flies from 6/13 communities. In 7/13 communities, infective flies were detected, with prevalences ranging from 1.6/10,000 to 29.0/10,000 and seasonal transmission potentials ranging from 0.4 to 3.3. Infected and infective flies were found in a community in Northern Chiapas, suggesting that, according to World Health Organization criteria, autochthonous transmission exists in this focus. These data suggest that O. volvulus transmission in Mexico has been suppressed or brought to a level that may be insufficient to sustain the parasite population.
Mayo, Christie; Shelley, Courtney; MacLachlan, N. James; Gardner, Ian; Hartley, David; Barker, Christopher
2016-01-01
The global distribution of bluetongue virus (BTV) has been changing recently, perhaps as a result of climate change. To evaluate the risk of BTV infection and transmission in a BTV-endemic region of California, sentinel dairy cows were evaluated for BTV infection, and populations of Culicoides vectors were collected at different sites using carbon dioxide. A deterministic model was developed to quantify risk and guide future mitigation strategies to reduce BTV infection in California dairy cattle. The greatest risk of BTV transmission was predicted within the warm Central Valley of California that contains the highest density of dairy cattle in the United States. Temperature and parameters associated with Culicoides vectors (transmission probabilities, carrying capacity, and survivorship) had the greatest effect on BTV’s basic reproduction number, R0. Based on these analyses, optimal control strategies for reducing BTV infection risk in dairy cattle will be highly reliant upon early efforts to reduce vector abundance during the months prior to peak transmission. PMID:27812161
Park, Andrew W; Cleveland, Christopher A; Dallas, Tad A; Corn, Joseph L
2016-06-01
Although many parasites are transmitted between hosts by a suite of arthropod vectors, the impact of vector biodiversity on parasite transmission is poorly understood. Positive relationships between host infection prevalence and vector species richness (SR) may operate through multiple mechanisms, including (i) increased vector abundance, (ii) a sampling effect in which species of high vectorial capacity are more likely to occur in species-rich communities, and (iii) functional diversity whereby communities comprised species with distinct phenologies may extend the duration of seasonal transmission. Teasing such mechanisms apart is impeded by a lack of appropriate data, yet could highlight a neglected role for functional diversity in parasite transmission. We used statistical modelling of extensive host, vector and microparasite data to test the hypothesis that functional diversity leading to longer seasonal transmission explained variable levels of disease in a wildlife population. We additionally developed a simple transmission model to guide our expectation of how an increased transmission season translates to infection prevalence. Our study demonstrates that vector SR is associated with increased levels of disease reporting, but not via increases in vector abundance or via a sampling effect. Rather, the relationship operates by extending the length of seasonal transmission, in line with theoretical predictions.
Probability function of breaking-limited surface elevation. [wind generated waves of ocean
NASA Technical Reports Server (NTRS)
Tung, C. C.; Huang, N. E.; Yuan, Y.; Long, S. R.
1989-01-01
The effect of wave breaking on the probability function of surface elevation is examined. The surface elevation limited by wave breaking zeta sub b(t) is first related to the original wave elevation zeta(t) and its second derivative. An approximate, second-order, nonlinear, non-Gaussian model for zeta(t) of arbitrary but moderate bandwidth is presented, and an expression for the probability density function zeta sub b(t) is derived. The results show clearly that the effect of wave breaking on the probability density function of surface elevation is to introduce a secondary hump on the positive side of the probability density function, a phenomenon also observed in wind wave tank experiments.
NASA Astrophysics Data System (ADS)
Wang, Meng; Deng, Ming; Luo, Xianhu; Zhao, Qingxian; Chen, Kai; Jing, Jianen
2018-02-01
The marine controlled source electromagnetic (CSEM) method has been recognized as an effective exploration method of shallow hydrocarbons around the world. We developed our own underwater marine CSEM transmitter that consisted of many functional modules with various response times. We previously adopted a centralized software-control technology to design the transmitter circuit topological structure. That structure probably generated a control disorder or malfunction. These undesirable conditions could lead to repeated recovery and deployment of the transmitter, which not only consumed time but also affected data continuity and establishment of stable and continuous CSEM field. We developed an instrument design concept named ‘control technology of hardware parallelism’. In this design, a noteworthy innovation of our new technology is to solve the above-mentioned problems at the physical and fundamental levels. We used several self-contained control-units to simultaneously accomplish the predetermined functions of the transmitter. The new solution relies on two technologies: multi-core embedded technology and multi-channel parallel optical-fiber data transmission technology. The first technology depends on many independent microcontrollers. Every microcontroller is only used to achieve a customized function. The second one relies on several multiple optical-fiber transmission channels realized by a complex programmable logic device and two optical-fiber conversion devices, which are used to establish a communication link between the shipboard monitoring and control-unit and underwater transmitter. We have conducted some marine experiments to verify the reliability and stability of the new method. In particular, the new technology used in the transmitter system could help us obtain more useful measured data in a limited time, improve real-time efficiency, and support the establishment of a stable CSEM field.
Nonlinear mixed effects modeling of gametocyte carriage in patients with uncomplicated malaria
2010-01-01
Background Gametocytes are the sexual form of the malaria parasite and the main agents of transmission. While there are several factors that influence host infectivity, the density of gametocytes appears to be the best single measure that is related to the human host's infectivity to mosquitoes. Despite the obviously important role that gametocytes play in the transmission of malaria and spread of anti-malarial resistance, it is common to estimate gametocyte carriage indirectly based on asexual parasite measurements. The objective of this research was to directly model observed gametocyte densities over time, during the primary infection. Methods Of 447 patients enrolled in sulphadoxine-pyrimethamine therapeutic efficacy studies in South Africa and Mozambique, a subset of 103 patients who had no gametocytes pre-treatment and who had at least three non-zero gametocyte densities over the 42-day follow up period were included in this analysis. Results A variety of different functions were examined. A modified version of the critical exponential function was selected for the final model given its robustness across different datasets and its flexibility in assuming a variety of different shapes. Age, site, initial asexual parasite density (logged to the base 10), and an empirical patient category were the co-variates that were found to improve the model. Conclusions A population nonlinear modeling approach seems promising and produced a flexible function whose estimates were stable across various different datasets. Surprisingly, dihydrofolate reductase and dihydropteroate synthetase mutation prevalence did not enter the model. This is probably related to a lack of power (quintuple mutations n = 12), and informative censoring; treatment failures were withdrawn from the study and given rescue treatment, usually prior to completion of follow up. PMID:20187935
Nonlinear mixed effects modeling of gametocyte carriage in patients with uncomplicated malaria.
Distiller, Greg B; Little, Francesca; Barnes, Karen I
2010-02-26
Gametocytes are the sexual form of the malaria parasite and the main agents of transmission. While there are several factors that influence host infectivity, the density of gametocytes appears to be the best single measure that is related to the human host's infectivity to mosquitoes. Despite the obviously important role that gametocytes play in the transmission of malaria and spread of anti-malarial resistance, it is common to estimate gametocyte carriage indirectly based on asexual parasite measurements. The objective of this research was to directly model observed gametocyte densities over time, during the primary infection. Of 447 patients enrolled in sulphadoxine-pyrimethamine therapeutic efficacy studies in South Africa and Mozambique, a subset of 103 patients who had no gametocytes pre-treatment and who had at least three non-zero gametocyte densities over the 42-day follow up period were included in this analysis. A variety of different functions were examined. A modified version of the critical exponential function was selected for the final model given its robustness across different datasets and its flexibility in assuming a variety of different shapes. Age, site, initial asexual parasite density (logged to the base 10), and an empirical patient category were the co-variates that were found to improve the model. A population nonlinear modeling approach seems promising and produced a flexible function whose estimates were stable across various different datasets. Surprisingly, dihydrofolate reductase and dihydropteroate synthetase mutation prevalence did not enter the model. This is probably related to a lack of power (quintuple mutations n = 12), and informative censoring; treatment failures were withdrawn from the study and given rescue treatment, usually prior to completion of follow up.
Leelahapongsathon, Kansuda; Schukken, Ynte Hein; Pinyopummintr, Tanu; Suriyasathaporn, Witaya
2016-02-01
The objectives of study were to determine the transmission parameters (β), durations of infection, and basic reproductive numbers (R0) of both Streptococcus agalactiae and Streptococcus uberis as pathogens causing mastitis outbreaks in dairy herds. A 10-mo longitudinal study was performed using 2 smallholder dairy herds with mastitis outbreaks caused by Strep. agalactiae and Strep. uberis, respectively. Both herds had poor mastitis control management and did not change their milking management during the entire study period. Quarter milk samples were collected at monthly intervals from all lactating animals in each herd for bacteriological identification. The durations of infection for Strep. uberis intramammary infection (IMI) and Strep. agalactiae IMI were examined using Kaplan-Meier survival curves, and the Kaplan-Meier survival functions for Strep. uberis IMI and Strep. agalactiae IMI were compared using log rank survival-test. The spread of Strep. uberis and Strep. agalactiae through the population was determined by transmission parameter, β, the probability per unit of time that one infectious quarter will infect another quarter, assuming that all other quarters are susceptible. For the Strep. uberis outbreak herd (31 cows), 56 new infections and 28 quarters with spontaneous cure were observed. For the Strep. agalactiae outbreak herd (19 cows), 26 new infections and 9 quarters with spontaneous cure were observed. The duration of infection for Strep. agalactiae (mean=270.84 d) was significantly longer than the duration of infection for Strep. uberis (mean=187.88 d). The transmission parameters (β) estimated (including 95% confidence interval) for Strep. uberis IMI and Strep. agalactiae IMI were 0.0155 (0.0035-0.0693) and 0.0068 (0.0008-0.0606), respectively. The R0 (including 95% confidence interval) during the study were 2.91 (0.63-13.47) and 1.86 (0.21-16.61) for Strep. uberis IMI and Strep. agalactiae IMI, respectively. In conclusion, the transmission parameter and R0 values were not different between both pathogens; however, the duration of infection for Strep. agalactiae was longer than Strep. uberis. These suggest that Strep. uberis may have a different transmission dynamic compared with Strep. agalactiae. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Zou, Huachun; Tabrizi, Sepehr N; Grulich, Andrew E; Hocking, Jane S; Bradshaw, Catriona S; Cornall, Alyssa M; Morrow, Andrea; Prestage, Garrett; Law, Matthew G; Garland, Suzanne M; Chen, Marcus Y; Fairley, Christopher K
2015-01-01
Men who have sex with men (MSM) have an increased risk of anogenital human papilomavirus (HPV) infection, which can lead to HPV-related anogenital lesions such as warts, anal intraepithelial neoplasia, and anal cancer. Some of these HPV types are preventable with vaccines. We aimed to describe the incidence of anal, penile, and oral HPV infection, and to estimate the site-specific transmission probability per partner, for teenage MSM. In our observational cohort study, we enrolled teenage MSM (aged 16-20 years) with low sexual exposure and a low prevalence of HPV in Melbourne (VIC, Australia). At baseline, 3, 6, and 12 months, we took a swab from the anal canal, and participants self-collected a swab from the penis and an oral rinse. Our primary outcome was definite and probable incident HPV infection of the anus, penis, or mouth at any time in the 12 months from baseline, assessed through the presence of HPV DNA. We defined definite incident HPV infection as the same HPV type detected more than once from the same site in men who had a negative HPV test at baseline. We defined probable incident HPV infection as only one positive test. We estimated the probability of HPV transmission per partner using HPV prevalence in MSM with a similar age to partners of men in our cohort. This study is registered at the Australian New Zealand Clinical Trials Registry and ClinicalTrials.gov, numbers ACTRN12611000857909 and NCT01422356. We enrolled 200 MSM aged 16-20 years (median 19 years [IRQ 18-20; range 16-20]) between Sept 20, 2010, and Aug 24, 2012. Over the 12 month follow-up period, we detected 48 definite (107 possible) HPV infections in the anus, ten definite (34 possible) HPV infections on the penis, and no definite (six possible) infections in the mouth. Definite incidence rate per 100 person-years for any anal HPV infection was 57 (95% CI 46-68), and for any anal HPV type in the quadrivalent vaccine was 33 (23-44). Definite incidence rate per 100 person-years for any penile HPV was 12 (6-21) and for any HPV type in the quadrivalent vaccine was 5 (1-12). Estimated probabilities of HPV transmission from the penis to the anus were significantly higher than were those from the anus to the penis (p<0·05 for all HPV types in the quadrivalent vaccine). High incidence rates suggest that the vaccination coverage in MSM will need to be high. The transmission estimates will inform HPV modelling. Merck. Copyright © 2015 Elsevier Ltd. All rights reserved.
Abrahams, M-R; Anderson, J A; Giorgi, E E; Seoighe, C; Mlisana, K; Ping, L-H; Athreya, G S; Treurnicht, F K; Keele, B F; Wood, N; Salazar-Gonzalez, J F; Bhattacharya, T; Chu, H; Hoffman, I; Galvin, S; Mapanje, C; Kazembe, P; Thebus, R; Fiscus, S; Hide, W; Cohen, M S; Karim, S Abdool; Haynes, B F; Shaw, G M; Hahn, B H; Korber, B T; Swanstrom, R; Williamson, C
2009-04-01
Identifying the specific genetic characteristics of successfully transmitted variants may prove central to the development of effective vaccine and microbicide interventions. Although human immunodeficiency virus transmission is associated with a population bottleneck, the extent to which different factors influence the diversity of transmitted viruses is unclear. We estimate here the number of transmitted variants in 69 heterosexual men and women with primary subtype C infections. From 1,505 env sequences obtained using a single genome amplification approach we show that 78% of infections involved single variant transmission and 22% involved multiple variant transmissions (median of 3). We found evidence for mutations selected for cytotoxic-T-lymphocyte or antibody escape and a high prevalence of recombination in individuals infected with multiple variants representing another potential escape pathway in these individuals. In a combined analysis of 171 subtype B and C transmission events, we found that infection with more than one variant does not follow a Poisson distribution, indicating that transmission of individual virions cannot be seen as independent events, each occurring with low probability. While most transmissions resulted from a single infectious unit, multiple variant transmissions represent a significant fraction of transmission events, suggesting that there may be important mechanistic differences between these groups that are not yet understood.
Greenhouse, Bryan; Dokomajilar, Christian; Hubbard, Alan; Rosenthal, Philip J; Dorsey, Grant
2007-09-01
Antimalarial clinical trials use genotyping techniques to distinguish new infection from recrudescence. In areas of high transmission, the accuracy of genotyping may be compromised due to the high number of infecting parasite strains. We compared the accuracies of genotyping methods, using up to six genotyping markers, to assign outcomes for two large antimalarial trials performed in areas of Africa with different transmission intensities. We then estimated the probability of genotyping misclassification and its effect on trial results. At a moderate-transmission site, three genotyping markers were sufficient to generate accurate estimates of treatment failure. At a high-transmission site, even with six markers, estimates of treatment failure were 20% for amodiaquine plus artesunate and 17% for artemether-lumefantrine, regimens expected to be highly efficacious. Of the observed treatment failures for these two regimens, we estimated that at least 45% and 35%, respectively, were new infections misclassified as recrudescences. Increasing the number of genotyping markers improved the ability to distinguish new infection from recrudescence at a moderate-transmission site, but using six markers appeared inadequate at a high-transmission site. Genotyping-adjusted estimates of treatment failure from high-transmission sites may represent substantial overestimates of the true risk of treatment failure.
Tygert, Mark
2010-09-21
We discuss several tests for determining whether a given set of independent and identically distributed (i.i.d.) draws does not come from a specified probability density function. The most commonly used are Kolmogorov-Smirnov tests, particularly Kuiper's variant, which focus on discrepancies between the cumulative distribution function for the specified probability density and the empirical cumulative distribution function for the given set of i.i.d. draws. Unfortunately, variations in the probability density function often get smoothed over in the cumulative distribution function, making it difficult to detect discrepancies in regions where the probability density is small in comparison with its values in surrounding regions. We discuss tests without this deficiency, complementing the classical methods. The tests of the present paper are based on the plain fact that it is unlikely to draw a random number whose probability is small, provided that the draw is taken from the same distribution used in calculating the probability (thus, if we draw a random number whose probability is small, then we can be confident that we did not draw the number from the same distribution used in calculating the probability).
Exposure Patterns Driving Ebola Transmission in West Africa: A Retrospective Observational Study.
Agua-Agum, Junerlyn; Ariyarajah, Archchun; Aylward, Bruce; Bawo, Luke; Bilivogui, Pepe; Blake, Isobel M; Brennan, Richard J; Cawthorne, Amy; Cleary, Eilish; Clement, Peter; Conteh, Roland; Cori, Anne; Dafae, Foday; Dahl, Benjamin; Dangou, Jean-Marie; Diallo, Boubacar; Donnelly, Christl A; Dorigatti, Ilaria; Dye, Christopher; Eckmanns, Tim; Fallah, Mosoka; Ferguson, Neil M; Fiebig, Lena; Fraser, Christophe; Garske, Tini; Gonzalez, Lice; Hamblion, Esther; Hamid, Nuha; Hersey, Sara; Hinsley, Wes; Jambei, Amara; Jombart, Thibaut; Kargbo, David; Keita, Sakoba; Kinzer, Michael; George, Fred Kuti; Godefroy, Beatrice; Gutierrez, Giovanna; Kannangarage, Niluka; Mills, Harriet L; Moller, Thomas; Meijers, Sascha; Mohamed, Yasmine; Morgan, Oliver; Nedjati-Gilani, Gemma; Newton, Emily; Nouvellet, Pierre; Nyenswah, Tolbert; Perea, William; Perkins, Devin; Riley, Steven; Rodier, Guenael; Rondy, Marc; Sagrado, Maria; Savulescu, Camelia; Schafer, Ilana J; Schumacher, Dirk; Seyler, Thomas; Shah, Anita; Van Kerkhove, Maria D; Wesseh, C Samford; Yoti, Zabulon
2016-11-01
The ongoing West African Ebola epidemic began in December 2013 in Guinea, probably from a single zoonotic introduction. As a result of ineffective initial control efforts, an Ebola outbreak of unprecedented scale emerged. As of 4 May 2015, it had resulted in more than 19,000 probable and confirmed Ebola cases, mainly in Guinea (3,529), Liberia (5,343), and Sierra Leone (10,746). Here, we present analyses of data collected during the outbreak identifying drivers of transmission and highlighting areas where control could be improved. Over 19,000 confirmed and probable Ebola cases were reported in West Africa by 4 May 2015. Individuals with confirmed or probable Ebola ("cases") were asked if they had exposure to other potential Ebola cases ("potential source contacts") in a funeral or non-funeral context prior to becoming ill. We performed retrospective analyses of a case line-list, collated from national databases of case investigation forms that have been reported to WHO. These analyses were initially performed to assist WHO's response during the epidemic, and have been updated for publication. We analysed data from 3,529 cases in Guinea, 5,343 in Liberia, and 10,746 in Sierra Leone; exposures were reported by 33% of cases. The proportion of cases reporting a funeral exposure decreased over time. We found a positive correlation (r = 0.35, p < 0.001) between this proportion in a given district for a given month and the within-district transmission intensity, quantified by the estimated reproduction number (R). We also found a negative correlation (r = -0.37, p < 0.001) between R and the district proportion of hospitalised cases admitted within ≤4 days of symptom onset. These two proportions were not correlated, suggesting that reduced funeral attendance and faster hospitalisation independently influenced local transmission intensity. We were able to identify 14% of potential source contacts as cases in the case line-list. Linking cases to the contacts who potentially infected them provided information on the transmission network. This revealed a high degree of heterogeneity in inferred transmissions, with only 20% of cases accounting for at least 73% of new infections, a phenomenon often called super-spreading. Multivariable regression models allowed us to identify predictors of being named as a potential source contact. These were similar for funeral and non-funeral contacts: severe symptoms, death, non-hospitalisation, older age, and travelling prior to symptom onset. Non-funeral exposures were strongly peaked around the death of the contact. There was evidence that hospitalisation reduced but did not eliminate onward exposures. We found that Ebola treatment units were better than other health care facilities at preventing exposure from hospitalised and deceased individuals. The principal limitation of our analysis is limited data quality, with cases not being entered into the database, cases not reporting exposures, or data being entered incorrectly (especially dates, and possible misclassifications). Achieving elimination of Ebola is challenging, partly because of super-spreading. Safe funeral practices and fast hospitalisation contributed to the containment of this Ebola epidemic. Continued real-time data capture, reporting, and analysis are vital to track transmission patterns, inform resource deployment, and thus hasten and maintain elimination of the virus from the human population.
