Kuniansky, Eve L.; Bellino, Jason C.
2012-04-19
A goal of the U.S. Geological Survey Groundwater Resources Program is to assess the availability of fresh water within each of the principal aquifers in the United States with the greatest groundwater withdrawals. The Floridan aquifer system (FAS), which covers an area of approximately 100,000 square miles in Florida and parts of Georgia, Alabama, Mississippi, and South Carolina, is one such principal aquifer, having the fifth largest groundwater withdrawals in the Nation, totaling 3.64 billion gallons per day in 2000. Compilation of FAS hydraulic properties is critical to the development and calibration of groundwater flow models that can be used to develop water budgets spatially and temporally, as well as to evaluate resource changes over time. Wells with aquifer test data were identified as Upper Floridan aquifer (UFA), Lower Floridan aquifer (LFA), Floridan aquifer system (FAS, Upper Floridan with some middle and/or Lower Floridan), or middle Floridan confining unit (MCU), based on the identification from the original database or report description, or comparison of the open interval of the well with previously published maps.This report consolidates aquifer hydraulic property data obtained from multiple databases and reports of the U.S. Geological Survey, various State agencies, and the Water Management Districts of Florida, that are compiled into tables to provide a single information source for transmissivity and storage properties of the FAS as of October 2011. Transmissivity calculated from aquifer pumping tests and specific-capacity data are included. Values for transmissivity and storage coefficients are intended for use in regional or sub regional groundwater flow models; thus, any tests (aquifer pumping tests and specific capacity data) that were conducted with packers or for open intervals less than 30 feet in length are excluded from the summary statistics and tables of this report, but are included in the database.The transmissivity distribution from the aquifer pumping tests is highly variable. The transmissivity based on aquifer pumping tests (from 1,045 values for the UFA and FAS) ranges from 8 to about 9,300,000 square feet per day (ft2/d) and values of storage coefficient (646 reported) range from 3x10-9 to 0.41. The 64 transmissivity values for the LFA range from about 130 to 4,500,000 ft2/d, and the 17 storage coefficient values range from 7x10-8 to 0.03. The 14 transmissivity values for the MCU range from 1 to about 600,000 ft2/d and the 10 storage coefficient values range from 8x10-8 to 0.03. Transmissivity estimates for the UFA and FAS for 442 specific capacity tests range from approximately 200 to 1,000,000 ft2/d.
Kuniansky, Eve L.; Bellino, Jason C.; Dixon, Joann F.
2012-01-01
The Floridan aquifer system (FAS) covers an area of approximately 100,000 square miles in Florida and parts of Georgia, South Carolina, Alabama, and Mississippi. Groundwater wells for water supply were first drilled in the late 1800s and by the year 2000, the FAS was the primary source of drinking water for about 10 million people. One of the methods for assessing groundwater availability is the development of regional or subregional groundwater flow models of the aquifer system that can be used to develop water budgets spatially and temporally, as well as evaluate the groundwater resource change over time. Understanding the distribution of transmissivity within the FAS is critical to the development of groundwater flow models. The map presented herein differs from previously published maps of the FAS in that it is based on interpolation of 1,487 values of transmissivity. The transmissivity values in the dataset range from 8 to 9,000,000 feet squared per day (ft2/d) with the majority of the values ranging from 10,000 to 100,000 ft2/d. The wide range in transmissivity (6 orders of magnitude) is typical of carbonate rock aquifers, which are characterized by a wide range in karstification. Commonly, the range in transmissivity is greatest in areas where groundwater flow creates conduits in facies that dissolve more readily or areas of high porosity units that have interconnected vugs, with diameters greater than 0.1 foot. These are also areas where transmissivity is largest. Additionally, first magnitude springsheds and springs are shown because in these springshed areas, the estimates of transmissivity from interpolation may underestimate the actual range in transmissivity. Also shown is an area within the Gulf Trough in Georgia where high yielding wells are unlikely to be developed in the Upper Floridan aquifer. The interpolated transmissivity ranges shown on this map reflect the geologic structure and karstified areas. Transmissivity is large in the areas where the system is unconfined, such as west-central Florida and southwest Georgia just northwest of the Gulf Trough. Transmissivity is small along the Gulf Trough and Southwest Georgia Embayment (referred to as Apalachicola Embayment in some reports). Transmissivity is also small in the thin, updip part of the system near its northern boundary. Another area of large transmissivity coincides with the Southeast Georgia Embayment.
NASA Technical Reports Server (NTRS)
Miranda, F. A.; Gordon, W. L.; Bhasin, K. B.; Heinen, V. O.; Warner, J. D.; Valco, G. J.
