Calculation of transmission probability by solving an eigenvalue problem
NASA Astrophysics Data System (ADS)
Bubin, Sergiy; Varga, Kálmán
2010-11-01
The electron transmission probability in nanodevices is calculated by solving an eigenvalue problem. The eigenvalues are the transmission probabilities and the number of nonzero eigenvalues is equal to the number of open quantum transmission eigenchannels. The number of open eigenchannels is typically a few dozen at most, thus the computational cost amounts to the calculation of a few outer eigenvalues of a complex Hermitian matrix (the transmission matrix). The method is implemented on a real space grid basis providing an alternative to localized atomic orbital based quantum transport calculations. Numerical examples are presented to illustrate the efficiency of the method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacvarov, D.C.
1981-01-01
A new method for probabilistic risk assessment of transmission line insulation flashovers caused by lightning strokes is presented. The utilized approach of applying the finite element method for probabilistic risk assessment is demonstrated to be very powerful. The reasons for this are two. First, the finite element method is inherently suitable for analysis of three dimensional spaces where the parameters, such as three variate probability densities of the lightning currents, are non-uniformly distributed. Second, the finite element method permits non-uniform discretization of the three dimensional probability spaces thus yielding high accuracy in critical regions, such as the area of themore » low probability events, while at the same time maintaining coarse discretization in the non-critical areas to keep the number of grid points and the size of the problem to a manageable low level. The finite element probabilistic risk assessment method presented here is based on a new multidimensional search algorithm. It utilizes an efficient iterative technique for finite element interpolation of the transmission line insulation flashover criteria computed with an electro-magnetic transients program. Compared to other available methods the new finite element probabilistic risk assessment method is significantly more accurate and approximately two orders of magnitude computationally more efficient. The method is especially suited for accurate assessment of rare, very low probability events.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stuyver, T.; Fias, S., E-mail: sfias@vub.ac.be; De Proft, F.
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based onmore » the atom-atom polarizability.« less
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Estimating transmission probability in schools for the 2009 H1N1 influenza pandemic in Italy.
Clamer, Valentina; Dorigatti, Ilaria; Fumanelli, Laura; Rizzo, Caterina; Pugliese, Andrea
2016-10-12
Epidemic models are being extensively used to understand the main pathways of spread of infectious diseases, and thus to assess control methods. Schools are well known to represent hot spots for epidemic spread; hence, understanding typical patterns of infection transmission within schools is crucial for designing adequate control strategies. The attention that was given to the 2009 A/H1N1pdm09 flu pandemic has made it possible to collect detailed data on the occurrence of influenza-like illness (ILI) symptoms in two primary schools of Trento, Italy. The data collected in the two schools were used to calibrate a discrete-time SIR model, which was designed to estimate the probabilities of influenza transmission within the classes, grades and schools using Markov Chain Monte Carlo (MCMC) methods. We found that the virus was mainly transmitted within class, with lower levels of transmission between students in the same grade and even lower, though not significantly so, among different grades within the schools. We estimated median values of R 0 from the epidemic curves in the two schools of 1.16 and 1.40; on the other hand, we estimated the average number of students infected by the first school case to be 0.85 and 1.09 in the two schools. The discrepancy between the values of R 0 estimated from the epidemic curve or from the within-school transmission probabilities suggests that household and community transmission played an important role in sustaining the school epidemics. The high probability of infection between students in the same class confirms that targeting within-class transmission is key to controlling the spread of influenza in school settings and, as a consequence, in the general population.
Conduction of molecular electronic devices: qualitative insights through atom-atom polarizabilities.
Stuyver, T; Fias, S; De Proft, F; Fowler, P W; Geerlings, P
2015-03-07
The atom-atom polarizability and the transmission probability at the Fermi level, as obtained through the source-and-sink-potential method for every possible configuration of contacts simultaneously, are compared for polycyclic aromatic compounds. This comparison leads to the conjecture that a positive atom-atom polarizability is a necessary condition for transmission to take place in alternant hydrocarbons without non-bonding orbitals and that the relative transmission probability for different configurations of the contacts can be predicted by analyzing the corresponding atom-atom polarizability. A theoretical link between the two considered properties is derived, leading to a mathematical explanation for the observed trends for transmission based on the atom-atom polarizability.
Tuberculosis in a South African prison – a transmission modelling analysis
Johnstone-Robertson, Simon; Lawn, Stephen D; Welte, Alex; Bekker, Linda-Gail; Wood, Robin
2015-01-01
Background Prisons are recognised internationally as institutions with very high tuberculosis (TB) burdens where transmission is predominantly determined by contact between infectious and susceptible prisoners. A recent South African court case described the conditions under which prisoners awaiting trial were kept. With the use of these data, a mathematical model was developed to explore the interactions between incarceration conditions and TB control measures. Methods Cell dimensions, cell occupancy, lock-up time, TB incidence and treatment delays were derived from court evidence and judicial reports. Using the Wells-Riley equation and probability analyses of contact between prisoners, we estimated the current TB transmission probability within prison cells, and estimated transmission probabilities of improved levels of case finding in combination with implementation of national and international minimum standards for incarceration. Results Levels of overcrowding (230%) in communal cells and poor TB case finding result in annual TB transmission risks of 90% per annum. Implementing current national or international cell occupancy recommendations would reduce TB transmission probabilities by 30% and 50%, respectively. Improved passive case finding, modest ventilation increase or decreased lock-up time would minimally impact on transmission if introduced individually. However, active case finding together with implementation of minimum national and international standards of incarceration could reduce transmission by 50% and 94%, respectively. Conclusions Current conditions of detention for awaiting-trial prisoners are highly conducive for spread of drug-sensitive and drug-resistant TB. Combinations of simple well-established scientific control measures should be implemented urgently. PMID:22272961
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marseguerra, M.; Pauli, G.
1958-07-01
The kinetic behavior of thermal neutrons in a time-offlight spectrometer is examined. An analytical method for obtaining the expressions for the probability for slow neutron transmission through a revolving slit (the general case of a curved slit is considered) is presented and discussed in detail. (auth)
NASA gear research and its probable effect on rotorcraft transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Townsend, D. P.; Coy, J. J.
1979-01-01
The results of the NASA gear research is reviewed as well as those programs which are presently being undertaken. Research programs studying pitting fatigue, gear steels and processing, life prediction methods, gear design and dynamics, elastohydrodynamic lubrication, lubrication methods and gear noise are presented. The impact of advanced gear research technology on rotorcraft transmission design is discussed.
NASA gear research and its probable effect on rotorcraft transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Townsend, D. P.; Coy, J. J.
1979-01-01
The NASA Lewis Research Center devised a comprehensive gear technology research program beginning in 1969, the results of which are being integrated into the NASA civilian Helicopter Transmission System Technology Program. Attention is given to the results of this gear research and those programs which are presently being undertaken. In addition, research programs studying pitting fatigue, gear steels and processing, life prediction methods, gear design and dynamics, elastohydrodynamic lubrication, lubrication methods and gear noise are presented. Finally, the impact of advanced gear research technology on rotorcraft transmission design is discussed.
The effect of timing errors in optical digital systems.
NASA Technical Reports Server (NTRS)
Gagliardi, R. M.
1972-01-01
The use of digital transmission with narrow light pulses appears attractive for data communications, but carries with it a stringent requirement on system bit timing. The effects of imperfect timing in direct-detection (noncoherent) optical binary systems are investigated using both pulse-position modulation and on-off keying for bit transmission. Particular emphasis is placed on specification of timing accuracy and an examination of system degradation when this accuracy is not attained. Bit error probabilities are shown as a function of timing errors from which average error probabilities can be computed for specific synchronization methods. Of significance is the presence of a residual or irreducible error probability in both systems, due entirely to the timing system, which cannot be overcome by the data channel.
Detecting a trend change in cross-border epidemic transmission
NASA Astrophysics Data System (ADS)
Maeno, Yoshiharu
2016-09-01
A method for a system of Langevin equations is developed for detecting a trend change in cross-border epidemic transmission. The equations represent a standard epidemiological SIR compartment model and a meta-population network model. The method analyzes a time series of the number of new cases reported in multiple geographical regions. The method is applicable to investigating the efficacy of the implemented public health intervention in managing infectious travelers across borders. It is found that the change point of the probability of travel movements was one week after the WHO worldwide alert on the SARS outbreak in 2003. The alert was effective in managing infectious travelers. On the other hand, it is found that the probability of travel movements did not change at all for the flu pandemic in 2009. The pandemic did not affect potential travelers despite the WHO alert.
Household Transmission of Clostridium difficile to Family Members and Domestic Pets.
Loo, Vivian G; Brassard, Paul; Miller, Mark A
2016-11-01
OBJECTIVE To determine the risk of Clostridium difficile transmission from index cases with C. difficile infection (CDI) to their household contacts and domestic pets. DESIGN A prospective study from April 2011 to June 2013. SETTING Patients with CDI from Canadian tertiary care centers. PARTICIPANTS Patients with CDI, their household human contacts, and pets. METHODS Epidemiologic information and stool or rectal swabs were collected from participants at enrollment and monthly for up to 4 months. Pulsed-field gel electrophoresis (PFGE) was performed on C. difficile isolates. Probable transmission was defined as the conversion of a C. difficile culture-negative contact to C. difficile culture-positive contact with a PFGE pattern indistinguishable or closely related to the index case. Possible transmission was defined as a contact with a positive C. difficile culture at baseline with a strain indistinguishable or closely related to the index case. RESULTS A total of 51 patients with CDI participated in this study; 67 human contacts and 15 pet contacts were included. Overall, 9 human contacts (13.4%) were C. difficile culture positive; 1 contact (1.5%) developed CDI; and 8 contacts were asymptomatic. Of 67 human contacts, probable transmission occurred in 1 human contact (1.5%) and possible transmission occurred in 5 human contacts (7.5%). Of 15 pet contacts, probable transmission occurred in 3 (20%) and possible transmission occurred in 1 (6.7%). CONCLUSIONS There was a high proportion of C. difficile culture positivity at 13.4% among human contacts and asymptomatic carriage of domestic pets reached 26.7%. These results suggest that household transmission of C. difficile may be a source of community-associated cases. Infect Control Hosp Epidemiol 2016;1-7.
Estimating parameter of influenza transmission using regularized least square
NASA Astrophysics Data System (ADS)
Nuraini, N.; Syukriah, Y.; Indratno, S. W.
2014-02-01
Transmission process of influenza can be presented in a mathematical model as a non-linear differential equations system. In this model the transmission of influenza is determined by the parameter of contact rate of the infected host and susceptible host. This parameter will be estimated using a regularized least square method where the Finite Element Method and Euler Method are used for approximating the solution of the SIR differential equation. The new infected data of influenza from CDC is used to see the effectiveness of the method. The estimated parameter represents the contact rate proportion of transmission probability in a day which can influence the number of infected people by the influenza. Relation between the estimated parameter and the number of infected people by the influenza is measured by coefficient of correlation. The numerical results show positive correlation between the estimated parameters and the infected people.
Identification of influential nodes in complex networks: Method from spreading probability viewpoint
NASA Astrophysics Data System (ADS)
Bao, Zhong-Kui; Ma, Chuang; Xiang, Bing-Bing; Zhang, Hai-Feng
2017-02-01
The problem of identifying influential nodes in complex networks has attracted much attention owing to its wide applications, including how to maximize the information diffusion, boost product promotion in a viral marketing campaign, prevent a large scale epidemic and so on. From spreading viewpoint, the probability of one node propagating its information to one other node is closely related to the shortest distance between them, the number of shortest paths and the transmission rate. However, it is difficult to obtain the values of transmission rates for different cases, to overcome such a difficulty, we use the reciprocal of average degree to approximate the transmission rate. Then a semi-local centrality index is proposed to incorporate the shortest distance, the number of shortest paths and the reciprocal of average degree simultaneously. By implementing simulations in real networks as well as synthetic networks, we verify that our proposed centrality can outperform well-known centralities, such as degree centrality, betweenness centrality, closeness centrality, k-shell centrality, and nonbacktracking centrality. In particular, our findings indicate that the performance of our method is the most significant when the transmission rate nears to the epidemic threshold, which is the most meaningful region for the identification of influential nodes.
Transmissibility of Variant Influenza From Swine to Humans: A Modeling Approach
Wong, Karen K.; Gambhir, Manoj; Finelli, Lyn; Swerdlow, David L.; Ostroff, Stephen; Reed, Carrie
2015-01-01
Background Respiratory illness was reported among humans and swine at an agricultural fair in 2011; 3 human infections with an influenza A(H3N2) variant (H3N2v) virus were confirmed. Using epidemiologic investigation data, we sought to estimate H3N2v transmissibility from swine to humans. Methods We developed a model of H3N2v transmission among swine and humans and fit it to data from a cohort of 100 agricultural club members reporting swine contact to estimate transmissibility. A sensitivity analysis was performed varying H3N2v prevalence in the club cohort. Using the best-fit transmission probability, we simulated the number of swine-acquired infections among all fair attendees. Results We estimated the best-fit probability of swine-to-human H3N2v transmission per minute of swine contact. Applying this probability to 14 910 people with swine contact at the fair, we estimate that there were 80 (95% confidence interval [CI], 40–133) H3N2v infections among persons aged <20 years and 58 (95% CI, 29–96) H3N2v infections among person aged ≥20 years. Conclusions Using early data from investigation of a new virus with unclear transmission properties, we estimated the transmissibility of H3N2v from swine to humans and the burden of H3N2v among fair attendees. Although the risk of H3N2v virus infection is small for fair attendees with minimal swine contact, large populations attend agricultural events each year, and human cases will likely occur when infected swine are present. PMID:23794727
Effect of a gap opening on the conductance of graphene with magnetic barrier structures
NASA Astrophysics Data System (ADS)
Esmailpour, Mohammad
2018-04-01
In the present study Klein tunneling in a single-layer gapped graphene was investigated by transfer matrix method under normal magnetic field for one and two magnetic barriers. Calculations show that electron transmission through a magnetic barrier is deflected to positive angles and reduces as the magnitude of magnetic field and especially the energy gap increases. This reduction is even more significant in larger fields so that after reaching a specific value of energy gap, an effective confinement for fermions and suppression of Klein tunneling is reached particularly in normal incidence and the conductance becomes zero. Unlike one barrier, the process of tunneling through two magnetic barriers induces symmetric transmission probability versus the incident angle; even, for lower energy gaps, electron transmission probability increases which in turn reduces total conductance via proper changes in the value of the magnetic field and energy gap. In general, it is concluded that confining electrons in asymmetric transmission through one barrier is conducted better than two barriers.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Evaluation of power system security and development of transmission pricing method
NASA Astrophysics Data System (ADS)
Kim, Hyungchul
The electric power utility industry is presently undergoing a change towards the deregulated environment. This has resulted in unbundling of generation, transmission and distribution services. The introduction of competition into unbundled electricity services may lead system operation closer to its security boundaries resulting in smaller operating safety margins. The competitive environment is expected to lead to lower price rates for customers and higher efficiency for power suppliers in the long run. Under this deregulated environment, security assessment and pricing of transmission services have become important issues in power systems. This dissertation provides new methods for power system security assessment and transmission pricing. In power system security assessment, the following issues are discussed (1) The description of probabilistic methods for power system security assessment; (2) The computation time of simulation methods; (3) on-line security assessment for operation. A probabilistic method using Monte-Carlo simulation is proposed for power system security assessment. This method takes into account dynamic and static effects corresponding to contingencies. Two different Kohonen networks, Self-Organizing Maps and Learning Vector Quantization, are employed to speed up the probabilistic method. The combination of Kohonen networks and Monte-Carlo simulation can reduce computation time in comparison with straight Monte-Carlo simulation. A technique for security assessment employing Bayes classifier is also proposed. This method can be useful for system operators to make security decisions during on-line power system operation. This dissertation also suggests an approach for allocating transmission transaction costs based on reliability benefits in transmission services. The proposed method shows the transmission transaction cost of reliability benefits when transmission line capacities are considered. The ratio between allocation by transmission line capacity-use and allocation by reliability benefits is computed using the probability of system failure.
Epidemiology and Diagnosis of Helicobacter pylori infection.
Mentis, Andreas; Lehours, Philippe; Mégraud, Francis
2015-09-01
During the period reviewed, prevalence studies were essentially performed in less economically advanced countries and a high prevalence was found. The traditional risk factors for Helicobacter pylori positivity were mostly found. Transmission studied by molecular typing showed a familial transmission. The eventual role of water transmission was explored in several studies with controversial results. Concerning diagnosis, most of the invasive and noninvasive methods used for the diagnosis of H. pylori infection are long standing with efficient performance. The most interesting recent improvements in H. pylori diagnosis include advances in endoscopy, developments in molecular methods, and the introduction of omics-based techniques. Interpretation of old or newer method should take into account the pretest probability and the prevalence of H. pylori in the population under investigation. © 2015 John Wiley & Sons Ltd.
Models of epidemics: when contact repetition and clustering should be included
Smieszek, Timo; Fiebig, Lena; Scholz, Roland W
2009-01-01
Background The spread of infectious disease is determined by biological factors, e.g. the duration of the infectious period, and social factors, e.g. the arrangement of potentially contagious contacts. Repetitiveness and clustering of contacts are known to be relevant factors influencing the transmission of droplet or contact transmitted diseases. However, we do not yet completely know under what conditions repetitiveness and clustering should be included for realistically modelling disease spread. Methods We compare two different types of individual-based models: One assumes random mixing without repetition of contacts, whereas the other assumes that the same contacts repeat day-by-day. The latter exists in two variants, with and without clustering. We systematically test and compare how the total size of an outbreak differs between these model types depending on the key parameters transmission probability, number of contacts per day, duration of the infectious period, different levels of clustering and varying proportions of repetitive contacts. Results The simulation runs under different parameter constellations provide the following results: The difference between both model types is highest for low numbers of contacts per day and low transmission probabilities. The number of contacts and the transmission probability have a higher influence on this difference than the duration of the infectious period. Even when only minor parts of the daily contacts are repetitive and clustered can there be relevant differences compared to a purely random mixing model. Conclusion We show that random mixing models provide acceptable estimates of the total outbreak size if the number of contacts per day is high or if the per-contact transmission probability is high, as seen in typical childhood diseases such as measles. In the case of very short infectious periods, for instance, as in Norovirus, models assuming repeating contacts will also behave similarly as random mixing models. If the number of daily contacts or the transmission probability is low, as assumed for MRSA or Ebola, particular consideration should be given to the actual structure of potentially contagious contacts when designing the model. PMID:19563624
Napp, S; Allepuz, A; García-Bocanegra, I; Alba, A; Vilar, M J; Casal, J
2011-03-15
Given that bluetongue (BT) may potentially be transmitted by semen, that the disease has significantly expanded in recent years, and that millions of doses of cattle semen are annually traded throughout the world, the transmission of bluetongue virus (BTV) by semen could have severe consequences in the cattle industry. The hypothesis that infected bulls could excrete BTV in their semen led to restrictions on international trade of ruminant semen and the establishment of measures to prevent BTV transmission by semen. However, neither the risk of BTV transmission by semen nor the effectiveness of these measures was estimated quantitatively. The objective of the study was to assess, in case of introduction of BTV into a bovine semen collection centre (SCC), both the risk of BTV transmission by bovine semen and the risk reduction achieved by some of the preventive measures, by means of a stochastic risk assessment model. The model was applied to different scenarios, depending on for example the type of diagnostic test and the interval between the controls (testing) of donor bulls, or the rate of BTV spread within the SCC. Enzyme-linked immunosorbant assay (ELISA) controls of donor bulls every 60 days seemed to be an ineffective method for reducing the risk of BTV transmission in contrast to polymerase chain reaction (PCR) tests every 28 days. An increase in the rate of spread within the SCC resulted in a reduced risk of BTV transmission by semen. The storage of semen for 30 days prior to dispatch seemed to be an efficient way of reducing the risk of transmission by semen. The sensitivity analysis identified the probability of BTV shedding in semen as a crucial parameter in the probability of BTV transmission by semen. However, there is a great degree of uncertainty associated with this parameter, with significant differences depending on the BTV serotype. Copyright © 2011 Elsevier Inc. All rights reserved.
Viral Linkage in HIV-1 Seroconverters and Their Partners in an HIV-1 Prevention Clinical Trial
Campbell, Mary S.; Mullins, James I.; Hughes, James P.; Celum, Connie; Wong, Kim G.; Raugi, Dana N.; Sorensen, Stefanie; Stoddard, Julia N.; Zhao, Hong; Deng, Wenjie; Kahle, Erin; Panteleeff, Dana; Baeten, Jared M.; McCutchan, Francine E.; Albert, Jan; Leitner, Thomas; Wald, Anna; Corey, Lawrence; Lingappa, Jairam R.
2011-01-01
Background Characterization of viruses in HIV-1 transmission pairs will help identify biological determinants of infectiousness and evaluate candidate interventions to reduce transmission. Although HIV-1 sequencing is frequently used to substantiate linkage between newly HIV-1 infected individuals and their sexual partners in epidemiologic and forensic studies, viral sequencing is seldom applied in HIV-1 prevention trials. The Partners in Prevention HSV/HIV Transmission Study (ClinicalTrials.gov #NCT00194519) was a prospective randomized placebo-controlled trial that enrolled serodiscordant heterosexual couples to determine the efficacy of genital herpes suppression in reducing HIV-1 transmission; as part of the study analysis, HIV-1 sequences were examined for genetic linkage between seroconverters and their enrolled partners. Methodology/Principal Findings We obtained partial consensus HIV-1 env and gag sequences from blood plasma for 151 transmission pairs and performed deep sequencing of env in some cases. We analyzed sequences with phylogenetic techniques and developed a Bayesian algorithm to evaluate the probability of linkage. For linkage, we required monophyletic clustering between enrolled partners' sequences and a Bayesian posterior probability of ≥50%. Adjudicators classified each seroconversion, finding 108 (71.5%) linked, 40 (26.5%) unlinked, and 3 (2.0%) indeterminate transmissions, with linkage determined by consensus env sequencing in 91 (84%). Male seroconverters had a higher frequency of unlinked transmissions than female seroconverters. The likelihood of transmission from the enrolled partner was related to time on study, with increasing numbers of unlinked transmissions occurring after longer observation periods. Finally, baseline viral load was found to be significantly higher among linked transmitters. Conclusions/Significance In this first use of HIV-1 sequencing to establish endpoints in a large clinical trial, more than one-fourth of transmissions were unlinked to the enrolled partner, illustrating the relevance of these methods in the design of future HIV-1 prevention trials in serodiscordant couples. A hierarchy of sequencing techniques, analysis methods, and expert adjudication contributed to the linkage determination process. PMID:21399681
Bacterial adhesion forces to Ag-impregnated contact lens cases and transmission to contact lenses.
Qu, Wenwen; Busscher, Henk J; van der Mei, Henny C; Hooymans, Johanna M M
2013-03-01
To measure adhesion forces of Pseudomonas aeruginosa, Staphylococcus aureus, and Serratia marcescens to a rigid contact lens (CL), standard polypropylene, and Ag-impregnated lens cases using atomic force microscopy and determine bacterial transmission from lens case to CL. Adhesion forces of bacterial strains to Ag-impregnated and polypropylene lens cases and a rigid CL were measured using atomic force microscopy. Adhesion forces were used to calculate Weibull distributions, from which transmission probabilities from lens case to CL were derived. Transmission probabilities were compared with actual transmission of viable bacteria from a lens case to the CL in 0.9% NaCl and in an antimicrobial lens care solution. Bacterial transmission probabilities from polypropylene lens cases based on force analysis coincided well for all strains with actual transmission in 0.9% NaCl. Bacterial adhesion forces on Ag-impregnated lens cases were much smaller than that on polypropylene and CLs, yielding a high probability of transmission. Comparison with actual bacterial transmission indicated bacterial killing due to Ag ions during colony-forming unit transmission from an Ag-impregnated lens case, especially for P. aeruginosa. Transmission of viable bacteria from Ag-impregnated lens cases could be further decreased by use of an antimicrobial lens care solution instead of 0.9% NaCl. Bacterial transmission probabilities are higher from Ag-impregnated lens cases than from polypropylene lens cases because of small adhesion forces, but this is compensated for by enhanced bacterial killing due to Ag impregnation, especially when in combination with an antimicrobial lens care solution. This calls for a balanced combination of antimicrobial lens care solutions and surface properties of a lens case and CL.
Kennedy, Paula L; Woodbury, Allan D
2002-01-01
In ground water flow and transport modeling, the heterogeneous nature of porous media has a considerable effect on the resulting flow and solute transport. Some method of generating the heterogeneous field from a limited dataset of uncertain measurements is required. Bayesian updating is one method that interpolates from an uncertain dataset using the statistics of the underlying probability distribution function. In this paper, Bayesian updating was used to determine the heterogeneous natural log transmissivity field for a carbonate and a sandstone aquifer in southern Manitoba. It was determined that the transmissivity in m2/sec followed a natural log normal distribution for both aquifers with a mean of -7.2 and - 8.0 for the carbonate and sandstone aquifers, respectively. The variograms were calculated using an estimator developed by Li and Lake (1994). Fractal nature was not evident in the variogram from either aquifer. The Bayesian updating heterogeneous field provided good results even in cases where little data was available. A large transmissivity zone in the sandstone aquifer was created by the Bayesian procedure, which is not a reflection of any deterministic consideration, but is a natural outcome of updating a prior probability distribution function with observations. The statistical model returns a result that is very reasonable; that is homogeneous in regions where little or no information is available to alter an initial state. No long range correlation trends or fractal behavior of the log-transmissivity field was observed in either aquifer over a distance of about 300 km.
NASA Astrophysics Data System (ADS)
Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.
2011-04-01
One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.
Andreo, Verónica; Glass, Gregory; Shields, Timothy; Provensal, Cecilia; Polop, Jaime
2011-09-01
We constructed a model to predict the potential distribution of Oligoryzomys longicaudatus, the reservoir of Andes virus (Genus: Hantavirus), in Argentina. We developed an extensive database of occurrence records from published studies and our own surveys and compared two methods to model the probability of O. longicaudatus presence; logistic regression and MaxEnt algorithm. The environmental variables used were tree, grass and bare soil cover from MODIS imagery and, altitude and 19 bioclimatic variables from WorldClim database. The models performances were evaluated and compared both by threshold dependent and independent measures. The best models included tree and grass cover, mean diurnal temperature range, and precipitation of the warmest and coldest seasons. The potential distribution maps for O. longicaudatus predicted the highest occurrence probabilities along the Andes range, from 32°S and narrowing southwards. They also predicted high probabilities for the south-central area of Argentina, reaching the Atlantic coast. The Hantavirus Pulmonary Syndrome cases coincided with mean occurrence probabilities of 95 and 77% for logistic and MaxEnt models, respectively. HPS transmission zones in Argentine Patagonia matched the areas with the highest probability of presence. Therefore, colilargos presence probability may provide an approximate risk of transmission and act as an early tool to guide control and prevention plans.
Double Barriers and Magnetic Field in Bilayer Graphene
NASA Astrophysics Data System (ADS)
Redouani, Ilham; Jellal, Ahmed; Bahlouli, Hocine
2015-12-01
We study the transmission probability in an AB-stacked bilayer graphene of Dirac fermions scattered by a double-barrier structure in the presence of a magnetic field. We take into account the full four bands structure of the energy spectrum and use the suitable boundary conditions to determine the transmission probability. Our numerical results show that for energies higher than the interlayer coupling, four ways for transmission are possible while for energies less than the height of the barrier, Dirac fermions exhibit transmission resonances and only one transmission channel is available. We show that, for AB-stacked bilayer graphene, there is no Klein tunneling at normal incidence. We find that the transmission displays sharp peaks inside the transmission gap around the Dirac point within the barrier regions while they are absent around the Dirac point in the well region. The effect of the magnetic field, interlayer electrostatic potential, and various barrier geometry parameters on the transmission probabilities is also discussed.
Microwave Analysis with Monte Carlo Methods for ECH Transmission Lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaufman, Michael C.; Lau, Cornwall H.; Hanson, Gregory R.
A new code framework, MORAMC, is presented which model transmission line (TL) systems consisting of overmoded circular waveguide and other components including miter bends and transmission line gaps. The transmission line is modeled as a set of mode converters in series where each component is composed of one or more converters. The parametrization of each mode converter can account for the fabrication tolerances of physically realizable components. These tolerances as well as the precision to which these TL systems can be installed and aligned gives a practical limit to which the uncertainty of the microwave performance of the system canmore » be calculated. Because of this, Monte Carlo methods are a natural fit and are employed to calculate the probability distribution that a given TL can deliver a required power and mode purity. Several examples are given to demonstrate the usefulness of MORAMC in optimizing TL systems.« less
Microwave Analysis with Monte Carlo Methods for ECH Transmission Lines
Kaufman, Michael C.; Lau, Cornwall H.; Hanson, Gregory R.
2018-03-08
A new code framework, MORAMC, is presented which model transmission line (TL) systems consisting of overmoded circular waveguide and other components including miter bends and transmission line gaps. The transmission line is modeled as a set of mode converters in series where each component is composed of one or more converters. The parametrization of each mode converter can account for the fabrication tolerances of physically realizable components. These tolerances as well as the precision to which these TL systems can be installed and aligned gives a practical limit to which the uncertainty of the microwave performance of the system canmore » be calculated. Because of this, Monte Carlo methods are a natural fit and are employed to calculate the probability distribution that a given TL can deliver a required power and mode purity. Several examples are given to demonstrate the usefulness of MORAMC in optimizing TL systems.« less
Microwave Analysis with Monte Carlo Methods for ECH Transmission Lines
NASA Astrophysics Data System (ADS)
Kaufman, M. C.; Lau, C.; Hanson, G. R.
2018-03-01
A new code framework, MORAMC, is presented which model transmission line (TL) systems consisting of overmoded circular waveguide and other components including miter bends and transmission line gaps. The transmission line is modeled as a set of mode converters in series where each component is composed of one or more converters. The parametrization of each mode converter can account for the fabrication tolerances of physically realizable components. These tolerances as well as the precision to which these TL systems can be installed and aligned gives a practical limit to which the uncertainty of the microwave performance of the system can be calculated. Because of this, Monte Carlo methods are a natural fit and are employed to calculate the probability distribution that a given TL can deliver a required power and mode purity. Several examples are given to demonstrate the usefulness of MORAMC in optimizing TL systems.
Ebrahimi, Sahar; Bordbar, Ali; Rastaghi, Ahmad R Esmaeili; Parvizi, Parviz
2016-06-01
Cutaneous leishmaniasis (CL) is a complex vector-borne disease caused by Leishmania parasites that are transmitted by the bite of several species of infected female phlebotomine sand flies. Monthly factor analysis of climatic variables indicated fundamental variables. Principal component-based regionalization was used for recognition of climatic zones using a clustering integrated method that identified five climatic zones based on factor analysis. To investigate spatial distribution of the sand fly species, the kriging method was used as an advanced geostatistical procedure in the ArcGIS modeling system that is beneficial to design measurement plans and to predict the transmission cycle in various regions of Khuzestan province, southwest of Iran. However, more than an 80% probability of P. papatasi was observed in rainy and temperate bio-climatic zones with a high potential of CL transmission. Finding P. sergenti revealed the probability of transmission and distribution patterns of a non-native vector of CL in related zones. These findings could be used as models indicating climatic zones and environmental variables connected to sand fly presence and vector distribution. Furthermore, this information is appropriate for future research efforts into the ecology of Phlebotomine sand flies and for the prevention of CL vector transmission as a public health priority. © 2016 The Society for Vector Ecology.
Performance Analysis of Cluster Formation in Wireless Sensor Networks.
Montiel, Edgar Romo; Rivero-Angeles, Mario E; Rubino, Gerardo; Molina-Lozano, Heron; Menchaca-Mendez, Rolando; Menchaca-Mendez, Ricardo
2017-12-13
Clustered-based wireless sensor networks have been extensively used in the literature in order to achieve considerable energy consumption reductions. However, two aspects of such systems have been largely overlooked. Namely, the transmission probability used during the cluster formation phase and the way in which cluster heads are selected. Both of these issues have an important impact on the performance of the system. For the former, it is common to consider that sensor nodes in a clustered-based Wireless Sensor Network (WSN) use a fixed transmission probability to send control data in order to build the clusters. However, due to the highly variable conditions experienced by these networks, a fixed transmission probability may lead to extra energy consumption. In view of this, three different transmission probability strategies are studied: optimal, fixed and adaptive. In this context, we also investigate cluster head selection schemes, specifically, we consider two intelligent schemes based on the fuzzy C-means and k-medoids algorithms and a random selection with no intelligence. We show that the use of intelligent schemes greatly improves the performance of the system, but their use entails higher complexity and selection delay. The main performance metrics considered in this work are energy consumption, successful transmission probability and cluster formation latency. As an additional feature of this work, we study the effect of errors in the wireless channel and the impact on the performance of the system under the different transmission probability schemes.
Performance Analysis of Cluster Formation in Wireless Sensor Networks
Montiel, Edgar Romo; Rivero-Angeles, Mario E.; Rubino, Gerardo; Molina-Lozano, Heron; Menchaca-Mendez, Rolando; Menchaca-Mendez, Ricardo
2017-01-01
Clustered-based wireless sensor networks have been extensively used in the literature in order to achieve considerable energy consumption reductions. However, two aspects of such systems have been largely overlooked. Namely, the transmission probability used during the cluster formation phase and the way in which cluster heads are selected. Both of these issues have an important impact on the performance of the system. For the former, it is common to consider that sensor nodes in a clustered-based Wireless Sensor Network (WSN) use a fixed transmission probability to send control data in order to build the clusters. However, due to the highly variable conditions experienced by these networks, a fixed transmission probability may lead to extra energy consumption. In view of this, three different transmission probability strategies are studied: optimal, fixed and adaptive. In this context, we also investigate cluster head selection schemes, specifically, we consider two intelligent schemes based on the fuzzy C-means and k-medoids algorithms and a random selection with no intelligence. We show that the use of intelligent schemes greatly improves the performance of the system, but their use entails higher complexity and selection delay. The main performance metrics considered in this work are energy consumption, successful transmission probability and cluster formation latency. As an additional feature of this work, we study the effect of errors in the wireless channel and the impact on the performance of the system under the different transmission probability schemes. PMID:29236065
Estimating malaria transmission from humans to mosquitoes in a noisy landscape
Reiner, Robert C.; Guerra, Carlos; Donnelly, Martin J.; Bousema, Teun; Drakeley, Chris; Smith, David L.
2015-01-01
A basic quantitative understanding of malaria transmission requires measuring the probability a mosquito becomes infected after feeding on a human. Parasite prevalence in mosquitoes is highly age-dependent, and the unknown age-structure of fluctuating mosquito populations impedes estimation. Here, we simulate mosquito infection dynamics, where mosquito recruitment is modelled seasonally with fractional Brownian noise, and we develop methods for estimating mosquito infection rates. We find that noise introduces bias, but the magnitude of the bias depends on the ‘colour' of the noise. Some of these problems can be overcome by increasing the sampling frequency, but estimates of transmission rates (and estimated reductions in transmission) are most accurate and precise if they combine parity, oocyst rates and sporozoite rates. These studies provide a basis for evaluating the adequacy of various entomological sampling procedures for measuring malaria parasite transmission from humans to mosquitoes and for evaluating the direct transmission-blocking effects of a vaccine. PMID:26400195
Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12
Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted
2012-01-01
SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962
The neutron channeling phenomenon.
Khanouchi, A; Sabir, A; Boulkheir, M; Ichaoui, R; Ghassoun, J; Jehouani, A
1997-01-01
Shields, used for protection against radiation, are often pierced with vacuum channels for passing cables and other instruments for measurements. The neutron transmission through these shields is an unavoidable phenomenon. In this work we study and discuss the effect of channels on neutron transmission through shields. We consider an infinite homogeneous slab, with a fixed thickness (20 lambda, with lambda the mean free path of the neutron in the slab), which contains a vacuum channel. This slab is irradiated with an infinite source of neutrons on the left side and on the other side (right side) many detectors with windows equal to 2 lambda are placed in order to evaluate the neutron transmission probabilities (Khanouchi, A., Aboubekr, A., Ghassoun, J. and Jehouani, A. (1994) Rencontre Nationale des Jeunes Chercheurs en Physique. Casa Blanca Maroc; Khanouchi, A., Sabir, A., Ghassoun, J. and Jehouani, A. (1995) Premier Congré International des Intéractions Rayonnements Matière. Eljadida Maroc). The neutron history within the slab is simulated by the Monte Carlo method (Booth, T. E. and Hendricks, J. S. (1994) Nuclear Technology 5) and using the exponential biasing technique in order to improve the Monte Carlo calculation (Levitt, L. B. (1968) Nuclear Science and Engineering 31, 500-504; Jehouani, A., Ghassoun, J. and Aboubker, A. (1994) In Proceedings of the 6th International Symposium on Radiation Physics, Rabat, Morocco). Then different geometries of the vacuum channel have been studied. For each geometry we have determined the detector response and calculated the neutron transmission probability for different detector positions. This neutron transmission probability presents a peak for the detectors placed in front of the vacuum channel. This study allowed us to clearly identify the neutron channeling phenomenon. One application of our study is to detect vacuum defects in materials.
An epidemiological model of virus transmission in salmonid fishes of the Columbia River Basin
Ferguson, Paige F. B.; Breyta, Rachel; Brito, Ilana L.; Kurath, Gael; LaDeau, Shannon L.
2018-01-01
We have developed a dynamic epidemiological model informed by records of viral presence and genotypes to evaluate potential transmission routes maintaining a viral pathogen in economically and culturally important anadromous fish populations. In the Columbia River Basin, infectious hematopoietic necrosis virus (IHNV) causes severe disease, predominantly in juvenile steelhead trout (Oncorhynchus mykiss) and less frequently in Chinook salmon (O. tshawytscha). Mortality events following IHNV infection can be devastating for individual hatchery programs. Despite reports of high local mortality and extensive surveillance efforts, there are questions about how viral transmission is maintained. Modeling this system offers important insights into disease transmission in natural aquatic systems, as well as about the data requirements for generating accurate estimates about transmission routes and infection probabilities. We simulated six scenarios in which testing rates and the relative importance of different transmission routes varied. The simulations demonstrated that the model accurately identified routes of transmission and inferred infection probabilities accurately when there was testing of all cohort-sites. When testing records were incomplete, the model accurately inferred which transmission routes exposed particular cohort-sites but generated biased infection probabilities given exposure. After validating the model and generating guidelines for result interpretation, we applied the model to data from 14 annual cohorts (2000–2013) at 24 focal sites in a sub-region of the Columbia River Basin, the lower Columbia River (LCR), to quantify the relative importance of potential transmission routes in this focal sub-region. We demonstrate that exposure to IHNV via the return migration of adult fish is an important route for maintaining IHNV in the LCR sub-region, and the probability of infection following this exposure was relatively high at 0.16. Although only 1% of cohort-sites experienced self-exposure by infected juvenile fish, this transmission route had the greatest probability of infection (0.22). Increased testing and/or determining whether transmission can occur from cohort-sites without testing records (e.g., determining there was no testing record because there were no fish at the cohort-site) are expected to improve inference about infection probabilities. Increased use of secure water supplies and continued use of biosecurity protocols may reduce IHNV transmission from adult fish and juvenile fish within the site, respectively, to juvenile salmonids at hatcheries. Models and conclusions from this study are potentially relevant to understanding the relative importance of transmission routes for other important aquatic pathogens in salmonids, including the agents of bacterial kidney disease and coldwater disease, and the basic approach may be useful for other pathogens and hosts in other geographic regions.
Mikolajczyk, Rafael T; Kauermann, Göran; Sagel, Ulrich; Kretzschmar, Mirjam
2009-08-01
Creation of a mixture model based on Poisson processes for assessment of the extent of cross-transmission of multidrug-resistant pathogens in the hospital. We propose a 2-component mixture of Poisson processes to describe the time series of detected cases of colonization. The first component describes the admission process of patients with colonization, and the second describes the cross-transmission. The data set used to illustrate the method consists of the routinely collected records for methicillin-resistant Staphylococcus aureus (MRSA), imipenem-resistant Pseudomonas aeruginosa, and multidrug-resistant Acinetobacter baumannii over a period of 3 years in a German tertiary care hospital. For MRSA and multidrug-resistant A. baumannii, cross-transmission was estimated to be responsible for more than 80% of cases; for imipenem-resistant P. aeruginosa, cross-transmission was estimated to be responsible for 59% of cases. For new cases observed within a window of less than 28 days for MRSA and multidrug-resistant A. baumannii or 40 days for imipenem-resistant P. aeruginosa, there was a 50% or greater probability that the cause was cross-transmission. The proposed method offers a solution to assessing of the extent of cross-transmission, which can be of clinical use. The method can be applied using freely available software (the package FlexMix in R) and it requires relatively little data.
Stability of excitons in double quantum well: Through electron and holes transmission probabilities
NASA Astrophysics Data System (ADS)
Vignesh, G.; Nithiananthi, P.
2017-05-01
Stability of excitons has been analyzed using the transmission probability of its constituent particles in GaAs/Al0.3Ga0.7As Double Quantum Well (DQW) structure by varying well and barrier layer thickness. The effective mass approximation is used and anisotropy in material properties are also considered to get realistic situations. It is observed that tuning barrier layer avails many resonance peaks for the transmission and tuning well width admits maximum transmission at narrow well widths. Every saddle point of the observed transmission coefficients decides the formation, strength and transportation of excitons in DQW.
NASA Astrophysics Data System (ADS)
Bellentani, Laura; Beggi, Andrea; Bordone, Paolo; Bertoni, Andrea
2018-05-01
We present a numerical study of a multichannel electronic Mach-Zehnder interferometer, based on magnetically driven noninteracting edge states. The electron path is defined by a full-scale potential landscape on the two-dimensional electron gas at filling factor 2, assuming initially only the first Landau level as filled. We tailor the two beamsplitters with 50 % interchannel mixing and measure Aharonov-Bohm oscillations in the transmission probability of the second channel. We perform time-dependent simulations by solving the electron Schrödinger equation through a parallel implementation of the split-step Fourier method, and we describe the charge-carrier wave function as a Gaussian wave packet of edge states. We finally develop a simplified theoretical model to explain the features observed in the transmission probability, and we propose possible strategies to optimize gate performances.
Percha, Bethany; Newman, M. E. J.; Foxman, Betsy
2012-01-01
Group B Streptococcus (GBS) remains a major cause of neonatal sepsis and is an emerging cause of invasive bacterial infections. The 9 known serotypes vary in virulence, and there is little cross-immunity. Key parameters for planning an effective vaccination strategy, such as average length of immunity and transmission probabilities by serotype, are unknown. We simulated GBS spread in a population using a computational model with parameters derived from studies of GBS sexual transmission in a college dormitory. Here we provide estimates of the duration of immunity relative to the transmission probabilities for the 3 GBS serotypes most associated with invasive disease: Ia, III, and V. We also place upper limits on the durations of immunity for serotype Ia (570 days), III (1125 days) and V (260 days). Better transmission estimates are required to establish the epidemiological parameters of GBS infection and determine the best vaccination strategies to prevent GBS disease. PMID:21605704
A Statistical Framework for Microbial Source Attribution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Velsko, S P; Allen, J E; Cunningham, C T
2009-04-28
This report presents a general approach to inferring transmission and source relationships among microbial isolates from their genetic sequences. The outbreak transmission graph (also called the transmission tree or transmission network) is the fundamental structure which determines the statistical distributions relevant to source attribution. The nodes of this graph are infected individuals or aggregated sub-populations of individuals in which transmitted bacteria or viruses undergo clonal expansion, leading to a genetically heterogeneous population. Each edge of the graph represents a transmission event in which one or a small number of bacteria or virions infects another node thus increasing the size ofmore » the transmission network. Recombination and re-assortment events originate in nodes which are common to two distinct networks. In order to calculate the probability that one node was infected by another, given the observed genetic sequences of microbial isolates sampled from them, we require two fundamental probability distributions. The first is the probability of obtaining the observed mutational differences between two isolates given that they are separated by M steps in a transmission network. The second is the probability that two nodes sampled randomly from an outbreak transmission network are separated by M transmission events. We show how these distributions can be obtained from the genetic sequences of isolates obtained by sampling from past outbreaks combined with data from contact tracing studies. Realistic examples are drawn from the SARS outbreak of 2003, the FMDV outbreak in Great Britain in 2001, and HIV transmission cases. The likelihood estimators derived in this report, and the underlying probability distribution functions required to calculate them possess certain compelling general properties in the context of microbial forensics. These include the ability to quantify the significance of a sequence 'match' or 'mismatch' between two isolates; the ability to capture non-intuitive effects of network structure on inferential power, including the 'small world' effect; the insensitivity of inferences to uncertainties in the underlying distributions; and the concept of rescaling, i.e. ability to collapse sub-networks into single nodes and examine transmission inferences on the rescaled network.« less
Identification of transmissivity fields using a Bayesian strategy and perturbative approach
NASA Astrophysics Data System (ADS)
Zanini, Andrea; Tanda, Maria Giovanna; Woodbury, Allan D.
2017-10-01
The paper deals with the crucial problem of the groundwater parameter estimation that is the basis for efficient modeling and reclamation activities. A hierarchical Bayesian approach is developed: it uses the Akaike's Bayesian Information Criteria in order to estimate the hyperparameters (related to the covariance model chosen) and to quantify the unknown noise variance. The transmissivity identification proceeds in two steps: the first, called empirical Bayesian interpolation, uses Y* (Y = lnT) observations to interpolate Y values on a specified grid; the second, called empirical Bayesian update, improve the previous Y estimate through the addition of hydraulic head observations. The relationship between the head and the lnT has been linearized through a perturbative solution of the flow equation. In order to test the proposed approach, synthetic aquifers from literature have been considered. The aquifers in question contain a variety of boundary conditions (both Dirichelet and Neuman type) and scales of heterogeneities (σY2 = 1.0 and σY2 = 5.3). The estimated transmissivity fields were compared to the true one. The joint use of Y* and head measurements improves the estimation of Y considering both degrees of heterogeneity. Even if the variance of the strong transmissivity field can be considered high for the application of the perturbative approach, the results show the same order of approximation of the non-linear methods proposed in literature. The procedure allows to compute the posterior probability distribution of the target quantities and to quantify the uncertainty in the model prediction. Bayesian updating has advantages related both to the Monte-Carlo (MC) and non-MC approaches. In fact, as the MC methods, Bayesian updating allows computing the direct posterior probability distribution of the target quantities and as non-MC methods it has computational times in the order of seconds.
Emergence and maintenance of infectious salmon anaemia virus (ISAV) in Europe: a new hypothesis.
Nylund, A; Devold, M; Plarre, H; Isdal, E; Aarseth, M
2003-08-15
The present study describes the use of molecular methods in studying infectious salmon anaemia virus (ISAV), an important pathogen of farmed salmon in Norway, Scotland, the Faeroe Islands, Canada, USA and Chile. The nucleotide sequences of the haemagglutinin gene (HA) from 70 ISAV isolates have been analysed for phylogenetic relationship and the average mutation rate of nucleotide substitutions calculated. The isolates constitute 2 major groups, 1 European and 1 North American group. The isolate from Chile is closely related to the North American isolates. The European isolates can be further divided into 3 separate groups reflecting geographical distribution, time of collection, and transmission connected with farming activity. Based on existing information about infectious salmon anaemia (ISA) and new information emerging from the present study, it is hypothesised that: (1) ISAV is maintained in wild populations of trout and salmon in Europe; (2) it is transmitted between wild hosts mainly during their freshwater spawning phase in rivers; (3) wild salmonids, mainly trout, possibly carry benign wild-type ISAV isolates; (4) a change (mutation) in virulence probably results from deletions of amino acid segments from the highly polymorphic region (HPR) of benign wild-type isolates; (5) ISA emerges in farmed Atlantic salmon when mutated isolates are transmitted from wild salmonids or, following mutation of benign isolates, in farmed salmon after transmission from wild salmonids; (6) farming activity is an important factor in transmission of ISAV between farming sites in addition to transmission of ISAV from wild salmonids to farmed salmon; (7) transmission of ISAV from farmed to wild salmonids probably occurs less frequently than transmission from wild to farmed fish due to lower frequency of susceptible wild individuals; (8) the frequency of new outbreaks of ISA in farmed salmon probably reflects natural variation in the prevalence of ISAV in wild populations of salmonids.
Horizontal transmission of group B streptococcus in a neonatal intensive care unit
Morinis, Julia; Shah, Jay; Murthy, Prashanth; Fulford, Martha
2011-01-01
The incidence of early-onset group B streptococcal (GBS) sepsis in the neonatal population has decreased substantially since the introduction of maternal intrapartum antibiotic prophylaxis and routine prenatal screening. However, these strategies have not reduced the incidence of late-onset GBS infections. Additional research pertaining to the transmission of late-onset GBS infections is required to develop effective preventive methods. The present report describes probable horizontal transmission of late-onset GBS infection among three infants in a neonatal intensive care unit. GBS strain confirmation was based on the microbiological picture, antibiogram and pulsed-field gel electrophoresis. These cases highlight the morbidity associated with late-onset GBS disease and the importance of considering horizontal transmission as an etiological factor in GBS infection in the newborn period. Further studies assessing horizontal transmission in late-onset GBS disease may improve prevention and early intervention. PMID:22654550
Horizontal transmission of group B streptococcus in a neonatal intensive care unit.
Morinis, Julia; Shah, Jay; Murthy, Prashanth; Fulford, Martha
2011-06-01
The incidence of early-onset group B streptococcal (GBS) sepsis in the neonatal population has decreased substantially since the introduction of maternal intrapartum antibiotic prophylaxis and routine prenatal screening. However, these strategies have not reduced the incidence of late-onset GBS infections. Additional research pertaining to the transmission of late-onset GBS infections is required to develop effective preventive methods. The present report describes probable horizontal transmission of late-onset GBS infection among three infants in a neonatal intensive care unit. GBS strain confirmation was based on the microbiological picture, antibiogram and pulsed-field gel electrophoresis. These cases highlight the morbidity associated with late-onset GBS disease and the importance of considering horizontal transmission as an etiological factor in GBS infection in the newborn period. Further studies assessing horizontal transmission in late-onset GBS disease may improve prevention and early intervention.
A generating function approach to HIV transmission with dynamic contact rates
Romero-Severson, Ethan O.; Meadors, Grant D.; Volz, Erik M.
2014-04-24
The basic reproduction number, R 0, is often defined as the average number of infections generated by a newly infected individual in a fully susceptible population. The interpretation, meaning, and derivation of R 0 are controversial. However, in the context of mean field models, R 0 demarcates the epidemic threshold below which the infected population approaches zero in the limit of time. In this manner, R 0 has been proposed as a method for understanding the relative impact of public health interventions with respect to disease eliminations from a theoretical perspective. The use of R 0 is made more complexmore » by both the strong dependency of R 0 on the model form and the stochastic nature of transmission. A common assumption in models of HIV transmission that have closed form expressions for R 0 is that a single individual’s behavior is constant over time. For this research, we derive expressions for both R 0 and probability of an epidemic in a finite population under the assumption that people periodically change their sexual behavior over time. We illustrate the use of generating functions as a general framework to model the effects of potentially complex assumptions on the number of transmissions generated by a newly infected person in a susceptible population. In conclusion, we find that the relationship between the probability of an epidemic and R 0 is not straightforward, but, that as the rate of change in sexual behavior increases both R 0 and the probability of an epidemic also decrease.« less
A generating function approach to HIV transmission with dynamic contact rates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romero-Severson, Ethan O.; Meadors, Grant D.; Volz, Erik M.
The basic reproduction number, R 0, is often defined as the average number of infections generated by a newly infected individual in a fully susceptible population. The interpretation, meaning, and derivation of R 0 are controversial. However, in the context of mean field models, R 0 demarcates the epidemic threshold below which the infected population approaches zero in the limit of time. In this manner, R 0 has been proposed as a method for understanding the relative impact of public health interventions with respect to disease eliminations from a theoretical perspective. The use of R 0 is made more complexmore » by both the strong dependency of R 0 on the model form and the stochastic nature of transmission. A common assumption in models of HIV transmission that have closed form expressions for R 0 is that a single individual’s behavior is constant over time. For this research, we derive expressions for both R 0 and probability of an epidemic in a finite population under the assumption that people periodically change their sexual behavior over time. We illustrate the use of generating functions as a general framework to model the effects of potentially complex assumptions on the number of transmissions generated by a newly infected person in a susceptible population. In conclusion, we find that the relationship between the probability of an epidemic and R 0 is not straightforward, but, that as the rate of change in sexual behavior increases both R 0 and the probability of an epidemic also decrease.« less
Transmission rights and market power
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bushnell, J.
1999-10-01
Most of the concerns about physical transmission rights relate to the ability to implicitly or explicitly remove that transmission capacity from the market-place. Under a very strict form of physical right, owners could simply choose not to sell it if they don't want to use it. Modifications that require the release of spare capacity back into an open market could potentially alleviate this problem but there is concern that such releases would not occur far enough in advance to be of much use to schedulers. Similarly, the transmission capacity that is made available for use by non-rights holders can alsomore » be manipulated by the owners of transmission rights. The alternative form, financial transmission rights, provide to their owners congestion payments, but physical control of transmission paths. In electricity markets such as California's, even financial transmission rights could potentially be utilized to effectively withhold transmission capacity from the marketplace. However, methods for withholding transmission capacity are somewhat more convoluted, and probably more difficult, for owners of financial rights than for owners of physical rights. In this article, the author discusses some of the potential concerns over transmission rights and their use for the exercise of various forms of market power.« less
Health Monitoring Survey of Bell 412EP Transmissions
NASA Technical Reports Server (NTRS)
Tucker, Brian E.; Dempsey, Paula J.
2016-01-01
Health and usage monitoring systems (HUMS) use vibration-based Condition Indicators (CI) to assess the health of helicopter powertrain components. A fault is detected when a CI exceeds its threshold value. The effectiveness of fault detection can be judged on the basis of assessing the condition of actual components from fleet aircraft. The Bell 412 HUMS-equipped helicopter is chosen for such an evaluation. A sample of 20 aircraft included 12 aircraft with confirmed transmission and gearbox faults (detected by CIs) and eight aircraft with no known faults. The associated CI data is classified into "healthy" and "faulted" populations based on actual condition and these populations are compared against their CI thresholds to quantify the probability of false alarm and the probability of missed detection. Receiver Operator Characteristic analysis is used to optimize thresholds. Based on the results of the analysis, shortcomings in the classification method are identified for slow-moving CI trends. Recommendations for improving classification using time-dependent receiver-operator characteristic methods are put forth. Finally, lessons learned regarding OEM-operator communication are presented.
Estimating malaria transmission from humans to mosquitoes in a noisy landscape.
Reiner, Robert C; Guerra, Carlos; Donnelly, Martin J; Bousema, Teun; Drakeley, Chris; Smith, David L
2015-10-06
A basic quantitative understanding of malaria transmission requires measuring the probability a mosquito becomes infected after feeding on a human. Parasite prevalence in mosquitoes is highly age-dependent, and the unknown age-structure of fluctuating mosquito populations impedes estimation. Here, we simulate mosquito infection dynamics, where mosquito recruitment is modelled seasonally with fractional Brownian noise, and we develop methods for estimating mosquito infection rates. We find that noise introduces bias, but the magnitude of the bias depends on the 'colour' of the noise. Some of these problems can be overcome by increasing the sampling frequency, but estimates of transmission rates (and estimated reductions in transmission) are most accurate and precise if they combine parity, oocyst rates and sporozoite rates. These studies provide a basis for evaluating the adequacy of various entomological sampling procedures for measuring malaria parasite transmission from humans to mosquitoes and for evaluating the direct transmission-blocking effects of a vaccine. © 2015 The Authors.
Wet climate and transportation routes accelerate spread of human plague
Xu, Lei; Stige, Leif Chr.; Kausrud, Kyrre Linné; Ben Ari, Tamara; Wang, Shuchun; Fang, Xiye; Schmid, Boris V.; Liu, Qiyong; Stenseth, Nils Chr.; Zhang, Zhibin
2014-01-01
Currently, large-scale transmissions of infectious diseases are becoming more closely associated with accelerated globalization and climate change, but quantitative analyses are still rare. By using an extensive dataset consisting of date and location of cases for the third plague pandemic from 1772 to 1964 in China and a novel method (nearest neighbour approach) which deals with both short- and long-distance transmissions, we found the presence of major roads, rivers and coastline accelerated the spread of plague and shaped the transmission patterns. We found that plague spread velocity was positively associated with wet conditions (measured by an index of drought and flood events) in China, probably due to flood-driven transmission by people or rodents. Our study provides new insights on transmission patterns and possible mechanisms behind variability in transmission speed, with implications for prevention and control measures. The methodology may also be applicable to studies of disease dynamics or species movement in other systems. PMID:24523275
Stochastic Models of Emerging Infectious Disease Transmission on Adaptive Random Networks
Pipatsart, Navavat; Triampo, Wannapong
2017-01-01
We presented adaptive random network models to describe human behavioral change during epidemics and performed stochastic simulations of SIR (susceptible-infectious-recovered) epidemic models on adaptive random networks. The interplay between infectious disease dynamics and network adaptation dynamics was investigated in regard to the disease transmission and the cumulative number of infection cases. We found that the cumulative case was reduced and associated with an increasing network adaptation probability but was increased with an increasing disease transmission probability. It was found that the topological changes of the adaptive random networks were able to reduce the cumulative number of infections and also to delay the epidemic peak. Our results also suggest the existence of a critical value for the ratio of disease transmission and adaptation probabilities below which the epidemic cannot occur. PMID:29075314
A Bayesian method for inferring transmission chains in a partially observed epidemic.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marzouk, Youssef M.; Ray, Jaideep
2008-10-01
We present a Bayesian approach for estimating transmission chains and rates in the Abakaliki smallpox epidemic of 1967. The epidemic affected 30 individuals in a community of 74; only the dates of appearance of symptoms were recorded. Our model assumes stochastic transmission of the infections over a social network. Distinct binomial random graphs model intra- and inter-compound social connections, while disease transmission over each link is treated as a Poisson process. Link probabilities and rate parameters are objects of inference. Dates of infection and recovery comprise the remaining unknowns. Distributions for smallpox incubation and recovery periods are obtained from historicalmore » data. Using Markov chain Monte Carlo, we explore the joint posterior distribution of the scalar parameters and provide an expected connectivity pattern for the social graph and infection pathway.« less
Conductance of three-terminal molecular bridge based on tight-binding theory
NASA Astrophysics Data System (ADS)
Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada
2005-05-01
The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.
Qu, Wenwen; Hooymans, Johanna M M; Qiu, Jun; de-Bont, Nik; Gelling, Onko-Jan; van der Mei, Henny C; Busscher, Henk J
2013-05-01
Surface properties of lens cases are determinant for their cleanability and for microbial transmission from lens cases to contact lenses (CLs). PEG-polymer-brush-coatings are known to decrease microbial adhesion more than other surface-coatings. Here, we applied a robust, silica nanoparticles-based brush-coating to polypropylene cases to evaluate their ease of cleaning and probability of bacterial transmission to CLs. Adhesion forces of nine bacterial strains (Pseudomonas, Staphylococci, and Serratia) to rigid CLs, polypropylene, and silica nanoparticles-based brush-coated polypropylene were measured using atomic-force-microscopy and subjected to Weibull analyses to yield bacterial transmission probabilities. Biofilms of each strain were grown in coated and uncoated cases and rinsed with a NaCl or antimicrobial lens care solution. Residual, viable organisms were quantified. Bacterial adhesion forces of all strains were significantly, up to tenfold smaller on brush-coated than on uncoated polypropylene. This yielded, higher transmission probabilities to a CL, but mild-rinsing yielded 10-100 fold higher removal of bacteria from brush-coated than from polypropylene cases. Moreover, due to weak adhesion forces, bacteria on brush-coated cases were two-to-three fold more susceptible to an antimicrobial lens care solution than on polypropylene cases. Therewith, the design of lens case surfaces is a compromise between ease of cleaning and transmission probability to CLs. Copyright © 2013 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Ngampitipan, Tritos; Boonserm, Petarpa; Chatrabhuti, Auttakit; Visser, Matt
2016-06-01
Hawking radiation is the evidence for the existence of black hole. What an observer can measure through Hawking radiation is the transmission probability. In the laboratory, miniature black holes can successfully be generated. The generated black holes are, most commonly, Myers-Perry black holes. In this paper, we will derive the rigorous bounds on the transmission probabilities for massless scalar fields of non-negative-angular-momentum modes emitted from a generated Myers-Perry black hole in six, seven, and eight dimensions. The results show that for low energy, the rigorous bounds increase with the increase in the energy of emitted particles. However, for high energy, the rigorous bounds decrease with the increase in the energy of emitted particles. When the black holes spin faster, the rigorous bounds decrease. For dimension dependence, the rigorous bounds also decrease with the increase in the number of extra dimensions. Furthermore, as comparison to the approximate transmission probability, the rigorous bound is proven to be useful.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ngampitipan, Tritos, E-mail: tritos.ngampitipan@gmail.com; Particle Physics Research Laboratory, Department of Physics, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330; Boonserm, Petarpa, E-mail: petarpa.boonserm@gmail.com
Hawking radiation is the evidence for the existence of black hole. What an observer can measure through Hawking radiation is the transmission probability. In the laboratory, miniature black holes can successfully be generated. The generated black holes are, most commonly, Myers-Perry black holes. In this paper, we will derive the rigorous bounds on the transmission probabilities for massless scalar fields of non-negative-angular-momentum modes emitted from a generated Myers-Perry black hole in six, seven, and eight dimensions. The results show that for low energy, the rigorous bounds increase with the increase in the energy of emitted particles. However, for high energy,more » the rigorous bounds decrease with the increase in the energy of emitted particles. When the black holes spin faster, the rigorous bounds decrease. For dimension dependence, the rigorous bounds also decrease with the increase in the number of extra dimensions. Furthermore, as comparison to the approximate transmission probability, the rigorous bound is proven to be useful.« less
Wang, Dawei; Ren, Pinyi; Du, Qinghe; Sun, Li; Wang, Yichen
2016-01-01
The rapid proliferation of independently-designed and -deployed wireless sensor networks extremely crowds the wireless spectrum and promotes the emergence of cognitive radio sensor networks (CRSN). In CRSN, the sensor node (SN) can make full use of the unutilized licensed spectrum, and the spectrum efficiency is greatly improved. However, inevitable spectrum sensing errors will adversely interfere with the primary transmission, which may result in primary transmission outage. To compensate the adverse effect of spectrum sensing errors, we propose a reciprocally-benefited secure transmission strategy, in which SN’s interference to the eavesdropper is employed to protect the primary confidential messages while the CRSN is also rewarded with a loose spectrum sensing error probability constraint. Specifically, according to the spectrum sensing results and primary users’ activities, there are four system states in this strategy. For each state, we analyze the primary secrecy rate and the SN’s transmission rate by taking into account the spectrum sensing errors. Then, the SN’s transmit power is optimally allocated for each state so that the average transmission rate of CRSN is maximized under the constraint of the primary maximum permitted secrecy outage probability. In addition, the performance tradeoff between the transmission rate of CRSN and the primary secrecy outage probability is investigated. Moreover, we analyze the primary secrecy rate for the asymptotic scenarios and derive the closed-form expression of the SN’s transmission outage probability. Simulation results show that: (1) the performance of the SN’s average throughput in the proposed strategy outperforms the conventional overlay strategy; (2) both the primary network and CRSN benefit from the proposed strategy. PMID:27897988
Romi, R; Boccolini, D; Menegon, M; Rezza, G
2012-11-29
We describe two cases of probable autochthonous introduced Plasmodium vivax malaria that occurred in 2009 and 2011 in two sites of South-Central Italy. Although the sources of the infections were not detected, local transmission could not be disproved and therefore the cases were classified as autochthonous. Sporadic P. vivax cases transmitted by indigenous vectors may be considered possible in some areas of the country where vector abundance and environmental conditions are favourable to malaria transmission.
A Comprehensive Breath Plume Model for Disease Transmission via Expiratory Aerosols
Halloran, Siobhan K.; Wexler, Anthony S.; Ristenpart, William D.
2012-01-01
The peak in influenza incidence during wintertime in temperate regions represents a longstanding, unresolved scientific question. One hypothesis is that the efficacy of airborne transmission via aerosols is increased at lower humidities and temperatures, conditions that prevail in wintertime. Recent work with a guinea pig model by Lowen et al. indicated that humidity and temperature do modulate airborne influenza virus transmission, and several investigators have interpreted the observed humidity dependence in terms of airborne virus survivability. This interpretation, however, neglects two key observations: the effect of ambient temperature on the viral growth kinetics within the animals, and the strong influence of the background airflow on transmission. Here we provide a comprehensive theoretical framework for assessing the probability of disease transmission via expiratory aerosols between test animals in laboratory conditions. The spread of aerosols emitted from an infected animal is modeled using dispersion theory for a homogeneous turbulent airflow. The concentration and size distribution of the evaporating droplets in the resulting “Gaussian breath plume” are calculated as functions of position, humidity, and temperature. The overall transmission probability is modeled with a combination of the time-dependent viral concentration in the infected animal and the probability of droplet inhalation by the exposed animal downstream. We demonstrate that the breath plume model is broadly consistent with the results of Lowen et al., without invoking airborne virus survivability. The results also suggest that, at least for guinea pigs, variation in viral kinetics within the infected animals is the dominant factor explaining the increased transmission probability observed at lower temperatures. PMID:22615902
Effect of tornado loads on transmission lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishac, M.F.; White, H.B.
Of all the populated areas in Canada, southwestern Ontario has experienced the highest tornado incidence and faces the greatest tornado damage. About 1 or 2 tornadoes per 10,000 km{sup 2} can be expected there annually. The probability of a tornado strike at a given point is very small but the probability of a transmission line being crossed by a tornado is significant. The purpose of this paper is to review the literature related to tornadoes in Ontario and to investigate the effect of tornado loads on transmission lines. Based on this investigation a design basis tornado loading for transmission towersmore » is proposed.« less
Effect of tornado loads on transmission lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishac, M.F.; White, H.B.
1994-12-31
Of all the populated areas in Canada, southwestern Ontario has experienced the highest tornado incidence and faces the greatest tornado damage. About 1 or 2 tornadoes per 10,000 km{sup 2} can be expected there annually. The probability of a tornado strike at a given point is very small but the probability of a transmission line being crossed by a tornado is significant. The purpose of this paper is to review the literature related to tornadoes in Ontario and to investigate the effect of tornado loads on transmission lines. Based on this investigation a design basis tornado loading for transmission towersmore » is proposed.« less
Large-scale entomologic assessment of Onchocerca volvulus transmission by poolscreen PCR in Mexico.
Rodríguez-Pérez, Mario A; Katholi, Charles R; Hassan, Hassan K; Unnasch, Thomas R
2006-06-01
To study the impact of mass Mectizan treatment on Onchocerca volvulus transmission in Mexico, entomological surveys were carried out in the endemic foci of Oaxaca, Southern Chiapas, and Northern Chiapas. Collected flies were screened by polymerase chain reaction (PCR) for O. volvulus parasites. The prevalence of infected and infective flies was estimated using the PoolScreen algorithm and with a novel probability-based method. O. volvulus infective larvae were not detected in flies from 6/13 communities. In 7/13 communities, infective flies were detected, with prevalences ranging from 1.6/10,000 to 29.0/10,000 and seasonal transmission potentials ranging from 0.4 to 3.3. Infected and infective flies were found in a community in Northern Chiapas, suggesting that, according to World Health Organization criteria, autochthonous transmission exists in this focus. These data suggest that O. volvulus transmission in Mexico has been suppressed or brought to a level that may be insufficient to sustain the parasite population.
Romero-Severson, Ethan O.; Bulla, Ingo; Hengartner, Nick; Bártolo, Inês; Abecasis, Ana; Azevedo-Pereira, José M.; Taveira, Nuno; Leitner, Thomas
2017-01-01
Diversity of the founding population of Human Immunodeficiency Virus Type 1 (HIV-1) transmissions raises many important biological, clinical, and epidemiological issues. In up to 40% of sexual infections, there is clear evidence for multiple founding variants, which can influence the efficacy of putative prevention methods, and the reconstruction of epidemiologic histories. To infer who-infected-whom, and to compute the probability of alternative transmission scenarios while explicitly taking phylogenetic uncertainty into account, we created an approximate Bayesian computation (ABC) method based on a set of statistics measuring phylogenetic topology, branch lengths, and genetic diversity. We applied our method to a suspected heterosexual transmission case involving three individuals, showing a complex monophyletic-paraphyletic-polyphyletic phylogenetic topology. We detected that seven phylogenetic lineages had been transmitted between two of the individuals based on the available samples, implying that many more unsampled lineages had also been transmitted. Testing whether the lineages had been transmitted at one time or over some length of time suggested that an ongoing superinfection process over several years was most likely. While one individual was found unlinked to the other two, surprisingly, when evaluating two competing epidemiological priors, the donor of the two that did infect each other was not identified by the host root-label, and was also not the primary suspect in that transmission. This highlights that it is important to take epidemiological information into account when analyzing support for one transmission hypothesis over another, as results may be nonintuitive and sensitive to details about sampling dates relative to possible infection dates. Our study provides a formal inference framework to include information on infection and sampling times, and to investigate ancestral node-label states, transmission direction, transmitted genetic diversity, and frequency of transmission. PMID:28912340
The myth of maternal transmission of spongiform encephalopathy.
Ridley, R. M.; Baker, H. F.
1995-01-01
It has long been accepted that the pattern of occurrence of scrapie--the form of spongiform encephalopathy associated with sheep--is determined mainly by maternal transmission, and this view has had a profound influence on policy decisions in the control of bovine spongiform encephalopathy and on public concern over the risk to human health form this disease. The occurrence of maternal transmission is, however, not predicted by modern knowledge of the aetiology of spongiform encephalopathy, and even though claims of maternal transmission have been reiterated frequently in the literature, re-examination of the source data reveals that these data are extremely scanty, unreplicated, and probably subject to ascertainment bias. The probability of maternal transmission of spongiform encephalopathy in any species should be viewed with the greatest scepticism. Images p1073-a PMID:7580668
Probable Tiger-to-Tiger Transmission of Avian Influenza H5N1
Thanawongnuwech, Roongroje; Amonsin, Alongkorn; Tantilertcharoen, Rachod; Damrongwatanapokin, Sudarat; Theamboonlers, Apiradee; Payungporn, Sunchai; Nanthapornphiphat, Kamonchart; Ratanamungklanon, Somchuan; Tunak, Eakchai; Songserm, Thaweesak; Vivatthanavanich, Veravit; Lekdumrongsak, Thawat; Kesdangsakonwut, Sawang; Tunhikorn, Schwann
2005-01-01
During the second outbreak of avian influenza H5N1 in Thailand, probable horizontal transmission among tigers was demonstrated in the tiger zoo. Sequencing and phylogenetic analysis of those viruses showed no differences from the first isolate obtained in January 2004. This finding has implications for influenza virus epidemiology and pathogenicity in mammals. PMID:15890122
Iraola, G; Betancor, L; Calleros, L; Gadea, P; Algorta, G; Galeano, S; Muxi, P; Greif, G; Pérez, R
2015-08-01
Whole-genome characterisation in clinical microbiology enables to detect trends in infection dynamics and disease transmission. Here, we report a case of bacteraemia due to Campylobacter fetus subsp. fetus in a rural worker under cancer treatment that was diagnosed with cellulitis; the patient was treated with antibiotics and recovered. The routine typing methods were not able to identify the microorganism causing the infection, so it was further analysed by molecular methods and whole-genome sequencing. The multi-locus sequence typing (MLST) revealed the presence of the bovine-associated ST-4 genotype. Whole-genome comparisons with other C. fetus strains revealed an inconsistent phylogenetic position based on the core genome, discordant with previous ST-4 strains. To the best of our knowledge, this is the first C. fetus subsp. fetus carrying the ST-4 isolated from humans and represents a probable case of zoonotic transmission from cattle.
Lethal exposure: An integrated approach to pathogen transmission via environmental reservoirs.
Turner, Wendy C; Kausrud, Kyrre L; Beyer, Wolfgang; Easterday, W Ryan; Barandongo, Zoë R; Blaschke, Elisabeth; Cloete, Claudine C; Lazak, Judith; Van Ert, Matthew N; Ganz, Holly H; Turnbull, Peter C B; Stenseth, Nils Chr; Getz, Wayne M
2016-06-06
To mitigate the effects of zoonotic diseases on human and animal populations, it is critical to understand what factors alter transmission dynamics. Here we assess the risk of exposure to lethal concentrations of the anthrax bacterium, Bacillus anthracis, for grazing animals in a natural system over time through different transmission mechanisms. We follow pathogen concentrations at anthrax carcass sites and waterholes for five years and estimate infection risk as a function of grass, soil or water intake, age of carcass sites, and the exposure required for a lethal infection. Grazing, not drinking, seems the dominant transmission route, and transmission is more probable from grazing at carcass sites 1-2 years of age. Unlike most studies of virulent pathogens that are conducted under controlled conditions for extrapolation to real situations, we evaluate exposure risk under field conditions to estimate the probability of a lethal dose, showing that not all reservoirs with detectable pathogens are significant transmission pathways.
Electrostatic and magnetic fields in bilayer graphene
NASA Astrophysics Data System (ADS)
Jellal, Ahmed; Redouani, Ilham; Bahlouli, Hocine
2015-08-01
We compute the transmission probability through rectangular potential barriers and p-n junctions in the presence of a magnetic and electric fields in bilayer graphene taking into account contributions from the full four bands of the energy spectrum. For energy E higher than the interlayer coupling γ1 (E >γ1) two propagation modes are available for transport giving rise to four possible ways for transmission and reflection coefficients. However, when the energy is less than the height of the barrier the Dirac fermions exhibit transmission resonances and only one mode of propagation is available for transport. We study the effect of the interlayer electrostatic potential denoted by δ and variations of different barrier geometry parameters on the transmission probability.