Exposure Patterns Driving Ebola Transmission in West Africa: A Retrospective Observational Study
Agua-Agum, Junerlyn; Aylward, Bruce; Bawo, Luke; Blake, Isobel M.; Brennan, Richard J.; Cawthorne, Amy; Cleary, Eilish; Clement, Peter; Conteh, Roland; Cori, Anne; Dafae, Foday; Dahl, Benjamin; Dangou, Jean-Marie; Diallo, Boubacar; Donnelly, Christl A.; Dye, Christopher; Eckmanns, Tim; Fallah, Mosoka; Fiebig, Lena; Fraser, Christophe; Garske, Tini; Gonzalez, Lice; Hamblion, Esther; Hamid, Nuha; Hinsley, Wes; Jambei, Amara; Jombart, Thibaut; Kargbo, David; Keita, Sakoba; Kinzer, Michael; George, Fred Kuti; Godefroy, Beatrice; Gutierrez, Giovanna; Kannangarage, Niluka; Mills, Harriet L.; Moller, Thomas; Meijers, Sascha; Mohamed, Yasmine; Newton, Emily; Nouvellet, Pierre; Nyenswah, Tolbert; Perea, William; Perkins, Devin; Riley, Steven; Rondy, Marc; Sagrado, Maria; Savulescu, Camelia; Schafer, Ilana J.; Schumacher, Dirk; Seyler, Thomas; Shah, Anita; Van Kerkhove, Maria D.; Wesseh, C. Samford; Yoti, Zabulon
2016-01-01
Background The ongoing West African Ebola epidemic began in December 2013 in Guinea, probably from a single zoonotic introduction. As a result of ineffective initial control efforts, an Ebola outbreak of unprecedented scale emerged. As of 4 May 2015, it had resulted in more than 19,000 probable and confirmed Ebola cases, mainly in Guinea (3,529), Liberia (5,343), and Sierra Leone (10,746). Here, we present analyses of data collected during the outbreak identifying drivers of transmission and highlighting areas where control could be improved. Methods and Findings Over 19,000 confirmed and probable Ebola cases were reported in West Africa by 4 May 2015. Individuals with confirmed or probable Ebola (“cases”) were asked if they had exposure to other potential Ebola cases (“potential source contacts”) in a funeral or non-funeral context prior to becoming ill. We performed retrospective analyses of a case line-list, collated from national databases of case investigation forms that have been reported to WHO. These analyses were initially performed to assist WHO’s response during the epidemic, and have been updated for publication. We analysed data from 3,529 cases in Guinea, 5,343 in Liberia, and 10,746 in Sierra Leone; exposures were reported by 33% of cases. The proportion of cases reporting a funeral exposure decreased over time. We found a positive correlation (r = 0.35, p < 0.001) between this proportion in a given district for a given month and the within-district transmission intensity, quantified by the estimated reproduction number (R). We also found a negative correlation (r = −0.37, p < 0.001) between R and the district proportion of hospitalised cases admitted within ≤4 days of symptom onset. These two proportions were not correlated, suggesting that reduced funeral attendance and faster hospitalisation independently influenced local transmission intensity. We were able to identify 14% of potential source contacts as cases in the case line-list. Linking cases to the contacts who potentially infected them provided information on the transmission network. This revealed a high degree of heterogeneity in inferred transmissions, with only 20% of cases accounting for at least 73% of new infections, a phenomenon often called super-spreading. Multivariable regression models allowed us to identify predictors of being named as a potential source contact. These were similar for funeral and non-funeral contacts: severe symptoms, death, non-hospitalisation, older age, and travelling prior to symptom onset. Non-funeral exposures were strongly peaked around the death of the contact. There was evidence that hospitalisation reduced but did not eliminate onward exposures. We found that Ebola treatment units were better than other health care facilities at preventing exposure from hospitalised and deceased individuals. The principal limitation of our analysis is limited data quality, with cases not being entered into the database, cases not reporting exposures, or data being entered incorrectly (especially dates, and possible misclassifications). Conclusions Achieving elimination of Ebola is challenging, partly because of super-spreading. Safe funeral practices and fast hospitalisation contributed to the containment of this Ebola epidemic. Continued real-time data capture, reporting, and analysis are vital to track transmission patterns, inform resource deployment, and thus hasten and maintain elimination of the virus from the human population. PMID:27846234
Estimating parameter of influenza transmission using regularized least square
NASA Astrophysics Data System (ADS)
Nuraini, N.; Syukriah, Y.; Indratno, S. W.
2014-02-01
Transmission process of influenza can be presented in a mathematical model as a non-linear differential equations system. In this model the transmission of influenza is determined by the parameter of contact rate of the infected host and susceptible host. This parameter will be estimated using a regularized least square method where the Finite Element Method and Euler Method are used for approximating the solution of the SIR differential equation. The new infected data of influenza from CDC is used to see the effectiveness of the method. The estimated parameter represents the contact rate proportion of transmission probability in a day which can influence the number of infected people by the influenza. Relation between the estimated parameter and the number of infected people by the influenza is measured by coefficient of correlation. The numerical results show positive correlation between the estimated parameters and the infected people.
Microwave Analysis with Monte Carlo Methods for ECH Transmission Lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaufman, Michael C.; Lau, Cornwall H.; Hanson, Gregory R.
A new code framework, MORAMC, is presented which model transmission line (TL) systems consisting of overmoded circular waveguide and other components including miter bends and transmission line gaps. The transmission line is modeled as a set of mode converters in series where each component is composed of one or more converters. The parametrization of each mode converter can account for the fabrication tolerances of physically realizable components. These tolerances as well as the precision to which these TL systems can be installed and aligned gives a practical limit to which the uncertainty of the microwave performance of the system canmore » be calculated. Because of this, Monte Carlo methods are a natural fit and are employed to calculate the probability distribution that a given TL can deliver a required power and mode purity. Several examples are given to demonstrate the usefulness of MORAMC in optimizing TL systems.« less
Microwave Analysis with Monte Carlo Methods for ECH Transmission Lines
Kaufman, Michael C.; Lau, Cornwall H.; Hanson, Gregory R.
2018-03-08
A new code framework, MORAMC, is presented which model transmission line (TL) systems consisting of overmoded circular waveguide and other components including miter bends and transmission line gaps. The transmission line is modeled as a set of mode converters in series where each component is composed of one or more converters. The parametrization of each mode converter can account for the fabrication tolerances of physically realizable components. These tolerances as well as the precision to which these TL systems can be installed and aligned gives a practical limit to which the uncertainty of the microwave performance of the system canmore » be calculated. Because of this, Monte Carlo methods are a natural fit and are employed to calculate the probability distribution that a given TL can deliver a required power and mode purity. Several examples are given to demonstrate the usefulness of MORAMC in optimizing TL systems.« less
Microwave Analysis with Monte Carlo Methods for ECH Transmission Lines
NASA Astrophysics Data System (ADS)
Kaufman, M. C.; Lau, C.; Hanson, G. R.
2018-03-01
A new code framework, MORAMC, is presented which model transmission line (TL) systems consisting of overmoded circular waveguide and other components including miter bends and transmission line gaps. The transmission line is modeled as a set of mode converters in series where each component is composed of one or more converters. The parametrization of each mode converter can account for the fabrication tolerances of physically realizable components. These tolerances as well as the precision to which these TL systems can be installed and aligned gives a practical limit to which the uncertainty of the microwave performance of the system can be calculated. Because of this, Monte Carlo methods are a natural fit and are employed to calculate the probability distribution that a given TL can deliver a required power and mode purity. Several examples are given to demonstrate the usefulness of MORAMC in optimizing TL systems.
The risk of airborne influenza transmission in passenger cars.
Knibbs, L D; Morawska, L; Bell, S C
2012-03-01
Travel in passenger cars is a ubiquitous aspect of the daily activities of many people. During the 2009 influenza A(H1N1) pandemic a case of probable transmission during car travel was reported in Australia, to which spread via the airborne route may have contributed. However, there are no data to indicate the likely risks of such events, and how they may vary and be mitigated. To address this knowledge gap, we estimated the risk of airborne influenza transmission in two cars (1989 model and 2005 model) by employing ventilation measurements and a variation of the Wells-Riley model. Results suggested that infection risk can be reduced by not recirculating air; however, estimated risk ranged from 59% to 99·9% for a 90-min trip when air was recirculated in the newer vehicle. These results have implications for interrupting in-car transmission of other illnesses spread by the airborne route.
[Cardiac involvement in Acute Chagas' Disease cases in the Amazon region].
Barbosa-Ferreira, João Marcos; Guerra, Jorge Augusto de Oliveira; Santana Filho, Franklin Simões de; Magalhães, Belisa Maria Lopes; Coelho, Leíla I A R C; Barbosa, Maria das Graças Vale
2010-06-01
The cardiac involvement of five patients from the Amazon region with Acute Chagas' Disease (ACD) is described. Four of these patients presented probable oral transmission. All of them presented some degree of cardiac involvement, but there were no deaths.
Ecology: avoidance of disease by social lobsters.
Behringer, Donald C; Butler, Mark J; Shields, Jeffrey D
2006-05-25
Transmissible pathogens are the bane of social animals, so they have evolved behaviours to decrease the probability of infection. There is no record, however, of social animals avoiding diseased individuals of their own species in the wild. Here we show how healthy, normally gregarious Caribbean spiny lobsters (Panulirus argus) avoid conspecifics that are infected with a lethal virus. Early detection and avoidance of infected, though not yet infectious, individuals by healthy lobsters confers a selective advantage and highlights the importance of host behaviour in disease transmission among natural populations.
Williams, David M.; Dechen Quinn, Amy C.; Porter, William F.
2014-01-01
Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05–0.14), to low levels post-parturition through summer (0.00–0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m – 7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response. PMID:24409293
NASA Technical Reports Server (NTRS)
Timofeyev, Y. M.
1979-01-01
In order to test the error of calculation in assumed values of the transmission function for Soviet and American radiometers sounding the atmosphere thermally from orbiting satellites, the assumptions of the transmission calculation is varied with respect to atmospheric CO2 content, transmission frequency, and atmospheric absorption. The error arising from variations of the assumptions from the standard basic model is calculated.
Research on Segmentation Monitoring Control of IA-RWA Algorithm with Probe Flow
NASA Astrophysics Data System (ADS)
Ren, Danping; Guo, Kun; Yao, Qiuyan; Zhao, Jijun
2018-04-01
The impairment-aware routing and wavelength assignment algorithm with probe flow (P-IA-RWA) can make an accurate estimation for the transmission quality of the link when the connection request comes. But it also causes some problems. The probe flow data introduced in the P-IA-RWA algorithm can result in the competition for wavelength resources. In order to reduce the competition and the blocking probability of the network, a new P-IA-RWA algorithm with segmentation monitoring-control mechanism (SMC-P-IA-RWA) is proposed. The algorithm would reduce the holding time of network resources for the probe flow. It segments the candidate path suitably for the data transmitting. And the transmission quality of the probe flow sent by the source node will be monitored in the endpoint of each segment. The transmission quality of data can also be monitored, so as to make the appropriate treatment to avoid the unnecessary probe flow. The simulation results show that the proposed SMC-P-IA-RWA algorithm can effectively reduce the blocking probability. It brings a better solution to the competition for resources between the probe flow and the main data to be transferred. And it is more suitable for scheduling control in the large-scale network.
Computation of the Complex Probability Function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trainer, Amelia Jo; Ledwith, Patrick John
The complex probability function is important in many areas of physics and many techniques have been developed in an attempt to compute it for some z quickly and e ciently. Most prominent are the methods that use Gauss-Hermite quadrature, which uses the roots of the n th degree Hermite polynomial and corresponding weights to approximate the complex probability function. This document serves as an overview and discussion of the use, shortcomings, and potential improvements on the Gauss-Hermite quadrature for the complex probability function.
Goode, D.J.; Appel, C.A.
1992-01-01
More accurate alternatives to the widely used harmonic mean interblock transmissivity are proposed for block-centered finite-difference models of ground-water flow in unconfined aquifers and in aquifers having smoothly varying transmissivity. The harmonic mean is the exact interblock transmissivity for steady-state one-dimensional flow with no recharge if the transmissivity is assumed to be spatially uniform over each finite-difference block, changing abruptly at the block interface. However, the harmonic mean may be inferior to other means if transmissivity varies in a continuous or smooth manner between nodes. Alternative interblock transmissivity functions are analytically derived for the case of steady-state one-dimensional flow with no recharge. The second author has previously derived the exact interblock transmissivity, the logarithmic mean, for one-dimensional flow when transmissivity is a linear function of distance in the direction of flow. We show that the logarithmic mean transmissivity is also exact for uniform flow parallel to the direction of changing transmissivity in a two- or three-dimensional model, regardless of grid orientation relative to the flow vector. For the case of horizontal flow in a homogeneous unconfined or water-table aquifer with a horizontal bottom and with areally distributed recharge, the exact interblock transmissivity is the unweighted arithmetic mean of transmissivity at the nodes. This mean also exhibits no grid-orientation effect for unidirectional flow in a two-dimensional model. For horizontal flow in an unconfined aquifer with no recharge where hydraulic conductivity is a linear function of distance in the direction of flow the exact interblock transmissivity is the product of the arithmetic mean saturated thickness and the logarithmic mean hydraulic conductivity. For several hypothetical two- and three-dimensional cases with smoothly varying transmissivity or hydraulic conductivity, the harmonic mean is shown to yield the least accurate solution to the flow equation of the alternatives considered. Application of the alternative interblock transmissivities to a regional aquifer system model indicates that the changes in computed heads and fluxes are typically small, relative to model calibration error. For this example, the use of alternative interblock transmissivities resulted in an increase in computational effort of less than 3 percent. Numerical algorithms to compute alternative interblock transmissivity functions in a modular three-dimensional flow model are presented and documented.
Probability and Quantum Paradigms: the Interplay
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kracklauer, A. F.
Since the introduction of Born's interpretation of quantum wave functions as yielding the probability density of presence, Quantum Theory and Probability have lived in a troubled symbiosis. Problems arise with this interpretation because quantum probabilities exhibit features alien to usual probabilities, namely non Boolean structure and non positive-definite phase space probability densities. This has inspired research into both elaborate formulations of Probability Theory and alternate interpretations for wave functions. Herein the latter tactic is taken and a suggested variant interpretation of wave functions based on photo detection physics proposed, and some empirical consequences are considered. Although incomplete in a fewmore » details, this variant is appealing in its reliance on well tested concepts and technology.« less
Probability and Quantum Paradigms: the Interplay
NASA Astrophysics Data System (ADS)
Kracklauer, A. F.
2007-12-01
Since the introduction of Born's interpretation of quantum wave functions as yielding the probability density of presence, Quantum Theory and Probability have lived in a troubled symbiosis. Problems arise with this interpretation because quantum probabilities exhibit features alien to usual probabilities, namely non Boolean structure and non positive-definite phase space probability densities. This has inspired research into both elaborate formulations of Probability Theory and alternate interpretations for wave functions. Herein the latter tactic is taken and a suggested variant interpretation of wave functions based on photo detection physics proposed, and some empirical consequences are considered. Although incomplete in a few details, this variant is appealing in its reliance on well tested concepts and technology.
How much attention is needed towards men who sell sex to men for HIV prevention in India?
Dandona, Lalit; Dandona, Rakhi; Kumar, G Anil; Gutierrez, Juan Pablo; McPherson, Sam; Bertozzi, Stefano M
2006-02-15
HIV prevention in India has mostly focussed on heterosexual transmission. Data on homosexual transmission are not readily available from India. We therefore assessed the probability of acquiring and transmitting HIV for men who sell sex to men and compared this with women who sell sex in India. Sexual behaviour characteristics of 6661 men who have sex with men and 6648 women who sell sex were obtained in the Indian state of Andhra Pradesh through confidential interviews. These, along with estimates of HIV rates among them and risk of HIV transmission per unprotected sex act from other sources, were used to calculate their annual probability of acquiring and transmitting HIV. Of 6661 men who have sex with men in this sample, 1776 (26.7%) had sold sex to men. For every 1000 men who sell sex to men, annually 146 (95% confidence interval [CI] 116-179) would acquire HIV and HIV would be transmitted to 55 (95% CI 42-71) men who do not sell sex or women. These estimates were higher by 6.7 (95% CI 4.9-9.2) times for acquiring HIV and 2.5 (95% CI 2.0-3.2) times for transmitting HIV to sex partners outside their group, as compared with similar estimates for women who sell sex. In this sample, the average annual probability of acquiring HIV was higher among men who have sex with men but do not sell sex as compared with women who sell sex. These data indicate that men who sell sex to men are at much higher risk of acquiring and transmitting HIV than women who sell sex. Therefore, men who sell sex to men and their clients warrant substantial attention for comprehensive HIV prevention in India.
Probable transfusion-transmitted Zika virus in Brazil.
Barjas-Castro, Maria L; Angerami, Rodrigo N; Cunha, Mariana S; Suzuki, Akemi; Nogueira, Juliana S; Rocco, Iray M; Maeda, Adriana Y; Vasami, Fernanda G S; Katz, Gizelda; Boin, Ilka F S F; Stucchi, Raquel S B; Resende, Mariângela R; Esposito, Danillo L A; de Souza, Renato P; da Fonseca, Benedito A; Addas-Carvalho, Marcelo
2016-07-01
Zika virus (ZIKV) is an emerging arthropod-borne flavivirus transmitted by Aedes mosquitoes. Recent commentaries regarding ZIKV routes of transmission describe a potential transmission by transfusion. Herein, we report a probable case of transfusion-transmitted ZIKV infection through a platelet transfusion that was detected from postdonation information. A blood donor made a voluntary telephone report to the blood donor facility 3 days after donation and informed the facility of a febrile illness (fever, malaise, and headaches). Due to the ongoing dengue epidemic, the initial clinical investigation included dengue among other possible diagnoses. The serology and molecular laboratory results excluded dengue infection. However, stored samples from the donation were positive for ZIKV on reverse transcription-polymerase chain reaction (RT-PCR) analysis. A retrospective investigation demonstrated that the platelet concentrate, which was part of a pool, had been transfused after a liver transplantation. A physician had evaluated the patient 4 days after surgery. Laboratory investigation showed enzyme-linked immunosorbent assay results that were negative for dengue immunoglobulin M antibodies; however, the results were positive for hemagglutination inhibition antibodies against flavivirus. ZIKV RT-PCR and virus isolation analyses in cell cultures from recipient serum were both positive. The sequencing confirmed ZIKV in the donor and patient samples. Ten partial nucleotide sequences from the ZIKV strain that were detected in the donor were aligned and compared with the ZIKV genome detected in the recipient, revealing a 99.8% homology between the two strains. This is a case of probable transmission of ZIKV through blood transfusion. The patient had been transfused with the blood product from an infected donor, most likely in the incubation period after ZIKV infection but prior to clinical disease onset. This report emphasizes the importance of postdonation information and recipient investigations during outbreaks of potentially blood-borne infections. © 2016 AABB.
Beccano-Kelly, Dayne A; Kuhlmann, Naila; Tatarnikov, Igor; Volta, Mattia; Munsie, Lise N; Chou, Patrick; Cao, Li-Ping; Han, Heather; Tapia, Lucia; Farrer, Matthew J; Milnerwood, Austen J
2014-01-01
Mutations in Leucine-Rich Repeat Kinase-2 (LRRK2) result in familial Parkinson's disease and the G2019S mutation alone accounts for up to 30% in some ethnicities. Despite this, the function of LRRK2 is largely undetermined although evidence suggests roles in phosphorylation, protein interactions, autophagy and endocytosis. Emerging reports link loss of LRRK2 to altered synaptic transmission, but the effects of the G2019S mutation upon synaptic release in mammalian neurons are unknown. To assess wild type and mutant LRRK2 in established neuronal networks, we conducted immunocytochemical, electrophysiological and biochemical characterization of >3 week old cortical cultures of LRRK2 knock-out, wild-type overexpressing and G2019S knock-in mice. Synaptic release and synapse numbers were grossly normal in LRRK2 knock-out cells, but discretely reduced glutamatergic activity and reduced synaptic protein levels were observed. Conversely, synapse density was modestly but significantly increased in wild-type LRRK2 overexpressing cultures although event frequency was not. In knock-in cultures, glutamate release was markedly elevated, in the absence of any change to synapse density, indicating that physiological levels of G2019S LRRK2 elevate probability of release. Several pre-synaptic regulatory proteins shown by others to interact with LRRK2 were expressed at normal levels in knock-in cultures; however, synapsin 1 phosphorylation was significantly reduced. Thus, perturbations to the pre-synaptic release machinery and elevated synaptic transmission are early neuronal effects of LRRK2 G2019S. Furthermore, the comparison of knock-in and overexpressing cultures suggests that one copy of the G2019S mutation has a more pronounced effect than an ~3-fold increase in LRRK2 protein. Mutant-induced increases in transmission may convey additional stressors to neuronal physiology that may eventually contribute to the pathogenesis of Parkinson's disease.
Systemic and Mucosal Differences in HIV Burden, Immune and Therapeutic Responses
Wahl, Sharon M.; Redford, Maryann; Christensen, Shawna; Mack, Wendy; Cohn, Jon; Janoff, Edward N.; Mestecky, Jiri; Jenson, Hal B.; Navazesh, Mahvash; Cohen, Mardge; Reichelderfer, Patricia; Kovacs, Andrea
2011-01-01
Background Mucosal tissues represent major targets for HIV transmission, but differ in susceptibility and reservoir function by unknown mechanisms. Methods In a cross-sectional study, HIV RNA and infectious virus were compared between oral and genital compartments and blood in HIV-infected women, in association with clinical parameters, co-pathogens and putative innate and adaptive HIV inhibitors. Results HIV RNA was detectable in 24.5% of women from all 3 compartments, whereas 45% had RNA in only one or two sites. By comparison, infectious HIV, present in blood of the majority, was rare in mucosal sites. Innate mediators, SLPI and TSP, were highest in mucosae. Highly active antiretroviral therapy (HAART) was associated with an 80% decreased probability of shedding. Multivariate logistic regression models revealed that mucosal HIV RNA was associated with higher plasma RNA, infectious virus, and total mucosal IgA, but not IgG. There was a 37-fold increased probability of detecting RNA in both genital and oral specimens (P=0.008;P=0.02, respectively) among women in highest vs lowest IgA tertiles. Conclusions Mucosal sites exhibit distinct characteristics of infectious HIV, viral shedding and responses to therapy, dependent upon both systemic and local factors. Of the putative innate and adaptive mucosal defense factors examined, only IgA was associated with HIV RNA shedding. However, rather than being protective, there was a striking increase in probability of detectable HIV RNA shedding in women with highest total IgA. PMID:21239996
Natural nanostructure and superlattice nanodomains in AgSbTe{sub 2}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carlton, Christopher E.; De Armas, Ricardo; Shao-Horn, Yang, E-mail: delaireoa@ornl.gov, E-mail: shaohorn@mit.edu
2014-04-14
AgSbTe{sub 2} has long been of interest for thermoelectric applications because of its favorable electronic properties and its low lattice thermal conductivity of ∼0.7 W/mK. In this work, we report new findings from a high-resolution transmission electron microscopy study revealing two nanostructures in single crystal Ag{sub 1−x}Sb{sub 1+x}Sb{sub 2+x} (with x = 0, 0.1, 0.2); (i) a rippled natural nanostructure with a period of ∼2.5–5 nm and (ii) superlattice ordered nanodomains consistent with cation ordering predicted in previous density functional theory studies. These nanostructures, combined with point-defects, probably serve as sources of scattering for phonons, thereby yielding a low lattice thermal conductivity over amore » wide temperature range.« less
Exciton in a spherical core/shell nanostructure: Influence of surface ligand
NASA Astrophysics Data System (ADS)
Anitha, B.; Nithiananthi, P.
2018-04-01
Studies on exciton in an inverted type I spherical GaAs/Al0.3Ga0.7As core/shell nanostructure (CSN) are made using variational method. Dielectric constant and effective mass mismatches of the core and shell materials are considered. The effect of core and the shell dimensions on the exciton binding energy (BE) are analyzed for different shell (Rs) and core radii (Rc). It is observed that with the core and the shell inducement, significant change in BE can be achieved. In addition, the influence of ligand enclosureon the BE as a function of shell thickness (ST) is reviewed. The result exhibits that the presence of ligand considerably affects the BE. Further the transmission probability of exciton for various Rc and Rs are reported. The notable changes are compared and examined with and without ligand inclusion.