1989-01-01
Millimeter wave transmission measurements through YBa2Cu3O(7-delta) thin films on MgO, ZrO2 and LaAlO3 substrates, are reported. The films (approx. 1 micron) were deposited by sequential evaporation and laser ablation techniques. Transition temperatures T sub c, ranging from 89.7 K for the Laser Ablated film on LaAlO3 to approximately 72 K for the sequentially evaporated film on MgO, were obtained. The values of the real and imaginary parts of the complex conductivity, sigma 1 and sigma 2, are obtained from the transmission data, assuming a two fluid model. The BCS approach is used to calculate values for an effective energy gap from the obtained values of sigma sub 1. A range of gap values from 2 DELTA o/K sub B T sub c = 4.19 to 4.35 was obtained. The magnetic penetration depth is evaluated from the deduced values of sigma 2. These results are discussed together with the frequency dependence of the normalized transmission amplitude, P/P sub c, below and above T sub c.
Attenuation of epsilon(sub eff) of coplanar waveguide transmission lines on silicon substrates
NASA Technical Reports Server (NTRS)
Taub, Susan R.; Young, Paul G.
1993-01-01
Attenuation and epsilon(sub eff) of Coplanar Waveguide (CPW) transmission lines were measured on Silicon substrates with resistivities ranging from 400 to greater than 30,000 ohm-cm, that have a 1000 angstrom coating of SiO2. Both attenuation and epsilon(sub eff) are given over the frequency range 5 to 40 GHz for various strip and slot widths. These measured values are also compared to the theoretical values.
NASA Technical Reports Server (NTRS)
Williams, K. K.; Greeley, R.
2001-01-01
Measurements of radar transmission through a Mars analog dust are used to calculate values of signal attenuation over a frequency range of 0.5-12 GHz. These values are discussed in the context of a Mars radar imaging mission. Additional information is contained in the original extended abstract.
Hoos, A.B.
1990-01-01
Quantitative information concerning aquifer hydrologic and hydraulic characteristics is needed to manage the development of ground-water resources. These characteristics are poorly defined for the bedrock aquifers in Middle and East Tennessee where demand for water is increasing. This report presents estimates of recharge rate, storage coefficient, diffusivity, and transmissivity for representative drainage basins in Middle and East Tennessee, as determined from analyses of stream-aquifer interactions. The drainage basins have been grouped according to the underlying major aquifer, then statistical descriptions applied to each group, in order to define area1 distribution of these characteristics. Aquifer recharge rates are estimated for representative low, average, and high flow years for 63 drainage basins using hydrograph analysis techniques. Net annual recharge during average flow years for all basins ranges from 4.1 to 16.8 in/yr (inches per year), with a mean value of 7.3 in. In general, recharge rates are highest for basins underlain by the Blue Ridge aquifer (mean value11.7 in/yr) and lowest for basins underlain by the Central Basin aquifer (mean value 5.6 in/yr). Mean recharge values for the Cumberland Plateau, Highland Rim, and Valley and Ridge aquifers are 6.5, 7.4, and 6.6 in/yr, respectively. Gravity drainage characterizes ground-water flow in most surficial bedrock aquifer in Tennessee. Accordingly, a gravity yield analysis, which compares concurrent water-level and streamflow hydrographs, was used to estimate aquifer storage coefficient for nine study basins. The basin estimates range from 0.002 to 0.140; however, most estimates are within a narrow range of values, from 0.01 to 0.025. Accordingly, storage coefficient is estimated to be 0.01 for all aquifers in Middle and East Tennessee, with the exception of the aquifer in the inner part of the Central Basin, for which storage coefficient is estimated to be 0.002. Estimates of aquifer hydraulic diffusivity are derived from estimates of the streamflow recession index and drainage density for 75 drainage basins; values range from 3,300 to 130,000 ft^2/d (feet squared per day). Basin-specific and site-specific estimates of transmissivity are computed from estimates of hydraulic diffusivity and specific-capacity test data, respectively. Basin-specific, or areal, estimates of transmissivity range from 22 to 1,300 ft^2/d, with a mean of 240 ft^2/d In general, areal transmissivity is highest for basins underlain by the Cumberland Plateau aquifer (mean value 480 ft^2/d) and lowest for basins underlain by the Central Basin aquifer (mean value 79 ft^2/d). Mean transmissivity values for the Highland Rim, Valley and Ridge, and Blue Ridge aquifer are 320,140, and 120 ft^2/d respectively. Site-specific estimates of transmissivity, computed from specific-capacity data from 118 test wells in Middle and East Tennessee range from 2 to 93,000 ft^2/d with a mean of 2,600 ft^2/d Mean transmissivity values for the Cumberland Plateau, Highland Rim, Central Basin, Valley and Ridge, and Blue Ridge aquifers are 2,800,1,200, 7,800, 390, and 65Oft Id, respectively.