NASA Astrophysics Data System (ADS)
Siettos, Constantinos I.; Anastassopoulou, Cleo; Russo, Lucia; Grigoras, Christos; Mylonakis, Eleftherios
2016-06-01
Based on multiscale agent-based computations we estimated the per-contact probability of transmission by age of the Ebola virus disease (EVD) that swept through Liberia from May 2014 to March 2015. For the approximation of the epidemic dynamics we have developed a detailed agent-based model with small-world interactions between individuals categorized by age. For the estimation of the structure of the evolving contact network as well as the per-contact transmission probabilities by age group we exploited the so called Equation-Free framework. Model parameters were fitted to official case counts reported by the World Health Organization (WHO) as well as to recently published data of key epidemiological variables, such as the mean time to death, recovery and the case fatality rate.
Meixell, Brandt W.; Arnold, Todd W.; Lindberg, Mark S.; Smith, Matthew M.; Runstadler, Jonathan A.; Ramey, Andy M.
2016-01-01
Methods: We used molecular methods to screen blood samples and cloacal/oropharyngeal swabs collected from 1347 ducks of five species during May-August 2010, in interior Alaska, for the presence of hematozoa, Influenza A Virus (IAV), and IAV antibodies. Using models to account for imperfect detection of parasites, we estimated seasonal variation in prevalence of three parasite genera (Haemoproteus, Plasmodium, Leucocytozoon) and investigated how co-infection with parasites and viruses were related to the probability of infection. Results: We detected parasites from each hematozoan genus in adult and juvenile ducks of all species sampled. Seasonal patterns in detection and prevalence varied by parasite genus and species, age, and sex of duck hosts. The probabilities of infection for Haemoproteus and Leucocytozoon parasites were strongly positively correlated, but hematozoa infection was not correlated with IAV infection or serostatus. The probability of Haemoproteus infection was negatively related to body condition in juvenile ducks; relationships between Leucocytozoon infection and body condition varied among host species. Conclusions: We present prevalence estimates for Haemoproteus, Leucocytozoon, and Plasmodium infections in waterfowl at the interface of the sub-Arctic and Arctic and provide evidence for local transmission of all three parasite genera. Variation in prevalence and molecular detection of hematozoa parasites in wild ducks is influenced by seasonal timing and a number of host traits. A positive correlation in co-infection of Leucocytozoon and Haemoproteus suggests that infection probability by parasites in one or both genera is enhanced by infection with the other, or that encounter rates of hosts and genus-specific vectors are correlated. Using size-adjusted mass as an index of host condition, we did not find evidence for strong deleterious consequences of hematozoa infection in wild ducks.
Syphilis transmission: a review of the current evidence
Stoltey, Juliet E.; Cohen, Stephanie E.
2018-01-01
Syphilis remains widespread worldwide, with increasing rates among men who have sex with men. This paper reviews available evidence regarding syphilis transmission, including data on: sexual transmission (transmission probability per sexual partnership), vertical transmission, transmission via blood products and organ donation, and other rare modes of transmission. In addition, host susceptibility to syphilis infection is discussed. Syphilis screening and treatment, condoms and risk-reduction counselling and how they modify syphilis transmission dynamics are considered. PMID:25702043
NASA Astrophysics Data System (ADS)
Sinkin, Oleg V.; Grigoryan, Vladimir S.; Menyuk, Curtis R.
2006-12-01
We introduce a fully deterministic, computationally efficient method for characterizing the effect of nonlinearity in optical fiber transmission systems that utilize wavelength-division multiplexing and return-to-zero modulation. The method accurately accounts for bit-pattern-dependent nonlinear distortion due to collision-induced timing jitter and for amplifier noise. We apply this method to calculate the error probability as a function of channel spacing in a prototypical multichannel return-to-zero undersea system.
Nouvellet, Pierre; Dumonteil, Eric; Gourbière, Sébastien
2013-11-01
Chagas disease has a major impact on human health in Latin America and is becoming of global concern due to international migrations. Trypanosoma cruzi, the etiological agent of the disease, is one of the rare human parasites transmitted by the feces of its vector, as it is unable to reach the salivary gland of the insect. This stercorarian transmission is notoriously poorly understood, despite its crucial role in the ecology and evolution of the pathogen and the disease. The objective of this study was to quantify the probability of T. cruzi vectorial transmission to humans, and to use such an estimate to predict human prevalence from entomological data. We developed several models of T. cruzi transmission to estimate the probability of transmission from vector to host. Using datasets from the literature, we estimated the probability of transmission per contact with an infected triatomine to be 5.8 × 10(-4) (95%CI: [2.6 ; 11.0] × 10(-4)). This estimate was consistent across triatomine species, robust to variations in other parameters, and corresponded to 900-4,000 contacts per case. Our models subsequently allowed predicting human prevalence from vector abundance and infection rate in 7/10 independent datasets covering various triatomine species and epidemiological situations. This low probability of T. cruzi transmission reflected well the complex and unlikely mechanism of transmission via insect feces, and allowed predicting human prevalence from basic entomological data. Although a proof of principle study would now be valuable to validate our models' predictive ability in an even broader range of entomological and ecological settings, our quantitative estimate could allow switching the evaluation of disease risk and vector control program from purely entomological indexes to parasitological measures, as commonly done for other major vector borne diseases. This might lead to different quantitative perspectives as these indexes are well known not to be proportional one to another.
An economic evaluation of home management of malaria in Uganda: an interactive Markov model.
Lubell, Yoel; Mills, Anne J; Whitty, Christopher J M; Staedke, Sarah G
2010-08-27
Home management of malaria (HMM), promoting presumptive treatment of febrile children in the community, is advocated to improve prompt appropriate treatment of malaria in Africa. The cost-effectiveness of HMM is likely to vary widely in different settings and with the antimalarial drugs used. However, no data on the cost-effectiveness of HMM programmes are available. A Markov model was constructed to estimate the cost-effectiveness of HMM as compared to conventional care for febrile illnesses in children without HMM. The model was populated with data from Uganda, but is designed to be interactive, allowing the user to adjust certain parameters, including the antimalarials distributed. The model calculates the cost per disability adjusted life year averted and presents the incremental cost-effectiveness ratio compared to a threshold value. Model output is stratified by level of malaria transmission and the probability that a child would receive appropriate care from a health facility, to indicate the circumstances in which HMM is likely to be cost-effective. The model output suggests that the cost-effectiveness of HMM varies with malaria transmission, the probability of appropriate care, and the drug distributed. Where transmission is high and the probability of appropriate care is limited, HMM is likely to be cost-effective from a provider perspective. Even with the most effective antimalarials, HMM remains an attractive intervention only in areas of high malaria transmission and in medium transmission areas with a lower probability of appropriate care. HMM is generally not cost-effective in low transmission areas, regardless of which antimalarial is distributed. Considering the analysis from the societal perspective decreases the attractiveness of HMM. Syndromic HMM for children with fever may be a useful strategy for higher transmission settings with limited health care and diagnosis, but is not appropriate for all settings. HMM may need to be tailored to specific settings, accounting for local malaria transmission intensity and availability of health services.
Nouvellet, Pierre; Dumonteil, Eric; Gourbière, Sébastien
2013-01-01
Chagas disease has a major impact on human health in Latin America and is becoming of global concern due to international migrations. Trypanosoma cruzi, the etiological agent of the disease, is one of the rare human parasites transmitted by the feces of its vector, as it is unable to reach the salivary gland of the insect. This stercorarian transmission is notoriously poorly understood, despite its crucial role in the ecology and evolution of the pathogen and the disease. The objective of this study was to quantify the probability of T. cruzi vectorial transmission to humans, and to use such an estimate to predict human prevalence from entomological data. We developed several models of T. cruzi transmission to estimate the probability of transmission from vector to host. Using datasets from the literature, we estimated the probability of transmission per contact with an infected triatomine to be 5.8×10−4 (95%CI: [2.6 ; 11.0]×10−4). This estimate was consistent across triatomine species, robust to variations in other parameters, and corresponded to 900–4,000 contacts per case. Our models subsequently allowed predicting human prevalence from vector abundance and infection rate in 7/10 independent datasets covering various triatomine species and epidemiological situations. This low probability of T. cruzi transmission reflected well the complex and unlikely mechanism of transmission via insect feces, and allowed predicting human prevalence from basic entomological data. Although a proof of principle study would now be valuable to validate our models' predictive ability in an even broader range of entomological and ecological settings, our quantitative estimate could allow switching the evaluation of disease risk and vector control program from purely entomological indexes to parasitological measures, as commonly done for other major vector borne diseases. This might lead to different quantitative perspectives as these indexes are well known not to be proportional one to another. PMID:24244766
State-space modeling to support management of brucellosis in the Yellowstone bison population
Hobbs, N. Thompson; Geremia, Chris; Treanor, John; Wallen, Rick; White, P.J.; Hooten, Mevin B.; Rhyan, Jack C.
2015-01-01
The bison (Bison bison) of the Yellowstone ecosystem, USA, exemplify the difficulty of conserving large mammals that migrate across the boundaries of conservation areas. Bison are infected with brucellosis (Brucella abortus) and their seasonal movements can expose livestock to infection. Yellowstone National Park has embarked on a program of adaptive management of bison, which requires a model that assimilates data to support management decisions. We constructed a Bayesian state-space model to reveal the influence of brucellosis on the Yellowstone bison population. A frequency-dependent model of brucellosis transmission was superior to a density-dependent model in predicting out-of-sample observations of horizontal transmission probability. A mixture model including both transmission mechanisms converged on frequency dependence. Conditional on the frequency-dependent model, brucellosis median transmission rate was 1.87 yr−1. The median of the posterior distribution of the basic reproductive ratio (R0) was 1.75. Seroprevalence of adult females varied around 60% over two decades, but only 9.6 of 100 adult females were infectious. Brucellosis depressed recruitment; estimated population growth rate λ averaged 1.07 for an infected population and 1.11 for a healthy population. We used five-year forecasting to evaluate the ability of different actions to meet management goals relative to no action. Annually removing 200 seropositive female bison increased by 30-fold the probability of reducing seroprevalence below 40% and increased by a factor of 120 the probability of achieving a 50% reduction in transmission probability relative to no action. Annually vaccinating 200 seronegative animals increased the likelihood of a 50% reduction in transmission probability by fivefold over no action. However, including uncertainty in the ability to implement management by representing stochastic variation in the number of accessible bison dramatically reduced the probability of achieving goals using interventions relative to no action. Because the width of the posterior predictive distributions of future population states expands rapidly with increases in the forecast horizon, managers must accept high levels of uncertainty. These findings emphasize the necessity of iterative, adaptive management with relatively short-term commitment to action and frequent reevaluation in response to new data and model forecasts. We believe our approach has broad applications.
Transmission of Actinobacillus pleuropneumoniae among weaned piglets on endemically infected farms.
Tobias, T J; Bouma, A; van den Broek, J; van Nes, A; Daemen, A J J M; Wagenaar, J A; Stegeman, J A; Klinkenberg, D
2014-11-01
Clinical outbreaks due to Actinobacillus pleuropneumoniae occur recurrently, despite the wide-scale use of antimicrobials or vaccination. Therefore, new approaches for the prevention and control of these outbreaks are necessary. For the development of alternative measures, more insight into the transmission of the bacterium on farms is necessary. The aim of this cohort study was to quantify transmission of A. pleuropneumoniae amongst weaned piglets on farms. We investigated three possible transmission routes: (i) indirect transmission by infected piglets within the same compartment, (ii) transmission by infected pigs in adjacent pens and (iii) transmission by direct contact within pens. Additionally, we evaluated the effect of independent litter characteristics on the probability of infection. Two farms participated in our study. Serum and tonsil brush samples were collected from sows pre-farrowing. Serum was analysed for antibodies against Apx toxins and Omp. Subsequently, tonsil brush samples were collected from all piglets from these dams (N=542) in three cohorts, 3 days before weaning and 6 weeks later. Tonsil samples were analysed by qPCR for the presence of the apxIVA gene of A. pleuropneumoniae. Before weaning, 25% of the piglets tested positive; 6 weeks later 47% tested positive. Regression and stochastic transmission models were used to assess the contribution of each of the three transmission routes and to estimate transmission rates. Transmission between piglets in adjacent pens did not differ significantly from that between non-adjacent pens. The transmission rate across pens was estimated to be 0.0058 day(-1) (95% CI: 0.0030-0.010), whereas the transmission rate within pens was ten times higher 0.059 day(-1) (95% CI: 0.048-0.072). Subsequently, the effects of parity and serological response of the dam and litter age at weaning on the probability of infection of pigs were evaluated by including these into the regression model. A higher dam ApxII antibody level was associated with a lower probability of infection of the pig after weaning; age at weaning was associated with a higher probability of infection of the pig after weaning. Finally, transmission rate estimates were used in a scenario study in which the litters within a compartment were mixed across pens at weaning instead of raising litter mates together in a pen. The results showed that the proportion of infected piglets increased to 69% if litters were mixed at weaning, indicating that farm management measures may affect spread of A. pleuropneumoniae. Copyright © 2014 Elsevier B.V. All rights reserved.
System life and reliability modeling for helicopter transmissions
NASA Technical Reports Server (NTRS)
Savage, M.; Brikmanis, C. K.
1986-01-01
A computer program which simulates life and reliability of helicopter transmissions is presented. The helicopter transmissions may be composed of spiral bevel gear units and planetary gear units - alone, in series or in parallel. The spiral bevel gear units may have either single or dual input pinions, which are identical. The planetary gear units may be stepped or unstepped and the number of planet gears carried by the planet arm may be varied. The reliability analysis used in the program is based on the Weibull distribution lives of the transmission components. The computer calculates the system lives and dynamic capacities of the transmission components and the transmission. The system life is defined as the life of the component or transmission at an output torque at which the probability of survival is 90 percent. The dynamic capacity of a component or transmission is defined as the output torque which can be applied for one million output shaft cycles for a probability of survival of 90 percent. A complete summary of the life and dynamic capacity results is produced by the program.
Size Estimation of Groups at High Risk of HIV/AIDS using Network Scale Up in Kerman, Iran
Shokoohi, Mostafa; Baneshi, Mohammad Reza; Haghdoost, Ali-Akbar
2012-01-01
Objective: To estimate the size of groups at high risk of HIV, Network Scale UP (NSU), an indirect method, was used. Methods: 500 Kermanian male aged 18 to 45 were recruited. 8 groups at high risk of HIV were defined: Users of opium, unknown drug, ecstasy, and alcohol; intra-venous drug users (IDUs; males who have extra-marital sex with females (MSF); male who have sex with female sex workers (MFSW); and male who have sex with other male (MSMs). We asked respondents whether they know anybody (probability method), and if yes, how many people (frequency method) in our target groups. Results: Estimates derived in the probability method were higher than the frequency method. Based on the probability method, 13.7% (95% CI: 11.3%, 16.1%) of males used alcohol at least once in last year; the corresponding percent for opium was 13.1% (95% CI: 10.9%, 15.3%). In addition, 12% has extra-marital sex in last year (95% CI: 10%, 14%); while 7% (95% CI: 5.8%, 8.2%) had sex with a female sex worker. Conclusion: We showed that drug use is more common among young and mid-age males; although their sexual contacts were also considerable. These percentages show that special preventive program is needed to control an HIV transmission. Estimates derived from probability method were comparable with data from external sources. The underestimation in frequency method might be due to the fact that respondents are not aware of sensitive characteristics of all those in their network and underreporting is likely to occur. PMID:22891148
Sainudiin, Raazesh; Welch, David
2016-12-07
We derive a combinatorial stochastic process for the evolution of the transmission tree over the infected vertices of a host contact network in a susceptible-infected (SI) model of an epidemic. Models of transmission trees are crucial to understanding the evolution of pathogen populations. We provide an explicit description of the transmission process on the product state space of (rooted planar ranked labelled) binary transmission trees and labelled host contact networks with SI-tags as a discrete-state continuous-time Markov chain. We give the exact probability of any transmission tree when the host contact network is a complete, star or path network - three illustrative examples. We then develop a biparametric Beta-splitting model that directly generates transmission trees with exact probabilities as a function of the model parameters, but without explicitly modelling the underlying contact network, and show that for specific values of the parameters we can recover the exact probabilities for our three example networks through the Markov chain construction that explicitly models the underlying contact network. We use the maximum likelihood estimator (MLE) to consistently infer the two parameters driving the transmission process based on observations of the transmission trees and use the exact MLE to characterize equivalence classes over the space of contact networks with a single initial infection. An exploratory simulation study of the MLEs from transmission trees sampled from three other deterministic and four random families of classical contact networks is conducted to shed light on the relation between the MLEs of these families with some implications for statistical inference along with pointers to further extensions of our models. The insights developed here are also applicable to the simplest models of "meme" evolution in online social media networks through transmission events that can be distilled from observable actions such as "likes", "mentions", "retweets" and "+1s" along with any concomitant comments. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Greenhouse, Bryan; Dokomajilar, Christian; Hubbard, Alan; Rosenthal, Philip J; Dorsey, Grant
2007-09-01
Antimalarial clinical trials use genotyping techniques to distinguish new infection from recrudescence. In areas of high transmission, the accuracy of genotyping may be compromised due to the high number of infecting parasite strains. We compared the accuracies of genotyping methods, using up to six genotyping markers, to assign outcomes for two large antimalarial trials performed in areas of Africa with different transmission intensities. We then estimated the probability of genotyping misclassification and its effect on trial results. At a moderate-transmission site, three genotyping markers were sufficient to generate accurate estimates of treatment failure. At a high-transmission site, even with six markers, estimates of treatment failure were 20% for amodiaquine plus artesunate and 17% for artemether-lumefantrine, regimens expected to be highly efficacious. Of the observed treatment failures for these two regimens, we estimated that at least 45% and 35%, respectively, were new infections misclassified as recrudescences. Increasing the number of genotyping markers improved the ability to distinguish new infection from recrudescence at a moderate-transmission site, but using six markers appeared inadequate at a high-transmission site. Genotyping-adjusted estimates of treatment failure from high-transmission sites may represent substantial overestimates of the true risk of treatment failure.
Analysis of automatic repeat request methods for deep-space downlinks
NASA Technical Reports Server (NTRS)
Pollara, F.; Ekroot, L.
1995-01-01
Automatic repeat request (ARQ) methods cannot increase the capacity of a memoryless channel. However, they can be used to decrease the complexity of the channel-coding system to achieve essentially error-free transmission and to reduce link margins when the channel characteristics are poorly predictable. This article considers ARQ methods on a power-limited channel (e.g., the deep-space channel), where it is important to minimize the total power needed to transmit the data, as opposed to a bandwidth-limited channel (e.g., terrestrial data links), where the spectral efficiency or the total required transmission time is the most relevant performance measure. In the analysis, we compare the performance of three reference concatenated coded systems used in actual deep-space missions to that obtainable by ARQ methods using the same codes, in terms of required power, time to transmit with a given number of retransmissions, and achievable probability of word error. The ultimate limits of ARQ with an arbitrary number of retransmissions are also derived.
NASA Astrophysics Data System (ADS)
Zhang, X.-G.; Varga, Kalman; Pantelides, Sokrates T.
2007-07-01
Band-theoretic methods with periodically repeated supercells have been a powerful approach for ground-state electronic structure calculations but have not so far been adapted for quantum transport problems with open boundary conditions. Here, we introduce a generalized Bloch theorem for complex periodic potentials and use a transfer-matrix formulation to cast the transmission probability in a scattering problem with open boundary conditions in terms of the complex wave vectors of a periodic system with absorbing layers, allowing a band technique for quantum transport calculations. The accuracy and utility of the method are demonstrated by the model problems of the transmission of an electron over a square barrier and the scattering of a phonon in an inhomogeneous nanowire. Application to the resistance of a twin boundary in nanocrystalline copper yields excellent agreement with recent experimental data.
Macedo, Alexandre Casimiro de; Cunha, José Evandro; Yaochite, Juliana Navarro Ueda; Tavares, Clodis Maria; Nagao-Dias, Aparecida Tiemi
Considering that the main route of Mycobacterium leprae transmission is the upper respiratory tract, detection of salivary antibodies can be a useful tool for diagnosing early infection. The study aimed to analyze salivary anti-PGL-1 IgA and IgM antibodies in 169 children aged 4-16 years old, who lived nearby or inside the house of multibacillary or paucibacillary leprosy patients in two endemic cities in Alagoas State - Brazil. Salivary anti-PGL-1 antibodies were quantified by modified ELISA method. The frequency of contact and clinical form of the index case were significantly associated with salivary antibody levels. High frequency of IgM positivity strongly suggests active transmission of M. leprae in these communities. We suggest in the present work that salivary anti-PGL IgA and IgM are important biomarkers to be used for identifying communities with probable active transmission of M. leprae. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
The efficacy of serostatus disclosure for HIV Transmission risk reduction.
O'Connell, Ann A; Reed, Sandra J; Serovich, Julianne A
2015-02-01
Interventions to assist HIV+ persons in disclosing their serostatus to sexual partners can play an important role in curbing rates of HIV transmission among men who have sex with men (MSM). Based on the methods of Pinkerton and Galletly (AIDS Behav 11:698-705, 2007), we develop a mathematical probability model for evaluating effectiveness of serostatus disclosure in reducing the risk of HIV transmission and extend the model to examine the impact of serosorting. In baseline data from 164 HIV+ MSM participating in a randomized controlled trial of a disclosure intervention, disclosure is associated with a 45.0 % reduction in the risk of HIV transmission. Accounting for serosorting, a 61.2 % reduction in risk due to disclosure was observed in serodisconcordant couples. The reduction in risk for seroconcordant couples was 38.4 %. Evidence provided supports the value of serostatus disclosure as a risk reduction strategy in HIV+ MSM. Interventions to increase serostatus disclosure and that address serosorting behaviors are needed.
The Efficacy of Serostatus Disclosure for HIV Transmission Risk Reduction
O’Connell, Ann A.; Serovich, Julianne A.
2015-01-01
Interventions to assist HIV+ persons in disclosing their serostatus to sexual partners can play an important role in curbing rates of HIV transmission among men who have sex with men (MSM). Based on the methods of Pinkerton and Galletly (AIDS Behav 11:698–705, 2007), we develop a mathematical probability model for evaluating effectiveness of serostatus disclosure in reducing the risk of HIV transmission and extend the model to examine the impact of serosorting. In baseline data from 164 HIV+ MSM participating in a randomized controlled trial of a disclosure intervention, disclosure is associated with a 45.0 % reduction in the risk of HIV transmission. Accounting for serosorting, a 61.2 % reduction in risk due to disclosure was observed in serodisconcordant couples. The reduction in risk for seroconcordant couples was 38.4 %. Evidence provided supports the value of serostatus disclosure as a risk reduction strategy in HIV+ MSM. Interventions to increase serostatus disclosure and that address serosorting behaviors are needed. PMID:25164375
Synaptic transmission and the susceptibility of HIV infection to anti-viral drugs
NASA Astrophysics Data System (ADS)
Komarova, Natalia L.; Levy, David N.; Wodarz, Dominik
2013-07-01
Cell-to-cell viral transmission via virological synapses has been argued to reduce susceptibility of the virus population to anti-viral drugs through multiple infection of cells, contributing to low-level viral persistence during therapy. Using a mathematical framework, we examine the role of synaptic transmission in treatment susceptibility. A key factor is the relative probability of individual virions to infect a cell during free-virus and synaptic transmission, a currently unknown quantity. If this infection probability is higher for free-virus transmission, then treatment susceptibility is lowest if one virus is transferred per synapse, and multiple infection of cells increases susceptibility. In the opposite case, treatment susceptibility is minimized for an intermediate number of virions transferred per synapse. Hence, multiple infection via synapses does not simply lower treatment susceptibility. Without further experimental investigations, one cannot conclude that synaptic transmission provides an additional mechanism for the virus to persist at low levels during anti-viral therapy.
Lethal exposure: An integrated approach to pathogen transmission via environmental reservoirs
Turner, Wendy C.; Kausrud, Kyrre L.; Beyer, Wolfgang; Easterday, W. Ryan; Barandongo, Zoë R.; Blaschke, Elisabeth; Cloete, Claudine C.; Lazak, Judith; Van Ert, Matthew N.; Ganz, Holly H.; Turnbull, Peter C. B.; Stenseth, Nils Chr.; Getz, Wayne M.
2016-01-01
To mitigate the effects of zoonotic diseases on human and animal populations, it is critical to understand what factors alter transmission dynamics. Here we assess the risk of exposure to lethal concentrations of the anthrax bacterium, Bacillus anthracis, for grazing animals in a natural system over time through different transmission mechanisms. We follow pathogen concentrations at anthrax carcass sites and waterholes for five years and estimate infection risk as a function of grass, soil or water intake, age of carcass sites, and the exposure required for a lethal infection. Grazing, not drinking, seems the dominant transmission route, and transmission is more probable from grazing at carcass sites 1–2 years of age. Unlike most studies of virulent pathogens that are conducted under controlled conditions for extrapolation to real situations, we evaluate exposure risk under field conditions to estimate the probability of a lethal dose, showing that not all reservoirs with detectable pathogens are significant transmission pathways. PMID:27265371
Quantifying the transmission potential of pandemic influenza
NASA Astrophysics Data System (ADS)
Chowell, Gerardo; Nishiura, Hiroshi
2008-03-01
This article reviews quantitative methods to estimate the basic reproduction number of pandemic influenza, a key threshold quantity to help determine the intensity of interventions required to control the disease. Although it is difficult to assess the transmission potential of a probable future pandemic, historical epidemiologic data is readily available from previous pandemics, and as a reference quantity for future pandemic planning, mathematical and statistical analyses of historical data are crucial. In particular, because many historical records tend to document only the temporal distribution of cases or deaths (i.e. epidemic curve), our review focuses on methods to maximize the utility of time-evolution data and to clarify the detailed mechanisms of the spread of influenza. First, we highlight structured epidemic models and their parameter estimation method which can quantify the detailed disease dynamics including those we cannot observe directly. Duration-structured epidemic systems are subsequently presented, offering firm understanding of the definition of the basic and effective reproduction numbers. When the initial growth phase of an epidemic is investigated, the distribution of the generation time is key statistical information to appropriately estimate the transmission potential using the intrinsic growth rate. Applications of stochastic processes are also highlighted to estimate the transmission potential using similar data. Critically important characteristics of influenza data are subsequently summarized, followed by our conclusions to suggest potential future methodological improvements.
Large-scale-system effectiveness analysis. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patton, A.D.; Ayoub, A.K.; Foster, J.W.
1979-11-01
Objective of the research project has been the investigation and development of methods for calculating system reliability indices which have absolute, and measurable, significance to consumers. Such indices are a necessary prerequisite to any scheme for system optimization which includes the economic consequences of consumer service interruptions. A further area of investigation has been joint consideration of generation and transmission in reliability studies. Methods for finding or estimating the probability distributions of some measures of reliability performance have been developed. The application of modern Monte Carlo simulation methods to compute reliability indices in generating systems has been studied.
Rosenberg, Nora E; Pettifor, Audrey E; Bruyn, Guy DE; Westreich, Daniel; Delany-Moretlwe, Sinead; Behets, Frieda; Maman, Suzanne; Coetzee, David; Kamupira, Mercy; Miller, William C
2012-01-01
Introduction Effective behavioral HIV prevention is needed for stable HIV-discordant couples at risk for HIV, especially those without access to biomedical prevention. This analysis addressed whether HIV testing and counseling (HTC) with ongoing counseling and condom distribution lead to reduced unprotected sex in HIV-discordant couples. Methods Partners in Prevention HSV/HIV Transmission Study was a randomized trial conducted from 2004–2008 assessing whether acyclovir reduced HIV transmission from HSV-2/HIV-1 co-infected persons to HIV-uninfected sex partners. This analysis relied on self-reported behavioral data from 508 HIV-infected South African participants. The exposure was timing of first HTC: 0–7, 8–14, 15–30, or >30 days before baseline. In each exposure group, predicted probabilities of unprotected sex in the last month were calculated at baseline, month one, and month twelve using generalized estimating equations with a logit link and exchangeable correlation matrix. Results At baseline, participants who knew their HIV status for less time experienced higher predicted probabilities of unprotected sex in the last month: 0–7 days, 0.71; 8–14 days, 0.52; 15–30 days, 0.49; >30 days, 0.26. At month one, once all participants had been aware of being in HIV-discordant relationships for ≥ 1 month, predicted probabilities declined: 0–7 days, 0.08; 8–14 days, 0.08; 15–30 days, 0.15; >30 days, 0.14. Lower predicted probabilities were sustained through month twelve: 0–7 days, 0.08; 8–14 days, 0.11; 15–30 days, 0.05; >30 days, 0.19. Conclusions Unprotected sex declined after HIV-positive diagnosis, and declined further after awareness of HIV-discordance. Identifying HIV-discordant couples for behavioral prevention is important for reducing HIV transmission risk. PMID:23117500
The study of RMB exchange rate complex networks based on fluctuation mode
NASA Astrophysics Data System (ADS)
Yao, Can-Zhong; Lin, Ji-Nan; Zheng, Xu-Zhou; Liu, Xiao-Feng
2015-10-01
In the paper, we research on the characteristics of RMB exchange rate time series fluctuation with methods of symbolization and coarse gaining. First, based on fluctuation features of RMB exchange rate, we define the first type of fluctuation mode as one specific foreign currency against RMB in four days' fluctuating situations, and the second type as four different foreign currencies against RMB in one day's fluctuating situation. With the transforming method, we construct the unique-currency and multi-currency complex networks. Further, through analyzing the topological features including out-degree, betweenness centrality and clustering coefficient of fluctuation-mode complex networks, we find that the out-degree distribution of both types of fluctuation mode basically follows power-law distributions with exponents between 1 and 2. The further analysis reveals that the out-degree and the clustering coefficient generally obey the approximated negative correlation. With this result, we confirm previous observations showing that the RMB exchange rate exhibits a characteristic of long-range memory. Finally, we analyze the most probable transmission route of fluctuation modes, and provide probability prediction matrix. The transmission route for RMB exchange rate fluctuation modes exhibits the characteristics of partially closed loop, repeat and reversibility, which lays a solid foundation for predicting RMB exchange rate fluctuation patterns with large volume of data.
Pathogen Transmission from Humans to Great Apes is a Growing Threat to Primate Conservation.
Dunay, Emily; Apakupakul, Kathleen; Leard, Stephen; Palmer, Jamie L; Deem, Sharon L
2018-01-23
All six great ape species are listed as endangered or critically endangered by the IUCN and experiencing decreasing population trends. One of the threats to these non-human primates is the transmission of pathogens from humans. We conducted a literature review on occurrences of pathogen transmission from humans to great apes to highlight this often underappreciated issue. In total, we found 33 individual occurrences of probable or confirmed pathogen transmission from humans to great apes: 23 involved both pathogen and disease transmission, 7 pathogen transmission only, 2 positive antibody titers to zoonotic pathogens, and 1 pathogen transmission with probable disease. Great ape populations were categorized into captive, semi-free-living, and free-living conditions. The majority of occurrences involved chimpanzees (Pan troglodytes) (n = 23) or mountain gorillas (Gorilla beringei beringei) (n = 8). These findings have implications for conservation efforts and management of endangered great ape populations. Future efforts should focus on monitoring and addressing zoonotic pathogen and disease transmission between humans, great ape species, and other taxa to ensure the health of humans, wild and domestic animals, and the ecosystems we share.
Outage analysis of relay-assisted underwater wireless optical communication systems
NASA Astrophysics Data System (ADS)
Tabeshnezhad, Azadeh; Pourmina, Mohammad Ali
2017-12-01
In this paper, we theoretically evaluate the outage probabilities of underwater wireless optical communication (UWOC) systems. Our derivations are general as the channel model under consideration takes into account all of the channel degrading effects, namely absorption, scattering, and turbulence-induced fading. We numerically show that the UWOC systems, due to the severe channel impairments, cannot typically support longer link ranges than 100 m. Therefore, in this paper, in order to increase the transmission reliability and hence extend the viable communication range of UWOC systems, we apply decode-and-forward (DF) relay-assisted communications either in the form of multi-hop transmission, where multiple intermediate relays are serially employed between the source and destination, or parallel relaying in which multiple DF relays are distributed among the source-to-destination path to cooperate in the end-to-end transmission. Our numerical results reveal that multi-hop transmission, owing to the distance-dependency of all of the channel degrading effects, can tremendously improve the end-to-end outage probability and increase the accessible link ranges to hundreds of meter. For example, a dual-hop transmission in a 45 m coastal water link can provide up to 41 dB performance improvement at the outage probability of 10-9.
Interference Information Based Power Control for Cognitive Radio with Multi-Hop Cooperative Sensing
NASA Astrophysics Data System (ADS)
Yu, Youngjin; Murata, Hidekazu; Yamamoto, Koji; Yoshida, Susumu
Reliable detection of other radio systems is crucial for systems that share the same frequency band. In wireless communication channels, there is uncertainty in the received signal level due to multipath fading and shadowing. Cooperative sensing techniques in which radio stations share their sensing information can improve the detection probability of other systems. In this paper, a new cooperative sensing scheme that reduces the false detection probability while maintaining the outage probability of other systems is investigated. In the proposed system, sensing information is collected using multi-hop transmission from all sensing stations that detect other systems, and transmission decisions are based on the received sensing information. The proposed system also controls the transmit power based on the received CINRs from the sensing stations. Simulation results reveal that the proposed system can reduce the outage probability of other systems, or improve its link success probability.
Zhu, Shufen; Guo, Wenlong; Sheng, Pengcheng; Wang, Zunmin; Zhao, Changliang; Zhao, Qingyou; Zhu, Ruiliang
2012-01-01
Contaminated vaccine is one unexpected and potential origin of virus infection. In order to investigate the most likely cause of disease in a broiler breeder company of Shandong Province, all 17 batches of live-virus vaccines used in the affected flocks and 478 tissue samples were tested by dot-blot hybridization, nested PCR, and IFA. The results suggested the outbreak of disease was most probably due to the vaccination of REV-contaminated MD-CVI988/Rispens vaccines and ND-LaSota+IB-H120 vaccines. Furthermore, the REV was probably transmitted to the commercial chickens through congenital transmission. PMID:22912872
Isotope analysis in the transmission electron microscope.
Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani
2016-10-10
The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.
NASA Astrophysics Data System (ADS)
Billingham, J.; Benford, James
We advocate international consultations on societal and technical issues to address the risk of Messaging to Extraterrestrial Intelligence (METI) transmissions, and a moratorium on future transmissions until such issues are resolved. Instead, we recommend continuing to conduct SETI by listening, with no innate risk, while using powerful new search systems to give a better total probability of detection of beacons and messages than METI for the same cost, and with no need for a long obligatory wait for a response. Realistically, beacons are costly. In light of recent work on the economics of contact by radio, we offer alternatives to the current standard methods of SETI searches. METI transmissions to date are faint and very unlikely to be detected, even by nearby stars. We show that historical leakage from Earth has been undetectable for Earth-scale receiver systems. Future space microwave and laser power systems will likely be more detectable.
NASA transmission research and its probable effects on helicopter transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Coy, J. J.; Townsend, D. P.
1983-01-01
Transmissions studied for application to helicopters in addition to the more conventional geared transmissions include hybrid (traction/gear), bearingless planetary, and split torque transmissions. Research is being performed to establish the validity of analysis and computer codes developed to predict the performance, efficiency, life, and reliability of these transmissions. Results of this research should provide the transmission designer with analytical tools to design for minimum weight and noise with maximum life and efficiency. In addition, the advantages and limitations of drive systems as well as the more conventional systems will be defined.
NASA transmission research and its probable effects on helicopter transmission design
NASA Technical Reports Server (NTRS)
Zaretsky, E. V.; Coy, J. J.; Townsend, D. P.
1984-01-01
Transmissions studied for application to helicopters in addition to the more conventional geared transmissions include hybrid (traction/gear), bearingless planetary, and split torque transmissions. Research is being performed to establish the validity of analysis and computer codes developed to predict the performance, efficiency, life, and reliability of these transmissions. Results of this research should provide the transmission designer with analytical tools to design for minimum weight and noise with maximum life and efficiency. In addition, the advantages and limitations of drive systems as well as the more conventional systems will be defined.
Lahodny, G E; Gautam, R; Ivanek, R
2015-01-01
Indirect transmission through the environment, pathogen shedding by infectious hosts, replication of free-living pathogens within the environment, and environmental decontamination are suspected to play important roles in the spread and control of environmentally transmitted infectious diseases. To account for these factors, the classic Susceptible-Infectious-Recovered-Susceptible epidemic model is modified to include a compartment representing the amount of free-living pathogen within the environment. The model accounts for host demography, direct and indirect transmission, replication of free-living pathogens in the environment, and removal of free-living pathogens by natural death or environmental decontamination. Based on the assumptions of the deterministic model, a continuous-time Markov chain model is developed. An estimate for the probability of disease extinction or a major outbreak is obtained by approximating the Markov chain with a multitype branching process. Numerical simulations illustrate important differences between the deterministic and stochastic counterparts, relevant for outbreak prevention, that depend on indirect transmission, pathogen shedding by infectious hosts, replication of free-living pathogens, and environmental decontamination. The probability of a major outbreak is computed for salmonellosis in a herd of dairy cattle as well as cholera in a human population. An explicit expression for the probability of disease extinction or a major outbreak in terms of the model parameters is obtained for systems with no direct transmission or replication of free-living pathogens.
Monoamines and assessment of risks.
Takahashi, Hidehiko
2012-12-01
Over the past decade, neuroeconomics studies utilizing neurophysiology methods (fMRI or EEG) have flourished, revealing the neural basis of 'boundedly rational' or 'irrational' decision-making that violates normative theory. The next question is how modulatory neurotransmission is involved in these central processes. Here I focused on recent efforts to understand how central monoamine transmission is related to nonlinear probability weighting and loss aversion, central features of prospect theory, which is a leading alternative to normative theory for decision-making under risk. Circumstantial evidence suggests that dopamine tone might be related to distortion of subjective reward probability and noradrenaline and serotonin tone might influence aversive emotional reaction to potential loss. Copyright © 2012 Elsevier Ltd. All rights reserved.
Formation of ZnS nanostructures by a simple way of thermal evaporation
NASA Astrophysics Data System (ADS)
Yuan, H. J.; Xie, S. S.; Liu, D. F.; Yan, X. Q.; Zhou, Z. P.; Ci, L. J.; Wang, J. X.; Gao, Y.; Song, L.; Liu, L. F.; Zhou, W. Y.; Wang, G.
2003-11-01
The mass synthesis of ZnS nanobelts, nanowires, and nanoparticles has been achieved by a simple method of thermal evaporation of ZnS powders onto silicon substrates in the presence of Au catalyst. The temperature of the substrates and the concentration of ZnS vapor were the critical experimental parameters for the formation of different morphologies of ZnS nanostructures. Scanning electron microscopy and transmission electron microscopy show that the diameters of as-prepared nanowires were 30-70 nm. The UV emission at 374 nm is probably related to the exciton emission, while the mechanism of blue emission at 443 nm is probably mainly due to the presence of various surface states.
Cross-Border Sexual Transmission of the Newly Emerging HIV-1 Clade CRF51_01B
Cheong, Hui Ting; Ng, Kim Tien; Ong, Lai Yee; Chook, Jack Bee; Chan, Kok Gan; Takebe, Yutaka; Kamarulzaman, Adeeba; Tee, Kok Keng
2014-01-01
A novel HIV-1 recombinant clade (CRF51_01B) was recently identified among men who have sex with men (MSM) in Singapore. As cases of sexually transmitted HIV-1 infection increase concurrently in two socioeconomically intimate countries such as Malaysia and Singapore, cross transmission of HIV-1 between said countries is highly probable. In order to investigate the timeline for the emergence of HIV-1 CRF51_01B in Singapore and its possible introduction into Malaysia, 595 HIV-positive subjects recruited in Kuala Lumpur from 2008 to 2012 were screened. Phylogenetic relationship of 485 amplified polymerase gene sequences was determined through neighbour-joining method. Next, near-full length sequences were amplified for genomic sequences inferred to be CRF51_01B and subjected to further analysis implemented through Bayesian Markov chain Monte Carlo (MCMC) sampling and maximum likelihood methods. Based on the near full length genomes, two isolates formed a phylogenetic cluster with CRF51_01B sequences of Singapore origin, sharing identical recombination structure. Spatial and temporal information from Bayesian MCMC coalescent and maximum likelihood analysis of the protease, gp120 and gp41 genes suggest that Singapore is probably the country of origin of CRF51_01B (as early as in the mid-1990s) and featured a Malaysian who acquired the infection through heterosexual contact as host for its ancestral lineages. CRF51_01B then spread rapidly among the MSM in Singapore and Malaysia. Although the importation of CRF51_01B from Singapore to Malaysia is supported by coalescence analysis, the narrow timeframe of the transmission event indicates a closely linked epidemic. Discrepancies in the estimated divergence times suggest that CRF51_01B may have arisen through multiple recombination events from more than one parental lineage. We report the cross transmission of a novel CRF51_01B lineage between countries that involved different sexual risk groups. Understanding the cross-border transmission of HIV-1 involving sexual networks is crucial for effective intervention strategies in the region. PMID:25340817
Cross-border sexual transmission of the newly emerging HIV-1 clade CRF51_01B.
Cheong, Hui Ting; Ng, Kim Tien; Ong, Lai Yee; Chook, Jack Bee; Chan, Kok Gan; Takebe, Yutaka; Kamarulzaman, Adeeba; Tee, Kok Keng
2014-01-01
A novel HIV-1 recombinant clade (CRF51_01B) was recently identified among men who have sex with men (MSM) in Singapore. As cases of sexually transmitted HIV-1 infection increase concurrently in two socioeconomically intimate countries such as Malaysia and Singapore, cross transmission of HIV-1 between said countries is highly probable. In order to investigate the timeline for the emergence of HIV-1 CRF51_01B in Singapore and its possible introduction into Malaysia, 595 HIV-positive subjects recruited in Kuala Lumpur from 2008 to 2012 were screened. Phylogenetic relationship of 485 amplified polymerase gene sequences was determined through neighbour-joining method. Next, near-full length sequences were amplified for genomic sequences inferred to be CRF51_01B and subjected to further analysis implemented through Bayesian Markov chain Monte Carlo (MCMC) sampling and maximum likelihood methods. Based on the near full length genomes, two isolates formed a phylogenetic cluster with CRF51_01B sequences of Singapore origin, sharing identical recombination structure. Spatial and temporal information from Bayesian MCMC coalescent and maximum likelihood analysis of the protease, gp120 and gp41 genes suggest that Singapore is probably the country of origin of CRF51_01B (as early as in the mid-1990s) and featured a Malaysian who acquired the infection through heterosexual contact as host for its ancestral lineages. CRF51_01B then spread rapidly among the MSM in Singapore and Malaysia. Although the importation of CRF51_01B from Singapore to Malaysia is supported by coalescence analysis, the narrow timeframe of the transmission event indicates a closely linked epidemic. Discrepancies in the estimated divergence times suggest that CRF51_01B may have arisen through multiple recombination events from more than one parental lineage. We report the cross transmission of a novel CRF51_01B lineage between countries that involved different sexual risk groups. Understanding the cross-border transmission of HIV-1 involving sexual networks is crucial for effective intervention strategies in the region.
Bos, Marian E H; Te Beest, Dennis E; van Boven, Michiel; van Beest Holle, Mirna Robert-Du Ry; Meijer, Adam; Bosman, Arnold; Mulder, Yonne M; Koopmans, Marion P G; Stegeman, Arjan
2010-05-01
An epizootic of avian influenza (H7N7) caused a large number of human infections in The Netherlands in 2003. We used data from this epizootic to estimate infection probabilities for persons involved in disease control on infected farms. Analyses were based on databases containing information on the infected farms, person-visits to these farms, and exposure variables (number of birds present, housing type, poultry type, depopulation method, period during epizootic). Case definition was based on self-reported conjunctivitis and positive response to hemagglutination inhibition assay. A high infection probability was associated with clinical inspection of poultry in the area surrounding infected flocks (7.6%; 95% confidence interval [CI], 1.4%-18.9%) and active culling during depopulation (6.2%; 95% CI, 3.7%-9.6%). Low probabilities were estimated for management of biosecurity (0.0%; 95% CI, 0.0%-1.0%) and cleaning assistance during depopulation (0.0%; 95% CI, 0.0%-9.2%). No significant association was observed between the probability of infection and the exposure variables.
Cetacean population density estimation from single fixed sensors using passive acoustics.
Küsel, Elizabeth T; Mellinger, David K; Thomas, Len; Marques, Tiago A; Moretti, David; Ward, Jessica
2011-06-01
Passive acoustic methods are increasingly being used to estimate animal population density. Most density estimation methods are based on estimates of the probability of detecting calls as functions of distance. Typically these are obtained using receivers capable of localizing calls or from studies of tagged animals. However, both approaches are expensive to implement. The approach described here uses a MonteCarlo model to estimate the probability of detecting calls from single sensors. The passive sonar equation is used to predict signal-to-noise ratios (SNRs) of received clicks, which are then combined with a detector characterization that predicts probability of detection as a function of SNR. Input distributions for source level, beam pattern, and whale depth are obtained from the literature. Acoustic propagation modeling is used to estimate transmission loss. Other inputs for density estimation are call rate, obtained from the literature, and false positive rate, obtained from manual analysis of a data sample. The method is applied to estimate density of Blainville's beaked whales over a 6-day period around a single hydrophone located in the Tongue of the Ocean, Bahamas. Results are consistent with those from previous analyses, which use additional tag data. © 2011 Acoustical Society of America
NASA Technical Reports Server (NTRS)
Schneider, Harold
1959-01-01
This method is investigated for semi-infinite multiple-slab configurations of arbitrary width, composition, and source distribution. Isotropic scattering in the laboratory system is assumed. Isotropic scattering implies that the fraction of neutrons scattered in the i(sup th) volume element or subregion that will make their next collision in the j(sup th) volume element or subregion is the same for all collisions. These so-called "transfer probabilities" between subregions are calculated and used to obtain successive-collision densities from which the flux and transmission probabilities directly follow. For a thick slab with little or no absorption, a successive-collisions technique proves impractical because an unreasonably large number of collisions must be followed in order to obtain the flux. Here the appropriate integral equation is converted into a set of linear simultaneous algebraic equations that are solved for the average total flux in each subregion. When ordinary diffusion theory applies with satisfactory precision in a portion of the multiple-slab configuration, the problem is solved by ordinary diffusion theory, but the flux is plotted only in the region of validity. The angular distribution of neutrons entering the remaining portion is determined from the known diffusion flux and the remaining region is solved by higher order theory. Several procedures for applying the numerical method are presented and discussed. To illustrate the calculational procedure, a symmetrical slab ia vacuum is worked by the numerical, Monte Carlo, and P(sub 3) spherical harmonics methods. In addition, an unsymmetrical double-slab problem is solved by the numerical and Monte Carlo methods. The numerical approach proved faster and more accurate in these examples. Adaptation of the method to anisotropic scattering in slabs is indicated, although no example is included in this paper.
NASA Astrophysics Data System (ADS)
Reuter, Matthew; Tschudi, Stephen
When investigating the electrical response properties of molecules, experiments often measure conductance whereas computation predicts transmission probabilities. Although the Landauer-Büttiker theory relates the two in the limit of coherent scattering through the molecule, a direct comparison between experiment and computation can still be difficult. Experimental data (specifically that from break junctions) is statistical and computational results are deterministic. Many studies compare the most probable experimental conductance with computation, but such an analysis discards almost all of the experimental statistics. In this work we develop tools to decipher the Landauer-Büttiker transmission function directly from experimental statistics and then apply them to enable a fairer comparison between experimental and computational results.
Drivers of Tuberculosis Transmission.
Mathema, Barun; Andrews, Jason R; Cohen, Ted; Borgdorff, Martien W; Behr, Marcel; Glynn, Judith R; Rustomjee, Roxana; Silk, Benjamin J; Wood, Robin
2017-11-03
Measuring tuberculosis transmission is exceedingly difficult, given the remarkable variability in the timing of clinical disease after Mycobacterium tuberculosis infection; incident disease can result from either a recent (ie, weeks to months) or a remote (ie, several years to decades) infection event. Although we cannot identify with certainty the timing and location of tuberculosis transmission for individuals, approaches for estimating the individual probability of recent transmission and for estimating the fraction of tuberculosis cases due to recent transmission in populations have been developed. Data used to estimate the probable burden of recent transmission include tuberculosis case notifications in young children and trends in tuberculin skin test and interferon γ-release assays. More recently, M. tuberculosis whole-genome sequencing has been used to estimate population levels of recent transmission, identify the distribution of specific strains within communities, and decipher chains of transmission among culture-positive tuberculosis cases. The factors that drive the transmission of tuberculosis in communities depend on the burden of prevalent tuberculosis; the ways in which individuals live, work, and interact (eg, congregate settings); and the capacity of healthcare and public health systems to identify and effectively treat individuals with infectious forms of tuberculosis. Here we provide an overview of these factors, describe tools for measurement of ongoing transmission, and highlight knowledge gaps that must be addressed. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Qu, Wenwen; Busscher, Henk J; Hooymans, Johanna M M; van der Mei, Henny C
2011-06-15
Contact lens induced microbial keratitis results from bacterial transmission from one surface to another. We investigated the adhesion forces of Pseudomonas aeruginosa, Staphylococci and Serratia to different contact lenses, lens cases and corneal surfaces using AFM, and applied a Weibull analysis on these adhesion forces to calculate bacterial transmission probabilities from lens case to corneas with a contact lens as an intermediate. Also a new surface thermodynamic parameter was introduced, the interfacial free energy of transmission, which in essence compares the interfacial free energies of bacterial adhesion, calculated from measured contact angles with liquids on the donating and receiving surfaces in the transmission process. Bacterial adhesion forces were generally strongest among all eight strains for the lens case (-6.5 to -12.0 nN) and corneas (-3.5 to -11.5 nN), while contact lenses (-0.6 to -13.1 nN) exerted slightly smaller adhesion forces. Consequently, bacterial transmission from lens case to contact lens yielded a smaller contribution in the final transmission than from contact lens to cornea. Bacterial transmission probabilities as derived from force analyses were higher when the interfacial free energies of transmission were more negative, which is in line with surface thermodynamic principles. Therewith this parameter could provide useful in analyzing other bacterial transmission phenomena between donating and receiving surfaces as well. Copyright © 2011 Elsevier Inc. All rights reserved.
A Comprehensive Breath Plume Model for Disease Transmission via Expiratory Aerosols
NASA Astrophysics Data System (ADS)
Halloran, S. K.; Wexler, A. S.; Ristenpart, W. D.
2012-11-01
The peak in influenza incidence during wintertime represents a longstanding unresolved scientific question. One hypothesis is that the efficacy of airborne transmission via aerosols is increased at low humidity and temperature, conditions that prevail in wintertime. Recent experiments with guinea pigs suggest that transmission is indeed maximized at low humidity and temperature, a finding which has been widely interpreted in terms of airborne influenza virus survivability. This interpretation, however, neglects the effect of the airflow on the transmission probability. Here we provide a comprehensive model for assessing the probability of disease transmission via expiratory aerosols between test animals in laboratory conditions. The spread of aerosols emitted from an infected animal is modeled using dispersion theory for a homogeneous turbulent airflow. The concentration and size distribution of the evaporating droplets in the resulting ``Gaussian breath plume'' are calculated as functions of downstream position. We demonstrate that the breath plume model is broadly consistent with the guinea pig experiments, without invoking airborne virus survivability. Moreover, the results highlight the need for careful characterization of the airflow in airborne transmission experiments.
Frössling, Jenny; Nusinovici, Simon; Nöremark, Maria; Widgren, Stefan; Lindberg, Ann
2014-11-15
In the design of surveillance, there is often a desire to target high risk herds. Such risk-based approaches result in better allocation of resources and improve the performance of surveillance activities. For many contagious animal diseases, movement of live animals is a main route of transmission, and because of this, herds that purchase many live animals or have a large contact network due to trade can be seen as a high risk stratum of the population. This paper presents a new method to assess herd disease risk in animal movement networks. It is an improvement to current network measures that takes direction, temporal order, and also movement size and probability of disease into account. In the study, the method was used to calculate a probability of disease ratio (PDR) of herds in simulated datasets, and of real herds based on animal movement data from dairy herds included in a bulk milk survey for Coxiella burnetii. Known differences in probability of disease are easily incorporated in the calculations and the PDR was calculated while accounting for regional differences in probability of disease, and also by applying equal probability of disease throughout the population. Each herd's increased probability of disease due to purchase of animals was compared to both the average herd and herds within the same risk stratum. The results show that the PDR is able to capture the different circumstances related to disease prevalence and animal trade contact patterns. Comparison of results based on inclusion or exclusion of differences in risk also highlights how ignoring such differences can influence the ability to correctly identify high risk herds. The method shows a potential to be useful for risk-based surveillance, in the classification of herds in control programmes or to represent influential contacts in risk factor studies. Copyright © 2014 Elsevier B.V. All rights reserved.
Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.
Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios
2012-06-01
Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.
The Role of Culex pipiens L. (Diptera: Culicidae) in Virus Transmission in Europe
Hernández-Triana, Luis M.; Medlock, Jolyon M.; Fooks, Anthony R.; Carpenter, Simon; Johnson, Nicholas
2018-01-01
Over the past three decades, a range of mosquito-borne viruses that threaten public and veterinary health have emerged or re-emerged in Europe. Mosquito surveillance activities have highlighted the Culex pipiens species complex as being critical for the maintenance of a number of these viruses. This species complex contains morphologically similar forms that exhibit variation in phenotypes that can influence the probability of virus transmission. Critical amongst these is the choice of host on which to feed, with different forms showing different feeding preferences. This influences the ability of the mosquito to vector viruses and facilitate transmission of viruses to humans and domestic animals. Biases towards blood-feeding on avian or mammalian hosts have been demonstrated for different Cx. pipiens ecoforms and emerging evidence of hybrid populations across Europe adds another level of complexity to virus transmission. A range of molecular methods based on DNA have been developed to enable discrimination between morphologically indistinguishable forms, although this remains an active area of research. This review provides a comprehensive overview of developments in the understanding of the ecology, behaviour and genetics of Cx. pipiens in Europe, and how this influences arbovirus transmission. PMID:29473903
A Population-Structured HIV Epidemic in Israel: Roles of Risk and Ethnicity
Grossman, Zehava; Avidor, Boaz; Mor, Zohar; Chowers, Michal; Levy, Itzchak; Shahar, Eduardo; Riesenberg, Klaris; Sthoeger, Zev; Maayan, Shlomo; Shao, Wei; Lorber, Margalit; Olstein-Pops, Karen; Elbirt, Daniel; Elinav, Hila; Asher, Ilan; Averbuch, Diana; Istomin, Valery; Gottesman, Bat Sheva; Kedem, Eynat; Girshengorn, Shirley; Kra-Oz, Zipi; Shemer Avni, Yonat; Radian Sade, Sara; Turner, Dan; Maldarelli, Frank
2015-01-01
Background HIV in Israel started with a subtype-B epidemic among men who have sex with men, followed in the 1980s and 1990s by introductions of subtype C from Ethiopia (predominantly acquired by heterosexual transmission) and subtype A from the former Soviet Union (FSU, most often acquired by intravenous drug use). The epidemic matured over the last 15 years without additional large influx of exogenous infections. Between 2005 and 2013 the number of infected men who have sex with men (MSM) increased 2.9-fold, compared to 1.6-fold and 1.3-fold for intravenous drug users (IVDU) and Ethiopian-origin residents. Understanding contemporary spread is essential for effective public health planning. Methods We analyzed demographic and virologic data from 1,427 HIV-infected individuals diagnosed with HIV-I during 1998–2012. HIV phylogenies were reconstructed with maximum-likelihood and Bayesian methods. Results Subtype-B viruses, but not A or C, demonstrated a striking number of large clusters with common ancestors having posterior probability ≥0.95, including some suggesting presence of transmission networks. Transmitted drug resistance was highest in subtype B (13%). MSM represented a frequent risk factor in cross-ethnic transmission, demonstrated by the presence of Israeli-born with non-B virus infections and FSU immigrants with non-A subtypes. Conclusions Reconstructed phylogenetic trees demonstrated substantial grouping in subtype B, but not in non-MSM subtype-A or in subtype-C, reflecting differences in transmission dynamics linked to HIV transmission categories. Cross-ethnic spread occurred through multiple independent introductions, with MSM playing a prevalent role in the transmission of the virus. Such data provide a baseline to track epidemic trends and will be useful in informing and quantifying efforts to reduce HIV transmission. PMID:26302493
Interleaved Training and Training-Based Transmission Design for Hybrid Massive Antenna Downlink
NASA Astrophysics Data System (ADS)
Zhang, Cheng; Jing, Yindi; Huang, Yongming; Yang, Luxi
2018-06-01
In this paper, we study the beam-based training design jointly with the transmission design for hybrid massive antenna single-user (SU) and multiple-user (MU) systems where outage probability is adopted as the performance measure. For SU systems, we propose an interleaved training design to concatenate the feedback and training procedures, thus making the training length adaptive to the channel realization. Exact analytical expressions are derived for the average training length and the outage probability of the proposed interleaved training. For MU systems, we propose a joint design for the beam-based interleaved training, beam assignment, and MU data transmissions. Two solutions for the beam assignment are provided with different complexity-performance tradeoff. Analytical results and simulations show that for both SU and MU systems, the proposed joint training and transmission designs achieve the same outage performance as the traditional full-training scheme but with significant saving in the training overhead.
Modeling highway travel time distribution with conditional probability models
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oliveira Neto, Francisco Moraes; Chin, Shih-Miao; Hwang, Ho-Ling
ABSTRACT Under the sponsorship of the Federal Highway Administration's Office of Freight Management and Operations, the American Transportation Research Institute (ATRI) has developed performance measures through the Freight Performance Measures (FPM) initiative. Under this program, travel speed information is derived from data collected using wireless based global positioning systems. These telemetric data systems are subscribed and used by trucking industry as an operations management tool. More than one telemetric operator submits their data dumps to ATRI on a regular basis. Each data transmission contains truck location, its travel time, and a clock time/date stamp. Data from the FPM program providesmore » a unique opportunity for studying the upstream-downstream speed distributions at different locations, as well as different time of the day and day of the week. This research is focused on the stochastic nature of successive link travel speed data on the continental United States Interstates network. Specifically, a method to estimate route probability distributions of travel time is proposed. This method uses the concepts of convolution of probability distributions and bivariate, link-to-link, conditional probability to estimate the expected distributions for the route travel time. Major contribution of this study is the consideration of speed correlation between upstream and downstream contiguous Interstate segments through conditional probability. The established conditional probability distributions, between successive segments, can be used to provide travel time reliability measures. This study also suggests an adaptive method for calculating and updating route travel time distribution as new data or information is added. This methodology can be useful to estimate performance measures as required by the recent Moving Ahead for Progress in the 21st Century Act (MAP 21).« less
Effects of random tooth profile errors on the dynamic behaviors of planetary gears
NASA Astrophysics Data System (ADS)
Xun, Chao; Long, Xinhua; Hua, Hongxing
2018-02-01
In this paper, a nonlinear random model is built to describe the dynamics of planetary gear trains (PGTs), in which the time-varying mesh stiffness, tooth profile modification (TPM), tooth contact loss, and random tooth profile error are considered. A stochastic method based on the method of multiple scales (MMS) is extended to analyze the statistical property of the dynamic performance of PGTs. By the proposed multiple-scales based stochastic method, the distributions of the dynamic transmission errors (DTEs) are investigated, and the lower and upper bounds are determined based on the 3σ principle. Monte Carlo method is employed to verify the proposed method. Results indicate that the proposed method can be used to determine the distribution of the DTE of PGTs high efficiently and allow a link between the manufacturing precision and the dynamical response. In addition, the effects of tooth profile modification on the distributions of vibration amplitudes and the probability of tooth contact loss with different manufacturing tooth profile errors are studied. The results show that the manufacturing precision affects the distribution of dynamic transmission errors dramatically and appropriate TPMs are helpful to decrease the nominal value and the deviation of the vibration amplitudes.
Effect of Condom Use on Per-act HSV-2 Transmission Risk in HIV-1, HSV-2-discordant Couples.
Magaret, Amalia S; Mujugira, Andrew; Hughes, James P; Lingappa, Jairam; Bukusi, Elizabeth A; DeBruyn, Guy; Delany-Moretlwe, Sinead; Fife, Kenneth H; Gray, Glenda E; Kapiga, Saidi; Karita, Etienne; Mugo, Nelly R; Rees, Helen; Ronald, Allan; Vwalika, Bellington; Were, Edwin; Celum, Connie; Wald, Anna
2016-02-15
The efficacy of condoms for protection against transmission of herpes simplex virus type 2 (HSV-2) has been examined in a variety of populations with different effect measures. Often the efficacy has been assessed as change in hazard of transmission with consistent vs inconsistent use, independent of the number of acts. Condom efficacy has not previously measured on a per-act basis. We examined the per-act HSV-2 transmission rates with and without condom use among 911 African HSV-2 and human immunodeficiency virus type 1 (HIV-1) serodiscordant couples followed for an average of 18 months in an HIV prevention study. Infectivity models were used to associate the log10 probability of HSV-2 transmission over monthly risk periods with reported numbers of protected and unprotected sex acts. Condom efficacy was computed as the proportionate reduction in transmission risk for protected relative to unprotected sex acts. Transmission of HSV-2 occurred in 68 couples, including 17 with susceptible women and 51 with susceptible men. The highest rate of transmission was from men to women: 28.5 transmissions per 1000 unprotected sex acts. We found that condoms were differentially protective against HSV-2 transmission by sex; condom use reduced per-act risk of transmission from men to women by 96% (P < .001) and marginally from women to men by 65% (P = .060). Condoms are recommended as an effective preventive method for heterosexual transmission of HSV-2. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Transmission characteristics of MERS and SARS in the healthcare setting: a comparative study.
Chowell, Gerardo; Abdirizak, Fatima; Lee, Sunmi; Lee, Jonggul; Jung, Eunok; Nishiura, Hiroshi; Viboud, Cécile
2015-09-03
The Middle East respiratory syndrome (MERS) coronavirus has caused recurrent outbreaks in the Arabian Peninsula since 2012. Although MERS has low overall human-to-human transmission potential, there is occasional amplification in the healthcare setting, a pattern reminiscent of the dynamics of the severe acute respiratory syndrome (SARS) outbreaks in 2003. Here we provide a head-to-head comparison of exposure patterns and transmission dynamics of large hospital clusters of MERS and SARS, including the most recent South Korean outbreak of MERS in 2015. To assess the unexpected nature of the recent South Korean nosocomial outbreak of MERS and estimate the probability of future large hospital clusters, we compared exposure and transmission patterns for previously reported hospital clusters of MERS and SARS, based on individual-level data and transmission tree information. We carried out simulations of nosocomial outbreaks of MERS and SARS using branching process models rooted in transmission tree data, and inferred the probability and characteristics of large outbreaks. A significant fraction of MERS cases were linked to the healthcare setting, ranging from 43.5 % for the nosocomial outbreak in Jeddah, Saudi Arabia, in 2014 to 100 % for both the outbreak in Al-Hasa, Saudi Arabia, in 2013 and the outbreak in South Korea in 2015. Both MERS and SARS nosocomial outbreaks are characterized by early nosocomial super-spreading events, with the reproduction number dropping below 1 within three to five disease generations. There was a systematic difference in the exposure patterns of MERS and SARS: a majority of MERS cases occurred among patients who sought care in the same facilities as the index case, whereas there was a greater concentration of SARS cases among healthcare workers throughout the outbreak. Exposure patterns differed slightly by disease generation, however, especially for SARS. Moreover, the distributions of secondary cases per single primary case varied highly across individual hospital outbreaks (Kruskal-Wallis test; P < 0.0001), with significantly higher transmission heterogeneity in the distribution of secondary cases for MERS than SARS. Simulations indicate a 2-fold higher probability of occurrence of large outbreaks (>100 cases) for SARS than MERS (2 % versus 1 %); however, owing to higher transmission heterogeneity, the largest outbreaks of MERS are characterized by sharper incidence peaks. The probability of occurrence of MERS outbreaks larger than the South Korean cluster (n = 186) is of the order of 1 %. Our study suggests that the South Korean outbreak followed a similar progression to previously described hospital clusters involving coronaviruses, with early super-spreading events generating a disproportionately large number of secondary infections, and the transmission potential diminishing greatly in subsequent generations. Differences in relative exposure patterns and transmission heterogeneity of MERS and SARS could point to changes in hospital practices since 2003 or differences in transmission mechanisms of these coronaviruses.
Liat, L B; Betterton, C
1977-01-01
Examination of naturally infected felids and viverrids in Malaysia confirmed previously published records which indicated that P. westermani occurred only in felid cats. Felis planiceps and F. temnickli were reported as new host records. Analysis of stomach contents revealed no crab remains in either family of cats, but confirmed that felids were strictly carnivorous while viverrids were often omnivorous. In feeding experiments, only viverrids ate the host crabs Potomiscus johorensis and Parathelphusa maculata. The probable transmission of P. westermani to felids via paratenic hosts was discussed.
Hetem, D J; Pekelharing, M; Thijsen, S F T
2013-08-16
We report a highly probable case of transmission of a Yersinia enterocolitica from a pet puppy dog, adopted from a Spanish asylum, to a 1-year-old girl. After several weeks of diarrhoea, a PCR detecting enteropathogenic bacteria was performed on the faeces, revealing Y enterocolitica. Following cultures yielded a Y enterocolitica biotype 4, serotype O:3 in the faeces of the girl as well as puppy dog. Despite antibiotic treatment, symptoms and shedding of the organism in the faeces endured during a 2 month period.
Characterizing risk of Ebola transmission based on frequency and type of case–contact exposures
Fallah, Mosoka P.; Gaffney, Stephen G.; Yaari, Rami; Yamin, Dan; Huppert, Amit; Bawo, Luke; Nyenswah, Tolbert; Galvani, Alison P.
2017-01-01
During the initial months of the 2013–2016 Ebola epidemic, rapid geographical dissemination and intense transmission challenged response efforts across West Africa. Contextual behaviours associated with increased risk of exposure included travel to high-transmission settings, caring for sick and preparing the deceased for traditional funerals. Although such behaviours are widespread in West Africa, high-transmission pockets were observed. Superspreading and clustering are typical phenomena in infectious disease outbreaks, as a relatively small number of transmission chains are often responsible for the majority of events. Determining the characteristics of contacts at greatest risk of developing disease and of cases with greatest transmission potential could therefore help curb propagation of infection. Our analysis of contact tracing data from Montserrado County, Liberia, suggested that the probability of transmission was 4.5 times higher for individuals who were reported as having contact with multiple cases. The probability of individuals developing disease was not significantly associated with age or sex of their source case but was higher when they were in the same household as the infectious case. Surveillance efforts for rapidly identifying symptomatic individuals and effectively messaged campaigns encouraging household members to bring the sick to designated treatment centres without administration of home care could mitigate transmission. This article is part of the themed issue ‘The 2013–2016 West African Ebola epidemic: data, decision-making and disease control’. PMID:28396472
Park, Andrew W.; Magori, Krisztian; White, Brad A.; Stallknecht, David E.
2013-01-01
The assumed straightforward connection between transmission intensity and disease occurrence impacts surveillance and control efforts along with statistical methodology, including parameter inference and niche modeling. Many infectious disease systems have the potential for this connection to be more complicated–although demonstrating this in any given disease system has remained elusive. Hemorrhagic disease (HD) is one of the most important diseases of white-tailed deer and is caused by viruses in the Orbivirus genus. Like many infectious diseases, the probability or severity of disease increases with age (after loss of maternal antibodies) and the probability of disease is lower upon re-infection compared to first infection (based on cross-immunity between virus strains). These broad criteria generate a prediction that disease occurrence is maximized at intermediate levels of transmission intensity. Using published US field data, we first fit a statistical model to predict disease occurrence as a function of seroprevalence (a proxy for transmission intensity), demonstrating that states with intermediate seroprevalence have the highest level of case reporting. We subsequently introduce an independently parameterized mechanistic model supporting the theory that high case reporting should come from areas with intermediate levels of transmission. This is the first rigorous demonstration of this phenomenon and illustrates that variation in transmission rate (e.g. along an ecologically-controlled transmission gradient) can create cryptic refuges for infectious diseases. PMID:23579922
Computing Tutte polynomials of contact networks in classrooms
NASA Astrophysics Data System (ADS)
Hincapié, Doracelly; Ospina, Juan
2013-05-01
Objective: The topological complexity of contact networks in classrooms and the potential transmission of an infectious disease were analyzed by sex and age. Methods: The Tutte polynomials, some topological properties and the number of spanning trees were used to algebraically compute the topological complexity. Computations were made with the Maple package GraphTheory. Published data of mutually reported social contacts within a classroom taken from primary school, consisting of children in the age ranges of 4-5, 7-8 and 10-11, were used. Results: The algebraic complexity of the Tutte polynomial and the probability of disease transmission increases with age. The contact networks are not bipartite graphs, gender segregation was observed especially in younger children. Conclusion: Tutte polynomials are tools to understand the topology of the contact networks and to derive numerical indexes of such topologies. It is possible to establish relationships between the Tutte polynomial of a given contact network and the potential transmission of an infectious disease within such network
Jansen, A M; Madeira, F B; Deane, M P
1994-01-01
The high rate of natural Trypanosoma cruzi infection found in opossums does not always correlate with appreciable densities of local triatomid populations. One alternative method which might bypass the invertebrate vector is direct transmission from mother to offspring. This possibility was investigated in five T. cruzi infected females and their litters (24 young). The influence of maternal antibodies transferred via lactation, on the course of experimental infection, was also examined. Our results show that neonatal transmission is probably not responsible for the high rate of natural T. cruzi infection among opossums. In addition antibodies of maternal origin confer a partial protection to the young. This was demonstrated by the finding of a double prepatency period and 4, 5 fold lower levels of circulating parasites, in experimentally infected pouch young from infected as compared to control uninfected mothers. On the other hand, the duration of patent parasitemia was twice as long as that observed in the control group.
Emergence, spread, persistence and fade-out of sylvatic plague in Kazakhstan
Heier, Lise; Storvik, Geir O.; Davis, Stephen A.; Viljugrein, Hildegunn; Ageyev, Vladimir S.; Klassovskaya, Evgeniya; Stenseth, Nils Chr.
2011-01-01
Predicting the dynamics of zoonoses in wildlife is important not only for prevention of transmission to humans, but also for improving the general understanding of epidemiological processes. A large dataset on sylvatic plague in the Pre-Balkhash area of Kazakhstan (collected for surveillance purposes) provides a rare opportunity for detailed statistical modelling of an infectious disease. Previous work using these data has revealed a host abundance threshold for epizootics, and climatic influences on plague prevalence. Here, we present a model describing the local space–time dynamics of the disease at a spatial scale of 20 × 20 km2 and a biannual temporal scale, distinguishing between invasion and persistence events. We used a Bayesian imputation method to account for uncertainties resulting from poor data in explanatory variables and response variables. Spatial autocorrelation in the data was accounted for in imputations and analyses through random effects. The results show (i) a clear effect of spatial transmission, (ii) a high probability of persistence compared with invasion, and (iii) a stronger influence of rodent abundance on invasion than on persistence. In particular, there was a substantial probability of persistence also at low host abundance. PMID:21345866
Modulation and multiplexing in ultra-broadband photonic internet: Part II
NASA Astrophysics Data System (ADS)
Romaniuk, Ryszard S.
2011-06-01
In this paper, there is presented a review of our today's understanding of the ultimately broadband photonic Internet. A simple calculation is presented showing the estimate of the throughput of the core photonic network branches. Optoelectronic components, circuits, systems and signals, together with analogous electronic entities and common software layers, are building blocks of the contemporary Internet. Participation of photonics in development of the physical layer in the future Internet will probably increase. The photonics leads now to a better usage of the available bandwidth (increase of the spectral efficiency measured in Bit/s/Hz), increase in the transmission rate (from Gbps, via Tbps up to probably Pbps), increase in the transmission distance without signal regeneration (in distortion compensated active optical cables), increase in energy/power efficiency measured in W/Gbps, etc. Photonics may lead, in the future, to fully transparent optical networks and, thus, to essential increase in bandwidth and network reliability. It is expected that photonics (with biochemistry, electronics and mechatronics) may build psychological and physiological interface for humans to the future global network. The following optical signal multiplexing methods were considered, which are possible without O/E/O conversion: TDM-OTDM, FDM-CO-OFDM, OCDM-OCDMA, WDM-DWDM.
Ultra-broadband photonic internet
NASA Astrophysics Data System (ADS)
Romaniuk, Ryszard S.
2011-06-01
In this paper, there is presented a review of our today's understanding of the ultimately broadband photonic Internet. A simple calculation is presented showing the estimate of the throughput of the core photonic network branches. Optoelectronic components, circuits, systems and signals, together with analogous electronic entities and common software layers, are building blocks of the contemporary Internet. Participation of photonics in development of the physical layer in the future Internet will probably increase. The photonics leads now to a better usage of the available bandwidth (increase of the spectral efficiency measured in Bit/s/Hz), increase in the transmission rate (from Gbps, via Tbps up to probably Pbps), increase in the transmission distance without signal regeneration (in distortion compensated active optical cables), increase in energy/power efficiency measured in W/Gbps, etc. Photonics may lead, in the future, to fully transparent optical networks and, thus, to essential increase in bandwidth and network reliability. It is expected that photonics (with biochemistry, electronics and mechatronics) may build psychological and physiological interface for humans to the future global network. The following optical signal multiplexing methods were considered, which are possible without O/E/O conversion: TDM-OTDM, FDM-CO-OFDM, OCDM-OCDMA, WDM-DWDM.
Modulation and multiplexing in ultra-broadband photonic internet: Part I
NASA Astrophysics Data System (ADS)
Romaniuk, Ryszard S.
2011-06-01
In this paper, there is presented a review of our today's understanding of the ultimately broadband photonic Internet. A simple calculation is presented showing the estimate of the throughput of the core photonic network branches. Optoelectronic components, circuits, systems and signals, together with analogous electronic entities and common software layers, are building blocks of the contemporary Internet. Participation of photonics in development of the physical layer in the future Internet will probably increase. The photonics leads now to a better usage of the available bandwidth (increase of the spectral efficiency measured in Bit/s/Hz), increase in the transmission rate (from Gbps, via Tbps up to probably Pbps), increase in the transmission distance without signal regeneration (in distortion compensated active optical cables), increase in energy/power efficiency measured in W/Gbps, etc. Photonics may lead, in the future, to fully transparent optical networks and, thus, to essential increase in bandwidth and network reliability. It is expected that photonics (with biochemistry, electronics and mechatronics) may build psychological and physiological interface for humans to the future global network. The following optical signal multiplexing methods were considered, which are possible without O/E/O conversion: TDM-OTDM, FDM-CO-OFDM, OCDM-OCDMA, WDM-DWDM.