Olfactory disruption: towards controlling important insect vectors of disease
USDA-ARS?s Scientific Manuscript database
Chemical repellents are used to decrease contacts between insect disease vectors and their hosts, thus reducing the probability of disease transmission. The molecular mechanisms by which repellents have their effects are poorly understood and remain a controversial topic. Here we present recent re...
Asimaki, E; Nolte, O; Overesch, G; Strahm, C
2017-08-01
Erysipelothrix rhusiopathiae is a facultative anaerobic Gram-positive rod that occurs widely in nature and is best known in veterinary medicine for causing swine erysipelas. In humans, infections are rare and mainly considered as occupationally acquired zoonosis. A case of E. rhusiopathiae bacteremia most likely associated with home freshwater aquarium handling is reported. The route of transmission was probably a cut with the dorsal fin of a dead pet fish. A short review of clinical presentations, therapeutic considerations and pitfalls of E. rhusiopathiae infections in humans is presented.
Enns, Eva Andrea; Kao, Szu-Yu; Kozhimannil, Katy Backes; Kahn, Judith; Farris, Jill; Kulasingam, Shalini L
2017-10-01
Mathematical models are important tools for assessing prevention and management strategies for sexually transmitted infections. These models are usually developed for a single infection and require calibration to observed epidemiological trends in the infection of interest. Incorporating other outcomes of sexual behavior into the model, such as pregnancy, may better inform the calibration process. We developed a mathematical model of chlamydia transmission and pregnancy in Minnesota adolescents aged 15 to 19 years. We calibrated the model to statewide rates of reported chlamydia cases alone (chlamydia calibration) and in combination with pregnancy rates (dual calibration). We evaluated the impact of calibrating to different outcomes of sexual behavior on estimated input parameter values, predicted epidemiological outcomes, and predicted impact of chlamydia prevention interventions. The two calibration scenarios produced different estimates of the probability of condom use, the probability of chlamydia transmission per sex act, the proportion of asymptomatic infections, and the screening rate among men. These differences resulted in the dual calibration scenario predicting lower prevalence and incidence of chlamydia compared with calibrating to chlamydia cases alone. When evaluating the impact of a 10% increase in condom use, the dual calibration scenario predicted fewer infections averted over 5 years compared with chlamydia calibration alone [111 (6.8%) vs 158 (8.5%)]. While pregnancy and chlamydia in adolescents are often considered separately, both are outcomes of unprotected sexual activity. Incorporating both as calibration targets in a model of chlamydia transmission resulted in different parameter estimates, potentially impacting the intervention effectiveness predicted by the model.
Drancourt, M; Raoult, D
2016-11-01
Plague, a deadly zoonose caused by the bacterium Yersinia pestis, has been firmly documented in 39 historical burial sites in Eurasia that date from the Bronze Age to two historical pandemics spanning the 6th to 18th centuries. Palaeomicrobiologic data, including gene and spacer sequences, whole genome sequences and protein data, confirmed that two historical pandemics swept over Europe from probable Asian sources and possible two-way-ticket journeys back from Europe to Asia. These investigations made it possible to address questions regarding the potential sources and routes of transmission by completing the standard rodent and rodent-flea transmission scheme. This suggested that plague was transmissible by human ectoparasites such as lice, and that Y. pestis was able to persist for months in the soil, which is a source of reinfection for burrowing mammals. The analyses of seven complete genome sequences from the Bronze Age indicated that Y. pestis was probably not an ectoparasite-borne pathogen in these populations. Further analyses of 14 genomes indicated that the Justinian pandemic strains may have formed a clade distinct from the one responsible for the second pandemic, spanning in Y. pestis branch 1, which also comprises the third pandemic strains. Further palaeomicrobiologic studies must tightly connect with historical and anthropologic studies to resolve questions regarding the actual sources of plague in ancient populations, alternative routes of transmission and resistance traits. Answering these questions will broaden our understanding of plague epidemiology so we may better face the actuality of this deadly infection in countries where it remains epidemic. Copyright © 2016. Published by Elsevier Ltd.
NASA Astrophysics Data System (ADS)
Proklov, V. V.; Rezvov, Yu. G.
2018-01-01
An analytical solution for the transmission function of noncoherent wideband radiation is obtained under acousto-optic (AO) filtering using a discrete set of monochromatic AO waves with a small spectral overlap. We studied characteristics of the AO transformation of a continuous spectrum of noncoherent radiation into a given set of discrete narrow bands of spectral transmission by excitation of a discrete set of sound frequencies. We carried out the analysis of transmission functions of individual channels taking into account a partial overlap of their spectra and possible intermodulation distortions. It is shown that a stationary value of the root-mean-square light power is found at the electronic output due to the photoelectric transformation and detecting diffracted light. Based on this, a necessary stationary, multiband, and nearly equidistant transmission function of a device can be formed by using a relevant spectrum of acoustic excitation. Peculiarities of this way of forming the multiband transmission function are revealed: the limitation of diffraction efficiency for an individual channel, the possibility of decoupling side lobes of adjacent channels, etc. A multiband acousto-optic filter (MAOF) was simulated that was based on a paratellurite monocrystal (TeO2), which was previously used for experimental optical encoding. The theoretical and experimental results are in gratifying agreement.
Uncertainty plus Prior Equals Rational Bias: An Intuitive Bayesian Probability Weighting Function
ERIC Educational Resources Information Center
Fennell, John; Baddeley, Roland
2012-01-01
Empirical research has shown that when making choices based on probabilistic options, people behave as if they overestimate small probabilities, underestimate large probabilities, and treat positive and negative outcomes differently. These distortions have been modeled using a nonlinear probability weighting function, which is found in several…
A study of the vacancy loop formation probability in Ni-Cu and Ag-Pd alloys. [50-keV Kr sup + ions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smalinskas, K.; Chen, Gengsheng; Haworth, J.
1992-04-01
The molten-zone model of vacancy loop formation from a displacement cascade predicts that the loop formation probability should scale with the melting temperature. To investigate this possibility the vacancy loop formation probability has been determined in a series of Cu-Ni and Ag-Pd alloys. The irradiations were performed at room temperature with 50 keV Kr+ ions and the resulting damage structure was examined by using transmission electron microscopy. In the Cu-Ni alloy series, the change in loop formation probability with increasing Ni concentration was complex, and at low- and high- nickel concentrations, the defect yield did not change in the predictedmore » manner. The defect yield was higher in the Cu-rich alloys than in the Ni-rich alloys. In the Ag-Pd alloy the change in the loop formation probability followed more closely the change in melting temperature, but no simple relationship was determined.« less
NASA Astrophysics Data System (ADS)
Yan, Wang-Ji; Ren, Wei-Xin
2018-01-01
This study applies the theoretical findings of circularly-symmetric complex normal ratio distribution Yan and Ren (2016) [1,2] to transmissibility-based modal analysis from a statistical viewpoint. A probabilistic model of transmissibility function in the vicinity of the resonant frequency is formulated in modal domain, while some insightful comments are offered. It theoretically reveals that the statistics of transmissibility function around the resonant frequency is solely dependent on 'noise-to-signal' ratio and mode shapes. As a sequel to the development of the probabilistic model of transmissibility function in modal domain, this study poses the process of modal identification in the context of Bayesian framework by borrowing a novel paradigm. Implementation issues unique to the proposed approach are resolved by Lagrange multiplier approach. Also, this study explores the possibility of applying Bayesian analysis in distinguishing harmonic components and structural ones. The approaches are verified through simulated data and experimentally testing data. The uncertainty behavior due to variation of different factors is also discussed in detail.
Liu, Yang; Han, Guangjie; Shi, Sulong; Li, Zhengquan
2018-06-20
This study investigates the superiority of cooperative broadcast transmission over traditional orthogonal schemes when applied in a downlink relaying broadcast channel (RBC). Two proposed cooperative broadcast transmission protocols, one with an amplify-and-forward (AF) relay, and the other with a repetition-based decode-and-forward (DF) relay, are investigated. By utilizing superposition coding (SupC), the source and the relay transmit the private user messages simultaneously instead of sequentially as in traditional orthogonal schemes, which means the channel resources are reused and an increased channel degree of freedom is available to each user, hence the half-duplex penalty of relaying is alleviated. To facilitate a performance evaluation, theoretical outage probability expressions of the two broadcast transmission schemes are developed, based on which, we investigate the minimum total power consumption of each scheme for a given traffic requirement by numerical simulation. The results provide details on the overall system performance and fruitful insights on the essential characteristics of cooperative broadcast transmission in RBCs. It is observed that better overall outage performances and considerable power gains can be obtained by utilizing cooperative broadcast transmissions compared to traditional orthogonal schemes.
The trophic vacuum and the evolution of complex life cycles in trophically transmitted helminths
Benesh, Daniel P.; Chubb, James C.; Parker, Geoff A.
2014-01-01
Parasitic worms (helminths) frequently have complex life cycles in which they are transmitted trophically between two or more successive hosts. Sexual reproduction often takes place in high trophic-level (TL) vertebrates, where parasites can grow to large sizes with high fecundity. Direct infection of high TL hosts, while advantageous, may be unachievable for parasites constrained to transmit trophically, because helminth propagules are unlikely to be ingested by large predators. Lack of niche overlap between propagule and definitive host (the trophic transmission vacuum) may explain the origin and/or maintenance of intermediate hosts, which overcome this transmission barrier. We show that nematodes infecting high TL definitive hosts tend to have more successive hosts in their life cycles. This relationship was modest, though, driven mainly by the minimum TL of hosts, suggesting that the shortest trophic chains leading to a host define the boundaries of the transmission vacuum. We also show that alternative modes of transmission, like host penetration, allow nematodes to reach high TLs without intermediate hosts. We suggest that widespread omnivory as well as parasite adaptations to increase transmission probably reduce, but do not eliminate, the barriers to the transmission of helminths through the food web. PMID:25209937
The random coding bound is tight for the average code.
NASA Technical Reports Server (NTRS)
Gallager, R. G.
1973-01-01
The random coding bound of information theory provides a well-known upper bound to the probability of decoding error for the best code of a given rate and block length. The bound is constructed by upperbounding the average error probability over an ensemble of codes. The bound is known to give the correct exponential dependence of error probability on block length for transmission rates above the critical rate, but it gives an incorrect exponential dependence at rates below a second lower critical rate. Here we derive an asymptotic expression for the average error probability over the ensemble of codes used in the random coding bound. The result shows that the weakness of the random coding bound at rates below the second critical rate is due not to upperbounding the ensemble average, but rather to the fact that the best codes are much better than the average at low rates.
Epidemiology and Diagnosis of Helicobacter pylori infection.
Mentis, Andreas; Lehours, Philippe; Mégraud, Francis
2015-09-01
During the period reviewed, prevalence studies were essentially performed in less economically advanced countries and a high prevalence was found. The traditional risk factors for Helicobacter pylori positivity were mostly found. Transmission studied by molecular typing showed a familial transmission. The eventual role of water transmission was explored in several studies with controversial results. Concerning diagnosis, most of the invasive and noninvasive methods used for the diagnosis of H. pylori infection are long standing with efficient performance. The most interesting recent improvements in H. pylori diagnosis include advances in endoscopy, developments in molecular methods, and the introduction of omics-based techniques. Interpretation of old or newer method should take into account the pretest probability and the prevalence of H. pylori in the population under investigation. © 2015 John Wiley & Sons Ltd.
Grain neighbour effects on twin transmission in hexagonal close-packed materials
NASA Astrophysics Data System (ADS)
Arul Kumar, M.; Beyerlein, I. J.; McCabe, R. J.; Tomé, C. N.
2016-12-01
Materials with a hexagonal close-packed (hcp) crystal structure such as Mg, Ti and Zr are being used in the transportation, aerospace and nuclear industry, respectively. Material strength and formability are critical qualities for shaping these materials into parts and a pervasive deformation mechanism that significantly affects their formability is deformation twinning. The interaction between grain boundaries and twins has an important influence on the deformation behaviour and fracture of hcp metals. Here, statistical analysis of large data sets reveals that whether twins transmit across grain boundaries depends not only on crystallography but also strongly on the anisotropy in crystallographic slip. We show that increases in crystal plastic anisotropy enhance the probability of twin transmission by comparing the relative ease of twin transmission in hcp materials such as Mg, Zr and Ti.
Grain neighbour effects on twin transmission in hexagonal close-packed materials.
Arul Kumar, M; Beyerlein, I J; McCabe, R J; Tomé, C N
2016-12-19
Materials with a hexagonal close-packed (hcp) crystal structure such as Mg, Ti and Zr are being used in the transportation, aerospace and nuclear industry, respectively. Material strength and formability are critical qualities for shaping these materials into parts and a pervasive deformation mechanism that significantly affects their formability is deformation twinning. The interaction between grain boundaries and twins has an important influence on the deformation behaviour and fracture of hcp metals. Here, statistical analysis of large data sets reveals that whether twins transmit across grain boundaries depends not only on crystallography but also strongly on the anisotropy in crystallographic slip. We show that increases in crystal plastic anisotropy enhance the probability of twin transmission by comparing the relative ease of twin transmission in hcp materials such as Mg, Zr and Ti.
Two small ncRNAs jointly govern virulence and transmission in Legionella pneumophila
Sahr, Tobias; Brüggemann, Holger; Jules, Matthieu; Lomma, Mariella; Albert-Weissenberger, Christiane; Cazalet, Christel; Buchrieser, Carmen
2009-01-01
Summary To transit from intra- to extracellular environments, L. pneumophila differentiates from a replicative/non-virulent to a transmissive/virulent form using the two-component system LetA/LetS and the global repressor protein CsrA. While investigating how both regulators act coordinately we characterized two ncRNAs, RsmY and RsmZ that link the LetA/LetS and CsrA regulatory networks. We demonstrate that LetA directly regulates their expression and show that RsmY and RsmZ are functional in E. coli and are able to bind CsrA in vitro. Single mutants have no (ΔrsmY) or a little (ΔrsmZ) impact on virulence, but the ΔrsmYZ strain shows a drastic defect in intracellular growth in Acanthamoeba castellanii and THP-1 monocyte-derived macrophages. Analysis of the transcriptional programs of the ΔletA, ΔletS and ΔrsmYZ strains revealed that the switch to the transmissive phase is partially blocked. One major difference between the ΔletA, ΔletS and ΔrsmYZ strains was that the latter synthesizes flagella. Taken together, LetA activates transcription of RsmY and RsmZ, which sequester CsrA and abolish its post-transcriptional repressive activity. However, the RsmYZ-CsrA pathway appears not to be the main or only regulatory circuit governing flagella synthesis. We suggest that rather RpoS and LetA, by influencing LetE and probably cyclic-di-GMP levels, regulate motility in L. pneumophila. PMID:19400772
Hornbeck, Thomas; Naylor, David; Segre, Alberto M; Thomas, Geb; Herman, Ted; Polgreen, Philip M
2012-11-15
Super-spreading events, in which an individual with measurably high connectivity is responsible for infecting a large number of people, have been observed. Our goal is to determine the impact of hand hygiene noncompliance among peripatetic (eg, highly mobile or highly connected) healthcare workers compared with less-connected workers. We used a mote-based sensor network to record contacts among healthcare workers and patients in a 20-bed intensive care unit. The data collected from this network form the basis for an agent-based simulation to model the spread of nosocomial pathogens with various transmission probabilities. We identified the most- and least-connected healthcare workers. We then compared the effects of hand hygiene noncompliance as a function of connectedness. The data confirm the presence of peripatetic healthcare workers. Also, agent-based simulations using our real contact network data confirm that the average number of infected patients was significantly higher when the most connected healthcare worker did not practice hand hygiene and significantly lower when the least connected healthcare workers were noncompliant. Heterogeneity in healthcare worker contact patterns dramatically affects disease diffusion. Our findings should inform future infection control interventions and encourage the application of social network analysis to study disease transmission in healthcare settings.
The influence of the uplink noise on the performance of satellite data transmission systems
NASA Astrophysics Data System (ADS)
Dewal, Vrinda P.
The problem of transmission of binary phase shift keying (BPSK) modulated digital data through a bandlimited nonlinear satellite channel in the presence of uplink, downlink Gaussian noise and intersymbol interface is examined. The satellite transponder is represented by a zero memory bandpass nonlinearity, with AM/AM conversion. The proposed optimum linear receiver structure consists of tapped-delay lines followed by a decision device. The linear receiver is designed to minimize the mean square error that is a function of the intersymbol interface, the uplink and the downlink noise. The minimum mean square error equalizer (MMSE) is derived using the Wiener-Kolmogorov theory. In this receiver, the decision about the transmitted signal is made by taking into account the received sequence of present sample, and the interfering past and future samples, which represent the intersymbol interference (ISI). Illustrative examples of the receiver structures are considered for the nonlinear channels with a symmetrical and asymmetrical frequency responses of the transmitter filter. The transponder nonlinearity is simulated by a polynomial using only the first and the third orders terms. A computer simulation determines the tap gain coefficients of the MMSE equalizer that adapt to the various uplink and downlink noise levels. The performance of the MMSE equalizer is evaluated in terms of an estimate of the average probability of error.
Chang, Yin-Jung
2014-11-17
Transverse-electric (TE) resonant optical tunneling through an asymmetric, single-barrier potential system consisting of all passive materials in two-dimensional (2-D) glass/silver/TiO₂/air configuration is quantified at a silver thickness of 35 nm. Resonant tunneling occurs when the incident condition corresponds to the excitation of a radiation mode. Lasing-like transmission occurring at resonance is carefully qualified in terms of power conservation, resonance condition, and identification of the gain medium equivalent. In particular, effective gain (geff) and threshold gain (gth) coefficients, both of which are strong functions of the forward reflection coefficient at the silver-TiO₂ interface, are analytically obtained and the angular span over which geff > gth is further verified rigorously electromagnetically. The results show that the present configuration may be treated as a cascade of the gain equivalent (i.e. the silver film) and the TiO₂resonator that is of Fabry-Perot type, giving rise to negative gth when resonant tunneling occurs. The transmittance spectrum exhibiting a gain-curve-like envelope is shown to be a direct consequence of the competition of the resonator loss at the silver-TiO₂interface and the forward tunneling probability through the silver barrier, all controlled by the effective silver barrier thickness.
Pangloss revisited: a critique of the dilution effect and the biodiversity-buffers-disease paradigm.
Randolph, S E; Dobson, A D M
2012-06-01
The twin concepts of zooprophylaxis and the dilution effect originated with vector-borne diseases (malaria), were driven forward by studies on Lyme borreliosis and have now developed into the mantra "biodiversity protects against disease". The basic idea is that by diluting the assemblage of transmission-competent hosts with non-competent hosts, the probability of vectors feeding on transmission-competent hosts is reduced and so the abundance of infected vectors is lowered. The same principle has recently been applied to other infectious disease systems--tick-borne, insect-borne, indirectly transmitted via intermediate hosts, directly transmitted. It is claimed that the presence of extra species of various sorts, acting through a variety of distinct mechanisms, causes the prevalence of infectious agents to decrease. Examination of the theoretical and empirical evidence for this hypothesis reveals that it applies only in certain circumstances even amongst tick-borne diseases, and even less often if considering the correct metric--abundance rather than prevalence of infected vectors. Whether dilution or amplification occurs depends more on specific community composition than on biodiversity per se. We warn against raising a straw man, an untenable argument easily dismantled and dismissed. The intrinsic value of protecting biodiversity and ecosystem function outweighs this questionable utilitarian justification.
Detection of cryogenic water ice contaminants and the IR AI&T environment
NASA Astrophysics Data System (ADS)
Lynch, David K.; Russell, Ray W.
2000-12-01
Several remote sensing/infrared space surveillance programs in the midst of assembly, integration and test have recently experienced delays when water vapor was deposited as ice on cold surfaces in a sensor under test or calibration. When these surfaces were at critical locations, the sensitivity or response of the sensor decreased significantly because the ice absorbed the incoming signal. The source of water vapor could be from a chamber leak or outgassing from the sensor system or the vacuum chamber itself. In order to quantify the effects of ice deposits on signals in various spectral bands, published optical constants for amorphous and crystalline water ice have been used to calculate the transmission of water ice films as a function of wavelength from 1 to 20 microns. The results are presented in two ways: spectra of the physical thickness of a layer of ice whose absorption optical depth is unity, and transmission spectra for several characteristic layer thicknesses. These tools can be used in estimating the amount of ice - and by inference water vapor - present in the system. Related calculations can also be used to assess the probability that a given hardware setup or resulting data set is showing signs of degradation of response due to ice absorption, and the implications for those trying to interpret the results.
NASA Astrophysics Data System (ADS)
Halloran, Siobhan; Ristenpart, William
2013-11-01
Virologists and other researchers who test pathogens for airborne disease transmissibility often place a test animal downstream from an inoculated animal and later determine whether the test animal became infected. Despite the crucial role of the airflow in pathogen transmission between the animals, to date the infectious disease community has paid little attention to the effect of airspeed or turbulent intensity on the probability of transmission. Here we present measurements of the turbulent dispersivity under conditions relevant to experimental tests of airborne disease transmissibility between laboratory animals. We used time lapse photography to visualize the downstream transport and turbulent dispersion of smoke particulates released from a point source downstream of an axial fan, thus mimicking the release and transport of expiratory aerosols exhaled by an inoculated animal. We show that for fan-generated turbulence the plume width is invariant with the mean airspeed and, close to the point source, increases linearly with downstream position. Importantly, the turbulent dispersivity is insensitive to the presence of meshes placed downstream from the point source, indicating that the fan length scale dictates the turbulent intensity and corresponding dispersivity.
Abrahams, M.-R.; Anderson, J. A.; Giorgi, E. E.; Seoighe, C.; Mlisana, K.; Ping, L.-H.; Athreya, G. S.; Treurnicht, F. K.; Keele, B. F.; Wood, N.; Salazar-Gonzalez, J. F.; Bhattacharya, T.; Chu, H.; Hoffman, I.; Galvin, S.; Mapanje, C.; Kazembe, P.; Thebus, R.; Fiscus, S.; Hide, W.; Cohen, M. S.; Karim, S. Abdool; Haynes, B. F.; Shaw, G. M.; Hahn, B. H.; Korber, B. T.; Swanstrom, R.; Williamson, C.