Short Range Acoustic Propagation Under Arctic Ice Cover During Icex 16
2016-09-01
There is no immediately apparent pattern to the discontinuity between modeled and observed transmission loss . In some cases, the modeled values are...Reeder THIS PAGE INTENTIONALLY LEFT BLANK i REPORT DOCUMENTATION PAGE Form Approved OMB No . 0704–0188 Public reporting burden for this...transmission loss in the observed frequency, range, and depth combinations. The received signals were processed and analyzed to determine observed
Alcaráz, Mirta R; Schwaighofer, Andreas; Goicoechea, Héctor; Lendl, Bernhard
2016-06-01
In this work, a novel EC-QCL-based setup for mid-IR transmission measurements in the amide I region is introduced for monitoring dynamic changes in secondary structure of proteins. For this purpose, α-chymotrypsin (aCT) acts as a model protein, which gradually forms intermolecular β-sheet aggregates after adopting a non-native α-helical structure induced by exposure to 50 % TFE. In order to showcase the versatility of the presented setup, the effects of varying pH values and protein concentration on the rate of β-aggregation were studied. The influence of the pH value on the initial reaction rate was studied in the range of pH 5.8-8.2. Results indicate an increased aggregation rate at elevated pH values. Furthermore, the widely accessible concentration range of the laser-based IR transmission setup was utilized to investigate β-aggregation across a concentration range of 5-60 mg mL(-1). For concentrations lower than 20 mg mL(-1), the aggregation rate appears to be independent of concentration. At higher values, the reaction rate increases linearly with protein concentration. Extended MCR-ALS was employed to obtain pure spectral and concentration profiles of the temporal transition between α-helices and intermolecular β-sheets. Comparison of the global solutions obtained by the modelled data with results acquired by the laser-based IR transmission setup at different conditions shows excellent agreement. This demonstrates the potential and versatility of the EC-QCL-based IR transmission setup to monitor dynamic changes of protein secondary structure in aqueous solution at varying conditions and across a wide concentration range. Graphical abstract EC-QCL IR spectroscopy for monitoring protein conformation change.
Denholm, Paul; Sioshansi, Ramteen
2009-05-05
In this paper, we examine the potential advantages of co-locating wind and energy storage to increase transmission utilization and decrease transmission costs. Co-location of wind and storage decreases transmission requirements, but also decreases the economic value of energy storage compared to locating energy storage at the load. This represents a tradeoff which we examine to estimate the transmission costs required to justify moving storage from load-sited to wind-sited in three different locations in the United States. We examined compressed air energy storage (CAES) in three “wind by wire” scenarios with a variety of transmission and CAES sizes relative to amore » given amount of wind. In the sites and years evaluated, the optimal amount of transmission ranges from 60% to 100% of the wind farm rating, with the optimal amount of CAES equal to 0–35% of the wind farm rating, depending heavily on wind resource, value of electricity in the local market, and the cost of natural gas.« less
Importance of contact lens power and thickness in oxygen transmissibility.
Lira, Madalena; Pereira, Clara; Real Oliveira, M Elisabete C D; Castanheira, Elisabete M S
2015-04-01
The aim of this work was to study the central and peripheral thickness of several contact lenses (CL) with different powers and analyze how thickness variation affects CL oxygen transmissibility. Four daily disposable and five monthly or biweekly CL were studied. The powers of each CL were: the maximum negative power of each brand; -6.00 D; -3.00 D; zero power (-0.25 D or -0.50 D), +3.00 D and +6.00 D. Central and peripheral thicknesses were measured with an electronic thickness gauge. Each lens was measured five times (central and 3mm paracentral) and the mean value was considered. Using the values of oxygen permeability given by the manufacturers and the measured thicknesses, the variation of oxygen transmissibility with lens power was determined. For monthly or biweekly lenses, central thickness changed between 0.061 ± 0.002 mm and 0.243 ± 0.002 mm, and peripheral thickness varied between 0.084 ± 0.002 mm and 0.231 ± 0.015 mm. Daily disposable lenses showed central values ranging between 0.056 ± 0.0016 mm and 0.205 ± 0.002 mm and peripheral values between 0.108 ± 0.05 and 0.232 ± 0.011 mm. Oxygen transmissibility (in units) of monthly or biweekly CL ranged between 39.4 ± 0.3 and 246.0 ± 14.4 and for daily disposable lenses the values range between 9.5 ± 0.5 and 178.1 ± 5.1. The central and peripheral thicknesses change significantly when considering the CL power and this has a significant impact on the oxygen transmissibility. Eyecare practitioners must have this fact in account when high power plus or minus lenses are fitted or when continuous wear is considered. Copyright © 2014 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.
Tables of spectral transmission of the atmosphere in the 2660-2750 cm(-1) and 810-980 cm(-1) ranges
NASA Technical Reports Server (NTRS)
1978-01-01
Thermal sounding data from satellites are presented together with a description of transmission function calculations. Tables contain experimental values for transmission of the entire thickness of the atmosphere for two regions of the spectrum: at 2660 to 2750 cm/1 and at 810 to 980 cm/1. The spectrum was recorded on an infrared spectrophotometer.