HIV-1 transmission linkage in an HIV-1 prevention clinical trial
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leitner, Thomas; Campbell, Mary S; Mullins, James I
2009-01-01
HIV-1 sequencing has been used extensively in epidemiologic and forensic studies to investigate patterns of HIV-1 transmission. However, the criteria for establishing genetic linkage between HIV-1 strains in HIV-1 prevention trials have not been formalized. The Partners in Prevention HSV/HIV Transmission Study (ClinicaITrials.gov NCT00194519) enrolled 3408 HIV-1 serodiscordant heterosexual African couples to determine the efficacy of genital herpes suppression with acyclovir in reducing HIV-1 transmission. The trial analysis required laboratory confirmation of HIV-1 linkage between enrolled partners in couples in which seroconversion occurred. Here we describe the process and results from HIV-1 sequencing studies used to perform transmission linkage determinationmore » in this clinical trial. Consensus Sanger sequencing of env (C2-V3-C3) and gag (p17-p24) genes was performed on plasma HIV-1 RNA from both partners within 3 months of seroconversion; env single molecule or pyrosequencing was also performed in some cases. For linkage, we required monophyletic clustering between HIV-1 sequences in the transmitting and seroconverting partners, and developed a Bayesian algorithm using genetic distances to evaluate the posterior probability of linkage of participants sequences. Adjudicators classified transmissions as linked, unlinked, or indeterminate. Among 151 seroconversion events, we found 108 (71.5%) linked, 40 (26.5%) unlinked, and 3 (2.0%) to have indeterminate transmissions. Nine (8.3%) were linked by consensus gag sequencing only and 8 (7.4%) required deep sequencing of env. In this first use of HIV-1 sequencing to establish endpoints in a large clinical trial, more than one-fourth of transmissions were unlinked to the enrolled partner, illustrating the relevance of these methods in the design of future HIV-1 prevention trials in serodiscordant couples. A hierarchy of sequencing techniques, analysis methods, and expert adjudication contributed to the linkage determination process.« less
Developmental plasticity in schistosomes and other helminths
Davies, Stephen J.; McKerrow, James H.
2010-01-01
Developmental plasticity in helminth life cycles serves, in most cases, to increase the probability of transmission between hosts, suggesting that the necessity to achieve transmission is a prominent selective pressure in the evolution of this phenomenon. Some evidence suggests that digenean trematodes from the genus Schistosoma are also capable of limited developmental responses to host factors. Here we review the currently available data on this phenomenon and attempt to draw comparisons with similar processes in the life cycles of other helminths. At present the biological significance of developmental responses by schistosomes under laboratory conditions remains unclear. Further work is needed to determine whether developmental plasticity plays any role in increasing the probability of schistosome transmission and life cycle propagation under adverse conditions, as it does in other helminth life cycles. PMID:13678642
Timing and Order of Transmission Events Is Not Directly Reflected in a Pathogen Phylogeny
Romero-Severson, Ethan; Skar, Helena; Bulla, Ingo; Albert, Jan; Leitner, Thomas
2014-01-01
Pathogen phylogenies are often used to infer spread among hosts. There is, however, not an exact match between the pathogen phylogeny and the host transmission history. Here, we examine in detail the limitations of this relationship. First, all splits in a pathogen phylogeny of more than 1 host occur within hosts, not at the moment of transmission, predating the transmission events as described by the pretransmission interval. Second, the order in which nodes in a phylogeny occur may be reflective of the within-host dynamics rather than epidemiologic relationships. To investigate these phenomena, motivated by within-host diversity patterns, we developed a two-phase coalescent model that includes a transmission bottleneck followed by linear outgrowth to a maximum population size followed by either stabilization or decline of the population. The model predicts that the pretransmission interval shrinks compared with predictions based on constant population size or a simple transmission bottleneck. Because lineages coalesce faster in a small population, the probability of a pathogen phylogeny to resemble the transmission history depends on when after infection a donor transmits to a new host. We also show that the probability of inferring the incorrect order of multiple transmissions from the same host is high. Finally, we compare time of HIV-1 infection informed by genetic distances in phylogenies to independent biomarker data, and show that, indeed, the pretransmission interval biases phylogeny-based estimates of when transmissions occurred. We describe situations where caution is needed not to misinterpret which parts of a phylogeny that may indicate outbreaks and tight transmission clusters. PMID:24874208
Reliable evaluation of the quantal determinants of synaptic efficacy using Bayesian analysis
Beato, M.
2013-01-01
Communication between neurones in the central nervous system depends on synaptic transmission. The efficacy of synapses is determined by pre- and postsynaptic factors that can be characterized using quantal parameters such as the probability of neurotransmitter release, number of release sites, and quantal size. Existing methods of estimating the quantal parameters based on multiple probability fluctuation analysis (MPFA) are limited by their requirement for long recordings to acquire substantial data sets. We therefore devised an algorithm, termed Bayesian Quantal Analysis (BQA), that can yield accurate estimates of the quantal parameters from data sets of as small a size as 60 observations for each of only 2 conditions of release probability. Computer simulations are used to compare its performance in accuracy with that of MPFA, while varying the number of observations and the simulated range in release probability. We challenge BQA with realistic complexities characteristic of complex synapses, such as increases in the intra- or intersite variances, and heterogeneity in release probabilities. Finally, we validate the method using experimental data obtained from electrophysiological recordings to show that the effect of an antagonist on postsynaptic receptors is correctly characterized by BQA by a specific reduction in the estimates of quantal size. Since BQA routinely yields reliable estimates of the quantal parameters from small data sets, it is ideally suited to identify the locus of synaptic plasticity for experiments in which repeated manipulations of the recording environment are unfeasible. PMID:23076101
Fiebig, Lena; Kohl, Thomas A; Popovici, Odette; Mühlenfeld, Margarita; Indra, Alexander; Homorodean, Daniela; Chiotan, Domnica; Richter, Elvira; Rüsch-Gerdes, Sabine; Schmidgruber, Beatrix; Beckert, Patrick; Hauer, Barbara; Niemann, Stefan; Allerberger, Franz; Haas, Walter
2017-01-01
Molecular surveillance of multidrug-resistant tuberculosis (MDR-TB) using 24-loci MIRU-VNTR in the European Union suggests the occurrence of international transmission. In early 2014, Austria detected a molecular MDR-TB cluster of five isolates. Links to Romania and Germany prompted the three countries to investigate possible cross-border MDR-TB transmission jointly. We searched genotyping databases, genotyped additional isolates from Romania, used whole genome sequencing (WGS) to infer putative transmission links, and investigated pairwise epidemiological links and patient mobility. Ten isolates from 10 patients shared the same 24-loci MIRU-VNTR pattern. Within this cluster, WGS defined two subgroups of four patients each. The first comprised an MDR-TB patient from Romania who had sought medical care in Austria and two patients from Austria. The second comprised patients, two of them epidemiologically linked, who lived in three different countries but had the same city of provenance in Romania. Our findings strongly suggested that the two cases in Austrian citizens resulted from a newly introduced MDR-TB strain, followed by domestic transmission. For the other cases, transmission probably occurred in the same city of provenance. To prevent further MDR-TB transmission, we need to ensure universal access to early and adequate therapy and collaborate closely in tuberculosis care beyond administrative borders. PMID:28106529
He, Yao; Jiang, Yong; Xing, Yu-bin; Zhong, Guang-lin; Wang, Lei; Sun, Zheng-ji; Jia, Hong; Chang, Qing; Wang, Yong; Ni, Bin; Chen, Shi-ping
2003-07-01
To study the transmission route of severe acute respiratory syndrome (SARS) nosocomial infection. Ten identified SARS patients were selected from a general hospital in March. Survey was carried out through a standardized questionnaire provided by Chinese Center for Disease Control and Prevention. Contents of the questionnaire would include: history of contact with SARS patient, route of infection, methods used for protection and so on. (1) Distribution os SARS patients were confined to 3 wards: 4, 5, and 6 on the 7, 8, 12, 13 and 14 floors in the west unit of the inpatient building. Most of the inpatients were elderly and having severe original diseases. (2) Index patients were the first generation source of transmission and they infected inpatients and medical staff, making them the second generation. People with latent infection who had close contact with SARS patients might also serve as the possible source of transmission. (3) The major transmission routes were: near distant droplet infection and close contact infection. There was also a clue to the probability of aerosol or droplet nuclei infection through air-conditioning and ventilation system. Nosocomial infection appeared to be the main characteristic of the SARS epidemic in the early stage of this hospital. Other than close contact and near space airborne transmission of SARS virus, the possibility of long-distance aerosol transmission called for further epidemiological and experimental studies in the future.
Fine, Amanda E.; O'Brien, Daniel J.; Winterstein, Scott R.; Kaneene, John B.
2011-01-01
Deer movements on cattle farms, wildlife feeding, and livestock management practices in Michigan are thought to create opportunities for indirect transmission of Mycobacterium bovis via environmental substrates. To confirm the presence of viable M. bovis in the environment, substrates were collected from 13 farms with culture-confirmed M. bovis in cattle and 5 sites with high prevalence of M. bovis in free-ranging deer. None of the samples processed for mycobacterial culture were positive for M. bovis. Agent, host, and landscape-level factors decrease the probability of detecting M. bovis in the environment using conventional mycobacterial culture. Molecular techniques that increase the probability of M. bovis detection in environmental substrates should be applied to known sites of M. bovis transmission in Michigan. In the interim, epidemiological investigations informed by experimental studies will be most effective in characterizing M. bovis persistence in the environment and its role in the indirect interspecies transmission of M. bovis. PMID:23738108
Manlove, Kezia R.; Cassirer, E. Frances; Plowright, Raina K.; Cross, Paul C.; Hudson, Peter J.
2018-01-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife.We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia.We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections.Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs.Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit.This analysis demonstrates a simple logistic regression approach for testing a priori hypotheses about variation in the odds of transmission given contact for free-ranging hosts, and may be broadly applicable for investigations in wildlife disease ecology. PMID:28317104
Manlove, Kezia R; Cassirer, E Frances; Plowright, Raina K; Cross, Paul C; Hudson, Peter J
2017-07-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife. We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia. We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections. Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs. Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit. This analysis demonstrates a simple logistic regression approach for testing a priori hypotheses about variation in the odds of transmission given contact for free-ranging hosts, and may be broadly applicable for investigations in wildlife disease ecology. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.
Manlove, Kezia R.; Cassirer, E. Frances; Plowright, Raina K.; Cross, Paul C.; Hudson, Peter J.
2017-01-01
Understanding both contact and probability of transmission given contact are key to managing wildlife disease. However, wildlife disease research tends to focus on contact heterogeneity, in part because the probability of transmission given contact is notoriously difficult to measure. Here, we present a first step towards empirically investigating the probability of transmission given contact in free-ranging wildlife.We used measured contact networks to test whether bighorn sheep demographic states vary systematically in infectiousness or susceptibility to Mycoplasma ovipneumoniae, an agent responsible for bighorn sheep pneumonia.We built covariates using contact network metrics, demographic information and infection status, and used logistic regression to relate those covariates to lamb survival. The covariate set contained degree, a classic network metric describing node centrality, but also included covariates breaking the network metrics into subsets that differentiated between contacts with yearlings, ewes with lambs, and ewes without lambs, and animals with and without active infections.Yearlings, ewes with lambs, and ewes without lambs showed similar group membership patterns, but direct interactions involving touch occurred at a rate two orders of magnitude higher between lambs and reproductive ewes than between any classes of adults or yearlings, and one order of magnitude higher than direct interactions between multiple lambs.Although yearlings and non-reproductive bighorn ewes regularly carried M. ovipneumoniae, our models suggest that a contact with an infected reproductive ewe had approximately five times the odds of producing a lamb mortality event of an identical contact with an infected dry ewe or yearling. Consequently, management actions targeting infected animals might lead to unnecessary removal of young animals that carry pathogens but rarely transmit.This analysis demonstrates a simple logistic regression approach for testing a priorihypotheses about variation in the odds of transmission given contact for free-ranging hosts, and may be broadly applicable for investigations in wildlife disease ecology.
Mustafa, Tariq; Horton, David R.; Cooper, W. Rodney; Swisher, Kylie D.; Zack, Richard S.; Pappu, Hanu R.; Munyaneza, Joseph E.
2015-01-01
The potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae), is a vector of the phloem-limited bacterium ‘Candidatus Liberibacter solanacearum’ (Lso), the putative causal agent of zebra chip disease of potato. Little is known about how potato psyllid transmits Lso to potato. We used electrical penetration graph (EPG) technology to compare stylet probing behaviors and efficiency of Lso transmission of three haplotypes of potato psyllid (Central, Western, Northwestern). All haplotypes exhibited the full suite of stylet behaviors identified in previous studies with this psyllid, including intercellular penetration and secretion of the stylet pathway, xylem ingestion, and phloem activities, the latter comprising salivation and ingestion. The three haplotypes exhibited similar frequency and duration of probing behaviors, with the exception of salivation into phloem, which was of higher duration by psyllids of the Western haplotype. We manipulated how long psyllids were allowed access to potato (“inoculation access period”, or IAP) to examine the relationship between phloem activities and Lso transmission. Between 25 and 30% of psyllids reached and salivated into phloem at an IAP of 1 hr, increasing to almost 80% of psyllids as IAP was increased to 24 h. Probability of Lso-transmission was lower across all IAP levels than probability of phloem salivation, indicating that a percentage of infected psyllids which salivated into the phloem failed to transmit Lso. Logistic regression showed that probability of transmission increased as a function of time spent salivating into the phloem; transmission occurred as quickly as 5 min following onset of salivation. A small percentage of infected psyllids showed extremely long salivation events but nonetheless failed to transmit Lso, for unknown reasons. Information from these studies increases our understanding of Lso transmission by potato psyllid, and demonstrates the value of EPG technology in exploring questions of vector efficiency. PMID:26407093
Whole-genome sequencing to determine Neisseria gonorrhoeae transmission: an observational study
Cole, Kevin; Cole, Michelle J; Cresswell, Fiona; Dean, Gillian; Dave, Jayshree; Thomas, Daniel Rh; Foster, Kirsty; Waldram, Alison; Wilson, Daniel J; Didelot, Xavier; Grad, Yonatan H; Crook, Derrick W; Peto, Tim EA; Walker, A Sarah
2016-01-01
Background New approaches are urgently required to address increasing rates of gonorrhoea and the emergence and global spread of antibiotic-resistant Neisseria gonorrhoeae. Whole genome sequencing (WGS) can be applied to study transmission and track resistance. Methods We performed WGS on 1659 isolates from Brighton, UK, and 217 additional isolates from other UK locations. We included WGS data (n=196) from the USA. Estimated mutation rates, plus diversity observed within patients across anatomical sites and probable transmission pairs, were used to fit a coalescent model to determine the number of single nucleotide polymorphisms (SNPs) expected between sequences related by direct/indirect transmission, depending on the time between samples. Findings We detected extensive local transmission. 281/1061(26%) Brighton cases were indistinguishable (0 SNPs) to ≥1 previous case(s), and 786(74%) had evidence of a sampled direct or indirect Brighton source. There was evidence of sustained transmission of some lineages. We observed multiple related samples across geographic locations. Of 1273 infections in Brighton, 225(18%) were linked to another case from elsewhere in the UK, and 115(9%) to a case from the USA. Four lineages initially identified in Brighton could be linked to 70 USA sequences, including 61 from a lineage carrying the mosaic penA XXXIV associated with reduced cefixime susceptibility. Interpretation We present a WGS-based tool for genomic contact tracing of N. gonorrhoeae and demonstrate local, national and international transmission. WGS can be applied across geographical boundaries to investigate gonorrhoea transmission and to track antimicrobial resistance. Funding Oxford NIHR Health Protection Research Unit and Biomedical Research Centre. PMID:27427203
Dennis, Ann M; Murillo, Wendy; de Maria Hernandez, Flor; Guardado, Maria Elena; Nieto, Ana Isabel; Lorenzana de Rivera, Ivette; Eron, Joseph J; Paz-Bailey, Gabriela
2013-05-01
HIV in Central America is concentrated among certain groups such as men who have sex with men (MSM) and female sex workers (FSWs). We compared social recruitment chains and HIV transmission clusters from 699 MSM and 787 FSWs to better understand factors contributing to ongoing HIV transmission in El Salvador. Phylogenies were reconstructed using pol sequences from 119 HIV-positive individuals recruited by respondent-driven sampling (RDS) and compared with RDS chains in 3 cities in El Salvador. Transmission clusters with a mean pairwise genetic distance ≤ 0.015 and Bayesian posterior probabilities =1 were identified. Factors associated with cluster membership were evaluated among MSM. Sequences from 34 (43%) MSM and 4 (10%) FSW grouped in 14 transmission clusters. Clusters were defined by risk group (12 MSM clusters) and geographic residence (only 1 spanned separate cities). In 4 MSM clusters (all n = 2), individuals were also members of the same RDS chain, but only 2 had members directly linked through recruitment. All large clusters (n ≥ 3) spanned >1 RDS chain. Among MSM, factors independently associated with cluster membership included recent infection by BED assay (P = 0.02), sex with stable male partners (P = 0.02), and sex with ≥ 3 male partners in the past year (P = 0.04). We found few HIV transmissions corresponding directly with the social recruitment. However, we identified clustering in nearly one-half of MSM suggesting that RDS recruitment was indirectly but successfully uncovering transmission networks, particularly among recent infections. Interrogating RDS chains with phylogenetic analyses may help refine methods for identifying transmission clusters.
Assessing the Risk of a Canine Rabies Incursion in Northern Australia
Hudson, Emily G.; Brookes, Victoria J.; Ward, Michael P.
2017-01-01
Rabies is a globally distributed virus that causes approximately 60,00 human deaths annually with >99% of cases caused by dog bites. Australia is currently canine rabies free. However, the recent eastward spread of rabies in the Indonesian archipelago has increased the probability of rabies entry into northern Australian communities. In addition, many northern Australian communities have large populations of free-roaming dogs, capable of maintaining rabies should an incursion occur. A risk assessment of rabies entry and transmission into these communities is needed to target control and surveillance measures. Illegal transportation of rabies-infected dogs via boat landings is a high-risk entry pathway and was the focus of the current study. A quantitative, stochastic, risk assessment model was developed to evaluate the risk of rabies entry into north-west Cape York Peninsula, Australia, and rabies introduction to resident dogs in one of the communities via transport of rabies-infected dogs on illegal Indonesian fishing boats. Parameter distributions were derived from expert opinion, literature, and analysis of field studies. The estimated median probability of rabies entry into north-west Cape York Peninsula and into Seisia from individual fishing boats was 1.9 × 10−4/boat and 8.7 × 10−6/boat, respectively. The estimated annual probability that at least one rabies-infected dog enters north-west Cape York Peninsula and into Seisia was 5.5 × 10−3 and 3.5 × 10−4, respectively. The estimated median probability of rabies introduction into Seisia was 4.7 × 10−8/boat, and the estimated annual probability that at least one rabies-infected dog causes rabies transmission in a resident Seisia dog was 8.3 × 10−5. Sensitivity analysis using the Sobol method highlighted some parameters as influential, including but not limited to the prevalence of rabies in Indonesia, the probability of a dog on board an Indonesian fishing boat, and the probability of a Seisia dog being on the beach. Overall, the probabilities of rabies entry into north-west Cape York Peninsula and rabies introduction into Seisia are low. However, the potential devastating consequences of a rabies incursion in this region make this a non-negligible risk. PMID:28913341
Li, Yuan; Jalil, Mansoor B. A.; Tan, S. G.; Zhao, W.; Bai, R.; Zhou, G. H.
2014-01-01
Time-periodic perturbation can be used to modify the transport properties of the surface states of topological insulators, specifically their chiral tunneling property. Using the scattering matrix method, we study the tunneling transmission of the surface states of a topological insulator under the influence of a time-dependent potential and finite gate bias voltage. It is found that perfect transmission is obtained for electrons which are injected normally into the time-periodic potential region in the absence of any bias voltage. However, this signature of Klein tunneling is destroyed when a bias voltage is applied, with the transmission probability of normally incident electrons decreasing with increasing gate bias voltage. Likewise, the overall conductance of the system decreases significantly when a gate bias voltage is applied. The characteristic left-handed helicity of the transmitted spin polarization is also broken by the finite gate bias voltage. In addition, the time-dependent potential modifies the large-angle transmission profile, which exhibits an oscillatory or resonance-like behavior. Finally, time-dependent transport modes (with oscillating potential in the THz frequency) can result in enhanced overall conductance, irrespective of the presence or absence of the gate bias voltage. PMID:24713634
Poulos, H M; Camp, A E
2010-02-01
Vegetation management is a critical component of rights-of-way (ROW) maintenance for preventing electrical outages and safety hazards resulting from tree contact with conductors during storms. Northeast Utility's (NU) transmission lines are a critical element of the nation's power grid; NU is therefore under scrutiny from federal agencies charged with protecting the electrical transmission infrastructure of the United States. We developed a decision support system to focus right-of-way maintenance and minimize the potential for a tree fall episode that disables transmission capacity across the state of Connecticut. We used field data on tree characteristics to develop a system for identifying hazard trees (HTs) in the field using limited equipment to manage Connecticut power line ROW. Results from this study indicated that the tree height-to-diameter ratio, total tree height, and live crown ratio were the key characteristics that differentiated potential risk trees (danger trees) from trees with a high probability of tree fall (HTs). Products from this research can be transferred to adaptive right-of-way management, and the methods we used have great potential for future application to other regions of the United States and elsewhere where tree failure can disrupt electrical power.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wen, Haiming; Lin, Yaojun; Seidman, David N.
The preparation of transmission electron microcopy (TEM) samples from powders with particle sizes larger than ~100 nm poses a challenge. The existing methods are complicated and expensive, or have a low probability of success. Herein, we report a modified methodology for preparation of TEM samples from powders, which is efficient, cost-effective, and easy to perform. This method involves mixing powders with an epoxy on a piece of weighing paper, curing the powder–epoxy mixture to form a bulk material, grinding the bulk to obtain a thin foil, punching TEM discs from the foil, dimpling the discs, and ion milling the dimpledmore » discs to electron transparency. Compared with the well established and robust grinding–dimpling–ion-milling method for TEM sample preparation for bulk materials, our modified approach for preparing TEM samples from powders only requires two additional simple steps. In this article, step-by-step procedures for our methodology are described in detail, and important strategies to ensure success are elucidated. Furthermore, our methodology has been applied successfully for preparing TEM samples with large thin areas and high quality for many different mechanically milled metallic powders.« less
Wen, Haiming; Lin, Yaojun; Seidman, David N.; ...
2015-09-09
The preparation of transmission electron microcopy (TEM) samples from powders with particle sizes larger than ~100 nm poses a challenge. The existing methods are complicated and expensive, or have a low probability of success. Herein, we report a modified methodology for preparation of TEM samples from powders, which is efficient, cost-effective, and easy to perform. This method involves mixing powders with an epoxy on a piece of weighing paper, curing the powder–epoxy mixture to form a bulk material, grinding the bulk to obtain a thin foil, punching TEM discs from the foil, dimpling the discs, and ion milling the dimpledmore » discs to electron transparency. Compared with the well established and robust grinding–dimpling–ion-milling method for TEM sample preparation for bulk materials, our modified approach for preparing TEM samples from powders only requires two additional simple steps. In this article, step-by-step procedures for our methodology are described in detail, and important strategies to ensure success are elucidated. Furthermore, our methodology has been applied successfully for preparing TEM samples with large thin areas and high quality for many different mechanically milled metallic powders.« less
NASA Astrophysics Data System (ADS)
Chang, Chun; Huang, Benxiong; Xu, Zhengguang; Li, Bin; Zhao, Nan
2018-02-01
Three soft-input-soft-output (SISO) detection methods for dual-polarized quadrature duobinary (DP-QDB), including maximum-logarithmic-maximum-a-posteriori-probability-algorithm (Max-log-MAP)-based detection, soft-output-Viterbi-algorithm (SOVA)-based detection, and a proposed SISO detection, which can all be combined with SISO decoding, are presented. The three detection methods are investigated at 128 Gb/s in five-channel wavelength-division-multiplexing uncoded and low-density-parity-check (LDPC) coded DP-QDB systems by simulations. Max-log-MAP-based detection needs the returning-to-initial-states (RTIS) process despite having the best performance. When the LDPC code with a code rate of 0.83 is used, the detecting-and-decoding scheme with the SISO detection does not need RTIS and has better bit error rate (BER) performance than the scheme with SOVA-based detection. The former can reduce the optical signal-to-noise ratio (OSNR) requirement (at BER=10-5) by 2.56 dB relative to the latter. The application of the SISO iterative detection in LDPC-coded DP-QDB systems makes a good trade-off between requirements on transmission efficiency, OSNR requirement, and transmission distance, compared with the other two SISO methods.
Transmission of electrons inside the cryogenic pumps of ITER injector.
Veltri, P; Sartori, E
2016-02-01
Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particle trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.
Chappell, Thomas M; Kennedy, George G
2018-06-21
Imidacloprid is widely used to manage tomato spotted wilt disease (TSW) in tobacco, tomato, and pepper, caused by Tomato spotted wilt orthotospovirus (TSWV) and spread by the tobacco thrips, Frankliniella fusca Hinds (Thysanoptera: Thripidae). Imidacloprid suppresses transmission of TSWV by reducing probing and feeding by adult thrips on treated plants, thereby reducing the probability of transmission by infectious thrips. Because imidacloprid does not reduce probing and feeding on treated plants to zero, the reduction in transmission probability per viruliferous thrips can be offset by an increase in the number of viruliferous thrips challenging treated plants. A composite of these effects which we call 'pathogen pressure' experienced by plants is a function of thrips population size, the proportion of those thrips that are viruliferous, and the probability that viruliferous thrips successfully inoculate plants. To better understand the relationship between imidacloprid's effect on virus transmission, pathogen pressure, and TSW incidence in tobacco, we modeled TSW incidence as a function of the two most important variables affecting components of pathogen pressure, temperature, and precipitation, and the dependence of imidacloprid's effect on pathogen pressure. A model incorporating imidacloprid's effect as a reduction in pathogen pressure was found to be more descriptive than models incorporating the effect as a reduction in TSW incidence. Results reveal maximum proportional reduction in TSW incidence resulting from imidacloprid use is associated with minimal potential TSW incidence. As pathogen pressure increases, potential TSW incidence approaches 100%, and the benefits of imidacloprid use are highest at intermediate levels of pathogen pressure.
IGM CONSTRAINTS FROM THE SDSS-III/BOSS DR9 Lyα FOREST TRANSMISSION PROBABILITY DISTRIBUTION FUNCTION
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Khee-Gan; Hennawi, Joseph F.; Spergel, David N.
2015-02-01
The Lyα forest transmission probability distribution function (PDF) is an established probe of the intergalactic medium (IGM) astrophysics, especially the temperature-density relationship of the IGM. We measure the transmission PDF from 3393 Baryon Oscillations Spectroscopic Survey (BOSS) quasars from Sloan Digital Sky Survey Data Release 9, and compare with mock spectra that include careful modeling of the noise, continuum, and astrophysical uncertainties. The BOSS transmission PDFs, measured at (z) = [2.3, 2.6, 3.0], are compared with PDFs created from mock spectra drawn from a suite of hydrodynamical simulations that sample the IGM temperature-density relationship, γ, and temperature at mean density,more » T {sub 0}, where T(Δ) = T {sub 0}Δ{sup γ} {sup –} {sup 1}. We find that a significant population of partial Lyman-limit systems (LLSs) with a column-density distribution slope of β{sub pLLS} ∼ – 2 are required to explain the data at the low-transmission end of transmission PDF, while uncertainties in the mean Lyα forest transmission affect the high-transmission end. After modeling the LLSs and marginalizing over mean transmission uncertainties, we find that γ = 1.6 best describes the data over our entire redshift range, although constraints on T {sub 0} are affected by systematic uncertainties. Within our model framework, isothermal or inverted temperature-density relationships (γ ≤ 1) are disfavored at a significance of over 4σ, although this could be somewhat weakened by cosmological and astrophysical uncertainties that we did not model.« less
NASA Astrophysics Data System (ADS)
Binder, T.; Boldini, P. C.; Romano, F.; Herdrich, G.; Fasoulas, S.
2016-11-01
Atmosphere-Breathing Electric Propulsion systems (ABEP) are currently investigated to utilize the residual atmosphere as propellant for drag-compensating thrusters on spacecraft in (very) low orbits. The key concept for an efficient intake of such a system is to feed a large fraction of the incoming flow to the thruster by a high transmission probability Θ for the inflow while Θ for the backflow should be as low as possible. This is the case for rarefied flows through tube-like structures of arbitrary cross section when assuming diffuse wall reflections inside and after these ducts, and entrance velocities u larger than thermal velocities vt h∝√{kBT /m } . The theory of transmission for free molecular flow through cylinders is well known for u = 0, but less research results are available for u > 0. In this paper, the desired theoretical characteristics of intakes for ABEP are pointed out, a short review of transmission probabilities is given, and results of Monte Carlo simulations concerning Θ are presented. Based on simple algebraic relations, an intake can be optimized in terms of collection efficiency by choosing optimal ducts. It is shown that Θ depends only on non-dimensional values of the duct geometry combined with vth and u. The simulation results of a complete exemplary ABEP configuration illustrate the influence of modeling quality in terms of inflow conditions and inter-particle collisions.
Exposure Patterns Driving Ebola Transmission in West Africa: A Retrospective Observational Study
Agua-Agum, Junerlyn; Aylward, Bruce; Bawo, Luke; Blake, Isobel M.; Brennan, Richard J.; Cawthorne, Amy; Cleary, Eilish; Clement, Peter; Conteh, Roland; Cori, Anne; Dafae, Foday; Dahl, Benjamin; Dangou, Jean-Marie; Diallo, Boubacar; Donnelly, Christl A.; Dye, Christopher; Eckmanns, Tim; Fallah, Mosoka; Fiebig, Lena; Fraser, Christophe; Garske, Tini; Gonzalez, Lice; Hamblion, Esther; Hamid, Nuha; Hinsley, Wes; Jambei, Amara; Jombart, Thibaut; Kargbo, David; Keita, Sakoba; Kinzer, Michael; George, Fred Kuti; Godefroy, Beatrice; Gutierrez, Giovanna; Kannangarage, Niluka; Mills, Harriet L.; Moller, Thomas; Meijers, Sascha; Mohamed, Yasmine; Newton, Emily; Nouvellet, Pierre; Nyenswah, Tolbert; Perea, William; Perkins, Devin; Riley, Steven; Rondy, Marc; Sagrado, Maria; Savulescu, Camelia; Schafer, Ilana J.; Schumacher, Dirk; Seyler, Thomas; Shah, Anita; Van Kerkhove, Maria D.; Wesseh, C. Samford; Yoti, Zabulon
2016-01-01
Background The ongoing West African Ebola epidemic began in December 2013 in Guinea, probably from a single zoonotic introduction. As a result of ineffective initial control efforts, an Ebola outbreak of unprecedented scale emerged. As of 4 May 2015, it had resulted in more than 19,000 probable and confirmed Ebola cases, mainly in Guinea (3,529), Liberia (5,343), and Sierra Leone (10,746). Here, we present analyses of data collected during the outbreak identifying drivers of transmission and highlighting areas where control could be improved. Methods and Findings Over 19,000 confirmed and probable Ebola cases were reported in West Africa by 4 May 2015. Individuals with confirmed or probable Ebola (“cases”) were asked if they had exposure to other potential Ebola cases (“potential source contacts”) in a funeral or non-funeral context prior to becoming ill. We performed retrospective analyses of a case line-list, collated from national databases of case investigation forms that have been reported to WHO. These analyses were initially performed to assist WHO’s response during the epidemic, and have been updated for publication. We analysed data from 3,529 cases in Guinea, 5,343 in Liberia, and 10,746 in Sierra Leone; exposures were reported by 33% of cases. The proportion of cases reporting a funeral exposure decreased over time. We found a positive correlation (r = 0.35, p < 0.001) between this proportion in a given district for a given month and the within-district transmission intensity, quantified by the estimated reproduction number (R). We also found a negative correlation (r = −0.37, p < 0.001) between R and the district proportion of hospitalised cases admitted within ≤4 days of symptom onset. These two proportions were not correlated, suggesting that reduced funeral attendance and faster hospitalisation independently influenced local transmission intensity. We were able to identify 14% of potential source contacts as cases in the case line-list. Linking cases to the contacts who potentially infected them provided information on the transmission network. This revealed a high degree of heterogeneity in inferred transmissions, with only 20% of cases accounting for at least 73% of new infections, a phenomenon often called super-spreading. Multivariable regression models allowed us to identify predictors of being named as a potential source contact. These were similar for funeral and non-funeral contacts: severe symptoms, death, non-hospitalisation, older age, and travelling prior to symptom onset. Non-funeral exposures were strongly peaked around the death of the contact. There was evidence that hospitalisation reduced but did not eliminate onward exposures. We found that Ebola treatment units were better than other health care facilities at preventing exposure from hospitalised and deceased individuals. The principal limitation of our analysis is limited data quality, with cases not being entered into the database, cases not reporting exposures, or data being entered incorrectly (especially dates, and possible misclassifications). Conclusions Achieving elimination of Ebola is challenging, partly because of super-spreading. Safe funeral practices and fast hospitalisation contributed to the containment of this Ebola epidemic. Continued real-time data capture, reporting, and analysis are vital to track transmission patterns, inform resource deployment, and thus hasten and maintain elimination of the virus from the human population. PMID:27846234
Djordjević, Tijana; Radović, Ivan; Despoja, Vito; Lyon, Keenan; Borka, Duško; Mišković, Zoran L
2018-01-01
We present an analytical modeling of the electron energy loss (EEL) spectroscopy data for free-standing graphene obtained by scanning transmission electron microscope. The probability density for energy loss of fast electrons traversing graphene under normal incidence is evaluated using an optical approximation based on the conductivity of graphene given in the local, i.e., frequency-dependent form derived by both a two-dimensional, two-fluid extended hydrodynamic (eHD) model and an ab initio method. We compare the results for the real and imaginary parts of the optical conductivity in graphene obtained by these two methods. The calculated probability density is directly compared with the EEL spectra from three independent experiments and we find very good agreement, especially in the case of the eHD model. Furthermore, we point out that the subtraction of the zero-loss peak from the experimental EEL spectra has a strong influence on the analytical model for the EEL spectroscopy data. Copyright © 2017 Elsevier B.V. All rights reserved.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-28
... bring together experts from diverse backgrounds and experiences including electric system operators... transmission switching; AC optimal power flow modeling; and use of active and dynamic transmission ratings. In... variability of the system, including forecast error? [cir] How can outage probability be captured in...
Cluster of Nipah virus infection, Kushtia District, Bangladesh, 2007.
Homaira, Nusrat; Rahman, Mahmudur; Hossain, M Jahangir; Nahar, Nazmun; Khan, Rasheda; Rahman, Mostafizur; Podder, Goutam; Nahar, Kamrun; Khan, Dawlat; Gurley, Emily S; Rollin, Pierre E; Comer, James A; Ksiazek, Thomas G; Luby, Stephen P
2010-10-21
In March 2007, we investigated a cluster of Nipah encephalitis to identify risk factors for Nipah infection in Bangladesh. We defined confirmed Nipah cases by the presence of IgM and IgG antibodies against Nipah virus in serum. Case-patients, who resided in the same village during the outbreak period but died before serum could be collected, were classified as probable cases. We identified three confirmed and five probable Nipah cases. There was a single index case. Five of the secondary cases came in close physical contact to the index case when she was ill. Case-patients were more likely to have physical contact with the index case (71% cases versus 0% controls, p = <0.001). The index case, on her third day of illness, and all the subsequent cases attended the same religious gathering. For three probable cases including the index case, we could not identify any known risk factors for Nipah infection such as physical contact with Nipah case-patients, consumption of raw date palm juice, or contact with sick animals or fruit bats. Though person-to-person transmission remains an important mode of transmission for Nipah infection, we could not confirm the source of infection for three of the probable Nipah case-patients. Continued surveillance and outbreak investigations will help better understand the transmission of Nipah virus and develop preventive strategies.
Solution of the finite Milne problem in stochastic media with RVT Technique
NASA Astrophysics Data System (ADS)
Slama, Howida; El-Bedwhey, Nabila A.; El-Depsy, Alia; Selim, Mustafa M.
2017-12-01
This paper presents the solution to the Milne problem in the steady state with isotropic scattering phase function. The properties of the medium are considered as stochastic ones with Gaussian or exponential distributions and hence the problem treated as a stochastic integro-differential equation. To get an explicit form for the radiant energy density, the linear extrapolation distance, reflectivity and transmissivity in the deterministic case the problem is solved using the Pomraning-Eddington method. The obtained solution is found to be dependent on the optical space variable and thickness of the medium which are considered as random variables. The random variable transformation (RVT) technique is used to find the first probability density function (1-PDF) of the solution process. Then the stochastic linear extrapolation distance, reflectivity and transmissivity are calculated. For illustration, numerical results with conclusions are provided.
A Comparison of Vibration and Oil Debris Gear Damage Detection Methods Applied to Pitting Damage
NASA Technical Reports Server (NTRS)
Dempsey, Paula J.
2000-01-01
Helicopter Health Usage Monitoring Systems (HUMS) must provide reliable, real-time performance monitoring of helicopter operating parameters to prevent damage of flight critical components. Helicopter transmission diagnostics are an important part of a helicopter HUMS. In order to improve the reliability of transmission diagnostics, many researchers propose combining two technologies, vibration and oil monitoring, using data fusion and intelligent systems. Some benefits of combining multiple sensors to make decisions include improved detection capabilities and increased probability the event is detected. However, if the sensors are inaccurate, or the features extracted from the sensors are poor predictors of transmission health, integration of these sensors will decrease the accuracy of damage prediction. For this reason, one must verify the individual integrity of vibration and oil analysis methods prior to integrating the two technologies. This research focuses on comparing the capability of two vibration algorithms, FM4 and NA4, and a commercially available on-line oil debris monitor to detect pitting damage on spur gears in the NASA Glenn Research Center Spur Gear Fatigue Test Rig. Results from this research indicate that the rate of change of debris mass measured by the oil debris monitor is comparable to the vibration algorithms in detecting gear pitting damage.
Fazil, Aamir; Gachon, Philippe; Deuymes, Guillaume; Radojević, Milka; Mascarenhas, Mariola; Garasia, Sophiya; Johansson, Michael A.; Ogden, Nicholas H.
2017-01-01
Background: Chikungunya virus (CHIKV) is a reemerging pathogen transmitted by Aedes aegypti and Aedes albopictus mosquitoes. The ongoing Caribbean outbreak is of concern due to the potential for infected travelers to spread the virus to countries where vectors are present and the population is susceptible. Although there has been no autochthonous transmission of CHIKV in Canada, there is concern that both Ae. albopictus and CHIKV will become established, particularly under projected climate change. We developed risk maps for autochthonous CHIKV transmission in Canada under recent (1981–2010) and projected climate (2011–2040 and 2041–2070). Methods: The risk for CHIKV transmission was the combination of the climatic suitability for CHIKV transmission potential and the climatic suitability for the presence of Ae. albopictus; the former was assessed using a stochastic model to calculate R0 and the latter was assessed by deriving a suitability indicator (SIG) that captures a set of climatic conditions known to influence the ecology of Ae. albopictus. R0 and SIG were calculated for each grid cell in Canada south of 60°N, for each time period and for two emission scenarios, and combined to produce overall risk categories that were mapped to identify areas suitable for transmission and the duration of transmissibility. Findings: The risk for autochthonous CHIKV transmission under recent climate is very low with all of Canada classified as unsuitable or rather unsuitable for transmission. Small parts of southern coastal British Columbia become progressively suitable with short-term and long-term projected climate; the duration of potential transmission is limited to 1–2 months of the year. Interpretation: Although the current risk for autochthonous CHIKV transmission in Canada is very low, our study could be further supported by the routine surveillance of Ae. albopictus in areas identified as potentially suitable for transmission given our uncertainty on the current distribution of this species in Canada. https://doi.org/10.1289/EHP669 PMID:28731409
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marsequerra, M.; Pauli, G.
1958-12-01
On the basis of the results obtained in Part I (CNC-1), expressions are derived for the transmission probability through a revolving curved slit for neutrons having a velocity distribution f(v), the distribution shown by the neutrons after the flight, and the uncertainty in the energy of neutrons detected in an infinitesimal time interval. (auth)
The potential for sexual transmission to compromise control of Ebola virus outbreaks.
Vinson, John E; Drake, John M; Rohani, Pejman; Park, Andrew W
2016-06-01
Recent evidence suggests that sexual contact may give rise to transmission of Ebola virus long after infection has been cleared from blood. We develop a simple mathematical model that incorporates contact transmission and sexual transmission parametrized from data relating to the 2013-2015 West African Ebola epidemic. The model explores scenarios where contact transmission is reduced following infection events, capturing behaviour change, and quantifies how these actions reducing transmission may be compromised by sexual transmission in terms of increasing likelihood, size and duration of outbreaks. We characterize the extent to which sexual transmission operates in terms of the probability of initial infection resolving to sexual infectiousness and the sexual transmission rate, and relate these parameters to the overall case burden. We find that sexual transmission can have large effects on epidemic dynamics (increasing attack ratios from 25% in scenarios without sexual transmission but with contact-transmission-reducing behaviour, up to 80% in equivalent scenarios with sexual transmission). © 2016 The Author(s).
2014-01-01
Background Plasmodium falciparum transmission has decreased significantly in Zambia in the last decade. The malaria transmission is influenced by environmental variables. Incorporation of environmental variables in models of malaria transmission likely improves model fit and predicts probable trends in malaria disease. This work is based on the hypothesis that remotely-sensed environmental factors, including nocturnal dew point, are associated with malaria transmission and sustain foci of transmission during the low transmission season in the Southern Province of Zambia. Methods Thirty-eight rural health centres in Southern Province, Zambia were divided into three zones based on transmission patterns. Correlations between weekly malaria cases and remotely-sensed nocturnal dew point, nocturnal land surface temperature as well as vegetation indices and rainfall were evaluated in time-series analyses from 2012 week 19 to 2013 week 36. Zonal as well as clinic-based, multivariate, autoregressive, integrated, moving average (ARIMAX) models implementing environmental variables were developed to model transmission in 2011 week 19 to 2012 week 18 and forecast transmission in 2013 week 37 to week 41. Results During the dry, low transmission season significantly higher vegetation indices, nocturnal land surface temperature and nocturnal dew point were associated with the areas of higher transmission. Environmental variables improved ARIMAX models. Dew point and normalized differentiated vegetation index were significant predictors and improved all zonal transmission models. In the high-transmission zone, this was also seen for land surface temperature. Clinic models were improved by adding dew point and land surface temperature as well as normalized differentiated vegetation index. The mean average error of prediction for ARIMAX models ranged from 0.7 to 33.5%. Forecasts of malaria incidence were valid for three out of five rural health centres; however, with poor results at the zonal level. Conclusions In this study, the fit of ARIMAX models improves when environmental variables are included. There is a significant association of remotely-sensed nocturnal dew point with malaria transmission. Interestingly, dew point might be one of the factors sustaining malaria transmission in areas of general aridity during the dry season. PMID:24927747
Transmission of electrons inside the cryogenic pumps of ITER injector
DOE Office of Scientific and Technical Information (OSTI.GOV)
Veltri, P., E-mail: pierluigi.veltri@igi.cnr.it; Sartori, E.
2016-02-15
Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particlemore » trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.« less
Analytical study of nano-scale logical operations
NASA Astrophysics Data System (ADS)
Patra, Moumita; Maiti, Santanu K.
2018-07-01
A complete analytical prescription is given to perform three basic (OR, AND, NOT) and two universal (NAND, NOR) logic gates at nano-scale level using simple tailor made geometries. Two different geometries, ring-like and chain-like, are taken into account where in each case the bridging conductor is coupled to a local atomic site through a dangling bond whose site energy can be controlled by means of external gate electrode. The main idea is that when injecting electron energy matches with site energy of local atomic site transmission probability drops exactly to zero, whereas the junction exhibits finite transmission for other energies. Utilizing this prescription we perform logical operations, and, we strongly believe that the proposed results can be verified in laboratory. Finally, we numerically compute two-terminal transmission probability considering general models and the numerical results match exactly well with our analytical findings.
Fiebig, Lena; Kohl, Thomas A; Popovici, Odette; Mühlenfeld, Margarita; Indra, Alexander; Homorodean, Daniela; Chiotan, Domnica; Richter, Elvira; Rüsch-Gerdes, Sabine; Schmidgruber, Beatrix; Beckert, Patrick; Hauer, Barbara; Niemann, Stefan; Allerberger, Franz; Haas, Walter
2017-01-12
Molecular surveillance of multidrug-resistant tuberculosis (MDR-TB) using 24-loci MIRU-VNTR in the European Union suggests the occurrence of international transmission. In early 2014, Austria detected a molecular MDR-TB cluster of five isolates. Links to Romania and Germany prompted the three countries to investigate possible cross-border MDR-TB transmission jointly. We searched genotyping databases, genotyped additional isolates from Romania, used whole genome sequencing (WGS) to infer putative transmission links, and investigated pairwise epidemiological links and patient mobility. Ten isolates from 10 patients shared the same 24-loci MIRU-VNTR pattern. Within this cluster, WGS defined two subgroups of four patients each. The first comprised an MDR-TB patient from Romania who had sought medical care in Austria and two patients from Austria. The second comprised patients, two of them epidemiologically linked, who lived in three different countries but had the same city of provenance in Romania. Our findings strongly suggested that the two cases in Austrian citizens resulted from a newly introduced MDR-TB strain, followed by domestic transmission. For the other cases, transmission probably occurred in the same city of provenance. To prevent further MDR-TB transmission, we need to ensure universal access to early and adequate therapy and collaborate closely in tuberculosis care beyond administrative borders. This article is copyright of The Authors, 2017.
Inference of R 0 and Transmission Heterogeneity from the Size Distribution of Stuttering Chains
Blumberg, Seth; Lloyd-Smith, James O.
2013-01-01
For many infectious disease processes such as emerging zoonoses and vaccine-preventable diseases, and infections occur as self-limited stuttering transmission chains. A mechanistic understanding of transmission is essential for characterizing the risk of emerging diseases and monitoring spatio-temporal dynamics. Thus methods for inferring and the degree of heterogeneity in transmission from stuttering chain data have important applications in disease surveillance and management. Previous researchers have used chain size distributions to infer , but estimation of the degree of individual-level variation in infectiousness (as quantified by the dispersion parameter, ) has typically required contact tracing data. Utilizing branching process theory along with a negative binomial offspring distribution, we demonstrate how maximum likelihood estimation can be applied to chain size data to infer both and the dispersion parameter that characterizes heterogeneity. While the maximum likelihood value for is a simple function of the average chain size, the associated confidence intervals are dependent on the inferred degree of transmission heterogeneity. As demonstrated for monkeypox data from the Democratic Republic of Congo, this impacts when a statistically significant change in is detectable. In addition, by allowing for superspreading events, inference of shifts the threshold above which a transmission chain should be considered anomalously large for a given value of (thus reducing the probability of false alarms about pathogen adaptation). Our analysis of monkeypox also clarifies the various ways that imperfect observation can impact inference of transmission parameters, and highlights the need to quantitatively evaluate whether observation is likely to significantly bias results. PMID:23658504
Sol-gel-derived double-layered nanocrystal memory
NASA Astrophysics Data System (ADS)
Ko, Fu-Hsiang; You, Hsin-Chiang; Lei, Tan-Fu
2006-12-01
The authors have used the sol-gel spin-coating method to fabricate a coexisting hafnium silicate and zirconium silicate double-layered nanocrystal (NC) memories. From transmission electron microscopic and x-ray photoelectron spectroscopic analyses, the authors determined that the hafnium silicate and zirconium silicate NCs formed after annealing at 900°C for 1min. When using channel hot electron injection for charging and band-to-band tunneling-induced hot hole injection for discharging, the NC memories exhibited superior Vth shifting because of the higher probability for trapping the charge carrier.
Bennett, Gordon D.; Patten, E.P.
1962-01-01
This report describes the theory and field procedures for determining the transmissibility and storage coefficients and the original hydrostatic head of each aquifer penetrated by a multiaquifer well. The procedure involves pumping the well in such a manner that the drawdown of water level is constant while the discharges of the different aquifers are measured by means of borehole flowmeters. The theory is developed by analogy to the heat-flow problem solved by Smith. The internal discharge between aquifers after the well is completed is analyzed as the first step. Pumping at constant, drawdown constitutes the second step. Transmissibility and storage coefficients are determined by a method described by Jacob and Lohman, after the original internal discharge to or from the aquifer has been compensated for in the calculations. The original hydrostatic head of each aquifer is then determined by resubstituting the transmissibility and storage coefficients into the first step of the analysis. The method was tested on a well in Chester County, Pa., but the results were not entirely satisfactory, owing to the lack of sufficiently accurate methods of flow measurement and, probably, to the effects of entrance losses in the well. The determinations of the transmissibility coefficient and static head can be accepted as having order-of-magnitude significance, but the determinations of the storage coefficient, which is highly sensitive to experimental error, must be rejected. It is felt that better results may be achieved in the future, as more reliable devices for metering the flow become available and as more is learned concerning the nature of entrance losses. If accurate data can be obtained, recently developed techniques of digital or analog computation may permit determination of the response of each aquifer in the well to any form of pumping.
Assessing wildland fire risk transmission to communities in northern Spain
Fermín J. Alcasena; Michele Salis; Alan A. Ager; Rafael Castell; Cristina Vega-García
2017-01-01
We assessed potential economic losses and transmission to residential houses from wildland fires in a rural area of central Navarra (Spain). Expected losses were quantified at the individual structure level (n = 306) in 14 rural communities by combining fire model predictions of burn probability and fire intensity with susceptibility functions derived from expert...
Estimating synaptic parameters from mean, variance, and covariance in trains of synaptic responses.
Scheuss, V; Neher, E
2001-10-01
Fluctuation analysis of synaptic transmission using the variance-mean approach has been restricted in the past to steady-state responses. Here we extend this method to short repetitive trains of synaptic responses, during which the response amplitudes are not stationary. We consider intervals between trains, long enough so that the system is in the same average state at the beginning of each train. This allows analysis of ensemble means and variances for each response in a train separately. Thus, modifications in synaptic efficacy during short-term plasticity can be attributed to changes in synaptic parameters. In addition, we provide practical guidelines for the analysis of the covariance between successive responses in trains. Explicit algorithms to estimate synaptic parameters are derived and tested by Monte Carlo simulations on the basis of a binomial model of synaptic transmission, allowing for quantal variability, heterogeneity in the release probability, and postsynaptic receptor saturation and desensitization. We find that the combined analysis of variance and covariance is advantageous in yielding an estimate for the number of release sites, which is independent of heterogeneity in the release probability under certain conditions. Furthermore, it allows one to calculate the apparent quantal size for each response in a sequence of stimuli.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, S.; Li, Y.; Liu, C.
2015-08-15
This paper presents a statistical theory for the initial onset of multipactor breakdown in coaxial transmission lines, taking both the nonuniform electric field and random electron emission velocity into account. A general numerical method is first developed to construct the joint probability density function based on the approximate equation of the electron trajectory. The nonstationary dynamics of the multipactor process on both surfaces of coaxial lines are modelled based on the probability of various impacts and their corresponding secondary emission. The resonant assumption of the classical theory on the independent double-sided and single-sided impacts is replaced by the consideration ofmore » their interaction. As a result, the time evolutions of the electron population for exponential growth and absorption on both inner and outer conductor, in response to the applied voltage above and below the multipactor breakdown level, are obtained to investigate the exact mechanism of multipactor discharge in coaxial lines. Furthermore, the multipactor threshold predictions of the presented model are compared with experimental results using measured secondary emission yield of the tested samples which shows reasonable agreement. Finally, the detailed impact scenario reveals that single-surface multipactor is more likely to occur with a higher outer to inner conductor radius ratio.« less
The Potential Economic Value of Screening Hospital Admissions for Clostridium difficile
Bartsch, Sarah M.; Curry, Scott R.; Harrison, Lee H.; Lee, Bruce Y.
2012-01-01
Purpose Asymptomatic Clostridium difficile carriage has a prevalence reported as high as 51% to 85%; with up to 84% of incident hospital-acquired infections linked to carriers. Accurately identifying carriers may limit the spread of Clostridium difficile. Methods Since new technology adoption depends heavily on its economic value, we developed a analytic simulation model to determine the cost-effectiveness screening hospital admissions for Clostridium difficile from the hospital and third party payer perspectives. Isolation precautions were applied to patients testing positive, preventing transmission. Sensitivity analyses varied Clostridium difficile colonization rate, infection probability among secondary cases, contact isolation compliance, and screening cost. Results Screening was cost-effective [i.e., incremental cost-effectiveness ratio (ICER) ≤$50,000/QALY] for every scenario tested; all ICER values ≤$256/QALY. Screening was economically dominant (i.e., saved costs and provided health benefits) with a ≥10.3% colonization rate and ≥5.88% infection probability when contact isolation compliance was ≥25% (hospital perspective). Under some conditions screening led to cost-savings per case averted (range: $53 to $272). Conclusion Clostridium difficile screening, coupled with isolation precautions, may be a cost-effective intervention to hospitals and third party payers, based on prevalence. Limiting Clostridium difficile transmission can reduce the number of infections, thereby reducing its economic burden to the healthcare system. PMID:22752150
Spatially structured superinfection and the evolution of disease virulence.
Caraco, Thomas; Glavanakov, Stephan; Li, Shengua; Maniatty, William; Szymanski, Boleslaw K
2006-06-01
When pathogen strains differing in virulence compete for hosts, spatial structuring of disease transmission can govern both evolved levels of virulence and patterns in strain coexistence. We develop a spatially detailed model of superinfection, a form of contest competition between pathogen strains; the probability of superinfection depends explicitly on the difference in levels of virulence. We apply methods of adaptive dynamics to address the interplay of spatial dynamics and evolution. The mean-field approximation predicts evolution to criticality; any small increase in virulence capable of dynamical persistence is favored. Both pair approximation and simulation of the detailed model indicate that spatial structure constrains disease virulence. Increased spatial clustering reduces the maximal virulence capable of single-strain persistence and, more importantly, reduces the convergent-stable virulence level under strain competition. The spatially detailed model predicts that increasing the probability of superinfection, for given difference in virulence, increases the likelihood of between-strain coexistence. When strains differing in virulence can coexist ecologically, our results may suggest policies for managing diseases with localized transmission. Comparing equilibrium densities from the pair approximation, we find that introducing a more virulent strain into a host population infected by a less virulent strain can sometimes reduce total host mortality and increase global host density.
Spin-dependent Seebeck effects in a graphene superlattice p-n junction with different shapes
NASA Astrophysics Data System (ADS)
Zhou, Benhu; Zhou, Benliang; Yao, Yagang; Zhou, Guanghui; Hu, Ming
2017-10-01
We theoretically calculate the spin-dependent transmission probability and spin Seebeck coefficient for a zigzag-edge graphene nanoribbon p-n junction with periodically attached stubs under a perpendicular magnetic field and a ferromagnetic insulator. By using the nonequilibrium Green’s function method combining with the tight-binding Hamiltonian, it is demonstrated that the spin-dependent transmission probability and spin Seebeck coefficient for two types of superlattices can be modulated by the potential drop, the magnetization strength, the number of periods of the superlattice, the strength of the perpendicular magnetic field, and the Anderson disorder strength. Interestingly, a metal to semiconductor transition occurs as the number of the superlattice for a crossed superlattice p-n junction increases, and its spin Seebeck coefficient is much larger than that for the T-shaped one around the zero Fermi energy. Furthermore, the spin Seebeck coefficient for crossed systems can be much pronounced and their maximum absolute value can reach 528 μV K-1 by choosing optimized parameters. Besides, the spin Seebeck coefficient for crossed p-n junction is strongly enhanced around the zero Fermi energy for a weak magnetic field. Our results provide theoretical references for modulating the thermoelectric properties of a graphene superlattice p-n junction by tuning its geometric structure and physical parameters.
French, N P; Clancy, D; Davison, H C; Trees, A J
1999-10-01
The transmission and control of Neospora caninum infection in dairy cattle was examined using deterministic and stochastic models. Parameter estimates were derived from recent studies conducted in the UK and from the published literature. Three routes of transmission were considered: maternal vertical transmission with a high probability (0.95), horizontal transmission from infected cattle within the herd, and horizontal transmission from an independent external source. Putative infection via pooled colostrum was used as an example of within-herd horizontal transmission, and the recent finding that the dog is a definitive host of N. caninum supported the inclusion of an external independent source of infection. The predicted amount of horizontal transmission required to maintain infection at levels commonly observed in field studies in the UK and elsewhere, was consistent with that observed in studies of post-natal seroconversion (0.85-9.0 per 100 cow-years). A stochastic version of the model was used to simulate the spread of infection in herds of 100 cattle, with a mean infection prevalence similar to that observed in UK studies (around 20%). The distributions of infected and uninfected cattle corresponded closely to Normal distributions, with S.D.s of 6.3 and 7.0, respectively. Control measures were considered by altering birth, death and horizontal transmission parameters. A policy of annual culling of infected cattle very rapidly reduced the prevalence of infection, and was shown to be the most effective method of control in the short term. Not breeding replacements from infected cattle was also effective in the short term, particularly in herds with a higher turnover of cattle. However, the long-term effectiveness of these measures depended on the amount and source of horizontal infection. If the level of within-herd transmission was above a critical threshold, then a combination of reducing within-herd, and blocking external sources of transmission was required to permanently eliminate infection.
Potential for Zika Virus to Establish a Sylvatic Transmission Cycle in the Americas
Althouse, Benjamin M.; Vasilakis, Nikos; Sall, Amadou A.; Diallo, Mawlouth; Weaver, Scott C.; Hanley, Kathryn A.
2016-01-01
Zika virus (ZIKV) originated and continues to circulate in a sylvatic transmission cycle between non-human primate hosts and arboreal mosquitoes in tropical Africa. Recently ZIKV invaded the Americas, where it poses a threat to human health, especially to pregnant women and their infants. Here we examine the risk that ZIKV will establish a sylvatic cycle in the Americas, focusing on Brazil. We review the natural history of sylvatic ZIKV and present a mathematical dynamic transmission model to assess the probability of establishment of a sylvatic ZIKV transmission cycle in non-human primates and/or other mammals and arboreal mosquito vectors in Brazil. Brazil is home to multiple species of primates and mosquitoes potentially capable of ZIKV transmission, though direct assessment of host competence (ability to mount viremia sufficient to infect a feeding mosquito) and vector competence (ability to become infected with ZIKV and disseminate and transmit upon subsequent feedings) of New World species is lacking. Modeling reveals a high probability of establishment of sylvatic ZIKV across a large range of biologically plausible parameters. Probability of establishment is dependent on host and vector population sizes, host birthrates, and ZIKV force of infection. Research on the host competence of New World monkeys or other small mammals to ZIKV, on vector competence of New World Aedes, Sabethes, and Haemagogus mosquitoes for ZIKV, and on the geographic range of potential New World hosts and vectors is urgently needed. A sylvatic cycle of ZIKV would make future elimination efforts in the Americas practically impossible, and paints a dire picture for the epidemiology of ZIKV and our ability to end the ongoing outbreak of congenital Zika syndrome. PMID:27977671
Hui, B; Fairley, C K; Chen, M; Grulich, A; Hocking, J; Prestage, G; Walker, S; Law, M; Regan, D
2015-08-01
Despite early treatment of urethral infection, gonorrhoea is endemic in urban populations of men who have sex with men (MSM) in Australia. By contrast, gonorrhoea is not common in urban heterosexual populations. Sexual activities among MSM usually involve anal or oral sex, and as these behaviours are becoming increasingly common among heterosexuals, there is a need to investigate their roles in transmission of gonorrhoea. We developed individual-based models of transmission of gonorrhoea in MSM and heterosexuals that incorporate anatomical site-specific transmission of gonorrhoea. We estimated the probabilities of transmission for anal sex and oral sex by calibrating an MSM model against prevalence of gonorrhoea and sexual activity data. These probabilities were then applied to a heterosexual model in order to examine whether gonorrhoea can persist in a heterosexual population through the addition of anal sex and oral sex. In the MSM model, gonorrhoea can persist despite prompt treatment of urethral infections. The probability of gonorrhoea persisting is reduced if use of condom for oral sex is increased to more than 15% of acts. Assuming that treatment of symptomatic infections is prompt, gonorrhoea is unlikely to persist in a heterosexual population even with the addition of anal and oral sex. Our models suggest that oral sex has an important role in sustaining gonorrhoea in a population of MSM by providing a pool of untreated asymptomatic infection. The importance of anal sex or oral sex in sustaining gonorrhoea in a heterosexual population remains uncertain due to the lack of information linking different types of sex acts and transmissibility. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Potential for Zika Virus to Establish a Sylvatic Transmission Cycle in the Americas.
Althouse, Benjamin M; Vasilakis, Nikos; Sall, Amadou A; Diallo, Mawlouth; Weaver, Scott C; Hanley, Kathryn A
2016-12-01
Zika virus (ZIKV) originated and continues to circulate in a sylvatic transmission cycle between non-human primate hosts and arboreal mosquitoes in tropical Africa. Recently ZIKV invaded the Americas, where it poses a threat to human health, especially to pregnant women and their infants. Here we examine the risk that ZIKV will establish a sylvatic cycle in the Americas, focusing on Brazil. We review the natural history of sylvatic ZIKV and present a mathematical dynamic transmission model to assess the probability of establishment of a sylvatic ZIKV transmission cycle in non-human primates and/or other mammals and arboreal mosquito vectors in Brazil. Brazil is home to multiple species of primates and mosquitoes potentially capable of ZIKV transmission, though direct assessment of host competence (ability to mount viremia sufficient to infect a feeding mosquito) and vector competence (ability to become infected with ZIKV and disseminate and transmit upon subsequent feedings) of New World species is lacking. Modeling reveals a high probability of establishment of sylvatic ZIKV across a large range of biologically plausible parameters. Probability of establishment is dependent on host and vector population sizes, host birthrates, and ZIKV force of infection. Research on the host competence of New World monkeys or other small mammals to ZIKV, on vector competence of New World Aedes, Sabethes, and Haemagogus mosquitoes for ZIKV, and on the geographic range of potential New World hosts and vectors is urgently needed. A sylvatic cycle of ZIKV would make future elimination efforts in the Americas practically impossible, and paints a dire picture for the epidemiology of ZIKV and our ability to end the ongoing outbreak of congenital Zika syndrome.
Gao, Xiaolei; Wei, Jianjian; Lei, Hao; Xu, Pengcheng; Cowling, Benjamin J; Li, Yuguo
2016-01-01
Emerging diseases may spread rapidly through dense and large urban contact networks, especially they are transmitted by the airborne route, before new vaccines can be made available. Airborne diseases may spread rapidly as people visit different indoor environments and are in frequent contact with others. We constructed a simple indoor contact model for an ideal city with 7 million people and 3 million indoor spaces, and estimated the probability and duration of contact between any two individuals during one day. To do this, we used data from actual censuses, social behavior surveys, building surveys, and ventilation measurements in Hong Kong to define eight population groups and seven indoor location groups. Our indoor contact model was integrated with an existing epidemiological Susceptible, Exposed, Infectious, and Recovered (SEIR) model to estimate disease spread and with the Wells-Riley equation to calculate local infection risks, resulting in an integrated indoor transmission network model. This model was used to estimate the probability of an infected individual infecting others in the city and to study the disease transmission dynamics. We predicted the infection probability of each sub-population under different ventilation systems in each location type in the case of a hypothetical airborne disease outbreak, which is assumed to have the same natural history and infectiousness as smallpox. We compared the effectiveness of controlling ventilation in each location type with other intervention strategies. We conclude that increasing building ventilation rates using methods such as natural ventilation in classrooms, offices, and homes is a relatively effective strategy for airborne diseases in a large city.
Wolfe, Mitchell I.; Xu, Fujie; Patel, Priti; O'Cain, Michael; Schillinger, Julia A.; St. Louis, Michael E.; Finelli, Lyn
2001-01-01
Objectives. After syphilis outbreaks were reported at 3 Alabama State men's prisons in early 1999, we conducted an investigation to evaluate risk factors for syphilis infection and describe patterns of syphilis transmission. Methods. We reviewed medical, patient interview, and prison transfer records and documented sexual networks. Presumptive source cases were identified. Odds of exposure to unscreened jail populations and transfer from other prisons were calculated for case patients at 1 prison. Results. Thirty-nine case patients with early syphilis were identified from 3 prisons. Recent jail exposure (odds ratio [OR] = 8.0, 95% confidence interval [CI] = 0.3, 158.7, P = .14) and prison transfer (OR = 32.0, 95% CI = 1.6, 1668.1, P < .01) were associated with being a source case patient. Conclusions. Probable sources of syphilis introduction into and transmission within prisons included mixing of prisoners with unscreened jail populations, transfer of infected inmates between prisons, and multiple concurrent sexual partnerships. Reducing sexual transmission of disease in correctional settings is a public health priority and will require innovative prevention strategies. PMID:11499107
Policies to Reduce Influenza in the Workplace: Impact Assessments Using an Agent-Based Model
Grefenstette, John J.; Galloway, David; Albert, Steven M.; Burke, Donald S.
2013-01-01
Objectives. We examined the impact of access to paid sick days (PSDs) and stay-at-home behavior on the influenza attack rate in workplaces. Methods. We used an agent-based model of Allegheny County, Pennsylvania, with PSD data from the US Bureau of Labor Statistics, standard influenza epidemic parameters, and the probability of staying home when ill. We compared the influenza attack rate among employees resulting from workplace transmission, focusing on the effects of presenteeism (going to work when ill). Results. In a simulated influenza epidemic (R0 = 1.4), the attack rate among employees owing to workplace transmission was 11.54%. A large proportion (72.00%) of this attack rate resulted from exposure to employees engaging in presenteeism. Universal PSDs reduced workplace infections by 5.86%. Providing 1 or 2 “flu days”—allowing employees with influenza to stay home—reduced workplace infections by 25.33% and 39.22%, respectively. Conclusions. PSDs reduce influenza transmission owing to presenteeism and, hence, the burden of influenza illness in workplaces. PMID:23763426
Analysis of Spatiotemporal Characteristics of Pandemic SARS Spread in Mainland China.
Cao, Chunxiang; Chen, Wei; Zheng, Sheng; Zhao, Jian; Wang, Jinfeng; Cao, Wuchun
2016-01-01
Severe acute respiratory syndrome (SARS) is one of the most severe emerging infectious diseases of the 21st century so far. SARS caused a pandemic that spread throughout mainland China for 7 months, infecting 5318 persons in 194 administrative regions. Using detailed mainland China epidemiological data, we study spatiotemporal aspects of this person-to-person contagious disease and simulate its spatiotemporal transmission dynamics via the Bayesian Maximum Entropy (BME) method. The BME reveals that SARS outbreaks show autocorrelation within certain spatial and temporal distances. We use BME to fit a theoretical covariance model that has a sine hole spatial component and exponential temporal component and obtain the weights of geographical and temporal autocorrelation factors. Using the covariance model, SARS dynamics were estimated and simulated under the most probable conditions. Our study suggests that SARS transmission varies in its epidemiological characteristics and SARS outbreak distributions exhibit palpable clusters on both spatial and temporal scales. In addition, the BME modelling demonstrates that SARS transmission features are affected by spatial heterogeneity, so we analyze potential causes. This may benefit epidemiological control of pandemic infectious diseases.
Analysis of Spatiotemporal Characteristics of Pandemic SARS Spread in Mainland China
Cao, Chunxiang; Zheng, Sheng; Zhao, Jian; Wang, Jinfeng; Cao, Wuchun
2016-01-01
Severe acute respiratory syndrome (SARS) is one of the most severe emerging infectious diseases of the 21st century so far. SARS caused a pandemic that spread throughout mainland China for 7 months, infecting 5318 persons in 194 administrative regions. Using detailed mainland China epidemiological data, we study spatiotemporal aspects of this person-to-person contagious disease and simulate its spatiotemporal transmission dynamics via the Bayesian Maximum Entropy (BME) method. The BME reveals that SARS outbreaks show autocorrelation within certain spatial and temporal distances. We use BME to fit a theoretical covariance model that has a sine hole spatial component and exponential temporal component and obtain the weights of geographical and temporal autocorrelation factors. Using the covariance model, SARS dynamics were estimated and simulated under the most probable conditions. Our study suggests that SARS transmission varies in its epidemiological characteristics and SARS outbreak distributions exhibit palpable clusters on both spatial and temporal scales. In addition, the BME modelling demonstrates that SARS transmission features are affected by spatial heterogeneity, so we analyze potential causes. This may benefit epidemiological control of pandemic infectious diseases. PMID:27597972
Pneumonic Plague Cluster, Uganda, 2004
Asiki, Gershim; Anywaine, Zaccheus; Yockey, Brook; Schriefer, Martin E.; Aleti, Philliam; Ogen-Odoi, Asaph; Staples, J. Erin; Sexton, Christopher; Bearden, Scott W.; Kool, Jacob L.
2006-01-01
The public and clinicians have long-held beliefs that pneumonic plague is highly contagious; inappropriate alarm and panic have occurred during outbreaks. We investigated communicability in a naturally occurring pneumonic plague cluster. We defined a probable pneumonic plague case as an acute-onset respiratory illness with bloody sputum during December 2004 in Kango Subcounty, Uganda. A definite case was a probable case with laboratory evidence of Yersinia pestis infection. The cluster (1 definite and 3 probable cases) consisted of 2 concurrent index patient–caregiver pairs. Direct fluorescent antibody microscopy and polymerase chain reaction testing on the only surviving patient's sputum verified plague infection. Both index patients transmitted pneumonic plague to only 1 caregiver each, despite 23 additional untreated close contacts (attack rate 8%). Person-to-person transmission was compatible with transmission by respiratory droplets, rather than aerosols, and only a few close contacts, all within droplet range, became ill. PMID:16704785
Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Tall, Ben D; Keys, Christine E; Ziobro, George C
2015-07-31
The mechanical transmission of pathogenic bacteria by synanthropic filth flies is widely recognized. While many studies report the fate and the temporospatial distribution of ingested foodborne bacteria by filth flies, there is little evidence about the transmission dynamics of ingested foodborne bacteria by adult house flies (Musca domestica) to their progeny. In this study, we fed parental house fly adults with food contaminated with low, medium, and high concentrations of Salmonella enterica, Cronobacter sakazakii, Escherichia coli O157:H7, and Listeria monocytogenes and evaluated the probability of transmission of these pathogens to house fly eggs and the surface and the alimentary canal of their first filial (F1) generation adults. All foodborne pathogens were present in samples containing pooled house fly eggs. The probability of transmission was higher after parental house flies ingested food containing medium bacterial loads. Cronobacter sakazakii was 16, 6, and 3 times more likely to be transmitted to house fly eggs than S. enterica, E. coli O157:H7, and L. monocytogenes, respectively. Only S. enterica and C. sakazakii were transmitted to F1 generation adults and their presence was 2.4 times more likely on their body surfaces than in their alimentary canals. The highest probabilities of finding S. enterica (60 %) and C. sakazakii (28 %) on newly emerged F1 adults were observed after parental house flies ingested food containing medium and high levels of these pathogens, respectively. Our study demonstrates that adult house flies that fed from food contaminated with various levels of foodborne bacteria were able to transmit those pathogens to their eggs and some were further transmitted to newly emerged F1 generation adults, enhancing the vector potential of these insects. Understanding the type of associations that synanthropic filth flies establish with foodborne pathogens will help to elucidate transmission mechanisms and possible ways to mitigate the spread of foodborne pathogens.
NASA Technical Reports Server (NTRS)
Coy, J. J.; Townsend, D. P.; Zaretsky, E. V.
1985-01-01
Gearing technology in its modern form has a history of only 100 years. However, the earliest form of gearing can probably be traced back to fourth century B.C. Greece. Current gear practice and recent advances in the technology are drawn together. The history of gearing is reviewed briefly in the Introduction. Subsequent sections describe types of gearing and their geometry, processing, and manufacture. Both conventional and more recent methods of determining gear stress and deflections are considered. The subjects of life prediction and lubrication are additions to the literature. New and more complete methods of power loss predictions as well as an optimum design of spur gear meshes are described. Conventional and new types of power transmission systems are presented.
Discovering network behind infectious disease outbreak
NASA Astrophysics Data System (ADS)
Maeno, Yoshiharu
2010-11-01
Stochasticity and spatial heterogeneity are of great interest recently in studying the spread of an infectious disease. The presented method solves an inverse problem to discover the effectively decisive topology of a heterogeneous network and reveal the transmission parameters which govern the stochastic spreads over the network from a dataset on an infectious disease outbreak in the early growth phase. Populations in a combination of epidemiological compartment models and a meta-population network model are described by stochastic differential equations. Probability density functions are derived from the equations and used for the maximal likelihood estimation of the topology and parameters. The method is tested with computationally synthesized datasets and the WHO dataset on the SARS outbreak.
Potential Impact of Sexual Transmission on Ebola Virus Epidemiology: Sierra Leone as a Case Study.