2009-01-01
Identifying the specific genetic characteristics of successfully transmitted variants may prove central to the development of effective vaccine and microbicide interventions. Although human immunodeficiency virus transmission is associated with a population bottleneck, the extent to which different factors influence the diversity of transmitted viruses is unclear. We estimate here the number of transmitted variants in 69 heterosexual men and women with primary subtype C infections. From 1,505 env sequences obtained using a single genome amplification approach we show that 78% of infections involved single variant transmission and 22% involved multiple variant transmissions (median of 3). We found evidence for mutations selected for cytotoxic-T-lymphocyte or antibody escape and a high prevalence of recombination in individuals infected with multiple variants representing another potential escape pathway in these individuals. In a combined analysis of 171 subtype B and C transmission events, we found that infection with more than one variant does not follow a Poisson distribution, indicating that transmission of individual virions cannot be seen as independent events, each occurring with low probability. While most transmissions resulted from a single infectious unit, multiple variant transmissions represent a significant fraction of transmission events, suggesting that there may be important mechanistic differences between these groups that are not yet understood. PMID:19193811
Path probability of stochastic motion: A functional approach
NASA Astrophysics Data System (ADS)
Hattori, Masayuki; Abe, Sumiyoshi
2016-06-01
The path probability of a particle undergoing stochastic motion is studied by the use of functional technique, and the general formula is derived for the path probability distribution functional. The probability of finding paths inside a tube/band, the center of which is stipulated by a given path, is analytically evaluated in a way analogous to continuous measurements in quantum mechanics. Then, the formalism developed here is applied to the stochastic dynamics of stock price in finance.
Efficiency analysis of a multiple axle vehicle with hydrostatic transmission overcoming obstacles
NASA Astrophysics Data System (ADS)
Comellas, M.; Pijuan, J.; Nogués, M.; Roca, J.
2018-01-01
Transmission configurations in off-road vehicles with multiple driven axles can be a determining factor in the obstacle surmounting capacity and also in the vehicle efficiency. An off-road articulated vehicle with four driven axles, four bogies and two modules has been considered for the global hydrostatic transmission efficiency analysis and for the vehicle functional efficiency analysis. The power flow through the transmission system has been quantified from the combustion engine shaft to each axle of the wheels. It has been done for different the operating conditions and taking into account the wheel-terrain interaction and the transmission configuration, that could lead to a forced slippage of some of the wheels. Results show the influence of the different wheels' requirements, the transmission configuration limitations and the considered control strategy on the global transmission and vehicle functional efficiencies.
Capsid functions of inactivated human picornaviruses and feline calicivirus.
Nuanualsuwan, Suphachai; Cliver, Dean O
2003-01-01
The exceptional stability of enteric viruses probably resides in their capsids. The capsid functions of inactivated human picornaviruses and feline calicivirus (FCV) were determined. Viruses were inactivated by UV, hypochlorite, high temperature (72 degrees C), and physiological temperature (37 degrees C), all of which are pertinent to transmission via food and water. Poliovirus (PV) and hepatitis A virus (HAV) are transmissible via water and food, and FCV is the best available surrogate for the Norwalk-like viruses, which are leading causes of food-borne and waterborne disease in the United States. The capsids of all 37 degrees C-inactivated viruses still protected the viral RNA against RNase, even in the presence of proteinase K, which contrasted with findings with viruses inactivated at 72 degrees C. The loss of ability of the virus to attach to homologous cell receptors was universal, regardless of virus type and inactivation method, except for UV-inactivated HAV, and so virus inactivation was almost always accompanied by the loss of virus attachment. Inactivated HAV and FCV were captured by homologous antibodies. However, inactivated PV type 1 (PV-1) was not captured by homologous antibody and 37 degrees C-inactivated PV-1 was only partially captured. The epitopes on the capsids of HAV and FCV are evidently discrete from the receptor attachment sites, unlike those of PV-1. These findings indicate that the primary target of UV, hypochlorite, and 72 degrees C inactivation is the capsid and that the target of thermal inactivation (37 degrees C versus 72 degrees C) is temperature dependent.
Wang, Tao; Guan, Rui-Li; Liu, Ming-Chao; Shen, Xue-Feng; Chen, Jing Yuan; Zhao, Ming-Gao; Luo, Wen-Jing
2016-08-01
Lead (Pb) is an environmental neurotoxic metal. Pb exposure may cause neurobehavioral changes, such as learning and memory impairment, and adolescence violence among children. Previous animal models have largely focused on the effects of Pb exposure during early development (from gestation to lactation period) on neurobehavior. In this study, we exposed Sprague-Dawley rats during the juvenile stage (from juvenile period to adult period). We investigated the synaptic function and structural changes and the relationship of these changes to neurobehavioral deficits in adult rats. Our results showed that juvenile Pb exposure caused fear-conditioned memory impairment and anxiety-like behavior, but locomotion and pain behavior were indistinguishable from the controls. Electrophysiological studies showed that long-term potentiation induction was affected in Pb-exposed rats, and this was probably due to excitatory synaptic transmission impairment in Pb-exposed rats. We found that NMDA and AMPA receptor-mediated current was inhibited, whereas the GABA synaptic transmission was normal in Pb-exposed rats. NR2A and phosphorylated GluR1 expression decreased. Moreover, morphological studies showed that density of dendritic spines declined by about 20 % in the Pb-treated group. The spine showed an immature form in Pb-exposed rats, as indicated by spine size measurements. However, the length and arborization of dendrites were unchanged. Our results suggested that juvenile Pb exposure in rats is associated with alterations in the glutamate receptor, which caused synaptic functional and morphological changes in hippocampal CA1 pyramidal neurons, thereby leading to behavioral changes.
Pourghassem, Hossein
2012-01-01
Material detection is a vital need in dual energy X-ray luggage inspection systems at security of airport and strategic places. In this paper, a novel material detection algorithm based on statistical trainable models using 2-Dimensional power density function (PDF) of three material categories in dual energy X-ray images is proposed. In this algorithm, the PDF of each material category as a statistical model is estimated from transmission measurement values of low and high energy X-ray images by Gaussian Mixture Models (GMM). Material label of each pixel of object is determined based on dependency probability of its transmission measurement values in the low and high energy to PDF of three material categories (metallic, organic and mixed materials). The performance of material detection algorithm is improved by a maximum voting scheme in a neighborhood of image as a post-processing stage. Using two background removing and denoising stages, high and low energy X-ray images are enhanced as a pre-processing procedure. For improving the discrimination capability of the proposed material detection algorithm, the details of the low and high energy X-ray images are added to constructed color image which includes three colors (orange, blue and green) for representing the organic, metallic and mixed materials. The proposed algorithm is evaluated on real images that had been captured from a commercial dual energy X-ray luggage inspection system. The obtained results show that the proposed algorithm is effective and operative in detection of the metallic, organic and mixed materials with acceptable accuracy.
NASA Astrophysics Data System (ADS)
Hwang, Eunju; Kim, Kyung Jae; Roijers, Frank; Choi, Bong Dae
In the centralized polling mode in IEEE 802.16e, a base station (BS) polls mobile stations (MSs) for bandwidth reservation in one of three polling modes; unicast, multicast, or broadcast pollings. In unicast polling, the BS polls each individual MS to allow to transmit a bandwidth request packet. This paper presents an analytical model for the unicast polling of bandwidth request in IEEE 802.16e networks over Gilbert-Elliot error channel. We derive the probability distribution for the delay of bandwidth requests due to wireless transmission errors and find the loss probability of request packets due to finite retransmission attempts. By using the delay distribution and the loss probability, we optimize the number of polling slots within a frame and the maximum retransmission number while satisfying QoS on the total loss probability which combines two losses: packet loss due to the excess of maximum retransmission and delay outage loss due to the maximum tolerable delay bound. In addition, we obtain the utilization of polling slots, which is defined as the ratio of the number of polling slots used for the MS's successful transmission to the total number of polling slots used by the MS over a long run time. Analysis results are shown to well match with simulation results. Numerical results give examples of the optimal number of polling slots within a frame and the optimal maximum retransmission number depending on delay bounds, the number of MSs, and the channel conditions.
Speech processing using conditional observable maximum likelihood continuity mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hogden, John; Nix, David
A computer implemented method enables the recognition of speech and speech characteristics. Parameters are initialized of first probability density functions that map between the symbols in the vocabulary of one or more sequences of speech codes that represent speech sounds and a continuity map. Parameters are also initialized of second probability density functions that map between the elements in the vocabulary of one or more desired sequences of speech transcription symbols and the continuity map. The parameters of the probability density functions are then trained to maximize the probabilities of the desired sequences of speech-transcription symbols. A new sequence ofmore » speech codes is then input to the continuity map having the trained first and second probability function parameters. A smooth path is identified on the continuity map that has the maximum probability for the new sequence of speech codes. The probability of each speech transcription symbol for each input speech code can then be output.« less
Economic Choices Reveal Probability Distortion in Macaque Monkeys
Lak, Armin; Bossaerts, Peter; Schultz, Wolfram
2015-01-01
Economic choices are largely determined by two principal elements, reward value (utility) and probability. Although nonlinear utility functions have been acknowledged for centuries, nonlinear probability weighting (probability distortion) was only recently recognized as a ubiquitous aspect of real-world choice behavior. Even when outcome probabilities are known and acknowledged, human decision makers often overweight low probability outcomes and underweight high probability outcomes. Whereas recent studies measured utility functions and their corresponding neural correlates in monkeys, it is not known whether monkeys distort probability in a manner similar to humans. Therefore, we investigated economic choices in macaque monkeys for evidence of probability distortion. We trained two monkeys to predict reward from probabilistic gambles with constant outcome values (0.5 ml or nothing). The probability of winning was conveyed using explicit visual cues (sector stimuli). Choices between the gambles revealed that the monkeys used the explicit probability information to make meaningful decisions. Using these cues, we measured probability distortion from choices between the gambles and safe rewards. Parametric modeling of the choices revealed classic probability weighting functions with inverted-S shape. Therefore, the animals overweighted low probability rewards and underweighted high probability rewards. Empirical investigation of the behavior verified that the choices were best explained by a combination of nonlinear value and nonlinear probability distortion. Together, these results suggest that probability distortion may reflect evolutionarily preserved neuronal processing. PMID:25698750
Economic choices reveal probability distortion in macaque monkeys.
Stauffer, William R; Lak, Armin; Bossaerts, Peter; Schultz, Wolfram
2015-02-18
Economic choices are largely determined by two principal elements, reward value (utility) and probability. Although nonlinear utility functions have been acknowledged for centuries, nonlinear probability weighting (probability distortion) was only recently recognized as a ubiquitous aspect of real-world choice behavior. Even when outcome probabilities are known and acknowledged, human decision makers often overweight low probability outcomes and underweight high probability outcomes. Whereas recent studies measured utility functions and their corresponding neural correlates in monkeys, it is not known whether monkeys distort probability in a manner similar to humans. Therefore, we investigated economic choices in macaque monkeys for evidence of probability distortion. We trained two monkeys to predict reward from probabilistic gambles with constant outcome values (0.5 ml or nothing). The probability of winning was conveyed using explicit visual cues (sector stimuli). Choices between the gambles revealed that the monkeys used the explicit probability information to make meaningful decisions. Using these cues, we measured probability distortion from choices between the gambles and safe rewards. Parametric modeling of the choices revealed classic probability weighting functions with inverted-S shape. Therefore, the animals overweighted low probability rewards and underweighted high probability rewards. Empirical investigation of the behavior verified that the choices were best explained by a combination of nonlinear value and nonlinear probability distortion. Together, these results suggest that probability distortion may reflect evolutionarily preserved neuronal processing. Copyright © 2015 Stauffer et al.
Secondary electron imaging of monolayer materials inside a transmission electron microscope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cretu, Ovidiu, E-mail: cretu.ovidiu@nims.go.jp; Lin, Yung-Chang; Suenaga, Kazutomo
2015-08-10
A scanning transmission electron microscope equipped with a backscattered and secondary electron detector is shown capable to image graphene and hexagonal boron nitride monolayers. Secondary electron contrasts of the two lightest monolayer materials are clearly distinguished from the vacuum level. A signal difference between these two materials is attributed to electronic structure differences, which will influence the escape probabilities of the secondary electrons. Our results show that the secondary electron signal can be used to distinguish between the electronic structures of materials with atomic layer sensitivity, enhancing its applicability as a complementary signal in the analytical microscope.
Time evolution of predictability of epidemics on networks.
Holme, Petter; Takaguchi, Taro
2015-04-01
Epidemic outbreaks of new pathogens, or known pathogens in new populations, cause a great deal of fear because they are hard to predict. For theoretical models of disease spreading, on the other hand, quantities characterizing the outbreak converge to deterministic functions of time. Our goal in this paper is to shed some light on this apparent discrepancy. We measure the diversity of (and, thus, the predictability of) outbreak sizes and extinction times as functions of time given different scenarios of the amount of information available. Under the assumption of perfect information-i.e., knowing the state of each individual with respect to the disease-the predictability decreases exponentially, or faster, with time. The decay is slowest for intermediate values of the per-contact transmission probability. With a weaker assumption on the information available, assuming that we know only the fraction of currently infectious, recovered, or susceptible individuals, the predictability also decreases exponentially most of the time. There are, however, some peculiar regions in this scenario where the predictability decreases. In other words, to predict its final size with a given accuracy, we would need increasingly more information about the outbreak.
Modelling relativistic effects in momentum-resolved electron energy loss spectroscopy of graphene
NASA Astrophysics Data System (ADS)
Lyon, K.; Mowbray, D. J.; Miskovic, Z. L.
2018-02-01
We present an analytical model for the electron energy loss through a two-dimensional (2D) layer of graphene, fully taking into account relativistic effects. Using two different models for graphene's 2D conductivity, one a two-fluid hydrodynamic model with an added correction to account for the inter-band electron transitions near the Dirac point in undoped graphene, the other derived from ab initio plane-wave time-dependent density functional theory in the frequency domain (PW-TDDFT-ω) calculations applied on a graphene superlattice, we derive various different expressions for the probability density of energy and momentum transfer from the incident electron to graphene. To further compare with electron energy loss spectroscopy (EELS) experiments that use setups like scanning Transmission Electron Microscopy, we integrated our energy loss functions over a range of wavenumbers, and compared how the choice of range directly affects the shape, position, and relative heights of graphene's π → π* and σ → σ* transition peaks. Comparisons were made with experimental EELS data under different model inputs, revealing again the strong effect that the choice of wavenumber range has on the energy loss.
Time evolution of predictability of epidemics on networks
NASA Astrophysics Data System (ADS)
Holme, Petter; Takaguchi, Taro
2015-04-01
Epidemic outbreaks of new pathogens, or known pathogens in new populations, cause a great deal of fear because they are hard to predict. For theoretical models of disease spreading, on the other hand, quantities characterizing the outbreak converge to deterministic functions of time. Our goal in this paper is to shed some light on this apparent discrepancy. We measure the diversity of (and, thus, the predictability of) outbreak sizes and extinction times as functions of time given different scenarios of the amount of information available. Under the assumption of perfect information—i.e., knowing the state of each individual with respect to the disease—the predictability decreases exponentially, or faster, with time. The decay is slowest for intermediate values of the per-contact transmission probability. With a weaker assumption on the information available, assuming that we know only the fraction of currently infectious, recovered, or susceptible individuals, the predictability also decreases exponentially most of the time. There are, however, some peculiar regions in this scenario where the predictability decreases. In other words, to predict its final size with a given accuracy, we would need increasingly more information about the outbreak.
Albert, Jan; Berglund, Torsten; Gisslén, Magnus; Gröön, Peter; Sönnerborg, Anders; Tegnell, Anders; Alexandersson, Anders; Berggren, Ingela; Blaxhult, Anders; Brytting, Maria; Carlander, Christina; Carlson, Johan; Flamholc, Leo; Follin, Per; Haggar, Axana; Hansdotter, Frida; Josephson, Filip; Karlström, Olle; Liljeros, Fredrik; Navér, Lars; Pettersson, Karin; Johansson, Veronica Svedhem; Svennerholm, Bo; Tunbäck, Petra; Widgren, Katarina
2014-10-01
The modern medical treatment of HIV with antiretroviral therapy (ART) has drastically reduced the morbidity and mortality in patients infected with this virus. ART has also been shown to reduce the transmission risk from individual patients as well as the spread of the infection at the population level. This position statement from the Public Health Agency of Sweden and the Swedish Reference Group for Antiviral Therapy is based on a workshop organized in the fall of 2012. It summarizes the latest research and knowledge on the risk of HIV transmission from patients on ART, with a focus on the risk of sexual transmission. The risk of transmission via shared injection equipment among intravenous drug users is also examined, as is the risk of mother-to-child transmission. Based on current knowledge, the risk of transmission through vaginal or anal intercourse involving the use of a condom has been judged to be minimal, provided that the person infected with HIV fulfils the criteria for effective ART. This probably also applies to unprotected intercourse, provided that no other sexually transmitted infections are present, although it is not currently possible to fully support this conclusion with direct scientific evidence. ART is judged to markedly reduce the risk of blood-borne transmission between people who share injection equipment. Finally, the risk of transmission from mother to child is very low, provided that ART is started well in advance of delivery.
On a Class of Hairy Square Barriers and Gamow Vectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernandez-Garcia, N.
The second order Darboux-Gamow transformation is applied to deform square one dimensional barriers in non-relativistic quantum mechanics. The initial and the new 'hairy' potentials have the same transmission probabilities (for the appropriate parameters). In general, new Gamow vectors are constructed as Darboux deformations of the initial ones.
AUTOMOTIVE DIESEL MAINTENANCE 2. UNIT XXII, MICHIGAN/CLARK TRANSMISSION--CONVERTER/TRANSMISSION.
ERIC Educational Resources Information Center
Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.
THIS MODULE OF A 25-MODULE COURSE IS DESIGNED TO DEVELOP A DETAILED UNDERSTANDING OF A SPECIFIC POWER CONVERTER AND TRANSMISSION USED ON DIESEL POWERED EQUIPMENT. TOPICS ARE A CLOSER LOOK AT THE CONVERTER, CONVERTER ASSEMBLY AND INSTALLATION, TRANSMISSION FUNCTION, AND TRANSMISSION SHIFTING. THE MODULE CONSISTS OF A SELF-INSTRUCTIONAL PROGRAMED…
Effect of Condom Use on Per-act HSV-2 Transmission Risk in HIV-1, HSV-2-discordant Couples.
Magaret, Amalia S; Mujugira, Andrew; Hughes, James P; Lingappa, Jairam; Bukusi, Elizabeth A; DeBruyn, Guy; Delany-Moretlwe, Sinead; Fife, Kenneth H; Gray, Glenda E; Kapiga, Saidi; Karita, Etienne; Mugo, Nelly R; Rees, Helen; Ronald, Allan; Vwalika, Bellington; Were, Edwin; Celum, Connie; Wald, Anna
2016-02-15
The efficacy of condoms for protection against transmission of herpes simplex virus type 2 (HSV-2) has been examined in a variety of populations with different effect measures. Often the efficacy has been assessed as change in hazard of transmission with consistent vs inconsistent use, independent of the number of acts. Condom efficacy has not previously measured on a per-act basis. We examined the per-act HSV-2 transmission rates with and without condom use among 911 African HSV-2 and human immunodeficiency virus type 1 (HIV-1) serodiscordant couples followed for an average of 18 months in an HIV prevention study. Infectivity models were used to associate the log10 probability of HSV-2 transmission over monthly risk periods with reported numbers of protected and unprotected sex acts. Condom efficacy was computed as the proportionate reduction in transmission risk for protected relative to unprotected sex acts. Transmission of HSV-2 occurred in 68 couples, including 17 with susceptible women and 51 with susceptible men. The highest rate of transmission was from men to women: 28.5 transmissions per 1000 unprotected sex acts. We found that condoms were differentially protective against HSV-2 transmission by sex; condom use reduced per-act risk of transmission from men to women by 96% (P < .001) and marginally from women to men by 65% (P = .060). Condoms are recommended as an effective preventive method for heterosexual transmission of HSV-2. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Interacting Genes Required for Pharyngeal Excitation by Motor Neuron Mc in Caenorhabditis Elegans
Raizen, D. M.; Lee, RYN.; Avery, L.
1995-01-01
We studied the control of pharyngeal excitation in Caenorhabditis elegans. By laser ablating subsets of the pharyngeal nervous system, we found that the MC neuron type is necessary and probably sufficient for rapid pharyngeal pumping. Electropharyngeograms showed that MC transmits excitatory postsynaptic potentials, suggesting that MC acts as a neurogenic pacemaker for pharyngeal pumping. Mutations in genes required for acetylcholine (ACh) release and an antagonist of the nicotinic ACh receptor (nAChR) reduced pumping rates, suggesting that a nAChR is required for MC transmission. To identify genes required for MC neurotransmission, we screened for mutations that cause slow pumping but no other defects. Mutations in two genes, eat-2 and eat-18, eliminated MC neurotransmission. A gain-of-function eat-18 mutation, ad820sd, and a putative loss-of-function eat-18 mutation, ad1110, both reduced the excitation of pharyngeal muscle in response to the nAChR agonists nicotine and carbachol, suggesting that eat-18 is required for the function of a pharyngeal nAChR. Fourteen recessive mutations in eat-2 fell into five complementation classes. We found allele-specific genetic interactions between eat-2 and eat-18 that correlated with complementation classes of eat-2. We propose that eat-18 and eat-2 function in a multisubunit protein complex involved in the function of a pharyngeal nAChR. PMID:8601480
Assessing the Risk of a Canine Rabies Incursion in Northern Australia
Hudson, Emily G.; Brookes, Victoria J.; Ward, Michael P.