Prediction of transmission loss through an aircraft sidewall using statistical energy analysis
NASA Astrophysics Data System (ADS)
Ming, Ruisen; Sun, Jincai
1989-06-01
The transmission loss of randomly incident sound through an aircraft sidewall is investigated using statistical energy analysis. Formulas are also obtained for the simple calculation of sound transmission loss through single- and double-leaf panels. Both resonant and nonresonant sound transmissions can be easily calculated using the formulas. The formulas are used to predict sound transmission losses through a Y-7 propeller airplane panel. The panel measures 2.56 m x 1.38 m and has two windows. The agreement between predicted and measured values through most of the frequency ranges tested is quite good.
Abbott, Marvin M.; DeHay, Kelli
2008-01-01
The Ada-Vamoosa aquifer of northeastern Oklahoma is a sedimentary bedrock aquifer of Pennsylvanian age that crops out over 800 square miles of the Osage Reservation. The Osage Nation needed additional information regarding the production potential of the aquifer to aid them in future development planning. To address this need, the U.S. Geological Survey, in cooperation with the Osage Nation, conducted a study of aquifer properties in the Ada-Vamoosa aquifer. This report presents the results of the aquifer tests from 20 wells in the Ada-Vamoosa aquifer and one well in a minor aquifer east of the Ada-Vamoosa outcrop on the Osage Reservation. Well information for 17 of the 21 wells in this report was obtained from the Indian Health Service. Data collected by the U.S. Geological Survey during this investigation are pumping well data from four domestic wells collected during the summer of 2006. Transmissivity values were calculated from well pumping data or were estimated from specific capacity values depending on the reliability of the data. The estimated transmissivity values are 1.1 to 4.3 times greater than the calculated transmissivity values. The calculated and estimated transmissivity values range from 5 to 1,000 feet squared per day.
NASA Technical Reports Server (NTRS)
Heinen, Vernon O.; Miranda, Felix A.; Bhasin, Kul B.
1992-01-01
A power transmission measurement technique was used to determine the magnetic penetration depth (lambda) of YBa2Cu3O(7-delta) superconducting thin films on LaAlO3 within the 26.5 to 40.0 GHz frequency range, and at temperatures from 20 to 300 K. Values of lambda ranging from 1100 to 2500 A were obtained at low temperatures. The anisotropy of lambda was determined from measurements of c-axis and a-axis oriented films. An estimate of the intrinsic value of lambda of 90 +/- 30 nm was obtained from the dependence of lambda on film thickness. The advantage of this technique is that it allows lambda to be determined nondestructively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spane, F.A. Jr.; Vermeul, V.R.
Pacific Northwest Laboratory, as part of the Hanford Site Ground-Water Surveillance Project, examines the potential for offsite migration of contamination within the upper basalt confined aquifer system. For the past 40 years, hydrologic testing of the upper basalt confined aquifer has been conducted by a number of Hanford Site programs. Hydraulic property estimates are important for evaluating aquifer flow characteristics (i.e., ground-water flow patterns, flow velocity, transport travel time). Presented are the first comprehensive Hanford Site-wide summary of hydraulic properties for the upper basalt confined aquifer system (i.e., the upper Saddle Mountains Basalt). Available hydrologic test data were reevaluated usingmore » recently developed diagnostic test analysis methods. A comparison of calculated transmissivity estimates indicates that, for most test results, a general correspondence within a factor of two between reanalysis and previously reported test values was obtained. For a majority of the tests, previously reported values are greater than reanalysis estimates. This overestimation is attributed to a number of factors, including, in many cases, a misapplication of nonleaky confined aquifer analysis methods in previous analysis reports to tests that exhibit leaky confined aquifer response behavior. Results of the test analyses indicate a similar range for transmissivity values for the various hydro-geologic units making up the upper basalt confined aquifer. Approximately 90% of the calculated transmissivity values for upper basalt confined aquifer hydrogeologic units occur within the range of 10{sup 0} to 10{sup 2} m{sup 2}/d, with 65% of the calculated estimate values occurring between 10{sup 1} to 10{sup 2} m{sup 2}d. These summary findings are consistent with the general range of values previously reported for basalt interflow contact zones and sedimentary interbeds within the Saddle Mountains Basalt.« less
NASA Astrophysics Data System (ADS)
Thomas, R.; Le Fèvre, O.; Le Brun, V.; Cassata, P.; Garilli, B.; Lemaux, B. C.; Maccagni, D.; Pentericci, L.; Tasca, L. A. M.; Zamorani, G.; Zucca, E.; Amorin, R.; Bardelli, S.; Cassarà, L.; Castellano, M.; Cimatti, A.; Cucciati, O.; Durkalec, A.; Fontana, A.; Giavalisco, M.; Grazian, A.; Hathi, N. P.; Ilbert, O.; Paltani, S.; Pforr, J.; Ribeiro, B.; Schaerer, D.; Scodeggio, M.; Sommariva, V.; Talia, M.; Tresse, L.; Vanzella, E.; Vergani, D.; Capak, P.; Charlot, S.; Contini, T.; Cuby, J. G.; de la Torre, S.; Dunlop, J.; Fotopoulou, S.; Koekemoer, A.; López-Sanjuan, C.; Mellier, Y.; Salvato, M.; Scoville, N.; Taniguchi, Y.; Wang, P. W.