Abbate, Jessica L; Murall, Carmen Lia; Richner, Heinz; Althaus, Christian L
2016-05-01
Sexual transmission of Ebola virus disease (EVD) 6 months after onset of symptoms has been recently documented, and Ebola virus RNA has been detected in semen of survivors up to 9 months after onset of symptoms. As countries affected by the 2013-2015 epidemic in West Africa, by far the largest to date, are declared free of Ebola virus disease (EVD), it remains unclear what threat is posed by rare sexual transmission events that could arise from survivors. We devised a compartmental mathematical model that includes sexual transmission from convalescent survivors: a SEICR (susceptible-exposed-infectious-convalescent-recovered) transmission model. We fitted the model to weekly incidence of EVD cases from the 2014-2015 epidemic in Sierra Leone. Sensitivity analyses and Monte Carlo simulations showed that a 0.1% per sex act transmission probability and a 3-month convalescent period (the two key unknown parameters of sexual transmission) create very few additional cases, but would extend the epidemic by 83 days [95% CI: 68-98 days] (p < 0.0001) on average. Strikingly, a 6-month convalescent period extended the average epidemic by 540 days (95% CI: 508-572 days), doubling the current length, despite an insignificant rise in the number of new cases generated. Our results show that reductions in the per sex act transmission probability via abstinence and condom use should reduce the number of sporadic sexual transmission events, but will not significantly reduce the epidemic size and may only minimally shorten the length of time the public health community must maintain response preparedness. While the number of infectious survivors is expected to greatly decline over the coming months, our results show that transmission events may still be expected for quite some time as each event results in a new potential cluster of non-sexual transmission. Precise measurement of the convalescent period is thus important for planning ongoing surveillance efforts.
Ramsey, J M; Salinas, E; Rodríguez, M H
1996-05-01
Naturally acquired transmission-blocking immunity to Plasmodium vivax was studied in three groups of patients from the southern coast of Mexico: primary cases (Group A, 61% of the study population), secondary cases with the prior infection seven or more months earlier (Group B, 23%), and secondary cases with the previous malaria experience within six months of the present study (Group C, 16%). Anopheles albimanus mosquitoes were fed with patients' infected blood cells in the presence of autologous or control serum, with or without heat-inactivation. Patients from all three groups had transmission-blocking immunity, although the quality and quantity of this blocking activity was significantly higher in the two secondary patient groups (B and C). Only primary malaria cases produced transmission-enhancing activity (23% of the cases), which was dependent on heat-labile serum components. The levels of patient group transmission-blocking immunity and mosquito infectivity were used to calculate the probabilities of a mosquito becoming infective after taking a blood meal from a P. vivax-infected patient from any one of the three groups. This probability was 0.025, with Group A patients providing the major source of these infections (92% risk from Group A and 4% risk for Groups B and C).
Potential for Rabies Control through Dog Vaccination in Wildlife-Abundant Communities of Tanzania
Fitzpatrick, Meagan C.; Hampson, Katie; Cleaveland, Sarah; Meyers, Lauren Ancel; Townsend, Jeffrey P.; Galvani, Alison P.
2012-01-01
Canine vaccination has been successful in controlling rabies in diverse settings worldwide. However, concerns remain that coverage levels which have previously been sufficient might be insufficient in systems where transmission occurs both between and within populations of domestic dogs and other carnivores. To evaluate the effectiveness of vaccination targeted at domestic dogs when wildlife also contributes to transmission, we applied a next-generation matrix model based on contract tracing data from the Ngorongoro and Serengeti Districts in northwest Tanzania. We calculated corresponding values of R 0, and determined, for policy purposes, the probabilities that various annual vaccination targets would control the disease, taking into account the empirical uncertainty in our field data. We found that transition rate estimates and corresponding probabilities of vaccination-based control indicate that rabies transmission in this region is driven by transmission within domestic dogs. Different patterns of rabies transmission between the two districts exist, with wildlife playing a more important part in Ngorongoro and leading to higher recommended coverage levels in that district. Nonetheless, our findings indicate that an annual dog vaccination campaign achieving the WHO-recommended target of 70% will control rabies in both districts with a high level of certainty. Our results support the feasibility of controlling rabies in Tanzania through dog vaccination. PMID:22928056
Real-time transmission of digital video using variable-length coding
NASA Technical Reports Server (NTRS)
Bizon, Thomas P.; Shalkhauser, Mary JO; Whyte, Wayne A., Jr.
1993-01-01
Huffman coding is a variable-length lossless compression technique where data with a high probability of occurrence is represented with short codewords, while 'not-so-likely' data is assigned longer codewords. Compression is achieved when the high-probability levels occur so frequently that their benefit outweighs any penalty paid when a less likely input occurs. One instance where Huffman coding is extremely effective occurs when data is highly predictable and differential coding can be applied (as with a digital video signal). For that reason, it is desirable to apply this compression technique to digital video transmission; however, special care must be taken in order to implement a communication protocol utilizing Huffman coding. This paper addresses several of the issues relating to the real-time transmission of Huffman-coded digital video over a constant-rate serial channel. Topics discussed include data rate conversion (from variable to a fixed rate), efficient data buffering, channel coding, recovery from communication errors, decoder synchronization, and decoder architectures. A description of the hardware developed to execute Huffman coding and serial transmission is also included. Although this paper focuses on matters relating to Huffman-coded digital video, the techniques discussed can easily be generalized for a variety of applications which require transmission of variable-length data.
Transmission events revealed in tuberculosis contact investigations in London.
Cavany, Sean M; Vynnycky, Emilia; Sumner, Tom; Macdonald, Neil; Thomas, H Lucy; White, Jacqui; White, Richard G; Maguire, Helen; Anderson, Charlotte
2018-04-27
Contact tracing is a key part of tuberculosis prevention and care, aiming to hasten diagnosis and prevent transmission. The proportion of case-contact pairs for which recent transmission occurred and the typical timespans between the index case and their contact accessing care are not known; we aimed to calculate these. We analysed individual-level TB contact tracing data, collected in London from 20/01/2011-31/12/2015, linked to tuberculosis surveillance and MIRU-VNTR 24-locus strain-typing information. Of pairs of index cases and contacts diagnosed with active tuberculosis, 85/314 (27%) had strain typing data available for both. Of these pairs, 79% (67/85) shared indistinguishable isolates, implying probable recent transmission. Of pairs in which both contact and the index case had a social risk factor, 11/11 (100%) shared indistinguishable isolates, compared to 55/75 (75%) of pairs in which neither had a social risk factor (P = 0.06). The median time interval between the index case and their contact accessing care was 42 days (IQR: 16, 96). As over 20% of pairs did probably not involve recent transmission between index case and contact, the effectiveness of contact tracing is not necessarily limited to those circumstances where the index case has transmitted disease to their close contacts.
2013-01-01
Background Plasmodium infections trigger complex immune reactions from their hosts against several life stages of the parasite, including gametocytes. These immune responses are highly variable, depending on age, genetics, and exposure history of the host as well as species and strain of parasite. Although the effects of host antibodies that act against gamete stages in the mosquito (due to uptake in the blood meal) are well documented, the effects of host immunity upon within-host gametocytes are not as well understood. This report consists of a theoretical population biology-based analysis to determine constraints that host immunity impose upon gametocyte population growth. The details of the mathematical models used for the analysis were guided by published reports of clinical and animal studies, incorporated plausible modalities of immune reactions to parasites, and were tailored to the life cycl es of the two most widespread human malaria pathogens, Plasmodium falciparum and Plasmodium vivax. Results For the same ability to bind and clear a target, the model simulations suggest that an antibody attacking immature gametocytes would tend to lower the overall density of transmissible mature gametocytes more than an antibody attacking the mature forms directly. Transmission of P. falciparum would be especially vulnerable to complete blocking by antibodies to its immature forms since its gametocytes take much longer to reach maturity than those of P. vivax. On the other hand, antibodies attacking the mature gametocytes directly would reduce the time the mature forms can linger in the host. Simulation results also suggest that varying the standard deviation in the time necessary for individual asexual parasites to develop and produce schizonts can affect the efficiency of production of transmissible gametocytes. Conclusions If mature gametocyte density determines the probability of transmission, both Plasmodium species, but especially P. falciparum, could bolster this probability through evasion or suppression of host immune responses against the immature gametocytes. However, if the long term lingering of mature gametocytes at low density in the host is also important to ensure transmission, then evasion or suppression of antibodies against the mature stages would bolster probability of transmission as well. PMID:23767770
Hall, Matthew; Woolhouse, Mark; Rambaut, Andrew
2015-01-01
The use of genetic data to reconstruct the transmission tree of infectious disease epidemics and outbreaks has been the subject of an increasing number of studies, but previous approaches have usually either made assumptions that are not fully compatible with phylogenetic inference, or, where they have based inference on a phylogeny, have employed a procedure that requires this tree to be fixed. At the same time, the coalescent-based models of the pathogen population that are employed in the methods usually used for time-resolved phylogeny reconstruction are a considerable simplification of epidemic process, as they assume that pathogen lineages mix freely. Here, we contribute a new method that is simultaneously a phylogeny reconstruction method for isolates taken from an epidemic, and a procedure for transmission tree reconstruction. We observe that, if one or more samples is taken from each host in an epidemic or outbreak and these are used to build a phylogeny, a transmission tree is equivalent to a partition of the set of nodes of this phylogeny, such that each partition element is a set of nodes that is connected in the full tree and contains all the tips corresponding to samples taken from one and only one host. We then implement a Monte Carlo Markov Chain (MCMC) procedure for simultaneous sampling from the spaces of both trees, utilising a newly-designed set of phylogenetic tree proposals that also respect node partitions. We calculate the posterior probability of these partitioned trees based on a model that acknowledges the population structure of an epidemic by employing an individual-based disease transmission model and a coalescent process taking place within each host. We demonstrate our method, first using simulated data, and then with sequences taken from the H7N7 avian influenza outbreak that occurred in the Netherlands in 2003. We show that it is superior to established coalescent methods for reconstructing the topology and node heights of the phylogeny and performs well for transmission tree reconstruction when the phylogeny is well-resolved by the genetic data, but caution that this will often not be the case in practice and that existing genetic and epidemiological data should be used to configure such analyses whenever possible. This method is available for use by the research community as part of BEAST, one of the most widely-used packages for reconstruction of dated phylogenies. PMID:26717515
MODFLOW 2000 Head Uncertainty, a First-Order Second Moment Method
Glasgow, H.S.; Fortney, M.D.; Lee, J.; Graettinger, A.J.; Reeves, H.W.
2003-01-01
A computationally efficient method to estimate the variance and covariance in piezometric head results computed through MODFLOW 2000 using a first-order second moment (FOSM) approach is presented. This methodology employs a first-order Taylor series expansion to combine model sensitivity with uncertainty in geologic data. MODFLOW 2000 is used to calculate both the ground water head and the sensitivity of head to changes in input data. From a limited number of samples, geologic data are extrapolated and their associated uncertainties are computed through a conditional probability calculation. Combining the spatially related sensitivity and input uncertainty produces the variance-covariance matrix, the diagonal of which is used to yield the standard deviation in MODFLOW 2000 head. The variance in piezometric head can be used for calibrating the model, estimating confidence intervals, directing exploration, and evaluating the reliability of a design. A case study illustrates the approach, where aquifer transmissivity is the spatially related uncertain geologic input data. The FOSM methodology is shown to be applicable for calculating output uncertainty for (1) spatially related input and output data, and (2) multiple input parameters (transmissivity and recharge).
NASA Astrophysics Data System (ADS)
Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; Lambrakos, Samuel G.; Moody, Nathan A.; Petillo, John J.; Yamaguchi, Hisato; Liu, Fangze
2018-01-01
Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al. [Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated by an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quantum yield, emittance, and emission models needed by beam optics codes are discussed.
Community Participation in Chagas Disease Vector Surveillance: Systematic Review
Abad-Franch, Fernando; Vega, M. Celeste; Rolón, Miriam S.; Santos, Walter S.; Rojas de Arias, Antonieta
2011-01-01
Background Vector control has substantially reduced Chagas disease (ChD) incidence. However, transmission by household-reinfesting triatomines persists, suggesting that entomological surveillance should play a crucial role in the long-term interruption of transmission. Yet, infestation foci become smaller and harder to detect as vector control proceeds, and highly sensitive surveillance methods are needed. Community participation (CP) and vector-detection devices (VDDs) are both thought to enhance surveillance, but this remains to be thoroughly assessed. Methodology/Principal Findings We searched Medline, Web of Knowledge, Scopus, LILACS, SciELO, the bibliographies of retrieved studies, and our own records. Data from studies describing vector control and/or surveillance interventions were extracted by two reviewers. Outcomes of primary interest included changes in infestation rates and the detection of infestation/reinfestation foci. Most results likely depended on study- and site-specific conditions, precluding meta-analysis, but we re-analysed data from studies comparing vector control and detection methods whenever possible. Results confirm that professional, insecticide-based vector control is highly effective, but also show that reinfestation by native triatomines is common and widespread across Latin America. Bug notification by householders (the simplest CP-based strategy) significantly boosts vector detection probabilities; in comparison, both active searches and VDDs perform poorly, although they might in some cases complement each other. Conclusions/Significance CP should become a strategic component of ChD surveillance, but only professional insecticide spraying seems consistently effective at eliminating infestation foci. Involvement of stakeholders at all process stages, from planning to evaluation, would probably enhance such CP-based strategies. PMID:21713022
Extinction times of epidemic outbreaks in networks.
Holme, Petter
2013-01-01
In the Susceptible-Infectious-Recovered (SIR) model of disease spreading, the time to extinction of the epidemics happens at an intermediate value of the per-contact transmission probability. Too contagious infections burn out fast in the population. Infections that are not contagious enough die out before they spread to a large fraction of people. We characterize how the maximal extinction time in SIR simulations on networks depend on the network structure. For example we find that the average distances in isolated components, weighted by the component size, is a good predictor of the maximal time to extinction. Furthermore, the transmission probability giving the longest outbreaks is larger than, but otherwise seemingly independent of, the epidemic threshold.
Including the Group Quarters Population in the US Synthesized Population Database
Chasteen, Bernadette M.; Wheaton, William D.; Cooley, Philip C.; Ganapathi, Laxminarayana; Wagener, Diane K.
2011-01-01
In 2005, RTI International researchers developed methods to generate synthesized population data on US households for the US Synthesized Population Database. These data are used in agent-based modeling, which simulates large-scale social networks to test how changes in the behaviors of individuals affect the overall network. Group quarters are residences where individuals live in close proximity and interact frequently. Although the Synthesized Population Database represents the population living in households, data for the nation’s group quarters residents are not easily quantified because of US Census Bureau reporting methods designed to protect individuals’ privacy. Including group quarters population data can be an important factor in agent-based modeling because the number of residents and the frequency of their interactions are variables that directly affect modeling results. Particularly with infectious disease modeling, the increased frequency of agent interaction may increase the probability of infectious disease transmission between individuals and the probability of disease outbreaks. This report reviews our methods to synthesize data on group quarters residents to match US Census Bureau data. Our goal in developing the Group Quarters Population Database was to enable its use with RTI’s US Synthesized Population Database in the Modeling of Infectious Diseases Agent Study. PMID:21841972
Preliminary appraisal of the geohydrologic aspects of drainage wells, Orlando area, central Florida
Kimrey, Joel O.
1978-01-01
The Floridan aquifer contains two highly transmissive cavernous zones in the Orlando area: an upper producing zone about 150-600 feet below land surface; and a lower producing zone about 1,100-1,500 feet below land surface. Natural head differences are downward and there is hydraulic connection between the two producing zones. Drainage wells are finished open-end into the upper producing zone and emplace surface waters directly into that zone by gravity. Quantitatively, their use constitutes an effective method of artificial recharge. Their negative aspects relate to the probably poor, but unknown, quality of the recharge water. Caution is suggested in drawing definite and final conclusions on the overall geohydrologic and environmental effects of drainage wells prior to the collection and interpretation of a considerable quantity of new data. Though few ground-water pollution problems have been documented to date, the potential for such pollution should be seriously considered in light of the prob-able continuing need to use drainage wells; the probable volumes and quality of water involved; and the hydraulic relations between the two producing zones.
Dosage Transmission Disequilibrium Test (dTDT) for Linkage and Association Detection
Zhang, Zhehao; Wang, Jen-Chyong; Howells, William; Lin, Peng; Agrawal, Arpana; Edenberg, Howard J.; Tischfield, Jay A.; Schuckit, Marc A.; Bierut, Laura J.; Goate, Alison; Rice, John P.
2013-01-01
Both linkage and association studies have been successfully applied to identify disease susceptibility genes with genetic markers such as microsatellites and Single Nucleotide Polymorphisms (SNPs). As one of the traditional family-based studies, the Transmission/Disequilibrium Test (TDT) measures the over-transmission of an allele in a trio from its heterozygous parents to the affected offspring and can be potentially useful to identify genetic determinants for complex disorders. However, there is reduced information when complete trio information is unavailable. In this study, we developed a novel approach to “infer” the transmission of SNPs by combining both the linkage and association data, which uses microsatellite markers from families informative for linkage together with SNP markers from the offspring who are genotyped for both linkage and a Genome-Wide Association Study (GWAS). We generalized the traditional TDT to process these inferred dosage probabilities, which we name as the dosage-TDT (dTDT). For evaluation purpose, we developed a simulation procedure to assess its operating characteristics. We applied the dTDT to the simulated data and documented the power of the dTDT under a number of different realistic scenarios. Finally, we applied our methods to a family study of alcohol dependence (COGA) and performed individual genotyping on complete families for the top signals. One SNP (rs4903712 on chromosome 14) remained significant after correcting for multiple testing Methods developed in this study can be adapted to other platforms and will have widespread applicability in genomic research when case-control GWAS data are collected in families with existing linkage data. PMID:23691058
A study of electric transmission lines for use on the lunar surface
NASA Technical Reports Server (NTRS)
Gaustad, Krista L.; Gordon, Lloyd B.; Weber, Jennifer R.
1994-01-01
The sources for electrical power on a lunar base are said to include solar/chemical, nuclear (static conversion), and nuclear (dynamic conversion). The transmission of power via transmission lines is more practical than power beaming or superconducting because of its low cost and reliable, proven technology. Transmission lines must have minimum mass, maximum efficiency, and the ability to operate reliably in the lunar environment. The transmission line design includes conductor material, insulator material, conductor geometry, conductor configuration, line location, waveform, phase selection, and frequency. This presentation oulines the design. Liquid and gaseous dielectrics are undesirable for long term use in the lunar vacuum due to a high probability of loss. Thus, insulation for high voltage transmission line will most likely be solid dielectric or vacuum insulation.
Pathogen transmission in relation to duration of attachment by Ixodes scapularis ticks.
Eisen, Lars
2018-03-01
The blacklegged tick, Ixodes scapularis, is the primary vector to humans in the eastern United States of the deer tick virus lineage of Powassan virus (Powassan virus disease); the protozoan parasite Babesia microti (babesiosis); and multiple bacterial disease agents including Anaplasma phagocytophilum (anaplasmosis), Borrelia burgdorferi and Borrelia mayonii (Lyme disease), Borrelia miyamotoi (relapsing fever-like illness, named Borrelia miyamotoi disease), and Ehrlichia muris eauclairensis (a minor causative agent of ehrlichiosis). With the notable exception of Powassan virus, which can be transmitted within minutes after attachment by an infected tick, there is no doubt that the risk of transmission of other I. scapularis-borne pathogens, including Lyme disease spirochetes, increases with the length of time (number of days) infected ticks are allowed to remain attached. This review summarizes data from experimental transmission studies to reinforce the important disease-prevention message that regular (at least daily) tick checks and prompt tick removal has strong potential to reduce the risk of transmission of I. scapularis-borne bacterial and parasitic pathogens from infected attached ticks. The most likely scenario for human exposure to an I. scapularis-borne pathogen is the bite by a single infected tick. However, recent reviews have failed to make a clear distinction between data based on transmission studies where experimental hosts were fed upon by a single versus multiple infected ticks. A summary of data from experimental studies on transmission of Lyme disease spirochetes (Bo. burgdorferi and Bo. mayonii) by I. scapularis nymphs indicates that the probability of transmission resulting in host infection, at time points from 24 to 72 h after nymphal attachment, is higher when multiple infected ticks feed together as compared to feeding by a single infected tick. In the specific context of risk for human infection, the most relevant experimental studies therefore are those where the probability of pathogen transmission at a given point in time after attachment was determined using a single infected tick. The minimum duration of attachment by single infected I. scapularis nymphs required for transmission to result in host infection is poorly defined for most pathogens, but experimental studies have shown that Powassan virus can be transmitted within 15 min of tick attachment and both A. phagocytophilum and Bo. miyamotoi within the first 24 h of attachment. There is no experimental evidence for transmission of Lyme disease spirochetes by single infected I. scapularis nymphs to result in host infection when ticks are attached for only 24 h (despite exposure of nearly 90 experimental rodent hosts across multiple studies) but the probability of transmission resulting in host infection appears to increase to approximately 10% by 48 h and reach 70% by 72 h for Bo. burgdorferi. Caveats to the results from experimental transmission studies, including specific circumstances (such as re-attachment of previously partially fed infected ticks) that may lead to more rapid transmission are discussed. Published by Elsevier GmbH.
The global dynamics for a stochastic SIS epidemic model with isolation
NASA Astrophysics Data System (ADS)
Chen, Yiliang; Wen, Buyu; Teng, Zhidong
2018-02-01
In this paper, we investigate the dynamical behavior for a stochastic SIS epidemic model with isolation which is as an important strategy for the elimination of infectious diseases. It is assumed that the stochastic effects manifest themselves mainly as fluctuation in the transmission coefficient, the death rate and the proportional coefficient of the isolation of infective. It is shown that the extinction and persistence in the mean of the model are determined by a threshold value R0S . That is, if R0S < 1, then disease dies out with probability one, and if R0S > 1, then the disease is stochastic persistent in the means with probability one. Furthermore, the existence of a unique stationary distribution is discussed, and the sufficient conditions are established by using the Lyapunov function method. Finally, some numerical examples are carried out to confirm the analytical results.
Disease-emergence dynamics and control in a socially-structured wildlife species
NASA Astrophysics Data System (ADS)
Pepin, Kim M.; Vercauteren, Kurt C.
2016-04-01
Once a pathogen is introduced in a population, key factors governing rate of spread include contact structure, supply of susceptible individuals and pathogen life-history. We examined the interplay of these factors on emergence dynamics and efficacy of disease prevention and response. We contrasted transmission dynamics of livestock viruses with different life-histories in hypothetical populations of feral swine with different contact structures (homogenous, metapopulation, spatial and network). Persistence probability was near 0 for the FMDV-like case under a wide range of parameter values and contact structures, while persistence was probable for the CSFV-like case. There were no sets of conditions where the FMDV-like pathogen persisted in every stochastic simulation. Even when population growth rates were up to 300% annually, the FMDV-like pathogen persisted in <25% of simulations regardless of transmission probabilities and contact structure. For networks and spatial contact structure, persistence probability of the FMDV-like pathogen was always <10%. Because of its low persistence probability, even very early response to the FMDV-like pathogen in feral swine was unwarranted while response to the CSFV-like pathogen was generally effective. When pre-emergence culling of feral swine caused population declines, it was effective at decreasing outbreak size of both diseases by ≥80%.
Chicoli, A.; Butail, S.; Lun, Y.; Bak-Coleman, J.; Coombs, S.; Paley, D.A.
2014-01-01
To assess how flow affects school structure and threat detection, startle response rates of solitary and small groups of giant danio Devario aequipinnatus were compared to visual looming stimuli in flow and no-flow conditions. The instantaneous position and heading of each D. aequipinnatus were extracted from high-speed videos. Behavioural results indicate that (1) school structure is altered in flow such that D. aequipinnatus orient upstream while spanning out in a crosswise direction, (2) the probability of at least one D. aequipinnatus detecting the visual looming stimulus is higher in flow than no flow for both solitary D. aequipinnatus and groups of eight D. aequipinnatus, however, (3) the probability of three or more individuals responding is higher in no flow than flow. Taken together, these results indicate a higher probability of stimulus detection in flow but a higher probability of internal transmission of information in no flow. Finally, results were well predicted by a computational model of collective fright response that included the probability of direct detection (based on signal detection theory) and indirect detection (i.e. via interactions between group members) of threatening stimuli. This model provides a new theoretical framework for analysing the collective transfer of information among groups of fishes and other organisms. PMID:24773538
Climate change and malaria risk in Russia in 21st century
NASA Astrophysics Data System (ADS)
Malkhazova, S.; Shartova, N.
2010-09-01
The purpose of this research is development of prognostic model of malaria risk for Russia in the 21st century according to climate scenario IPCC "А2". The following issues have been formulated to reach the goal of the research: - define the basic epidemiological parameters describing malaria situation and methods of data processing; - creating of maps of malaria risk; - analysis of changes in malaria distribution for predictable future climate conditions in comparison with conditions of a modern climate. A lot of reasons (biological, social and economic) impact on malaria distribution. Nevertheless, incubation period of the parasite first of all depends on temperature. This is a primary factor that defines a potential area of infection, ability and specificity to transmit malaria. According to this, the model is based on the relationship between climate (average daily temperature) and the intensity of malaria transmission. The object of research is malaria parasite Plasmodium vivax, which has for Russia the greatest importance because it has the lowest minimal temperature threshold for development. Climate data is presented by daily average temperatures of air for three analyzed periods. 1961 -1989 describes a modern climate and corresponds to the minimum 30-year period that is necessary for an assessment of climate and changes connected with biotic components. Prognostic malaria model is based on predicted daily average temperatures for 2046-2065 (the middle of century) and 2089-2100 (the end of century). All data sets are presented in the grid 2х20. The conclusion on possible changes in malaria distribution and transmission in the middle and the end of the 21st century: There is going to be the increase of duration of effective temperatures period (period when parasite development is possible), period of effective susceptibility to infection of mosquitoes (period when malaria transmission cycle is possible); shift of the beginning of malaria transmission period to earlier time as well as the end of this period's shift to later time is connected to increase of effective temperatures annual sum. Northern bounds of the territory where temperature conditions allow parasite's development and disease transmission are going to move significantly to the north. Accordingly there will be an expansion of potential disease distribution area. Annual development of parasite and malaria transmission will probably be possible on nearly whole European part of Russia. The probability of malaria transmission and its intensity will increase. The results of the research indicate growth of malaria risk in Russia in 21st century.
Chan, Philip A.; Hogan, Joseph W.; Huang, Austin; DeLong, Allison; Salemi, Marco; Mayer, Kenneth H.; Kantor, Rami
2015-01-01
Background Molecular epidemiologic evaluation of HIV-1 transmission networks can elucidate behavioral components of transmission that can be targets for intervention. Methods We combined phylogenetic and statistical approaches using pol sequences from patients diagnosed 2004-2011 at a large HIV center in Rhode Island, following 75% of the state’s HIV population. Phylogenetic trees were constructed using maximum likelihood and putative transmission clusters were evaluated using latent class analyses (LCA) to determine association of cluster size with underlying demographic/behavioral characteristics. A logistic growth model was used to assess intra-cluster dynamics over time and predict “active” clusters that were more likely to harbor undiagnosed infections. Results Of 1,166 HIV-1 subtype B sequences, 31% were distributed among 114 statistically-supported, monophyletic clusters (range: 2-15 sequences/cluster). Sequences from men who have sex with men (MSM) formed 52% of clusters. LCA demonstrated that sequences from recently diagnosed (2008-2011) MSM with primary HIV infection (PHI) and other sexually transmitted infections (STIs) were more likely to form larger clusters (Odds Ratio 1.62-11.25, p<0.01). MSM in clusters were more likely to have anonymous partners and meet partners at sex clubs and pornographic stores. Four large clusters with 38 sequences (100% male, 89% MSM) had a high-probability of harboring undiagnosed infections and included younger MSM with PHI and STIs. Conclusions In this first large-scale molecular epidemiologic investigation of HIV-1 transmission in New England, sexual networks among recently diagnosed MSM with PHI and concomitant STIs contributed to ongoing transmission. Characterization of transmission dynamics revealed actively growing clusters which may be targets for intervention. PMID:26258569
De Backer, A; Martinez, G T; Rosenauer, A; Van Aert, S
2013-11-01
In the present paper, a statistical model-based method to count the number of atoms of monotype crystalline nanostructures from high resolution high-angle annular dark-field (HAADF) scanning transmission electron microscopy (STEM) images is discussed in detail together with a thorough study on the possibilities and inherent limitations. In order to count the number of atoms, it is assumed that the total scattered intensity scales with the number of atoms per atom column. These intensities are quantitatively determined using model-based statistical parameter estimation theory. The distribution describing the probability that intensity values are generated by atomic columns containing a specific number of atoms is inferred on the basis of the experimental scattered intensities. Finally, the number of atoms per atom column is quantified using this estimated probability distribution. The number of atom columns available in the observed STEM image, the number of components in the estimated probability distribution, the width of the components of the probability distribution, and the typical shape of a criterion to assess the number of components in the probability distribution directly affect the accuracy and precision with which the number of atoms in a particular atom column can be estimated. It is shown that single atom sensitivity is feasible taking the latter aspects into consideration. © 2013 Elsevier B.V. All rights reserved.
Review of sampling hard-to-reach and hidden populations for HIV surveillance.
Magnani, Robert; Sabin, Keith; Saidel, Tobi; Heckathorn, Douglas
2005-05-01
Adequate surveillance of hard-to-reach and 'hidden' subpopulations is crucial to containing the HIV epidemic in low prevalence settings and in slowing the rate of transmission in high prevalence settings. For a variety of reasons, however, conventional facility and survey-based surveillance data collection strategies are ineffective for a number of key subpopulations, particularly those whose behaviors are illegal or illicit. This paper critically reviews alternative sampling strategies for undertaking behavioral or biological surveillance surveys of such groups. Non-probability sampling approaches such as facility-based sentinel surveillance and snowball sampling are the simplest to carry out, but are subject to a high risk of sampling/selection bias. Most of the probability sampling methods considered are limited in that they are adequate only under certain circumstances and for some groups. One relatively new method, respondent-driven sampling, an adaptation of chain-referral sampling, appears to be the most promising for general applications. However, as its applicability to HIV surveillance in resource-poor settings has yet to be established, further field trials are needed before a firm conclusion can be reached.
Soler, Juan José; Peralta-Sánchez, Juan Manuel; Flensted-Jensen, Einar; Martín-Platero, Antonio Manuel; Møller, Anders Pape
2011-09-01
Fitness benefits associated with the development of a costly immune system would include not only self-protection against pathogenic microorganisms but also protection of host offspring if it reduces the probability and the rate of vertical transmission of microorganisms. This possibility predicts a negative relationship between probabilities of vertical transmission of symbionts and level of immune response that we here explore inter-specifically. We estimated eggshell bacterial loads by culturing heterotrophic bacteria, Enterococcus, Staphylococcus and Enterobacteriaceae on the eggshells of 29 species of birds as a proxy of vertical transmission of bacteria from mother to offspring. For this pool of species, we also estimated innate immune response (natural antibody and complement (lysis)) of adults, which constitute the main defence against bacterial infection. Multivariate general linear models revealed the predicted negative association between natural antibodies and density of bacteria on the eggshell of 19 species of birds for which we sampled the eggs in more than one nest. Univariate analyses revealed significant associations for heterotrophic bacteria and for Enterobacteriaceae, a group of bacteria that includes important pathogens of avian embryos. Therefore, these results suggest a possible trans-generational benefit of developing a strong immune system by reducing vertical transmission of pathogens.
NASA Astrophysics Data System (ADS)
Soler, Juan José; Peralta-Sánchez, Juan Manuel; Flensted-Jensen, Einar; Martín-Platero, Antonio Manuel; Møller, Anders Pape
2011-09-01
Fitness benefits associated with the development of a costly immune system would include not only self-protection against pathogenic microorganisms but also protection of host offspring if it reduces the probability and the rate of vertical transmission of microorganisms. This possibility predicts a negative relationship between probabilities of vertical transmission of symbionts and level of immune response that we here explore inter-specifically. We estimated eggshell bacterial loads by culturing heterotrophic bacteria, Enterococcus, Staphylococcus and Enterobacteriaceae on the eggshells of 29 species of birds as a proxy of vertical transmission of bacteria from mother to offspring. For this pool of species, we also estimated innate immune response (natural antibody and complement (lysis)) of adults, which constitute the main defence against bacterial infection. Multivariate general linear models revealed the predicted negative association between natural antibodies and density of bacteria on the eggshell of 19 species of birds for which we sampled the eggs in more than one nest. Univariate analyses revealed significant associations for heterotrophic bacteria and for Enterobacteriaceae, a group of bacteria that includes important pathogens of avian embryos. Therefore, these results suggest a possible trans-generational benefit of developing a strong immune system by reducing vertical transmission of pathogens.
Estimating a mosquito repellent's potential to reduce malaria in communities.
Kiszewski, A E; Darling, S T
2010-12-01
Probability models for assessing a mosquito repellent's potential to reduce malaria transmission are not readily available to public health researchers. To provide a means for estimating the epidemiological efficacy of mosquito repellents in communities, we developed a simple mathematical model. A static probability model is presented to simulate malaria infection in a community during a single transmission season. The model includes five parameters- sporozoite rate, human infection rate, biting pressure, repellent efficacy, and product-acceptance rate. The model assumes that a certain percentage of the population uses a personal mosquito repellent over the course of a seven-month transmission season and that this repellent maintains a constant rate of protective efficacy against the bites of malaria vectors. This model measures the probability of evading infection in circumstances where vector biting pressure, repellent efficacy, and product acceptance may vary. [corrected] Absolute protection using mosquito repellents alone requires high rates of repellent efficacy and product acceptance. [corrected] Using performance data from a highly effective repellent, the model estimates an 88.9% reduction of infections over a seven- month transmission season. A corresponding reduction in the incidence of super-infection in community members not completely evading infection can also be presumed. Thus, the model shows that mass distribution of a repellent with >98% efficacy and >98% product acceptance would suppress new malaria infections to levels lower than those achieved with insecticide treated nets (ITNs). A combination of both interventions could create synergies that result in reductions of disease burden significantly greater than with the use of ITNs alone.
Spatial spread of the West Africa Ebola epidemic.
Kramer, Andrew M; Pulliam, J Tomlin; Alexander, Laura W; Park, Andrew W; Rohani, Pejman; Drake, John M
2016-08-01
Controlling Ebola outbreaks and planning an effective response to future emerging diseases are enhanced by understanding the role of geography in transmission. Here we show how epidemic expansion may be predicted by evaluating the relative probability of alternative epidemic paths. We compared multiple candidate models to characterize the spatial network over which the 2013-2015 West Africa epidemic of Ebola virus spread and estimate the effects of geographical covariates on transmission during peak spread. The best model was a generalized gravity model where the probability of transmission between locations depended on distance, population density and international border closures between Guinea, Liberia and Sierra Leone and neighbouring countries. This model out-performed alternative models based on diffusive spread, the force of infection, mobility estimated from cell phone records and other hypothesized patterns of spread. These findings highlight the importance of integrated geography to epidemic expansion and may contribute to identifying both the most vulnerable unaffected areas and locations of maximum intervention value.
Spatial spread of the West Africa Ebola epidemic
Pulliam, J. Tomlin; Alexander, Laura W.; Rohani, Pejman; Drake, John M.
2016-01-01
Controlling Ebola outbreaks and planning an effective response to future emerging diseases are enhanced by understanding the role of geography in transmission. Here we show how epidemic expansion may be predicted by evaluating the relative probability of alternative epidemic paths. We compared multiple candidate models to characterize the spatial network over which the 2013–2015 West Africa epidemic of Ebola virus spread and estimate the effects of geographical covariates on transmission during peak spread. The best model was a generalized gravity model where the probability of transmission between locations depended on distance, population density and international border closures between Guinea, Liberia and Sierra Leone and neighbouring countries. This model out-performed alternative models based on diffusive spread, the force of infection, mobility estimated from cell phone records and other hypothesized patterns of spread. These findings highlight the importance of integrated geography to epidemic expansion and may contribute to identifying both the most vulnerable unaffected areas and locations of maximum intervention value. PMID:27853607
NASA Astrophysics Data System (ADS)
Wang, Jixin; Wang, Zhenyu; Yu, Xiangjun; Yao, Mingyao; Yao, Zongwei; Zhang, Erping
2012-09-01
Highly versatile machines, such as wheel loaders, forklifts, and mining haulers, are subject to many kinds of working conditions, as well as indefinite factors that lead to the complexity of the load. The load probability distribution function (PDF) of transmission gears has many distributions centers; thus, its PDF cannot be well represented by just a single-peak function. For the purpose of representing the distribution characteristics of the complicated phenomenon accurately, this paper proposes a novel method to establish a mixture model. Based on linear regression models and correlation coefficients, the proposed method can be used to automatically select the best-fitting function in the mixture model. Coefficient of determination, the mean square error, and the maximum deviation are chosen and then used as judging criteria to describe the fitting precision between the theoretical distribution and the corresponding histogram of the available load data. The applicability of this modeling method is illustrated by the field testing data of a wheel loader. Meanwhile, the load spectra based on the mixture model are compiled. The comparison results show that the mixture model is more suitable for the description of the load-distribution characteristics. The proposed research improves the flexibility and intelligence of modeling, reduces the statistical error and enhances the fitting accuracy, and the load spectra complied by this method can better reflect the actual load characteristic of the gear component.
Characterizing microclimate in urban malaria transmission settings: a case study from Chennai, India
2013-01-01
Background Environmental temperature is an important driver of malaria transmission dynamics. Both the parasite and vector are sensitive to mean ambient temperatures and daily temperature variation. To understand transmission ecology, therefore, it is important to determine the range of microclimatic temperatures experienced by malaria vectors in the field. Methods A pilot study was conducted in the Indian city of Chennai to determine the temperature variation in urban microclimates and characterize the thermal ecology of the local transmission setting. Temperatures were measured in a range of probable indoor and outdoor resting habitats of Anopheles stephensi in two urban slum malaria sites. Mean temperatures and daily temperature fluctuations in local transmission sites were compared with standard temperature measures from the local weather station. The biological implications of the different temperatures were explored using temperature-dependent parasite development models to provide estimates of the extrinsic incubation period (EIP) of Plasmodium vivax and Plasmodium falciparum. Results Mean daily temperatures within the urban transmission sites were generally warmer than those recorded at the local weather station. The main reason was that night-time temperatures were higher (and hence diurnal temperature ranges smaller) in the urban settings. Mean temperatures and temperature variation also differed between specific resting sites within the transmission environments. Most differences were of the order of 1-3°C but were sufficient to lead to important variation in predicted EIPs and hence, variation in estimates of transmission intensity. Conclusions Standard estimates of environmental temperature derived from local weather stations do not necessarily provide realistic measures of temperatures within actual transmission environments. Even the small differences in mean temperatures or diurnal temperature ranges reported in this study can lead to large variations in key mosquito and/or parasite life history traits that determine transmission intensity. Greater effort should be directed at quantifying adult mosquito resting behaviour and determining the temperatures actually experienced by mosquitoes and parasites in local transmission environments. In the absence of such highly resolved data, the approach used in the current study provides a framework for improved thermal characterization of transmission settings. PMID:23452620
NASA Technical Reports Server (NTRS)
Kim, Hyun Jung; Choi, Sang H.; Bae, Hyung-Bin; Lee, Tae Woo
2012-01-01
The National Aeronautics and Space Administration-invented X-ray diffraction (XRD) methods, including the total defect density measurement method and the spatial wafer mapping method, have confirmed super hetero epitaxy growth for rhombohedral single crystalline silicon germanium (Si1-xGex) on a c-plane sapphire substrate. However, the XRD method cannot observe the surface morphology or roughness because of the method s limited resolution. Therefore the authors used transmission electron microscopy (TEM) with samples prepared in two ways, the focused ion beam (FIB) method and the tripod method to study the structure between Si1-xGex and sapphire substrate and Si1?xGex itself. The sample preparation for TEM should be as fast as possible so that the sample should contain few or no artifacts induced by the preparation. The standard sample preparation method of mechanical polishing often requires a relatively long ion milling time (several hours), which increases the probability of inducing defects into the sample. The TEM sampling of the Si1-xGex on sapphire is also difficult because of the sapphire s high hardness and mechanical instability. The FIB method and the tripod method eliminate both problems when performing a cross-section TEM sampling of Si1-xGex on c-plane sapphire, which shows the surface morphology, the interface between film and substrate, and the crystal structure of the film. This paper explains the FIB sampling method and the tripod sampling method, and why sampling Si1-xGex, on a sapphire substrate with TEM, is necessary.
Real-time first-principles simulations of thermionic emission from N-doped diamond surfaces
NASA Astrophysics Data System (ADS)
Shinozaki, Tomoki; Hagiwara, Satoshi; Morioka, Naoya; Kimura, Yuji; Watanabe, Kazuyuki
2018-06-01
We investigate thermionic emission from N-doped C(100) surfaces terminated with H or Li atoms using finite-temperature real-time density functional theory simulations. The current–temperature characteristics are found to follow the Richardson–Dushman (RD) equation, which was derived from a semiclassical theory. However, the Richardson constants are two orders of magnitude smaller than the ideal values from the RD theory. This considerable reduction is attributed primarily to the extremely low transmission probability of electrons from the surfaces toward the vacuum. The present method enables straightforward evaluation of the ideal efficiency of a thermionic energy converter.
Genomic Infectious Disease Epidemiology in Partially Sampled and Ongoing Outbreaks
Didelot, Xavier; Fraser, Christophe; Gardy, Jennifer; Colijn, Caroline
2017-01-01
Abstract Genomic data are increasingly being used to understand infectious disease epidemiology. Isolates from a given outbreak are sequenced, and the patterns of shared variation are used to infer which isolates within the outbreak are most closely related to each other. Unfortunately, the phylogenetic trees typically used to represent this variation are not directly informative about who infected whom—a phylogenetic tree is not a transmission tree. However, a transmission tree can be inferred from a phylogeny while accounting for within-host genetic diversity by coloring the branches of a phylogeny according to which host those branches were in. Here we extend this approach and show that it can be applied to partially sampled and ongoing outbreaks. This requires computing the correct probability of an observed transmission tree and we herein demonstrate how to do this for a large class of epidemiological models. We also demonstrate how the branch coloring approach can incorporate a variable number of unique colors to represent unsampled intermediates in transmission chains. The resulting algorithm is a reversible jump Monte–Carlo Markov Chain, which we apply to both simulated data and real data from an outbreak of tuberculosis. By accounting for unsampled cases and an outbreak which may not have reached its end, our method is uniquely suited to use in a public health environment during real-time outbreak investigations. We implemented this transmission tree inference methodology in an R package called TransPhylo, which is freely available from https://github.com/xavierdidelot/TransPhylo. PMID:28100788
Dynamical jumping real-time fault-tolerant routing protocol for wireless sensor networks.
Wu, Guowei; Lin, Chi; Xia, Feng; Yao, Lin; Zhang, He; Liu, Bing
2010-01-01
In time-critical wireless sensor network (WSN) applications, a high degree of reliability is commonly required. A dynamical jumping real-time fault-tolerant routing protocol (DMRF) is proposed in this paper. Each node utilizes the remaining transmission time of the data packets and the state of the forwarding candidate node set to dynamically choose the next hop. Once node failure, network congestion or void region occurs, the transmission mode will switch to jumping transmission mode, which can reduce the transmission time delay, guaranteeing the data packets to be sent to the destination node within the specified time limit. By using feedback mechanism, each node dynamically adjusts the jumping probabilities to increase the ratio of successful transmission. Simulation results show that DMRF can not only efficiently reduce the effects of failure nodes, congestion and void region, but also yield higher ratio of successful transmission, smaller transmission delay and reduced number of control packets.
2012-01-01
Background For parasites with complex life cycles, size at transmission can impact performance in the next host, thereby coupling parasite phenotypes in the two consecutive hosts. However, a handful of studies with parasites, and numerous studies with free-living, complex-life-cycle animals, have found that larval size correlates poorly with fitness under particular conditions, implying that other traits, such as physiological or ontogenetic variation, may predict fitness more reliably. Using the tapeworm Schistocephalus solidus, we evaluated how parasite size, age, and ontogeny in the copepod first host interact to determine performance in the stickleback second host. Methods We raised infected copepods under two feeding treatments (to manipulate parasite growth), and then exposed fish to worms of two different ages (to manipulate parasite ontogeny). We assessed how growth and ontogeny in copepods affected three measures of fitness in fish: infection probability, growth rate, and energy storage. Results Our main, novel finding is that the increase in fitness (infection probability and growth in fish) with larval size and age observed in previous studies on S. solidus seems to be largely mediated by ontogenetic variation. Worms that developed rapidly (had a cercomer after 9 days in copepods) were able to infect fish at an earlier age, and they grew to larger sizes with larger energy reserves in fish. Infection probability in fish increased with larval size chiefly in young worms, when size and ontogeny are positively correlated, but not in older worms that had essentially completed their larval development in copepods. Conclusions Transmission to sticklebacks as a small, not-yet-fully developed larva has clear costs for S. solidus, but it remains unclear what prevents the evolution of faster growth and development in this species. PMID:22564512
Elimination of Ebola Virus Transmission in Liberia - September 3, 2015.
Bawo, Luke; Fallah, Mosoka; Kateh, Francis; Nagbe, Thomas; Clement, Peter; Gasasira, Alex; Mahmoud, Nuha; Musa, Emmanuel; Lo, Terrence Q; Pillai, Satish K; Seeman, Sara; Sunshine, Brittany J; Weidle, Paul J; Nyensweh, Tolbert
2015-09-11
Following 42 days since the last Ebola virus disease (Ebola) patient was discharged from a Liberian Ebola treatment unit (ETU), September 3, 2015, marks the second time in a 4-month period that the World Health Organization (WHO) has declared Liberia free of Ebola virus transmission (1). The first confirmed Ebola cases in West Africa were identified in southeastern Guinea on March 23, 2014, and within 1 week, cases were identified and confirmed in Liberia (1). Since then, Liberia has reported 5,036 confirmed and probable Ebola cases and 4,808 Ebola-related deaths. The epidemic in Liberia peaked in late summer and early fall of 2014, when more than 200 confirmed and probable cases were reported each week .
Li, Ning; Cürüklü, Baran; Bastos, Joaquim; Sucasas, Victor; Fernandez, Jose Antonio Sanchez; Rodriguez, Jonathan
2017-01-01
The aim of the Smart and Networking Underwater Robots in Cooperation Meshes (SWARMs) project is to make autonomous underwater vehicles (AUVs), remote operated vehicles (ROVs) and unmanned surface vehicles (USVs) more accessible and useful. To achieve cooperation and communication between different AUVs, these must be able to exchange messages, so an efficient and reliable communication network is necessary for SWARMs. In order to provide an efficient and reliable communication network for mission execution, one of the important and necessary issues is the topology control of the network of AUVs that are cooperating underwater. However, due to the specific properties of an underwater AUV cooperation network, such as the high mobility of AUVs, large transmission delays, low bandwidth, etc., the traditional topology control algorithms primarily designed for terrestrial wireless sensor networks cannot be used directly in the underwater environment. Moreover, these algorithms, in which the nodes adjust their transmission power once the current transmission power does not equal an optimal one, are costly in an underwater cooperating AUV network. Considering these facts, in this paper, we propose a Probabilistic Topology Control (PTC) algorithm for an underwater cooperating AUV network. In PTC, when the transmission power of an AUV is not equal to the optimal transmission power, then whether the transmission power needs to be adjusted or not will be determined based on the AUV’s parameters. Each AUV determines their own transmission power adjustment probability based on the parameter deviations. The larger the deviation, the higher the transmission power adjustment probability is, and vice versa. For evaluating the performance of PTC, we combine the PTC algorithm with the Fuzzy logic Topology Control (FTC) algorithm and compare the performance of these two algorithms. The simulation results have demonstrated that the PTC is efficient at reducing the transmission power adjustment ratio while improving the network performance. PMID:28471387
Li, Ning; Cürüklü, Baran; Bastos, Joaquim; Sucasas, Victor; Fernandez, Jose Antonio Sanchez; Rodriguez, Jonathan
2017-05-04
The aim of the Smart and Networking Underwater Robots in Cooperation Meshes (SWARMs) project is to make autonomous underwater vehicles (AUVs), remote operated vehicles (ROVs) and unmanned surface vehicles (USVs) more accessible and useful. To achieve cooperation and communication between different AUVs, these must be able to exchange messages, so an efficient and reliable communication network is necessary for SWARMs. In order to provide an efficient and reliable communication network for mission execution, one of the important and necessary issues is the topology control of the network of AUVs that are cooperating underwater. However, due to the specific properties of an underwater AUV cooperation network, such as the high mobility of AUVs, large transmission delays, low bandwidth, etc., the traditional topology control algorithms primarily designed for terrestrial wireless sensor networks cannot be used directly in the underwater environment. Moreover, these algorithms, in which the nodes adjust their transmission power once the current transmission power does not equal an optimal one, are costly in an underwater cooperating AUV network. Considering these facts, in this paper, we propose a Probabilistic Topology Control (PTC) algorithm for an underwater cooperating AUV network. In PTC, when the transmission power of an AUV is not equal to the optimal transmission power, then whether the transmission power needs to be adjusted or not will be determined based on the AUV's parameters. Each AUV determines their own transmission power adjustment probability based on the parameter deviations. The larger the deviation, the higher the transmission power adjustment probability is, and vice versa. For evaluating the performance of PTC, we combine the PTC algorithm with the Fuzzy logic Topology Control (FTC) algorithm and compare the performance of these two algorithms. The simulation results have demonstrated that the PTC is efficient at reducing the transmission power adjustment ratio while improving the network performance.
Faye, Ousmane; Boëlle, Pierre-Yves; Heleze, Emmanuel; Faye, Oumar; Loucoubar, Cheikh; Magassouba, N'Faly; Soropogui, Barré; Keita, Sakoba; Gakou, Tata; Bah, El Hadji Ibrahima; Koivogui, Lamine; Sall, Amadou Alpha; Cauchemez, Simon
2015-03-01
An epidemic of Ebola virus disease of unprecedented size continues in parts of west Africa. For the first time, large urban centres such as Conakry, the capital of Guinea, are affected. We did an observational study of patients with Ebola virus disease in three regions of Guinea, including Conakry, aiming to map the routes of transmission and assess the effect of interventions. Between Feb 10, 2014, and Aug 25, 2014, we obtained data from the linelist of all confirmed and probable cases in Guinea (as of Sept 16, 2014), a laboratory database of information about patients, and interviews with patients and their families and neighbours. With this information, we mapped chains of transmission, identified which setting infections most probably originated from (community, hospitals, or funerals), and computed the context-specific and overall reproduction numbers. Of 193 confirmed and probable cases of Ebola virus disease reported in Conakry, Boffa, and Télimélé, 152 (79%) were positioned in chains of transmission. Health-care workers contributed little to transmission. In March, 2014, individuals with Ebola virus disease who were not health-care workers infected a mean of 2·3 people (95% CI 1·6-3·2): 1·4 (0·9-2·2) in the community, 0·4 (0·1-0·9) in hospitals, and 0·5 (0·2-1·0) at funerals. After the implementation of infection control in April, the reproduction number in hospitals and at funerals reduced to lower than 0·1. In the community, the reproduction number dropped by 50% for patients that were admitted to hospital, but remained unchanged for those that were not. In March, hospital transmissions constituted 35% (seven of 20) of all transmissions and funeral transmissions constituted 15% (three); but from April to the end of the study period, they constituted only 9% (11 of 128) and 4% (five), respectively. 82% (119 of 145) of transmission occurred in the community and 72% (105) between family members. Our simulations show that a 10% increase in hospital admissions could have reduced the length of chains by 26% (95% CI 4-45). In Conakry, interventions had the potential to stop the epidemic, but reintroductions of the disease and poor cooperation of a few families led to prolonged low-level spread, showing the challenges of Ebola virus disease control in large urban centres. Monitoring of chains of transmission is crucial to assess and optimise local control strategies for Ebola virus disease. Labex IBEID, Reacting, PREDEMICS, NIGMS MIDAS initiative, Institut Pasteur de Dakar. Copyright © 2015 Elsevier Ltd. All rights reserved.
Davies, Bethan; Anderson, Sarah-Jane; Turner, Katy M E; Ward, Helen
2014-01-30
Transmission dynamic models linked to economic analyses often form part of the decision making process when introducing new chlamydia screening interventions. Outputs from these transmission dynamic models can vary depending on the values of the parameters used to describe the infection. Therefore these values can have an important influence on policy and resource allocation. The risk of progression from infection to pelvic inflammatory disease has been extensively studied but the parameters which govern the transmission dynamics are frequently neglected. We conducted a systematic review of transmission dynamic models linked to economic analyses of chlamydia screening interventions to critically assess the source and variability of the proportion of infections that are asymptomatic, the duration of infection and the transmission probability. We identified nine relevant studies in Pubmed, Embase and the Cochrane database. We found that there is a wide variation in their natural history parameters, including an absolute difference in the proportion of asymptomatic infections of 25% in women and 75% in men, a six-fold difference in the duration of asymptomatic infection and a four-fold difference in the per act transmission probability. We consider that much of this variation can be explained by a lack of consensus in the literature. We found that a significant proportion of parameter values were referenced back to the early chlamydia literature, before the introduction of nucleic acid modes of diagnosis and the widespread testing of asymptomatic individuals. In conclusion, authors should use high quality contemporary evidence to inform their parameter values, clearly document their assumptions and make appropriate use of sensitivity analysis. This will help to make models more transparent and increase their utility to policy makers.
An Emergency Packet Forwarding Scheme for V2V Communication Networks
2014-01-01
This paper proposes an effective warning message forwarding scheme for cooperative collision avoidance. In an emergency situation, an emergency-detecting vehicle warns the neighbor vehicles via an emergency warning message. Since the transmission range is limited, the warning message is broadcast in a multihop manner. Broadcast packets lead two challenges to forward the warning message in the vehicular network: redundancy of warning messages and competition with nonemergency transmissions. In this paper, we study and address the two major challenges to achieve low latency in delivery of the warning message. To reduce the intervehicle latency and end-to-end latency, which cause chain collisions, we propose a two-way intelligent broadcasting method with an adaptable distance-dependent backoff algorithm. Considering locations of vehicles, the proposed algorithm controls the broadcast of a warning message to reduce redundant EWM messages and adaptively chooses the contention window to compete with nonemergency transmission. Via simulations, we show that our proposed algorithm reduces the probability of rear-end crashes by 70% compared to previous algorithms by reducing the intervehicle delay. We also show that the end-to-end propagation delay of the warning message is reduced by 55%. PMID:25054181
OH-58 Helicopter Transmission Failure Analysis
1976-01-01
would require rigid stradle mountings in place of the overhung mountings currently on the plane- tary spider. However, there is a probability that...roller bearings with rigid stradle mounting to replace the overhung mounting. This change would re- duce the heat generation in the planet...Weapons System Manager requested NASA-Lewis Research Center’s assistance in upgrading the current OH-58 main rotor transmission in performance and
HMM for hyperspectral spectrum representation and classification with endmember entropy vectors
NASA Astrophysics Data System (ADS)
Arabi, Samir Y. W.; Fernandes, David; Pizarro, Marco A.
2015-10-01
The Hyperspectral images due to its good spectral resolution are extensively used for classification, but its high number of bands requires a higher bandwidth in the transmission data, a higher data storage capability and a higher computational capability in processing systems. This work presents a new methodology for hyperspectral data classification that can work with a reduced number of spectral bands and achieve good results, comparable with processing methods that require all hyperspectral bands. The proposed method for hyperspectral spectra classification is based on the Hidden Markov Model (HMM) associated to each Endmember (EM) of a scene and the conditional probabilities of each EM belongs to each other EM. The EM conditional probability is transformed in EM vector entropy and those vectors are used as reference vectors for the classes in the scene. The conditional probability of a spectrum that will be classified is also transformed in a spectrum entropy vector, which is classified in a given class by the minimum ED (Euclidian Distance) among it and the EM entropy vectors. The methodology was tested with good results using AVIRIS spectra of a scene with 13 EM considering the full 209 bands and the reduced spectral bands of 128, 64 and 32. For the test area its show that can be used only 32 spectral bands instead of the original 209 bands, without significant loss in the classification process.
Modeling infection transmission in primate networks to predict centrality-based risk.
Romano, Valéria; Duboscq, Julie; Sarabian, Cécile; Thomas, Elodie; Sueur, Cédric; MacIntosh, Andrew J J
2016-07-01
Social structure can theoretically regulate disease risk by mediating exposure to pathogens via social proximity and contact. Investigating the role of central individuals within a network may help predict infectious agent transmission as well as implement disease control strategies, but little is known about such dynamics in real primate networks. We combined social network analysis and a modeling approach to better understand transmission of a theoretical infectious agent in wild Japanese macaques, highly social animals which form extended but highly differentiated social networks. We collected focal data from adult females living on the islands of Koshima and Yakushima, Japan. Individual identities as well as grooming networks were included in a Markov graph-based simulation. In this model, the probability that an individual will transmit an infectious agent depends on the strength of its relationships with other group members. Similarly, its probability of being infected depends on its relationships with already infected group members. We correlated: (i) the percentage of subjects infected during a latency-constrained epidemic; (ii) the mean latency to complete transmission; (iii) the probability that an individual is infected first among all group members; and (iv) each individual's mean rank in the chain of transmission with different individual network centralities (eigenvector, strength, betweenness). Our results support the hypothesis that more central individuals transmit infections in a shorter amount of time and to more subjects but also become infected more quickly than less central individuals. However, we also observed that the spread of infectious agents on the Yakushima network did not always differ from expectations of spread on random networks. Generalizations about the importance of observed social networks in pathogen flow should thus be made with caution, since individual characteristics in some real world networks appear less relevant than they are in others in predicting disease spread. Am. J. Primatol. 78:767-779, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Interference-Robust Transmission in Wireless Sensor Networks
Han, Jin-Seok; Lee, Yong-Hwan
2016-01-01
Low-power wireless sensor networks (WSNs) operating in unlicensed spectrum bands may seriously suffer from interference from other coexisting radio systems, such as IEEE 802.11 wireless local area networks. In this paper, we consider the improvement of the transmission performance of low-power WSNs by adjusting the transmission rate and the payload size in response to the change of co-channel interference. We estimate the probability of transmission failure and the data throughput and then determine the payload size to maximize the throughput performance. We investigate that the transmission time maximizing the normalized throughput is not much affected by the transmission rate, but rather by the interference condition. We adjust the transmission rate and the transmission time in response to the change of the channel and interference condition, respectively. Finally, we verify the performance of the proposed scheme by computer simulation. The simulation results show that the proposed scheme significantly improves data throughput compared with conventional schemes while preserving energy efficiency even in the presence of interference. PMID:27854249
Interference-Robust Transmission in Wireless Sensor Networks.
Han, Jin-Seok; Lee, Yong-Hwan
2016-11-14
Low-power wireless sensor networks (WSNs) operating in unlicensed spectrum bands may seriously suffer from interference from other coexisting radio systems, such as IEEE 802.11 wireless local area networks. In this paper, we consider the improvement of the transmission performance of low-power WSNs by adjusting the transmission rate and the payload size in response to the change of co-channel interference. We estimate the probability of transmission failure and the data throughput and then determine the payload size to maximize the throughput performance. We investigate that the transmission time maximizing the normalized throughput is not much affected by the transmission rate, but rather by the interference condition. We adjust the transmission rate and the transmission time in response to the change of the channel and interference condition, respectively. Finally, we verify the performance of the proposed scheme by computer simulation. The simulation results show that the proposed scheme significantly improves data throughput compared with conventional schemes while preserving energy efficiency even in the presence of interference.
Peculiarities of the detection and identification of substance at long distance
NASA Astrophysics Data System (ADS)
Trofimov, Vyacheslav A.; Varentsova, Svetlana A.; Trofimov, Vladislav V.; Tikhomirov, Vasily V.
2014-05-01
Nowadays, the detection and identification of dangerous substances at long distance (several meters, for example) by using of THz pulse reflected from the object is an important problem. In this report we demonstrate possibility of THz signal measuring reflected from investigated object that is placed before a flat metallic mirror. A distance between the flat mirror and the parabolic mirror this mirror is equal to 3.5 meters. Therefore, at present time our measurements contain features of both transmission and reflection modes. The reflecting mirror is used because of weak average power of used femtosecond laser. Measurements were provided at room temperature and humidity about 60%. The aim of investigation was the detection of a substance in real condition. Chocolate and Cookies were used as samples for identification. We also discuss modified correlation criteria for the detection and identification of various substances using pulsed THz signal in the transmission and reflection mode at short distances of about 30-40 cm. These criteria are integral criteria in time and they are based on the SDA method. Proposed algorithms show both high probability of the substance identification and a reliability of realization in practice. We compare P-spectrum and SDA- methods in the paper and show that P-spectrum method is a partial case of SDAmethod.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew
Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less
Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; ...
2018-01-28
Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al.[Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated bymore » an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quan-tum yield, emittance, and emission models needed by beam optics codes are discussed. Published by AIP Publishing. https://doi.org/10.1063/1.5008600« less
Simulation of the dynamical transmission of several-hundred-keV protons through a conical capillary
NASA Astrophysics Data System (ADS)
Yang, A. X.; Zhu, B. H.; Niu, S. T.; Pan, P.; Han, C. Z.; Song, H. Y.; Shao, J. X.; Chen, X. M.
2018-05-01
The time evolution of the trajectories, angular distributions, and two-dimensional images of intermediate-energy protons being transmitted through a conical capillary was simulated. The simulation results indicate that the charge deposited in the capillary significantly enhances the probability of surface specular scattering and thus greatly enhances the transmission rate. Furthermore, this deposited-charge-assisted specular reflection causes the transmission rate to exhibit an energy dependence proportional to E-1, which is very consistent with the experimental data. After transmission at nonzero tilt angles, the angular distribution of several-hundred-keV protons is far from symmetric, unlike in the case of keV protons.
NASA Astrophysics Data System (ADS)
Khalaf, E.; Skvortsov, M. A.; Ostrovsky, P. M.
2016-03-01
We study electron transport at the edge of a generic disordered two-dimensional topological insulator, where some channels are topologically protected from backscattering. Assuming the total number of channels is large, we consider the edge as a quasi-one-dimensional quantum wire and describe it in terms of a nonlinear sigma model with a topological term. Neglecting localization effects, we calculate the average distribution function of transmission probabilities as a function of the sample length. We mainly focus on the two experimentally relevant cases: a junction between two quantum Hall (QH) states with different filling factors (unitary class) and a relatively thick quantum well exhibiting quantum spin Hall (QSH) effect (symplectic class). In a QH sample, the presence of topologically protected modes leads to a strong suppression of diffusion in the other channels already at scales much shorter than the localization length. On the semiclassical level, this is accompanied by the formation of a gap in the spectrum of transmission probabilities close to unit transmission, thereby suppressing shot noise and conductance fluctuations. In the case of a QSH system, there is at most one topologically protected edge channel leading to weaker transport effects. In order to describe `topological' suppression of nearly perfect transparencies, we develop an exact mapping of the semiclassical limit of the one-dimensional sigma model onto a zero-dimensional sigma model of a different symmetry class, allowing us to identify the distribution of transmission probabilities with the average spectral density of a certain random-matrix ensemble. We extend our results to other symmetry classes with topologically protected edges in two dimensions.
Larkin, Joshua D; Jenni, Nicole L; Floresco, Stan B
2016-01-01
Dopamine (DA) transmission within cortico-limbic-striatal circuitry is integral in modulating decisions involving reward uncertainty. The basolateral amygdala (BLA) also plays a role in these processes, yet how DA transmission within this nucleus regulates cost/benefit decision making is unknown. We investigated the contribution of DA transmission within the BLA to risk/reward decision making assessed with a probabilistic discounting task. Rats were well-trained to choose between a small/certain reward and a large/risky reward, with the probability of obtaining the larger reward decreasing (100-12.5 %) or increasing (12.5-100 %) over a session. We examined the effects of antagonizing BLA D1 (SCH 23390, 0.1-1 μg) or D2 (eticlopride, 0.1-1 μg) receptors, as well as intra-BLA infusions of agonists for D1 (SKF 81297, 0.1-1 μg) and D2 (quinpirole, 1-10 μg) receptors. We also assessed how DA receptor stimulation may induce differential effects related to baseline levels of risky choice. BLA D1 receptor antagonism reduced risky choice by decreasing reward sensitivity, whereas D2 antagonism did not affect overall choice patterns. Stimulation of BLA D1 receptors optimized decision making in a baseline-dependent manner: in risk-averse rats, infusions of a lower dose of SKF81297 increased risky choice when reward probabilities were high (50 %), whereas in risk-prone rats, this drug reduced risky choice when probabilities were low (12.5 %). Quinpirole reduced risky choice in risk-prone rats, enhancing lose-shift behavior. These data highlight previously uncharacterized roles for BLA DA D1 and D2 receptors in biasing choice during risk/reward decision making through mediation of reward/negative feedback sensitivity.
Cost-effective solutions to maintaining smart grid reliability
NASA Astrophysics Data System (ADS)
Qin, Qiu
As the aging power systems are increasingly working closer to the capacity and thermal limits, maintaining an sufficient reliability has been of great concern to the government agency, utility companies and users. This dissertation focuses on improving the reliability of transmission and distribution systems. Based on the wide area measurements, multiple model algorithms are developed to diagnose transmission line three-phase short to ground faults in the presence of protection misoperations. The multiple model algorithms utilize the electric network dynamics to provide prompt and reliable diagnosis outcomes. Computational complexity of the diagnosis algorithm is reduced by using a two-step heuristic. The multiple model algorithm is incorporated into a hybrid simulation framework, which consist of both continuous state simulation and discrete event simulation, to study the operation of transmission systems. With hybrid simulation, line switching strategy for enhancing the tolerance to protection misoperations is studied based on the concept of security index, which involves the faulted mode probability and stability coverage. Local measurements are used to track the generator state and faulty mode probabilities are calculated in the multiple model algorithms. FACTS devices are considered as controllers for the transmission system. The placement of FACTS devices into power systems is investigated with a criterion of maintaining a prescribed level of control reconfigurability. Control reconfigurability measures the small signal combined controllability and observability of a power system with an additional requirement on fault tolerance. For the distribution systems, a hierarchical framework, including a high level recloser allocation scheme and a low level recloser placement scheme, is presented. The impacts of recloser placement on the reliability indices is analyzed. Evaluation of reliability indices in the placement process is carried out via discrete event simulation. The reliability requirements are described with probabilities and evaluated from the empirical distributions of reliability indices.
MONTEIRO, J.F.G.; ESCUDERO, D.J.; WEINREB, C.; FLANIGAN, T.; GALEA, S.; FRIEDMAN, S.R.; MARSHALL, B.D.L.
2017-01-01
SUMMARY We investigated how different models of HIV transmission, and assumptions regarding the distribution of unprotected sex and syringe-sharing events (‘risk acts’), affect quantitative understanding of HIV transmission process in people who inject drugs (PWID). The individual-based model simulated HIV transmission in a dynamic sexual and injecting network representing New York City. We constructed four HIV transmission models: model 1, constant probabilities; model 2, random number of sexual and parenteral acts; model 3, viral load individual assigned; and model 4, two groups of partnerships (low and high risk). Overall, models with less heterogeneity were more sensitive to changes in numbers risk acts, producing HIV incidence up to four times higher than that empirically observed. Although all models overestimated HIV incidence, micro-simulations with greater heterogeneity in the HIV transmission modelling process produced more robust results and better reproduced empirical epidemic dynamics. PMID:26753627
VHF command system study. [spectral analysis of GSFC VHF-PSK and VHF-FSK Command Systems
NASA Technical Reports Server (NTRS)
Gee, T. H.; Geist, J. M.
1973-01-01
Solutions are provided to specific problems arising in the GSFC VHF-PSK and VHF-FSK Command Systems in support of establishment and maintenance of Data Systems Standards. Signal structures which incorporate transmission on the uplink of a clock along with the PSK or FSK data are considered. Strategies are developed for allocating power between the clock and data, and spectral analyses are performed. Bit error probability and other probabilities pertinent to correct transmission of command messages are calculated. Biphase PCM/PM and PCM/FM are considered as candidate modulation techniques on the telemetry downlink, with application to command verification. Comparative performance of PCM/PM and PSK systems is given special attention, including implementation considerations. Gain in bit error performance due to coding is also considered.
Agampodi, Suneth B.; Wickramage, Kolitha
2013-01-01
The fact that yellow fever (YF) has never occurred in Asia remains an “unsolved mystery” in global health. Most countries in Asia with high Aedes aegypti mosquito density are considered “receptive” for YF transmission. Recently, health officials in Sri Lanka issued a public health alert on the potential spread of YF from a migrant group from West Africa. We performed an extensive review of literature pertaining to the risk of YF in Sri Lanka/South Asian region to understand the probability of actual risk and assist health authorities to form evidence informed public health policies/practices. Published data from epidemiological, historical, biological, molecular, and mathematical models were harnessed to assess the risk of YF in Asia. Using this data we examine a number of theories proposed to explain lack of YF in Asia. Considering the evidence available, we conclude that the probable risk of local transmission of YF is extremely low in Sri Lanka and for other South Asian countries despite a high Aedes aegypti density and associated dengue burden. This does not however exclude the future possibility of transmission in Asia, especially considering the rapid influx travelers from endemic areas, as we report, arriving in Sri Lanka. PMID:24367789
Ecological Potential for Rabies Virus Transmission via Scavenging of Dead Bats by Mesocarnivores.
Theimer, Tad C; Dyer, Annie C; Keeley, Brian W; Gilbert, Amy T; Bergman, David L
2017-04-01
Multiple species of bats are reservoirs of rabies virus in the Americas and are occasionally the source of spillover infections into mesocarnivore species. Although rabies transmission generally is assumed to occur via bite, laboratory studies have demonstrated the potential for rabies transmission via ingestion of rabid animals. We investigated the ecological potential for this mode of transmission by assessing mesocarnivore scavenging behavior of dead bats in suburban habitats of Flagstaff, Arizona, US. In autumn 2013, summer 2014, and autumn 2015, we placed 104 rabies-negative bat carcasses either near buildings, in wildland areas, or in residential yards and then monitored them with trail cameras for 5 d. Overall, 52 (50%) bat carcasses were scavenged, with 39 (75%) of those scavenged by striped skunks ( Mephitis mephitis ). Within our study area, striped skunks had a higher ecological potential to contract rabies via ingestion of bat carcasses compared to other mesocarnivore species, due both to a greater number of encounters and a higher probability of ingestion per encounter (91%), and they were significantly more likely to approach bat carcasses in yards than in wildland areas. Raccoons ( Procyon lotor ) and gray foxes ( Urocyon cinereoargenteus ) had fewer encounters (nine and 13, respectively) and lower probability of ingesting bats (33% and 8%, respectively).
Ssematimba, Amos; Elbers, Armin R. W.; Hagenaars, Thomas J.; de Jong, Mart C. M.
2012-01-01
Estimates of the per-contact probability of transmission between farms of Highly Pathogenic Avian Influenza virus of H7N7 subtype during the 2003 epidemic in the Netherlands are important for the design of better control and biosecurity strategies. We used standardized data collected during the epidemic and a model to extract data for untraced contacts based on the daily number of infectious farms within a given distance of a susceptible farm. With these data, we used a maximum likelihood estimation approach to estimate the transmission probabilities by the individual contact types, both traced and untraced. The estimated conditional probabilities, conditional on the contact originating from an infectious farm, of virus transmission were: 0.000057 per infectious farm within 1 km per day, 0.000413 per infectious farm between 1 and 3 km per day, 0.0000895 per infectious farm between 3 and 10 km per day, 0.0011 per crisis organisation contact, 0.0414 per feed delivery contact, 0.308 per egg transport contact, 0.133 per other-professional contact and, 0.246 per rendering contact. We validate these outcomes against literature data on virus genetic sequences for outbreak farms. These estimates can be used to inform further studies on the role that improved biosecurity between contacts and/or contact frequency reduction can play in eliminating between-farm spread of the virus during future epidemics. The findings also highlight the need to; 1) understand the routes underlying the infections without traced contacts and, 2) to review whether the contact-tracing protocol is exhaustive in relation to all the farm’s day-to-day activities and practices. PMID:22808285
2010-01-01
Background In south-eastern Senegal, malaria and onchocerciasis are co-endemic. Onchocerciasis in this region has been controlled by once or twice yearly mass drug administration (MDA) with ivermectin (IVM) for over fifteen years. Since laboratory-raised Anopheles gambiae s.s. are susceptible to ivermectin at concentrations found in human blood post-ingestion of IVM, it is plausible that a similar effect could be quantified in the field, and that IVM might have benefits as a malaria control tool. Methods In 2008 and 2009, wild-caught blood fed An. gambiae s.l. mosquitoes were collected from huts of three pairs of Senegalese villages before and after IVM MDAs. Mosquitoes were held in an insectary to assess their survival rate, subsequently identified to species, and their blood meals were identified. Differences in mosquito survival were statistically analysed using a Glimmix model. Lastly, changes in the daily probability of mosquito survivorship surrounding IVM MDAs were calculated, and these data were inserted into a previously developed, mosquito age-structured model of malaria transmission. Results Anopheles gambiae s.s. (P < 0.0001) and Anopheles arabiensis (P = 0.0191) from the treated villages had significantly reduced survival compared to those from control villages. Furthermore, An gambiae s.s. caught 1-6 days after MDA in treated villages had significantly reduced survival compared to control village collections (P = 0.0003), as well as those caught pre-MDA (P < 0.0001) and >7 days post-MDA (P < 0.0001). The daily probability of mosquito survival dropped >10% for the six days following MDA. The mosquito age-structured model of malaria transmission demonstrated that a single IVM MDA would reduce malaria transmission (Ro) below baseline for at least eleven days, and that repeated IVM MDAs would result in a sustained reduction in malaria Ro. Conclusions Ivermectin MDA significantly reduced the survivorship of An. gambiae s.s. for six days past the date of the MDA, which is sufficient to temporarily reduce malaria transmission. Repeated IVM MDAs could be a novel and integrative malaria control tool in areas with seasonal transmission, and which would have simultaneous impacts on neglected tropical diseases in the same villages. PMID:21171970
Wang, Fei; Salous, Sana; Zhou, Jianjiang
2017-01-01
In this paper, we investigate a low probability of intercept (LPI)-based optimal power allocation strategy for a joint bistatic radar and communication system, which is composed of a dedicated transmitter, a radar receiver, and a communication receiver. The joint system is capable of fulfilling the requirements of both radar and communications simultaneously. First, assuming that the signal-to-noise ratio (SNR) corresponding to the target surveillance path is much weaker than that corresponding to the line of sight path at radar receiver, the analytically closed-form expression for the probability of false alarm is calculated, whereas the closed-form expression for the probability of detection is not analytically tractable and is approximated due to the fact that the received signals are not zero-mean Gaussian under target presence hypothesis. Then, an LPI-based optimal power allocation strategy is presented to minimize the total transmission power for information signal and radar waveform, which is constrained by a specified information rate for the communication receiver and the desired probabilities of detection and false alarm for the radar receiver. The well-known bisection search method is employed to solve the resulting constrained optimization problem. Finally, numerical simulations are provided to reveal the effects of several system parameters on the power allocation results. It is also demonstrated that the LPI performance of the joint bistatic radar and communication system can be markedly improved by utilizing the proposed scheme. PMID:29186850
Shi, Chenguang; Wang, Fei; Salous, Sana; Zhou, Jianjiang
2017-11-25
In this paper, we investigate a low probability of intercept (LPI)-based optimal power allocation strategy for a joint bistatic radar and communication system, which is composed of a dedicated transmitter, a radar receiver, and a communication receiver. The joint system is capable of fulfilling the requirements of both radar and communications simultaneously. First, assuming that the signal-to-noise ratio (SNR) corresponding to the target surveillance path is much weaker than that corresponding to the line of sight path at radar receiver, the analytically closed-form expression for the probability of false alarm is calculated, whereas the closed-form expression for the probability of detection is not analytically tractable and is approximated due to the fact that the received signals are not zero-mean Gaussian under target presence hypothesis. Then, an LPI-based optimal power allocation strategy is presented to minimize the total transmission power for information signal and radar waveform, which is constrained by a specified information rate for the communication receiver and the desired probabilities of detection and false alarm for the radar receiver. The well-known bisection search method is employed to solve the resulting constrained optimization problem. Finally, numerical simulations are provided to reveal the effects of several system parameters on the power allocation results. It is also demonstrated that the LPI performance of the joint bistatic radar and communication system can be markedly improved by utilizing the proposed scheme.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Konno, Kohkichi, E-mail: kohkichi@tomakomai-ct.ac.jp; Nagasawa, Tomoaki, E-mail: nagasawa@tomakomai-ct.ac.jp; Takahashi, Rohta, E-mail: takahashi@tomakomai-ct.ac.jp
We consider the scattering of a quantum particle by two independent, successive parity-invariant point interactions in one dimension. The parameter space for the two point interactions is given by the direct product of two tori, which is described by four parameters. By investigating the effects of the two point interactions on the transmission probability of plane wave, we obtain the conditions for the parameter space under which perfect resonant transmission occur. The resonance conditions are found to be described by symmetric and anti-symmetric relations between the parameters.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brogi, Bharat Bhushan, E-mail: brogi-221179@yahoo.in; Ahluwalia, P. K.; Chand, Shyam
2015-06-24
Theoretical study of the Coulomb blockade effect on transport properties (Transmission Probability and I-V characteristics) for varied configuration of coupled quantum dot system has been studied by using Non Equilibrium Green Function(NEGF) formalism and Equation of Motion(EOM) method in the presence of magnetic flux. The self consistent approach and intra-dot Coulomb interaction is being taken into account. As the key parameters of the coupled quantum dot system such as dot-lead coupling, inter-dot tunneling and magnetic flux threading through the system can be tuned, the effect of asymmetry parameter and magnetic flux on this tuning is being explored in Coulomb blockademore » regime. The presence of the Coulomb blockade due to on-dot Coulomb interaction decreases the width of transmission peak at energy level ε + U and by adjusting the magnetic flux the swapping effect in the Fano peaks in asymmetric and symmetric parallel configuration sustains despite strong Coulomb blockade effect.« less
Neuromuscular transmission and muscle fatigue changes by nanostructured oxygen.