2017-01-01
Rabies is a globally distributed virus that causes approximately 60,00 human deaths annually with >99% of cases caused by dog bites. Australia is currently canine rabies free. However, the recent eastward spread of rabies in the Indonesian archipelago has increased the probability of rabies entry into northern Australian communities. In addition, many northern Australian communities have large populations of free-roaming dogs, capable of maintaining rabies should an incursion occur. A risk assessment of rabies entry and transmission into these communities is needed to target control and surveillance measures. Illegal transportation of rabies-infected dogs via boat landings is a high-risk entry pathway and was the focus of the current study. A quantitative, stochastic, risk assessment model was developed to evaluate the risk of rabies entry into north-west Cape York Peninsula, Australia, and rabies introduction to resident dogs in one of the communities via transport of rabies-infected dogs on illegal Indonesian fishing boats. Parameter distributions were derived from expert opinion, literature, and analysis of field studies. The estimated median probability of rabies entry into north-west Cape York Peninsula and into Seisia from individual fishing boats was 1.9 × 10−4/boat and 8.7 × 10−6/boat, respectively. The estimated annual probability that at least one rabies-infected dog enters north-west Cape York Peninsula and into Seisia was 5.5 × 10−3 and 3.5 × 10−4, respectively. The estimated median probability of rabies introduction into Seisia was 4.7 × 10−8/boat, and the estimated annual probability that at least one rabies-infected dog causes rabies transmission in a resident Seisia dog was 8.3 × 10−5. Sensitivity analysis using the Sobol method highlighted some parameters as influential, including but not limited to the prevalence of rabies in Indonesia, the probability of a dog on board an Indonesian fishing boat, and the probability of a Seisia dog being on the beach. Overall, the probabilities of rabies entry into north-west Cape York Peninsula and rabies introduction into Seisia are low. However, the potential devastating consequences of a rabies incursion in this region make this a non-negligible risk. PMID:28913341
Owczarek, Grzegorz; Gralewicz, Grzegorz; Skuza, Natalia; Jurowski, Piotr
2016-01-01
In this research the factors used to evaluate the light transmission through two types of acrylic hydrophobic intraocular lenses, one that contained yellow chromophore that blocks blue light transmission and the other which did not contain that filter, were defined according to various light condition, e.g., daylight and at night. The potential influence of light transmission trough intraocular lenses with or without yellow chromophore on functional vision in everyday environmental conditions was analysed.
Computerized Design and Generation of Low-Noise Gears with Localized Bearing Contact
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Chen, Ningxin; Chen, Jui-Sheng; Lu, Jian; Handschuh, Robert F.
1995-01-01
The results of research projects directed at the reduction of noise caused by misalignment of the following gear drives: double-circular arc helical gears, modified involute helical gears, face-milled spiral bevel gears, and face-milled formate cut hypoid gears are presented. Misalignment in these types of gear drives causes periodic, almost linear discontinuous functions of transmission errors. The period of such functions is the cycle of meshing when one pair of teeth is changed for the next. Due to the discontinuity of such functions of transmission errors high vibration and noise are inevitable. A predesigned parabolic function of transmission errors that is able to absorb linear discontinuous functions of transmission errors and change the resulting function of transmission errors into a continuous one is proposed. The proposed idea was successfully tested using spiral bevel gears and the noise was reduced a substantial amount in comparison with the existing design. The idea of a predesigned parabolic function is applied for the reduction of noise of helical and hypoid gears. The effectiveness of the proposed approach has been investigated by developed TCA (tooth contact analysis) programs. The bearing contact for the mentioned gears is localized. Conditions that avoid edge contact for the gear drives have been determined. Manufacturing of helical gears with new topology by hobs and grinding worms has been investigated.
Chapman, S
1992-06-01
The concept of tertiary sexual transmission of human immunodeficiency virus (HIV) has been central to government efforts to communicate notions of risk to heterosexuals in Australia. Data on heterosexually transmitted acquired immune deficiency syndrome (AIDS) and HIV for Australia are reviewed with emphasis given to the probability of misclassification bias in the heterosexually acquired and 'other/undetermined' categories. Tertiary cases are almost certainly rare in Australia, with little evidence of any increase in their incidence since the first cases were recorded. Three factors (low probability of exposure, the infectivity of HIV and a comparatively low rate of sexual partner change) make it improbable that Australian heterosexuals with no risk factors will experience endemic HIV infection, with a caveat to this conclusion lying in the potential of Australian sex tourism to Southeast Asia for introducing HIV into the Australian heterosexual population. Four hegemonic factors which have acted to suppress any serious debate of the notion that HIV in Australia is unlikely to become endemic among heterosexuals are discussed: the political 'democratization' of risk inspired by concerns that gay men should not be further vilified as a victim group; the preventive imperative; a reluctance among health educators to question the very foundations of the message they are employed to deliver; and a reluctance to curtail 'Trojan horse' benefits to sexually transmissible disease prevention engendered by HIV education promoting safe sex messages.
Rabies transmission risks during peripartum--Two cases and a review of the literature.
Aguèmon, Christiane Tshabu; Tarantola, Arnaud; Zoumènou, Eugène; Goyet, Sophie; Assouto, Pamphile; Ly, Sowath; Mewanou, Serge; Bourhy, Hervé; Dodet, Betty; Aguèmon, Abdou-Rahmann
2016-04-04
We report two cases of probable rabies in near-term/at-term pregnant women in sub-Saharan Africa and Asia. One baby was delivered by caesarean section and the other one vaginally. Both received post-exposure prophylaxis (PEP), including RIG and vaccine and both are alive and healthy, at 9 and 24 months, respectively. We found 14 other published cases of infants born from rabid mothers. One confirmed case of rabies transmission occurred. The other children born from rabid mothers, with or without caesarean section, did not acquire rabies, and were still healthy at the time of reporting, with or without post-exposure prophylaxis. Mother-to-child transmission of rabies is possible, but rare, because rabies virus is not present in blood and exposure of the baby's mucosa to maternal infectious fluids and tissue seems limited. A conservative approach should however, be adopted, and rabies PEP, including RIG, be administered as soon as possible to babies born from probably rabid mothers. Whether cesarean-section clearly provides prevention remains unclear. Rabies can be prevented in pregnant women by PEP administration. Rabies cell-culture vaccines are safe and effective and can be administered to pregnant and lactating women, as well as newborns. Efforts must focus on raising rabies awareness in the general population, as well as in healthcare workers. Copyright © 2016 Elsevier Ltd. All rights reserved.
Doak, Daniel F; Bakker, Victoria J; Vickers, Winston
2013-04-01
Outbreaks of infectious disease represent serious threats to the viability of many vertebrate populations, but few studies have included quantitative evaluations of alternative approaches to the management of disease. The most prevalent management approach is monitoring for and rapid response to an epizootic. An alternative is vaccination of a subset of the free-living population (i.e., a "vaccinated core") such that some individuals are partially or fully immune in the event of an epizootic. We developed a simulation model describing epizootic dynamics, which we then embedded in a demographic simulation to assess these alternative approaches to managing rabies epizootics in the island fox (Urocyon littoralis), a species composed of only 6 small populations on the California Channel Islands. Although the monitor and respond approach was superior to the vaccinated-core approach for some transmission models and parameter values, this type of reactive management did not protect the population from rabies under many disease-transmission assumptions. In contrast, a logistically feasible program of prophylactic vaccination for part of the wild population yielded low extinction probabilities across all likely disease-transmission scenarios, even with recurrent disease introductions. Our use of a single metric of successful management-probability of extreme endangerment (i.e., quasi extinction)-to compare very different management approaches allowed an objective assessment of alternative strategies for controlling the threats posed by infectious disease outbreaks. © 2013 Society for Conservation Biology.
Cascading failures in ac electricity grids.
Rohden, Martin; Jung, Daniel; Tamrakar, Samyak; Kettemann, Stefan
2016-09-01
Sudden failure of a single transmission element in a power grid can induce a domino effect of cascading failures, which can lead to the isolation of a large number of consumers or even to the failure of the entire grid. Here we present results of the simulation of cascading failures in power grids, using an alternating current (AC) model. We first apply this model to a regular square grid topology. For a random placement of consumers and generators on the grid, the probability to find more than a certain number of unsupplied consumers decays as a power law and obeys a scaling law with respect to system size. Varying the transmitted power threshold above which a transmission line fails does not seem to change the power-law exponent q≈1.6. Furthermore, we study the influence of the placement of generators and consumers on the number of affected consumers and demonstrate that large clusters of generators and consumers are especially vulnerable to cascading failures. As a real-world topology, we consider the German high-voltage transmission grid. Applying the dynamic AC model and considering a random placement of consumers, we find that the probability to disconnect more than a certain number of consumers depends strongly on the threshold. For large thresholds the decay is clearly exponential, while for small ones the decay is slow, indicating a power-law decay.
Digital control algorithms for microgravity isolation systems
NASA Technical Reports Server (NTRS)
Sinha, Alok; Wang, Yung-Peng
1992-01-01
New digital control algorithms were developed to achieve the desired acceleration transmissibility function. The attractive electromagnets have been taken as actuators. The relative displacement and the acceleration of the mass were used as feedback signals. Two approaches were developed to find that controller transfer function in Z-domain, which yields the desired transmissibility at each frequency. In the first approach, the controller transfer function is obtained by assuming that the desired transmissibility is known in Z-domain. Since the desired transmissibility H sub d(S) = 1/(tauS+1)(exp 2) is given in S-domain, the first task is to obtain the desired transmissibility in Z-domain. There are three methods to perform this task: bilinear transformation, and backward and forward rectangular rules. The bilinear transformation and backward rectangular rule lead to improper controller transfer functions, which are physically not realizable. The forward rectangular rule does lead to a physically realizable controller. However, this controller is found to be marginally stable because of a pole at Z=1. In order to eliminate this pole, a hybrid control structure is proposed. Here the control input is composed of two parts: analog and digital. The analog input simply represents the velocity (or the integral of acceleration) feedback; and the digital controller which uses only relative displacement signal, is then obtained to achieve the desired closed-loop transfer function. The stability analysis indicates that the controller transfer function is stable for typical values of sampling period. In the second approach, the aforementioned hybrid control structure is again used. First, an analog controller transfer function corresponding to relative displacement feedback is obtained to achieve the transmissibility as 1/(tauS+1)(exp 2). Then the transfer function for the digital control input is obtained by discretizing this analog controller transfer function via bilinear transformation. The stability of the resulting Z-domain closed loop system is analyzed. Also, the frequency response of the Z-domain closed-loop transfer function is determined to evaluate the performance of the control system.
Transmission function properties for multi-layered structures: application to super-resolution.
Mattiucci, N; D'Aguanno, G; Scalora, M; Bloemer, M J; Sibilia, C
2009-09-28
We discuss the properties of the transmission function in the k-space for a generic multi-layered structure. In particular we analytically demonstrate that a transmission greater than one in the evanescent spectrum (amplification of the evanescent modes) can be directly linked to the guided modes supported by the structure. Moreover we show that the slope of the phase of the transmission function in the propagating spectrum is inversely proportional to the ability of the structure to compensate the diffraction of the propagating modes. We apply these findings to discuss several examples where super-resolution is achieved thanks to the simultaneous availability of the amplification of the evanescent modes and the diffraction compensation of the propagating modes.
Mapping the zoonotic niche of Ebola virus disease in Africa
Pigott, David M; Golding, Nick; Mylne, Adrian; Huang, Zhi; Henry, Andrew J; Weiss, Daniel J; Brady, Oliver J; Kraemer, Moritz UG; Smith, David L; Moyes, Catherine L; Bhatt, Samir; Gething, Peter W; Horby, Peter W; Bogoch, Isaac I; Brownstein, John S; Mekaru, Sumiko R; Tatem, Andrew J; Khan, Kamran; Hay, Simon I
2014-01-01
Ebola virus disease (EVD) is a complex zoonosis that is highly virulent in humans. The largest recorded outbreak of EVD is ongoing in West Africa, outside of its previously reported and predicted niche. We assembled location data on all recorded zoonotic transmission to humans and Ebola virus infection in bats and primates (1976–2014). Using species distribution models, these occurrence data were paired with environmental covariates to predict a zoonotic transmission niche covering 22 countries across Central and West Africa. Vegetation, elevation, temperature, evapotranspiration, and suspected reservoir bat distributions define this relationship. At-risk areas are inhabited by 22 million people; however, the rarity of human outbreaks emphasises the very low probability of transmission to humans. Increasing population sizes and international connectivity by air since the first detection of EVD in 1976 suggest that the dynamics of human-to-human secondary transmission in contemporary outbreaks will be very different to those of the past. DOI: http://dx.doi.org/10.7554/eLife.04395.001 PMID:25201877
Macedo, Alexandre Casimiro de; Cunha, José Evandro; Yaochite, Juliana Navarro Ueda; Tavares, Clodis Maria; Nagao-Dias, Aparecida Tiemi
Considering that the main route of Mycobacterium leprae transmission is the upper respiratory tract, detection of salivary antibodies can be a useful tool for diagnosing early infection. The study aimed to analyze salivary anti-PGL-1 IgA and IgM antibodies in 169 children aged 4-16 years old, who lived nearby or inside the house of multibacillary or paucibacillary leprosy patients in two endemic cities in Alagoas State - Brazil. Salivary anti-PGL-1 antibodies were quantified by modified ELISA method. The frequency of contact and clinical form of the index case were significantly associated with salivary antibody levels. High frequency of IgM positivity strongly suggests active transmission of M. leprae in these communities. We suggest in the present work that salivary anti-PGL IgA and IgM are important biomarkers to be used for identifying communities with probable active transmission of M. leprae. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
The efficacy of serostatus disclosure for HIV Transmission risk reduction.
O'Connell, Ann A; Reed, Sandra J; Serovich, Julianne A
2015-02-01
Interventions to assist HIV+ persons in disclosing their serostatus to sexual partners can play an important role in curbing rates of HIV transmission among men who have sex with men (MSM). Based on the methods of Pinkerton and Galletly (AIDS Behav 11:698-705, 2007), we develop a mathematical probability model for evaluating effectiveness of serostatus disclosure in reducing the risk of HIV transmission and extend the model to examine the impact of serosorting. In baseline data from 164 HIV+ MSM participating in a randomized controlled trial of a disclosure intervention, disclosure is associated with a 45.0 % reduction in the risk of HIV transmission. Accounting for serosorting, a 61.2 % reduction in risk due to disclosure was observed in serodisconcordant couples. The reduction in risk for seroconcordant couples was 38.4 %. Evidence provided supports the value of serostatus disclosure as a risk reduction strategy in HIV+ MSM. Interventions to increase serostatus disclosure and that address serosorting behaviors are needed.
The Efficacy of Serostatus Disclosure for HIV Transmission Risk Reduction
O’Connell, Ann A.; Serovich, Julianne A.
2015-01-01
Interventions to assist HIV+ persons in disclosing their serostatus to sexual partners can play an important role in curbing rates of HIV transmission among men who have sex with men (MSM). Based on the methods of Pinkerton and Galletly (AIDS Behav 11:698–705, 2007), we develop a mathematical probability model for evaluating effectiveness of serostatus disclosure in reducing the risk of HIV transmission and extend the model to examine the impact of serosorting. In baseline data from 164 HIV+ MSM participating in a randomized controlled trial of a disclosure intervention, disclosure is associated with a 45.0 % reduction in the risk of HIV transmission. Accounting for serosorting, a 61.2 % reduction in risk due to disclosure was observed in serodisconcordant couples. The reduction in risk for seroconcordant couples was 38.4 %. Evidence provided supports the value of serostatus disclosure as a risk reduction strategy in HIV+ MSM. Interventions to increase serostatus disclosure and that address serosorting behaviors are needed. PMID:25164375
Nalca, Aysegul; Rossi, Franco D.; Miller, Lynn J.; Wiley, Michael R.; Perez-Sautu, Unai; Washington, Samuel C.; Norris, Sarah L.; Wollen-Roberts, Suzanne E.; Shamblin, Joshua D.; Kimmel, Adrienne E.; Bloomfield, Holly A.; Valdez, Stephanie M.; Sprague, Thomas R.; Principe, Lucia M.; Bellanca, Stephanie A.; Cinkovich, Stephanie S.; Lugo-Roman, Luis; Cazares, Lisa H.; Pratt, William D.; Palacios, Gustavo F.; Bavari, Sina; Pitt, M. Louise; Nasar, Farooq
2017-01-01
Unprotected sexual intercourse between persons residing in or traveling from regions with Zika virus transmission is a risk factor for infection. To model risk for infection after sexual intercourse, we inoculated rhesus and cynomolgus macaques with Zika virus by intravaginal or intrarectal routes. In macaques inoculated intravaginally, we detected viremia and virus RNA in 50% of macaques, followed by seroconversion. In macaques inoculated intrarectally, we detected viremia, virus RNA, or both, in 100% of both species, followed by seroconversion. The magnitude and duration of infectious virus in the blood of macaques suggest humans infected with Zika virus through sexual transmission will likely generate viremias sufficient to infect competent mosquito vectors. Our results indicate that transmission of Zika virus by sexual intercourse might serve as a virus maintenance mechanism in the absence of mosquito-to-human transmission and could increase the probability of establishment and spread of Zika virus in regions where this virus is not present. PMID:28548637
Haddow, Andrew D; Nalca, Aysegul; Rossi, Franco D; Miller, Lynn J; Wiley, Michael R; Perez-Sautu, Unai; Washington, Samuel C; Norris, Sarah L; Wollen-Roberts, Suzanne E; Shamblin, Joshua D; Kimmel, Adrienne E; Bloomfield, Holly A; Valdez, Stephanie M; Sprague, Thomas R; Principe, Lucia M; Bellanca, Stephanie A; Cinkovich, Stephanie S; Lugo-Roman, Luis; Cazares, Lisa H; Pratt, William D; Palacios, Gustavo F; Bavari, Sina; Pitt, M Louise; Nasar, Farooq
2017-08-01
Unprotected sexual intercourse between persons residing in or traveling from regions with Zika virus transmission is a risk factor for infection. To model risk for infection after sexual intercourse, we inoculated rhesus and cynomolgus macaques with Zika virus by intravaginal or intrarectal routes. In macaques inoculated intravaginally, we detected viremia and virus RNA in 50% of macaques, followed by seroconversion. In macaques inoculated intrarectally, we detected viremia, virus RNA, or both, in 100% of both species, followed by seroconversion. The magnitude and duration of infectious virus in the blood of macaques suggest humans infected with Zika virus through sexual transmission will likely generate viremias sufficient to infect competent mosquito vectors. Our results indicate that transmission of Zika virus by sexual intercourse might serve as a virus maintenance mechanism in the absence of mosquito-to-human transmission and could increase the probability of establishment and spread of Zika virus in regions where this virus is not present.
Guédon, Gérard; Libante, Virginie; Coluzzi, Charles; Payot, Sophie
2017-01-01
Conjugation is a key mechanism of bacterial evolution that involves mobile genetic elements. Recent findings indicated that the main actors of conjugative transfer are not the well-known conjugative or mobilizable plasmids but are the integrated elements. This paper reviews current knowledge on “integrative and mobilizable elements” (IMEs) that have recently been shown to be highly diverse and highly widespread but are still rarely described. IMEs encode their own excision and integration and use the conjugation machinery of unrelated co-resident conjugative element for their own transfer. Recent studies revealed a much more complex and much more diverse lifecycle than initially thought. Besides their main transmission as integrated elements, IMEs probably use plasmid-like strategies to ensure their maintenance after excision. Their interaction with conjugative elements reveals not only harmless hitchhikers but also hunters that use conjugative elements as target for their integration or harmful parasites that subvert the conjugative apparatus of incoming elements to invade cells that harbor them. IMEs carry genes conferring various functions, such as resistance to antibiotics, that can enhance the fitness of their hosts and that contribute to their maintenance in bacterial populations. Taken as a whole, IMEs are probably major contributors to bacterial evolution. PMID:29165361
Spontaneous and evoked release are independently regulated at individual active zones.
Melom, Jan E; Akbergenova, Yulia; Gavornik, Jeffrey P; Littleton, J Troy
2013-10-30
Neurotransmitter release from synaptic vesicle fusion is the fundamental mechanism for neuronal communication at synapses. Evoked release following an action potential has been well characterized for its function in activating the postsynaptic cell, but the significance of spontaneous release is less clear. Using transgenic tools to image single synaptic vesicle fusion events at individual release sites (active zones) in Drosophila, we characterized the spatial and temporal dynamics of exocytotic events that occur spontaneously or in response to an action potential. We also analyzed the relationship between these two modes of fusion at single release sites. A majority of active zones participate in both modes of fusion, although release probability is not correlated between the two modes of release and is highly variable across the population. A subset of active zones is specifically dedicated to spontaneous release, indicating a population of postsynaptic receptors is uniquely activated by this mode of vesicle fusion. Imaging synaptic transmission at individual release sites also revealed general rules for spontaneous and evoked release, and indicate that active zones with similar release probability can cluster spatially within individual synaptic boutons. These findings suggest neuronal connections contain two information channels that can be spatially segregated and independently regulated to transmit evoked or spontaneous fusion signals.
Formal analysis and evaluation of the back-off procedure in IEEE802.11P VANET
NASA Astrophysics Data System (ADS)
Jin, Li; Zhang, Guoan; Zhu, Xiaojun
2017-07-01
The back-off procedure is one of the media access control technologies in 802.11P communication protocol. It plays an important role in avoiding message collisions and allocating channel resources. Formal methods are effective approaches for studying the performances of communication systems. In this paper, we establish a discrete time model for the back-off procedure. We use Markov Decision Processes (MDPs) to model the non-deterministic and probabilistic behaviors of the procedure, and use the probabilistic computation tree logic (PCTL) language to express different properties, which ensure that the discrete time model performs their basic functionality. Based on the model and PCTL specifications, we study the effect of contention window length on the number of senders in the neighborhood of given receivers, and that on the station’s expected cost required by the back-off procedure to successfully send packets. The variation of the window length may increase or decrease the maximum probability of correct transmissions within a time contention unit. We propose to use PRISM model checker to describe our proposed back-off procedure for IEEE802.11P protocol in vehicle network, and define different probability properties formulas to automatically verify the model and derive numerical results. The obtained results are helpful for justifying the values of the time contention unit.
The influence of air humidity on an unsealed ionization chamber in a linear accelerator.
Blad, B; Nilsson, P; Knöös, T
1996-11-01
The safe and accurate delivery of the prescribed absorbed dose is the central function of the dose monitoring and beam stabilization system in a medical linear accelerator. The absorbed dose delivered to the patient during radiotherapy is often monitored by a transmission ionization chamber. Therefore it is of utmost importance that the chamber behaves correctly. We have noticed that the sensitivity of an unsealed chamber in a Philips SL linear accelerator changes significantly, especially during and after the summer season. The reason for this is probably a corrosion effect of the conductive plates in the chamber due to the increased relative humidity during hot periods. We have found that the responses of the different ion chamber plates change with variations in air humidity and that they do not return to their original values when the air humidity is returned to ambient conditions.