2017-01-01
The observed UV rest-frame spectra of distant galaxies are the result of their intrinsic emission combined with absorption along the line of sight produced by the inter-galactic medium (IGM). Here we analyse the evolution of the mean IGM transmission Tr(Lyα) and its dispersion along the line of sight for 2127 galaxies with 2.5 < z < 5.5 in the VIMOS Ultra Deep Survey (VUDS). We fitted model spectra combined with a range of IGM transmission to the galaxy spectra using the spectral fitting algorithm GOSSIP+. We used these fits to derive the mean IGM transmission towards each galaxy for several redshift slices from z = 2.5 to z = 5.5. We found that the mean IGM transmission defined as Tr(Lyα) = e- τ (with τ as the HI optical depth) is 79%, 69%, 59%, 55%, and 46% at redshifts 2.75, 3.22, 3.70, 4.23, and 4.77, respectively. We compared these results to measurements obtained from quasar lines of sight and found that the IGM transmission towards galaxies is in excellent agreement with quasar values up to redshift z 4. We found tentative evidence for a higher IGM transmission at z ≥ 4 compared to results from QSOs, but a degeneracy between dust extinction and IGM prevents us from firmly concluding whether the internal dust extinction for star-forming galaxies at z > 4 takes a mean value significantly in excess of E(B-V) > 0.15. Most importantly, we found a large dispersion of IGM transmission along the lines of sight towards distant galaxies with 68% of the distribution within 10 to 17% of the median value in δz = 0.5 bins, similar to what is found on the lines of sight towards QSOs. We demonstrate that taking this broad range of IGM transmission into account is important when selecting high-redshift galaxies based on their colour properties (e.g. LBG or photometric redshiftselection) because failing to do so causes a significant incompleteness in selecting high-redshift galaxy populations. We finally discuss the observed IGM properties and speculate that the broad range of observed transmissions might be the result of cosmic variance and clustering along lines of sight. This clearly shows that the sources that cause this extinction need to be more completely modelled. Based on data obtained with the European Southern Observatory Very Large Telescope, Paranal, Chile, under Large Program 185.A-0791.
Truscott, James E; Werkman, Marleen; Wright, James E; Farrell, Sam H; Sarkar, Rajiv; Ásbjörnsdóttir, Kristjana; Anderson, Roy M
2017-06-30
There is an increased focus on whether mass drug administration (MDA) programmes alone can interrupt the transmission of soil-transmitted helminths (STH). Mathematical models can be used to model these interventions and are increasingly being implemented to inform investigators about expected trial outcome and the choice of optimum study design. One key factor is the choice of threshold for detecting elimination. However, there are currently no thresholds defined for STH regarding breaking transmission. We develop a simulation of an elimination study, based on the DeWorm3 project, using an individual-based stochastic disease transmission model in conjunction with models of MDA, sampling, diagnostics and the construction of study clusters. The simulation is then used to analyse the relationship between the study end-point elimination threshold and whether elimination is achieved in the long term within the model. We analyse the quality of a range of statistics in terms of the positive predictive values (PPV) and how they depend on a range of covariates, including threshold values, baseline prevalence, measurement time point and how clusters are constructed. End-point infection prevalence performs well in discriminating between villages that achieve interruption of transmission and those that do not, although the quality of the threshold is sensitive to baseline prevalence and threshold value. Optimal post-treatment prevalence threshold value for determining elimination is in the range 2% or less when the baseline prevalence range is broad. For multiple clusters of communities, both the probability of elimination and the ability of thresholds to detect it are strongly dependent on the size of the cluster and the size distribution of the constituent communities. Number of communities in a cluster is a key indicator of probability of elimination and PPV. Extending the time, post-study endpoint, at which the threshold statistic is measured improves PPV value in discriminating between eliminating clusters and those that bounce back. The probability of elimination and PPV are very sensitive to baseline prevalence for individual communities. However, most studies and programmes are constructed on the basis of clusters. Since elimination occurs within smaller population sub-units, the construction of clusters introduces new sensitivities for elimination threshold values to cluster size and the underlying population structure. Study simulation offers an opportunity to investigate key sources of sensitivity for elimination studies and programme designs in advance and to tailor interventions to prevailing local or national conditions.
Comparison of dose response functions for EBT3 model GafChromic™ film dosimetry system.