Ivannikov, Maxim V; Sugimori, Mutsuyuki; Llinás, Rodolfo R
2017-04-01
Oxygen (O 2 ) nanobubbles offer a new method for tissue oxygenation. The effects of O 2 nanobubbles on transmission at neuromuscular junctions (NMJs) and muscle function were explored in murine diaphragm. Electrophysiological parameters, NMJ ultrastructure, muscle force, and muscle fatigue were studied during superfusion with solutions with different oxygen levels or oxygen nanobubbles. High frequency nerve stimulation of muscles superfused with O 2 nanobubble solution slowed neurotransmission decline over those with either control or hyperoxic solution. O 2 nanobubble solution increased the amplitude of evoked end plate potentials and quantal content but did not affect spontaneous activity. Electron microscopy of stimulated O 2 nanobubble treated NMJs showed accumulation of large synaptic vesicles and endosome-like structures. O 2 nanobubble solution had no effects on isometric muscle force, but it significantly decreased fatigability and maximum force recovery time in nerve stimulated muscles. O 2 nanobubbles increase neurotransmission and reduce the probability of neurotransmission failure in muscle fatigue. Muscle Nerve 55: 555-563, 2017. © 2016 Wiley Periodicals, Inc.
Multibands tunneling in AAA-stacked trilayer graphene
NASA Astrophysics Data System (ADS)
Redouani, Ilham; Jellal, Ahmed; Bahaoui, Abdelhadi; Bahlouli, Hocine
2018-04-01
We study the electronic transport through np and npn junctions for AAA-stacked trilayer graphene. Two kinds of gates are considered where the first is a single gate and the second is a double gate. After obtaining the solutions for the energy spectrum, we use the transfer matrix method to determine the three transmission probabilities for each individual cone τ = 0 , ± 1 . We show that the quasiparticles in AAA-stacked trilayer graphene are not only chiral but also labeled by an additional cone index τ. The obtained bands are composed of three Dirac cones that depend on the chirality indexes. We show that there is perfect transmission for normal or near normal incidence, which is a manifestation of the Klein tunneling effect. We analyze also the corresponding total conductance, which is defined as the sum of the conductance channels in each individual cone. Our results are numerically discussed and compared with those obtained for ABA- and ABC-stacked trilayer graphene.
Gomez-Lazaro, Emilio; Bueso, Maria C.; Kessler, Mathieu; ...
2016-02-02
Here, the Weibull probability distribution has been widely applied to characterize wind speeds for wind energy resources. Wind power generation modeling is different, however, due in particular to power curve limitations, wind turbine control methods, and transmission system operation requirements. These differences are even greater for aggregated wind power generation in power systems with high wind penetration. Consequently, models based on one-Weibull component can provide poor characterizations for aggregated wind power generation. With this aim, the present paper focuses on discussing Weibull mixtures to characterize the probability density function (PDF) for aggregated wind power generation. PDFs of wind power datamore » are firstly classified attending to hourly and seasonal patterns. The selection of the number of components in the mixture is analyzed through two well-known different criteria: the Akaike information criterion (AIC) and the Bayesian information criterion (BIC). Finally, the optimal number of Weibull components for maximum likelihood is explored for the defined patterns, including the estimated weight, scale, and shape parameters. Results show that multi-Weibull models are more suitable to characterize aggregated wind power data due to the impact of distributed generation, variety of wind speed values and wind power curtailment.« less
Lei, H; Li, Y; Xiao, S; Lin, C-H; Norris, S L; Wei, D; Hu, Z; Ji, S
2018-05-01
Identifying the exact transmission route(s) of infectious diseases in indoor environments is a crucial step in developing effective intervention strategies. In this study, we proposed a comparative analysis approach and built a model to simulate outbreaks of 3 different in-flight infections in a similar cabin environment, that is, influenza A H1N1, severe acute respiratory syndrome (SARS) coronavirus (CoV), and norovirus. The simulation results seemed to suggest that the close contact route was probably the most significant route (contributes 70%, 95% confidence interval [CI]: 67%-72%) in the in-flight transmission of influenza A H1N1 transmission; as a result, passengers within 2 rows of the index case had a significantly higher infection risk than others in the outbreak (relative risk [RR]: 13.4, 95% CI: 1.5-121.2, P = .019). For SARS CoV, the airborne, close contact, and fomite routes contributed 21% (95% CI: 19%-23%), 29% (95% CI: 27%-31%), and 50% (95% CI: 48%-53%), respectively. For norovirus, the simulation results suggested that the fomite route played the dominant role (contributes 85%, 95% CI: 83%-87%) in most cases; as a result, passengers in aisle seats had a significantly higher infection risk than others (RR: 9.5, 95% CI: 1.2-77.4, P = .022). This work highlighted a method for using observed outbreak data to analyze the roles of different infection transmission routes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Feng, Jun; Xia, Zhigui; Zhang, Li; Cheng, Siyuan; Wang, Rubo
2016-01-01
The objective of this study was to investigate malaria prevalence after the 2014 earthquakes in Ludian, Yongshan, and Jinggu counties, Yunnan Province, China. We collected and analyzed epidemiological data and made a risk assessment of transmission probability. From January 2005 to July 2015, 87 malaria cases were reported in the three counties, most of which (81.6%) occurred between 2005 and 2009, with five cases reported in Jinggu County between January 2014 and July 2015, of which one case was reported after the earthquake. In addition, no local transmission occurred in the three counties from 2010, and 95.5% of imported malaria occurred in patients who had returned from Myanmar. The townships of Lehong, Qingsheng, and Weiyuan were the main endemic areas in the three counties. The probability of malaria transmission in the three counties was low, but Jinggu County had a higher risk due to the existence of infected patients and an appropriate vector. With sporadic cases reported annually, close monitoring should continue to enhance early detection of a possible malaria outbreak. PMID:26711514
Genetic aspect of Alzheimer disease: Results of complex segregation analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sadonvick, A.D.; Lee, I.M.L.; Bailey-Wilson, J.E.
1994-09-01
The study was designed to evaluate the possibility that a single major locus will explain the segregation of Alzheimer disease (AD). The data were from the population-based AD Genetic Database and consisted of 402 consecutive, unrelated probands, diagnosed to have either `probable` or `autopsy confirmed` AD and their 2,245 first-degree relatives. In this analysis, a relative was considered affected with AD only when there were sufficient medical/autopsy data to support diagnosis of AD being the most likely cause of the dementia. Transmission probability models allowing for a genotype-dependent and logistically distributed age-of-onset were used. The program REGTL in the S.A.G.E.more » computer program package was used for a complex segregation analysis. The models included correction for single ascertainment. Regressive familial effects were not estimated. The data were analyzed to test for single major locus (SML), random transmission and no transmission (environmental) hypotheses. The results of the complex segregation analysis showed that (1) the SML was the best fit, and (2) the non-genetic models could be rejected.« less
Climate change and malaria risk in the European part of Russia in 21st century
NASA Astrophysics Data System (ADS)
Shartova, N.; Malkhazova, S.
2009-04-01
The purpose of this research is development of prognostic model of malaria risk for European part of Russia (EPR) in the 21st century according to climate scenario IPCC "A2". The following issues have been formulated to reach the goal of the research: define the basic epidemiological parameters describing malaria situation and methods of data processing; creating of maps of malaria risk; analysis of changes in malaria distribution for predictable future climate conditions in comparison with conditions of a modern climate. A lot of reasons (biological, social and economic) impact on malaria distribution. Nevertheless, incubation period of the parasite first of all depends on temperature. This is a primary factor that defines a potential area of infection, ability and specificity to transmit malaria. According to this, the model is based on the relationship between climate (average daily temperature) and the intensity of malaria transmission. The object of research is malaria parasite Plasmodium vivax, which has for Russia (particularly for EPR) the greatest importance because it has the lowest minimal temperature threshold for development. Climate data is presented by daily average temperatures of air for three analyzed periods. 1961 -1989 describes a modern climate and corresponds to the minimum 30-year period that is necessary for an assessment of climate and changes connected with biotic components. Prognostic malaria model is based on predicted daily average temperatures for 2046-2065 (the middle of century) and 2089-2100 (the end of century). All data sets for EPR are presented in the grid 2x2. The conclusion on possible changes in malaria distribution and transmission in the middle and the end of the 21st century: There is going to be the increase of duration of effective temperatures period (period when parasite development is possible), period of effective susceptibility to infection of mosquitoes (period when malaria transmission cycle is possible); shift of the beginning of malaria transmission period to earlier time as well as the end of this period's shift to later time is connected to increase of effective temperatures annual sum. Northern bounds of the territory where temperature conditions allow parasite's development and disease transmission are going to move significantly to the north. Accordingly there will be an expansion of potential disease distribution area. Annual development of parasite and malaria transmission will probably be possible on nearly whole EPR. The probability of malaria transmission and its intensity will increase. The greatest changes in malaria situation will occur in the north of EPR. The results of the research indicate growth of malaria risk on whole European part of Russia in 21st century.
A beam splitter for Dirac-Weyl fermions through the Goos-Hänchen-like shift
NASA Astrophysics Data System (ADS)
Zheng, Ren-fei; Zhou, Lu; Zhang, Weiping
2017-12-01
We propose a method of realizing an effective beam splitter for Dirac-Weyl fermions through the Goos-Hänchen-like shift. It is implemented via the birefringence of a wave packet of pseudospin-3/2 Dirac-Weyl fermions impinging upon a potential barrier. It is shown that experimentally observable spatial separation between the transmitted fermions with helicity-1/2 and 3/2 can be generated by the Goos-Hänchen-like shift. The dependence of Goos-Hänchen-like shift and the corresponding transmission probability on the incident angle, the height and width of the potential barrier are carefully studied.
NASA Astrophysics Data System (ADS)
Xu, Ding; Li, Qun
2017-01-01
This paper addresses the power allocation problem for cognitive radio (CR) based on hybrid-automatic-repeat-request (HARQ) with chase combining (CC) in Nakagamimslow fading channels. We assume that, instead of the perfect instantaneous channel state information (CSI), only the statistical CSI is available at the secondary user (SU) transmitter. The aim is to minimize the SU outage probability under the primary user (PU) interference outage constraint. Using the Lagrange multiplier method, an iterative and recursive algorithm is derived to obtain the optimal power allocation for each transmission round. Extensive numerical results are presented to illustrate the performance of the proposed algorithm.
Fixed forced detection for fast SPECT Monte-Carlo simulation
NASA Astrophysics Data System (ADS)
Cajgfinger, T.; Rit, S.; Létang, J. M.; Halty, A.; Sarrut, D.
2018-03-01
Monte-Carlo simulations of SPECT images are notoriously slow to converge due to the large ratio between the number of photons emitted and detected in the collimator. This work proposes a method to accelerate the simulations based on fixed forced detection (FFD) combined with an analytical response of the detector. FFD is based on a Monte-Carlo simulation but forces the detection of a photon in each detector pixel weighted by the probability of emission (or scattering) and transmission to this pixel. The method was evaluated with numerical phantoms and on patient images. We obtained differences with analog Monte Carlo lower than the statistical uncertainty. The overall computing time gain can reach up to five orders of magnitude. Source code and examples are available in the Gate V8.0 release.
Fixed forced detection for fast SPECT Monte-Carlo simulation.
Cajgfinger, T; Rit, S; Létang, J M; Halty, A; Sarrut, D
2018-03-02
Monte-Carlo simulations of SPECT images are notoriously slow to converge due to the large ratio between the number of photons emitted and detected in the collimator. This work proposes a method to accelerate the simulations based on fixed forced detection (FFD) combined with an analytical response of the detector. FFD is based on a Monte-Carlo simulation but forces the detection of a photon in each detector pixel weighted by the probability of emission (or scattering) and transmission to this pixel. The method was evaluated with numerical phantoms and on patient images. We obtained differences with analog Monte Carlo lower than the statistical uncertainty. The overall computing time gain can reach up to five orders of magnitude. Source code and examples are available in the Gate V8.0 release.
Genné, Daniel
2007-10-10
For many centuries, man is fascinated by bats, the only flying mammals. Probably because of their particular immune system, bats can be considered an important reservoir for new emerging viral diseases like SARS-Coronavirus, Marburg fever, Ebola fever and Nipah virus encephalitis. During closer contact, they can transmit rabies and probably other nonviral infectious diseases. Bats get closer to man due to ecological modifications like deforestation, so that transmission of new infectious agents might provoke dramatic epidemics.
NASA Astrophysics Data System (ADS)
Sallah, M.
2014-03-01
The problem of monoenergetic radiative transfer in a finite planar stochastic atmospheric medium with polarized (vector) Rayleigh scattering is proposed. The solution is presented for an arbitrary absorption and scattering cross sections. The extinction function of the medium is assumed to be a continuous random function of position, with fluctuations about the mean taken as Gaussian distributed. The joint probability distribution function of these Gaussian random variables is used to calculate the ensemble-averaged quantities, such as reflectivity and transmissivity, for an arbitrary correlation function. A modified Gaussian probability distribution function is also used to average the solution in order to exclude the probable negative values of the optical variable. Pomraning-Eddington approximation is used, at first, to obtain the deterministic analytical solution for both the total intensity and the difference function used to describe the polarized radiation. The problem is treated with specular reflecting boundaries and angular-dependent externally incident flux upon the medium from one side and with no flux from the other side. For the sake of comparison, two different forms of the weight function, which introduced to force the boundary conditions to be fulfilled, are used. Numerical results of the average reflectivity and average transmissivity are obtained for both Gaussian and modified Gaussian probability density functions at the different degrees of polarization.
NASA Astrophysics Data System (ADS)
Jiang, YuXiao; Guo, PengLiang; Gao, ChengYan; Wang, HaiBo; Alzahrani, Faris; Hobiny, Aatef; Deng, FuGuo
2017-12-01
We present an original self-error-rejecting photonic qubit transmission scheme for both the polarization and spatial states of photon systems transmitted over collective noise channels. In our scheme, we use simple linear-optical elements, including half-wave plates, 50:50 beam splitters, and polarization beam splitters, to convert spatial-polarization modes into different time bins. By using postselection in different time bins, the success probability of obtaining the uncorrupted states approaches 1/4 for single-photon transmission, which is not influenced by the coefficients of noisy channels. Our self-error-rejecting transmission scheme can be generalized to hyperentangled n-photon systems and is useful in practical high-capacity quantum communications with photon systems in two degrees of freedom.
Zehender, Gianguglielmo; Frati, Elena Rosanna; Martinelli, Marianna; Bianchi, Silvia; Amendola, Antonella; Ebranati, Erika; Ciccozzi, Massimo; Galli, Massimo; Lai, Alessia; Tanzi, Elisabetta
2016-04-01
A major limitation when reconstructing the origin and evolution of HPV-16 is the lack of reliable substitution rate estimates for the viral genes. On the basis of the hypothesis of human HPV-16 co-divergence, we estimated a mean evolutionary rate of 1.47×10(-7) (95% HPD=0.64-2.47×10(-7)) subs/site/year for the viral LCR region. The results of a Bayesian phylogeographical analysis suggest that the currently circulating HPV-16 most probably originated in Africa about 110 thousand years ago (Kya), before giving rise to four known geographical lineages: the Asian/European lineage, which most probably originated in Asia a mean 38 Kya, and the Asian/American and two African lineages, which probably respectively originated about 33 and 27 Kya. These data closely reflect current hypotheses concerning modern human expansion based on studies of mitochondrial DNA phylogeny. The correlation between ancient human migration and the present HPV phylogeny may be explained by the co-existence of modes of transmission other than sexual transmission. Copyright © 2016. Published by Elsevier B.V.
Entomologic considerations in the study of onchocerciasis transmission.
Vargas, L; Díaz-Nájera, A
1980-01-01
The entomological resources utilized for a better understanding of Onchocerca volvulus transmission are discussed in this paper. Vector density, anthropohilia, gonotrophic cycyle, parous condition longevity and probability of survival in days after the infectious meal are assessed here in order to integrate an overall picture. The concept of vectorial capacity is developed stressing the quantitative aspects. Parasitism of the black-flies by filariae that are doubtfully identified as O. volvulus is also mentioned here.
A Distributed Transmission Rate Adjustment Algorithm in Heterogeneous CSMA/CA Networks
Xie, Shuanglong; Low, Kay Soon; Gunawan, Erry
2015-01-01
Distributed transmission rate tuning is important for a wide variety of IEEE 802.15.4 network applications such as industrial network control systems. Such systems often require each node to sustain certain throughput demand in order to guarantee the system performance. It is thus essential to determine a proper transmission rate that can meet the application requirement and compensate for network imperfections (e.g., packet loss). Such a tuning in a heterogeneous network is difficult due to the lack of modeling techniques that can deal with the heterogeneity of the network as well as the network traffic changes. In this paper, a distributed transmission rate tuning algorithm in a heterogeneous IEEE 802.15.4 CSMA/CA network is proposed. Each node uses the results of clear channel assessment (CCA) to estimate the busy channel probability. Then a mathematical framework is developed to estimate the on-going heterogeneous traffics using the busy channel probability at runtime. Finally a distributed algorithm is derived to tune the transmission rate of each node to accurately meet the throughput requirement. The algorithm does not require modifications on IEEE 802.15.4 MAC layer and it has been experimentally implemented and extensively tested using TelosB nodes with the TinyOS protocol stack. The results reveal that the algorithm is accurate and can satisfy the throughput demand. Compared with existing techniques, the algorithm is fully distributed and thus does not require any central coordination. With this property, it is able to adapt to traffic changes and re-adjust the transmission rate to the desired level, which cannot be achieved using the traditional modeling techniques. PMID:25822140
Weiss, Howard; Elon, Lisa; Si, Wenpei; Norris, Sharon L.
2018-01-01
With over 3 billion airline passengers annually, the inflight transmission of infectious diseases is an important global health concern. Over a dozen cases of inflight transmission of serious infections have been documented, and air travel can serve as a conduit for the rapid spread of newly emerging infections and pandemics. Despite sensational media stories and anecdotes, the risks of transmission of respiratory viruses in an airplane cabin are unknown. Movements of passengers and crew may facilitate disease transmission. On 10 transcontinental US flights, we chronicled behaviors and movements of individuals in the economy cabin on single-aisle aircraft. We simulated transmission during flight based on these data. Our results indicate there is low probability of direct transmission to passengers not seated in close proximity to an infectious passenger. This data-driven, dynamic network transmission model of droplet-mediated respiratory disease is unique. To measure the true pathogen burden, our team collected 229 environmental samples during the flights. Although eight flights were during Influenza season, all qPCR assays for 18 common respiratory viruses were negative. PMID:29555754
NASA Astrophysics Data System (ADS)
Kropotov, Y. A.; Belov, A. A.; Proskuryakov, A. Y.; Kolpakov, A. A.
2018-05-01
The paper considers models and methods for estimating signals during the transmission of information messages in telecommunication systems of audio exchange. One-dimensional probability distribution functions that can be used to isolate useful signals, and acoustic noise interference are presented. An approach to the estimation of the correlation and spectral functions of the parameters of acoustic signals is proposed, based on the parametric representation of acoustic signals and the components of the noise components. The paper suggests an approach to improving the efficiency of interference cancellation and highlighting the necessary information when processing signals from telecommunications systems. In this case, the suppression of acoustic noise is based on the methods of adaptive filtering and adaptive compensation. The work also describes the models of echo signals and the structure of subscriber devices in operational command telecommunications systems.
NASA Astrophysics Data System (ADS)
Sakata, T.; Suzuki, M.; Yamamoto, T.; Nakanishi, S.; Funahashi, M.; Tsurumachi, N.
2017-10-01
We investigated the optical transmission properties of one-dimensional photonic crystal (1D-PC) microcavity structures containing the liquid-crystalline (LC) perylene tetracarboxylic bisimide (PTCBI) derivative. We fabricated the microcavity structures for this study by two different methods and observed the cavity polaritons successfully in both samples. For one sample, since the PTCBI molecules were aligned in the cavity layer of the 1D-PC by utilizing a friction transfer method, vacuum Rabi splitting energy was strongly dependent on the polarization of the incident light produced by the peculiar optical features of the LC organic semiconductor. For the other sample, we did not utilize the friction transfer method and did not observe such polarization dependence. However, we did observe a relatively large Rabi splitting energy of 187 meV, probably due to the improvement of optical confinement effect.
Deterministic quantum state transfer between remote qubits in cavities
NASA Astrophysics Data System (ADS)
Vogell, B.; Vermersch, B.; Northup, T. E.; Lanyon, B. P.; Muschik, C. A.
2017-12-01
Performing a faithful transfer of an unknown quantum state is a key challenge for enabling quantum networks. The realization of networks with a small number of quantum links is now actively pursued, which calls for an assessment of different state transfer methods to guide future design decisions. Here, we theoretically investigate quantum state transfer between two distant qubits, each in a cavity, connected by a waveguide, e.g., an optical fiber. We evaluate the achievable success probabilities of state transfer for two different protocols: standard wave packet shaping and adiabatic passage. The main loss sources are transmission losses in the waveguide and absorption losses in the cavities. While special cases studied in the literature indicate that adiabatic passages may be beneficial in this context, it remained an open question under which conditions this is the case and whether their use will be advantageous in practice. We answer these questions by providing a full analysis, showing that state transfer by adiabatic passage—in contrast to wave packet shaping—can mitigate the effects of undesired cavity losses, far beyond the regime of coupling to a single waveguide mode and the regime of lossless waveguides, as was proposed so far. Furthermore, we show that the photon arrival probability is in fact bounded in a trade-off between losses due to non-adiabaticity and due to coupling to off-resonant waveguide modes. We clarify that neither protocol can avoid transmission losses and discuss how the cavity parameters should be chosen to achieve an optimal state transfer.
Cross, Paul C.; Maichak, Eric J.; Rogerson, Jared D.; Irvine, Kathryn M.; Jones, Jennifer D; Heisey, Dennis M.; Edwards, William H.; Scurlock, Brandon M.
2015-01-01
Understanding the seasonal timing of disease transmission can lead to more effective control strategies, but the seasonality of transmission is often unknown for pathogens transmitted directly. We inserted vaginal implant transmitters (VITs) in 575 elk (Cervus elaphus canadensis) from 2006 to 2014 to assess when reproductive failures (i.e., abortions or still births) occur, which is the primary transmission route of Brucella abortus, the causative agent of brucellosis in the Greater Yellowstone Ecosystem. Using a survival analysis framework, we developed a Bayesian hierarchical model that simultaneously estimated the total baseline hazard of a reproductive event as well as its 2 mutually exclusive parts (abortions or live births). Approximately, 16% (95% CI = 0.10, 0.23) of the pregnant seropositive elk had reproductive failures, whereas 2% (95% CI = 0.01, 0.04) of the seronegative elk had probable abortions. Reproductive failures could have occurred as early as 13 February and as late as 10 July, peaking from March through May. Model results suggest that less than 5% of likely abortions occurred after 6 June each year and abortions were approximately 5 times more likely in March, April, or May compared to February or June. In western Wyoming, supplemental feeding of elk begins in December and ends during the peak of elk abortions and brucellosis transmission (i.e., Mar and Apr). Years with more snow may enhance elk-to-elk transmission on supplemental feeding areas because elk are artificially aggregated for the majority of the transmission season. Elk-to-cattle transmission will depend on the transmission period relative to the end of the supplemental feeding season, elk seroprevalence, population size, and the amount of commingling. Our statistical approach allowed us to estimate the probability density function of different event types over time, which may be applicable to other cause-specific survival analyses. It is often challenging to assess the cause of death, or in this case whether the reproductive event was an abortion or live birth. Accounting for uncertainty in the event type is an important future addition to our methodological approach.
2014-01-01
Background Transmission models can aid understanding of disease dynamics and are useful in testing the efficiency of control measures. The aim of this study was to formulate an appropriate stochastic Susceptible-Infectious-Resistant/Carrier (SIR) model for Salmonella Typhimurium in pigs and thus estimate the transmission parameters between states. Results The transmission parameters were estimated using data from a longitudinal study of three Danish farrow-to-finish pig herds known to be infected. A Bayesian model framework was proposed, which comprised Binomial components for the transition from susceptible to infectious and from infectious to carrier; and a Poisson component for carrier to infectious. Cohort random effects were incorporated into these models to allow for unobserved cohort-specific variables as well as unobserved sources of transmission, thus enabling a more realistic estimation of the transmission parameters. In the case of the transition from susceptible to infectious, the cohort random effects were also time varying. The number of infectious pigs not detected by the parallel testing was treated as unknown, and the probability of non-detection was estimated using information about the sensitivity and specificity of the bacteriological and serological tests. The estimate of the transmission rate from susceptible to infectious was 0.33 [0.06, 1.52], from infectious to carrier was 0.18 [0.14, 0.23] and from carrier to infectious was 0.01 [0.0001, 0.04]. The estimate for the basic reproduction ration (R 0 ) was 1.91 [0.78, 5.24]. The probability of non-detection was estimated to be 0.18 [0.12, 0.25]. Conclusions The proposed framework for stochastic SIR models was successfully implemented to estimate transmission rate parameters for Salmonella Typhimurium in swine field data. R 0 was 1.91, implying that there was dissemination of the infection within pigs of the same cohort. There was significant temporal-cohort variability, especially at the susceptible to infectious stage. The model adequately fitted the data, allowing for both observed and unobserved sources of uncertainty (cohort effects, diagnostic test sensitivity), so leading to more reliable estimates of transmission parameters. PMID:24774444
Canadian hepatitis C look-back investigation to detect transmission from an infected general surgeon
Dawar, Meenakshi; Stuart, Tammy L; Sweet, Lamont E; Neatby, Anne M; Abbott, Lewis P; Andonov, Anton P; Wong, Tom; Gervais, Robert; Stirling, Rob
2010-01-01
BACKGROUND: In February 2007, a general surgeon in Charlottetown, Prince Edward Island, tested positive for hepatitis C virus (HCV). The surgeon’s infection onset date could not be determined; however, episodic hepatic enzyme elevations were first detected in November 2004 and again in February 2007. HCV transmission during surgery, alhough rare, has been documented. A phased look-back HCV screening program was conducted to detect HCV transmission from this surgeon to patients who underwent the highest-risk procedures in the three years before his positive test. METHODS: Highest-risk procedures were defined as exposure-prone procedures (EPP) in which exposure to the surgeon’s blood was most likely. EPP patients from January 2004 to February 2007 were identified using hospital and administrative records. Linkages with the provincial notifiable disease for HCV was performed, and death records for deceased EPP patients were reviewed. Eligible patients were invited for screening. RESULTS: Of 6248 patients seen in phase 1, 272 (4.4%) were identified to be EPP. Of the 272 patients, 248 (91.1%) were invited for HCV testing and 24 (8.8%) were deceased. To date, 231 of 248 (93.1%) patients have presented for screening. Two patients (one alive, one deceased) were HCV positive before their EPP. Viral sequence of the surgeon’s isolate is unrelated to the first patient; the second individual has a resolved infection (polymerase chain reaction negative). No new transmission events were identified in the screened patients. The 95% CI of the transmission probability was estimated to be 0 to 0.016. INTERPRETATION: HCV transmission from the surgeon during a 38-month look back was unlikely. In the absence of protocols for investigating HCV transmission from infected health care workers, screening was initially prioritized to the highest-risk patients. The investigation has been satisfactorily terminated based on these results. PMID:21358878
Chains of transmission and control of Ebola Virus Disease in Conakry, Guinea in 2014
Faye, Ousmane; Boëlle, Pierre-Yves; Heleze, Emmanuel; Faye, Oumar; Loucoubar, Cheikh; Magassouba, N’Faly; Soropogui, Barré; Keita, Sakoba; Gakou, Tata; Bah, El Hadji Ibrahima; Koivogui, Lamine; Sall, Amadou Alpha; Cauchemez, Simon
2015-01-01
Background An Ebola Virus Disease (EVD) epidemic of unprecedented magnitude is ongoing in West Africa, affecting for the first time large urban centers like Conakry, the capital of Guinea. Methods Interviews of EVD patients, relatives and neighbors and laboratory databases were used to reconstruct EVD chains of transmission in Conakry, from March to August 2014. Findings Out of 193 confirmed and probable EVD cases reported in Conakry, Boffa and Télimélé, 152 (79%) were positioned in the chains of transmission. In March, non-Health Care Workers cases infected on average 2.3 (95% CI: 1.6, 3.2) persons, breaking down into 1.4 (95% CI: 0.9, 2.2) persons in the community, 0.4 (95% CI: 0.1, 0.9) in the hospital and 0.5 (95% CI: 0.2, 1.0) at funerals. Following implementation of infection control in April, the reproduction number in the hospital and at funerals reduced below 0.1. In the community, the reproduction number, which was positively correlated with patients viremia, dropped by 50% for hospitalized cases but remained unchanged for those not hospitalized. Hospital and funeral transmission represented 35% (7/20) and 15% (3/20) of all transmissions in March; but only 9% (11/128) and 4% (5/128) from April onward. Overall, 82% (119/145) of transmission occurred in the community and 72% (105/145) between family members. Simulations showed that a 10% increase in hospitalizations could have reduced the length of chains by 26% (95% CI: 4%, 45%). Interpretation Monitoring chains of transmission is critical to evaluate and optimize local control strategies for EVD. In Conakry, interventions had the potential to stop the epidemic but reintroductions of the disease and lack of cooperation of a small number of families led to prolonged low-level spread, highlighting challenges of EVD control in large urban centers. Funding Labex IBEID, Reacting, PREDEMICS, NIGMS MIDAS initiative, Institut Pasteur de Dakar. PMID:25619149
Investigation of and Response to 2 Plague Cases, Yosemite National Park, California, USA, 2015.
Danforth, Mary; Novak, Mark; Petersen, Jeannine; Mead, Paul; Kingry, Luke; Weinburke, Matthew; Buttke, Danielle; Hacker, Gregory; Tucker, James; Niemela, Michael; Jackson, Bryan; Padgett, Kerry; Liebman, Kelly; Vugia, Duc; Kramer, Vicki
2016-12-01
In August 2015, plague was diagnosed for 2 persons who had visited Yosemite National Park in California, USA. One case was septicemic and the other bubonic. Subsequent environmental investigation identified probable locations of exposure for each patient and evidence of epizootic plague in other areas of the park. Transmission of Yersinia pestis was detected by testing rodent serum, fleas, and rodent carcasses. The environmental investigation and whole-genome multilocus sequence typing of Y. pestis isolates from the patients and environmental samples indicated that the patients had been exposed in different locations and that at least 2 distinct strains of Y. pestis were circulating among vector-host populations in the area. Public education efforts and insecticide applications in select areas to control rodent fleas probably reduced the risk for plague transmission to park visitors and staff.
Continuous-variable quantum key distribution in uniform fast-fading channels
NASA Astrophysics Data System (ADS)
Papanastasiou, Panagiotis; Weedbrook, Christian; Pirandola, Stefano
2018-03-01
We investigate the performance of several continuous-variable quantum key distribution protocols in the presence of uniform fading channels. These are lossy channels whose transmissivity changes according to a uniform probability distribution. We assume the worst-case scenario where an eavesdropper induces a fast-fading process, where she chooses the instantaneous transmissivity while the remote parties may only detect the mean statistical effect. We analyze coherent-state protocols in various configurations, including the one-way switching protocol in reverse reconciliation, the measurement-device-independent protocol in the symmetric configuration, and its extension to a three-party network. We show that, regardless of the advantage given to the eavesdropper (control of the fading), these protocols can still achieve high rates under realistic attacks, within reasonable values for the variance of the probability distribution associated with the fading process.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lupinetti, F.
1988-01-01
This paper outlines a video communication system capable of non-line-of-sight (NLOS), secure, low-probability of intercept (LPI), antijam, real time transmission and reception of video information in a tactical enviroment. An introduction to a class of ternary PN sequences is presented to familiarize the reader with yet another avenue for spreading and despreading baseband information. The use of the high frequency (HF) band (1.5 to 30 MHz) for real time video transmission is suggested to allow NLOS communication. The spreading of the baseband information by means of multiple nontrivially different ternary pseudonoise (PN) sequence is used in order to assure encryptionmore » of the signal, enhanced security, a good degree of LPI, and good antijam features. 18 refs., 3 figs., 1 tab.« less
Investigation of and Response to 2 Plague Cases, Yosemite National Park, California, USA, 2015
Danforth, Mary; Novak, Mark; Petersen, Jeannine; Mead, Paul; Kingry, Luke; Weinburke, Matthew; Buttke, Danielle; Hacker, Gregory; Tucker, James; Niemela, Michael; Jackson, Bryan; Padgett, Kerry; Liebman, Kelly; Vugia, Duc
2016-01-01
In August 2015, plague was diagnosed for 2 persons who had visited Yosemite National Park in California, USA. One case was septicemic and the other bubonic. Subsequent environmental investigation identified probable locations of exposure for each patient and evidence of epizootic plague in other areas of the park. Transmission of Yersinia pestis was detected by testing rodent serum, fleas, and rodent carcasses. The environmental investigation and whole-genome multilocus sequence typing of Y. pestis isolates from the patients and environmental samples indicated that the patients had been exposed in different locations and that at least 2 distinct strains of Y. pestis were circulating among vector–host populations in the area. Public education efforts and insecticide applications in select areas to control rodent fleas probably reduced the risk for plague transmission to park visitors and staff. PMID:27870634
Probability theory for 3-layer remote sensing in ideal gas law environment.
Ben-David, Avishai; Davidson, Charles E
2013-08-26
We extend the probability model for 3-layer radiative transfer [Opt. Express 20, 10004 (2012)] to ideal gas conditions where a correlation exists between transmission and temperature of each of the 3 layers. The effect on the probability density function for the at-sensor radiances is surprisingly small, and thus the added complexity of addressing the correlation can be avoided. The small overall effect is due to (a) small perturbations by the correlation on variance population parameters and (b) cancellation of perturbation terms that appear with opposite signs in the model moment expressions.
Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor
2014-01-01
Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40–100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data. PMID:24415932
Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor
2014-01-01
Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40-100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data.
Proposal for a transmon-based quantum router.
Sala, Arnau; Blaauboer, M
2016-07-13
We propose an implementation of a quantum router for microwave photons in a superconducting qubit architecture consisting of a transmon qubit, SQUIDs and a nonlinear capacitor. We model and analyze the dynamics of operation of the quantum switch using quantum Langevin equations in a scattering approach and compute the photon reflection and transmission probabilities. For parameters corresponding to up-to-date experimental devices we predict successful operation of the router with probabilities above 94%.
Jullian-Desayes, Ingrid; Landelle, Caroline; Mallaret, Marie-Reine; Brun-Buisson, Christian; Barbut, Frédéric
2017-01-01
Clostridium difficile infection (CDI) can be transmitted from patient to patient by the hands of health care workers (HCWs); however, the relative importance of this route in the spread of C difficile in the hospital is currently unknown. Our aim was to review studies examining HCWs' hand carriage and its potential role in CDI transmission. First, English-speaking references addressing HCWs' hand sampling obtained from the PubMed database were reviewed. Second, C difficile outbreaks definitely or probably implicating HCWs were retrieved from the Outbreak Database Web site (www.outbreak-database.com). Finally, cases of C difficile occurring in HCWs after contact with an infected patient were retrieved from PubMed. A total of 11 studies dealing with HCWs' hand carriage were selected and reviewed. Between 0% and 59% of HCWs' hands were found contaminated with C difficile after caring for a patient with CDI. There were several differences between studies regarding site of hands sampling, timing after contact, and bacteriologic methods. Only 2 C difficile outbreaks implicating HCWs and 6 series of cases of transmission from patients to HCWs have been reported. This review shows that HCWs' hands could play an important role in the transmission of C difficile. Hand hygiene and reduction of environmental contamination are essential to control C difficile transmission. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Gene-culture coevolution in whales and dolphins.
Whitehead, Hal
2017-07-24
Whales and dolphins (Cetacea) have excellent social learning skills as well as a long and strong mother-calf bond. These features produce stable cultures, and, in some species, sympatric groups with different cultures. There is evidence and speculation that this cultural transmission of behavior has affected gene distributions. Culture seems to have driven killer whales into distinct ecotypes, which may be incipient species or subspecies. There are ecotype-specific signals of selection in functional genes that correspond to cultural foraging behavior and habitat use by the different ecotypes. The five species of whale with matrilineal social systems have remarkably low diversity of mtDNA. Cultural hitchhiking, the transmission of functionally neutral genes in parallel with selective cultural traits, is a plausible hypothesis for this low diversity, especially in sperm whales. In killer whales the ecotype divisions, together with founding bottlenecks, selection, and cultural hitchhiking, likely explain the low mtDNA diversity. Several cetacean species show habitat-specific distributions of mtDNA haplotypes, probably the result of mother-offspring cultural transmission of migration routes or destinations. In bottlenose dolphins, remarkable small-scale differences in haplotype distribution result from maternal cultural transmission of foraging methods, and large-scale redistributions of sperm whale cultural clans in the Pacific have likely changed mitochondrial genetic geography. With the acceleration of genomics new results should come fast, but understanding gene-culture coevolution will be hampered by the measured pace of research on the socio-cultural side of cetacean biology.
Gene–culture coevolution in whales and dolphins
Whitehead, Hal
2017-01-01
Whales and dolphins (Cetacea) have excellent social learning skills as well as a long and strong mother–calf bond. These features produce stable cultures, and, in some species, sympatric groups with different cultures. There is evidence and speculation that this cultural transmission of behavior has affected gene distributions. Culture seems to have driven killer whales into distinct ecotypes, which may be incipient species or subspecies. There are ecotype-specific signals of selection in functional genes that correspond to cultural foraging behavior and habitat use by the different ecotypes. The five species of whale with matrilineal social systems have remarkably low diversity of mtDNA. Cultural hitchhiking, the transmission of functionally neutral genes in parallel with selective cultural traits, is a plausible hypothesis for this low diversity, especially in sperm whales. In killer whales the ecotype divisions, together with founding bottlenecks, selection, and cultural hitchhiking, likely explain the low mtDNA diversity. Several cetacean species show habitat-specific distributions of mtDNA haplotypes, probably the result of mother–offspring cultural transmission of migration routes or destinations. In bottlenose dolphins, remarkable small-scale differences in haplotype distribution result from maternal cultural transmission of foraging methods, and large-scale redistributions of sperm whale cultural clans in the Pacific have likely changed mitochondrial genetic geography. With the acceleration of genomics new results should come fast, but understanding gene–culture coevolution will be hampered by the measured pace of research on the socio-cultural side of cetacean biology. PMID:28739936
The donor-acceptor approach allows a black-to-transmissive switching polymeric electrochrome
NASA Astrophysics Data System (ADS)
Beaujuge, P. M.; Ellinger, S.; Reynolds, J. R.
2008-10-01
In the context of the fast-growing demand for innovative high-performance display technologies, the perspective of manufacturing low-cost functional materials that can be easily processed over large areas or finely printed into individual pixels, while being mechanically deformable, has motivated the development of novel electronically active organic components fulfilling the requirements for flexible displays and portable applications. Among all technologies relying on a low-power stimulated optical change, non-emissive organic electrochromic devices (ECDs) offer the advantage of being operational under a wide range of viewing angles and lighting conditions spanning direct sunlight as desired for various applications including signage, information tags and electronic paper. Combining mechanical flexibility, high contrast ratios and fast response times, along with colour tunability through structural control, polymeric electrochromes constitute the most attractive organic electronics for tomorrow's reflective/transmissive ECDs and displays. Although red, blue and most recently green electrochromic polymers (ECPs) required for additive primary colour space were investigated, attempts to make saturated black ECPs have not been reported, probably owing to the complexity of designing materials absorbing effectively over the whole visible spectrum. Here, we report on the use of the donor-acceptor approach to make the first neutral-state black polymeric electrochrome. Processable black-to-transmissive ECPs promise to affect the development of both reflective and transmissive ECDs by providing lower fabrication and processing costs through printing, spraying and coating methods, along with good scalability when compared with their traditional inorganic counterparts.
NASA Technical Reports Server (NTRS)
Kiang, Richard K.; Adimi, Farida; Zollner, Gabriela E.; Coleman, Russell E.
2007-01-01
We have used discrete-event simulation to model the malaria transmission in a Thailand village with approximately 700 residents. Specifically, we model the detailed interactions among the vector life cycle, sporogonic cycle and human infection cycle under the explicit influences of selected extrinsic and intrinsic factors. Some of the meteorological and environmental parameters used in the simulation are derived from Tropical Rainfall Measuring Mission and the Ikonos satellite data. Parameters used in the simulations reflect the realistic condition of the village, including the locations and sizes of the households, ages and estimated immunity of the residents, presence of farm animals, and locations of larval habitats. Larval habitats include the actual locations where larvae were collected and the probable locations based on satellite data. The output of the simulation includes the individual infection status and the quantities normally observed in field studies, such as mosquito biting rates, sporozoite infection rates, gametocyte prevalence and incidence. Simulated transmission under homogeneous environmental condition was compared with that predicted by a SEIR model. Sensitivity of the output with respect to some extrinsic and intrinsic factors was investigated. Results were compared with mosquito vector and human malaria data acquired over 4.5 years (June 1999 - January 2004) in Kong Mong Tha, a remote village in Kanchanaburi Province, western Thailand. The simulation method is useful for testing transmission hypotheses, estimating the efficacy of insecticide applications, assessing the impacts of nonimmune immigrants, and predicting the effects of socioeconomic, environmental and climatic changes.
Chis Ster, Irina; Dodd, Peter J; Ferguson, Neil M
2012-08-01
This paper uses statistical and mathematical models to examine the potential impact of within-farm transmission dynamics on the spread of the 2001 foot and mouth disease (FMD) outbreak in Great Britain. We partly parameterize a simple within farm transmission model using data from experimental studies of FMD pathogenesis, embed this model within an existing between-farm transmission model, and then estimate unknown parameters (such as the species-specific within-farm reproduction number) from the 2001 epidemic case data using Markov Chain Monte-Carlo (MCMC) methods. If the probability of detecting an infected premises depends on farm size and species mix then the within-farm species specific basic reproduction ratios for baseline models are estimated to be 21 (16, 25) and 14 (10, 19) for cattle and sheep, respectively. Alternatively, if detection is independent of farm size, then the corresponding estimates are 49 (41, 61) and 10 (1.4, 21). Both model variants predict that the average fraction of total farm infectiousness accumulated prior to detection of infection on an IP is about 30-50% in cattle or mixed farms. The corresponding estimate for sheep farms depended more on the detection model, being 65-80% if detection was linked to the farms' characteristics, but only 25% if not. We highlighted evidence which reinforces the role of within-farm dynamics in contributing to the long tail of the 2001 epidemic. Copyright © 2012 Elsevier B.V. All rights reserved.
Bintz, Jason; Lenhart, Suzanne; Lanzas, Cristina
2017-01-01
We implement an agent-based model for Clostridium difficile transmission in hospitals that accounts for several processes and individual factors including environmental and antibiotic heterogeneity in order to evaluate the efficacy of various control measures aimed at reducing environmental contamination and mitigating the effects of antibiotic use on transmission. In particular, we account for local contamination levels that contribute to the probability of colonization and we account for both the number and type of antibiotic treatments given to patients. Simulations illustrate the relative efficacy of several strategies for the reduction of nosocomial colonizations and nosocomial diseases. PMID:27826877
Statistical performance evaluation of ECG transmission using wireless networks.
Shakhatreh, Walid; Gharaibeh, Khaled; Al-Zaben, Awad
2013-07-01
This paper presents simulation of the transmission of biomedical signals (using ECG signal as an example) over wireless networks. Investigation of the effect of channel impairments including SNR, pathloss exponent, path delay and network impairments such as packet loss probability; on the diagnosability of the received ECG signal are presented. The ECG signal is transmitted through a wireless network system composed of two communication protocols; an 802.15.4- ZigBee protocol and an 802.11b protocol. The performance of the transmission is evaluated using higher order statistics parameters such as kurtosis and Negative Entropy in addition to the common techniques such as the PRD, RMS and Cross Correlation.
Characteristics of white LED transmission through a smoke screen
NASA Astrophysics Data System (ADS)
Zheng, Yunfei; Yang, Aiying; Feng, Lihui; Guo, Peng
2018-01-01
The characteristics of white LED transmission through a smoke screen is critical for visible light communication through a smoke screen. Based on the Mie scattering theory, the Monte Carlo transmission model is established. Based on the probability density function, the white LED sampling model is established according to the measured spectrum of a white LED and the distribution angle of the lambert model. The sampling model of smoke screen particle diameter is also established according to its distribution. We simulate numerically the influence the smoke thickness, the smoke concentration and the angle of irradiance of white LED on transmittance of the white LED. We construct a white LED smoke transmission experiment system. The measured result on the light transmittance and the smoke concentration agreed with the simulated result, and demonstrated the validity of simulation model for visible light transmission channel through a smoke screen.
2010-03-01
uses all available resources in some optimized manner. By further exploiting the design flexibility and computational efficiency of Orthogonal Frequency...in the following sections. 3.2.1 Estimation of PU Signal Statistics. The Estimate PU Signal Statis- tics function of Fig 3.4 is used to compute the...consecutive PU transmissions, and 4) the probability of transitioning from one transmission state to another. These statistics are then used to compute the
Vitamin A supplements for reducing mother-to-child HIV transmission
Wiysonge, Charles S; Ndze, Valantine N; Kongnyuy, Eugene J; Shey, Muki S
2017-01-01
Background Strategies to reduce the risk of mother-to-child transmission of the human immunodeficiency virus (HIV) include lifelong antiretroviral therapy (ART) for HIV-positive women, exclusive breastfeeding from birth for six weeks plus nevirapine or replacement feeding plus nevirapine from birth for four to six weeks, elective Caesarean section delivery, and avoiding giving children chewed food. In some settings, these interventions may not be practical, feasible, or affordable. Simple, inexpensive, and effective interventions (that could potentially be implemented even in the absence of prenatal HIV testing programmes) would be valuable. Vitamin A, which plays a role in immune function, is one low-cost intervention that has been suggested in such settings. Objectives To summarize the effects of giving vitamin A supplements to HIV-positive women during pregnancy and after delivery. Search methods We searched the Cochrane Central Register of Controlled Trials (CENTRAL), PubMed, Embase, and the World Health Organization International Clinical Trials Registry Platform (WHO ICTRP) up to 25 August 2017, and checked the reference lists of relevant articles for eligible studies. Selection criteria We included randomized controlled trials conducted in any setting that compared vitamin A supplements to placebo or no intervention among HIV-positive women during pregnancy or after delivery, or both. Data collection and analysis At least two review authors independently assessed study eligibility and extracted data. We expressed study results as risk ratios (RR) or mean differences (MD) as appropriate, with their 95% confidence intervals (CI), and conducted random-effects meta-analyses. This is an update of a review last published in 2011. Main results Five trials met the inclusion criteria. These were conducted in Malawi, South Africa, Tanzania, and Zimbabwe between 1995 and 2005 and none of the participants received ART. Women allocated to intervention arms received vitamin A supplements at a variety of doses (daily during pregnancy; a single dose immediately after delivery, or daily doses during pregnancy plus a single dose after delivery). Women allocated to comparison arms received identical placebo (6601 women, 4 trials) or no intervention (697 women, 1 trial). Four trials (with 6995 women) had low risk of bias and one trial (with 303 women) had high risk of attrition bias. The trials show that giving vitamin A supplements to HIV-positive women during pregnancy, the immediate postpartum period, or both, probably has little or no effect on mother-to-child transmission of HIV (RR 1.07, 95% CI 0.91 to 1.26; 4428 women, 5 trials, moderate certainty evidence) and may have little or no effect on child death by two years of age (RR 1.06, 95% CI 0.92 to 1.22; 3883 women, 3 trials, low certainty evidence). However, giving vitamin A supplements during pregnancy may increase the mean birthweight (MD 34.12 g, 95% CI −12.79 to 81.02; 2181 women, 3 trials, low certainty evidence) and probably reduces the incidence of low birthweight (RR 0.78, 95% CI 0.63 to 0.97; 1819 women, 3 trials, moderate certainty evidence); but we do not know whether vitamin A supplements affect the risk of preterm delivery (1577 women, 2 trials), stillbirth (2335 women, 3 trials), or maternal death (1267 women, 2 trials). Authors' conclusions Antepartum or postpartum vitamin A supplementation, or both, probably has little or no effect on mother-to-child transmission of HIV in women living with HIV infection and not on antiretroviral drugs. The intervention has largely been superseded by ART which is widely available and effective in preventing vertical transmission. Vitamin A supplements for reducing mother-to-child transmission of HIV infection What is the aim of this review? The main aim of this Cochrane Review was to assess the effects of giving vitamin A supplements to HIV-positive women, during pregnancy or after delivery, or both, on the risk of mother-to-child transmission of HIV infection. Cochrane researchers collected and examined all relevant studies to answer this question and included five trials. This is an update of a review last published in 2011. What is the key message of this review? Giving vitamin A supplements to HIV-positive women, during pregnancy or after delivery, or both, probably makes little or no difference to the risk of mother-to-child transmission of HIV (moderate certainty evidence). What are the main results of the review? Five trials met the inclusion criteria of the review. Two trials were from South Africa and one trial each from Malawi, Tanzania, and Zimbabwe. The trials compared women receiving vitamin A supplements to women not receiving such supplements. None of the participants received antiretroviral therapy (ART). The review shows that in women living with HIV infection and not on ART: - giving vitamin A supplements to HIV-positive women during pregnancy, immediately after delivery, or both, probably has little or no effect on the risk of mother-to-child transmission of HIV (moderate certainty evidence) and may have little or no effect on child death by two years of age (low certainty evidence); - giving vitamin A supplements to HIV-positive women during pregnancy may increase the mean birthweight (low certainty evidence) and probably reduces the number of low birthweight babies (moderate certainty evidence), but it is uncertain whether the intervention has an effect on the number of preterm births, stillbirths, or deaths among the women (very low certainty evidence). The intervention has largely been superseded by ART, which is widely available and effective in preventing mother-to-child transmission of HIV. How up-to-date is this review? The review authors searched for studies up to 25 August 2017. PMID:28880995
NASA Astrophysics Data System (ADS)
Wieczorek, Andrzej N.; Kruk, Radosław
2016-03-01
In correctly functioning maintenance systems it is most important to prevent possible failures. A reduction of the vibroacoustic effects accompanying the operation of machines and equipment, including transmissions, is among the factors that lower the probability of a failure. The paper presents the results of the research on the impact of operational factors on vibroacoustic conditions of transmissions. The factors covered by the analysis included a change in the mating conditions of gear wheels associated with the wear of tooth surfaces, operation of transmissions in subharmonic conditions of the main resonance and the temperature of the lubricating oil. The study demonstrated that it was possible to reduce the vibroacoustic effects generated by gear transmissions by changing the conditions of their operation. Based on the results obtained, it has been found that the operation of gear transmissions in accordance with the sustainable development principles requires technical services to take active measures consisting in the search for optimal operating conditions in terms of the vibroacoustic conditions.
Effect of advanced component technology on helicopter transmissions
NASA Technical Reports Server (NTRS)
Lewicki, David G.; Townsend, Dennis P.
1989-01-01
Experimental tests were performed on the NASA/Bell Helicopter Textron (BHT) 500 hp advanced technology transmission (ATT) at the NASA Lewis Research Center. The ATT was a retrofit of the OH-58C helicopter 236 kW (317 hp) main rotor transmission, upgraded to 373 kW (500 hp), with a design goal of retaining long life with a minimum increase in cost, weight, and size. Vibration, strain, efficiency, deflection, and temperature experiments were performed and the results were compared to previous experiments on the OH-58A, OH-58C, and UH-60A transmissions. The high-contact-ratio gears and the cantilevered-mounted, flexible ring gear of the ATT reduced vibration compared to that of the OH-58C. The ATT flexible ring gear improved planetary load sharing compared to that of the rigid ring gear of the UH-60A transmission. The ATT mechanical efficiency was lower than that of the OH-58A transmission, probably due to the high-contact-ratio planetary gears.
Force Transmission Modes of Non-Cohesive and Cohesive Materials at the Critical State.
Wang, Ji-Peng
2017-08-31
This paper investigates the force transmission modes, mainly described by probability density distributions, in non-cohesive dry and cohesive wet granular materials by discrete element modeling. The critical state force transmission patterns are focused on with the contact model effect being analyzed. By shearing relatively dense and loose dry specimens to the critical state in the conventional triaxial loading path, it is observed that there is a unique critical state force transmission mode. There is a universe critical state force distribution pattern for both the normal contact forces and tangential contact forces. Furthermore, it is found that using either the linear Hooke or the non-linear Hertz model does not affect the universe force transmission mode, and it is only related to the grain size distribution. Wet granular materials are also simulated by incorporating a water bridge model. Dense and loose wet granular materials are tested, and the critical state behavior for the wet material is also observed. The critical state strength and void ratio of wet granular materials are higher than those of a non-cohesive material. The critical state inter-particle distribution is altered from that of a non-cohesive material with higher probability in relatively weak forces. Grains in non-cohesive materials are under compressive stresses, and their principal directions are mainly in the axial loading direction. However, for cohesive wet granular materials, some particles are in tension, and the tensile stresses are in the horizontal direction on which the confinement is applied. The additional confinement by the tensile stress explains the macro strength and dilatancy increase in wet samples.
Force Transmission Modes of Non-Cohesive and Cohesive Materials at the Critical State
2017-01-01
This paper investigates the force transmission modes, mainly described by probability density distributions, in non-cohesive dry and cohesive wet granular materials by discrete element modeling. The critical state force transmission patterns are focused on with the contact model effect being analyzed. By shearing relatively dense and loose dry specimens to the critical state in the conventional triaxial loading path, it is observed that there is a unique critical state force transmission mode. There is a universe critical state force distribution pattern for both the normal contact forces and tangential contact forces. Furthermore, it is found that using either the linear Hooke or the non-linear Hertz model does not affect the universe force transmission mode, and it is only related to the grain size distribution. Wet granular materials are also simulated by incorporating a water bridge model. Dense and loose wet granular materials are tested, and the critical state behavior for the wet material is also observed. The critical state strength and void ratio of wet granular materials are higher than those of a non-cohesive material. The critical state inter-particle distribution is altered from that of a non-cohesive material with higher probability in relatively weak forces. Grains in non-cohesive materials are under compressive stresses, and their principal directions are mainly in the axial loading direction. However, for cohesive wet granular materials, some particles are in tension, and the tensile stresses are in the horizontal direction on which the confinement is applied. The additional confinement by the tensile stress explains the macro strength and dilatancy increase in wet samples. PMID:28858238
Short-sighted evolution of virulence in parasitic honeybee workers ( Apis mellifera capensis Esch.)
NASA Astrophysics Data System (ADS)
Moritz, Robin F. A.; Pirk, Christian W. W.; Hepburn, H. Randall; Neumann, Peter
2008-06-01
The short-sighted selection hypothesis for parasite virulence predicts that winners of within-host competition are poorer at transmission to new hosts. Social parasitism by self-replicating, female-producing workers occurs in the Cape honeybee Apis mellifera capensis, and colonies of other honeybee subspecies are susceptible hosts. We found high within-host virulence but low transmission rates in a clone of social parasitic A. m. capensis workers invading the neighbouring subspecies A. m. scutellata. In contrast, parasitic workers from the endemic range of A. m. capensis showed low within-host virulence but high transmission rates. This suggests a short-sighted selection scenario for the host-parasite co-evolution in the invasive range of the Cape honeybee, probably facilitated by beekeeping-assisted parasite transmission in apiaries.
Adaptive decoding of convolutional codes
NASA Astrophysics Data System (ADS)
Hueske, K.; Geldmacher, J.; Götze, J.
2007-06-01
Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.
[Brazilian psychosocial and operational research vis-à-vis the UNGASS targets].
Bastos, Francisco Inácio; Hacker, Mariana A
2006-04-01
Items from the UNGASS Draft Declaration of Commitment on HIV/AIDS (2001) are analyzed. The Brazilian experience of new methods for testing and counseling among vulnerable populations, preventive methods controlled by women, prevention, psychosocial support for people living with HIV/AIDS, and mother-child transmission, is discussed. These items were put into operation in the form of keywords, in systematic searches within the standard biomedicine databases, also including the subdivisions of the Web of Science relating to natural and social sciences. The Brazilian experience relating to testing and counseling strategies has been consolidated through the utilization of algorithms aimed at estimating incidence rates and identifying recently infected individuals, testing and counseling for pregnant women, and application of quick tests. The introduction of alternative methods and new technologies for collecting data from vulnerable populations has been allowing speedy monitoring of the epidemic. Psychosocial support assessments for people living with HIV/AIDS have gained impetus in Brazil, probably as a result of increased survival and quality of life among these individuals. Substantial advances in controlling mother-child transmission have been observed. This is one of the most important victories within the field of HIV/AIDS in Brazil, but deficiencies in prenatal care still constitute a challenge. With regard to prevention methods for women, Brazil has only shown a halting response. Widespread implementation of new technologies for data gathering and management depends on investments in infrastructure and professional skills acquisition.
Properties of plastic tapes for cryogenic power cable insulation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muller, A C
1978-01-01
A superconducting ac power transmission cable is under development at Brookhaven National Laboratory (BNL). This project was undertaken in 1972 in response to growing national power requirements. The goal of this program is to develop an underground power transmission system suitable for transferring bulk quantities of electricity over distances of 16 to 160 km. Both the capital investment and operating costs must be low enough to make the system attractive to the electric utilities. The superconducting cable shares the advantages with conventional underground cables of needing only a few feet of right-of-way width rather than the large tracts of increasinglymore » expensive land required for conventional aerial transmission. Recent cost analysis studies show that superconducting cables, although more expensive than aerial transmission, will probably be competitive with other methods of underground transmission at loads greater than 2000 MVA. Initial design studies showed that a flexible, forced-cooled cable offered the best combination of technical and economic features. A helium cooled cable with Nb/sub 3/Sn superconductor was chosen as the BNL design. The present goal of the BNL program is the construction of a 100 meter outdoor three-phase ac cable rated at 138 kV and 1000 MVA. The refrigerator and the 100 m-long dewar are already installed. Terminations and cables are under design, and it is planned to begin installation of the first single phase cable in 1979. If the results on this model show promise for eventual commercial use, cables of higher voltage and power rating will be developed. One fundamental phase of this project; the development of the required insulating materials, is described.« less
Behavioral connectivity among bighorn sheep suggests potential for disease spread
Borg, Nathan J.; Mitchell, Michael S.; Lukacs, Paul M.; Mack, Curt M.; Waits, Lisette P.; Krausman, Paul R.
2017-01-01
Connectivity is important for population persistence and can reduce the potential for inbreeding depression. Connectivity between populations can also facilitate disease transmission; respiratory diseases are one of the most important factors affecting populations of bighorn sheep (Ovis canadensis). The mechanisms of connectivity in populations of bighorn sheep likely have implications for spread of disease, but the behaviors leading to connectivity between bighorn sheep groups are not well understood. From 2007–2012, we radio-collared and monitored 56 bighorn sheep in the Salmon River canyon in central Idaho. We used cluster analysis to define social groups of bighorn sheep and then estimated connectivity between these groups using a multi-state mark-recapture model. Social groups of bighorn sheep were spatially segregated and linearly distributed along the Salmon River canyon. Monthly probabilities of movement between adjacent male and female groups ranged from 0.08 (±0.004 SE) to 0.76 (±0.068) for males and 0.05 (±0.132) to 0.24 (±0.034) for females. Movements of males were extensive and probabilities of movement were considerably higher during the rut. Probabilities of movement for females were typically smaller than those of males and did not change seasonally. Whereas adjacent groups of bighorn sheep along the Salmon River canyon were well connected, connectivity between groups north and south of the Salmon River was limited. The novel application of a multi-state model to a population of bighorn sheep allowed us to estimate the probability of movement between adjacent social groups and approximate the level of connectivity across the population. Our results suggest high movement rates of males during the rut are the most likely to result in transmission of pathogens among both male and female groups. Potential for disease spread among female groups was smaller but non-trivial. Land managers can plan grazing of domestic sheep for spring and summer months when males are relatively inactive. Removal or quarantine of social groups may reduce probability of disease transmission in populations of bighorn sheep consisting of linearly distributed social groups.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wen, Zhigang, E-mail: xh168688@126.com; State Key Laboratory of Powder Metallurgy, Central South University, Changsha 410083; Department of Chemistry and Chemical Engineering, Qiannan Normal College for Nationalities, Duyun 558000
SnO{sub 2} nanorod bundles were synthesized by hydrothermal method. Field-emission scanning electron microscopy and transmission electron microscopy images showed that the as-prepared flowerlike SnO{sub 2} nanorod bundles consist of tetragonal nanorods with size readily tunable. Their electrochemical properties and application as anode for lithium-ion battery were evaluated by galvanostatic discharge–charge testing and cycle voltammetry. SnO{sub 2} nanorod flowers possess improved discharge capacity of 694 mA h g{sup −1} up to 40th cycle at 0.1 C. - Highlights: ► The flowerlike SnO{sub 2} nanorod bundles were synthesized by hydrothermal method. ► SnO{sub 2} nanorod bundles with tunable size by controlling concentrationmore » of SnCl{sub 4}. ► A probable formation mechanism of SnO{sub 2} nanorod bundles has been proposed.« less
Carbajo, Aníbal E; Vera, Carolina; González, Paula LM
2009-01-01
Background Oligoryzomys longicaudatus (colilargo) is the rodent responsible for hantavirus pulmonary syndrome (HPS) in Argentine Patagonia. In past decades (1967–1998), trends of precipitation reduction and surface air temperature increase have been observed in western Patagonia. We explore how the potential distribution of the hantavirus reservoir would change under different climate change scenarios based on the observed trends. Methods Four scenarios of potential climate change were constructed using temperature and precipitation changes observed in Argentine Patagonia between 1967 and 1998: Scenario 1 assumed no change in precipitation but a temperature trend as observed; scenario 2 assumed no changes in temperature but a precipitation trend as observed; Scenario 3 included changes in both temperature and precipitation trends as observed; Scenario 4 assumed changes in both temperature and precipitation trends as observed but doubled. We used a validated spatial distribution model of O. longicaudatus as a function of temperature and precipitation. From the model probability of the rodent presence was calculated for each scenario. Results If changes in precipitation follow previous trends, the probability of the colilargo presence would fall in the HPS transmission zone of northern Patagonia. If temperature and precipitation trends remain at current levels for 60 years or double in the future 30 years, the probability of the rodent presence and the associated total area of potential distribution would diminish throughout Patagonia; the areas of potential distribution for colilargos would shift eastwards. These results suggest that future changes in Patagonia climate may lower transmission risk through a reduction in the potential distribution of the rodent reservoir. Conclusion According to our model the rates of temperature and precipitation changes observed between 1967 and 1998 may produce significant changes in the rodent distribution in an equivalent period of time only in certain areas. Given that changes maintain for 60 years or double in 30 years, the hantavirus reservoir Oligoryzomys longicaudatus may contract its distribution in Argentine Patagonia extensively. PMID:19607707
Jacob, C; Viet, A F
2003-03-01
This paper covers the elaboration of a general class of multitype branching processes for modeling in a branching population, the evolution of a disease with horizontal and vertical transmissions. When the size of the population may tend to infinity, normalization must be carried out. As the initial size tends to infinity, the normalized model converges a.s. to a dynamical system the solution of which is the probability law of the state of health for an individual ancestors line. The focal point of this study concerns the transient and asymptotical behaviors of a SIS model with two age classes in a branching population. We will compare the asymptotical probability of extinction on the scale of a finite population and on the scale of an individual in an infinite population: when the rates of transmission are small compared to the rate of renewing the population of susceptibles, the two models lead to a.s. extinction, giving consistent results, which no longer applies to the opposite situation of important transmissions. In that case the size of the population plays a crucial role in the spreading of the disease.
Modulation/demodulation techniques for satellite communications. Part 1: Background
NASA Technical Reports Server (NTRS)
Omura, J. K.; Simon, M. K.
1981-01-01
Basic characteristics of digital data transmission systems described include the physical communication links, the notion of bandwidth, FCC regulations, and performance measurements such as bit rates, bit error probabilities, throughputs, and delays. The error probability performance and spectral characteristics of various modulation/demodulation techniques commonly used or proposed for use in radio and satellite communication links are summarized. Forward error correction with block or convolutional codes is also discussed along with the important coding parameter, channel cutoff rate.
Dolan, Marc C; Breuner, Nicole E; Hojgaard, Andrias; Boegler, Karen A; Hoxmeier, J Charles; Replogle, Adam J; Eisen, Lars
2017-09-01
The recently recognized Lyme disease spirochete, Borrelia mayonii, has been detected in host-seeking Ixodes scapularis Say ticks and is associated with human disease in the Upper Midwest. Although experimentally shown to be vector competent, studies have been lacking to determine the duration of time from attachment of a single B. mayonii-infected I. scapularis nymph to transmission of spirochetes to a host. If B. mayonii spirochetes were found to be transmitted within the first 24 h after tick attachment, in contrast to Borrelia burgdorferi spirochetes (>24 h), then current recommendations for tick checks and prompt tick removal as a way to prevent transmission of Lyme disease spirochetes would need to be amended. We therefore conducted a study to determine the probability of transmission of B. mayonii spirochetes from single infected nymphal I. scapularis ticks to susceptible experimental mouse hosts at three time points postattachment (24, 48, and 72 h) and for a complete feed (>72-96 h). No evidence of infection with or exposure to B. mayonii occurred in mice that were fed upon by a single infected nymph for 24 or 48 h. The probability of transmission by a single infected nymphal tick was 31% after 72 h of attachment and 57% for a complete feed. In addition, due to unintended simultaneous feeding upon some mice by two B. mayonii-infected nymphs, we recorded a single occasion in which feeding for 48 h by two infected nymphs resulted in transmission and viable infection in the mouse. We conclude that the duration of attachment of a single infected nymphal I. scapularis tick required for transmission of B. mayonii appears to be similar to that for B. burgdorferi: transmission is minimal for the first 24 h of attachment, rare up to 48 h, but then increases distinctly by 72 h postattachment. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by US Government employees and is in the public domain in the US.
Heym, Eva C; Kampen, Helge; Walther, Doreen
2018-06-01
Due to their large diversity of potential blood hosts, breeding habitats, and resting sites, zoological gardens represent highly interesting places to study mosquito ecology. In order to better assess the risk of mosquito-borne disease-agent transmission in zoos, potential vector species must be known, as well as the communities in which they occur. For this reason, species composition and dynamics were examined in 2016 in two zoological gardens in Germany. Using different methods for mosquito sampling, a total of 2,257 specimens belonging to 20 taxa were collected. Species spectra depended on the collection method but generally differed between the two zoos, while species compositions and relative abundances varied seasonally in both of them. As both sampled zoos were located in the same climatic region and potential breeding sites within the zoos were similar, the differences in mosquito compositions are attributed to immigration of specimens from surrounding landscapes, although the different sizes of the zoos and the different blood host populations available probably also have an impact. Based on the differences in species composition and the various biological characteristics of the species, the risk of certain pathogens to be transmitted must also be expected to differ between the zoos. © 2018 The Society for Vector Ecology.
in silico Surveillance: evaluating outbreak detection with simulation models
2013-01-01
Background Detecting outbreaks is a crucial task for public health officials, yet gaps remain in the systematic evaluation of outbreak detection protocols. The authors’ objectives were to design, implement, and test a flexible methodology for generating detailed synthetic surveillance data that provides realistic geographical and temporal clustering of cases and use to evaluate outbreak detection protocols. Methods A detailed representation of the Boston area was constructed, based on data about individuals, locations, and activity patterns. Influenza-like illness (ILI) transmission was simulated, producing 100 years of in silico ILI data. Six different surveillance systems were designed and developed using gathered cases from the simulated disease data. Performance was measured by inserting test outbreaks into the surveillance streams and analyzing the likelihood and timeliness of detection. Results Detection of outbreaks varied from 21% to 95%. Increased coverage did not linearly improve detection probability for all surveillance systems. Relaxing the decision threshold for signaling outbreaks greatly increased false-positives, improved outbreak detection slightly, and led to earlier outbreak detection. Conclusions Geographical distribution can be more important than coverage level. Detailed simulations of infectious disease transmission can be configured to represent nearly any conceivable scenario. They are a powerful tool for evaluating the performance of surveillance systems and methods used for outbreak detection. PMID:23343523
Carne, Charlotte; Semple, Stuart; Morrogh-Bernard, Helen; Zuberbühler, Klaus; Lehmann, Julia
2014-01-01
All great ape species are endangered, and infectious diseases are thought to pose a particular threat to their survival. As great ape species vary substantially in social organisation and gregariousness, there are likely to be differences in susceptibility to disease types and spread. Understanding the relation between social variables and disease is therefore crucial for implementing effective conservation measures. Here, we simulate the transmission of a range of diseases in a population of orang-utans in Sabangau Forest (Central Kalimantan) and a community of chimpanzees in Budongo Forest (Uganda), by systematically varying transmission likelihood and probability of subsequent recovery. Both species have fission-fusion social systems, but differ considerably in their level of gregariousness. We used long-term behavioural data to create networks of association patterns on which the spread of different diseases was simulated. We found that chimpanzees were generally far more susceptible to the spread of diseases than orang-utans. When simulating different diseases that varied widely in their probability of transmission and recovery, it was found that the chimpanzee community was widely and strongly affected, while in orang-utans even highly infectious diseases had limited spread. Furthermore, when comparing the observed association network with a mean-field network (equal contact probability between group members), we found no major difference in simulated disease spread, suggesting that patterns of social bonding in orang-utans are not an important determinant of susceptibility to disease. In chimpanzees, the predicted size of the epidemic was smaller on the actual association network than on the mean-field network, indicating that patterns of social bonding have important effects on susceptibility to disease. We conclude that social networks are a potentially powerful tool to model the risk of disease transmission in great apes, and that chimpanzees are particularly threatened by infectious disease outbreaks as a result of their social structure.
Carne, Charlotte; Semple, Stuart; Morrogh-Bernard, Helen; Zuberbühler, Klaus; Lehmann, Julia
2014-01-01
All great ape species are endangered, and infectious diseases are thought to pose a particular threat to their survival. As great ape species vary substantially in social organisation and gregariousness, there are likely to be differences in susceptibility to disease types and spread. Understanding the relation between social variables and disease is therefore crucial for implementing effective conservation measures. Here, we simulate the transmission of a range of diseases in a population of orang-utans in Sabangau Forest (Central Kalimantan) and a community of chimpanzees in Budongo Forest (Uganda), by systematically varying transmission likelihood and probability of subsequent recovery. Both species have fission-fusion social systems, but differ considerably in their level of gregariousness. We used long-term behavioural data to create networks of association patterns on which the spread of different diseases was simulated. We found that chimpanzees were generally far more susceptible to the spread of diseases than orang-utans. When simulating different diseases that varied widely in their probability of transmission and recovery, it was found that the chimpanzee community was widely and strongly affected, while in orang-utans even highly infectious diseases had limited spread. Furthermore, when comparing the observed association network with a mean-field network (equal contact probability between group members), we found no major difference in simulated disease spread, suggesting that patterns of social bonding in orang-utans are not an important determinant of susceptibility to disease. In chimpanzees, the predicted size of the epidemic was smaller on the actual association network than on the mean-field network, indicating that patterns of social bonding have important effects on susceptibility to disease. We conclude that social networks are a potentially powerful tool to model the risk of disease transmission in great apes, and that chimpanzees are particularly threatened by infectious disease outbreaks as a result of their social structure. PMID:24740263
No Trend in the Intergenerational Transmission of Divorce
LI, JUI-CHUNG ALLEN; WU, LAWRENCE L.