Feed-forward frequency offset estimation for 32-QAM optical coherent detection.
Xiao, Fei; Lu, Jianing; Fu, Songnian; Xie, Chenhui; Tang, Ming; Tian, Jinwen; Liu, Deming
2017-04-17
Due to the non-rectangular distribution of the constellation points, traditional fast Fourier transform based frequency offset estimation (FFT-FOE) is no longer suitable for 32-QAM signal. Here, we report a modified FFT-FOE technique by selecting and digitally amplifying the inner QPSK ring of 32-QAM after the adaptive equalization, which is defined as QPSK-selection assisted FFT-FOE. Simulation results show that no FOE error occurs with a FFT size of only 512 symbols, when the signal-to-noise ratio (SNR) is above 17.5 dB using our proposed FOE technique. However, the error probability of traditional FFT-FOE scheme for 32-QAM is always intolerant. Finally, our proposed FOE scheme functions well for 10 Gbaud dual polarization (DP)-32-QAM signal to reach 20% forward error correction (FEC) threshold of BER=2×10-2, under the scenario of back-to-back (B2B) transmission.
Emergence of new norovirus variants on spring cruise ships and prediction of winter epidemics.
Verhoef, Linda; Depoortere, Evelyn; Boxman, Ingeborg; Duizer, Erwin; van Duynhoven, Yvonne; Harris, John; Johnsen, Christina; Kroneman, Annelies; Le Guyader, Soizick; Lim, Wilina; Maunula, Leena; Meldal, Hege; Ratcliff, Rod; Reuter, Gábor; Schreier, Eckart; Siebenga, Joukje; Vainio, Kirsti; Varela, Carmen; Vennema, Harry; Koopmans, Marion
2008-02-01
In June 2006, reported outbreaks of norovirus on cruise ships suddenly increased; 43 outbreaks occurred on 13 vessels. All outbreaks investigated manifested person-to-person transmission. Detection of a point source was impossible because of limited investigation of initial outbreaks and data sharing. The most probable explanation for these outbreaks is increased norovirus activity in the community, which coincided with the emergence of 2 new GGII.4 variant strains in Europe and the Pacific. As in 2002, a new GGII.4 variant detected in the spring and summer corresponded with high norovirus activity in the subsequent winter. Because outbreaks on cruise ships are likely to occur when new variants circulate, an active reporting system could function as an early warning system. Internationally accepted guidelines are needed for reporting, investigating, and controlling norovirus illness on cruise ships in Europe.
Emergence of New Norovirus Variants on Spring Cruise Ships and Prediction of Winter Epidemics
Depoortere, Evelyn; Boxman, Ingeborg; Duizer, Erwin; van Duynhoven, Yvonne; Harris, John; Johnsen, Christina; Kroneman, Annelies; Le Guyader, Soizick; Lim, Wilina; Maunula, Leena; Meldal, Hege; Ratcliff, Rod; Reuter, Gábor; Schreier, Eckart; Siebenga, Joukje; Vainio, Kirsti; Varela, Carmen; Vennema, Harry; Koopmans, Marion
2008-01-01
In June 2006, reported outbreaks of norovirus on cruise ships suddenly increased; 43 outbreaks occurred on 13 vessels. All outbreaks investigated manifested person-to-person transmission. Detection of a point source was impossible because of limited investigation of initial outbreaks and data sharing. The most probable explanation for these outbreaks is increased norovirus activity in the community, which coincided with the emergence of 2 new GGII.4 variant strains in Europe and the Pacific. As in 2002, a new GGII.4 variant detected in the spring and summer corresponded with high norovirus activity in the subsequent winter. Because outbreaks on cruise ships are likely to occur when new variants circulate, an active reporting system could function as an early warning system. Internationally accepted guidelines are needed for reporting, investigating, and controlling norovirus illness on cruise ships in Europe. PMID:18258116
Performance of a short 'magnetic bottle' electron spectrometer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mucke, M.; Lischke, T.; Arion, T.
2012-06-15
In this article, a newly constructed electron spectrometer of the magnetic bottle type is described. The instrument is part of an apparatus for measuring the electron spectra of free clusters using synchrotron radiation. Argon and helium outer valence photoelectron spectra have been recorded in order to investigate the characteristic features of the spectrometer. The energy resolution (E/{Delta}E) has been found to be {approx}30. Using electrostatic retardation of the electrons, it can be increased to at least 110. The transmission as a function of kinetic energy is flat, and is not impaired much by retardation with up to 80% of themore » initial kinetic energy. We have measured a detection efficiency of most probably 0.6{sub -0.1}{sup +0.05}, but at least of 0.4. Results from testing the alignment of the magnet, and from trajectory simulations, are also discussed.« less
A spatial risk assessment of bighorn sheep extirpation by grazing domestic sheep on public lands.
Carpenter, Tim E; Coggins, Victor L; McCarthy, Clinton; O'Brien, Chans S; O'Brien, Joshua M; Schommer, Timothy J
2014-04-01
Bighorn sheep currently occupy just 30% of their historic distribution, and persist in populations less than 5% as abundant overall as their early 19th century counterparts. Present-day recovery of bighorn sheep populations is in large part limited by periodic outbreaks of respiratory disease, which can be transmitted to bighorn sheep via contact with domestic sheep grazing in their vicinity. In order to assess the viability of bighorn sheep populations on the Payette National Forest (PNF) under several alternative proposals for domestic sheep grazing, we developed a series of interlinked models. Using telemetry and habitat data, we characterized herd home ranges and foray movements of bighorn sheep from their home ranges. Combining foray model movement estimates with known domestic sheep grazing areas (allotments), a Risk of Contact Model estimated bighorn sheep contact rates with domestic sheep allotments. Finally, we used demographic and epidemiologic data to construct population and disease transmission models (Disease Model), which we used to estimate bighorn sheep persistence under each alternative grazing scenario. Depending on the probability of disease transmission following interspecies contact, extirpation probabilities for the seven bighorn sheep herds examined here ranged from 20% to 100%. The Disease Model allowed us to assess the probabilities that varied domestic sheep management scenarios would support persistent populations of free-ranging bighorn sheep. Copyright © 2014 Elsevier B.V. All rights reserved.
Cyber-Physical Correlations for Infrastructure Resilience: A Game-Theoretic Approach
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rao, Nageswara S; He, Fei; Ma, Chris Y. T.
In several critical infrastructures, the cyber and physical parts are correlated so that disruptions to one affect the other and hence the whole system. These correlations may be exploited to strategically launch components attacks, and hence must be accounted for ensuring the infrastructure resilience, specified by its survival probability. We characterize the cyber-physical interactions at two levels: (i) the failure correlation function specifies the conditional survival probability of cyber sub-infrastructure given the physical sub-infrastructure as a function of their marginal probabilities, and (ii) the individual survival probabilities of both sub-infrastructures are characterized by first-order differential conditions. We formulate a resiliencemore » problem for infrastructures composed of discrete components as a game between the provider and attacker, wherein their utility functions consist of an infrastructure survival probability term and a cost term expressed in terms of the number of components attacked and reinforced. We derive Nash Equilibrium conditions and sensitivity functions that highlight the dependence of infrastructure resilience on the cost term, correlation function and sub-infrastructure survival probabilities. These results generalize earlier ones based on linear failure correlation functions and independent component failures. We apply the results to models of cloud computing infrastructures and energy grids.« less
Life history and virulence are linked in the ectoparasitic salmon louse Lepeophtheirus salmonis.
Mennerat, A; Hamre, L; Ebert, D; Nilsen, F; Dávidová, M; Skorping, A
2012-05-01
Models of virulence evolution for horizontally transmitted parasites often assume that transmission rate (the probability that an infected host infects a susceptible host) and virulence (the increase in host mortality due to infection) are positively correlated, because higher rates of production of propagules may cause more damages to the host. However, empirical support for this assumption is scant and limited to microparasites. To fill this gap, we explored the relationships between parasite life history and virulence in the salmon louse, Lepeophtheirus salmonis, a horizontally transmitted copepod ectoparasite on Atlantic salmon Salmo salar. In the laboratory, we infected juvenile salmon hosts with equal doses of infective L. salmonis larvae and monitored parasite age at first reproduction, parasite fecundity, area of damage caused on the skin of the host, and host weight and length gain. We found that earlier onset of parasite reproduction was associated with higher parasite fecundity. Moreover, higher parasite fecundity (a proxy for transmission rate, as infection probability increases with higher numbers of parasite larvae released to the water) was associated with lower host weight gain (correlated with lower survival in juvenile salmon), supporting the presence of a virulence-transmission trade-off. Our results are relevant in the context of increasing intensive farming, where frequent anti-parasite drug use and increased host density may have selected for faster production of parasite transmission stages, via earlier reproduction and increased early fecundity. Our study highlights that salmon lice, therefore, are a good model for studying how human activity may affect the evolution of parasite virulence. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.
Identification of transmissivity fields using a Bayesian strategy and perturbative approach
NASA Astrophysics Data System (ADS)
Zanini, Andrea; Tanda, Maria Giovanna; Woodbury, Allan D.
2017-10-01
The paper deals with the crucial problem of the groundwater parameter estimation that is the basis for efficient modeling and reclamation activities. A hierarchical Bayesian approach is developed: it uses the Akaike's Bayesian Information Criteria in order to estimate the hyperparameters (related to the covariance model chosen) and to quantify the unknown noise variance. The transmissivity identification proceeds in two steps: the first, called empirical Bayesian interpolation, uses Y* (Y = lnT) observations to interpolate Y values on a specified grid; the second, called empirical Bayesian update, improve the previous Y estimate through the addition of hydraulic head observations. The relationship between the head and the lnT has been linearized through a perturbative solution of the flow equation. In order to test the proposed approach, synthetic aquifers from literature have been considered. The aquifers in question contain a variety of boundary conditions (both Dirichelet and Neuman type) and scales of heterogeneities (σY2 = 1.0 and σY2 = 5.3). The estimated transmissivity fields were compared to the true one. The joint use of Y* and head measurements improves the estimation of Y considering both degrees of heterogeneity. Even if the variance of the strong transmissivity field can be considered high for the application of the perturbative approach, the results show the same order of approximation of the non-linear methods proposed in literature. The procedure allows to compute the posterior probability distribution of the target quantities and to quantify the uncertainty in the model prediction. Bayesian updating has advantages related both to the Monte-Carlo (MC) and non-MC approaches. In fact, as the MC methods, Bayesian updating allows computing the direct posterior probability distribution of the target quantities and as non-MC methods it has computational times in the order of seconds.
Partridge, D G; Evans, C M; Raza, M; Kudesia, G; Parsons, H K
2012-05-01
Hospital norovirus outbreaks cause significant financial and operational disruption which should be minimised by optimal handling of affected areas and use of isolation facilities. To identify factors associated with increased duration of symptoms and viral excretion and increased probability of transmission. Retrospective observational study of a large norovirus outbreak at a UK teaching hospital in the winter of 2009-2010 where patients were diagnosed using a real-time polymerase chain reaction (PCR) assay. Symptom duration was significantly associated with patient age (Spearman rank correlation coefficient: 0.197; P = 0.002) but not with PCR cycle threshold (C(T)) value. Duration of viral excretion was found to be longer in patients with higher viral loads. Transmission within a ward bay was not significantly associated either with age or with C(T) value but was more likely to occur in some ward blocks than others, which may relate to differences in ward design. Transfer of patients into isolation rooms or cohorted area within two days of symptom onset did not significantly influence probability of onward transmission (52% vs 47%; P = 0.67). The presented data suggest that C(T) value may guide timing of repeat sample collection if ongoing gastrointestinal symptoms may relate to other pathologies, and that patients developing symptoms of norovirus may remain in their current bay rather than being moved into isolation facilities. The bay or ward should be closed to new admissions but it should be anticipated that duration of symptoms and therefore closure will be longer when the outbreak involves elderly patients. Copyright © 2012 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Chromatic line-profile tomography to reveal exoplanetary atmospheres: application to HD 189733b
NASA Astrophysics Data System (ADS)
Borsa, F.; Rainer, M.; Poretti, E.
2016-05-01
Context. Transmission spectroscopy can be used to constrain the properties of exoplanetary atmospheres. During a transit, the light blocked from the atmosphere of the planet leaves an imprint in the light coming from the star. This has been shown for many exoplanets with both photometry and spectroscopy, using different analysis methods. Aims: We test chromatic line-profile tomography as a new tool to investigate exoplanetary atmospheres. The signal imprinted on the cross-correlation function (CCF) by a planet transiting its star is dependent on the planet-to-star radius ratio. We want to verify whether the precision reachable on the CCF obtained from a subset of the spectral orders of the HARPS spectrograph is high enough to determine the radius of a planet at different wavelengths. Methods: We analyze HARPS archival data of three transits of HD 189733b. We divide the HARPS spectral range into seven broadbands, calculating for each band the ratio between the area of the out-of-transit CCF and the area of the signal imprinted by the planet on it during the full part of the transit. We take into account the effect of the limb darkening using the theoretical coefficients of a linear law. Averaging the results of three different transits allows us to obtain a good-quality broadband transmission spectrum of HD 189733b with a greater precision than that of the chromatic Rossiter McLaughlin effect. Results: We proved that chromatic line-profile tomography is an interesting way to reveal broadband transmission spectra of exoplanets: our analysis of the atmosphere of HD 189733b is in agreement with other ground- and space-based observations. The independent analysis of different transits emphasizes the probability that stellar activity plays a role in the extracted transmission spectrum. Therefore, care should be taken when claiming that Rayleigh scattering is present in the atmosphere of exoplanets orbiting active stars using only one transit.
Force Density Function Relationships in 2-D Granular Media
NASA Technical Reports Server (NTRS)
Youngquist, Robert C.; Metzger, Philip T.; Kilts, Kelly N.
2004-01-01
An integral transform relationship is developed to convert between two important probability density functions (distributions) used in the study of contact forces in granular physics. Developing this transform has now made it possible to compare and relate various theoretical approaches with one another and with the experimental data despite the fact that one may predict the Cartesian probability density and another the force magnitude probability density. Also, the transforms identify which functional forms are relevant to describe the probability density observed in nature, and so the modified Bessel function of the second kind has been identified as the relevant form for the Cartesian probability density corresponding to exponential forms in the force magnitude distribution. Furthermore, it is shown that this transform pair supplies a sufficient mathematical framework to describe the evolution of the force magnitude distribution under shearing. Apart from the choice of several coefficients, whose evolution of values must be explained in the physics, this framework successfully reproduces the features of the distribution that are taken to be an indicator of jamming and unjamming in a granular packing. Key words. Granular Physics, Probability Density Functions, Fourier Transforms
Comparison of dose response functions for EBT3 model GafChromic™ film dosimetry system.
Aldelaijan, Saad; Devic, Slobodan
2018-05-01
Different dose response functions of EBT3 model GafChromic™ film dosimetry system have been compared in terms of sensitivity as well as uncertainty vs. error analysis. We also made an assessment of the necessity of scanning film pieces before and after irradiation. Pieces of EBT3 film model were irradiated to different dose values in Solid Water (SW) phantom. Based on images scanned in both reflection and transmission mode before and after irradiation, twelve different response functions were calculated. For every response function, a reference radiochromic film dosimetry system was established by generating calibration curve and by performing the error vs. uncertainty analysis. Response functions using pixel values from the green channel demonstrated the highest sensitivity in both transmission and reflection mode. All functions were successfully fitted with rational functional form, and provided an overall one-sigma uncertainty of better than 2% for doses above 2 Gy. Use of pre-scanned images to calculate response functions resulted in negligible improvement in dose measurement accuracy. Although reflection scanning mode provides higher sensitivity and could lead to a more widespread use of radiochromic film dosimetry, it has fairly limited dose range and slightly increased uncertainty when compared to transmission scan based response functions. Double-scanning technique, either in transmission or reflection mode, shows negligible improvement in dose accuracy as well as a negligible increase in dose uncertainty. Normalized pixel value of the images scanned in transmission mode shows linear response in a dose range of up to 11 Gy. Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Bingi, J.; Hemalatha, M.; Anita, R. W.; Vijayan, C.; Murukeshan, V. M.
2015-11-01
Light transport and the physical phenomena related to light propagation in random media are very intriguing, they also provide scope for new paradigms of device functionality, most of which remain unexplored. Here we demonstrate, experimentally and by simulation, a novel kind of asymmetric light transmission (diffusion) in a stack of random media (SRM) with graded transport mean free path. The structure is studied in terms of transmission, of photons propagated through and photons generated within the SRM. It is observed that the SRM exhibits asymmetric transmission property with a transmission contrast of 0.25. In addition, it is shown that the SRM works as a perfect optical low-pass filter with a well-defined cutoff wavelength at 580 nm. Further, the photons generated within the SRM found to exhibit functionality similar to an optical diode with a transmission contrast of 0.62. The basis of this functionality is explained in terms of wavelength dependent photon randomization and the graded transport mean free path of SRM.
Transmission dynamics: critical questions and challenges
2017-01-01
This article overviews the dynamics of disease transmission in one-host–one-parasite systems. Transmission is the result of interacting host and pathogen processes, encapsulated with the environment in a ‘transmission triangle’. Multiple transmission modes and their epidemiological consequences are often not understood because the direct measurement of transmission is difficult. However, its different components can be analysed using nonlinear transmission functions, contact matrices and networks. A particular challenge is to develop such functions for spatially extended systems. This is illustrated for vector transmission where a ‘perception kernel’ approach is developed that incorporates vector behaviour in response to host spacing. A major challenge is understanding the relative merits of the large number of approaches to quantifying transmission. The evolution of transmission mode itself has been a rather neglected topic, but is important in the context of understanding disease emergence and genetic variation in pathogens. Disease impacts many biological processes such as community stability, the evolution of sex and speciation, yet the importance of different transmission modes in these processes is not understood. Broader approaches and ideas to disease transmission are important in the public health realm for combating newly emerging infections. This article is part of the themed issue ‘Opening the black box: re-examining the ecology and evolution of parasite transmission’. PMID:28289255
Sexual relationship power and depression among HIV-infected women in Rural Uganda.
Hatcher, Abigail M; Tsai, Alexander C; Kumbakumba, Elias; Dworkin, Shari L; Hunt, Peter W; Martin, Jeffrey N; Clark, Gina; Bangsberg, David R; Weiser, Sheri D
2012-01-01
Depression is associated with increased HIV transmission risk, increased morbidity, and higher risk of HIV-related death among HIV-infected women. Low sexual relationship power also contributes to HIV risk, but there is limited understanding of how it relates to mental health among HIV-infected women. Participants were 270 HIV-infected women from the Uganda AIDS Rural Treatment Outcomes study, a prospective cohort of individuals initiating antiretroviral therapy (ART) in Mbarara, Uganda. Our primary predictor was baseline sexual relationship power as measured by the Sexual Relationship Power Scale (SRPS). The primary outcome was depression severity, measured with the Hopkins Symptom Checklist (HSCL), and a secondary outcome was a functional scale for mental health status (MHS). Adjusted models controlled for socio-demographic factors, CD4 count, alcohol and tobacco use, baseline WHO stage 4 disease, social support, and duration of ART. The mean HSCL score was 1.34 and 23.7% of participants had HSCL scores consistent with probable depression (HSCL>1.75). Compared to participants with low SRPS scores, individuals with both moderate (coefficient b = -0.21; 95%CI, -0.36 to -0.07) and high power (b = -0.21; 95%CI, -0.36 to -0.06) reported decreased depressive symptomology. High SRPS scores halved the likelihood of women meeting criteria for probable depression (adjusted odds ratio = 0.44; 95%CI, 0.20 to 0.93). In lagged models, low SRPS predicted subsequent depression severity, but depression did not predict subsequent changes in SPRS. Results were similar for MHS, with lagged models showing SRPS predicts subsequent mental health, but not visa versa. Both Decision-Making Dominance and Relationship Control subscales of SRPS were associated with depression symptom severity. HIV-infected women with high sexual relationship power had lower depression and higher mental health status than women with low power. Interventions to improve equity in decision-making and control within dyadic partnerships are critical to prevent HIV transmission and to optimize mental health of HIV-infected women.
NASA Astrophysics Data System (ADS)
Libera, Arianna; de Barros, Felipe P. J.; Riva, Monica; Guadagnini, Alberto
2017-10-01
Our study is keyed to the analysis of the interplay between engineering factors (i.e., transient pumping rates versus less realistic but commonly analyzed uniform extraction rates) and the heterogeneous structure of the aquifer (as expressed by the probability distribution characterizing transmissivity) on contaminant transport. We explore the joint influence of diverse (a) groundwater pumping schedules (constant and variable in time) and (b) representations of the stochastic heterogeneous transmissivity (T) field on temporal histories of solute concentrations observed at an extraction well. The stochastic nature of T is rendered by modeling its natural logarithm, Y = ln T, through a typical Gaussian representation and the recently introduced Generalized sub-Gaussian (GSG) model. The latter has the unique property to embed scale-dependent non-Gaussian features of the main statistics of Y and its (spatial) increments, which have been documented in a variety of studies. We rely on numerical Monte Carlo simulations and compute the temporal evolution at the well of low order moments of the solute concentration (C), as well as statistics of the peak concentration (Cp), identified as the environmental performance metric of interest in this study. We show that the pumping schedule strongly affects the pattern of the temporal evolution of the first two statistical moments of C, regardless the nature (Gaussian or non-Gaussian) of the underlying Y field, whereas the latter quantitatively influences their magnitude. Our results show that uncertainty associated with C and Cp estimates is larger when operating under a transient extraction scheme than under the action of a uniform withdrawal schedule. The probability density function (PDF) of Cp displays a long positive tail in the presence of time-varying pumping schedule. All these aspects are magnified in the presence of non-Gaussian Y fields. Additionally, the PDF of Cp displays a bimodal shape for all types of pumping schemes analyzed, independent of the type of heterogeneity considered.
Modeling the effect of reward amount on probability discounting.