Aldelaijan, Saad; Devic, Slobodan
2018-05-01
Different dose response functions of EBT3 model GafChromic™ film dosimetry system have been compared in terms of sensitivity as well as uncertainty vs. error analysis. We also made an assessment of the necessity of scanning film pieces before and after irradiation. Pieces of EBT3 film model were irradiated to different dose values in Solid Water (SW) phantom. Based on images scanned in both reflection and transmission mode before and after irradiation, twelve different response functions were calculated. For every response function, a reference radiochromic film dosimetry system was established by generating calibration curve and by performing the error vs. uncertainty analysis. Response functions using pixel values from the green channel demonstrated the highest sensitivity in both transmission and reflection mode. All functions were successfully fitted with rational functional form, and provided an overall one-sigma uncertainty of better than 2% for doses above 2 Gy. Use of pre-scanned images to calculate response functions resulted in negligible improvement in dose measurement accuracy. Although reflection scanning mode provides higher sensitivity and could lead to a more widespread use of radiochromic film dosimetry, it has fairly limited dose range and slightly increased uncertainty when compared to transmission scan based response functions. Double-scanning technique, either in transmission or reflection mode, shows negligible improvement in dose accuracy as well as a negligible increase in dose uncertainty. Normalized pixel value of the images scanned in transmission mode shows linear response in a dose range of up to 11 Gy. Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Owen, R. B.
1972-01-01
A transmission electron microscopy study involving direct and replicating techniques is directed to a definition of the microstructure of radio frequency-sputtered, thin lead-dielectric cermet films. Once defined, this microstructure is used to obtain theoretical film refractive indices. The Maxwell Garnett theory provides a basis for the theoretical results. Measurements of film transmission and reflectivity are used to obtain rough experimental values for film refractive indices by the Tekucheva method. More exact values are obtained via ellipsometry. The rough Tekucheva values are used to determine the range over which computer calculations interpreting the ellipsometric results must be made. This technique yields accurate values for the film refractive indices.
Spherical gearing with intermediate ball elements: parameter ranges with a high contact ratio
NASA Astrophysics Data System (ADS)
Gorbenko, M. V.; Gorbenko, T. I.
2017-02-01
The paper presents analytical research of the geometry and kinematical parameters of spherical gearing with ball intermediate elements. The main attention is paid to the influence of the offset coefficient on the tooth geometry generation, the contact ratio and the motion transmission angle. Intermediate ball element racetracks on the gear are trochoidal curves on a spherical surface. Two areas for the offset coefficient values providing a high value of the contact ratio - basic trochoid (without offset) and prolate trochoid with abutting racetracks of adjacent ball elements ― were revealed. Analysis of the investigated parameters showed that for power transmission, it is preferable to use spherical gearing without an offset, and for kinematic transmission, it is possible to use profiles with a large offset. The present study allows making a rational choice of geometrical parameters depending on the transmission predestination.
Clarke, John S.; Leeth, David C.; Taylor-Harris, DaVette; Painter, Jaime A.; Labowski, James L.
2005-01-01
Hydraulic-property data for the Floridan aquifer system and equivalent clastic sediments in a 67-county area of coastal Georgia and adjacent parts of South Carolina and Florida were evaluated to provide data necessary for development of ground-water flow and solute-transport models. Data include transmissivity at 324 wells, storage coefficient at 115 wells, and vertical hydraulic conductivity of 72 core samples from 27 sites. Hydraulic properties of the Upper Floridan aquifer vary greatly in the study area due to the heterogeneity (and locally to anisotropy) of the aquifer and to variations in the degree of confinement provided by confining units. Prominent structural features in the areathe Southeast Georgia Embayment, the Beaufort Arch, and the Gulf Troughinfluence the thickness and hydraulic properties of the sediments comprising the Floridan aquifer system. Transmissivity of the Upper Floridan aquifer and equivalent updip units was compiled for 239 wells and ranges from 530 feet squared per day (ft2/d) at Beaufort County, South Carolina, to 600,000 ft2/d in Coffee County, Georgia. In carbonate rock settings of the lower Coastal Plain, transmissivity of the Upper Floridan aquifer generally is greater than 20,000 ft2/d, with values exceeding 100,000 ft2/d in the southeastern and southwestern parts of the study area (generally coinciding with the area of greatest aquifer thickness). Transmissivity of the Upper Floridan aquifer generally is less than 10,000 ft2/d in and near the upper Coastal Plain, where the aquifer is thin and consists largely of clastic sediments, and in the vicinity of the Gulf Trough, where the aquifer consists of low permeability rocks and sediments. Large variability in the range of transmissivity in Camden and Glynn Counties, Georgia, and Nassau County, Florida, demonstrates the anisotropic distribution of hydraulic properties that may result from fractures or solution openings in the carbonate rocks. Storage coefficient of the Upper Floridan aquifer was compiled for 106 wells and ranges from about 0.00004 at Beaufort County, South Carolina, to 0.04 in Baker County, Florida. Transmissivity of the Lower Floridan aquifer and equivalent updip clastic units was compiled for 53 wells and ranges from about 170 ft2/d in Barnwell County, South Carolina, to about 43,000 ft2/d in Camden County, Georgia. Transmissivity of the Lower Floridan aquifer is greatest where the aquifer is thickest in southeastern Georgia and northeastern Floridawhere estimates are greater than 10,000 ft2/d; at one well in southeastern Georgia transmissivity was estimated to be as high as 200,000 ft2/d. Storage-coefficient data for the Lower Floridan aquifer are limited to three estimates in Barnwell and Allendale Counties, South Carolina, and to estimates determined from six multi-aquifer tests in Duval County, Florida. In the South Carolina tests, storage coefficient ranges from 0.0003 to 0.0004; this range is indicative of a confined aquifer. The storage coefficient for the combined Upper and Lower Floridan wells in Duval County, Florida, ranges from 0.00002 to 0.02. Vertical hydraulic conductivity was compiled from core samples collected at 27 sites. For the Upper Floridan confining unit, values from 39 core samples at 17 sites range from 0.0002 to 3 feet per day (ft/d). For the Lower Floridan confining unit, values from 10 core samples at 9 sites range from about 0.000004 to 0.16 ft/d. Vertical hydraulic conductivity of the Upper Floridan aquifer was compiled from 16 core samples at five sites, mostly in the Brunswick, Georgia, area and values range from 0.00134 to 160.4 ft/d. Vertical hydraulic conductivity for the semiconfining unit separating the upper and lower water-bearing zones of the Upper Floridan at Brunswick, Georgia, compiled from 6 core samples at three sites ranges from 0.000008 to 0.000134 ft/d. The vertical hydraulic conductivity of the Lower Floridan aquifer in a core sample from a well at Brunswick, G
Novel framework for assessing epidemiologic effects of influenza epidemics and pandemics.