2008-01-01
Previous studies on trends in the intergenerational transmission of divorce have produced mixed findings, with two studies (McLanahan and Bumpass 1988; Teachman 2002) reporting no trend in divorce transmission and one study (Wolfinger 1999) finding that divorce transmission has weakened substantially. Using a stratified Cox proportional hazard model, we analyze data from the National Survey of Families and Households and find no evidence for any trend in divorce transmission. To reconcile apparent differences in results, we note that the General Social Survey data used by Wolfinger lack information on marital duration, permitting analysis only for whether respondents have divorced by interview. As a result, an apparent decline in divorce transmission could be due to inadequate adjustments for the longer exposures to risk by earlier marriage cohorts, yielding a higher probability of divorce by interview for earlier cohorts relative to more recent cohorts even if divorce risks are identical across all marriage cohorts. We confirm this possibility by using a series of discrete-time hazard logistic regressions to investigate the sensitivity of estimates of trends in divorce transmission to different adjustments for exposure to risk. We conclude that there has been no trend in the intergenerational transmission of divorce. PMID:19110902
Counterfactuality of ‘counterfactual’ communication
NASA Astrophysics Data System (ADS)
Vaidman, L.
2015-11-01
The counterfactuality of the recently proposed protocols for direct quantum communication is analyzed. It is argued that the protocols can be counterfactual only for one value of the transmitted bit. The protocols achieve a reduced probability of detection of the particle in the transmission channel by increasing the number of paths in the channel. However, this probability is not lower than the probability of detecting a particle actually passing through such a multi-path channel, which was found to be surprisingly small. The relation between security and counterfactuality of the protocols is discussed. An analysis of counterfactuality of the protocols in the framework of the Bohmian interpretation is performed.
Williams, David M; Dechen Quinn, Amy C; Porter, William F
2014-01-01
Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05-0.14), to low levels post-parturition through summer (0.00-0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m-7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response.
Nasir, Hina; Javaid, Nadeem; Sher, Muhammad; Qasim, Umar; Khan, Zahoor Ali; Alrajeh, Nabil; Niaz, Iftikhar Azim
2016-01-01
This paper embeds a bi-fold contribution for Underwater Wireless Sensor Networks (UWSNs); performance analysis of incremental relaying in terms of outage and error probability, and based on the analysis proposition of two new cooperative routing protocols. Subject to the first contribution, a three step procedure is carried out; a system model is presented, the number of available relays are determined, and based on cooperative incremental retransmission methodology, closed-form expressions for outage and error probability are derived. Subject to the second contribution, Adaptive Cooperation in Energy (ACE) efficient depth based routing and Enhanced-ACE (E-ACE) are presented. In the proposed model, feedback mechanism indicates success or failure of data transmission. If direct transmission is successful, there is no need for relaying by cooperative relay nodes. In case of failure, all the available relays retransmit the data one by one till the desired signal quality is achieved at destination. Simulation results show that the ACE and E-ACE significantly improves network performance, i.e., throughput, when compared with other incremental relaying protocols like Cooperative Automatic Repeat reQuest (CARQ). E-ACE and ACE achieve 69% and 63% more throughput respectively as compared to CARQ in hard underwater environment. PMID:27420061
Finding the probability of infection in an SIR network is NP-Hard
Shapiro, Michael; Delgado-Eckert, Edgar
2012-01-01
It is the purpose of this article to review results that have long been known to communications network engineers and have direct application to epidemiology on networks. A common approach in epidemiology is to study the transmission of a disease in a population where each individual is initially susceptible (S), may become infective (I) and then removed or recovered (R) and plays no further epidemiological role. Much of the recent work gives explicit consideration to the network of social interactions or disease-transmitting contacts and attendant probability of transmission for each interacting pair. The state of such a network is an assignment of the values {S, I, R} to its members. Given such a network, an initial state and a particular susceptible individual, we would like to compute their probability of becoming infected in the course of an epidemic. It turns out that this and related problems are NP-hard. In particular, it belongs in a class of problems for which no efficient algorithms for their solution are known. Moreover, finding an efficient algorithm for the solution of any problem in this class would entail a major breakthrough in theoretical computer science. PMID:22824138
Causality in time-neutral cosmologies
NASA Astrophysics Data System (ADS)
Kent, Adrian
1999-02-01
Gell-Mann and Hartle (GMH) have recently considered time-neutral cosmological models in which the initial and final conditions are independently specified, and several authors have investigated experimental tests of such models. We point out here that GMH time-neutral models can allow superluminal signaling, in the sense that it can be possible for observers in those cosmologies, by detecting and exploiting regularities in the final state, to construct devices which send and receive signals between space-like separated points. In suitable cosmologies, any single superluminal message can be transmitted with probability arbitrarily close to one by the use of redundant signals. However, the outcome probabilities of quantum measurements generally depend on precisely which past and future measurements take place. As the transmission of any signal relies on quantum measurements, its transmission probability is similarly context dependent. As a result, the standard superluminal signaling paradoxes do not apply. Despite their unusual features, the models are internally consistent. These results illustrate an interesting conceptual point. The standard view of Minkowski causality is not an absolutely indispensable part of the mathematical formalism of relativistic quantum theory. It is contingent on the empirical observation that naturally occurring ensembles can be naturally pre-selected but not post-selected.
Potter, Gail E; Smieszek, Timo; Sailer, Kerstin
2015-09-01
Face-to-face social contacts are potentially important transmission routes for acute respiratory infections, and understanding the contact network can improve our ability to predict, contain, and control epidemics. Although workplaces are important settings for infectious disease transmission, few studies have collected workplace contact data and estimated workplace contact networks. We use contact diaries, architectural distance measures, and institutional structures to estimate social contact networks within a Swiss research institute. Some contact reports were inconsistent, indicating reporting errors. We adjust for this with a latent variable model, jointly estimating the true (unobserved) network of contacts and duration-specific reporting probabilities. We find that contact probability decreases with distance, and that research group membership, role, and shared projects are strongly predictive of contact patterns. Estimated reporting probabilities were low only for 0-5 min contacts. Adjusting for reporting error changed the estimate of the duration distribution, but did not change the estimates of covariate effects and had little effect on epidemic predictions. Our epidemic simulation study indicates that inclusion of network structure based on architectural and organizational structure data can improve the accuracy of epidemic forecasting models.
Potter, Gail E.; Smieszek, Timo; Sailer, Kerstin
2015-01-01
Face-to-face social contacts are potentially important transmission routes for acute respiratory infections, and understanding the contact network can improve our ability to predict, contain, and control epidemics. Although workplaces are important settings for infectious disease transmission, few studies have collected workplace contact data and estimated workplace contact networks. We use contact diaries, architectural distance measures, and institutional structures to estimate social contact networks within a Swiss research institute. Some contact reports were inconsistent, indicating reporting errors. We adjust for this with a latent variable model, jointly estimating the true (unobserved) network of contacts and duration-specific reporting probabilities. We find that contact probability decreases with distance, and that research group membership, role, and shared projects are strongly predictive of contact patterns. Estimated reporting probabilities were low only for 0–5 min contacts. Adjusting for reporting error changed the estimate of the duration distribution, but did not change the estimates of covariate effects and had little effect on epidemic predictions. Our epidemic simulation study indicates that inclusion of network structure based on architectural and organizational structure data can improve the accuracy of epidemic forecasting models. PMID:26634122
Stern, Shani; Biron, David; Moses, Elisha
2016-07-11
Down syndrome incidence in humans increases dramatically with maternal age. This is mainly the result of increased meiotic errors, but factors such as differences in abortion rate may play a role as well. Since the meiotic error rate increases almost exponentially after a certain age, its contribution to the overall incidence aneuploidy may mask the contribution of other processes. To focus on such selection mechanisms we investigated transmission in trisomic females, using data from mouse models and from Down syndrome humans. In trisomic females the a-priori probability for trisomy is independent of meiotic errors and thus approximately constant in the early embryo. Despite this, the rate of transmission of the extra chromosome decreases with age in females of the Ts65Dn and, as we show, for the Tc1 mouse models for Down syndrome. Evaluating progeny of 73 Tc1 births and 112 Ts65Dn births from females aged 130 days to 250 days old showed that both models exhibit a 3-fold reduction of the probability to transmit the trisomy with increased maternal ageing. This is concurrent with a 2-fold reduction of litter size with maternal ageing. Furthermore, analysis of previously reported 30 births in Down syndrome women shows a similar tendency with an almost three fold reduction in the probability to have a Down syndrome child between a 20 and 30 years old Down syndrome woman. In the two types of mice models for Down syndrome that were used for this study, and in human Down syndrome, older females have significantly lower probability to transmit the trisomy to the offspring. Our findings, taken together with previous reports of decreased supportive environment of the older uterus, add support to the notion that an older uterus negatively selects the less fit trisomic embryos.
Deterministic and stochastic CTMC models from Zika disease transmission
NASA Astrophysics Data System (ADS)
Zevika, Mona; Soewono, Edy
2018-03-01
Zika infection is one of the most important mosquito-borne diseases in the world. Zika virus (ZIKV) is transmitted by many Aedes-type mosquitoes including Aedes aegypti. Pregnant women with the Zika virus are at risk of having a fetus or infant with a congenital defect and suffering from microcephaly. Here, we formulate a Zika disease transmission model using two approaches, a deterministic model and a continuous-time Markov chain stochastic model. The basic reproduction ratio is constructed from a deterministic model. Meanwhile, the CTMC stochastic model yields an estimate of the probability of extinction and outbreaks of Zika disease. Dynamical simulations and analysis of the disease transmission are shown for the deterministic and stochastic models.
RAPTOR Transmissivity and Cloud Climatology Study. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eis, K.E.; Vonder Haar, T.H.; Forsythe, J.
1993-01-01
The RAPTOR Transmissivity Study (RTS) was funded by Lawrence Livermore National Laboratory (LLNL) under a sub contract to support the U.S. Army`s RAPTOR program. The intent of the study is to answer two questions: (1) What are the typical transmission levels of clouds as a function of target altitude for two locations and wavelengths of interest? (2) What is the probability that a cloud will intervene between sensor and target for a given target altitude, range, wavelength and location? This was addressed for Iraq and Korea. Answers to both questions are treated using existing software and data sources where possiblemore » due to the limited funding and scope of the contract.« less
Streicker, Daniel G.; Fischer, Justin W.; VerCauteren, Kurt C.; Gilbert, Amy T.
2017-01-01
Background Prevention and control of wildlife disease invasions relies on the ability to predict spatio-temporal dynamics and understand the role of factors driving spread rates, such as seasonality and transmission distance. Passive disease surveillance (i.e., case reports by public) is a common method of monitoring emergence of wildlife diseases, but can be challenging to interpret due to spatial biases and limitations in data quantity and quality. Methodology/Principal findings We obtained passive rabies surveillance data from dead striped skunks (Mephitis mephitis) in an epizootic in northern Colorado, USA. We developed a dynamic patch-occupancy model which predicts spatio-temporal spreading while accounting for heterogeneous sampling. We estimated the distance travelled per transmission event, direction of invasion, rate of spatial spread, and effects of infection density and season. We also estimated mean transmission distance and rates of spatial spread using a phylogeographic approach on a subsample of viral sequences from the same epizootic. Both the occupancy and phylogeographic approaches predicted similar rates of spatio-temporal spread. Estimated mean transmission distances were 2.3 km (95% Highest Posterior Density (HPD95): 0.02, 11.9; phylogeographic) and 3.9 km (95% credible intervals (CI95): 1.4, 11.3; occupancy). Estimated rates of spatial spread in km/year were: 29.8 (HPD95: 20.8, 39.8; phylogeographic, branch velocity, homogenous model), 22.6 (HPD95: 15.3, 29.7; phylogeographic, diffusion rate, homogenous model) and 21.1 (CI95: 16.7, 25.5; occupancy). Initial colonization probability was twice as high in spring relative to fall. Conclusions/Significance Skunk-to-skunk transmission was primarily local (< 4 km) suggesting that if interventions were needed, they could be applied at the wave front. Slower viral invasions of skunk rabies in western USA compared to a similar epizootic in raccoons in the eastern USA implies host species or landscape factors underlie the dynamics of rabies invasions. Our framework provides a straightforward method for estimating rates of spatial spread of wildlife diseases. PMID:28759576
Lawrence, K E; Summers, S R; Heath, A C G; McFadden, A M J; Pulford, D J; Pomroy, W E
2016-07-15
The tick-borne haemoparasite Theileria orientalis is the most important infectious cause of anaemia in New Zealand cattle. Since 2012 a previously unrecorded type, T. orientalis type 2 (Ikeda), has been associated with disease outbreaks of anaemia, lethargy, jaundice and deaths on over 1000 New Zealand cattle farms, with most of the affected farms found in the upper North Island. The aim of this study was to model the relative environmental suitability for T. orientalis transmission throughout New Zealand, to predict the proportion of cattle farms potentially suitable for active T. orientalis infection by region, island and the whole of New Zealand and to estimate the average relative environmental suitability per farm by region, island and the whole of New Zealand. The relative environmental suitability for T. orientalis transmission was estimated using the Maxent (maximum entropy) modelling program. The Maxent model predicted that 99% of North Island cattle farms (n=36,257), 64% South Island cattle farms (n=15,542) and 89% of New Zealand cattle farms overall (n=51,799) could potentially be suitable for T. orientalis transmission. The average relative environmental suitability of T. orientalis transmission at the farm level was 0.34 in the North Island, 0.02 in the South Island and 0.24 overall. The study showed that the potential spatial distribution of T. orientalis environmental suitability was much greater than presumed in the early part of the Theileria associated bovine anaemia (TABA) epidemic. Maximum entropy offers a computer efficient method of modelling the probability of habitat suitability for an arthropod vectored disease. This model could help estimate the boundaries of the endemically stable and endemically unstable areas for T. orientalis transmission within New Zealand and be of considerable value in informing practitioner and farmer biosecurity decisions in these respective areas. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection of isolated protein-bound metal ions by single-particle cryo-STEM.
Elad, Nadav; Bellapadrona, Giuliano; Houben, Lothar; Sagi, Irit; Elbaum, Michael
2017-10-17
Metal ions play essential roles in many aspects of biological chemistry. Detecting their presence and location in proteins and cells is important for understanding biological function. Conventional structural methods such as X-ray crystallography and cryo-transmission electron microscopy can identify metal atoms on protein only if the protein structure is solved to atomic resolution. We demonstrate here the detection of isolated atoms of Zn and Fe on ferritin, using cryogenic annular dark-field scanning transmission electron microscopy (cryo-STEM) coupled with single-particle 3D reconstructions. Zn atoms are found in a pattern that matches precisely their location at the ferroxidase sites determined earlier by X-ray crystallography. By contrast, the Fe distribution is smeared along an arc corresponding to the proposed path from the ferroxidase sites to the mineral nucleation sites along the twofold axes. In this case the single-particle reconstruction is interpreted as a probability distribution function based on the average of individual locations. These results establish conditions for detection of isolated metal atoms in the broader context of electron cryo-microscopy and tomography.
Struck, Daniel; Roman, François; De Landtsheer, Sébastien; Servais, Jean-Yves; Lambert, Christine; Masquelier, Cécile; Venard, Véronique; Ruelle, Jean; Nijhuis, Monique; Schmit, Jean-Claude; Seguin-Devaux, Carole
2015-05-01
A new recombinant form representing a mosaic of HIV-1 subtype B and F1 and designated as CRF42_BF was identified in Luxembourg. We confirmed the inedited nature of CRF42_BF by near full-length genome characterization and retrieved a possible ancestor originating from Brazil. The demographic history of CRF42_BF in Luxembourg using Bayesian coalescent-based methods was investigated. The exponential phase of the logistic growth happened in a very short time period of approximately 5 months associated with a high mean rate of population growth of 15.02 new infections per year. However, CRF42_BF was not characterized by either a higher ex vivo replication capacity in peripheral blood mononuclear cells (PBMCs) or a higher ex vivo transmission efficiency from monocyte-derived dendritic cells to PBMCs as compared to B and F1 viruses. These data do not support a high pathogenic potential of CFR42_BF but rather an initial bursting spread of the recombinant probably due to a more favorable transmission route.
Detection of isolated protein-bound metal ions by single-particle cryo-STEM
Elad, Nadav; Bellapadrona, Giuliano; Houben, Lothar; Sagi, Irit; Elbaum, Michael
2017-01-01
Metal ions play essential roles in many aspects of biological chemistry. Detecting their presence and location in proteins and cells is important for understanding biological function. Conventional structural methods such as X-ray crystallography and cryo-transmission electron microscopy can identify metal atoms on protein only if the protein structure is solved to atomic resolution. We demonstrate here the detection of isolated atoms of Zn and Fe on ferritin, using cryogenic annular dark-field scanning transmission electron microscopy (cryo-STEM) coupled with single-particle 3D reconstructions. Zn atoms are found in a pattern that matches precisely their location at the ferroxidase sites determined earlier by X-ray crystallography. By contrast, the Fe distribution is smeared along an arc corresponding to the proposed path from the ferroxidase sites to the mineral nucleation sites along the twofold axes. In this case the single-particle reconstruction is interpreted as a probability distribution function based on the average of individual locations. These results establish conditions for detection of isolated metal atoms in the broader context of electron cryo-microscopy and tomography. PMID:28973937
Chromatic line-profile tomography to reveal exoplanetary atmospheres: application to HD 189733b
NASA Astrophysics Data System (ADS)
Borsa, F.; Rainer, M.; Poretti, E.
2016-05-01
Context. Transmission spectroscopy can be used to constrain the properties of exoplanetary atmospheres. During a transit, the light blocked from the atmosphere of the planet leaves an imprint in the light coming from the star. This has been shown for many exoplanets with both photometry and spectroscopy, using different analysis methods. Aims: We test chromatic line-profile tomography as a new tool to investigate exoplanetary atmospheres. The signal imprinted on the cross-correlation function (CCF) by a planet transiting its star is dependent on the planet-to-star radius ratio. We want to verify whether the precision reachable on the CCF obtained from a subset of the spectral orders of the HARPS spectrograph is high enough to determine the radius of a planet at different wavelengths. Methods: We analyze HARPS archival data of three transits of HD 189733b. We divide the HARPS spectral range into seven broadbands, calculating for each band the ratio between the area of the out-of-transit CCF and the area of the signal imprinted by the planet on it during the full part of the transit. We take into account the effect of the limb darkening using the theoretical coefficients of a linear law. Averaging the results of three different transits allows us to obtain a good-quality broadband transmission spectrum of HD 189733b with a greater precision than that of the chromatic Rossiter McLaughlin effect. Results: We proved that chromatic line-profile tomography is an interesting way to reveal broadband transmission spectra of exoplanets: our analysis of the atmosphere of HD 189733b is in agreement with other ground- and space-based observations. The independent analysis of different transits emphasizes the probability that stellar activity plays a role in the extracted transmission spectrum. Therefore, care should be taken when claiming that Rayleigh scattering is present in the atmosphere of exoplanets orbiting active stars using only one transit.
Le Vu, Stéphane; Ratmann, Oliver; Delpech, Valerie; Brown, Alison E; Gill, O Noel; Tostevin, Anna; Fraser, Christophe; Volz, Erik M
2018-06-01
Phylogenetic clustering of HIV sequences from a random sample of patients can reveal epidemiological transmission patterns, but interpretation is hampered by limited theoretical support and statistical properties of clustering analysis remain poorly understood. Alternatively, source attribution methods allow fitting of HIV transmission models and thereby quantify aspects of disease transmission. A simulation study was conducted to assess error rates of clustering methods for detecting transmission risk factors. We modeled HIV epidemics among men having sex with men and generated phylogenies comparable to those that can be obtained from HIV surveillance data in the UK. Clustering and source attribution approaches were applied to evaluate their ability to identify patient attributes as transmission risk factors. We find that commonly used methods show a misleading association between cluster size or odds of clustering and covariates that are correlated with time since infection, regardless of their influence on transmission. Clustering methods usually have higher error rates and lower sensitivity than source attribution method for identifying transmission risk factors. But neither methods provide robust estimates of transmission risk ratios. Source attribution method can alleviate drawbacks from phylogenetic clustering but formal population genetic modeling may be required to estimate quantitative transmission risk factors. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Teleportation of Three-Qubit State via Six-qubit Cluster State
NASA Astrophysics Data System (ADS)
Yu, Li-zhi; Sun, Shao-xin
2015-05-01
A scheme of probabilistic teleportation was proposed. In this scheme, we took a six-qubit nonmaximally cluster state as the quantum channel to teleport an unknown three-qubit entangled state. Based on Bob's three times Bell state measurement (BSM) results, the receiver Bob can by introducing an auxiliary particle and the appropriate transformation to reconstruct the initial state with a certain probability. We found that, the successful transmission probability depend on the absolute value of coefficients of two of six particle cluster state minimum.
Multiple-path model of spectral reflectance of a dyed fabric.
Rogers, Geoffrey; Dalloz, Nicolas; Fournel, Thierry; Hebert, Mathieu
2017-05-01
Experimental results are presented of the spectral reflectance of a dyed fabric as analyzed by a multiple-path model of reflection. The multiple-path model provides simple analytic expressions for reflection and transmission of turbid media by applying the Beer-Lambert law to each path through the medium and summing over all paths, each path weighted by its probability. The path-length probability is determined by a random-walk analysis. The experimental results presented here show excellent agreement with predictions made by the model.
Transmission overhaul and replacement predictions using Weibull and renewel theory
NASA Technical Reports Server (NTRS)
Savage, M.; Lewicki, D. G.
1989-01-01
A method to estimate the frequency of transmission overhauls is presented. This method is based on the two-parameter Weibull statistical distribution for component life. A second method is presented to estimate the number of replacement components needed to support the transmission overhaul pattern. The second method is based on renewal theory. Confidence statistics are applied with both methods to improve the statistical estimate of sample behavior. A transmission example is also presented to illustrate the use of the methods. Transmission overhaul frequency and component replacement calculations are included in the example.
The quick acquisition technique for laser communication between LEO and GEO
NASA Astrophysics Data System (ADS)
Zhang, Li-zhong; Zhang, Rui-qin; Li, Yong-hao; Meng, Li-xin; Li, Xiao-ming
2013-08-01
The sight-axis alignment can be accomplished by the quick acquisition operation between two laser communication terminals, which is the premise of establishing a free-space optical communication link. Especially for the laser communication links of LEO (Low Earth Orbit)-Ground and LEO-GEO (Geostationary Earth Orbit), since the earth would break the transmission of laser and break the communication as well, so the effective time for each communication is very shot (several minutes~ dozens of minutes), as a result the communication terminals have to capture each other to rebuild the laser communication link. In the paper, on the basis of the analysis of the traditional methods, it presents a new idea that using the long beacon light instead of the circular beacon light; thereby the original of two-dimensional raster spiral scanning is replaced by one-dimensional scanning. This method will reduce the setup time and decrease the failure probability of acquisition for the LEO-GEO laser communication link. Firstly, the analysis of the external constraint conditions in the acquisition phase has been presented in this paper. Furthermore, the acquisition algorithm models have been established. The optimization analysis for the parameters of the acquisition unit has been carried out, and the ground validation experiments of the acquisition strategy have also been performed. The experiments and analysis show that compared with traditional capturing methods, the method presented in this article can make the capturing time be shortened by about 40%, and the failure probability of capturing be reduced by about 30%. So, the method is significant for the LEO-GEO laser communication link.
Outage Probability Minimization for Energy Harvesting Cognitive Radio Sensor Networks
Zhang, Fan; Jing, Tao; Huo, Yan; Jiang, Kaiwei
2017-01-01
The incorporation of cognitive radio (CR) capability in wireless sensor networks yields a promising network paradigm known as CR sensor networks (CRSNs), which is able to provide spectrum efficient data communication. However, due to the high energy consumption results from spectrum sensing, as well as subsequent data transmission, the energy supply for the conventional sensor nodes powered by batteries is regarded as a severe bottleneck for sustainable operation. The energy harvesting technique, which gathers energy from the ambient environment, is regarded as a promising solution to perpetually power-up energy-limited devices with a continual source of energy. Therefore, applying the energy harvesting (EH) technique in CRSNs is able to facilitate the self-sustainability of the energy-limited sensors. The primary concern of this study is to design sensing-transmission policies to minimize the long-term outage probability of EH-powered CR sensor nodes. We formulate this problem as an infinite-horizon discounted Markov decision process and propose an ϵ-optimal sensing-transmission (ST) policy through using the value iteration algorithm. ϵ is the error bound between the ST policy and the optimal policy, which can be pre-defined according to the actual need. Moreover, for a special case that the signal-to-noise (SNR) power ratio is sufficiently high, we present an efficient transmission (ET) policy and prove that the ET policy achieves the same performance with the ST policy. Finally, extensive simulations are conducted to evaluate the performance of the proposed policies and the impaction of various network parameters. PMID:28125023
Outage Probability Minimization for Energy Harvesting Cognitive Radio Sensor Networks.
Zhang, Fan; Jing, Tao; Huo, Yan; Jiang, Kaiwei
2017-01-24
The incorporation of cognitive radio (CR) capability in wireless sensor networks yields a promising network paradigm known as CR sensor networks (CRSNs), which is able to provide spectrum efficient data communication. However, due to the high energy consumption results from spectrum sensing, as well as subsequent data transmission, the energy supply for the conventional sensor nodes powered by batteries is regarded as a severe bottleneck for sustainable operation. The energy harvesting technique, which gathers energy from the ambient environment, is regarded as a promising solution to perpetually power-up energy-limited devices with a continual source of energy. Therefore, applying the energy harvesting (EH) technique in CRSNs is able to facilitate the self-sustainability of the energy-limited sensors. The primary concern of this study is to design sensing-transmission policies to minimize the long-term outage probability of EH-powered CR sensor nodes. We formulate this problem as an infinite-horizon discounted Markov decision process and propose an ϵ -optimal sensing-transmission (ST) policy through using the value iteration algorithm. ϵ is the error bound between the ST policy and the optimal policy, which can be pre-defined according to the actual need. Moreover, for a special case that the signal-to-noise (SNR) power ratio is sufficiently high, we present an efficient transmission (ET) policy and prove that the ET policy achieves the same performance with the ST policy. Finally, extensive simulations are conducted to evaluate the performance of the proposed policies and the impaction of various network parameters.
Dobson, Katharine L.; Jackson, Claire; Balakrishnan, Saju; Bellamy, Tomas C.
2015-01-01
Background Cerebellar parallel fibres release glutamate at both the synaptic active zone and at extrasynaptic sites—a process known as ectopic release. These sites exhibit different short-term and long-term plasticity, the basis of which is incompletely understood but depends on the efficiency of vesicle release and recycling. To investigate whether release of calcium from internal stores contributes to these differences in plasticity, we tested the effects of the ryanodine receptor agonist caffeine on both synaptic and ectopic transmission. Methods Whole cell patch clamp recordings from Purkinje neurons and Bergmann glia were carried out in transverse cerebellar slices from juvenile (P16-20) Wistar rats. Key Results Caffeine caused complex changes in transmission at both synaptic and ectopic sites. The amplitude of postsynaptic currents in Purkinje neurons and extrasynaptic currents in Bergmann glia were increased 2-fold and 4-fold respectively, but paired pulse ratio was substantially reduced, reversing the short-term facilitation observed under control conditions. Caffeine treatment also caused synaptic sites to depress during 1 Hz stimulation, consistent with inhibition of the usual mechanisms for replenishing vesicles at the active zone. Unexpectedly, pharmacological intervention at known targets for caffeine—intracellular calcium release, and cAMP signalling—had no impact on these effects. Conclusions We conclude that caffeine increases release probability and inhibits vesicle recovery at parallel fibre synapses, independently of known pharmacological targets. This complex effect would lead to potentiation of transmission at fibres firing at low frequencies, but depression of transmission at high frequency connections. PMID:25933382
Koedijk, Femke; van Ballegooijen, Marijn; Cremer, Jeroen; Bruisten, Sylvia; Coutinho, Roel
2013-01-01
Background & Aims In the Netherlands, a selective hepatitis B virus (HBV) vaccination programme started in 2002 for men having sex with men, drug users, commercial sex workers and heterosexuals with frequent partner changes. We assessed the programme's effectiveness to guide policy on HBV prevention. Methods We analysed reports of acute HBV infection in the Netherlands between 2004 and 2010 requesting serum from patients for HBV-genome S- and C-region sequencing. We used coalescence analyses to assess genetic diversity of nonimported genotype-A cases over time. Results 1687 patients with acute HBV infection were reported between 2004 and 2010. The incidence of reported acute HBV infection decreased from 1.8 to 1.2 per 100,000 inhabitants, mostly due to a reduction in the number of cases in men who have sex with men. Men were overrepresented among cases with an unknown route of transmission, especially among genotype A2 cases mainly associated with transmission through male homosexual contact. The genetic diversity of nonimported genotype-A strains obtained from men who have sex with men decreased from 2006 onwards, suggesting HBV incidence in this group decreased. Conclusions The selective HBV-vaccination programme for behavioural high-risk groups very likely reduced the incidence of HBV infection in the Netherlands mainly by preventing HBV infections in men who have sex with men. A considerable proportion of cases in men who did not report risk behaviour was probably acquired through homosexual contact. Our findings support continuation of the programme, and adopting similar approaches in other countries where HBV transmission is focused in high-risk adults. PMID:23922651
Johansson, Michael A.; Arana-Vizcarrondo, Neysarí; Biggerstaff, Brad J.; Gallagher, Nancy; Marano, Nina; Staples, J. Erin
2012-01-01
Yellow fever virus (YFV), a mosquito-borne virus endemic to tropical Africa and South America, is capable of causing large urban outbreaks of human disease. With the ease of international travel, urban outbreaks could lead to the rapid spread and subsequent transmission of YFV in distant locations. We designed a stochastic metapopulation model with spatiotemporally explicit transmissibility scenarios to simulate the global spread of YFV from a single urban outbreak by infected airline travelers. In simulations of a 2008 outbreak in Asunción, Paraguay, local outbreaks occurred in 12.8% of simulations and international spread in 2.0%. Using simple probabilistic models, we found that local incidence, travel rates, and basic transmission parameters are sufficient to assess the probability of introduction and autochthonous transmission events. These models could be used to assess the risk of YFV spread during an urban outbreak and identify locations at risk for YFV introduction and subsequent autochthonous transmission. PMID:22302873
CHAKRABORTY, A.; SAZZAD, H. M. S.; HOSSAIN, M. J.; ISLAM, M. S.; PARVEEN, S.; HUSAIN, M.; BANU, S. S.; PODDER, G.; AFROJ, S.; ROLLIN, P. E.; DASZAK, P.; LUBY, S. P.; RAHMAN, M.; GURLEY, E. S.
2015-01-01
SUMMARY Drinking raw date palm sap is the primary route of Nipah virus (NiV) transmission from bats to people in Bangladesh; subsequent person-to-person transmission is common. During December 2010 to March 2011, we investigated NiV epidemiology by interviewing cases using structured questionnaires, in-depth interviews, and group discussions to collect clinical and exposure histories. We conducted a case-control study to identify risk factors for transmission. We identified 43 cases; 23 were laboratory-confirmed and 20 probable. Thirty-eight (88%) cases died. Drinking raw date palm sap and contact with an infected person were major risk factors; one healthcare worker was infected and for another case transmission apparently occurred through contact with a corpse. In absence of these risk factors, apparent routes of transmission included drinking fermented date palm sap. For the first time, a case was detected in eastern Bangladesh. Identification of new epidemiological characteristics emphasizes the importance of continued NiV surveillance and case investigation. PMID:26122675
Chakraborty, A; Sazzad, H M S; Hossain, M J; Islam, M S; Parveen, S; Husain, M; Banu, S S; Podder, G; Afroj, S; Rollin, P E; Daszak, P; Luby, S P; Rahman, M; Gurley, E S
2016-01-01
Drinking raw date palm sap is the primary route of Nipah virus (NiV) transmission from bats to people in Bangladesh; subsequent person-to-person transmission is common. During December 2010 to March 2011, we investigated NiV epidemiology by interviewing cases using structured questionnaires, in-depth interviews, and group discussions to collect clinical and exposure histories. We conducted a case-control study to identify risk factors for transmission. We identified 43 cases; 23 were laboratory-confirmed and 20 probable. Thirty-eight (88%) cases died. Drinking raw date palm sap and contact with an infected person were major risk factors; one healthcare worker was infected and for another case transmission apparently occurred through contact with a corpse. In absence of these risk factors, apparent routes of transmission included drinking fermented date palm sap. For the first time, a case was detected in eastern Bangladesh. Identification of new epidemiological characteristics emphasizes the importance of continued NiV surveillance and case investigation.
Johansson, Michael A; Arana-Vizcarrondo, Neysarí; Biggerstaff, Brad J; Gallagher, Nancy; Marano, Nina; Staples, J Erin
2012-02-01
Yellow fever virus (YFV), a mosquito-borne virus endemic to tropical Africa and South America, is capable of causing large urban outbreaks of human disease. With the ease of international travel, urban outbreaks could lead to the rapid spread and subsequent transmission of YFV in distant locations. We designed a stochastic metapopulation model with spatiotemporally explicit transmissibility scenarios to simulate the global spread of YFV from a single urban outbreak by infected airline travelers. In simulations of a 2008 outbreak in Asunción, Paraguay, local outbreaks occurred in 12.8% of simulations and international spread in 2.0%. Using simple probabilistic models, we found that local incidence, travel rates, and basic transmission parameters are sufficient to assess the probability of introduction and autochthonous transmission events. These models could be used to assess the risk of YFV spread during an urban outbreak and identify locations at risk for YFV introduction and subsequent autochthonous transmission.
Mayo, Christie; Shelley, Courtney; MacLachlan, N. James; Gardner, Ian; Hartley, David; Barker, Christopher
2016-01-01
The global distribution of bluetongue virus (BTV) has been changing recently, perhaps as a result of climate change. To evaluate the risk of BTV infection and transmission in a BTV-endemic region of California, sentinel dairy cows were evaluated for BTV infection, and populations of Culicoides vectors were collected at different sites using carbon dioxide. A deterministic model was developed to quantify risk and guide future mitigation strategies to reduce BTV infection in California dairy cattle. The greatest risk of BTV transmission was predicted within the warm Central Valley of California that contains the highest density of dairy cattle in the United States. Temperature and parameters associated with Culicoides vectors (transmission probabilities, carrying capacity, and survivorship) had the greatest effect on BTV’s basic reproduction number, R0. Based on these analyses, optimal control strategies for reducing BTV infection risk in dairy cattle will be highly reliant upon early efforts to reduce vector abundance during the months prior to peak transmission. PMID:27812161
Transmission overhaul estimates for partial and full replacement at repair
NASA Technical Reports Server (NTRS)
Savage, M.; Lewicki, D. G.
1991-01-01
Timely transmission overhauls increase in-flight service reliability greater than the calculated design reliabilities of the individual aircraft transmission components. Although necessary for aircraft safety, transmission overhauls contribute significantly to aircraft expense. Predictions of a transmission's maintenance needs at the design stage should enable the development of more cost effective and reliable transmissions in the future. The frequency is estimated of overhaul along with the number of transmissions or components needed to support the overhaul schedule. Two methods based on the two parameter Weibull statistical distribution for component life are used to estimate the time between transmission overhauls. These methods predict transmission lives for maintenance schedules which repair the transmission with a complete system replacement or repair only failed components of the transmission. An example illustrates the methods.
2013-01-01
Background As successful malaria control programmes move towards elimination, they must identify residual transmission foci, target vector control to high-risk areas, focus on both asymptomatic and symptomatic infections, and manage importation risk. High spatial and temporal resolution maps of malaria risk can support all of these activities, but commonly available malaria maps are based on parasite rate, a poor metric for measuring malaria at extremely low prevalence. New approaches are required to provide case-based risk maps to countries seeking to identify remaining hotspots of transmission while managing the risk of transmission from imported cases. Methods Household locations and travel histories of confirmed malaria patients during 2011 were recorded through routine surveillance by the Swaziland National Malaria Control Programme for the higher transmission months of January to April and the lower transmission months of May to December. Household locations for patients with no travel history to endemic areas were compared against a random set of background points sampled proportionate to population density with respect to a set of variables related to environment, population density, vector control, and distance to the locations of identified imported cases. Comparisons were made separately for the high and low transmission seasons. The Random Forests regression tree classification approach was used to generate maps predicting the probability of a locally acquired case at 100 m resolution across Swaziland for each season. Results Results indicated that case households during the high transmission season tended to be located in areas of lower elevation, closer to bodies of water, in more sparsely populated areas, with lower rainfall and warmer temperatures, and closer to imported cases than random background points (all p < 0.001). Similar differences were evident during the low transmission season. Maps from the fit models suggested better predictive ability during the high season. Both models proved useful at predicting the locations of local cases identified in 2012. Conclusions The high-resolution mapping approaches described here can help elimination programmes understand the epidemiology of a disappearing disease. Generating case-based risk maps at high spatial and temporal resolution will allow control programmes to direct interventions proactively according to evidence-based measures of risk and ensure that the impact of limited resources is maximized to achieve and maintain malaria elimination. PMID:23398628
Dynamic Variation in Sexual Contact Rates in a Cohort of HIV-Negative Gay Men.
Romero-Severson, E O; Volz, E; Koopman, J S; Leitner, T; Ionides, E L
2015-08-01
Human immunodeficiency virus (HIV) transmission models that include variability in sexual behavior over time have shown increased incidence, prevalence, and acute-state transmission rates for a given population risk profile. This raises the question of whether dynamic variation in individual sexual behavior is a real phenomenon that can be observed and measured. To study this dynamic variation, we developed a model incorporating heterogeneity in both between-person and within-person sexual contact patterns. Using novel methodology that we call iterated filtering for longitudinal data, we fitted this model by maximum likelihood to longitudinal survey data from the Centers for Disease Control and Prevention's Collaborative HIV Seroincidence Study (1992-1995). We found evidence for individual heterogeneity in sexual behavior over time. We simulated an epidemic process and found that inclusion of empirically measured levels of dynamic variation in individual-level sexual behavior brought the theoretical predictions of HIV incidence into closer alignment with reality given the measured per-act probabilities of transmission. The methods developed here provide a framework for quantifying variation in sexual behaviors that helps in understanding the HIV epidemic among gay men. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Data Delivery Method Based on Neighbor Nodes' Information in a Mobile Ad Hoc Network
Hayashi, Takuma; Taenaka, Yuzo; Okuda, Takeshi; Yamaguchi, Suguru
2014-01-01
This paper proposes a data delivery method based on neighbor nodes' information to achieve reliable communication in a mobile ad hoc network (MANET). In a MANET, it is difficult to deliver data reliably due to instabilities in network topology and wireless network condition which result from node movement. To overcome such unstable communication, opportunistic routing and network coding schemes have lately attracted considerable attention. Although an existing method that employs such schemes, MAC-independent opportunistic routing and encoding (MORE), Chachulski et al. (2007), improves the efficiency of data delivery in an unstable wireless mesh network, it does not address node movement. To efficiently deliver data in a MANET, the method proposed in this paper thus first employs the same opportunistic routing and network coding used in MORE and also uses the location information and transmission probabilities of neighbor nodes to adapt to changeable network topology and wireless network condition. The simulation experiments showed that the proposed method can achieve efficient data delivery with low network load when the movement speed is relatively slow. PMID:24672371
Data delivery method based on neighbor nodes' information in a mobile ad hoc network.
Kashihara, Shigeru; Hayashi, Takuma; Taenaka, Yuzo; Okuda, Takeshi; Yamaguchi, Suguru
2014-01-01
This paper proposes a data delivery method based on neighbor nodes' information to achieve reliable communication in a mobile ad hoc network (MANET). In a MANET, it is difficult to deliver data reliably due to instabilities in network topology and wireless network condition which result from node movement. To overcome such unstable communication, opportunistic routing and network coding schemes have lately attracted considerable attention. Although an existing method that employs such schemes, MAC-independent opportunistic routing and encoding (MORE), Chachulski et al. (2007), improves the efficiency of data delivery in an unstable wireless mesh network, it does not address node movement. To efficiently deliver data in a MANET, the method proposed in this paper thus first employs the same opportunistic routing and network coding used in MORE and also uses the location information and transmission probabilities of neighbor nodes to adapt to changeable network topology and wireless network condition. The simulation experiments showed that the proposed method can achieve efficient data delivery with low network load when the movement speed is relatively slow.
Maximum likelihood sequence estimation for optical complex direct modulation.
Che, Di; Yuan, Feng; Shieh, William
2017-04-17
Semiconductor lasers are versatile optical transmitters in nature. Through the direct modulation (DM), the intensity modulation is realized by the linear mapping between the injection current and the light power, while various angle modulations are enabled by the frequency chirp. Limited by the direct detection, DM lasers used to be exploited only as 1-D (intensity or angle) transmitters by suppressing or simply ignoring the other modulation. Nevertheless, through the digital coherent detection, simultaneous intensity and angle modulations (namely, 2-D complex DM, CDM) can be realized by a single laser diode. The crucial technique of CDM is the joint demodulation of intensity and differential phase with the maximum likelihood sequence estimation (MLSE), supported by a closed-form discrete signal approximation of frequency chirp to characterize the MLSE transition probability. This paper proposes a statistical method for the transition probability to significantly enhance the accuracy of the chirp model. Using the statistical estimation, we demonstrate the first single-channel 100-Gb/s PAM-4 transmission over 1600-km fiber with only 10G-class DM lasers.
Liu, Xin
2015-10-30
In a cognitive sensor network (CSN), the wastage of sensing time and energy is a challenge to cooperative spectrum sensing, when the number of cooperative cognitive nodes (CNs) becomes very large. In this paper, a novel wireless power transfer (WPT)-based weighed clustering cooperative spectrum sensing model is proposed, which divides all the CNs into several clusters, and then selects the most favorable CNs as the cluster heads and allows the common CNs to transfer the received radio frequency (RF) energy of the primary node (PN) to the cluster heads, in order to supply the electrical energy needed for sensing and cooperation. A joint resource optimization is formulated to maximize the spectrum access probability of the CSN, through jointly allocating sensing time and clustering number. According to the resource optimization results, a clustering algorithm is proposed. The simulation results have shown that compared to the traditional model, the cluster heads of the proposed model can achieve more transmission power and there exists optimal sensing time and clustering number to maximize the spectrum access probability.
Zou, Huachun; Tabrizi, Sepehr N; Grulich, Andrew E; Hocking, Jane S; Bradshaw, Catriona S; Cornall, Alyssa M; Morrow, Andrea; Prestage, Garrett; Law, Matthew G; Garland, Suzanne M; Chen, Marcus Y; Fairley, Christopher K
2015-01-01
Men who have sex with men (MSM) have an increased risk of anogenital human papilomavirus (HPV) infection, which can lead to HPV-related anogenital lesions such as warts, anal intraepithelial neoplasia, and anal cancer. Some of these HPV types are preventable with vaccines. We aimed to describe the incidence of anal, penile, and oral HPV infection, and to estimate the site-specific transmission probability per partner, for teenage MSM. In our observational cohort study, we enrolled teenage MSM (aged 16-20 years) with low sexual exposure and a low prevalence of HPV in Melbourne (VIC, Australia). At baseline, 3, 6, and 12 months, we took a swab from the anal canal, and participants self-collected a swab from the penis and an oral rinse. Our primary outcome was definite and probable incident HPV infection of the anus, penis, or mouth at any time in the 12 months from baseline, assessed through the presence of HPV DNA. We defined definite incident HPV infection as the same HPV type detected more than once from the same site in men who had a negative HPV test at baseline. We defined probable incident HPV infection as only one positive test. We estimated the probability of HPV transmission per partner using HPV prevalence in MSM with a similar age to partners of men in our cohort. This study is registered at the Australian New Zealand Clinical Trials Registry and ClinicalTrials.gov, numbers ACTRN12611000857909 and NCT01422356. We enrolled 200 MSM aged 16-20 years (median 19 years [IRQ 18-20; range 16-20]) between Sept 20, 2010, and Aug 24, 2012. Over the 12 month follow-up period, we detected 48 definite (107 possible) HPV infections in the anus, ten definite (34 possible) HPV infections on the penis, and no definite (six possible) infections in the mouth. Definite incidence rate per 100 person-years for any anal HPV infection was 57 (95% CI 46-68), and for any anal HPV type in the quadrivalent vaccine was 33 (23-44). Definite incidence rate per 100 person-years for any penile HPV was 12 (6-21) and for any HPV type in the quadrivalent vaccine was 5 (1-12). Estimated probabilities of HPV transmission from the penis to the anus were significantly higher than were those from the anus to the penis (p<0·05 for all HPV types in the quadrivalent vaccine). High incidence rates suggest that the vaccination coverage in MSM will need to be high. The transmission estimates will inform HPV modelling. Merck. Copyright © 2015 Elsevier Ltd. All rights reserved.
Saviane, Chiara; Silver, R Angus
2006-06-15
Synapses play a crucial role in information processing in the brain. Amplitude fluctuations of synaptic responses can be used to extract information about the mechanisms underlying synaptic transmission and its modulation. In particular, multiple-probability fluctuation analysis can be used to estimate the number of functional release sites, the mean probability of release and the amplitude of the mean quantal response from fits of the relationship between the variance and mean amplitude of postsynaptic responses, recorded at different probabilities. To determine these quantal parameters, calculate their uncertainties and the goodness-of-fit of the model, it is important to weight the contribution of each data point in the fitting procedure. We therefore investigated the errors associated with measuring the variance by determining the best estimators of the variance of the variance and have used simulations of synaptic transmission to test their accuracy and reliability under different experimental conditions. For central synapses, which generally have a low number of release sites, the amplitude distribution of synaptic responses is not normal, thus the use of a theoretical variance of the variance based on the normal assumption is not a good approximation. However, appropriate estimators can be derived for the population and for limited sample sizes using a more general expression that involves higher moments and introducing unbiased estimators based on the h-statistics. Our results are likely to be relevant for various applications of fluctuation analysis when few channels or release sites are present.
Abrahams, M-R; Anderson, J A; Giorgi, E E; Seoighe, C; Mlisana, K; Ping, L-H; Athreya, G S; Treurnicht, F K; Keele, B F; Wood, N; Salazar-Gonzalez, J F; Bhattacharya, T; Chu, H; Hoffman, I; Galvin, S; Mapanje, C; Kazembe, P; Thebus, R; Fiscus, S; Hide, W; Cohen, M S; Karim, S Abdool; Haynes, B F; Shaw, G M; Hahn, B H; Korber, B T; Swanstrom, R; Williamson, C
2009-04-01
Identifying the specific genetic characteristics of successfully transmitted variants may prove central to the development of effective vaccine and microbicide interventions. Although human immunodeficiency virus transmission is associated with a population bottleneck, the extent to which different factors influence the diversity of transmitted viruses is unclear. We estimate here the number of transmitted variants in 69 heterosexual men and women with primary subtype C infections. From 1,505 env sequences obtained using a single genome amplification approach we show that 78% of infections involved single variant transmission and 22% involved multiple variant transmissions (median of 3). We found evidence for mutations selected for cytotoxic-T-lymphocyte or antibody escape and a high prevalence of recombination in individuals infected with multiple variants representing another potential escape pathway in these individuals. In a combined analysis of 171 subtype B and C transmission events, we found that infection with more than one variant does not follow a Poisson distribution, indicating that transmission of individual virions cannot be seen as independent events, each occurring with low probability. While most transmissions resulted from a single infectious unit, multiple variant transmissions represent a significant fraction of transmission events, suggesting that there may be important mechanistic differences between these groups that are not yet understood.
Exposure Patterns Driving Ebola Transmission in West Africa: A Retrospective Observational Study.
Agua-Agum, Junerlyn; Ariyarajah, Archchun; Aylward, Bruce; Bawo, Luke; Bilivogui, Pepe; Blake, Isobel M; Brennan, Richard J; Cawthorne, Amy; Cleary, Eilish; Clement, Peter; Conteh, Roland; Cori, Anne; Dafae, Foday; Dahl, Benjamin; Dangou, Jean-Marie; Diallo, Boubacar; Donnelly, Christl A; Dorigatti, Ilaria; Dye, Christopher; Eckmanns, Tim; Fallah, Mosoka; Ferguson, Neil M; Fiebig, Lena; Fraser, Christophe; Garske, Tini; Gonzalez, Lice; Hamblion, Esther; Hamid, Nuha; Hersey, Sara; Hinsley, Wes; Jambei, Amara; Jombart, Thibaut; Kargbo, David; Keita, Sakoba; Kinzer, Michael; George, Fred Kuti; Godefroy, Beatrice; Gutierrez, Giovanna; Kannangarage, Niluka; Mills, Harriet L; Moller, Thomas; Meijers, Sascha; Mohamed, Yasmine; Morgan, Oliver; Nedjati-Gilani, Gemma; Newton, Emily; Nouvellet, Pierre; Nyenswah, Tolbert; Perea, William; Perkins, Devin; Riley, Steven; Rodier, Guenael; Rondy, Marc; Sagrado, Maria; Savulescu, Camelia; Schafer, Ilana J; Schumacher, Dirk; Seyler, Thomas; Shah, Anita; Van Kerkhove, Maria D; Wesseh, C Samford; Yoti, Zabulon
2016-11-01
The ongoing West African Ebola epidemic began in December 2013 in Guinea, probably from a single zoonotic introduction. As a result of ineffective initial control efforts, an Ebola outbreak of unprecedented scale emerged. As of 4 May 2015, it had resulted in more than 19,000 probable and confirmed Ebola cases, mainly in Guinea (3,529), Liberia (5,343), and Sierra Leone (10,746). Here, we present analyses of data collected during the outbreak identifying drivers of transmission and highlighting areas where control could be improved. Over 19,000 confirmed and probable Ebola cases were reported in West Africa by 4 May 2015. Individuals with confirmed or probable Ebola ("cases") were asked if they had exposure to other potential Ebola cases ("potential source contacts") in a funeral or non-funeral context prior to becoming ill. We performed retrospective analyses of a case line-list, collated from national databases of case investigation forms that have been reported to WHO. These analyses were initially performed to assist WHO's response during the epidemic, and have been updated for publication. We analysed data from 3,529 cases in Guinea, 5,343 in Liberia, and 10,746 in Sierra Leone; exposures were reported by 33% of cases. The proportion of cases reporting a funeral exposure decreased over time. We found a positive correlation (r = 0.35, p < 0.001) between this proportion in a given district for a given month and the within-district transmission intensity, quantified by the estimated reproduction number (R). We also found a negative correlation (r = -0.37, p < 0.001) between R and the district proportion of hospitalised cases admitted within ≤4 days of symptom onset. These two proportions were not correlated, suggesting that reduced funeral attendance and faster hospitalisation independently influenced local transmission intensity. We were able to identify 14% of potential source contacts as cases in the case line-list. Linking cases to the contacts who potentially infected them provided information on the transmission network. This revealed a high degree of heterogeneity in inferred transmissions, with only 20% of cases accounting for at least 73% of new infections, a phenomenon often called super-spreading. Multivariable regression models allowed us to identify predictors of being named as a potential source contact. These were similar for funeral and non-funeral contacts: severe symptoms, death, non-hospitalisation, older age, and travelling prior to symptom onset. Non-funeral exposures were strongly peaked around the death of the contact. There was evidence that hospitalisation reduced but did not eliminate onward exposures. We found that Ebola treatment units were better than other health care facilities at preventing exposure from hospitalised and deceased individuals. The principal limitation of our analysis is limited data quality, with cases not being entered into the database, cases not reporting exposures, or data being entered incorrectly (especially dates, and possible misclassifications). Achieving elimination of Ebola is challenging, partly because of super-spreading. Safe funeral practices and fast hospitalisation contributed to the containment of this Ebola epidemic. Continued real-time data capture, reporting, and analysis are vital to track transmission patterns, inform resource deployment, and thus hasten and maintain elimination of the virus from the human population.
Scattering of charged particles on two spatially separated time-periodic optical fields
NASA Astrophysics Data System (ADS)
Szabó, Lóránt Zs.; Benedict, Mihály G.; Földi, Péter
2017-12-01
We consider a monoenergetic beam of moving charged particles interacting with two separated oscillating electric fields. Time-periodic linear potential is assumed to model the light-particle interaction using a nonrelativistic, quantum mechanical description based on Gordon-Volkov states. Applying Floquet theory, we calculate transmission probabilities as a function of the laser field parameters. The transmission resonances in this Ramsey-like setup are interpreted as if they originated from a corresponding static double-potential barrier with heights equal to the ponderomotive potential resulting from the oscillating field. Due to the opening of new "Floquet channels," the resonances are repeated at input energies when the corresponding frequency is shifted by an integer multiple of the exciting frequency. These narrow resonances can be used as precise energy filters. The fine structure of the transmission spectra is determined by the phase difference between the two oscillating light fields, allowing for the optical control of the transmission.
The risk of airborne influenza transmission in passenger cars.
Knibbs, L D; Morawska, L; Bell, S C
2012-03-01
Travel in passenger cars is a ubiquitous aspect of the daily activities of many people. During the 2009 influenza A(H1N1) pandemic a case of probable transmission during car travel was reported in Australia, to which spread via the airborne route may have contributed. However, there are no data to indicate the likely risks of such events, and how they may vary and be mitigated. To address this knowledge gap, we estimated the risk of airborne influenza transmission in two cars (1989 model and 2005 model) by employing ventilation measurements and a variation of the Wells-Riley model. Results suggested that infection risk can be reduced by not recirculating air; however, estimated risk ranged from 59% to 99·9% for a 90-min trip when air was recirculated in the newer vehicle. These results have implications for interrupting in-car transmission of other illnesses spread by the airborne route.
[Cardiac involvement in Acute Chagas' Disease cases in the Amazon region].
Barbosa-Ferreira, João Marcos; Guerra, Jorge Augusto de Oliveira; Santana Filho, Franklin Simões de; Magalhães, Belisa Maria Lopes; Coelho, Leíla I A R C; Barbosa, Maria das Graças Vale
2010-06-01
The cardiac involvement of five patients from the Amazon region with Acute Chagas' Disease (ACD) is described. Four of these patients presented probable oral transmission. All of them presented some degree of cardiac involvement, but there were no deaths.
Ecology: avoidance of disease by social lobsters.
Behringer, Donald C; Butler, Mark J; Shields, Jeffrey D
2006-05-25
Transmissible pathogens are the bane of social animals, so they have evolved behaviours to decrease the probability of infection. There is no record, however, of social animals avoiding diseased individuals of their own species in the wild. Here we show how healthy, normally gregarious Caribbean spiny lobsters (Panulirus argus) avoid conspecifics that are infected with a lethal virus. Early detection and avoidance of infected, though not yet infectious, individuals by healthy lobsters confers a selective advantage and highlights the importance of host behaviour in disease transmission among natural populations.
Williams, David M.; Dechen Quinn, Amy C.; Porter, William F.
2014-01-01
Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05–0.14), to low levels post-parturition through summer (0.00–0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m – 7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response. PMID:24409293
McDonald, Scott A; Mohamed, Rosmawati; Dahlui, Maznah; Naning, Herlianna; Kamarulzaman, Adeeba
2014-11-07
Collecting adequate information on key epidemiological indicators is a prerequisite to informing a public health response to reduce the impact of hepatitis C virus (HCV) infection in Malaysia. Our goal was to overcome the acute data shortage typical of low/middle income countries using statistical modelling to estimate the national HCV prevalence and the distribution over transmission pathways as of the end of 2009. Multi-parameter evidence synthesis methods were applied to combine all available relevant data sources - both direct and indirect - that inform the epidemiological parameters of interest. An estimated 454,000 (95% credible interval [CrI]: 392,000 to 535,000) HCV antibody-positive individuals were living in Malaysia in 2009; this represents 2.5% (95% CrI: 2.2-3.0%) of the population aged 15-64 years. Among males of Malay ethnicity, for 77% (95% CrI: 69-85%) the route of probable transmission was active or a previous history of injecting drugs. The corresponding proportions were smaller for male Chinese and Indian/other ethnic groups (40% and 71%, respectively). The estimated prevalence in females of all ethnicities was 1% (95% CrI: 0.6 to 1.4%); 92% (95% CrI: 88 to 95%) of infections were attributable to non-drug injecting routes of transmission. The prevalent number of persons living with HCV infection in Malaysia is estimated to be very high. Low/middle income countries often lack a comprehensive evidence base; however, evidence synthesis methods can assist in filling the data gaps required for the development of effective policy to address the future public health and economic burden due to HCV.
Research on Segmentation Monitoring Control of IA-RWA Algorithm with Probe Flow
NASA Astrophysics Data System (ADS)
Ren, Danping; Guo, Kun; Yao, Qiuyan; Zhao, Jijun
2018-04-01
The impairment-aware routing and wavelength assignment algorithm with probe flow (P-IA-RWA) can make an accurate estimation for the transmission quality of the link when the connection request comes. But it also causes some problems. The probe flow data introduced in the P-IA-RWA algorithm can result in the competition for wavelength resources. In order to reduce the competition and the blocking probability of the network, a new P-IA-RWA algorithm with segmentation monitoring-control mechanism (SMC-P-IA-RWA) is proposed. The algorithm would reduce the holding time of network resources for the probe flow. It segments the candidate path suitably for the data transmitting. And the transmission quality of the probe flow sent by the source node will be monitored in the endpoint of each segment. The transmission quality of data can also be monitored, so as to make the appropriate treatment to avoid the unnecessary probe flow. The simulation results show that the proposed SMC-P-IA-RWA algorithm can effectively reduce the blocking probability. It brings a better solution to the competition for resources between the probe flow and the main data to be transferred. And it is more suitable for scheduling control in the large-scale network.
NASA Astrophysics Data System (ADS)
Alinejad, Babak; Mahmoodi, Korosh
Natural graphite is a soft material that conventional milling methods fail to grind into nanoparticles. We found that adding NaCl into graphite during milling allows obtaining graphene nanoflakes of about 50×200nm2 as evidenced by Transmission Electron Microscope (TEM). NaCl particles are substantially brittle and harder than graphite, serving as milling agents by both helping to chop graphite into smaller pieces and preventing graphite particles from agglomeration. After milling, NaCl can be easily washed away by water. Probable mechanism for exfoliation of graphene during the modified ball milling may be explained by NaCl and graphene slipping or sliding against and over each other, exfoliating the graphene particles into thin layers.
Preliminary system design study for a digital fly-by-wire flight control system for an F-8C aircraft
NASA Technical Reports Server (NTRS)
Seacord, C. L.; Vaughn, D. K.
1976-01-01
The design of a fly-by-wire control system having a mission failure probability of less than one millionth failures per flight hour is examined. Emphasis was placed on developing actuator configurations that would improve the system performance, and consideration of the practical aspects of sensor/computer and computer/actuator interface implementation. Five basic configurations were defined as appropriate candidates for the F-8C research aircraft. Options on the basic configurations were included to cover variations in flight sensors, redundancy levels, data transmission techniques, processor input/output methods, and servo actuator arrangements. The study results can be applied to fly by wire systems for transport aircraft in general and the space shuttle.
Schistosomiasis: eradication or control
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strickland, G.T.
Schistosomiasis cannot be eradicated from the world at this time. However, it can be eradicated from focal areas where major improvements in the standard of living have occurred. In most areas control of biological transmission can be obtained by a systematic use of chemotherapy along with other methods including control of snails and reduction in both water contamination and contact. In some areas, where the prevalence and intensity of infection are very high, the only reasonable objective is control of the disease. Disease morbidity correlates with intensity of infection and can probably be reduced with repeated courses of chemotherapy. Themore » appropriate application of a schistosomal vaccine, when it becomes available, will expedite the eradication of this parasite, which infects greater than 200 million people.« less
How much attention is needed towards men who sell sex to men for HIV prevention in India?
Dandona, Lalit; Dandona, Rakhi; Kumar, G Anil; Gutierrez, Juan Pablo; McPherson, Sam; Bertozzi, Stefano M
2006-02-15
HIV prevention in India has mostly focussed on heterosexual transmission. Data on homosexual transmission are not readily available from India. We therefore assessed the probability of acquiring and transmitting HIV for men who sell sex to men and compared this with women who sell sex in India. Sexual behaviour characteristics of 6661 men who have sex with men and 6648 women who sell sex were obtained in the Indian state of Andhra Pradesh through confidential interviews. These, along with estimates of HIV rates among them and risk of HIV transmission per unprotected sex act from other sources, were used to calculate their annual probability of acquiring and transmitting HIV. Of 6661 men who have sex with men in this sample, 1776 (26.7%) had sold sex to men. For every 1000 men who sell sex to men, annually 146 (95% confidence interval [CI] 116-179) would acquire HIV and HIV would be transmitted to 55 (95% CI 42-71) men who do not sell sex or women. These estimates were higher by 6.7 (95% CI 4.9-9.2) times for acquiring HIV and 2.5 (95% CI 2.0-3.2) times for transmitting HIV to sex partners outside their group, as compared with similar estimates for women who sell sex. In this sample, the average annual probability of acquiring HIV was higher among men who have sex with men but do not sell sex as compared with women who sell sex. These data indicate that men who sell sex to men are at much higher risk of acquiring and transmitting HIV than women who sell sex. Therefore, men who sell sex to men and their clients warrant substantial attention for comprehensive HIV prevention in India.
Probable transfusion-transmitted Zika virus in Brazil.
Barjas-Castro, Maria L; Angerami, Rodrigo N; Cunha, Mariana S; Suzuki, Akemi; Nogueira, Juliana S; Rocco, Iray M; Maeda, Adriana Y; Vasami, Fernanda G S; Katz, Gizelda; Boin, Ilka F S F; Stucchi, Raquel S B; Resende, Mariângela R; Esposito, Danillo L A; de Souza, Renato P; da Fonseca, Benedito A; Addas-Carvalho, Marcelo
2016-07-01
Zika virus (ZIKV) is an emerging arthropod-borne flavivirus transmitted by Aedes mosquitoes. Recent commentaries regarding ZIKV routes of transmission describe a potential transmission by transfusion. Herein, we report a probable case of transfusion-transmitted ZIKV infection through a platelet transfusion that was detected from postdonation information. A blood donor made a voluntary telephone report to the blood donor facility 3 days after donation and informed the facility of a febrile illness (fever, malaise, and headaches). Due to the ongoing dengue epidemic, the initial clinical investigation included dengue among other possible diagnoses. The serology and molecular laboratory results excluded dengue infection. However, stored samples from the donation were positive for ZIKV on reverse transcription-polymerase chain reaction (RT-PCR) analysis. A retrospective investigation demonstrated that the platelet concentrate, which was part of a pool, had been transfused after a liver transplantation. A physician had evaluated the patient 4 days after surgery. Laboratory investigation showed enzyme-linked immunosorbent assay results that were negative for dengue immunoglobulin M antibodies; however, the results were positive for hemagglutination inhibition antibodies against flavivirus. ZIKV RT-PCR and virus isolation analyses in cell cultures from recipient serum were both positive. The sequencing confirmed ZIKV in the donor and patient samples. Ten partial nucleotide sequences from the ZIKV strain that were detected in the donor were aligned and compared with the ZIKV genome detected in the recipient, revealing a 99.8% homology between the two strains. This is a case of probable transmission of ZIKV through blood transfusion. The patient had been transfused with the blood product from an infected donor, most likely in the incubation period after ZIKV infection but prior to clinical disease onset. This report emphasizes the importance of postdonation information and recipient investigations during outbreaks of potentially blood-borne infections. © 2016 AABB.
Glucose and lactate as metabolic constraints on presynaptic transmission at an excitatory synapse.
Lucas, Sarah J; Michel, Christophe B; Marra, Vincenzo; Smalley, Joshua L; Hennig, Matthias H; Graham, Bruce P; Forsythe, Ian D
2018-05-01
Synapses have high energy demands which increase during intense activity. We show that presynaptic terminals can utilise extracellular glucose or lactate to generate energy to maintain synaptic transmission. Reducing energy substrates induces a metabolic stress: presynaptic ATP depletion impaired synaptic transmission through a reduction in the number of functional synaptic vesicle release sites and a slowing of vesicle pool replenishment, without a consistent change in release probability. Metabolic function is compromised in many pathological conditions (e.g. stroke, traumatic brain injury and neurodegeneration). Knowledge of how synaptic transmission is constrained by metabolic stress, especially during intense brain activity, will provide insights to improve cognition following pathological insults. The synapse has high energy demands, which increase during intense activity. Presynaptic ATP production depends on substrate availability and usage will increase during activity, which in turn could influence transmitter release and information transmission. We investigated transmitter release at the mouse calyx of Held synapse using glucose or lactate (10, 1 or 0 mm) as the extracellular substrates while inducing metabolic stress. High-frequency stimulation (HFS) and recovery paradigms evoked trains of EPSCs monitored under voltage-clamp. Whilst postsynaptic intracellular ATP was stabilised by diffusion from the patch pipette, depletion of glucose increased EPSC depression during HFS and impaired subsequent recovery. Computational modelling of these data demonstrated a reduction in the number of functional release sites and slowed vesicle pool replenishment during metabolic stress, with little change in release probability. Directly depleting presynaptic terminal ATP impaired transmitter release in an analogous manner to glucose depletion. In the absence of glucose, presynaptic terminal metabolism could utilise lactate from the aCSF and this was blocked by inhibition of monocarboxylate transporters (MCTs). MCT inhibitors significantly suppressed transmission in low glucose, implying that lactate is a presynaptic substrate. Additionally, block of glycogenolysis accelerated synaptic transmission failure in the absence of extracellular glucose, consistent with supplemental supply of lactate by local astrocytes. We conclude that both glucose and lactate support presynaptic metabolism and that limited availability, exacerbated by high-intensity firing, constrains presynaptic ATP, impeding transmission through a reduction in functional presynaptic release sites as vesicle recycling slows when ATP levels are low. © 2018 The Authors. The Journal of Physiology © 2018 The Physiological Society.
Olfactory disruption: towards controlling important insect vectors of disease
USDA-ARS?s Scientific Manuscript database
Chemical repellents are used to decrease contacts between insect disease vectors and their hosts, thus reducing the probability of disease transmission. The molecular mechanisms by which repellents have their effects are poorly understood and remain a controversial topic. Here we present recent re...
Quantitative Risk Mapping of Urban Gas Pipeline Networks Using GIS
NASA Astrophysics Data System (ADS)
Azari, P.; Karimi, M.
2017-09-01
Natural gas is considered an important source of energy in the world. By increasing growth of urbanization, urban gas pipelines which transmit natural gas from transmission pipelines to consumers, will become a dense network. The increase in the density of urban pipelines will influence probability of occurring bad accidents in urban areas. These accidents have a catastrophic effect on people and their property. Within the next few years, risk mapping will become an important component in urban planning and management of large cities in order to decrease the probability of accident and to control them. Therefore, it is important to assess risk values and determine their location on urban map using an appropriate method. In the history of risk analysis of urban natural gas pipeline networks, the pipelines has always been considered one by one and their density in urban area has not been considered. The aim of this study is to determine the effect of several pipelines on the risk value of a specific grid point. This paper outlines a quantitative risk assessment method for analysing the risk of urban natural gas pipeline networks. It consists of two main parts: failure rate calculation where the EGIG historical data are used and fatal length calculation that involves calculation of gas release and fatality rate of consequences. We consider jet fire, fireball and explosion for investigating the consequences of gas pipeline failure. The outcome of this method is an individual risk and is shown as a risk map.
Asimaki, E; Nolte, O; Overesch, G; Strahm, C
2017-08-01
Erysipelothrix rhusiopathiae is a facultative anaerobic Gram-positive rod that occurs widely in nature and is best known in veterinary medicine for causing swine erysipelas. In humans, infections are rare and mainly considered as occupationally acquired zoonosis. A case of E. rhusiopathiae bacteremia most likely associated with home freshwater aquarium handling is reported. The route of transmission was probably a cut with the dorsal fin of a dead pet fish. A short review of clinical presentations, therapeutic considerations and pitfalls of E. rhusiopathiae infections in humans is presented.
Silver, R Angus; Momiyama, Akiko; Cull-Candy, Stuart G
1998-01-01
EPSCs were recorded under whole-cell voltage clamp at room temperature from Purkinje cells in slices of cerebellum from 12- to 14-day-old rats. EPSCs from individual climbing fibre (CF) inputs were identified on the basis of their large size, paired-pulse depression and all-or-none appearance in response to a graded stimulus. Synaptic transmission was investigated over a wide range of experimentally imposed release probabilities by analysing fluctuations in the peak of the EPSC. Release probability was manipulated by altering the extracellular [Ca2+] and [Mg2+]. Quantal parameters were estimated from plots of coefficient of variation (CV) or variance against mean conductance by fitting a multinomial model that incorporated both spatial variation in quantal size and non-uniform release probability. This ‘multiple-probability fluctuation’ (MPF) analysis gave an estimate of 510 ± 50 for the number of functional release sites (N) and a quantal size (q) of 0.5 ± 0.03 nS (n = 6). Control experiments, and simulations examining the effects of non-uniform release probability, indicate that MPF analysis provides a reliable estimate of quantal parameters. Direct measurement of quantal amplitudes in the presence of 5 mm Sr2+, which gave asynchronous release, yielded distributions with a mean quantal size of 0.55 ± 0.01 nS and a CV of 0.37 ± 0.01 (n = 4). Similar estimates of q were obtained in 2 mm Ca2+ when release probability was lowered with the calcium channel blocker Cd2+. The non-NMDA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX; 1 μm) reduced both the evoked current and the quantal size (estimated with MPF analysis) to a similar degree, but did not affect the estimate of N. We used MPF analysis to identify those quantal parameters that change during frequency-dependent depression at climbing fibre-Purkinje cell synaptic connections. At low stimulation frequencies, the mean release probability (P¯r) was unusually high (0.90 ± 0.03 at 0.033 Hz, n = 5), but as the frequency of stimulation was increased, pr fell dramatically (0.02 ± 0.01 at 10 Hz, n = 4) with no apparent change in either q or N. This indicates that the observed 50-fold depression in EPSC amplitude is presynaptic in origin. Presynaptic frequency-dependent depression was investigated with double-pulse and multiple-pulse protocols. EPSC recovery, following simultaneous release at practically all sites, was slow, being well fitted by the sum of two exponential functions (time constants of 0.35 ± 0.09 and 3.2 ± 0.4 s, n = 5). EPSC recovery following sustained stimulation was even slower. We propose that presynaptic depression at CF synapses reflects a slow recovery of release probability following release of each quantum of transmitter. The large number of functional release sites, relatively large quantal size, and unusual dynamics of transmitter release at the CF synapse appear specialized to ensure highly reliable olivocerebellar transmission at low frequencies but to limit transmission at higher frequencies. PMID:9660900
Selby, Thomas H.; Hart, Kristen M.; Fujisaki, Ikuko; Smith, Brian J.; Pollock, Clayton J; Hillis-Star, Zandy M; Lundgren, Ian; Oli, Madan K.
2016-01-01
Submerged passive acoustic technology allows researchers to investigate spatial and temporal movement patterns of many marine and freshwater species. The technology uses receivers to detect and record acoustic transmissions emitted from tags attached to an individual. Acoustic signal strength naturally attenuates over distance, but numerous environmental variables also affect the probability a tag is detected. Knowledge of receiver range is crucial for designing acoustic arrays and analyzing telemetry data. Here, we present a method for testing a relatively large-scale receiver array in a dynamic Caribbean coastal environment intended for long-term monitoring of multiple species. The U.S. Geological Survey and several academic institutions in collaboration with resource management at Buck Island Reef National Monument (BIRNM), off the coast of St. Croix, recently deployed a 52 passive acoustic receiver array. We targeted 19 array-representative receivers for range-testing by submersing fixed delay interval range-testing tags at various distance intervals in each cardinal direction from a receiver for a minimum of an hour. Using a generalized linear mixed model (GLMM), we estimated the probability of detection across the array and assessed the effect of water depth, habitat, wind, temperature, and time of day on the probability of detection. The predicted probability of detection across the entire array at 100 m distance from a receiver was 58.2% (95% CI: 44.0–73.0%) and dropped to 26.0% (95% CI: 11.4–39.3%) 200 m from a receiver indicating a somewhat constrained effective detection range. Detection probability varied across habitat classes with the greatest effective detection range occurring in homogenous sand substrate and the smallest in high rugosity reef. Predicted probability of detection across BIRNM highlights potential gaps in coverage using the current array as well as limitations of passive acoustic technology within a complex coral reef environment.
NASA Astrophysics Data System (ADS)
Xu, Feng; Davis, Anthony B.; Diner, David J.
2016-11-01
A Markov chain formalism is developed for computing the transport of polarized radiation according to Generalized Radiative Transfer (GRT) theory, which was developed recently to account for unresolved random fluctuations of scattering particle density and can also be applied to unresolved spectral variability of gaseous absorption as an improvement over the standard correlated-k method. Using Gamma distribution to describe the probability density function of the extinction or absorption coefficient, a shape parameter a that quantifies the variability is introduced, defined as the mean extinction or absorption coefficient squared divided by its variance. It controls the decay rate of a power-law transmission that replaces the usual exponential Beer-Lambert-Bouguer law. Exponential transmission, hence classic RT, is recovered when a→∞. The new approach is verified to high accuracy against numerical benchmark results obtained with a custom Monte Carlo method. For a<∞, angular reciprocity is violated to a degree that increases with the spatial variability, as observed for finite portions of real-world cloudy scenes. While the degree of linear polarization in liquid water cloudbows, supernumerary bows, and glories is affected by spatial heterogeneity, the positions in scattering angle of these features are relatively unchanged. As a result, a single-scattering model based on the assumption of subpixel homogeneity can still be used to derive droplet size distributions from polarimetric measurements of extended stratocumulus clouds.