Myerson, Joel; Green, Leonard; Morris, Joshua
2011-03-01
The present study with college students examined the effect of amount on the discounting of probabilistic monetary rewards. A hyperboloid function accurately described the discounting of hypothetical rewards ranging in amount from $20 to $10,000,000. The degree of discounting increased continuously with amount of probabilistic reward. This effect of amount was not due to changes in the rate parameter of the discounting function, but rather was due to increases in the exponent. These results stand in contrast to those observed with the discounting of delayed monetary rewards, in which the degree of discounting decreases with reward amount due to amount-dependent decreases in the rate parameter. Taken together, this pattern of results suggests that delay and probability discounting reflect different underlying mechanisms. That is, the fact that the exponent in the delay discounting function is independent of amount is consistent with a psychophysical scaling interpretation, whereas the finding that the exponent of the probability-discounting function is amount-dependent is inconsistent with such an interpretation. Instead, the present results are consistent with the idea that the probability-discounting function is itself the product of a value function and a weighting function. This idea was first suggested by Kahneman and Tversky (1979), although their prospect theory does not predict amount effects like those observed. The effect of amount on probability discounting was parsimoniously incorporated into our hyperboloid discounting function by assuming that the exponent was proportional to the amount raised to a power. The amount-dependent exponent of the probability-discounting function may be viewed as reflecting the effect of amount on the weighting of the probability with which the reward will be received.
Mikolajczyk, Rafael T; Kauermann, Göran; Sagel, Ulrich; Kretzschmar, Mirjam
2009-08-01
Creation of a mixture model based on Poisson processes for assessment of the extent of cross-transmission of multidrug-resistant pathogens in the hospital. We propose a 2-component mixture of Poisson processes to describe the time series of detected cases of colonization. The first component describes the admission process of patients with colonization, and the second describes the cross-transmission. The data set used to illustrate the method consists of the routinely collected records for methicillin-resistant Staphylococcus aureus (MRSA), imipenem-resistant Pseudomonas aeruginosa, and multidrug-resistant Acinetobacter baumannii over a period of 3 years in a German tertiary care hospital. For MRSA and multidrug-resistant A. baumannii, cross-transmission was estimated to be responsible for more than 80% of cases; for imipenem-resistant P. aeruginosa, cross-transmission was estimated to be responsible for 59% of cases. For new cases observed within a window of less than 28 days for MRSA and multidrug-resistant A. baumannii or 40 days for imipenem-resistant P. aeruginosa, there was a 50% or greater probability that the cause was cross-transmission. The proposed method offers a solution to assessing of the extent of cross-transmission, which can be of clinical use. The method can be applied using freely available software (the package FlexMix in R) and it requires relatively little data.
Bessell, Paul R; Shaw, Darren J; Savill, Nicholas J; Woolhouse, Mark E J
2008-10-03
Models of Foot and Mouth Disease (FMD) transmission have assumed a homogeneous landscape across which Euclidean distance is a suitable measure of the spatial dependency of transmission. This paper investigated features of the landscape and their impact on transmission during the period of predominantly local spread which followed the implementation of the national movement ban during the 2001 UK FMD epidemic. In this study 113 farms diagnosed with FMD which had a known source of infection within 3 km (cases) were matched to 188 control farms which were either uninfected or infected at a later timepoint. Cases were matched to controls by Euclidean distance to the source of infection and farm size. Intervening geographical features and connectivity between the source of infection and case and controls were compared. Road distance between holdings, access to holdings, presence of forest, elevation change between holdings and the presence of intervening roads had no impact on the risk of local FMD transmission (p > 0.2). However the presence of linear features in the form of rivers and railways acted as barriers to FMD transmission (odds ratio = 0.507, 95% CIs = 0.297,0.887, p = 0.018). This paper demonstrated that although FMD spread can generally be modelled using Euclidean distance and numbers of animals on susceptible holdings, the presence of rivers and railways has an additional protective effect reducing the probability of transmission between holdings.
Probability of the moiré effect in barrier and lenticular autostereoscopic 3D displays.
Saveljev, Vladimir; Kim, Sung-Kyu
2015-10-05
The probability of the moiré effect in LCD displays is estimated as a function of angle based on the experimental data; a theoretical function (node spacing) is proposed basing on the distance between nodes. Both functions are close to each other. The connection between the probability of the moiré effect and the Thomae's function is also found. The function proposed in this paper can be used in the minimization of the moiré effect in visual displays, especially in autostereoscopic 3D displays.
Impenetrability in Floquet Scattering in One Dimension
NASA Astrophysics Data System (ADS)
Volosniev, A. G.; Smith, D. H.
2018-07-01
We study the scattering off a time-periodic zero-range potential in one spatial dimension. We focus on the parameter regions that lead to zero-transmission probability (ZTP). For static potentials, ZTP leads to fermionization of distinguishable equal-mass particles. For time-periodic potentials, fermionization is prevented by the formation of evanescent waves.
Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12
Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted
2012-01-01
SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962
The trophic vacuum and the evolution of complex life cycles in trophically transmitted helminths.
Benesh, Daniel P; Chubb, James C; Parker, Geoff A
2014-10-22
Parasitic worms (helminths) frequently have complex life cycles in which they are transmitted trophically between two or more successive hosts. Sexual reproduction often takes place in high trophic-level (TL) vertebrates, where parasites can grow to large sizes with high fecundity. Direct infection of high TL hosts, while advantageous, may be unachievable for parasites constrained to transmit trophically, because helminth propagules are unlikely to be ingested by large predators. Lack of niche overlap between propagule and definitive host (the trophic transmission vacuum) may explain the origin and/or maintenance of intermediate hosts, which overcome this transmission barrier. We show that nematodes infecting high TL definitive hosts tend to have more successive hosts in their life cycles. This relationship was modest, though, driven mainly by the minimum TL of hosts, suggesting that the shortest trophic chains leading to a host define the boundaries of the transmission vacuum. We also show that alternative modes of transmission, like host penetration, allow nematodes to reach high TLs without intermediate hosts. We suggest that widespread omnivory as well as parasite adaptations to increase transmission probably reduce, but do not eliminate, the barriers to the transmission of helminths through the food web. © 2014 The Author(s) Published by the Royal Society. All rights reserved.
Healthcare-associated viral and bacterial infections in dentistry
Laheij, A.M.G.A.; Kistler, J.O.; Belibasakis, G.N.; Välimaa, H.; de Soet, J.J.
2012-01-01
Infection prevention in dentistry is an important topic that has gained more interest in recent years and guidelines for the prevention of cross-transmission are common practice in many countries. However, little is known about the real risks of cross-transmission, specifically in the dental healthcare setting. This paper evaluated the literature to determine the risk of cross-transmission and infection of viruses and bacteria that are of particular relevance in the dental practice environment. Facts from the literature on HSV, VZV, HIV, Hepatitis B, C and D viruses, Mycobacterium spp., Pseudomonas spp., Legionella spp. and multi-resistant bacteria are presented. There is evidence that Hepatitis B virus is a real threat for cross-infection in dentistry. Data for the transmission of, and infection with, other viruses or bacteria in dental practice are scarce. However, a number of cases are probably not acknowledged by patients, healthcare workers and authorities. Furthermore, cross-transmission in dentistry is under-reported in the literature. For the above reasons, the real risks of cross-transmission are likely to be higher. There is therefore a need for prospective longitudinal research in this area, to determine the real risks of cross-infection in dentistry. This will assist the adoption of effective hygiene procedures in dental practice. PMID:22701774
Emerging Infectious Diseases and Blood Safety: Modeling the Transfusion-Transmission Risk.
Kiely, Philip; Gambhir, Manoj; Cheng, Allen C; McQuilten, Zoe K; Seed, Clive R; Wood, Erica M
2017-07-01
While the transfusion-transmission (TT) risk associated with the major transfusion-relevant viruses such as HIV is now very low, during the last 20 years there has been a growing awareness of the threat to blood safety from emerging infectious diseases, a number of which are known to be, or are potentially, transfusion transmissible. Two published models for estimating the transfusion-transmission risk from EIDs, referred to as the Biggerstaff-Petersen model and the European Upfront Risk Assessment Tool (EUFRAT), respectively, have been applied to several EIDs in outbreak situations. We describe and compare the methodological principles of both models, highlighting their similarities and differences. We also discuss the appropriateness of comparing results from the two models. Quantitating the TT risk of EIDs can inform decisions about risk mitigation strategies and their cost-effectiveness. Finally, we present a qualitative risk assessment for Zika virus (ZIKV), an EID agent that has caused several outbreaks since 2007. In the latest and largest ever outbreak, several probable cases of transfusion-transmission ZIKV have been reported, indicating that it is transfusion-transmissible and therefore a risk to blood safety. We discuss why quantitative modeling the TT risk of ZIKV is currently problematic. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.
Thin-Film Phase Plates for Transmission Electron Microscopy Fabricated from Metallic Glasses.
Dries, Manuel; Hettler, Simon; Schulze, Tina; Send, Winfried; Müller, Erich; Schneider, Reinhard; Gerthsen, Dagmar; Luo, Yuansu; Samwer, Konrad
2016-10-01
Thin-film phase plates (PPs) have become an interesting tool to enhance the contrast of weak-phase objects in transmission electron microscopy (TEM). The thin film usually consists of amorphous carbon, which suffers from quick degeneration under the intense electron-beam illumination. Recent investigations have focused on the search for alternative materials with an improved material stability. This work presents thin-film PPs fabricated from metallic glass alloys, which are characterized by a high electrical conductivity and an amorphous structure. Thin films of the zirconium-based alloy Zr65.0Al7.5Cu27.5 (ZAC) were fabricated and their phase-shifting properties were evaluated. The ZAC film was investigated by different TEM techniques, which reveal beneficial properties compared with amorphous carbon PPs. Particularly favorable is the small probability for inelastic plasmon scattering, which results from the combined effect of a moderate inelastic mean free path and a reduced film thickness due to a high mean inner potential. Small probability plasmon scattering improves contrast transfer at high spatial frequencies, which makes the ZAC alloy a promising material for PP fabrication.
Health Monitoring Survey of Bell 412EP Transmissions
NASA Technical Reports Server (NTRS)
Tucker, Brian E.; Dempsey, Paula J.
2016-01-01
Health and usage monitoring systems (HUMS) use vibration-based Condition Indicators (CI) to assess the health of helicopter powertrain components. A fault is detected when a CI exceeds its threshold value. The effectiveness of fault detection can be judged on the basis of assessing the condition of actual components from fleet aircraft. The Bell 412 HUMS-equipped helicopter is chosen for such an evaluation. A sample of 20 aircraft included 12 aircraft with confirmed transmission and gearbox faults (detected by CIs) and eight aircraft with no known faults. The associated CI data is classified into "healthy" and "faulted" populations based on actual condition and these populations are compared against their CI thresholds to quantify the probability of false alarm and the probability of missed detection. Receiver Operator Characteristic analysis is used to optimize thresholds. Based on the results of the analysis, shortcomings in the classification method are identified for slow-moving CI trends. Recommendations for improving classification using time-dependent receiver-operator characteristic methods are put forth. Finally, lessons learned regarding OEM-operator communication are presented.
A robust approach to chance constrained optimal power flow with renewable generation
Lubin, Miles; Dvorkin, Yury; Backhaus, Scott N.
2016-09-01
Optimal Power Flow (OPF) dispatches controllable generation at minimum cost subject to operational constraints on generation and transmission assets. The uncertainty and variability of intermittent renewable generation is challenging current deterministic OPF approaches. Recent formulations of OPF use chance constraints to limit the risk from renewable generation uncertainty, however, these new approaches typically assume the probability distributions which characterize the uncertainty and variability are known exactly. We formulate a robust chance constrained (RCC) OPF that accounts for uncertainty in the parameters of these probability distributions by allowing them to be within an uncertainty set. The RCC OPF is solved usingmore » a cutting-plane algorithm that scales to large power systems. We demonstrate the RRC OPF on a modified model of the Bonneville Power Administration network, which includes 2209 buses and 176 controllable generators. In conclusion, deterministic, chance constrained (CC), and RCC OPF formulations are compared using several metrics including cost of generation, area control error, ramping of controllable generators, and occurrence of transmission line overloads as well as the respective computational performance.« less
Decision making generalized by a cumulative probability weighting function
NASA Astrophysics Data System (ADS)
dos Santos, Lindomar Soares; Destefano, Natália; Martinez, Alexandre Souto
2018-01-01
Typical examples of intertemporal decision making involve situations in which individuals must choose between a smaller reward, but more immediate, and a larger one, delivered later. Analogously, probabilistic decision making involves choices between options whose consequences differ in relation to their probability of receiving. In Economics, the expected utility theory (EUT) and the discounted utility theory (DUT) are traditionally accepted normative models for describing, respectively, probabilistic and intertemporal decision making. A large number of experiments confirmed that the linearity assumed by the EUT does not explain some observed behaviors, as nonlinear preference, risk-seeking and loss aversion. That observation led to the development of new theoretical models, called non-expected utility theories (NEUT), which include a nonlinear transformation of the probability scale. An essential feature of the so-called preference function of these theories is that the probabilities are transformed by decision weights by means of a (cumulative) probability weighting function, w(p) . We obtain in this article a generalized function for the probabilistic discount process. This function has as particular cases mathematical forms already consecrated in the literature, including discount models that consider effects of psychophysical perception. We also propose a new generalized function for the functional form of w. The limiting cases of this function encompass some parametric forms already proposed in the literature. Far beyond a mere generalization, our function allows the interpretation of probabilistic decision making theories based on the assumption that individuals behave similarly in the face of probabilities and delays and is supported by phenomenological models.
Failure detection system risk reduction assessment
NASA Technical Reports Server (NTRS)
Aguilar, Robert B. (Inventor); Huang, Zhaofeng (Inventor)
2012-01-01
A process includes determining a probability of a failure mode of a system being analyzed reaching a failure limit as a function of time to failure limit, determining a probability of a mitigation of the failure mode as a function of a time to failure limit, and quantifying a risk reduction based on the probability of the failure mode reaching the failure limit and the probability of the mitigation.
Bos, Marian E H; Te Beest, Dennis E; van Boven, Michiel; van Beest Holle, Mirna Robert-Du Ry; Meijer, Adam; Bosman, Arnold; Mulder, Yonne M; Koopmans, Marion P G; Stegeman, Arjan
2010-05-01
An epizootic of avian influenza (H7N7) caused a large number of human infections in The Netherlands in 2003. We used data from this epizootic to estimate infection probabilities for persons involved in disease control on infected farms. Analyses were based on databases containing information on the infected farms, person-visits to these farms, and exposure variables (number of birds present, housing type, poultry type, depopulation method, period during epizootic). Case definition was based on self-reported conjunctivitis and positive response to hemagglutination inhibition assay. A high infection probability was associated with clinical inspection of poultry in the area surrounding infected flocks (7.6%; 95% confidence interval [CI], 1.4%-18.9%) and active culling during depopulation (6.2%; 95% CI, 3.7%-9.6%). Low probabilities were estimated for management of biosecurity (0.0%; 95% CI, 0.0%-1.0%) and cleaning assistance during depopulation (0.0%; 95% CI, 0.0%-9.2%). No significant association was observed between the probability of infection and the exposure variables.
A two-stage broadcast message propagation model in social networks
NASA Astrophysics Data System (ADS)
Wang, Dan; Cheng, Shun-Jun
2016-11-01
Message propagation in social networks is becoming a popular topic in complex networks. One of the message types in social networks is called broadcast message. It refers to a type of message which has a unique and unknown destination for the publisher, such as 'lost and found'. Its propagation always has two stages. Due to this feature, rumor propagation model and epidemic propagation model have difficulty in describing this message's propagation accurately. In this paper, an improved two-stage susceptible-infected-removed model is proposed. We come up with the concept of the first forwarding probability and the second forwarding probability. Another part of our work is figuring out the influence to the successful message transmission chance in each level resulting from multiple reasons, including the topology of the network, the receiving probability, the first stage forwarding probability, the second stage forwarding probability as well as the length of the shortest path between the publisher and the relevant destination. The proposed model has been simulated on real networks and the results proved the model's effectiveness.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Hesheng, E-mail: hesheng@umich.edu; Feng, Mary; Jackson, Andrew
Purpose: To develop a local and global function model in the liver based on regional and organ function measurements to support individualized adaptive radiation therapy (RT). Methods and Materials: A local and global model for liver function was developed to include both functional volume and the effect of functional variation of subunits. Adopting the assumption of parallel architecture in the liver, the global function was composed of a sum of local function probabilities of subunits, varying between 0 and 1. The model was fit to 59 datasets of liver regional and organ function measures from 23 patients obtained before, during, andmore » 1 month after RT. The local function probabilities of subunits were modeled by a sigmoid function in relating to MRI-derived portal venous perfusion values. The global function was fitted to a logarithm of an indocyanine green retention rate at 15 minutes (an overall liver function measure). Cross-validation was performed by leave-m-out tests. The model was further evaluated by fitting to the data divided according to whether the patients had hepatocellular carcinoma (HCC) or not. Results: The liver function model showed that (1) a perfusion value of 68.6 mL/(100 g · min) yielded a local function probability of 0.5; (2) the probability reached 0.9 at a perfusion value of 98 mL/(100 g · min); and (3) at a probability of 0.03 [corresponding perfusion of 38 mL/(100 g · min)] or lower, the contribution to global function was lost. Cross-validations showed that the model parameters were stable. The model fitted to the data from the patients with HCC indicated that the same amount of portal venous perfusion was translated into less local function probability than in the patients with non-HCC tumors. Conclusions: The developed liver function model could provide a means to better assess individual and regional dose-responses of hepatic functions, and provide guidance for individualized treatment planning of RT.« less
Berglund, Torsten; Gisslén, Magnus; Gröön, Peter; Sönnerborg, Anders; Tegnell, Anders; Alexandersson, Anders; Berggren, Ingela; Blaxhult, Anders; Brytting, Maria; Carlander, Christina; Carlson, Johan; Flamholc, Leo; Follin, Per; Haggar, Axana; Hansdotter, Frida; Josephson, Filip; Karlström, Olle; Liljeros, Fredrik; Navér, Lars; Pettersson, Karin; Johansson, Veronica Svedhem; Svennerholm, Bo; Tunbäck, Petra; Widgren, Katarina
2014-01-01
The modern medical treatment of HIV with antiretroviral therapy (ART) has drastically reduced the morbidity and mortality in patients infected with this virus. ART has also been shown to reduce the transmission risk from individual patients as well as the spread of the infection at the population level. This position statement from the Public Health Agency of Sweden and the Swedish Reference Group for Antiviral Therapy is based on a workshop organized in the fall of 2012. It summarizes the latest research and knowledge on the risk of HIV transmission from patients on ART, with a focus on the risk of sexual transmission. The risk of transmission via shared injection equipment among intravenous drug users is also examined, as is the risk of mother-to-child transmission. Based on current knowledge, the risk of transmission through vaginal or anal intercourse involving the use of a condom has been judged to be minimal, provided that the person infected with HIV fulfils the criteria for effective ART. This probably also applies to unprotected intercourse, provided that no other sexually transmitted infections are present, although it is not currently possible to fully support this conclusion with direct scientific evidence. ART is judged to markedly reduce the risk of blood-borne transmission between people who share injection equipment. Finally, the risk of transmission from mother to child is very low, provided that ART is started well in advance of delivery. PMID:25073537
Banks, Paul James; Burroughs, Amelia Caroline; Barker, Gareth Robert Isaac; Brown, Jon Thomas; Warburton, Elizabeth Clea; Bashir, Zafar Iqbal
2015-01-01
Functional connectivity between the hippocampus and prefrontal cortex (PFC) is essential for associative recognition memory and working memory. Disruption of hippocampal–PFC synchrony occurs in schizophrenia, which is characterized by hypofunction of NMDA receptor (NMDAR)-mediated transmission. We demonstrate that activity of dopamine D2-like receptors (D2Rs) leads selectively to long-term depression (LTD) of hippocampal–PFC NMDAR-mediated synaptic transmission. We show that dopamine-dependent LTD of NMDAR-mediated transmission profoundly disrupts normal synaptic transmission between hippocampus and PFC. These results show how dopaminergic activation induces long-term hypofunction of NMDARs, which can contribute to disordered functional connectivity, a characteristic that is a hallmark of psychiatric disorders such as schizophrenia. PMID:26286993
Meixell, Brandt W.; Arnold, Todd W.; Lindberg, Mark S.; Smith, Matthew M.; Runstadler, Jonathan A.; Ramey, Andy M.
2016-01-01
Methods: We used molecular methods to screen blood samples and cloacal/oropharyngeal swabs collected from 1347 ducks of five species during May-August 2010, in interior Alaska, for the presence of hematozoa, Influenza A Virus (IAV), and IAV antibodies. Using models to account for imperfect detection of parasites, we estimated seasonal variation in prevalence of three parasite genera (Haemoproteus, Plasmodium, Leucocytozoon) and investigated how co-infection with parasites and viruses were related to the probability of infection. Results: We detected parasites from each hematozoan genus in adult and juvenile ducks of all species sampled. Seasonal patterns in detection and prevalence varied by parasite genus and species, age, and sex of duck hosts. The probabilities of infection for Haemoproteus and Leucocytozoon parasites were strongly positively correlated, but hematozoa infection was not correlated with IAV infection or serostatus. The probability of Haemoproteus infection was negatively related to body condition in juvenile ducks; relationships between Leucocytozoon infection and body condition varied among host species. Conclusions: We present prevalence estimates for Haemoproteus, Leucocytozoon, and Plasmodium infections in waterfowl at the interface of the sub-Arctic and Arctic and provide evidence for local transmission of all three parasite genera. Variation in prevalence and molecular detection of hematozoa parasites in wild ducks is influenced by seasonal timing and a number of host traits. A positive correlation in co-infection of Leucocytozoon and Haemoproteus suggests that infection probability by parasites in one or both genera is enhanced by infection with the other, or that encounter rates of hosts and genus-specific vectors are correlated. Using size-adjusted mass as an index of host condition, we did not find evidence for strong deleterious consequences of hematozoa infection in wild ducks.
Diagnoses of HIV-1 and HIV-2 in England, Wales, and Northern Ireland associated with west Africa.