Reed, Carrie; Biggerstaff, Matthew; Finelli, Lyn; Koonin, Lisa M; Beauvais, Denise; Uzicanin, Amra; Plummer, Andrew; Bresee, Joe; Redd, Stephen C; Jernigan, Daniel B
2013-01-01
The effects of influenza on a population are attributable to the clinical severity of illness and the number of persons infected, which can vary greatly between seasons or pandemics. To create a systematic framework for assessing the public health effects of an emerging pandemic, we reviewed data from past influenza seasons and pandemics to characterize severity and transmissibility (based on ranges of these measures in the United States) and outlined a formal assessment of the potential effects of a novel virus. The assessment was divided into 2 periods. Because early in a pandemic, measurement of severity and transmissibility is uncertain, we used a broad dichotomous scale in the initial assessment to divide the range of historic values. In the refined assessment, as more data became available, we categorized those values more precisely. By organizing and prioritizing data collection, this approach may inform an evidence-based assessment of pandemic effects and guide decision making.
Novel Framework for Assessing Epidemiologic Effects of Influenza Epidemics and Pandemics
Biggerstaff, Matthew; Finelli, Lyn; Koonin, Lisa M.; Beauvais, Denise; Uzicanin, Amra; Plummer, Andrew; Bresee, Joe; Redd, Stephen C.; Jernigan, Daniel B.
2013-01-01
The effects of influenza on a population are attributable to the clinical severity of illness and the number of persons infected, which can vary greatly between seasons or pandemics. To create a systematic framework for assessing the public health effects of an emerging pandemic, we reviewed data from past influenza seasons and pandemics to characterize severity and transmissibility (based on ranges of these measures in the United States) and outlined a formal assessment of the potential effects of a novel virus. The assessment was divided into 2 periods. Because early in a pandemic, measurement of severity and transmissibility is uncertain, we used a broad dichotomous scale in the initial assessment to divide the range of historic values. In the refined assessment, as more data became available, we categorized those values more precisely. By organizing and prioritizing data collection, this approach may inform an evidence-based assessment of pandemic effects and guide decision making. PMID:23260039
Tunable MOEMS Fabry-Perot interferometer for miniaturized spectral sensing in near-infrared
NASA Astrophysics Data System (ADS)
Rissanen, A.; Mannila, R.; Tuohiniemi, M.; Akujärvi, A.; Antila, J.
2014-03-01
This paper presents a novel MOEMS Fabry-Perot interferometer (FPI) process platform for the range of 800 - 1050 nm. Simulation results including design and optimization of device properties in terms of transmission peak width, tuning range and electrical properties are discussed. Process flow for the device fabrication is presented, with overall process integration and backend dicing steps resulting in successful fabrication yield. The mirrors of the FPI consist of LPCVD (low-pressure chemical vapor) deposited polySi-SiN λ/4-thin film Bragg reflectors, with the air gap formed by sacrificial SiO2 etching in HF vapor. Silicon substrate below the optical aperture is removed by inductively coupled plasma (ICP) etching to ensure transmission in the visible - near infra-red (NIR), which is below silicon transmission range. The characterized optical properties of the chips are compared to the simulated values. Achieved optical aperture diameter size enables utilization of the chips in both imaging as well as single-point spectral sensors.
NASA Astrophysics Data System (ADS)
Panin, V. Y.; Aykac, M.; Casey, M. E.