Chaillon, Antoine; Nakazawa, Masato; Wertheim, Joel O; Little, Susan J; Smith, Davey M; Mehta, Sanjay R; Gianella, Sara
2017-11-01
During primary HIV infection, the presence of minority drug resistance mutations (DRM) may be a consequence of sexual transmission, de novo mutations, or technical errors in identification. Baseline blood samples were collected from 24 HIV-infected antiretroviral-naive, genetically and epidemiologically linked source and recipient partners shortly after the recipient's estimated date of infection. An additional 32 longitudinal samples were available from 11 recipients. Deep sequencing of HIV reverse transcriptase (RT) was performed (Roche/454), and the sequences were screened for nucleoside and nonnucleoside RT inhibitor DRM. The likelihood of sexual transmission and persistence of DRM was assessed using Bayesian-based statistical modeling. While the majority of DRM (>20%) were consistently transmitted from source to recipient, the probability of detecting a minority DRM in the recipient was not increased when the same minority DRM was detected in the source (Bayes factor [BF] = 6.37). Longitudinal analyses revealed an exponential decay of DRM (BF = 0.05) while genetic diversity increased. Our analysis revealed no substantial evidence for sexual transmission of minority DRM (BF = 0.02). The presence of minority DRM during early infection, followed by a rapid decay, is consistent with the "mutation-selection balance" hypothesis, in which deleterious mutations are more efficiently purged later during HIV infection when the larger effective population size allows more efficient selection. Future studies using more recent sequencing technologies that are less prone to single-base errors should confirm these results by applying a similar Bayesian framework in other clinical settings. IMPORTANCE The advent of sensitive sequencing platforms has led to an increased identification of minority drug resistance mutations (DRM), including among antiretroviral therapy-naive HIV-infected individuals. While transmission of DRM may impact future therapy options for newly infected individuals, the clinical significance of the detection of minority DRM remains controversial. In the present study, we applied deep-sequencing techniques within a Bayesian hierarchical framework to a cohort of 24 transmission pairs to investigate whether minority DRM detected shortly after transmission were the consequence of (i) sexual transmission from the source, (ii) de novo emergence shortly after infection followed by viral selection and evolution, or (iii) technical errors/limitations of deep-sequencing methods. We found no clear evidence to support the sexual transmission of minority resistant variants, and our results suggested that minor resistant variants may emerge de novo shortly after transmission, when the small effective population size limits efficient purge by natural selection. Copyright © 2017 American Society for Microbiology.
Enns, Eva Andrea; Kao, Szu-Yu; Kozhimannil, Katy Backes; Kahn, Judith; Farris, Jill; Kulasingam, Shalini L
2017-10-01
Mathematical models are important tools for assessing prevention and management strategies for sexually transmitted infections. These models are usually developed for a single infection and require calibration to observed epidemiological trends in the infection of interest. Incorporating other outcomes of sexual behavior into the model, such as pregnancy, may better inform the calibration process. We developed a mathematical model of chlamydia transmission and pregnancy in Minnesota adolescents aged 15 to 19 years. We calibrated the model to statewide rates of reported chlamydia cases alone (chlamydia calibration) and in combination with pregnancy rates (dual calibration). We evaluated the impact of calibrating to different outcomes of sexual behavior on estimated input parameter values, predicted epidemiological outcomes, and predicted impact of chlamydia prevention interventions. The two calibration scenarios produced different estimates of the probability of condom use, the probability of chlamydia transmission per sex act, the proportion of asymptomatic infections, and the screening rate among men. These differences resulted in the dual calibration scenario predicting lower prevalence and incidence of chlamydia compared with calibrating to chlamydia cases alone. When evaluating the impact of a 10% increase in condom use, the dual calibration scenario predicted fewer infections averted over 5 years compared with chlamydia calibration alone [111 (6.8%) vs 158 (8.5%)]. While pregnancy and chlamydia in adolescents are often considered separately, both are outcomes of unprotected sexual activity. Incorporating both as calibration targets in a model of chlamydia transmission resulted in different parameter estimates, potentially impacting the intervention effectiveness predicted by the model.
Drancourt, M; Raoult, D
2016-11-01
Plague, a deadly zoonose caused by the bacterium Yersinia pestis, has been firmly documented in 39 historical burial sites in Eurasia that date from the Bronze Age to two historical pandemics spanning the 6th to 18th centuries. Palaeomicrobiologic data, including gene and spacer sequences, whole genome sequences and protein data, confirmed that two historical pandemics swept over Europe from probable Asian sources and possible two-way-ticket journeys back from Europe to Asia. These investigations made it possible to address questions regarding the potential sources and routes of transmission by completing the standard rodent and rodent-flea transmission scheme. This suggested that plague was transmissible by human ectoparasites such as lice, and that Y. pestis was able to persist for months in the soil, which is a source of reinfection for burrowing mammals. The analyses of seven complete genome sequences from the Bronze Age indicated that Y. pestis was probably not an ectoparasite-borne pathogen in these populations. Further analyses of 14 genomes indicated that the Justinian pandemic strains may have formed a clade distinct from the one responsible for the second pandemic, spanning in Y. pestis branch 1, which also comprises the third pandemic strains. Further palaeomicrobiologic studies must tightly connect with historical and anthropologic studies to resolve questions regarding the actual sources of plague in ancient populations, alternative routes of transmission and resistance traits. Answering these questions will broaden our understanding of plague epidemiology so we may better face the actuality of this deadly infection in countries where it remains epidemic. Copyright © 2016. Published by Elsevier Ltd.
Noradrenergic modulation of risk/reward decision making.
Montes, David R; Stopper, Colin M; Floresco, Stan B
2015-08-01
Catecholamine transmission modulates numerous cognitive and reward-related processes that can subserve more complex functions such as cost/benefit decision making. Dopamine has been shown to play an integral role in decisions involving reward uncertainty, yet there is a paucity of research investigating the contributions of noradrenaline (NA) transmission to these functions. The present study was designed to elucidate the contribution of NA to risk/reward decision making in rats, assessed with a probabilistic discounting task. We examined the effects of reducing noradrenergic transmission with the α2 agonist clonidine (10-100 μg/kg), and increasing activity at α2A receptor sites with the agonist guanfacine (0.1-1 mg/kg), the α2 antagonist yohimbine (1-3 mg/kg), and the noradrenaline transporter (NET) inhibitor atomoxetine (0.3-3 mg/kg) on probabilistic discounting. Rats chose between a small/certain reward and a larger/risky reward, wherein the probability of obtaining the larger reward either decreased (100-12.5 %) or increased (12.5-100 %) over a session. In well-trained rats, clonidine reduced risky choice by decreasing reward sensitivity, whereas guanfacine did not affect choice behavior. Yohimbine impaired adjustments in decision biases as reward probability changed within a session by altering negative feedback sensitivity. In a subset of rats that displayed prominent discounting of probabilistic rewards, the lowest dose of atomoxetine increased preference for the large/risky reward when this option had greater long-term utility. These data highlight an important and previously uncharacterized role for noradrenergic transmission in mediating different aspects of risk/reward decision making and mediating reward and negative feedback sensitivity.
When can scientific studies promote consensus among conflicting stakeholders?
Small, Mitchell J; Güvenç, Ümit; DeKay, Michael L
2014-11-01
While scientific studies may help conflicting stakeholders come to agreement on a best management option or policy, often they do not. We review the factors affecting trust in the efficacy and objectivity of scientific studies in an analytical-deliberative process where conflict is present, and show how they may be incorporated in an extension to the traditional Bayesian decision model. The extended framework considers stakeholders who differ in their prior beliefs regarding the probability of possible outcomes (in particular, whether a proposed technology is hazardous), differ in their valuations of these outcomes, and differ in their assessment of the ability of a proposed study to resolve the uncertainty in the outcomes and their hazards--as measured by their perceived false positive and false negative rates for the study. The Bayesian model predicts stakeholder-specific preposterior probabilities of consensus, as well as pathways for increasing these probabilities, providing important insights into the value of scientific information in an analytic-deliberative decision process where agreement is sought. It also helps to identify the interactions among perceived risk and benefit allocations, scientific beliefs, and trust in proposed scientific studies when determining whether a consensus can be achieved. The article provides examples to illustrate the method, including an adaptation of a recent decision analysis for managing the health risks of electromagnetic fields from high voltage transmission lines. © 2014 Society for Risk Analysis.
Statistical analysis of dislocations and dislocation boundaries from EBSD data.
Moussa, C; Bernacki, M; Besnard, R; Bozzolo, N
2017-08-01
Electron BackScatter Diffraction (EBSD) is often used for semi-quantitative analysis of dislocations in metals. In general, disorientation is used to assess Geometrically Necessary Dislocations (GNDs) densities. In the present paper, we demonstrate that the use of disorientation can lead to inaccurate results. For example, using the disorientation leads to different GND density in recrystallized grains which cannot be physically justified. The use of disorientation gradients allows accounting for measurement noise and leads to more accurate results. Misorientation gradient is then used to analyze dislocations boundaries following the same principle applied on TEM data before. In previous papers, dislocations boundaries were defined as Geometrically Necessary Boundaries (GNBs) and Incidental Dislocation Boundaries (IDBs). It has been demonstrated in the past, through transmission electron microscopy data, that the probability density distribution of the disorientation of IDBs and GNBs can be described with a linear combination of two Rayleigh functions. Such function can also describe the probability density of disorientation gradient obtained through EBSD data as reported in this paper. This opens the route for determining IDBs and GNBs probability density distribution functions separately from EBSD data, with an increased statistical relevance as compared to TEM data. The method is applied on deformed Tantalum where grains exhibit dislocation boundaries, as observed using electron channeling contrast imaging. Copyright © 2017 Elsevier B.V. All rights reserved.
A study of the vacancy loop formation probability in Ni-Cu and Ag-Pd alloys. [50-keV Kr sup + ions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smalinskas, K.; Chen, Gengsheng; Haworth, J.
1992-04-01
The molten-zone model of vacancy loop formation from a displacement cascade predicts that the loop formation probability should scale with the melting temperature. To investigate this possibility the vacancy loop formation probability has been determined in a series of Cu-Ni and Ag-Pd alloys. The irradiations were performed at room temperature with 50 keV Kr+ ions and the resulting damage structure was examined by using transmission electron microscopy. In the Cu-Ni alloy series, the change in loop formation probability with increasing Ni concentration was complex, and at low- and high- nickel concentrations, the defect yield did not change in the predictedmore » manner. The defect yield was higher in the Cu-rich alloys than in the Ni-rich alloys. In the Ag-Pd alloy the change in the loop formation probability followed more closely the change in melting temperature, but no simple relationship was determined.« less
A low delay transmission method of multi-channel video based on FPGA
NASA Astrophysics Data System (ADS)
Fu, Weijian; Wei, Baozhi; Li, Xiaobin; Wang, Quan; Hu, Xiaofei
2018-03-01
In order to guarantee the fluency of multi-channel video transmission in video monitoring scenarios, we designed a kind of video format conversion method based on FPGA and its DMA scheduling for video data, reduces the overall video transmission delay.In order to sace the time in the conversion process, the parallel ability of FPGA is used to video format conversion. In order to improve the direct memory access (DMA) writing transmission rate of PCIe bus, a DMA scheduling method based on asynchronous command buffer is proposed. The experimental results show that this paper designs a low delay transmission method based on FPGA, which increases the DMA writing transmission rate by 34% compared with the existing method, and then the video overall delay is reduced to 23.6ms.
Grobusch, Martin P.; Gautret, Philippe; Kuhn, Susan; Lim, Poh Lian; Yates, Johnnie; McCarthy, Anne E.; Rothe, Camilla; Kato, Yasuyuki; Huber, Kristina; Schwartz, Eli; Shaw, Marc T. M.; Rapp, Christophe; Blumberg, Lucille; Jensenius, Mogens; van Genderen, Perry J. J.
2017-01-01
Background Zika virus (ZIKV) was first isolated in Africa; decades later, caused large outbreaks in the Pacific, and is considered endemic in Asia. We aim to describe ZIKV disease epidemiology outside the Americas, the importance of travelers as sentinels of disease transmission, and discrepancies in travel advisories from major international health organizations. Methods and findings This descriptive analysis using GeoSentinel Surveillance Network records involves sixty-four travel and tropical medicine clinics in 29 countries. Ill returned travelers with a confirmed or probable diagnosis of ZIKV disease acquired in Africa, Asia and the Pacific seen between 1 January 2012 and 31 December 2016 are included, and the frequencies of demographic, trip, and diagnostic characteristics described. ZIKV was acquired in Asia (18), the Pacific (10) and Africa (1). For five countries (Indonesia, Philippines, Thailand, Vietnam, Cameroon), GeoSentinel patients were sentinel markers of recent Zika activity. Additionally, the first confirmed ZIKV infection acquired in Kiribati was reported to GeoSentinel (2015), and a probable case was reported from Timor Leste (April 2016), representing the only case known to date. Review of Zika situation updates from major international health authorities for country risk classifications shows heterogeneity in ZIKV country travel advisories. Conclusions Travelers are integral to the global spread of ZIKV, serving as sentinel markers of disease activity. Although GeoSentinel data are collected by specialized clinics and do not capture all imported cases, we show that surveillance of imported infections by returned travelers augments local surveillance system data regarding ZIKV epidemiology and can assist with risk categorization by international authorities. However, travel advisories are variable due to risk uncertainties. PMID:28973011
Optimizing Retransmission Threshold in Wireless Sensor Networks
Bi, Ran; Li, Yingshu; Tan, Guozhen; Sun, Liang
2016-01-01
The retransmission threshold in wireless sensor networks is critical to the latency of data delivery in the networks. However, existing works on data transmission in sensor networks did not consider the optimization of the retransmission threshold, and they simply set the same retransmission threshold for all sensor nodes in advance. The method did not take link quality and delay requirement into account, which decreases the probability of a packet passing its delivery path within a given deadline. This paper investigates the problem of finding optimal retransmission thresholds for relay nodes along a delivery path in a sensor network. The object of optimizing retransmission thresholds is to maximize the summation of the probability of the packet being successfully delivered to the next relay node or destination node in time. A dynamic programming-based distributed algorithm for finding optimal retransmission thresholds for relay nodes along a delivery path in the sensor network is proposed. The time complexity is OnΔ·max1≤i≤n{ui}, where ui is the given upper bound of the retransmission threshold of sensor node i in a given delivery path, n is the length of the delivery path and Δ is the given upper bound of the transmission delay of the delivery path. If Δ is greater than the polynomial, to reduce the time complexity, a linear programming-based (1+pmin)-approximation algorithm is proposed. Furthermore, when the ranges of the upper and lower bounds of retransmission thresholds are big enough, a Lagrange multiplier-based distributed O(1)-approximation algorithm with time complexity O(1) is proposed. Experimental results show that the proposed algorithms have better performance. PMID:27171092
Escamilla, Veronica; Chibwesha, Carla J.; Gartland, Matthew; Chintu, Namwinga; Mubiana-Mbewe, Mwangelwa; Musokotwane, Kebby; Musonda, Patrick; Miller, William C.; Stringer, Jeffrey S. A.; Chi, Benjamin H.
2016-01-01
Background In rural settings, HIV-infected pregnant women often live significant distances from facilities that provide prevention of mother-to-child transmission (PMTCT) services. Methods We implemented a pilot project to offer universal maternal combination antiretroviral regimens in 4 clinics in rural Zambia. To evaluate the impact of services, we conducted a household survey in communities surrounding each facility. We collected information about HIV status and antenatal service utilization from women who delivered in the past two years. Using household global positing systems coordinates collected in the survey, we measured Euclidean (i.e., straight line) distance between individual households and clinics. Multivariable logistic regression and predicted probabilities were used to determine associations between distance and uptake of any PMTCT regimen and combination antiretroviral regimens specifically. Results From March to December 2011, 390 HIV-infected mothers were surveyed across four communities. Of these, 254 (65%) had household geographical coordinates documented. 168 women reported use of a PMTCT regimen during pregnancy, including 102 who initiated a combination antiretroviral regimen. The probability of PMTCT regimen initiation was highest within 1.9 km of the facility and gradually declined. Overall, 103 of 145 (71%) who lived within 1.9 km of the facility initiated PMTCT, versus 65 of 109 (60%) who lived farther away. For every kilometer increase, the association with PMTCT regimen uptake (adjusted odds ratio [AOR]: 0.90, 95%CI: 0.82—0.99) and combination antiretroviral regimen uptake (AOR: 0.88, 95%CI: 0.80—0.97) decreased. Conclusions In this rural African setting, uptake of PMTCT regimens was influenced by distance to health facility. Program models that further decentralize care into remote communities are urgently needed. PMID:26470035
Liu, Yang; Han, Guangjie; Shi, Sulong; Li, Zhengquan
2018-06-20
This study investigates the superiority of cooperative broadcast transmission over traditional orthogonal schemes when applied in a downlink relaying broadcast channel (RBC). Two proposed cooperative broadcast transmission protocols, one with an amplify-and-forward (AF) relay, and the other with a repetition-based decode-and-forward (DF) relay, are investigated. By utilizing superposition coding (SupC), the source and the relay transmit the private user messages simultaneously instead of sequentially as in traditional orthogonal schemes, which means the channel resources are reused and an increased channel degree of freedom is available to each user, hence the half-duplex penalty of relaying is alleviated. To facilitate a performance evaluation, theoretical outage probability expressions of the two broadcast transmission schemes are developed, based on which, we investigate the minimum total power consumption of each scheme for a given traffic requirement by numerical simulation. The results provide details on the overall system performance and fruitful insights on the essential characteristics of cooperative broadcast transmission in RBCs. It is observed that better overall outage performances and considerable power gains can be obtained by utilizing cooperative broadcast transmissions compared to traditional orthogonal schemes.
The trophic vacuum and the evolution of complex life cycles in trophically transmitted helminths
Benesh, Daniel P.; Chubb, James C.; Parker, Geoff A.
2014-01-01
Parasitic worms (helminths) frequently have complex life cycles in which they are transmitted trophically between two or more successive hosts. Sexual reproduction often takes place in high trophic-level (TL) vertebrates, where parasites can grow to large sizes with high fecundity. Direct infection of high TL hosts, while advantageous, may be unachievable for parasites constrained to transmit trophically, because helminth propagules are unlikely to be ingested by large predators. Lack of niche overlap between propagule and definitive host (the trophic transmission vacuum) may explain the origin and/or maintenance of intermediate hosts, which overcome this transmission barrier. We show that nematodes infecting high TL definitive hosts tend to have more successive hosts in their life cycles. This relationship was modest, though, driven mainly by the minimum TL of hosts, suggesting that the shortest trophic chains leading to a host define the boundaries of the transmission vacuum. We also show that alternative modes of transmission, like host penetration, allow nematodes to reach high TLs without intermediate hosts. We suggest that widespread omnivory as well as parasite adaptations to increase transmission probably reduce, but do not eliminate, the barriers to the transmission of helminths through the food web. PMID:25209937
[Determination of wine original regions using information fusion of NIR and MIR spectroscopy].
Xiang, Ling-Li; Li, Meng-Hua; Li, Jing-Mingz; Li, Jun-Hui; Zhang, Lu-Da; Zhao, Long-Lian
2014-10-01
Geographical origins of wine grapes are significant factors affecting wine quality and wine prices. Tasters' evaluation is a good method but has some limitations. It is important to discriminate different wine original regions quickly and accurately. The present paper proposed a method to determine wine original regions based on Bayesian information fusion that fused near-infrared (NIR) transmission spectra information and mid-infrared (MIR) ATR spectra information of wines. This method improved the determination results by expanding the sources of analysis information. NIR spectra and MIR spectra of 153 wine samples from four different regions of grape growing were collected by near-infrared and mid-infrared Fourier transform spe trometer separately. These four different regions are Huailai, Yantai, Gansu and Changli, which areall typical geographical originals for Chinese wines. NIR and MIR discriminant models for wine regions were established using partial least squares discriminant analysis (PLS-DA) based on NIR spectra and MIR spectra separately. In PLS-DA, the regions of wine samples are presented in group of binary code. There are four wine regions in this paper, thereby using four nodes standing for categorical variables. The output nodes values for each sample in NIR and MIR models were normalized first. These values stand for the probabilities of each sample belonging to each category. They seemed as the input to the Bayesian discriminant formula as a priori probability value. The probabilities were substituteed into the Bayesian formula to get posterior probabilities, by which we can judge the new class characteristics of these samples. Considering the stability of PLS-DA models, all the wine samples were divided into calibration sets and validation sets randomly for ten times. The results of NIR and MIR discriminant models of four wine regions were as follows: the average accuracy rates of calibration sets were 78.21% (NIR) and 82.57% (MIR), and the average accuracy rates of validation sets were 82.50% (NIR) and 81.98% (MIR). After using the method proposed in this paper, the accuracy rates of calibration and validation changed to 87.11% and 90.87% separately, which all achieved better results of determination than individual spectroscopy. These results suggest that Bayesian information fusion of NIR and MIR spectra is feasible for fast identification of wine original regions.
The feasibility of age-specific travel restrictions during influenza pandemics
2011-01-01
Background Epidemiological studies have shown that imposing travel restrictions to prevent or delay an influenza pandemic may not be feasible. To delay an epidemic substantially, an extremely high proportion of trips (~99%) would have to be restricted in a homogeneously mixing population. Influenza is, however, strongly influenced by age-dependent transmission dynamics, and the effectiveness of age-specific travel restrictions, such as the selective restriction of travel by children, has yet to be examined. Methods A simple stochastic model was developed to describe the importation of infectious cases into a population and to model local chains of transmission seeded by imported cases. The probability of a local epidemic, and the time period until a major epidemic takes off, were used as outcome measures, and travel restriction policies in which children or adults were preferentially restricted were compared to age-blind restriction policies using an age-dependent next generation matrix parameterized for influenza H1N1-2009. Results Restricting children from travelling would yield greater reductions to the short-term risk of the epidemic being established locally than other policy options considered, and potentially could delay an epidemic for a few weeks. However, given a scenario with a total of 500 imported cases over a period of a few months, a substantial reduction in the probability of an epidemic in this time period is possible only if the transmission potential were low and assortativity (i.e. the proportion of contacts within-group) were unrealistically high. In all other scenarios considered, age-structured travel restrictions would not prevent an epidemic and would not delay the epidemic for longer than a few weeks. Conclusions Selectively restricting children from traveling overseas during a pandemic may potentially delay its arrival for a few weeks, depending on the characteristics of the pandemic strain, but could have less of an impact on the economy compared to restricting adult travelers. However, as long as adults have at least a moderate potential to trigger an epidemic, selectively restricting the higher risk group (children) may not be a practical option to delay the arrival of an epidemic substantially. PMID:22078655
Almario, Christopher V.; May, Folasade P.; Shaheen, Nicholas J.; Murthy, Rekha; Gupta, Kapil; Jamil, Laith H.; Lo, Simon K.; Spiegel, Brennan M.R.
2015-01-01
OBJECTIVES Prior reports have linked patient transmission of carbapenem-resistant Enterobacteriaceae (CRE, or “superbug”) to endoscopes used during endoscopic retrograde cholangiopancreatography (ERCP). We performed a decision analysis to measure the cost-effectiveness of four competing strategies for CRE risk management. METHODS We used decision analysis to calculate the cost-effectiveness of four approaches to reduce the risk of CRE transmission among patients presenting to the hospital for symptomatic common bile duct stones. The strategies included: (1) perform ERCP followed by U.S. Food and Drug Administration (FDA)-recommended endoscope reprocessing procedures; (2) perform ERCP followed by “endoscope culture and hold”; (3) perform ERCP followed by ethylene oxide (EtO) sterilization of the endoscope; and (4) stop performing ERCP in lieu of laparoscopic cholecystectomy (LC) with common bile duct exploration (CBDE). Our outcome was incremental cost per quality-adjusted life year (QALY) gained. RESULTS In the base-case scenario, ERCP with FDA-recommended endoscope reprocessing was the most cost-effective strategy. Both the ERCP with culture and hold ($4,228,170/QALY) and ERCP with EtO sterilization ($50,572,348/QALY) strategies had unacceptable incremental costs per QALY gained. LC with CBDE was dominated, being both more costly and marginally less effective versus the alternatives. In sensitivity analysis, ERCP with culture and hold became the most cost-effective approach when the pretest probability of CRE exceeded 24%. CONCLUSIONS In institutions with a low CRE prevalence, ERCP with FDA-recommended reprocessing is the most cost-effective approach for mitigating CRE transmission risk. Only in settings with an extremely high CRE prevalence did ERCP with culture and hold become cost-effective. PMID:26526083
The random coding bound is tight for the average code.
NASA Technical Reports Server (NTRS)
Gallager, R. G.
1973-01-01
The random coding bound of information theory provides a well-known upper bound to the probability of decoding error for the best code of a given rate and block length. The bound is constructed by upperbounding the average error probability over an ensemble of codes. The bound is known to give the correct exponential dependence of error probability on block length for transmission rates above the critical rate, but it gives an incorrect exponential dependence at rates below a second lower critical rate. Here we derive an asymptotic expression for the average error probability over the ensemble of codes used in the random coding bound. The result shows that the weakness of the random coding bound at rates below the second critical rate is due not to upperbounding the ensemble average, but rather to the fact that the best codes are much better than the average at low rates.
Grain neighbour effects on twin transmission in hexagonal close-packed materials
NASA Astrophysics Data System (ADS)
Arul Kumar, M.; Beyerlein, I. J.; McCabe, R. J.; Tomé, C. N.
2016-12-01
Materials with a hexagonal close-packed (hcp) crystal structure such as Mg, Ti and Zr are being used in the transportation, aerospace and nuclear industry, respectively. Material strength and formability are critical qualities for shaping these materials into parts and a pervasive deformation mechanism that significantly affects their formability is deformation twinning. The interaction between grain boundaries and twins has an important influence on the deformation behaviour and fracture of hcp metals. Here, statistical analysis of large data sets reveals that whether twins transmit across grain boundaries depends not only on crystallography but also strongly on the anisotropy in crystallographic slip. We show that increases in crystal plastic anisotropy enhance the probability of twin transmission by comparing the relative ease of twin transmission in hcp materials such as Mg, Zr and Ti.
Grain neighbour effects on twin transmission in hexagonal close-packed materials.
Arul Kumar, M; Beyerlein, I J; McCabe, R J; Tomé, C N
2016-12-19
Materials with a hexagonal close-packed (hcp) crystal structure such as Mg, Ti and Zr are being used in the transportation, aerospace and nuclear industry, respectively. Material strength and formability are critical qualities for shaping these materials into parts and a pervasive deformation mechanism that significantly affects their formability is deformation twinning. The interaction between grain boundaries and twins has an important influence on the deformation behaviour and fracture of hcp metals. Here, statistical analysis of large data sets reveals that whether twins transmit across grain boundaries depends not only on crystallography but also strongly on the anisotropy in crystallographic slip. We show that increases in crystal plastic anisotropy enhance the probability of twin transmission by comparing the relative ease of twin transmission in hcp materials such as Mg, Zr and Ti.
NASA Astrophysics Data System (ADS)
Halloran, Siobhan; Ristenpart, William
2013-11-01
Virologists and other researchers who test pathogens for airborne disease transmissibility often place a test animal downstream from an inoculated animal and later determine whether the test animal became infected. Despite the crucial role of the airflow in pathogen transmission between the animals, to date the infectious disease community has paid little attention to the effect of airspeed or turbulent intensity on the probability of transmission. Here we present measurements of the turbulent dispersivity under conditions relevant to experimental tests of airborne disease transmissibility between laboratory animals. We used time lapse photography to visualize the downstream transport and turbulent dispersion of smoke particulates released from a point source downstream of an axial fan, thus mimicking the release and transport of expiratory aerosols exhaled by an inoculated animal. We show that for fan-generated turbulence the plume width is invariant with the mean airspeed and, close to the point source, increases linearly with downstream position. Importantly, the turbulent dispersivity is insensitive to the presence of meshes placed downstream from the point source, indicating that the fan length scale dictates the turbulent intensity and corresponding dispersivity.
Abrahams, M.-R.; Anderson, J. A.; Giorgi, E. E.; Seoighe, C.; Mlisana, K.; Ping, L.-H.; Athreya, G. S.; Treurnicht, F. K.; Keele, B. F.; Wood, N.; Salazar-Gonzalez, J. F.; Bhattacharya, T.; Chu, H.; Hoffman, I.; Galvin, S.; Mapanje, C.; Kazembe, P.; Thebus, R.; Fiscus, S.; Hide, W.; Cohen, M. S.; Karim, S. Abdool; Haynes, B. F.; Shaw, G. M.; Hahn, B. H.; Korber, B. T.; Swanstrom, R.; Williamson, C.
2009-01-01
Identifying the specific genetic characteristics of successfully transmitted variants may prove central to the development of effective vaccine and microbicide interventions. Although human immunodeficiency virus transmission is associated with a population bottleneck, the extent to which different factors influence the diversity of transmitted viruses is unclear. We estimate here the number of transmitted variants in 69 heterosexual men and women with primary subtype C infections. From 1,505 env sequences obtained using a single genome amplification approach we show that 78% of infections involved single variant transmission and 22% involved multiple variant transmissions (median of 3). We found evidence for mutations selected for cytotoxic-T-lymphocyte or antibody escape and a high prevalence of recombination in individuals infected with multiple variants representing another potential escape pathway in these individuals. In a combined analysis of 171 subtype B and C transmission events, we found that infection with more than one variant does not follow a Poisson distribution, indicating that transmission of individual virions cannot be seen as independent events, each occurring with low probability. While most transmissions resulted from a single infectious unit, multiple variant transmissions represent a significant fraction of transmission events, suggesting that there may be important mechanistic differences between these groups that are not yet understood. PMID:19193811
Slyker, Jennifer; Farquhar, Carey; Atkinson, Claire; Ásbjörnsdóttir, Kristjana; Roxby, Alison; Drake, Alison; Kiarie, James; Wald, Anna; Boeckh, Michael; Richardson, Barbra; Odem-Davis, Katherine; John-Stewart, Grace; Emery, Vincent
2014-01-01
Background. Cytomegalovirus (CMV) infection is associated with adverse outcomes in human immunodeficiency virus (HIV)–exposed infants. Determinants of vertical CMV transmission in the setting of maternal HIV-1 infection are not well-defined. Methods. CMV and HIV-1 levels were measured in plasma, cervical secretions, and breast milk of 147 HIV-1–infected women to define correlates of maternal CMV replication and infant CMV acquisition. Results. Although few women had detectable CMV in plasma (4.8%), the majority had detectable CMV DNA in cervical secretions (66%) and breast milk (99%). There was a strong association between cervical CMV detection during pregnancy and later breast milk levels (β = 0.47; P = .005). Plasma HIV-1 level and CD4 counts were associated with CMV in the cervix and breast milk. However HIV-1 levels within the cervix and breast milk were not associated with CMV within these compartments. Maternal breast milk CMV levels (hazard ratio [HR], 1.4; P = .003) and maternal CD4 < 450 cells/mm3 (HR, 1.8; P = .008) were independently associated with infant CMV acquisition; each log10 increase in breast milk CMV was associated with a 40% increase in infant infection. The breast milk CMV level required to attain a 50% probability of CMV transmission increased with higher maternal CD4 counts, increasing from 3.55 log10 CMV DNA copies/mL at a CD4 count of 350 cells/mm3 to 5.50 log10 CMV DNA copies/mL at a CD4 count of 1000 cells/mm3. Conclusions. Breast milk CMV levels and maternal CD4 count are major determinants of CMV transmission in the setting of maternal HIV-1. Maternal immune reconstitution or lowering breast milk CMV levels may reduce vertical CMV transmission. PMID:24192386
NASA Astrophysics Data System (ADS)
Sheldrake, L.; Mitchell, D.; Allen, M. R.
2015-12-01
Temperature and precipitation limit areas of stable malaria transmission, but the effects of climate change on the disease remain controversial. Previously, studies have not separated the influence of anthropogenic climate change and natural variability, despite being an essential step in the attribution of climate change impacts. Ensembles of 2900 simulations of regional climate in sub-Saharan Africa for the year 2013, one representing realistic conditions and the other how climate might have been in the absence of human influence, were used to force a P.falciparium climate suitability model developed by the Mapping Malaria Risk in Africa project. Strongest signals were detected in areas of unstable transmission, indicating their heightened sensitivity to climatic factors. Evidently, impacts of human-induced climate change were unevenly distributed: the probability of conditions being suitable for stable malaria transmission were substantially reduced (increased) in the Sahel (Greater Horn of Africa (GHOA), particularly in the Ethiopian and Kenyan highlands). The length of the transmission season was correspondingly shortened in the Sahel and extended in the GHOA, by 1 to 2 months, including in Kericho (Kenya), where the role of climate change in driving recent malaria occurrence is hotly contested. Human-induced warming was primarily responsible for positive anomalies in the GHOA, while reduced rainfall caused negative anomalies in the Sahel. The latter was associated with anthropogenic impacts on the West African Monsoon, but uncertainty in the RCM's ability to reproduce precipitation trends in the region weakens confidence in the result. That said, outputs correspond well with broad-scale changes in observed endemicity, implying a potentially important contribution of anthropogenic climate change to the malaria burden during the past century. Results support the health-framing of climate risk and help indicate hotspots of climate vulnerability, providing information to direct control interventions and investment, and allude to climate injustices. Extending methods, such as by using multiple climate and malaria models and investigating trends over longer timescales, would make results more generally applicable and improve their policy relevance.
Orchi, Nicoletta; Gori, Caterina; Bertoli, Ada; Forbici, Federica; Montella, Francesco; Pennica, Alfredo; De Carli, Gabriella; Giuliani, Massimo; Continenza, Fabio; Pinnetti, Carmela; Nicastri, Emanuele; Ceccherini-Silberstein, Francesca; Mastroianni, Claudio Maria; Girardi, Enrico; Andreoni, Massimo; Antinori, Andrea; Santoro, Maria Mercedes; Perno, Carlo Federico
2015-01-01
Background Increased evidence of relevant HIV-1 epidemic transmission in European countries is being reported, with an increased circulation of non-B-subtypes. Here, we present two recent HIV-1 non-B transmission clusters characterized by NNRTI-related amino-acidic mutations among newly diagnosed HIV-1 infected men, living in Rome (Central-Italy). Methods Pol and V3 sequences were available at the time of diagnosis for all individuals. Maximum-Likelihood and Bayesian phylogenetic-trees with bootstrap and Bayesian-probability supports defined transmission-clusters. HIV-1 drug-resistance and V3-tropism were also evaluated. Results Among 534 new HIV-1 non-B cases, diagnosed from 2011 to 2014, in Central-Italy, 35 carried virus gathering in two distinct clusters, including 27 HIV-1 C and 8 CRF17_BF subtypes, respectively. Both clusters were centralized in Rome, and their origin was estimated to have been after 2007. All individuals within both clusters were males and 37.1% of them had been recently-infected. While C-cluster was entirely composed by Italian men-who-have-sex-with-men, with a median-age of 34 years (IQR:30–39), individuals in CRF17_BF-cluster were older, with a median-age of 51 years (IQR:48–59) and almost all reported sexual-contacts with men and women. All carried R5-tropic viruses, with evidence of atypical or resistance amino-acidic mutations related to NNRTI-drugs (K103Q in C-cluster, and K101E+E138K in CRF17_BF-cluster). Conclusions These two epidemiological clusters provided evidence of a strong and recent circulation of C and CRF17_BF strains in central Italy, characterized by NNRTI-related mutations among men engaging in high-risk behaviours. These findings underline the role of molecular epidemiology in identifying groups at increased risk of HIV-1 transmission, and in enhancing additional prevention efforts. PMID:26270824
Peridomestic Infection as a Determining Factor of Dengue Transmission
Martínez-Vega, Ruth Aralí; Danis-Lozano, Rogelio; Díaz-Quijano, Fredi Alexander; Velasco-Hernández, Jorge; Santos-Luna, René; Román-Pérez, Susana; Kuri-Morales, Pablo; Ramos-Castañeda, José
2015-01-01
Background The study of endemic dengue transmission is essential for proposing alternatives to impact its burden. The traditional paradigm establishes that transmission starts around cases, but there are few studies that determine the risk. Methods To assess the association between the peridomestic dengue infection and the exposure to a dengue index case (IC), a cohort was carried out in two Mexican endemic communities. People cohabitating with IC or living within a 50-meter radius (exposed cohort) and subjects of areas with no ICs in a 200-meter radius (unexposed cohort) were included. Results Exposure was associated with DENV infection in cohabitants (PRa 3.55; 95%CI 2.37–5.31) or neighbors (PRa 1.82; 95%CI 1.29–2.58). Age, location, toilets with no direct water discharge, families with children younger than 5 and the House Index, were associated with infection. Families with older than 13 were associated with a decreased frequency. After a month since the IC fever onset, the infection incidence was not influenced by exposure to an IC or vector density; it was influenced by the local seasonal behavior of dengue and the age. Additionally, we found asymptomatic infections accounted for 60% and a greater age was a protective factor for the presence of symptoms (RR 0.98; 95%CI 0.97–0.99). Conclusion The evidence suggests that dengue endemic transmission in these locations is initially peridomestic, around an infected subject who may be asymptomatic due to demographic structure and endemicity, and it is influenced by other characteristics of the individual, the neighborhood and the location. Once the transmission chain has been established, dengue spreads in the community probably by the adults who, despite being the group with lower infection frequency, mostly suffer asymptomatic infections and have higher mobility. This scenario complicates the opportunity and the effectiveness of control programs and highlights the need to apply multiple measures for dengue control. PMID:26671573
Ishikawa, Naoko; Shimbo, Takuro; Miyano, Shinsuke; Sikazwe, Izukanji; Mwango, Albert; Ghidinelli, Massimo N.; Syakantu, Gardner
2014-01-01
Background Countries are currently progressing towards the elimination of new paediatric HIV infections by 2015. WHO published new consolidated guidelines in June 2013, which now recommend either ‘Antiretroviral drugs (ARVs) for women living with HIV during pregnancy and breastfeeding (Option B)’ or ‘Lifelong antiretroviral therapy (ART) for all pregnant and breastfeeding women living with HIV (Option B+)’, while de facto phasing out Option A. This study examined health outcomes and cost impact of the shift to WHO 2013 recommendations in Zambia. Methods A decision analytic model was developed based on the national health system perspective. Estimated risk and number of cases of HIV transmission to infants and to serodiscordant partners, and proportions of HIV-infected pregnant women with CD4 count of ≤350 cells/mm3 to initiate ART were compared between 2010 Option A and the 2013 recommendations. Total costs of prevention of mother-to-child transmission of HIV (PMTCT) services per annual cohort of pregnant women, incremental cost-effectiveness ratio (ICER) per infection averted and quality-adjusted life-year (QALY) gained were examined. Results Our analysis suggested that the shift from 2010 Option A to the 2013 guidelines would result in a 33% reduction of the risk of HIV transmission among exposed infants. The risk of transmission to serodiscordant partners for a period of 24 months would be reduced by 72% with ‘ARVs during pregnancy and breastfeeding’ and further reduced by 15% with ‘Lifelong ART’. The probability of HIV-infected pregnant women to initiate ART would increase by 80%. It was also suggested that while the shift would generate higher PMTCT costs, it would be cost-saving in the long term as it spares future treatment costs by preventing infections in infants and partners. Conclusion The shift to the WHO 2013 guidelines in Zambia would positively impact health of family and save future costs related to care and treatment. PMID:24604067
NASA Astrophysics Data System (ADS)
Hwang, Eunju; Kim, Kyung Jae; Roijers, Frank; Choi, Bong Dae
In the centralized polling mode in IEEE 802.16e, a base station (BS) polls mobile stations (MSs) for bandwidth reservation in one of three polling modes; unicast, multicast, or broadcast pollings. In unicast polling, the BS polls each individual MS to allow to transmit a bandwidth request packet. This paper presents an analytical model for the unicast polling of bandwidth request in IEEE 802.16e networks over Gilbert-Elliot error channel. We derive the probability distribution for the delay of bandwidth requests due to wireless transmission errors and find the loss probability of request packets due to finite retransmission attempts. By using the delay distribution and the loss probability, we optimize the number of polling slots within a frame and the maximum retransmission number while satisfying QoS on the total loss probability which combines two losses: packet loss due to the excess of maximum retransmission and delay outage loss due to the maximum tolerable delay bound. In addition, we obtain the utilization of polling slots, which is defined as the ratio of the number of polling slots used for the MS's successful transmission to the total number of polling slots used by the MS over a long run time. Analysis results are shown to well match with simulation results. Numerical results give examples of the optimal number of polling slots within a frame and the optimal maximum retransmission number depending on delay bounds, the number of MSs, and the channel conditions.
Secondary electron imaging of monolayer materials inside a transmission electron microscope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cretu, Ovidiu, E-mail: cretu.ovidiu@nims.go.jp; Lin, Yung-Chang; Suenaga, Kazutomo
2015-08-10
A scanning transmission electron microscope equipped with a backscattered and secondary electron detector is shown capable to image graphene and hexagonal boron nitride monolayers. Secondary electron contrasts of the two lightest monolayer materials are clearly distinguished from the vacuum level. A signal difference between these two materials is attributed to electronic structure differences, which will influence the escape probabilities of the secondary electrons. Our results show that the secondary electron signal can be used to distinguish between the electronic structures of materials with atomic layer sensitivity, enhancing its applicability as a complementary signal in the analytical microscope.
Method and apparatus for free-space quantum key distribution in daylight
Hughes, Richard J.; Buttler, William T.; Lamoreaux, Steve K.; Morgan, George L.; Nordholt, Jane E.; Peterson, C. Glen; Kwiat, Paul G.
2004-06-08
A quantum cryptography apparatus securely generates a key to be used for secure transmission between a sender and a receiver connected by an atmospheric transmission link. A first laser outputs a timing bright light pulse; other lasers output polarized optical data pulses after having been enabled by a random bit generator. Output optics transmit output light from the lasers that is received by receiving optics. A first beam splitter receives light from the receiving optics, where a received timing bright light pulse is directed to a delay circuit for establishing a timing window for receiving light from the lasers and where an optical data pulse from one of the lasers has a probability of being either transmitted by the beam splitter or reflected by the beam splitter. A first polarizer receives transmitted optical data pulses to output one data bit value and a second polarizer receives reflected optical data pulses to output a second data bit value. A computer receives pulses representing receipt of a timing bright timing pulse and the first and second data bit values, where receipt of the first and second data bit values is indexed by the bright timing pulse.
Ogawa, K
1992-01-01
This paper proposes a new evaluation and prediction method for computer usability. This method is based on our two previously proposed information transmission measures created from a human-to-computer information transmission model. The model has three information transmission levels: the device, software, and task content levels. Two measures, called the device independent information measure (DI) and the computer independent information measure (CI), defined on the software and task content levels respectively, are given as the amount of information transmitted. Two information transmission rates are defined as DI/T and CI/T, where T is the task completion time: the device independent information transmission rate (RDI), and the computer independent information transmission rate (RCI). The method utilizes the RDI and RCI rates to evaluate relatively the usability of software and device operations on different computer systems. Experiments using three different systems, in this case a graphical information input task, confirm that the method offers an efficient way of determining computer usability.
Albert, Jan; Berglund, Torsten; Gisslén, Magnus; Gröön, Peter; Sönnerborg, Anders; Tegnell, Anders; Alexandersson, Anders; Berggren, Ingela; Blaxhult, Anders; Brytting, Maria; Carlander, Christina; Carlson, Johan; Flamholc, Leo; Follin, Per; Haggar, Axana; Hansdotter, Frida; Josephson, Filip; Karlström, Olle; Liljeros, Fredrik; Navér, Lars; Pettersson, Karin; Johansson, Veronica Svedhem; Svennerholm, Bo; Tunbäck, Petra; Widgren, Katarina
2014-10-01
The modern medical treatment of HIV with antiretroviral therapy (ART) has drastically reduced the morbidity and mortality in patients infected with this virus. ART has also been shown to reduce the transmission risk from individual patients as well as the spread of the infection at the population level. This position statement from the Public Health Agency of Sweden and the Swedish Reference Group for Antiviral Therapy is based on a workshop organized in the fall of 2012. It summarizes the latest research and knowledge on the risk of HIV transmission from patients on ART, with a focus on the risk of sexual transmission. The risk of transmission via shared injection equipment among intravenous drug users is also examined, as is the risk of mother-to-child transmission. Based on current knowledge, the risk of transmission through vaginal or anal intercourse involving the use of a condom has been judged to be minimal, provided that the person infected with HIV fulfils the criteria for effective ART. This probably also applies to unprotected intercourse, provided that no other sexually transmitted infections are present, although it is not currently possible to fully support this conclusion with direct scientific evidence. ART is judged to markedly reduce the risk of blood-borne transmission between people who share injection equipment. Finally, the risk of transmission from mother to child is very low, provided that ART is started well in advance of delivery.
On a Class of Hairy Square Barriers and Gamow Vectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernandez-Garcia, N.
The second order Darboux-Gamow transformation is applied to deform square one dimensional barriers in non-relativistic quantum mechanics. The initial and the new 'hairy' potentials have the same transmission probabilities (for the appropriate parameters). In general, new Gamow vectors are constructed as Darboux deformations of the initial ones.
Shao, Jing-Yuan; Qu, Hai-Bin; Gong, Xing-Chu
2018-05-01
In this work, two algorithms (overlapping method and the probability-based method) for design space calculation were compared by using the data collected from extraction process of Codonopsis Radix as an example. In the probability-based method, experimental error was simulated to calculate the probability of reaching the standard. The effects of several parameters on the calculated design space were studied, including simulation number, step length, and the acceptable probability threshold. For the extraction process of Codonopsis Radix, 10 000 times of simulation and 0.02 for the calculation step length can lead to a satisfactory design space. In general, the overlapping method is easy to understand, and can be realized by several kinds of commercial software without coding programs, but the reliability of the process evaluation indexes when operating in the design space is not indicated. Probability-based method is complex in calculation, but can provide the reliability to ensure that the process indexes can reach the standard within the acceptable probability threshold. In addition, there is no probability mutation in the edge of design space by probability-based method. Therefore, probability-based method is recommended for design space calculation. Copyright© by the Chinese Pharmaceutical Association.
Kisch-Wedel, H; Bernreuter, P; Kemming, G; Albert, M; Zwissler, B
2009-09-01
A new technique was validated in vivo in reflectance pulse oximetry for measuring low oxygen saturations. Two pairs of light emitter/detector diodes allow for estimation of light attenuation (LA) in tissue, which is assumed to be responsible for the inaccuracy of pulse oximetry at less than 70 % arterial oxygen saturation. For validation, 17 newborn piglets were desaturated stepwise from 21 % to 1.25 % inspiratory oxygen concentration during general anesthesia, and arterial oxygen saturation was measured with the reflectance pulse oximeter adjusted for LA in tissue, with a standard transmission pulse oximeter and a hemoximeter. LA in tissue could be quantified and was different between snout and foreleg (probability level (p) < 0.05). At arterial oxygen saturations above 70 %, the bias between the methods was at 0 %-1 % and the variability 4 %-5 %. From 2 % to 100 % arterial oxygen saturation, the reflectance pulse oximeter estimated oxyhemoglobin saturation more accurately than a conventional transmission pulse oximeter (p < 0.05). At low oxygen saturations below 70 %, the bias and variability of the reflectance pulse oximeter calibration were closer to the hemoximeter measurements than the transmission pulse oximeter (p < 0.05). The variability of the reflectance pulse oximeter was slightly lower than the traditional oximeter by taking into account the LA in tissue (9 % versus 11 % -15 %, ns), and thus, the quality of the individual calibration lines improved (correlation coefficient, p < 0.05).
Airborne sound transmission loss characteristics of wood-frame construction
NASA Astrophysics Data System (ADS)
Rudder, F. F., Jr.
1985-03-01
This report summarizes the available data on the airborne sound transmission loss properties of wood-frame construction and evaluates the methods for predicting the airborne sound transmission loss. The first part of the report comprises a summary of sound transmission loss data for wood-frame interior walls and floor-ceiling construction. Data bases describing the sound transmission loss characteristics of other building components, such as windows and doors, are discussed. The second part of the report presents the prediction of the sound transmission loss of wood-frame construction. Appropriate calculation methods are described both for single-panel and for double-panel construction with sound absorption material in the cavity. With available methods, single-panel construction and double-panel construction with the panels connected by studs may be adequately characterized. Technical appendices are included that summarize laboratory measurements, compare measurement with theory, describe details of the prediction methods, and present sound transmission loss data for common building materials.
Chapman, S
1992-06-01
The concept of tertiary sexual transmission of human immunodeficiency virus (HIV) has been central to government efforts to communicate notions of risk to heterosexuals in Australia. Data on heterosexually transmitted acquired immune deficiency syndrome (AIDS) and HIV for Australia are reviewed with emphasis given to the probability of misclassification bias in the heterosexually acquired and 'other/undetermined' categories. Tertiary cases are almost certainly rare in Australia, with little evidence of any increase in their incidence since the first cases were recorded. Three factors (low probability of exposure, the infectivity of HIV and a comparatively low rate of sexual partner change) make it improbable that Australian heterosexuals with no risk factors will experience endemic HIV infection, with a caveat to this conclusion lying in the potential of Australian sex tourism to Southeast Asia for introducing HIV into the Australian heterosexual population. Four hegemonic factors which have acted to suppress any serious debate of the notion that HIV in Australia is unlikely to become endemic among heterosexuals are discussed: the political 'democratization' of risk inspired by concerns that gay men should not be further vilified as a victim group; the preventive imperative; a reluctance among health educators to question the very foundations of the message they are employed to deliver; and a reluctance to curtail 'Trojan horse' benefits to sexually transmissible disease prevention engendered by HIV education promoting safe sex messages.
Rabies transmission risks during peripartum--Two cases and a review of the literature.
Aguèmon, Christiane Tshabu; Tarantola, Arnaud; Zoumènou, Eugène; Goyet, Sophie; Assouto, Pamphile; Ly, Sowath; Mewanou, Serge; Bourhy, Hervé; Dodet, Betty; Aguèmon, Abdou-Rahmann
2016-04-04
We report two cases of probable rabies in near-term/at-term pregnant women in sub-Saharan Africa and Asia. One baby was delivered by caesarean section and the other one vaginally. Both received post-exposure prophylaxis (PEP), including RIG and vaccine and both are alive and healthy, at 9 and 24 months, respectively. We found 14 other published cases of infants born from rabid mothers. One confirmed case of rabies transmission occurred. The other children born from rabid mothers, with or without caesarean section, did not acquire rabies, and were still healthy at the time of reporting, with or without post-exposure prophylaxis. Mother-to-child transmission of rabies is possible, but rare, because rabies virus is not present in blood and exposure of the baby's mucosa to maternal infectious fluids and tissue seems limited. A conservative approach should however, be adopted, and rabies PEP, including RIG, be administered as soon as possible to babies born from probably rabid mothers. Whether cesarean-section clearly provides prevention remains unclear. Rabies can be prevented in pregnant women by PEP administration. Rabies cell-culture vaccines are safe and effective and can be administered to pregnant and lactating women, as well as newborns. Efforts must focus on raising rabies awareness in the general population, as well as in healthcare workers. Copyright © 2016 Elsevier Ltd. All rights reserved.
Doak, Daniel F; Bakker, Victoria J; Vickers, Winston
2013-04-01
Outbreaks of infectious disease represent serious threats to the viability of many vertebrate populations, but few studies have included quantitative evaluations of alternative approaches to the management of disease. The most prevalent management approach is monitoring for and rapid response to an epizootic. An alternative is vaccination of a subset of the free-living population (i.e., a "vaccinated core") such that some individuals are partially or fully immune in the event of an epizootic. We developed a simulation model describing epizootic dynamics, which we then embedded in a demographic simulation to assess these alternative approaches to managing rabies epizootics in the island fox (Urocyon littoralis), a species composed of only 6 small populations on the California Channel Islands. Although the monitor and respond approach was superior to the vaccinated-core approach for some transmission models and parameter values, this type of reactive management did not protect the population from rabies under many disease-transmission assumptions. In contrast, a logistically feasible program of prophylactic vaccination for part of the wild population yielded low extinction probabilities across all likely disease-transmission scenarios, even with recurrent disease introductions. Our use of a single metric of successful management-probability of extreme endangerment (i.e., quasi extinction)-to compare very different management approaches allowed an objective assessment of alternative strategies for controlling the threats posed by infectious disease outbreaks. © 2013 Society for Conservation Biology.
Cascading failures in ac electricity grids.
Rohden, Martin; Jung, Daniel; Tamrakar, Samyak; Kettemann, Stefan
2016-09-01
Sudden failure of a single transmission element in a power grid can induce a domino effect of cascading failures, which can lead to the isolation of a large number of consumers or even to the failure of the entire grid. Here we present results of the simulation of cascading failures in power grids, using an alternating current (AC) model. We first apply this model to a regular square grid topology. For a random placement of consumers and generators on the grid, the probability to find more than a certain number of unsupplied consumers decays as a power law and obeys a scaling law with respect to system size. Varying the transmitted power threshold above which a transmission line fails does not seem to change the power-law exponent q≈1.6. Furthermore, we study the influence of the placement of generators and consumers on the number of affected consumers and demonstrate that large clusters of generators and consumers are especially vulnerable to cascading failures. As a real-world topology, we consider the German high-voltage transmission grid. Applying the dynamic AC model and considering a random placement of consumers, we find that the probability to disconnect more than a certain number of consumers depends strongly on the threshold. For large thresholds the decay is clearly exponential, while for small ones the decay is slow, indicating a power-law decay.
A short-range optical wireless transmission method based on LED
NASA Astrophysics Data System (ADS)
Miao, Meiyuan; Chen, Ailin; Zhu, Mingxing; Li, Ping; Gao, Yingming; Zou, Nianyu
2016-10-01
As to electromagnetic wave interfere and only one to one transmission problem of Bluetooth, a short-range LED optical wireless transmission method is proposed to be complementary technology in this paper. Furthermore achieved image transmission through this method. The system makes C52 to be the mater controller, transmitter got data from terminals by USB and sends modulated signals with LED. Optical signal is detected by PD, through amplified, filtered with shaping wave from, and demodulated on receiver. Then send to terminals like PC and reverted back to original image. Analysis the performance from peak power and average power, power consumption of transmitter, relationship of bit error rate and modulation mode, and influence of ambient light, respectively. The results shows that image can be received accurately which uses this method. The most distant transmission distance can get to 1m with transmitter LED source of 1w, and the transfer rate is 14.4Kbit/s with OOK modulation mode on stabilization system, the ambient light effect little to LED transmission system in normal light environment. The method is a convenient to carry LED wireless short range transmission for mobile transmission equipment as a supplement of Bluetooth short-range transmission for its ISM band interfere, and the analysis method in this paper can be a reference for other similar systems. It also proves the system is feasibility for next study.
MATIN: a random network coding based framework for high quality peer-to-peer live video streaming.
Barekatain, Behrang; Khezrimotlagh, Dariush; Aizaini Maarof, Mohd; Ghaeini, Hamid Reza; Salleh, Shaharuddin; Quintana, Alfonso Ariza; Akbari, Behzad; Cabrera, Alicia Triviño
2013-01-01
In recent years, Random Network Coding (RNC) has emerged as a promising solution for efficient Peer-to-Peer (P2P) video multicasting over the Internet. This probably refers to this fact that RNC noticeably increases the error resiliency and throughput of the network. However, high transmission overhead arising from sending large coefficients vector as header has been the most important challenge of the RNC. Moreover, due to employing the Gauss-Jordan elimination method, considerable computational complexity can be imposed on peers in decoding the encoded blocks and checking linear dependency among the coefficients vectors. In order to address these challenges, this study introduces MATIN which is a random network coding based framework for efficient P2P video streaming. The MATIN includes a novel coefficients matrix generation method so that there is no linear dependency in the generated coefficients matrix. Using the proposed framework, each peer encapsulates one instead of n coefficients entries into the generated encoded packet which results in very low transmission overhead. It is also possible to obtain the inverted coefficients matrix using a bit number of simple arithmetic operations. In this regard, peers sustain very low computational complexities. As a result, the MATIN permits random network coding to be more efficient in P2P video streaming systems. The results obtained from simulation using OMNET++ show that it substantially outperforms the RNC which uses the Gauss-Jordan elimination method by providing better video quality on peers in terms of the four important performance metrics including video distortion, dependency distortion, End-to-End delay and Initial Startup delay.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morise, A.P.; Duval, R.D.
To determine whether recent refinements in Bayesian methods have led to improved diagnostic ability, 3 methods using Bayes' theorem and the independence assumption for estimating posttest probability after exercise stress testing were compared. Each method differed in the number of variables considered in the posttest probability estimate (method A = 5, method B = 6 and method C = 15). Method C is better known as CADENZA. There were 436 patients (250 men and 186 women) who underwent stress testing (135 had concurrent thallium scintigraphy) followed within 2 months by coronary arteriography. Coronary artery disease ((CAD), at least 1 vesselmore » with greater than or equal to 50% diameter narrowing) was seen in 169 (38%). Mean pretest probabilities using each method were not different. However, the mean posttest probabilities for CADENZA were significantly greater than those for method A or B (p less than 0.0001). Each decile of posttest probability was compared to the actual prevalence of CAD in that decile. At posttest probabilities less than or equal to 20%, there was underestimation of CAD. However, at posttest probabilities greater than or equal to 60%, there was overestimation of CAD by all methods, especially CADENZA. Comparison of sensitivity and specificity at every fifth percentile of posttest probability revealed that CADENZA was significantly more sensitive and less specific than methods A and B. Therefore, at lower probability thresholds, CADENZA was a better screening method. However, methods A or B still had merit as a means to confirm higher probabilities generated by CADENZA (especially greater than or equal to 60%).« less
Mapping the zoonotic niche of Ebola virus disease in Africa
Pigott, David M; Golding, Nick; Mylne, Adrian; Huang, Zhi; Henry, Andrew J; Weiss, Daniel J; Brady, Oliver J; Kraemer, Moritz UG; Smith, David L; Moyes, Catherine L; Bhatt, Samir; Gething, Peter W; Horby, Peter W; Bogoch, Isaac I; Brownstein, John S; Mekaru, Sumiko R; Tatem, Andrew J; Khan, Kamran; Hay, Simon I
2014-01-01
Ebola virus disease (EVD) is a complex zoonosis that is highly virulent in humans. The largest recorded outbreak of EVD is ongoing in West Africa, outside of its previously reported and predicted niche. We assembled location data on all recorded zoonotic transmission to humans and Ebola virus infection in bats and primates (1976–2014). Using species distribution models, these occurrence data were paired with environmental covariates to predict a zoonotic transmission niche covering 22 countries across Central and West Africa. Vegetation, elevation, temperature, evapotranspiration, and suspected reservoir bat distributions define this relationship. At-risk areas are inhabited by 22 million people; however, the rarity of human outbreaks emphasises the very low probability of transmission to humans. Increasing population sizes and international connectivity by air since the first detection of EVD in 1976 suggest that the dynamics of human-to-human secondary transmission in contemporary outbreaks will be very different to those of the past. DOI: http://dx.doi.org/10.7554/eLife.04395.001 PMID:25201877
Inelastic cotunneling with energy-dependent contact transmission
NASA Astrophysics Data System (ADS)
Blok, S.; Agundez Mojarro, R. R.; Maduro, L. A.; Blaauboer, M.; Van Der Molen, S. J.
2017-03-01
We investigate inelastic cotunneling in a model system where the charging island is connected to the leads through molecules with energy-dependent transmission functions. To study this problem, we propose two different approaches. The first is a pragmatic approach that assumes Lorentzian-like transmission functions that determine the transmission probability to the island. Using this model, we calculate current versus voltage (IV) curves for increasing resonance level positions of the molecule. We find that shifting the resonance energy of the molecule away from the Fermi energy of the contacts leads to a decreased current at low bias, but as bias increases, this difference decreases and eventually inverses. This is markedly different from IV behavior outside the cotunneling regime. The second approach involves multiple cotunneling where also the molecules are considered to be in the Coulomb blockade regime. We find here that when Ec≫eV ,kBT , the IV behavior approaches the original cotunneling behavior proposed by Averin and Nazarov [Phys. Rev. Lett. 65, 2446-2449 (1990)].
Nalca, Aysegul; Rossi, Franco D.; Miller, Lynn J.; Wiley, Michael R.; Perez-Sautu, Unai; Washington, Samuel C.; Norris, Sarah L.; Wollen-Roberts, Suzanne E.; Shamblin, Joshua D.; Kimmel, Adrienne E.; Bloomfield, Holly A.; Valdez, Stephanie M.; Sprague, Thomas R.; Principe, Lucia M.; Bellanca, Stephanie A.; Cinkovich, Stephanie S.; Lugo-Roman, Luis; Cazares, Lisa H.; Pratt, William D.; Palacios, Gustavo F.; Bavari, Sina; Pitt, M. Louise; Nasar, Farooq
2017-01-01
Unprotected sexual intercourse between persons residing in or traveling from regions with Zika virus transmission is a risk factor for infection. To model risk for infection after sexual intercourse, we inoculated rhesus and cynomolgus macaques with Zika virus by intravaginal or intrarectal routes. In macaques inoculated intravaginally, we detected viremia and virus RNA in 50% of macaques, followed by seroconversion. In macaques inoculated intrarectally, we detected viremia, virus RNA, or both, in 100% of both species, followed by seroconversion. The magnitude and duration of infectious virus in the blood of macaques suggest humans infected with Zika virus through sexual transmission will likely generate viremias sufficient to infect competent mosquito vectors. Our results indicate that transmission of Zika virus by sexual intercourse might serve as a virus maintenance mechanism in the absence of mosquito-to-human transmission and could increase the probability of establishment and spread of Zika virus in regions where this virus is not present. PMID:28548637
Haddow, Andrew D; Nalca, Aysegul; Rossi, Franco D; Miller, Lynn J; Wiley, Michael R; Perez-Sautu, Unai; Washington, Samuel C; Norris, Sarah L; Wollen-Roberts, Suzanne E; Shamblin, Joshua D; Kimmel, Adrienne E; Bloomfield, Holly A; Valdez, Stephanie M; Sprague, Thomas R; Principe, Lucia M; Bellanca, Stephanie A; Cinkovich, Stephanie S; Lugo-Roman, Luis; Cazares, Lisa H; Pratt, William D; Palacios, Gustavo F; Bavari, Sina; Pitt, M Louise; Nasar, Farooq
2017-08-01
Unprotected sexual intercourse between persons residing in or traveling from regions with Zika virus transmission is a risk factor for infection. To model risk for infection after sexual intercourse, we inoculated rhesus and cynomolgus macaques with Zika virus by intravaginal or intrarectal routes. In macaques inoculated intravaginally, we detected viremia and virus RNA in 50% of macaques, followed by seroconversion. In macaques inoculated intrarectally, we detected viremia, virus RNA, or both, in 100% of both species, followed by seroconversion. The magnitude and duration of infectious virus in the blood of macaques suggest humans infected with Zika virus through sexual transmission will likely generate viremias sufficient to infect competent mosquito vectors. Our results indicate that transmission of Zika virus by sexual intercourse might serve as a virus maintenance mechanism in the absence of mosquito-to-human transmission and could increase the probability of establishment and spread of Zika virus in regions where this virus is not present.
Pulse transmission transceiver architecture for low power communications
Dress, Jr., William B.; Smith, Stephen F.
2003-08-05
Systems and methods for pulse-transmission low-power communication modes are disclosed. A method of pulse transmission communications includes: generating a modulated pulse signal waveform; transforming said modulated pulse signal waveform into at least one higher-order derivative waveform; and transmitting said at least one higher-order derivative waveform as an emitted pulse. The systems and methods significantly reduce lower-frequency emissions from pulse transmission spread-spectrum communication modes, which reduces potentially harmful interference to existing radio frequency services and users and also simultaneously permit transmission of multiple data bits by utilizing specific pulse shapes.
NASA Astrophysics Data System (ADS)
Gilmanshin, I. R.; Kirpichnikov, A. P.
2017-09-01
In the result of study of the algorithm of the functioning of the early detection module of excessive losses, it is proven the ability to model it by using absorbing Markov chains. The particular interest is in the study of probability characteristics of early detection module functioning algorithm of losses in order to identify the relationship of indicators of reliability of individual elements, or the probability of occurrence of certain events and the likelihood of transmission of reliable information. The identified relations during the analysis allow to set thresholds reliability characteristics of the system components.
A spatial risk assessment of bighorn sheep extirpation by grazing domestic sheep on public lands.
Carpenter, Tim E; Coggins, Victor L; McCarthy, Clinton; O'Brien, Chans S; O'Brien, Joshua M; Schommer, Timothy J
2014-04-01
Bighorn sheep currently occupy just 30% of their historic distribution, and persist in populations less than 5% as abundant overall as their early 19th century counterparts. Present-day recovery of bighorn sheep populations is in large part limited by periodic outbreaks of respiratory disease, which can be transmitted to bighorn sheep via contact with domestic sheep grazing in their vicinity. In order to assess the viability of bighorn sheep populations on the Payette National Forest (PNF) under several alternative proposals for domestic sheep grazing, we developed a series of interlinked models. Using telemetry and habitat data, we characterized herd home ranges and foray movements of bighorn sheep from their home ranges. Combining foray model movement estimates with known domestic sheep grazing areas (allotments), a Risk of Contact Model estimated bighorn sheep contact rates with domestic sheep allotments. Finally, we used demographic and epidemiologic data to construct population and disease transmission models (Disease Model), which we used to estimate bighorn sheep persistence under each alternative grazing scenario. Depending on the probability of disease transmission following interspecies contact, extirpation probabilities for the seven bighorn sheep herds examined here ranged from 20% to 100%. The Disease Model allowed us to assess the probabilities that varied domestic sheep management scenarios would support persistent populations of free-ranging bighorn sheep. Copyright © 2014 Elsevier B.V. All rights reserved.
Life history and virulence are linked in the ectoparasitic salmon louse Lepeophtheirus salmonis.
Mennerat, A; Hamre, L; Ebert, D; Nilsen, F; Dávidová, M; Skorping, A
2012-05-01
Models of virulence evolution for horizontally transmitted parasites often assume that transmission rate (the probability that an infected host infects a susceptible host) and virulence (the increase in host mortality due to infection) are positively correlated, because higher rates of production of propagules may cause more damages to the host. However, empirical support for this assumption is scant and limited to microparasites. To fill this gap, we explored the relationships between parasite life history and virulence in the salmon louse, Lepeophtheirus salmonis, a horizontally transmitted copepod ectoparasite on Atlantic salmon Salmo salar. In the laboratory, we infected juvenile salmon hosts with equal doses of infective L. salmonis larvae and monitored parasite age at first reproduction, parasite fecundity, area of damage caused on the skin of the host, and host weight and length gain. We found that earlier onset of parasite reproduction was associated with higher parasite fecundity. Moreover, higher parasite fecundity (a proxy for transmission rate, as infection probability increases with higher numbers of parasite larvae released to the water) was associated with lower host weight gain (correlated with lower survival in juvenile salmon), supporting the presence of a virulence-transmission trade-off. Our results are relevant in the context of increasing intensive farming, where frequent anti-parasite drug use and increased host density may have selected for faster production of parasite transmission stages, via earlier reproduction and increased early fecundity. Our study highlights that salmon lice, therefore, are a good model for studying how human activity may affect the evolution of parasite virulence. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.
Partridge, D G; Evans, C M; Raza, M; Kudesia, G; Parsons, H K
2012-05-01
Hospital norovirus outbreaks cause significant financial and operational disruption which should be minimised by optimal handling of affected areas and use of isolation facilities. To identify factors associated with increased duration of symptoms and viral excretion and increased probability of transmission. Retrospective observational study of a large norovirus outbreak at a UK teaching hospital in the winter of 2009-2010 where patients were diagnosed using a real-time polymerase chain reaction (PCR) assay. Symptom duration was significantly associated with patient age (Spearman rank correlation coefficient: 0.197; P = 0.002) but not with PCR cycle threshold (C(T)) value. Duration of viral excretion was found to be longer in patients with higher viral loads. Transmission within a ward bay was not significantly associated either with age or with C(T) value but was more likely to occur in some ward blocks than others, which may relate to differences in ward design. Transfer of patients into isolation rooms or cohorted area within two days of symptom onset did not significantly influence probability of onward transmission (52% vs 47%; P = 0.67). The presented data suggest that C(T) value may guide timing of repeat sample collection if ongoing gastrointestinal symptoms may relate to other pathologies, and that patients developing symptoms of norovirus may remain in their current bay rather than being moved into isolation facilities. The bay or ward should be closed to new admissions but it should be anticipated that duration of symptoms and therefore closure will be longer when the outbreak involves elderly patients. Copyright © 2012 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Hayden, Todd A.; Holbrook, Christopher M.; Binder, Thomas; Dettmers, John M.; Cooke, Steven J.; Vandergoot, Christopher S.; Krueger, Charles C.
2016-01-01
BackgroundAdvances in acoustic telemetry technology have led to an improved understanding of the spatial ecology of many freshwater and marine fish species. Understanding the performance of acoustic receivers is necessary to distinguish between tagged fish that may have been present but not detected and from those fish that were absent from the area. In this study, two stationary acoustic transmitters were deployed 250 m apart within each of four acoustic receiver lines each containing at least 10 receivers (i.e., eight acoustic transmitters) located in Saginaw Bay and central Lake Huron for nearly 2 years to determine whether the probability of detecting an acoustic transmission varied as a function of time (i.e., season), location, and distance between acoustic transmitter and receiver. Distances between acoustic transmitters and receivers ranged from 200 m to >10 km in each line. The daily observed probability of detecting an acoustic transmission was used in simulation models to estimate the probability of detecting a moving acoustic transmitter on a line of receivers.ResultsThe probability of detecting an acoustic transmitter on a receiver 1000 m away differed by month for different receiver lines in Lake Huron and Saginaw Bay but was similar for paired acoustic transmitters deployed 250 m apart within the same line. Mean probability of detecting an acoustic transmitter at 1000 m calculated over the study period varied among acoustic transmitters 250 m apart within a line and differed among receiver lines in Lake Huron and Saginaw Bay. The simulated probability of detecting a moving acoustic transmitter on a receiver line was characterized by short periods of time with decreased detection. Although increased receiver spacing and higher fish movement rates decreased simulated detection probability, the location of the simulated receiver line in Lake Huron had the strongest effect on simulated detection probability.ConclusionsPerformance of receiver lines in Lake Huron varied across a range of spatiotemporal scales and was inconsistent among receiver lines. Our simulations indicated that if 69 kHz acoustic transmitters operating at 158 dB in 10–30 m of freshwater were being used, then receivers should be placed 1000 m apart to ensure that all fish moving at 1 m s−1 or less will be detected 90% of days over a 2-year period. Whereas these results can be used as general guidelines for designing new studies, the irregular variation in acoustic transmitter detection probabilities we observed among receiver line locations in Lake Huron makes designing receiver lines in similar systems challenging and emphasizes the need to conduct post hoc analyses of acoustic transmitter detection probabilities.
Precision of EM Simulation Based Wireless Location Estimation in Multi-Sensor Capsule Endoscopy
Ye, Yunxing; Aisha, Ain-Ul; Swar, Pranay; Pahlavan, Kaveh
2018-01-01
In this paper, we compute and examine two-way localization limits for an RF endoscopy pill as it passes through an individuals gastrointestinal (GI) tract. We obtain finite-difference time-domain and finite element method-based simulation results position assessment employing time of arrival (TOA). By means of a 3-D human body representation from a full-wave simulation software and lognormal models for TOA propagation from implant organs to body surface, we calculate bounds on location estimators in three digestive organs: stomach, small intestine, and large intestine. We present an investigation of the causes influencing localization precision, consisting of a range of organ properties; peripheral sensor array arrangements, number of pills in cooperation, and the random variations in transmit power of sensor nodes. We also perform a localization precision investigation for the situation where the transmission signal of the antenna is arbitrary with a known probability distribution. The computational solver outcome shows that the number of receiver antennas on the exterior of the body has higher impact on the precision of the location than the amount of capsules in collaboration within the GI region. The large intestine is influenced the most by the transmitter power probability distribution. PMID:29651364
Precision of EM Simulation Based Wireless Location Estimation in Multi-Sensor Capsule Endoscopy.
Khan, Umair; Ye, Yunxing; Aisha, Ain-Ul; Swar, Pranay; Pahlavan, Kaveh
2018-01-01
In this paper, we compute and examine two-way localization limits for an RF endoscopy pill as it passes through an individuals gastrointestinal (GI) tract. We obtain finite-difference time-domain and finite element method-based simulation results position assessment employing time of arrival (TOA). By means of a 3-D human body representation from a full-wave simulation software and lognormal models for TOA propagation from implant organs to body surface, we calculate bounds on location estimators in three digestive organs: stomach, small intestine, and large intestine. We present an investigation of the causes influencing localization precision, consisting of a range of organ properties; peripheral sensor array arrangements, number of pills in cooperation, and the random variations in transmit power of sensor nodes. We also perform a localization precision investigation for the situation where the transmission signal of the antenna is arbitrary with a known probability distribution. The computational solver outcome shows that the number of receiver antennas on the exterior of the body has higher impact on the precision of the location than the amount of capsules in collaboration within the GI region. The large intestine is influenced the most by the transmitter power probability distribution.
Stacking dependence of carrier transport properties in multilayered black phosphorous
NASA Astrophysics Data System (ADS)
Sengupta, A.; Audiffred, M.; Heine, T.; Niehaus, T. A.
2016-02-01
We present the effect of different stacking orders on carrier transport properties of multi-layer black phosphorous. We consider three different stacking orders AAA, ABA and ACA, with increasing number of layers (from 2 to 6 layers). We employ a hierarchical approach in density functional theory (DFT), with structural simulations performed with generalized gradient approximation (GGA) and the bandstructure, carrier effective masses and optical properties evaluated with the meta-generalized gradient approximation (MGGA). The carrier transmission in the various black phosphorous sheets was carried out with the non-equilibrium green’s function (NEGF) approach. The results show that ACA stacking has the highest electron and hole transmission probabilities. The results show tunability for a wide range of band-gaps, carrier effective masses and transmission with a great promise for lattice engineering (stacking order and layers) in black phosphorous.