Dougan, S; Patel, B; Tosswill, J H; Sinka, K
2005-08-01
To describe HIV diagnoses, including those of HIV-2 infection, made in England, Wales, and Northern Ireland (E,W&NI) among those probably infected in west Africa, and to consider whether there is evidence for ongoing heterosexual transmission within the United Kingdom. Reports of new HIV diagnoses received at the Communicable Disease Surveillance Centre were analysed. Individuals probably infected in west Africa and those infected through heterosexual intercourse within the United Kingdom by a heterosexual partner infected in west Africa were included. Between 1985 and 2003 inclusive, 1324 individuals diagnosed and reported with HIV had probably been infected in west Africa, with 222 diagnoses made in 2003. 917 (69%) were HIV-1 infected and 52 (6%) HIV-2 or HIV-1/HIV-2 co-infected. For 355 (27%) the HIV type was not reported. The proportion of HIV-2 and HIV-1/HIV-2 infections varied by country of infection (p<0.001): ranging from the Gambia (11.7%-15.2%) to Nigeria (0.7%-1.0%). A further 130 individuals were probably infected through heterosexual intercourse within the United Kingdom by a heterosexual partner infected in west Africa. 89 (68%) were HIV-1 infected and three (2%) HIV-2 infected or HIV-1/HIV-2 co-infected. For 38 (29%) HIV type was not reported. The number of people infected with HIV in west Africa and diagnosed in E,W&NI has increased in recent years, and there is evidence of heterosexual transmission within the United Kingdom from people infected in west Africa. While numbers of HIV-2 diagnoses remain relatively low, an appreciable proportion of people infected in some west African countries and diagnosed in the United Kingdom may be HIV-2 positive, with implications for prognosis and treatment.
Wildfire exposure and fuel management on western US national forests.
Ager, Alan A; Day, Michelle A; McHugh, Charles W; Short, Karen; Gilbertson-Day, Julie; Finney, Mark A; Calkin, David E
2014-12-01
Substantial investments in fuel management activities on national forests in the western US are part of a national strategy to reduce human and ecological losses from catastrophic wildfire and create fire resilient landscapes. Prioritizing these investments within and among national forests remains a challenge, partly because a comprehensive assessment that establishes the current wildfire risk and exposure does not exist, making it difficult to identify national priorities and target specific areas for fuel management. To gain a broader understanding of wildfire exposure in the national forest system, we analyzed an array of simulated and empirical data on wildfire activity and fuel treatment investments on the 82 western US national forests. We first summarized recent fire data to examine variation among the Forests in ignition frequency and burned area in relation to investments in fuel reduction treatments. We then used simulation modeling to analyze fine-scale spatial variation in burn probability and intensity. We also estimated the probability of a mega-fire event on each of the Forests, and the transmission of fires ignited on national forests to the surrounding urban interface. The analysis showed a good correspondence between recent area burned and predictions from the simulation models. The modeling also illustrated the magnitude of the variation in both burn probability and intensity among and within Forests. Simulated burn probabilities in most instances were lower than historical, reflecting fire exclusion on many national forests. Simulated wildfire transmission from national forests to the urban interface was highly variable among the Forests. We discuss how the results of the study can be used to prioritize investments in hazardous fuel reduction within a comprehensive multi-scale risk management framework. Published by Elsevier Ltd.
Optimal Joint Remote State Preparation of Arbitrary Equatorial Multi-qudit States
NASA Astrophysics Data System (ADS)
Cai, Tao; Jiang, Min
2017-03-01
As an important communication technology, quantum information transmission plays an important role in the future network communication. It involves two kinds of transmission ways: quantum teleportation and remote state preparation. In this paper, we put forward a new scheme for optimal joint remote state preparation (JRSP) of an arbitrary equatorial two-qudit state with hybrid dimensions. Moreover, the receiver can reconstruct the target state with 100 % success probability in a deterministic manner via two spatially separated senders. Based on it, we can extend it to joint remote preparation of arbitrary equatorial multi-qudit states with hybrid dimensions using the same strategy.
NASA Technical Reports Server (NTRS)
Zimmerman, I. H.; Baer, M.; George, T. F.
1979-01-01
Collinear quantum calculations are carried out for reactive F + H2 collisions on two electronic potential energy surfaces. The resulting transmission and reflection probabilities exhibit much greater variation with energy than single-surface studies would lead us to anticipate. Transmission to low-lying product channels is increased by orders of magnitude by the presence of the second surface; however, branching ratios among product states are found to be independent of the initial electronic state of the reactants. These apparently contradictory aspects of the calculation are discussed and a tentative explanation put forward to resolve them.
Organic Over-the-Horizon Targeting for the 2025 Surface Fleet
2015-06-01
Detection Phit Probability of Hit Pk Probability of Kill PLAN People’s Liberation Army Navy PMEL Pacific Marine Environmental Laboratory...probability of hit ( Phit ). 2. Top-Level Functional Flow Block Diagram With the high-level functions of the project’s systems of systems properly
Guinat, Claire; Gogin, Andrey; Blome, Sandra; Keil, Guenther; Pollin, Reiko; Pfeiffer, Dirk U; Dixon, Linda
2016-03-12
African swine fever (ASF) is a major threat to the pig industry in Europe. Since 2007, ASF outbreaks have been ongoing in the Caucasus, Eastern Europe and the Baltic countries, causing severe economic losses for many pig farmers and pork producers. In addition, the number of ASF cases in wild boar populations has dramatically increased over the past few years. Evidence supports direct contact with infectious domestic pigs and wild boars, and consumption of contaminated feed, as the main transmission routes of ASF virus (ASFV) to domestic pigs. However, significant knowledge gaps highlight the urgent need for research to investigate the dynamics of indirect transmission via the environment, the minimal infective doses for contaminated feed ingestion, the probability of effective contacts between infectious wild boars and domestic pigs, the potential for recovered animals to become carriers and a reservoir for transmission, the potential virus persistence within wild boar populations and the influence of human behaviour for the spread of ASFV. This will provide an improved scientific basis to optimise current interventions and develop new tools and strategies to reduce the risk of ASFV transmission to domestic pigs. British Veterinary Association.
Guinat, Claire; Gogin, Andrey; Blome, Sandra; Keil, Guenther; Pollin, Reiko; Pfeiffer, Dirk U.; Dixon, Linda
2016-01-01
African swine fever (ASF) is a major threat to the pig industry in Europe. Since 2007, ASF outbreaks have been ongoing in the Caucasus, Eastern Europe and the Baltic countries, causing severe economic losses for many pig farmers and pork producers. In addition, the number of ASF cases in wild boar populations has dramatically increased over the past few years. Evidence supports direct contact with infectious domestic pigs and wild boars, and consumption of contaminated feed, as the main transmission routes of ASF virus (ASFV) to domestic pigs. However, significant knowledge gaps highlight the urgent need for research to investigate the dynamics of indirect transmission via the environment, the minimal infective doses for contaminated feed ingestion, the probability of effective contacts between infectious wild boars and domestic pigs, the potential for recovered animals to become carriers and a reservoir for transmission, the potential virus persistence within wild boar populations and the influence of human behaviour for the spread of ASFV. This will provide an improved scientific basis to optimise current interventions and develop new tools and strategies to reduce the risk of ASFV transmission to domestic pigs. PMID:26966305
Mimbacas, Adriana; Pérez-Bravo, Fernando; Santos, Jose Luis; Pisciottano, Carmen; Grignola, Rosario; Javiel, Gerardo; Jorge, Ana Maria; Cardoso, Horacio
2004-01-01
Susceptibility to the type 1 diabetes is genetically controlled and there is an increased risk associated with the presence of some specific alleles of the human leukocyte antigens class II loci (DQA1 and DQB1 genes). The purpose of this study is to evaluate the association between type 1 diabetes and HLA DQ alleles using case-parents trios in the admixed population of Uruguay composed by a mixture of Caucasian, Amerindian and Negroid populations. DQA1 and DQB1 genotyping was performed by polimerase chain reaction followed by oligospecific probes hybridization in 51 case-parents trios. The transmission disequilibrium test was used for detecting differential transmission in the HLA DQ loci. DQB1*0302 was the only allele for which preferential transmission is suggested (probability of transmission = 67.56%; exact p-value TDT = 0.047 uncorrected for multiple comparisons). DQA1*0301 allele showed a trend for preferential transmission without achieving statistical significance. This result would confirm the hypothesis previously advanced in a case-control study. Therefore, DQB1*0302 allele could be considered as the most important susceptibility allele for developing type 1 diabetes in Uruguay population.
Self-similar transmission patterns induced by magnetic field effects in graphene
NASA Astrophysics Data System (ADS)
Rodríguez-González, R.; Rodríguez-Vargas, I.; Díaz-Guerrero, D. S.; Gaggero-Sager, L. M.
2018-07-01
In this work we study the propagation of Dirac electrons through Cantor-like structures in graphene. In concrete, we are considering structures with magnetic and electrostatic barriers arrange in Cantor-like fashion. The Dirac-like equation and the transfer matrix approach have been used to obtain the transmission properties. We found self-similar patterns in the transmission probability or transmittance once the magnetic field is incorporated. Moreover, these patterns can be connected with other ones at different scales through well-defined scaling rules. In particular, we have found two scaling rules that become a useful tool to describe the self-similarity of our system. The first expression is related to the generation and the second one to the length of the Cantor-like structure. As far as we know it is the first time that a special self-similar structure in conjunction with magnetic field effects give rise to self-similar transmission patterns. It is also important to remark that according to our knowledge it is fundamental to break some symmetry of graphene in order to obtain self-similar transmission properties. In fact, in our case the time-reversal symmetry is broken by the magnetic field effects.
The Role of Culex pipiens L. (Diptera: Culicidae) in Virus Transmission in Europe
Hernández-Triana, Luis M.; Medlock, Jolyon M.; Fooks, Anthony R.; Carpenter, Simon; Johnson, Nicholas
2018-01-01
Over the past three decades, a range of mosquito-borne viruses that threaten public and veterinary health have emerged or re-emerged in Europe. Mosquito surveillance activities have highlighted the Culex pipiens species complex as being critical for the maintenance of a number of these viruses. This species complex contains morphologically similar forms that exhibit variation in phenotypes that can influence the probability of virus transmission. Critical amongst these is the choice of host on which to feed, with different forms showing different feeding preferences. This influences the ability of the mosquito to vector viruses and facilitate transmission of viruses to humans and domestic animals. Biases towards blood-feeding on avian or mammalian hosts have been demonstrated for different Cx. pipiens ecoforms and emerging evidence of hybrid populations across Europe adds another level of complexity to virus transmission. A range of molecular methods based on DNA have been developed to enable discrimination between morphologically indistinguishable forms, although this remains an active area of research. This review provides a comprehensive overview of developments in the understanding of the ecology, behaviour and genetics of Cx. pipiens in Europe, and how this influences arbovirus transmission. PMID:29473903
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nikiforov, E. P.
2009-07-15
Damage by lightning discharges to lightning arrester cables for 110-175 kV aerial transmission lines is analyzed using data from power systems on incidents with aerial transmission lines over a ten year operating period (1997-2006). It is found that failures of lightning arrester cables occur when a tensile force acts on a cable heated to the melting point by a lightning current. The lightning currents required to heat a cable to this extent are greater for larger cable cross sections. The probability that a lightning discharge will develop decreases as the amplitude of the lightning current increases, which greatly reduces themore » number of lightning discharges which damage TK-70 cables compared to TK-50 cables. In order to increase the reliability of lightning arrester cables for 110 kV aerial transmission lines, TK-70 cables should be used in place of TK-50 cables. The number of lightning discharges per year which damage lightning arrester cables is lowered when the density of aerial transmission lines is reduced within the territory of electrical power systems. An approximate relationship between these two parameters is obtained.« less
Uncertainty plus prior equals rational bias: an intuitive Bayesian probability weighting function.
Fennell, John; Baddeley, Roland
2012-10-01
Empirical research has shown that when making choices based on probabilistic options, people behave as if they overestimate small probabilities, underestimate large probabilities, and treat positive and negative outcomes differently. These distortions have been modeled using a nonlinear probability weighting function, which is found in several nonexpected utility theories, including rank-dependent models and prospect theory; here, we propose a Bayesian approach to the probability weighting function and, with it, a psychological rationale. In the real world, uncertainty is ubiquitous and, accordingly, the optimal strategy is to combine probability statements with prior information using Bayes' rule. First, we show that any reasonable prior on probabilities leads to 2 of the observed effects; overweighting of low probabilities and underweighting of high probabilities. We then investigate 2 plausible kinds of priors: informative priors based on previous experience and uninformative priors of ignorance. Individually, these priors potentially lead to large problems of bias and inefficiency, respectively; however, when combined using Bayesian model comparison methods, both forms of prior can be applied adaptively, gaining the efficiency of empirical priors and the robustness of ignorance priors. We illustrate this for the simple case of generic good and bad options, using Internet blogs to estimate the relevant priors of inference. Given this combined ignorant/informative prior, the Bayesian probability weighting function is not only robust and efficient but also matches all of the major characteristics of the distortions found in empirical research. PsycINFO Database Record (c) 2012 APA, all rights reserved.
Concurrency and HIV transmission network characteristics among MSM with recent HIV infection.
Pines, Heather A; Wertheim, Joel O; Liu, Lin; Garfein, Richard S; Little, Susan J; Karris, Maile Y
2016-11-28
Sexual partner concurrency is common among MSM and may increase the probability of HIV transmission during recent (acute or early) infection. We examined the relationship between concurrency and HIV transmission network characteristics (proxies for HIV transmission) among MSM with recent HIV infection. Observational study integrating behavioral, clinical, and molecular epidemiology. We inferred a partial HIV transmission network using 986 HIV-1 pol sequences obtained from HIV-infected individuals in San Diego, California (1996-2015). We further analyzed data from 285 recently HIV-infected MSM in the network who provided information on up to three sexual partners in the past 3 months, including the timing of intercourse with each partner. Concurrency was defined as sexual partners overlapping in time. Logistic and negative binomial regressions were used to investigate the link between concurrency and HIV transmission network characteristics (i.e. clustering and degree or number of connections to others in the network) among these MSM. Of recently HIV-infected MSM (n = 285), 54% reported concurrent partnerships and 54% were connected by at least one putative transmission link to others (i.e. clustered) in the network (median degree = 1.0; interquartile range: 0.0-3.0). Concurrency was positively associated with HIV transmission network clustering (adjusted odds ratio = 1.83, 95% confidence interval: 1.08, 3.10) and degree (adjusted incidence rate ratio = 1.48, 95% confidence interval: 1.02, 2.15). Our findings provide empirical evidence consistent with the hypothesis that concurrency facilitates HIV transmission during recent infection. Interventions to mitigate the impact of concurrency on HIV transmission may help curb the HIV epidemic among MSM.
18 CFR 358.8 - Implementation requirements.
Code of Federal Regulations, 2011 CFR
2011-04-01
... those of its affiliates that employ or retain marketing function employees, and these must be available... standards of conduct on the date it commences transmission transactions with an affiliate that engages in marketing functions. (b) Compliance measures and written procedures. (1) A transmission provider must...
1978-03-01
for the risk of rupture for a unidirectionally laminat - ed composite subjected to pure bending. (5D This equation can be simplified further by use of...C EVALUATION OF THE THREE PARAMETER WEIBULL DISTRIBUTION FUNCTION FOR PREDICTING FRACTURE PROBABILITY IN COMPOSITE MATERIALS. THESIS / AFIT/GAE...EVALUATION OF THE THREE PARAMETER WE1BULL DISTRIBUTION FUNCTION FOR PREDICTING FRACTURE PROBABILITY IN COMPOSITE MATERIALS THESIS Presented
Influence of support conditions on vertical whole-body vibration of the seated human body.
M-Pranesh, Anand; Rakheja, Subhash; Demont, Richard
2010-01-01
The vibration transmission to the lumbar and thoracic segments of seated human subjects exposed to whole body vibration of a vehicular nature have been mostly characterised without the back and hand supports, which is not representative of general driving conditions. This non-invasive experimental study investigated the transmission of vertical seat vibration to selected vertebrae and the head along the vertical and fore-aft axes of twelve male human subjects seated on a rigid seat and exposed to random vertical excitation in the 0.5-20 Hz range. The measurements were performed under four different sitting postures involving combinations of back support conditions and hands positions, and three difference magnitudes of vertical vibration (0.25, 0.5 and 1.0 m/s(2) rms acceleration). The results showed significant errors induced by sensor misalignment and skin effects, which required appropriate correction methodologies. The averaged corrected responses revealed that the back support attenuates vibration in the vertical axis to all the body locations while increasing the fore-aft transmissibility at the C7 and T5. The hands position generally has a relatively smaller effect, showing some influences on the C7 and L5 vibration. Sitting without a back support resulted in very low magnitude fore-aft vibration at T5, which was substantially higher with a back support, suggestive of a probable change in the body's vibration mode. The effect of back support was observed to be very small on the horizontal vibration of the lower thoracic and lumbar regions. The results suggest that distinctly different target body-segment biodynamic functions need to be defined for different support conditions in order to represent the unique contribution of the specific support condition. These datasets may then be useful for the development of biodynamic models.
Tompkins, Adrian M; Ermert, Volker
2013-02-18
The relative roles of climate variability and population related effects in malaria transmission could be better understood if regional-scale dynamical malaria models could account for these factors. A new dynamical community malaria model is introduced that accounts for the temperature and rainfall influences on the parasite and vector life cycles which are finely resolved in order to correctly represent the delay between the rains and the malaria season. The rainfall drives a simple but physically based representation of the surface hydrology. The model accounts for the population density in the calculation of daily biting rates. Model simulations of entomological inoculation rate and circumsporozoite protein rate compare well to data from field studies from a wide range of locations in West Africa that encompass both seasonal endemic and epidemic fringe areas. A focus on Bobo-Dioulasso shows the ability of the model to represent the differences in transmission rates between rural and peri-urban areas in addition to the seasonality of malaria. Fine spatial resolution regional integrations for Eastern Africa reproduce the malaria atlas project (MAP) spatial distribution of the parasite ratio, and integrations for West and Eastern Africa show that the model grossly reproduces the reduction in parasite ratio as a function of population density observed in a large number of field surveys, although it underestimates malaria prevalence at high densities probably due to the neglect of population migration. A new dynamical community malaria model is publicly available that accounts for climate and population density to simulate malaria transmission on a regional scale. The model structure facilitates future development to incorporate migration, immunity and interventions.
2013-01-01
Background The relative roles of climate variability and population related effects in malaria transmission could be better understood if regional-scale dynamical malaria models could account for these factors. Methods A new dynamical community malaria model is introduced that accounts for the temperature and rainfall influences on the parasite and vector life cycles which are finely resolved in order to correctly represent the delay between the rains and the malaria season. The rainfall drives a simple but physically based representation of the surface hydrology. The model accounts for the population density in the calculation of daily biting rates. Results Model simulations of entomological inoculation rate and circumsporozoite protein rate compare well to data from field studies from a wide range of locations in West Africa that encompass both seasonal endemic and epidemic fringe areas. A focus on Bobo-Dioulasso shows the ability of the model to represent the differences in transmission rates between rural and peri-urban areas in addition to the seasonality of malaria. Fine spatial resolution regional integrations for Eastern Africa reproduce the malaria atlas project (MAP) spatial distribution of the parasite ratio, and integrations for West and Eastern Africa show that the model grossly reproduces the reduction in parasite ratio as a function of population density observed in a large number of field surveys, although it underestimates malaria prevalence at high densities probably due to the neglect of population migration. Conclusions A new dynamical community malaria model is publicly available that accounts for climate and population density to simulate malaria transmission on a regional scale. The model structure facilitates future development to incorporate migration, immunity and interventions. PMID:23419192
Biophoton signal transmission and processing in the brain.
Tang, Rendong; Dai, Jiapei
2014-10-05
The transmission and processing of neural information in the nervous system plays a key role in neural functions. It is well accepted that neural communication is mediated by bioelectricity and chemical molecules via the processes called bioelectrical and chemical transmission, respectively. Indeed, the traditional theories seem to give valuable explanations for the basic functions of the nervous system, but difficult to construct general accepted concepts or principles to provide reasonable explanations of higher brain functions and mental activities, such as perception, learning and memory, emotion and consciousness. Therefore, many unanswered questions and debates over the neural encoding and mechanisms of neuronal networks remain. Cell to cell communication by biophotons, also called ultra-weak photon emissions, has been demonstrated in several plants, bacteria and certain animal cells. Recently, both experimental evidence and theoretical speculation have suggested that biophotons may play a potential role in neural signal transmission and processing, contributing to the understanding of the high functions of nervous system. In this paper, we review the relevant experimental findings and discuss the possible underlying mechanisms of biophoton signal transmission and processing in the nervous system. Copyright © 2014 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Roest, Annette M. C.; Dubas, Judith Semon; Gerris, Jan R. M.
2010-01-01
This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and…
Decomposition of conditional probability for high-order symbolic Markov chains.
Melnik, S S; Usatenko, O V
2017-07-01
The main goal of this paper is to develop an estimate for the conditional probability function of random stationary ergodic symbolic sequences with elements belonging to a finite alphabet. We elaborate on a decomposition procedure for the conditional probability function of sequences considered to be high-order Markov chains. We represent the conditional probability function as the sum of multilinear memory function monomials of different orders (from zero up to the chain order). This allows us to introduce a family of Markov chain models and to construct artificial sequences via a method of successive iterations, taking into account at each step increasingly high correlations among random elements. At weak correlations, the memory functions are uniquely expressed in terms of the high-order symbolic correlation functions. The proposed method fills the gap between two approaches, namely the likelihood estimation and the additive Markov chains. The obtained results may have applications for sequential approximation of artificial neural network training.
Decomposition of conditional probability for high-order symbolic Markov chains
NASA Astrophysics Data System (ADS)
Melnik, S. S.; Usatenko, O. V.
2017-07-01
The main goal of this paper is to develop an estimate for the conditional probability function of random stationary ergodic symbolic sequences with elements belonging to a finite alphabet. We elaborate on a decomposition procedure for the conditional probability function of sequences considered to be high-order Markov chains. We represent the conditional probability function as the sum of multilinear memory function monomials of different orders (from zero up to the chain order). This allows us to introduce a family of Markov chain models and to construct artificial sequences via a method of successive iterations, taking into account at each step increasingly high correlations among random elements. At weak correlations, the memory functions are uniquely expressed in terms of the high-order symbolic correlation functions. The proposed method fills the gap between two approaches, namely the likelihood estimation and the additive Markov chains. The obtained results may have applications for sequential approximation of artificial neural network training.