Method for bonding a transmission line to a downhole tool
Hall, David R.; Fox, Joe
2007-11-06
An apparatus for bonding a transmission line to the central bore of a downhole tool includes a pre-formed interface for bonding a transmission line to the inside diameter of a downhole tool. The pre-formed interface includes a first surface that substantially conforms to the outside contour of a transmission line and a second surface that substantially conforms to the inside diameter of a downhole tool. In another aspect of the invention, a method for bonding a transmission line to the inside diameter of a downhole tool includes positioning a transmission line near the inside wall of a downhole tool and placing a mold near the transmission line and the inside wall. The method further includes injecting a bonding material into the mold and curing the bonding material such that the bonding material bonds the transmission line to the inside wall.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zieliński, W., E-mail: wiziel@inmat.pw.edu.pl; Płociński, T.; Kurzydłowski, K.J.
2015-06-15
We present a study of the efficiency of the utility of scanning electron microscope (SEM)-based transmission methods for characterizing grain structure in thinned bulk metals. Foils of type 316 stainless steel were prepared by two methods commonly used for transmission electron microscopy — double-jet electropolishing and focused ion beam milling. A customized holder allowed positioning of the foils in a configuration appropriate for both transmission electron forward scatter diffraction, and for transmission imaging by the use of a forescatter detector with two diodes. We found that both crystallographic orientation maps and dark-field transmitted images could be obtained for specimens preparedmore » by either method. However, for both methods, preparation-induced artifacts may affect the quality or accuracy of transmission SEM data, especially those acquired by the use of transmission Kikuchi diffraction. Generally, the quality of orientation data was better for specimens prepared by electropolishing, due to the absence of ion-induced damage. - Highlights: • The transmission imaging and diffraction techniques are emerging in scanning electron microscopy (SEM) as promising new field of materials characterization. • The manuscript titled: “Transmission Kikuchi Diffraction and Transmission Electron Forescatter Imaging of Electropolished and FIB Manufactured TEM Specimens” documents how different specimen thinning procedures can effect efficiency of transmission Kikuchi diffraction and transmission electron forescatter imaging. • The abilities to make precision crystallographic orientation maps and dark-field images in transmission was studied on electropolished versus focus ion beam manufactured TEM specimens. • Depending on the need, electropolished and focused ion beam technique may produce suitable specimens for transmission imaging and diffraction in SEM.« less
Bessell, Paul R; Shaw, Darren J; Savill, Nicholas J; Woolhouse, Mark E J
2008-10-03
Models of Foot and Mouth Disease (FMD) transmission have assumed a homogeneous landscape across which Euclidean distance is a suitable measure of the spatial dependency of transmission. This paper investigated features of the landscape and their impact on transmission during the period of predominantly local spread which followed the implementation of the national movement ban during the 2001 UK FMD epidemic. In this study 113 farms diagnosed with FMD which had a known source of infection within 3 km (cases) were matched to 188 control farms which were either uninfected or infected at a later timepoint. Cases were matched to controls by Euclidean distance to the source of infection and farm size. Intervening geographical features and connectivity between the source of infection and case and controls were compared. Road distance between holdings, access to holdings, presence of forest, elevation change between holdings and the presence of intervening roads had no impact on the risk of local FMD transmission (p > 0.2). However the presence of linear features in the form of rivers and railways acted as barriers to FMD transmission (odds ratio = 0.507, 95% CIs = 0.297,0.887, p = 0.018). This paper demonstrated that although FMD spread can generally be modelled using Euclidean distance and numbers of animals on susceptible holdings, the presence of rivers and railways has an additional protective effect reducing the probability of transmission between holdings.
NASA Astrophysics Data System (ADS)
Abdolkader, Tarek M.; Shaker, Ahmed; Alahmadi, A. N. M.
2018-07-01
With the continuous miniaturization of electronic devices, quantum-mechanical effects such as tunneling become more effective in many device applications. In this paper, a numerical simulation tool is developed under a MATLAB environment to calculate the tunneling probability and current through an arbitrary potential barrier comparing three different numerical techniques: the finite difference method, transfer matrix method, and transmission line method. For benchmarking, the tool is applied to many case studies such as the rectangular single barrier, rectangular double barrier, and continuous bell-shaped potential barrier, each compared to analytical solutions and giving the dependence of the error on the number of mesh points. In addition, a thorough study of the J ‑ V characteristics of MIM and MIIM diodes, used as rectifiers for rectenna solar cells, is presented and simulations are compared to experimental results showing satisfactory agreement. On the undergraduate level, the tool provides a deeper insight for students to compare numerical techniques used to solve various tunneling problems and helps students to choose a suitable technique for a certain application.
Impenetrability in Floquet Scattering in One Dimension
NASA Astrophysics Data System (ADS)
Volosniev, A. G.; Smith, D. H.
2018-07-01
We study the scattering off a time-periodic zero-range potential in one spatial dimension. We focus on the parameter regions that lead to zero-transmission probability (ZTP). For static potentials, ZTP leads to fermionization of distinguishable equal-mass particles. For time-periodic potentials, fermionization is prevented by the formation of evanescent waves.
The trophic vacuum and the evolution of complex life cycles in trophically transmitted helminths.
Benesh, Daniel P; Chubb, James C; Parker, Geoff A
2014-10-22
Parasitic worms (helminths) frequently have complex life cycles in which they are transmitted trophically between two or more successive hosts. Sexual reproduction often takes place in high trophic-level (TL) vertebrates, where parasites can grow to large sizes with high fecundity. Direct infection of high TL hosts, while advantageous, may be unachievable for parasites constrained to transmit trophically, because helminth propagules are unlikely to be ingested by large predators. Lack of niche overlap between propagule and definitive host (the trophic transmission vacuum) may explain the origin and/or maintenance of intermediate hosts, which overcome this transmission barrier. We show that nematodes infecting high TL definitive hosts tend to have more successive hosts in their life cycles. This relationship was modest, though, driven mainly by the minimum TL of hosts, suggesting that the shortest trophic chains leading to a host define the boundaries of the transmission vacuum. We also show that alternative modes of transmission, like host penetration, allow nematodes to reach high TLs without intermediate hosts. We suggest that widespread omnivory as well as parasite adaptations to increase transmission probably reduce, but do not eliminate, the barriers to the transmission of helminths through the food web. © 2014 The Author(s) Published by the Royal Society. All rights reserved.
Healthcare-associated viral and bacterial infections in dentistry
Laheij, A.M.G.A.; Kistler, J.O.; Belibasakis, G.N.; Välimaa, H.; de Soet, J.J.
2012-01-01
Infection prevention in dentistry is an important topic that has gained more interest in recent years and guidelines for the prevention of cross-transmission are common practice in many countries. However, little is known about the real risks of cross-transmission, specifically in the dental healthcare setting. This paper evaluated the literature to determine the risk of cross-transmission and infection of viruses and bacteria that are of particular relevance in the dental practice environment. Facts from the literature on HSV, VZV, HIV, Hepatitis B, C and D viruses, Mycobacterium spp., Pseudomonas spp., Legionella spp. and multi-resistant bacteria are presented. There is evidence that Hepatitis B virus is a real threat for cross-infection in dentistry. Data for the transmission of, and infection with, other viruses or bacteria in dental practice are scarce. However, a number of cases are probably not acknowledged by patients, healthcare workers and authorities. Furthermore, cross-transmission in dentistry is under-reported in the literature. For the above reasons, the real risks of cross-transmission are likely to be higher. There is therefore a need for prospective longitudinal research in this area, to determine the real risks of cross-infection in dentistry. This will assist the adoption of effective hygiene procedures in dental practice. PMID:22701774
Emerging Infectious Diseases and Blood Safety: Modeling the Transfusion-Transmission Risk.
Kiely, Philip; Gambhir, Manoj; Cheng, Allen C; McQuilten, Zoe K; Seed, Clive R; Wood, Erica M
2017-07-01
While the transfusion-transmission (TT) risk associated with the major transfusion-relevant viruses such as HIV is now very low, during the last 20 years there has been a growing awareness of the threat to blood safety from emerging infectious diseases, a number of which are known to be, or are potentially, transfusion transmissible. Two published models for estimating the transfusion-transmission risk from EIDs, referred to as the Biggerstaff-Petersen model and the European Upfront Risk Assessment Tool (EUFRAT), respectively, have been applied to several EIDs in outbreak situations. We describe and compare the methodological principles of both models, highlighting their similarities and differences. We also discuss the appropriateness of comparing results from the two models. Quantitating the TT risk of EIDs can inform decisions about risk mitigation strategies and their cost-effectiveness. Finally, we present a qualitative risk assessment for Zika virus (ZIKV), an EID agent that has caused several outbreaks since 2007. In the latest and largest ever outbreak, several probable cases of transfusion-transmission ZIKV have been reported, indicating that it is transfusion-transmissible and therefore a risk to blood safety. We discuss why quantitative modeling the TT risk of ZIKV is currently problematic. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.
Thin-Film Phase Plates for Transmission Electron Microscopy Fabricated from Metallic Glasses.
Dries, Manuel; Hettler, Simon; Schulze, Tina; Send, Winfried; Müller, Erich; Schneider, Reinhard; Gerthsen, Dagmar; Luo, Yuansu; Samwer, Konrad
2016-10-01
Thin-film phase plates (PPs) have become an interesting tool to enhance the contrast of weak-phase objects in transmission electron microscopy (TEM). The thin film usually consists of amorphous carbon, which suffers from quick degeneration under the intense electron-beam illumination. Recent investigations have focused on the search for alternative materials with an improved material stability. This work presents thin-film PPs fabricated from metallic glass alloys, which are characterized by a high electrical conductivity and an amorphous structure. Thin films of the zirconium-based alloy Zr65.0Al7.5Cu27.5 (ZAC) were fabricated and their phase-shifting properties were evaluated. The ZAC film was investigated by different TEM techniques, which reveal beneficial properties compared with amorphous carbon PPs. Particularly favorable is the small probability for inelastic plasmon scattering, which results from the combined effect of a moderate inelastic mean free path and a reduced film thickness due to a high mean inner potential. Small probability plasmon scattering improves contrast transfer at high spatial frequencies, which makes the ZAC alloy a promising material for PP fabrication.
A robust approach to chance constrained optimal power flow with renewable generation
Lubin, Miles; Dvorkin, Yury; Backhaus, Scott N.
2016-09-01
Optimal Power Flow (OPF) dispatches controllable generation at minimum cost subject to operational constraints on generation and transmission assets. The uncertainty and variability of intermittent renewable generation is challenging current deterministic OPF approaches. Recent formulations of OPF use chance constraints to limit the risk from renewable generation uncertainty, however, these new approaches typically assume the probability distributions which characterize the uncertainty and variability are known exactly. We formulate a robust chance constrained (RCC) OPF that accounts for uncertainty in the parameters of these probability distributions by allowing them to be within an uncertainty set. The RCC OPF is solved usingmore » a cutting-plane algorithm that scales to large power systems. We demonstrate the RRC OPF on a modified model of the Bonneville Power Administration network, which includes 2209 buses and 176 controllable generators. In conclusion, deterministic, chance constrained (CC), and RCC OPF formulations are compared using several metrics including cost of generation, area control error, ramping of controllable generators, and occurrence of transmission line overloads as well as the respective computational performance.« less
NASA Astrophysics Data System (ADS)
Blazejewski, Jacob; Schultz, Chase; Mazzuca, James
2015-03-01
Many biological systems utilize water chains to transfer charge over long distances by means of an excess proton. This study examines how quantum effects impact these reactions in a small model system. The model consists of a water molecule situated between an imidazole donor and acceptor group, which simulate a fixed amino acid backbone. A one dimensional energy profile is evaluated using density functional theory at the 6-31G*/B3LYP level, which generates a barrier with a width of 0.6 Å and a height of 20.7 kcal/mol. Quantum transmission probability is evaluated by solving the time dependent Schrödinger equation on a grid. Isotopic effects are examined by performing calculations with both hydrogen and deuterium. The ratio of hydrogen over the deuterium shows a 130-fold increase in transmission probability at low temperatures. This indicates a substantial quantum tunneling effect. The study of higher dimensional systems as well as increasing the number of water molecules in the chain will be necessary to fully describe the proton transfer process. Alma College Provost's Office.
Baksi, B Güniz; Ermis, R Banu
2007-10-01
To test the efficacy of conventional radiometry with indirect digital image analysis in the assessment of the relative radiopacity of dental cements used as liners or bases compared to human enamel and dentin. Disks of 15 different dental cements, 5 mm in diameter and 2 mm thick, were exposed to radiation together with 2-mm-thick disks of enamel and dentin and an aluminum step wedge. Density was evaluated by digital transmission densitometry and with the histogram function of an image analysis program following digitization of the radiographs with a flatbed scanner. A higher number of dental cements were discriminated from both dentin and enamel with conventional radiographic densitometer. All the cements examined, except Ionoseal (Voco) and Ionobond (Voco), were more radiopaque than dentin. With both methods, Chelon-Silver (3M ESPE) had the highest radiopacity and glass-ionomer cements the lowest. Radiodensity of dental cements can be differentiated with a high probability with the conventional radiometric method.
McDonald, S A; Hutchinson, S J; Schnier, C; McLeod, A; Goldberg, D J
2014-01-01
In countries maintaining national hepatitis C virus (HCV) surveillance systems, a substantial proportion of individuals report no risk factors for infection. Our goal was to estimate the proportion of diagnosed HCV antibody-positive persons in Scotland (1991-2010) who probably acquired infection through injecting drug use (IDU), by combining data on IDU risk from four linked data sources using log-linear capture-recapture methods. Of 25,521 HCV-diagnosed individuals, 14,836 (58%) reported IDU risk with their HCV diagnosis. Log-linear modelling estimated a further 2484 HCV-diagnosed individuals with IDU risk, giving an estimated prevalence of 83. Stratified analyses indicated variation across birth cohort, with estimated prevalence as low as 49% in persons born before 1960 and greater than 90% for those born since 1960. These findings provide public-health professionals with a more complete profile of Scotland's HCV-infected population in terms of transmission route, which is essential for targeting educational, prevention and treatment interventions.
NASA Astrophysics Data System (ADS)
Jayarubi, J.; Peter, A. John
2017-05-01
Confinement potential profiles due to conduction and valence bands are obtained in a Ga0.7Al0.3As/ GaAs/ Ga0.7Al0.3As using variation formulism. The free electron distribution is carried out. The confined energy eigenvalue and its corresponding wavefunctions of charge carriers are found using self-consistent method. The confined energies with the geometrical confinement are computed. The potentials due to charges are done by Poisson equation. The effects of dielectric mismatch between the GaAs and GaAlAs semiconductors are introduced in the effective potential expressions. Transfer matrix method is employed to obtain the respective energies. The transmission probability is obtained for a constant well size. The high current density characteristics as a function of applied voltage is investigated. This investigation on the electromagnetically induced transparency in the photonic material will exploit in fabricating novel nonlinear optical devices in future.
Whole-Genome Sequencing in Outbreak Analysis
Turner, Stephen D.; Riley, Margaret F.; Petri, William A.; Hewlett, Erik L.
2015-01-01
SUMMARY In addition to the ever-present concern of medical professionals about epidemics of infectious diseases, the relative ease of access and low cost of obtaining, producing, and disseminating pathogenic organisms or biological toxins mean that bioterrorism activity should also be considered when facing a disease outbreak. Utilization of whole-genome sequencing (WGS) in outbreak analysis facilitates the rapid and accurate identification of virulence factors of the pathogen and can be used to identify the path of disease transmission within a population and provide information on the probable source. Molecular tools such as WGS are being refined and advanced at a rapid pace to provide robust and higher-resolution methods for identifying, comparing, and classifying pathogenic organisms. If these methods of pathogen characterization are properly applied, they will enable an improved public health response whether a disease outbreak was initiated by natural events or by accidental or deliberate human activity. The current application of next-generation sequencing (NGS) technology to microbial WGS and microbial forensics is reviewed. PMID:25876885
Quantum Biometrics with Retinal Photon Counting
NASA Astrophysics Data System (ADS)
Loulakis, M.; Blatsios, G.; Vrettou, C. S.; Kominis, I. K.
2017-10-01
It is known that the eye's scotopic photodetectors, rhodopsin molecules, and their associated phototransduction mechanism leading to light perception, are efficient single-photon counters. We here use the photon-counting principles of human rod vision to propose a secure quantum biometric identification based on the quantum-statistical properties of retinal photon detection. The photon path along the human eye until its detection by rod cells is modeled as a filter having a specific transmission coefficient. Precisely determining its value from the photodetection statistics registered by the conscious observer is a quantum parameter estimation problem that leads to a quantum secure identification method. The probabilities for false-positive and false-negative identification of this biometric technique can readily approach 10-10 and 10-4, respectively. The security of the biometric method can be further quantified by the physics of quantum measurements. An impostor must be able to perform quantum thermometry and quantum magnetometry with energy resolution better than 10-9ℏ , in order to foil the device by noninvasively monitoring the biometric activity of a user.
A two-stage broadcast message propagation model in social networks
NASA Astrophysics Data System (ADS)
Wang, Dan; Cheng, Shun-Jun
2016-11-01
Message propagation in social networks is becoming a popular topic in complex networks. One of the message types in social networks is called broadcast message. It refers to a type of message which has a unique and unknown destination for the publisher, such as 'lost and found'. Its propagation always has two stages. Due to this feature, rumor propagation model and epidemic propagation model have difficulty in describing this message's propagation accurately. In this paper, an improved two-stage susceptible-infected-removed model is proposed. We come up with the concept of the first forwarding probability and the second forwarding probability. Another part of our work is figuring out the influence to the successful message transmission chance in each level resulting from multiple reasons, including the topology of the network, the receiving probability, the first stage forwarding probability, the second stage forwarding probability as well as the length of the shortest path between the publisher and the relevant destination. The proposed model has been simulated on real networks and the results proved the model's effectiveness.
NASA Astrophysics Data System (ADS)
Mori, Kazuo; Naito, Katsuhiro; Kobayashi, Hideo
This paper proposes an asymmetric traffic accommodation scheme using a multihop transmission technique for CDMA/FDD cellular communication systems. The proposed scheme exploits the multihop transmission to downlink packet transmissions, which require the large transmission power at their single-hop transmissions, in order to increase the downlink capacity. In these multihop transmissions, vacant uplink band is used for the transmissions from relay stations to destination mobile stations, and this leads more capacity enhancement in the downlink communications. The relay route selection method and power control method for the multihop transmissions are also investigated in the proposed scheme. The proposed scheme is evaluated by computer simulation and the results show that the proposed scheme can achieve better system performance.
Berglund, Torsten; Gisslén, Magnus; Gröön, Peter; Sönnerborg, Anders; Tegnell, Anders; Alexandersson, Anders; Berggren, Ingela; Blaxhult, Anders; Brytting, Maria; Carlander, Christina; Carlson, Johan; Flamholc, Leo; Follin, Per; Haggar, Axana; Hansdotter, Frida; Josephson, Filip; Karlström, Olle; Liljeros, Fredrik; Navér, Lars; Pettersson, Karin; Johansson, Veronica Svedhem; Svennerholm, Bo; Tunbäck, Petra; Widgren, Katarina
2014-01-01
The modern medical treatment of HIV with antiretroviral therapy (ART) has drastically reduced the morbidity and mortality in patients infected with this virus. ART has also been shown to reduce the transmission risk from individual patients as well as the spread of the infection at the population level. This position statement from the Public Health Agency of Sweden and the Swedish Reference Group for Antiviral Therapy is based on a workshop organized in the fall of 2012. It summarizes the latest research and knowledge on the risk of HIV transmission from patients on ART, with a focus on the risk of sexual transmission. The risk of transmission via shared injection equipment among intravenous drug users is also examined, as is the risk of mother-to-child transmission. Based on current knowledge, the risk of transmission through vaginal or anal intercourse involving the use of a condom has been judged to be minimal, provided that the person infected with HIV fulfils the criteria for effective ART. This probably also applies to unprotected intercourse, provided that no other sexually transmitted infections are present, although it is not currently possible to fully support this conclusion with direct scientific evidence. ART is judged to markedly reduce the risk of blood-borne transmission between people who share injection equipment. Finally, the risk of transmission from mother to child is very low, provided that ART is started well in advance of delivery. PMID:25073537
Systemic and Mucosal Differences in HIV Burden, Immune and Therapeutic Responses
Wahl, Sharon M.; Redford, Maryann; Christensen, Shawna; Mack, Wendy; Cohn, Jon; Janoff, Edward N.; Mestecky, Jiri; Jenson, Hal B.; Navazesh, Mahvash; Cohen, Mardge; Reichelderfer, Patricia; Kovacs, Andrea
2011-01-01
Background Mucosal tissues represent major targets for HIV transmission, but differ in susceptibility and reservoir function by unknown mechanisms. Methods In a cross-sectional study, HIV RNA and infectious virus were compared between oral and genital compartments and blood in HIV-infected women, in association with clinical parameters, co-pathogens and putative innate and adaptive HIV inhibitors. Results HIV RNA was detectable in 24.5% of women from all 3 compartments, whereas 45% had RNA in only one or two sites. By comparison, infectious HIV, present in blood of the majority, was rare in mucosal sites. Innate mediators, SLPI and TSP, were highest in mucosae. Highly active antiretroviral therapy (HAART) was associated with an 80% decreased probability of shedding. Multivariate logistic regression models revealed that mucosal HIV RNA was associated with higher plasma RNA, infectious virus, and total mucosal IgA, but not IgG. There was a 37-fold increased probability of detecting RNA in both genital and oral specimens (P=0.008;P=0.02, respectively) among women in highest vs lowest IgA tertiles. Conclusions Mucosal sites exhibit distinct characteristics of infectious HIV, viral shedding and responses to therapy, dependent upon both systemic and local factors. Of the putative innate and adaptive mucosal defense factors examined, only IgA was associated with HIV RNA shedding. However, rather than being protective, there was a striking increase in probability of detectable HIV RNA shedding in women with highest total IgA. PMID:21239996
Shape-controlled synthesis and properties of dandelion-like manganese sulfide hollow spheres
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Wei; State Key Laboratory of Powder Metallurgy, Central South University, Changsha, Hunan 410083; Chen, Gen
2012-09-15
Graphical abstract: Dandelion-like MnS hollow spheres assembled with nanorods could be successfully synthesized in large quantities through a simple and convenient hydrothermal synthetic method under mild conditions using soluble hydrated manganese chloride as Mn source, L-cysteine as both a precipitator and complexing reagent. The dandelion-like MnS hollow spheres might have potential applications in microdevices and magnetic cells. Highlights: ► MnS hollow spheres assembled with nanorods could be synthesized. ► The morphologies and sizes of final products could be controlled. ► Possible formation mechanism of MnS hollow spheres is proposed. -- Abstract: Dandelion-like gamma-manganese (II) sulfide (MnS) hollow spheres assembled withmore » nanorods have been prepared via a hydrothermal process in the presence of L-cysteine and polyvinylpyrrolidone (PVP). L-cysteine was employed as not only sulfur source, but also coordinating reagent for the synthesis of dandelion-like MnS hollow spheres. The morphology, structure and properties of as-prepared products have been investigated in detail by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDS), selected area electron diffraction (SAED), high-resolution transmission electron microscopy (HRTEM) and photoluminescence spectra (PL). The probable formation mechanism of as-prepared MnS hollow spheres was discussed on the basis of the experimental results. This strategy may provide an effective method for the fabrication of other metal sulfides hollow spheres.« less
Malaria Situation and Anopheline Mosquitoes in Qom Province, Central Iran
Farzinnia, B; Saghafipour, A; Abai, MR
2010-01-01
Background: The aims of this study was to analysis the current situation of malaria and to find the distribution of anopheline mosquitoes, as probable vectors of the disease, in Qom Province, central Iran. Methods: This study was carried out in two parts. First stage was data collection about malaria cases using recorded documents of patients in the Province health center, during 2001–2008. The second stage was entomological survey conducted by mosquito larval collection method in 4 villages with different geographical positions in 2008. Data were analyzed using Excel software. Results: Of 4456 blood slides, 10.9% out were positive. Most of cases were imported from other countries (90.4%), mainly from Afghanistan (56.5%) and Pakistan (16.3%). Slide positive rate showed a maximum of 16.9% and a minimum of 2.9% in 2008 and 2007, respectively. Plasmodium vivax was causative agent of 93.75% of cases, followed by P. falciparum (6.25%). More than 15 years old age group contained the most malaria reported cases (66.7%). Two Anopheles species, An. superpictus and An. claviger were collected and identified. This is the first report of Anopheles claviger in Qom Province. Conclusion: Malaria is in the control stage in Qom Province. The rate of local transmission is very low (only 1 case), shows Anopheles superpictus, as the main malaria vector of central part of Iran, can play its role in malaria transmission in the area. PMID:22808402
Hospital disinfection: efficacy and safety issues.
Dettenkofer, Markus; Block, Colin
2005-08-01
To review recent publications relevant to hospital disinfection (and cleaning) including the reprocessing of medical instruments. The key question as to whether the use of disinfectants on environmental surfaces rather than cleaning with detergents only reduces nosocomial infection rates still awaits conclusive studies. New disinfectants, mainly peroxygen compounds, show good sporicidal properties and will probably replace more problematical substances such as chlorine-releasing agents. The safe reprocessing of medical devices requires a well-coordinated approach, starting with proper cleaning. New methods and substances show promising activity for preventing the transmission of prions. Different aspects of virus inactivation have been studied, and the transmissibility, e.g. of norovirus, shows the need for sound data on how different disinfectant classes perform. Biofilms or other forms of surface-adherent organisms pose an extraordinary challenge to decontamination. Although resistance to biocides is generally not judged to be as critical as antibiotic resistance, scientific data support the need for proper use, i.e. the avoidance of widespread application, especially in low concentrations and in consumer products. Chemical disinfection of heat-sensitive instruments and targeted disinfection of environmental surfaces are established components of hospital infection control. To avoid danger to staff, patients and the environment, prudent use as well as established safety precautions are required. New technologies and products should be evaluated with sound methods. As emerging resistant pathogens will challenge healthcare facilities in the future even more than at present, there is a need for well-designed studies addressing the role of disinfection in hospital infection control.
Diagnoses of HIV-1 and HIV-2 in England, Wales, and Northern Ireland associated with west Africa.
Dougan, S; Patel, B; Tosswill, J H; Sinka, K
2005-08-01
To describe HIV diagnoses, including those of HIV-2 infection, made in England, Wales, and Northern Ireland (E,W&NI) among those probably infected in west Africa, and to consider whether there is evidence for ongoing heterosexual transmission within the United Kingdom. Reports of new HIV diagnoses received at the Communicable Disease Surveillance Centre were analysed. Individuals probably infected in west Africa and those infected through heterosexual intercourse within the United Kingdom by a heterosexual partner infected in west Africa were included. Between 1985 and 2003 inclusive, 1324 individuals diagnosed and reported with HIV had probably been infected in west Africa, with 222 diagnoses made in 2003. 917 (69%) were HIV-1 infected and 52 (6%) HIV-2 or HIV-1/HIV-2 co-infected. For 355 (27%) the HIV type was not reported. The proportion of HIV-2 and HIV-1/HIV-2 infections varied by country of infection (p<0.001): ranging from the Gambia (11.7%-15.2%) to Nigeria (0.7%-1.0%). A further 130 individuals were probably infected through heterosexual intercourse within the United Kingdom by a heterosexual partner infected in west Africa. 89 (68%) were HIV-1 infected and three (2%) HIV-2 infected or HIV-1/HIV-2 co-infected. For 38 (29%) HIV type was not reported. The number of people infected with HIV in west Africa and diagnosed in E,W&NI has increased in recent years, and there is evidence of heterosexual transmission within the United Kingdom from people infected in west Africa. While numbers of HIV-2 diagnoses remain relatively low, an appreciable proportion of people infected in some west African countries and diagnosed in the United Kingdom may be HIV-2 positive, with implications for prognosis and treatment.
Wildfire exposure and fuel management on western US national forests.
Ager, Alan A; Day, Michelle A; McHugh, Charles W; Short, Karen; Gilbertson-Day, Julie; Finney, Mark A; Calkin, David E
2014-12-01
Substantial investments in fuel management activities on national forests in the western US are part of a national strategy to reduce human and ecological losses from catastrophic wildfire and create fire resilient landscapes. Prioritizing these investments within and among national forests remains a challenge, partly because a comprehensive assessment that establishes the current wildfire risk and exposure does not exist, making it difficult to identify national priorities and target specific areas for fuel management. To gain a broader understanding of wildfire exposure in the national forest system, we analyzed an array of simulated and empirical data on wildfire activity and fuel treatment investments on the 82 western US national forests. We first summarized recent fire data to examine variation among the Forests in ignition frequency and burned area in relation to investments in fuel reduction treatments. We then used simulation modeling to analyze fine-scale spatial variation in burn probability and intensity. We also estimated the probability of a mega-fire event on each of the Forests, and the transmission of fires ignited on national forests to the surrounding urban interface. The analysis showed a good correspondence between recent area burned and predictions from the simulation models. The modeling also illustrated the magnitude of the variation in both burn probability and intensity among and within Forests. Simulated burn probabilities in most instances were lower than historical, reflecting fire exclusion on many national forests. Simulated wildfire transmission from national forests to the urban interface was highly variable among the Forests. We discuss how the results of the study can be used to prioritize investments in hazardous fuel reduction within a comprehensive multi-scale risk management framework. Published by Elsevier Ltd.
A transaction assessment method for allocation of transmission services
NASA Astrophysics Data System (ADS)
Banunarayanan, Venkatasubramaniam
The purpose of this research is to develop transaction assessment methods for allocating transmission services that are provided by an area/utility to power transactions. Transmission services are the services needed to deliver, or provide the capacity to deliver, real and reactive power from one or more supply points to one or more delivery points. As the number of transactions increase rapidly in the emerging deregulated environment, accurate quantification of the transmission services an area/utility provides to accommodate a transaction is becoming important, because then appropriate pricing schemes can be developed to compensate for the parties that provide these services. The Allocation methods developed are based on the "Fair Resource Allocation Principle" and they determine for each transaction the following: the flowpath of the transaction (both real and reactive power components), generator reactive power support from each area/utility, real power loss support from each area/utility. Further, allocation methods for distributing the cost of relieving congestion on transmission lines caused by transactions are also developed. The main feature of the proposed methods is representation of actual usage of the transmission services by the transactions. The proposed method is tested extensively on a variety of systems. The allocation methods developed in this thesis for allocation of transmission services to transactions is not only useful in studying the impact of transactions on a transmission system in a multi-transaction case, but they are indeed necessary to meet the criteria set forth by FERC with regard to pricing based on actual usage. The "consistency" of the proposed allocation methods has also been investigated and tested.
Optimal Joint Remote State Preparation of Arbitrary Equatorial Multi-qudit States
NASA Astrophysics Data System (ADS)
Cai, Tao; Jiang, Min
2017-03-01
As an important communication technology, quantum information transmission plays an important role in the future network communication. It involves two kinds of transmission ways: quantum teleportation and remote state preparation. In this paper, we put forward a new scheme for optimal joint remote state preparation (JRSP) of an arbitrary equatorial two-qudit state with hybrid dimensions. Moreover, the receiver can reconstruct the target state with 100 % success probability in a deterministic manner via two spatially separated senders. Based on it, we can extend it to joint remote preparation of arbitrary equatorial multi-qudit states with hybrid dimensions using the same strategy.
NASA Technical Reports Server (NTRS)
Zimmerman, I. H.; Baer, M.; George, T. F.
1979-01-01
Collinear quantum calculations are carried out for reactive F + H2 collisions on two electronic potential energy surfaces. The resulting transmission and reflection probabilities exhibit much greater variation with energy than single-surface studies would lead us to anticipate. Transmission to low-lying product channels is increased by orders of magnitude by the presence of the second surface; however, branching ratios among product states are found to be independent of the initial electronic state of the reactants. These apparently contradictory aspects of the calculation are discussed and a tentative explanation put forward to resolve them.
Guinat, Claire; Gogin, Andrey; Blome, Sandra; Keil, Guenther; Pollin, Reiko; Pfeiffer, Dirk U; Dixon, Linda
2016-03-12
African swine fever (ASF) is a major threat to the pig industry in Europe. Since 2007, ASF outbreaks have been ongoing in the Caucasus, Eastern Europe and the Baltic countries, causing severe economic losses for many pig farmers and pork producers. In addition, the number of ASF cases in wild boar populations has dramatically increased over the past few years. Evidence supports direct contact with infectious domestic pigs and wild boars, and consumption of contaminated feed, as the main transmission routes of ASF virus (ASFV) to domestic pigs. However, significant knowledge gaps highlight the urgent need for research to investigate the dynamics of indirect transmission via the environment, the minimal infective doses for contaminated feed ingestion, the probability of effective contacts between infectious wild boars and domestic pigs, the potential for recovered animals to become carriers and a reservoir for transmission, the potential virus persistence within wild boar populations and the influence of human behaviour for the spread of ASFV. This will provide an improved scientific basis to optimise current interventions and develop new tools and strategies to reduce the risk of ASFV transmission to domestic pigs. British Veterinary Association.
Guinat, Claire; Gogin, Andrey; Blome, Sandra; Keil, Guenther; Pollin, Reiko; Pfeiffer, Dirk U.; Dixon, Linda
2016-01-01
African swine fever (ASF) is a major threat to the pig industry in Europe. Since 2007, ASF outbreaks have been ongoing in the Caucasus, Eastern Europe and the Baltic countries, causing severe economic losses for many pig farmers and pork producers. In addition, the number of ASF cases in wild boar populations has dramatically increased over the past few years. Evidence supports direct contact with infectious domestic pigs and wild boars, and consumption of contaminated feed, as the main transmission routes of ASF virus (ASFV) to domestic pigs. However, significant knowledge gaps highlight the urgent need for research to investigate the dynamics of indirect transmission via the environment, the minimal infective doses for contaminated feed ingestion, the probability of effective contacts between infectious wild boars and domestic pigs, the potential for recovered animals to become carriers and a reservoir for transmission, the potential virus persistence within wild boar populations and the influence of human behaviour for the spread of ASFV. This will provide an improved scientific basis to optimise current interventions and develop new tools and strategies to reduce the risk of ASFV transmission to domestic pigs. PMID:26966305
Mimbacas, Adriana; Pérez-Bravo, Fernando; Santos, Jose Luis; Pisciottano, Carmen; Grignola, Rosario; Javiel, Gerardo; Jorge, Ana Maria; Cardoso, Horacio
2004-01-01
Susceptibility to the type 1 diabetes is genetically controlled and there is an increased risk associated with the presence of some specific alleles of the human leukocyte antigens class II loci (DQA1 and DQB1 genes). The purpose of this study is to evaluate the association between type 1 diabetes and HLA DQ alleles using case-parents trios in the admixed population of Uruguay composed by a mixture of Caucasian, Amerindian and Negroid populations. DQA1 and DQB1 genotyping was performed by polimerase chain reaction followed by oligospecific probes hybridization in 51 case-parents trios. The transmission disequilibrium test was used for detecting differential transmission in the HLA DQ loci. DQB1*0302 was the only allele for which preferential transmission is suggested (probability of transmission = 67.56%; exact p-value TDT = 0.047 uncorrected for multiple comparisons). DQA1*0301 allele showed a trend for preferential transmission without achieving statistical significance. This result would confirm the hypothesis previously advanced in a case-control study. Therefore, DQB1*0302 allele could be considered as the most important susceptibility allele for developing type 1 diabetes in Uruguay population.
Self-similar transmission patterns induced by magnetic field effects in graphene
NASA Astrophysics Data System (ADS)
Rodríguez-González, R.; Rodríguez-Vargas, I.; Díaz-Guerrero, D. S.; Gaggero-Sager, L. M.
2018-07-01
In this work we study the propagation of Dirac electrons through Cantor-like structures in graphene. In concrete, we are considering structures with magnetic and electrostatic barriers arrange in Cantor-like fashion. The Dirac-like equation and the transfer matrix approach have been used to obtain the transmission properties. We found self-similar patterns in the transmission probability or transmittance once the magnetic field is incorporated. Moreover, these patterns can be connected with other ones at different scales through well-defined scaling rules. In particular, we have found two scaling rules that become a useful tool to describe the self-similarity of our system. The first expression is related to the generation and the second one to the length of the Cantor-like structure. As far as we know it is the first time that a special self-similar structure in conjunction with magnetic field effects give rise to self-similar transmission patterns. It is also important to remark that according to our knowledge it is fundamental to break some symmetry of graphene in order to obtain self-similar transmission properties. In fact, in our case the time-reversal symmetry is broken by the magnetic field effects.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nikiforov, E. P.
2009-07-15
Damage by lightning discharges to lightning arrester cables for 110-175 kV aerial transmission lines is analyzed using data from power systems on incidents with aerial transmission lines over a ten year operating period (1997-2006). It is found that failures of lightning arrester cables occur when a tensile force acts on a cable heated to the melting point by a lightning current. The lightning currents required to heat a cable to this extent are greater for larger cable cross sections. The probability that a lightning discharge will develop decreases as the amplitude of the lightning current increases, which greatly reduces themore » number of lightning discharges which damage TK-70 cables compared to TK-50 cables. In order to increase the reliability of lightning arrester cables for 110 kV aerial transmission lines, TK-70 cables should be used in place of TK-50 cables. The number of lightning discharges per year which damage lightning arrester cables is lowered when the density of aerial transmission lines is reduced within the territory of electrical power systems. An approximate relationship between these two parameters is obtained.« less
An analytical method for designing low noise helicopter transmissions
NASA Technical Reports Server (NTRS)
Bossler, R. B., Jr.; Bowes, M. A.; Royal, A. C.
1978-01-01
The development and experimental validation of a method for analytically modeling the noise mechanism in the helicopter geared power transmission systems is described. This method can be used within the design process to predict interior noise levels and to investigate the noise reducing potential of alternative transmission design details. Examples are discussed.
Concurrency and HIV transmission network characteristics among MSM with recent HIV infection.
Pines, Heather A; Wertheim, Joel O; Liu, Lin; Garfein, Richard S; Little, Susan J; Karris, Maile Y
2016-11-28
Sexual partner concurrency is common among MSM and may increase the probability of HIV transmission during recent (acute or early) infection. We examined the relationship between concurrency and HIV transmission network characteristics (proxies for HIV transmission) among MSM with recent HIV infection. Observational study integrating behavioral, clinical, and molecular epidemiology. We inferred a partial HIV transmission network using 986 HIV-1 pol sequences obtained from HIV-infected individuals in San Diego, California (1996-2015). We further analyzed data from 285 recently HIV-infected MSM in the network who provided information on up to three sexual partners in the past 3 months, including the timing of intercourse with each partner. Concurrency was defined as sexual partners overlapping in time. Logistic and negative binomial regressions were used to investigate the link between concurrency and HIV transmission network characteristics (i.e. clustering and degree or number of connections to others in the network) among these MSM. Of recently HIV-infected MSM (n = 285), 54% reported concurrent partnerships and 54% were connected by at least one putative transmission link to others (i.e. clustered) in the network (median degree = 1.0; interquartile range: 0.0-3.0). Concurrency was positively associated with HIV transmission network clustering (adjusted odds ratio = 1.83, 95% confidence interval: 1.08, 3.10) and degree (adjusted incidence rate ratio = 1.48, 95% confidence interval: 1.02, 2.15). Our findings provide empirical evidence consistent with the hypothesis that concurrency facilitates HIV transmission during recent infection. Interventions to mitigate the impact of concurrency on HIV transmission may help curb the HIV epidemic among MSM.
Introduction of SARS in France, March–April, 2003
van der Werf, Sylvie; Bonmarin, Isabelle; Levy-Bruhl, Daniel; Yazdanpanah, Yazdan; Hoen, Bruno; Emmanuelli, Julien; Lesens, Olivier; Dupon, Michel; Natali, François; Michelet, Christian; Reynes, Jacques; Guery, Benoit; Larsen, Christine; Semaille, Caroline; Mouton, Yves; Christmann, Daniel; André, Michel; Escriou, Nicolas; Burguière, Anna; Manuguerra, Jean-Claude; Coignard, Bruno; Lepoutre, Agnés; Meffre, Christine; Bitar, Dounia; Decludt, Bénédicte; Capek, Isabelle; Antona, Denise; Che, Didier; Herida, Magid; Infuso, Andréa; Saura, Christine; Brücker, Gilles; Hubert, Bruno; LeGoff, Dominique; Scheidegger, Suzanne
2004-01-01
We describe severe acute respiratory syndrome (SARS) in France. Patients meeting the World Health Organization definition of a suspected case underwent a clinical, radiologic, and biologic assessment at the closest university-affiliated infectious disease ward. Suspected cases were immediately reported to the Institut de Veille Sanitaire. Probable case-patients were isolated, their contacts quarantined at home, and were followed for 10 days after exposure. Five probable cases occurred from March through April 2003; four were confirmed as SARS coronavirus by reverse transcription–polymerase chain reaction, serologic testing, or both. The index case-patient (patient A), who had worked in the French hospital of Hanoi, Vietnam, was the most probable source of transmission for the three other confirmed cases; two had been exposed to patient A while on the Hanoi-Paris flight of March 22–23. Timely detection, isolation of probable cases, and quarantine of their contacts appear to have been effective in preventing the secondary spread of SARS in France. PMID:15030682
On the extinction probability in models of within-host infection: the role of latency and immunity.
Yan, Ada W C; Cao, Pengxing; McCaw, James M
2016-10-01
Not every exposure to virus establishes infection in the host; instead, the small amount of initial virus could become extinct due to stochastic events. Different diseases and routes of transmission have a different average number of exposures required to establish an infection. Furthermore, the host immune response and antiviral treatment affect not only the time course of the viral load provided infection occurs, but can prevent infection altogether by increasing the extinction probability. We show that the extinction probability when there is a time-dependent immune response depends on the chosen form of the model-specifically, on the presence or absence of a delay between infection of a cell and production of virus, and the distribution of latent and infectious periods of an infected cell. We hypothesise that experimentally measuring the extinction probability when the virus is introduced at different stages of the immune response, alongside the viral load which is usually measured, will improve parameter estimates and determine the most suitable mathematical form of the model.
Method of converting an existing vehicle powertrain to a hybrid powertrain system
Reed, Jr., Richard G.; Boberg, Evan S.; Lawrie, Robert E.; Castaing, Francois J.
2001-12-25
A method of converting an existing vehicle powertrain including a manual transmission to a hybrid powertrain system with an automated powertrain transmission. The first step in the method of attaching a gear train housing to a housing of said manual transmission, said gear train housing receiving as end of drive shaft of said transmission and rotatably supporting a gear train assembly. Secondly, mounting an electric motor/generator to said gear train housing and attaching a motor/generator drive shaft of said electric motor/generator to said gear train assembly. Lastly, connecting an electro-mechanical clutch actuator to a friction clutch mechanism of said manual transmission.
NASA Astrophysics Data System (ADS)
Fang, G. J.; Bao, H.
2017-12-01
The widely used method of calculating electric distances is sensitivity method. The sensitivity matrix is the result of linearization and based on the hypothesis that the active power and reactive power are decoupled, so it is inaccurate. In addition, it calculates the ratio of two partial derivatives as the relationship of two dependent variables, so there is no physical meaning. This paper presents a new method for calculating electrical distance, namely transmission impedance method. It forms power supply paths based on power flow tracing, then establishes generalized branches to calculate transmission impedances. In this paper, the target of power flow tracing is S instead of Q. Q itself has no direction and the grid delivers complex power so that S contains more electrical information than Q. By describing the power transmission relationship of the branch and drawing block diagrams in both forward and reverse directions, it can be found that the numerators of feedback parts of two block diagrams are all the transmission impedances. To ensure the distance is scalar, the absolute value of transmission impedance is defined as electrical distance. Dividing network according to the electric distances and comparing with the results of sensitivity method, it proves that the transmission impedance method can adapt to the dynamic change of system better and reach a reasonable subarea division scheme.
Hydraulic characteristics of, and ground-water flow in, coal-bearing rocks of southwestern Virginia
Harlow, George E.; LeCain, Gary D.
1993-01-01
This report presents the results of a study by the U.S Geological Survey, in cooperation with the Virginia Department of Mines, Minerals, and Energy, Division of Mined Land Reclamation, and the Powell River Project, to describe the hydraulic characteristics of major water-bearing zones in the coal-bearing rocks of southwestern Virginia and to develop a conceptual model of the ground-water-flow system. Aquifer testing in1987 and 1988 of 9-ft intervals in coal-exploration coreholes indicates that transmissivity decreases with increasing depth. Most rock types are permeable to a depth of approximately 100 ft; however, only coal seams are consistently permeable (transmissivity greater than 0.001 ft/d) at depths greater than 200 ft . Constant-head injection testing of rock intervals adjacent to coal seams usually indicated lower values of transmissivity than those values obtained when coal seams were isolated within the test interval; thus, large values of horizontal hydraulic conductivity at depth are associated with coal seams. Potentiometric-head measurements indicate that high topographic areas (ridges) function as recharge areas; water infiltrates through the surface, percolates into regolith, and flows downward and laterally through fractures in the shallow bedrock. Hydraulic conductivity decreases with increasing depth, and ground water flows primarily in the lateral direction along fractures or bedding planes or through coal seams. If vertical hydraulic conductivity is negligible, ground water continues to flow laterally, discharging as springs or seeps on hill slopes. Where vertical hydraulic conductivity is appreciable, groundwater follows a stair step path through the regolith, fractures, bedding planes, and coal seams, discharging to streams and (or) recharging coal seams at depth. Permeable coal seams probably underlie valleys in the region; however, aquifer-test data indicate that the horizontal hydraulic conductivity of coal is a function of depth and probably decreases under ridges because of increased overburden pressures. Ground water beneath valleys that does not discharge to streams probably flows down gradient as underflow beneath the streams. Topographic relief in the area provides large hydraulic-head differences (greater than 300 ft in some instances) for the ground-water-flow system. Transmissivity data from the range of depths tested during this study indicate that most ground-water flow takes place at moderate depths (less than 300 ft) and that little deep regional ground-water flow occurs.
Truscott, James E; Werkman, Marleen; Wright, James E; Farrell, Sam H; Sarkar, Rajiv; Ásbjörnsdóttir, Kristjana; Anderson, Roy M
2017-06-30
There is an increased focus on whether mass drug administration (MDA) programmes alone can interrupt the transmission of soil-transmitted helminths (STH). Mathematical models can be used to model these interventions and are increasingly being implemented to inform investigators about expected trial outcome and the choice of optimum study design. One key factor is the choice of threshold for detecting elimination. However, there are currently no thresholds defined for STH regarding breaking transmission. We develop a simulation of an elimination study, based on the DeWorm3 project, using an individual-based stochastic disease transmission model in conjunction with models of MDA, sampling, diagnostics and the construction of study clusters. The simulation is then used to analyse the relationship between the study end-point elimination threshold and whether elimination is achieved in the long term within the model. We analyse the quality of a range of statistics in terms of the positive predictive values (PPV) and how they depend on a range of covariates, including threshold values, baseline prevalence, measurement time point and how clusters are constructed. End-point infection prevalence performs well in discriminating between villages that achieve interruption of transmission and those that do not, although the quality of the threshold is sensitive to baseline prevalence and threshold value. Optimal post-treatment prevalence threshold value for determining elimination is in the range 2% or less when the baseline prevalence range is broad. For multiple clusters of communities, both the probability of elimination and the ability of thresholds to detect it are strongly dependent on the size of the cluster and the size distribution of the constituent communities. Number of communities in a cluster is a key indicator of probability of elimination and PPV. Extending the time, post-study endpoint, at which the threshold statistic is measured improves PPV value in discriminating between eliminating clusters and those that bounce back. The probability of elimination and PPV are very sensitive to baseline prevalence for individual communities. However, most studies and programmes are constructed on the basis of clusters. Since elimination occurs within smaller population sub-units, the construction of clusters introduces new sensitivities for elimination threshold values to cluster size and the underlying population structure. Study simulation offers an opportunity to investigate key sources of sensitivity for elimination studies and programme designs in advance and to tailor interventions to prevailing local or national conditions.
Nygren, David; Stoyanov, Cristina; Lewold, Clemens; Månsson, Fredrik; Miller, John; Kamanga, Aniset; Shiff, Clive J
2014-06-13
Plasmodium falciparum transmission has decreased significantly in Zambia in the last decade. The malaria transmission is influenced by environmental variables. Incorporation of environmental variables in models of malaria transmission likely improves model fit and predicts probable trends in malaria disease. This work is based on the hypothesis that remotely-sensed environmental factors, including nocturnal dew point, are associated with malaria transmission and sustain foci of transmission during the low transmission season in the Southern Province of Zambia. Thirty-eight rural health centres in Southern Province, Zambia were divided into three zones based on transmission patterns. Correlations between weekly malaria cases and remotely-sensed nocturnal dew point, nocturnal land surface temperature as well as vegetation indices and rainfall were evaluated in time-series analyses from 2012 week 19 to 2013 week 36. Zonal as well as clinic-based, multivariate, autoregressive, integrated, moving average (ARIMAX) models implementing environmental variables were developed to model transmission in 2011 week 19 to 2012 week 18 and forecast transmission in 2013 week 37 to week 41. During the dry, low transmission season significantly higher vegetation indices, nocturnal land surface temperature and nocturnal dew point were associated with the areas of higher transmission. Environmental variables improved ARIMAX models. Dew point and normalized differentiated vegetation index were significant predictors and improved all zonal transmission models. In the high-transmission zone, this was also seen for land surface temperature. Clinic models were improved by adding dew point and land surface temperature as well as normalized differentiated vegetation index. The mean average error of prediction for ARIMAX models ranged from 0.7 to 33.5%. Forecasts of malaria incidence were valid for three out of five rural health centres; however, with poor results at the zonal level. In this study, the fit of ARIMAX models improves when environmental variables are included. There is a significant association of remotely-sensed nocturnal dew point with malaria transmission. Interestingly, dew point might be one of the factors sustaining malaria transmission in areas of general aridity during the dry season.
Computation and measurement of cell decision making errors using single cell data
Habibi, Iman; Cheong, Raymond; Levchenko, Andre; Emamian, Effat S.; Abdi, Ali
2017-01-01
In this study a new computational method is developed to quantify decision making errors in cells, caused by noise and signaling failures. Analysis of tumor necrosis factor (TNF) signaling pathway which regulates the transcription factor Nuclear Factor κB (NF-κB) using this method identifies two types of incorrect cell decisions called false alarm and miss. These two events represent, respectively, declaring a signal which is not present and missing a signal that does exist. Using single cell experimental data and the developed method, we compute false alarm and miss error probabilities in wild-type cells and provide a formulation which shows how these metrics depend on the signal transduction noise level. We also show that in the presence of abnormalities in a cell, decision making processes can be significantly affected, compared to a wild-type cell, and the method is able to model and measure such effects. In the TNF—NF-κB pathway, the method computes and reveals changes in false alarm and miss probabilities in A20-deficient cells, caused by cell’s inability to inhibit TNF-induced NF-κB response. In biological terms, a higher false alarm metric in this abnormal TNF signaling system indicates perceiving more cytokine signals which in fact do not exist at the system input, whereas a higher miss metric indicates that it is highly likely to miss signals that actually exist. Overall, this study demonstrates the ability of the developed method for modeling cell decision making errors under normal and abnormal conditions, and in the presence of transduction noise uncertainty. Compared to the previously reported pathway capacity metric, our results suggest that the introduced decision error metrics characterize signaling failures more accurately. This is mainly because while capacity is a useful metric to study information transmission in signaling pathways, it does not capture the overlap between TNF-induced noisy response curves. PMID:28379950
Computation and measurement of cell decision making errors using single cell data.
Habibi, Iman; Cheong, Raymond; Lipniacki, Tomasz; Levchenko, Andre; Emamian, Effat S; Abdi, Ali
2017-04-01
In this study a new computational method is developed to quantify decision making errors in cells, caused by noise and signaling failures. Analysis of tumor necrosis factor (TNF) signaling pathway which regulates the transcription factor Nuclear Factor κB (NF-κB) using this method identifies two types of incorrect cell decisions called false alarm and miss. These two events represent, respectively, declaring a signal which is not present and missing a signal that does exist. Using single cell experimental data and the developed method, we compute false alarm and miss error probabilities in wild-type cells and provide a formulation which shows how these metrics depend on the signal transduction noise level. We also show that in the presence of abnormalities in a cell, decision making processes can be significantly affected, compared to a wild-type cell, and the method is able to model and measure such effects. In the TNF-NF-κB pathway, the method computes and reveals changes in false alarm and miss probabilities in A20-deficient cells, caused by cell's inability to inhibit TNF-induced NF-κB response. In biological terms, a higher false alarm metric in this abnormal TNF signaling system indicates perceiving more cytokine signals which in fact do not exist at the system input, whereas a higher miss metric indicates that it is highly likely to miss signals that actually exist. Overall, this study demonstrates the ability of the developed method for modeling cell decision making errors under normal and abnormal conditions, and in the presence of transduction noise uncertainty. Compared to the previously reported pathway capacity metric, our results suggest that the introduced decision error metrics characterize signaling failures more accurately. This is mainly because while capacity is a useful metric to study information transmission in signaling pathways, it does not capture the overlap between TNF-induced noisy response curves.
A missing dimension in measures of vaccination impacts
Gomes, M. Gabriela M.; Lipsitch, Marc; Wargo, Andrew R.; Kurath, Gael; Rebelo, Carlota; Medley, Graham F.; Coutinho, Antonio
2013-01-01
Immunological protection, acquired from either natural infection or vaccination, varies among hosts, reflecting underlying biological variation and affecting population-level protection. Owing to the nature of resistance mechanisms, distributions of susceptibility and protection entangle with pathogen dose in a way that can be decoupled by adequately representing the dose dimension. Any infectious processes must depend in some fashion on dose, and empirical evidence exists for an effect of exposure dose on the probability of transmission to mumps-vaccinated hosts [1], the case-fatality ratio of measles [2], and the probability of infection and, given infection, of symptoms in cholera [3]. Extreme distributions of vaccine protection have been termed leaky (partially protects all hosts) and all-or-nothing (totally protects a proportion of hosts) [4]. These distributions can be distinguished in vaccine field trials from the time dependence of infections [5]. Frailty mixing models have also been proposed to estimate the distribution of protection from time to event data [6], [7], although the results are not comparable across regions unless there is explicit control for baseline transmission [8]. Distributions of host susceptibility and acquired protection can be estimated from dose-response data generated under controlled experimental conditions [9]–[11] and natural settings [12], [13]. These distributions can guide research on mechanisms of protection, as well as enable model validity across the entire range of transmission intensities. We argue for a shift to a dose-dimension paradigm in infectious disease science and community health.
Transmission of Babesia microti Parasites by Solid Organ Transplantation
Herwaldt, Barbara L.; Kazmierczak, James J.; Weiss, John W.; Klein, Christina L.; Leith, Catherine P.; He, Rong; Oberley, Matthew J.; Tonnetti, Laura; Wilkins, Patricia P.; Gauthier, Gregory M.
2016-01-01
Babesia microti, an intraerythrocytic parasite, is tickborne in nature. In contrast to transmission by blood transfusion, which has been well documented, transmission associated with solid organ transplantation has not been reported. We describe parasitologically confirmed cases of babesiosis diagnosed ≈8 weeks posttransplantation in 2 recipients of renal allografts from an organ donor who was multiply transfused on the day he died from traumatic injuries. The organ donor and recipients had no identified risk factors for tickborne infection. Antibodies against B. microti parasites were not detected by serologic testing of archived pretransplant specimens. However, 1 of the organ donor’s blood donors was seropositive when tested postdonation and had risk factors for tick exposure. The organ donor probably served as a conduit of Babesia parasites from the seropositive blood donor to both kidney recipients. Babesiosis should be included in the differential diagnosis of unexplained fever and hemolytic anemia after blood transfusion or organ transplantation. PMID:27767010
Grain neighbour effects on twin transmission in hexagonal close-packed materials
Arul Kumar, Mariyappan; Beyerlein, Irene Jane; McCabe, Rodney James; ...
2016-12-19
Materials with a hexagonal close-packed (hcp) crystal structure such as Mg, Ti and Zr are being used in the transportation, aerospace and nuclear industry, respectively. Material strength and formability are critical qualities for shaping these materials into parts and a pervasive deformation mechanism that significantly affects their formability is deformation twinning. The interaction between grain boundaries and twins has an important influence on the deformation behaviour and fracture of hcp metals. Here, statistical analysis of large data sets reveals that whether twins transmit across grain boundaries depends not only on crystallography but also strongly on the anisotropy in crystallographic slip.more » As a result, we show that increases in crystal plastic anisotropy enhance the probability of twin transmission by comparing the relative ease of twin transmission in hcp materials such as Mg, Zr and Ti.« less
Plate Wave Resonance with Air-Coupled Ultrasonics
NASA Astrophysics Data System (ADS)
Bar, H. N.; Dayal, V.; Barnard, D.; Hsu, D. K.
2010-02-01
Air-coupled ultrasonic transducers can excite plate waves in metals and composites. The coincidence effect, i.e., the wave vector of plate wave coincides with projection of exciting airborne sound vector, leads to a resonance which strongly amplifies the sound transmission through the plate. The resonance depends on the angle of incidence and the frequency. In the present study, the incidence angle for maximum transmission (θmax) is measured in plates of steel, aluminum, carbon fiber reinforced composites and honeycomb sandwich panels. The variations of (θmax) with plate thickness are compared with theoretical values in steel, aluminum and quasi-isotropic carbon fiber composites. The enhanced transmission of air-coupled ultrasound at oblique incidence can substantially improve the probability of flaw detection in plates and especially in honeycomb structures. Experimental air-coupled ultrasonic scan of subtle flaws in CFRP laminates showed definite improvement of signal-to-noise ratio with oblique incidence at θmax.
Canine Visceral Leishmaniasis, United States and Canada, 2000–2003
Duprey, Zandra H.; Steurer, Francis J.; Rooney, Jane A.; Kirchhoff, Louis V.; Jackson, Joan E.; Rowton, Edgar D.
2006-01-01
Visceral leishmaniasis, caused by protozoa of the genus Leishmania donovani complex, is a vectorborne zoonotic infection that infects humans, dogs, and other mammals. In 2000, this infection was implicated as causing high rates of illness and death among foxhounds in a kennel in New York. A serosurvey of >12,000 foxhounds and other canids and 185 persons in 35 states and 4 Canadian provinces was performed to determine geographic extent, prevalence, host range, and modes of transmission within foxhounds, other dogs, and wild canids and to assess possible infections in humans. Foxhounds infected with Leishmania spp. were found in 18 states and 2 Canadian provinces. No evidence of infection was found in humans. The infection in North America appears to be widespread in foxhounds and limited to dog-to-dog mechanisms of transmission; however, if the organism becomes adapted for vector transmission by indigenous phlebotomines, the probability of human exposure will be greatly increased. PMID:16704782
Le Menach, Arnaud; Vergu, Elisabeta; Grais, Rebecca F; Smith, David L; Flahault, Antoine
2006-01-01
Recent avian flu epidemics (A/H5N1) in Southeast Asia and case reports from around the world have led to fears of a human pandemic. Control of these outbreaks in birds would probably lead to reduced transmission of the avian virus to humans. This study presents a mathematical model based on stochastic farm-to-farm transmission that incorporates flock size and spatial contacts to evaluate the impact of control strategies. Fit to data from the recent epidemic in the Netherlands, we evaluate the efficacy of control strategies and forecast avian influenza dynamics. Our results identify high-risk areas of spread by mapping of the farm level reproductive number. Results suggest that an immediate depopulation of infected flocks following an accurate and quick diagnosis would have a greater impact than simply depopulating surrounding flocks. Understanding the relative importance of different control measures is essential for response planning. PMID:16959637
Biology as population dynamics: heuristics for transmission risk.
Keebler, Daniel; Walwyn, David; Welte, Alex
2013-02-01
Population-type models, accounting for phenomena such as population lifetimes, mixing patterns, recruitment patterns, genetic evolution and environmental conditions, can be usefully applied to the biology of HIV infection and viral replication. A simple dynamic model can explore the effect of a vaccine-like stimulus on the mortality and infectiousness, which formally looks like fertility, of invading virions; the mortality of freshly infected cells; and the availability of target cells, all of which impact on the probability of infection. Variations on this model could capture the importance of the timing and duration of different key events in viral transmission, and hence be applied to questions of mucosal immunology. The dynamical insights and assumptions of such models are compatible with the continuum of between- and within-individual risks in sexual violence and may be helpful in making sense of the sparse data available on the association between HIV transmission and sexual violence. © 2012 John Wiley & Sons A/S.
Wolfinger, Nicholas H
2011-05-01
Many studies have demonstrated that the children of divorce are disproportionately likely to end their own marriages. In previous work, I showed that the transmission of divorce between generations weakened substantially for General Social Survey (GSS) respondents interviewed between 1973 and 1996 (Wolfinger 1999); Li and Wu (2006, 2008) contended that my finding is a methodological artifact of the GSS's lack of marriage duration data. This article presents a completed-cohort approach to studying divorce using the GSS. The results confirm a decline in the probability of divorce transmission that cannot be explained by the right-censoring bias alleged by Li and Wu. This finding contributes to an ongoing debate about trends in the negative consequences of parental divorce, as well as demonstrating a useful approach to right-censored phenomena when event history data are not available.
Coaxial tube array space transmission line characterization
NASA Technical Reports Server (NTRS)
Switzer, Colleen A.; Bents, David J.
1987-01-01
The coaxial tube array tether/transmission line used to connect an SP-100 nuclear power system to the space station was characterized over the range of reactor-to-platform separation distances of 1 to 10 km. Characterization was done with respect to array performance, physical dimensions and masses. Using a fixed design procedure, a family of designs was generated for the same power level (300 kWe), power loss (1.5 percent), and meteoroid survival probability (99.5 percent over 10 yr). To differentiate between vacuum insulated and gas insulated lines, two different maximum values of the E field were considered: 20 kV/cm (appropriate to vacuum insulation) and 50 kV/cm (compressed SF6). Core conductor, tube, bumper, standoff, spacer and bumper support dimensions, and masses were also calculated. The results of the characterization show mainly how transmission line size and mass scale with reactor-to-platform separation distance.
A Novel Scheme for Bidirectional and Hybrid Quantum Information Transmission via a Seven-Qubit State
NASA Astrophysics Data System (ADS)
Fang, Sheng-hui; Jiang, Min
2018-02-01
In this paper, we present a novel scheme for bidirectional and hybrid quantum information transmission via a seven-qubit state. We demonstrate that under the control of the supervisor two distant participants can simultaneously and deterministically exchange their states with each other no matter whether they know the states or not. In our scheme, Alice can teleport an arbitrary single-qubit state (two-qubit state) to Bob and Bob can prepare a known two-qubit state (single-qubit state) for Alice simultaneously via the control of the supervisor Charlie. Compared with previous studies for single bidirectional quantum teleportation or single bidirectional remote state preparation schemes, our protocol is a kind of hybrid approach for quantum information transmission. Furthermore, it achieves success with unit probability. Notably, since only pauli operations and two-qubit and single-qubit measurements are used in our schemes, it is flexible in physical experiments.
Coaxial tube array space transmission line characterization
NASA Astrophysics Data System (ADS)
Switzer, Colleen A.; Bents, David J.
The coaxial tube array tether/transmission line used to connect an SP-100 nuclear power system to the space station was characterized over the range of reactor-to-platform separation distances of 1 to 10 km. Characterization was done with respect to array performance, physical dimensions and masses. Using a fixed design procedure, a family of designs was generated for the same power level (300 kWe), power loss (1.5 percent), and meteoroid survival probability (99.5 percent over 10 yr). To differentiate between vacuum insulated and gas insulated lines, two different maximum values of the E field were considered: 20 kV/cm (appropriate to vacuum insulation) and 50 kV/cm (compressed SF6). Core conductor, tube, bumper, standoff, spacer and bumper support dimensions, and masses were also calculated. The results of the characterization show mainly how transmission line size and mass scale with reactor-to-platform separation distance.
Philippe, C; Blech, M F; Hartemann, P
2006-04-01
Legionnaires' disease is one of the major infectious risks related to hospital water systems. It is commonly accepted, that the disease is transmitted to man mostly by inhalation of water aerosols contaminated by Legionella pneumophila. The ability of L. pneumophila to multiply intracellularly within some amoebae better explains the ecology, the pathogenicity, and the virulence of this bacterium against human alveolar macrophages. The presence of these amoebae in water systems located where cases of Legionnaire's disease broke out, partly explains the difficulty in eradicating Legionella. Some studies also show that amoebae can play a major role in the transmission of the disease to man. Some other studies point out that inhaled amoebae could be involved in the pathogenesis of Legionnaire's disease. Future strategies to prevent the transmission of Legionella will probably have to include efficient treatments against amoebae.
Zahedi, Razieh; Noroozi, Alireza; Hajebi, Ahmad; Haghdoost, Ali Akbar; Baneshi, Mohammad Reza; Sharifi, Hamid; Mirzazadeh, Ali
2018-04-30
This study aimed to estimate the prevalence of substance use among university students measured by direct and indirect methods, and to calculate the visibility factor (VF) defined as ratio of indirect to direct estimates of substance use prevalence. A cross-sectional study. Using a multistage non-random sampling approach, we recruited 2157 students from three universities in Kerman, Iran, in 2016. We collected data on substance use by individual face-to-face interview using direct (i.e. self-report of their own behaviors) and indirect (NSU: Network scale up) methods. All estimates from direct and indirect methods were weighted based on inverse probability weight of sampling university. The response rate was 83.6%. The last year prevalence of water pipe, alcohol, and cigarettes indirect method was 44.6%, 18.1%, and 13.2% respectively. Corresponding figures in NSU analysis were 36.4%, 18.2%, and 16.5% respectively. In the female population, VF for all types of substance was less than male. Considerable numbers of university students used substances like a water pipe, alcohol, and cigarettes. NSU seems a promising method, especially among male students. Among female students, direct method provided more reliable results mainly due to transmission and prestige biases.
Exciton in a spherical core/shell nanostructure: Influence of surface ligand
NASA Astrophysics Data System (ADS)
Anitha, B.; Nithiananthi, P.
2018-04-01
Studies on exciton in an inverted type I spherical GaAs/Al0.3Ga0.7As core/shell nanostructure (CSN) are made using variational method. Dielectric constant and effective mass mismatches of the core and shell materials are considered. The effect of core and the shell dimensions on the exciton binding energy (BE) are analyzed for different shell (Rs) and core radii (Rc). It is observed that with the core and the shell inducement, significant change in BE can be achieved. In addition, the influence of ligand enclosureon the BE as a function of shell thickness (ST) is reviewed. The result exhibits that the presence of ligand considerably affects the BE. Further the transmission probability of exciton for various Rc and Rs are reported. The notable changes are compared and examined with and without ligand inclusion.
A Novel Friendly Jamming Scheme in Industrial Crowdsensing Networks against Eavesdropping Attack.
Li, Xuran; Wang, Qiu; Dai, Hong-Ning; Wang, Hao
2018-06-14
Eavesdropping attack is one of the most serious threats in industrial crowdsensing networks. In this paper, we propose a novel anti-eavesdropping scheme by introducing friendly jammers to an industrial crowdsensing network. In particular, we establish a theoretical framework considering both the probability of eavesdropping attacks and the probability of successful transmission to evaluate the effectiveness of our scheme. Our framework takes into account various channel conditions such as path loss, Rayleigh fading, and the antenna type of friendly jammers. Our results show that using jammers in industrial crowdsensing networks can effectively reduce the eavesdropping risk while having no significant influence on legitimate communications.
Classical Physics and the Bounds of Quantum Correlations.
Frustaglia, Diego; Baltanás, José P; Velázquez-Ahumada, María C; Fernández-Prieto, Armando; Lujambio, Aintzane; Losada, Vicente; Freire, Manuel J; Cabello, Adán
2016-06-24
A unifying principle explaining the numerical bounds of quantum correlations remains elusive, despite the efforts devoted to identifying it. Here, we show that these bounds are indeed not exclusive to quantum theory: for any abstract correlation scenario with compatible measurements, models based on classical waves produce probability distributions indistinguishable from those of quantum theory and, therefore, share the same bounds. We demonstrate this finding by implementing classical microwaves that propagate along meter-size transmission-line circuits and reproduce the probabilities of three emblematic quantum experiments. Our results show that the "quantum" bounds would also occur in a classical universe without quanta. The implications of this observation are discussed.
Experimental demonstration of a BDCZ quantum repeater node.
Yuan, Zhen-Sheng; Chen, Yu-Ao; Zhao, Bo; Chen, Shuai; Schmiedmayer, Jörg; Pan, Jian-Wei
2008-08-28
Quantum communication is a method that offers efficient and secure ways for the exchange of information in a network. Large-scale quantum communication (of the order of 100 km) has been achieved; however, serious problems occur beyond this distance scale, mainly due to inevitable photon loss in the transmission channel. Quantum communication eventually fails when the probability of a dark count in the photon detectors becomes comparable to the probability that a photon is correctly detected. To overcome this problem, Briegel, Dür, Cirac and Zoller (BDCZ) introduced the concept of quantum repeaters, combining entanglement swapping and quantum memory to efficiently extend the achievable distances. Although entanglement swapping has been experimentally demonstrated, the implementation of BDCZ quantum repeaters has proved challenging owing to the difficulty of integrating a quantum memory. Here we realize entanglement swapping with storage and retrieval of light, a building block of the BDCZ quantum repeater. We follow a scheme that incorporates the strategy of BDCZ with atomic quantum memories. Two atomic ensembles, each originally entangled with a single emitted photon, are projected into an entangled state by performing a joint Bell state measurement on the two single photons after they have passed through a 300-m fibre-based communication channel. The entanglement is stored in the atomic ensembles and later verified by converting the atomic excitations into photons. Our method is intrinsically phase insensitive and establishes the essential element needed to realize quantum repeaters with stationary atomic qubits as quantum memories and flying photonic qubits as quantum messengers.
NASA Astrophysics Data System (ADS)
Connick, Robert J.
Accurate measurement of normal incident transmission loss is essential for the acoustic characterization of building materials. In this research, a method of measuring normal incidence sound transmission loss proposed by Salissou et al. as a complement to standard E2611-09 of the American Society for Testing and Materials [Standard Test Method for Measurement of Normal Incidence Sound Transmission of Acoustical Materials Based on the Transfer Matrix Method (American Society for Testing and Materials, New York, 2009)] is verified. Two sam- ples from the original literature are used to verify the method as well as a Filtros RTM sample. Following the verification, several nano-material Aerogel samples are measured.
Transmitted HIV Drug Resistance Is High and Longstanding in Metropolitan Washington, DC
Kassaye, Seble G.; Grossman, Zehava; Balamane, Maya; Johnston-White, Betsy; Liu, Chenglong; Kumar, Princy; Young, Mary; Sneller, Michael C.; Sereti, Irini; Dewar, Robin; Rehm, Catherine; Meyer, William; Shafer, Robert; Katzenstein, David; Maldarelli, Frank
2016-01-01
Background. Washington, DC, has 2.5% human immunodeficiency virus (HIV) prevalence, 3.9% among African Americans. Antiretrovirals (ARTs) are the cornerstone for treatment and prevention. Monitoring changes in transmitted drug resistance (TDR) is critical for effective HIV care. Methods. HIV genotype data for individuals enrolled in research studies in metropolitan Washington, D.C., were used to identify TDR using the World Health Organization mutation list [Bennett DE, Camacho RJ, Otelea D, et al. Drug resistance mutations for surveillance of transmitted HIV-1 drug-resistance: 2009 update. PloS One 2009; 4:e4724]. HIV phylogenies were reconstructed using maximum likelihood and Bayesian methods. HIV transmission clusters were supported by 1000 bootstrap values >0.70 and posterior probability >0.95 of having a common ancestor. Results. Among 710 individuals enrolled in 1994–2013, the median age was 38.6 years, 46.2% were female, and 53.3% were African-American. TDR was 22.5% among 566 treatment-naive individuals; 15.8% had nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) resistance, 9.8% had nonnucleoside reverse-transcriptase inhibitor (NNRTI) resistance, and 4.2% had protease inhibitor (PI) resistance. Single class TDR was 10.0%, 5.1%, and 1.6% to NRTIs, NNRTIs, and PIs. Dual TDR to PI and NRTI was seen in 1.6%, NRTI and NNRTI in 3.4%, and triple class TDR in 0.9%. TDR frequency decreased from 1994–2006 (27.1%) to 2007–2013 (19.4%; P = .02). Only 6/79 (7.6%) individuals within transmission clusters had evidence of TDR. Discussions. We identified high prevalence of TDR among HIV-infected individuals in metropolitan Washington, DC, regardless of gender. Active surveillance for TDR is needed to guide ART usage and analyses of risk group contributions to HIV transmission and resistance. PMID:27307507
Method and apparatus for wavefront sensing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bahk, Seung-Whan
A method for performing optical wavefront sensing includes providing an amplitude transmission mask having a light input side, a light output side, and an optical transmission axis passing from the light input side to the light output side. The amplitude transmission mask is characterized by a checkerboard pattern having a square unit cell of size .LAMBDA.. The method also includes directing an incident light field having a wavelengthmore » $$ \\lamda $$ to be incident on the light input side and propagating the incident light field through the amplitude transmission mask. The method further includes producing a plurality of diffracted light fields on the light output side and detecting, at a detector disposed a distance L from the amplitude transmission mask, an interferogram associated with the plurality of diffracted light fields.« less
[Design and optimization of wireless power and data transmission for visual prosthesis].
Lei, Xuping; Wu, Kaijie; Zhao, Lei; Chai, Xinyu
2013-11-01
Boosting spatial resolution of visual prostheses is an effective method to improve implant subjects' visual perception. However, power consumption of visual implants greatly rises with the increasing number of implanted electrodes. In respond to this trend, visual prostheses need to develop high-efficiency wireless power transmission and high-speed data transmission. This paper presents a review of current research progress on wireless power and data transmission for visual prostheses, analyzes relative principles and requirement, and introduces design methods of power and data transmission.
Dads and Daughters: The Changing Impact of Fathers on Women's Occupational Choices
ERIC Educational Resources Information Center
Hellerstein, Judith K.; Morrill, Melinda Sandler
2011-01-01
We examine whether women's rising labor force participation led to increased intergenerational transmission of occupation from fathers to daughters. We develop a model where fathers invest in human capital that is specific to their own occupations. Our model generates an empirical test where we compare the trends in the probabilities that women…