2013-06-01
The simultaneous PET data reconstruction of emission activity and attenuation coefficient distribution is presented, where the attenuation image is constrained by exploiting an external transmission source. Data are acquired in time-of-flight (TOF) mode, allowing in principle for separation of emission and transmission data. Nevertheless, here all data are reconstructed at once, eliminating the need to trace the position of the transmission source in sinogram space. Contamination of emission data by the transmission source and vice versa is naturally modeled. Attenuated emission activity data also provide additional information about object attenuation coefficient values. The algorithm alternates between attenuation and emission activity image updates. We also proposed a method of estimation of spatial scatter distribution from the transmission source by incorporating knowledge about the expected range of attenuation map values. The reconstruction of experimental data from the Siemens mCT scanner suggests that simultaneous reconstruction improves attenuation map image quality, as compared to when data are separated. In the presented example, the attenuation map image noise was reduced and non-uniformity artifacts that occurred due to scatter estimation were suppressed. On the other hand, the use of transmission data stabilizes attenuation coefficient distribution reconstruction from TOF emission data alone. The example of improving emission images by refining a CT-based patient attenuation map is presented, revealing potential benefits of simultaneous CT and PET data reconstruction.
Photon interaction study of organic nonlinear optical materials in the energy range 122-1330 keV
NASA Astrophysics Data System (ADS)
Awasarmol, Vishal V.; Gaikwad, Dhammajyot K.; Raut, Siddheshwar D.; Pawar, Pravina P.
2017-01-01
In the present study, the mass attenuation coefficient (μm) of six organic nonlinear optical materials has been calculated in the energy range 122-1330 keV and compared with the obtained values from the WinXCOM program. It is found that there is a good agreement between theoretical and experimental values (<3%). The linear attenuation coefficients (μ) total atomic cross section (σt, a), and total electronic cross section (σt, el) have also been calculated from the obtained μm values and their variations with photon energy have been plotted. From the present work, it is observed that the variation of obtained values of μm, μ, σt, a, and σt, el strongly depends on the photon energy and decreases or increases due to chemical composition and density of the sample. All the samples have been studied extensively using transmission method with a view to utilize the material for radiation dosimetry. Investigated samples are good material for radiation dosimetry due their low effective atomic number. The mass attenuation coefficient (μm), linear attenuation coefficients (μ), total atomic cross section (σt, a), total electronic cross section (σt, el), effective atomic numbers (Zeff), molar extinction coefficient (ε), mass energy absorption coefficient (μen/ρ) and effective atomic energy absorption cross section (σa, en) of all sample materials have been carried out and transmission curves have been plotted. The transmission curve shows that the variation of all sample materials decreases with increasing photon energy.
Transmission characteristics of a two dimensional antiscatter grid prototype for CBCT.
Altunbas, Cem; Kavanagh, Brian; Alexeev, Timur; Miften, Moyed
2017-08-01
High fraction of scattered radiation in cone-beam CT (CBCT) imaging degrades CT number accuracy and visualization of low contrast objects. To suppress scatter in CBCT projections, we developed a focused, two-dimensional antiscatter grid (2DASG) prototype. In this work, we report on the primary and scatter transmission characteristics of the 2DASG prototype aimed for linac mounted, offset detector geometry CBCT systems in radiation therapy, and compared its performance to a conventional one-dimensional ASG (1DASG). The 2DASG is an array of through-holes separated by 0.1 mm septa that was fabricated from tungsten using additive manufacturing techniques. Through-holes' focusing geometry was designed for offset detector CBCT in Varian TrueBeam system. Two types of ASGs were evaluated: (a) a conventional 1DASG with a grid ratio of 10, (b) the 2DASG prototype with a grid ratio of 8.2. To assess the scatter suppression performance of both ASGs, Scatter-to-primary ratio (SPR) and scatter transmission fraction (Ts) were measured using the beam stop method. Scatter and primary intensities were modulated by varying the phantom thickness between 10 and 40 cm. Additionally, the effect of air gap and bow tie (BT) filter on SPR and Ts were evaluated. Average primary transmission fraction (T P ) and pixel specific primary transmission were also measured for both ASGs. To assess the effect of transmission characteristics on projection image signal-to-noise ratio (SNR), SNR improvement factor was calculated. Improvement in contrast to noise ratio (CNR) was demonstrated using a low contrast object. In comparison to 1DASG, 2DASG reduced SPRs by a factor of 3 to 6 across the range of phantom setups investigated. Ts values for 1D and 2DASGs were in the range of 21 to 29%, and 5 to 14% respectively. 2DASG continued to provide lower SPR and Ts at increased air gap and with BT filter. Tp of 1D and 2DASGs were 70.6% and 84.7% respectively. Due to the septal shadow of the 2DASG, its pixel specific primary transmission values varied between 32.5% and 99.1%. With respect to 1DASG, 2DASG provided up to factor of 1.7 more improvement in SNR across the SPR range investigated. Moreover, 2DASG provided improved visualization of low contrast objects with respect to 1DASG and NOASG setups. When compared to a conventional 1DASG, 2DASG prototype provided noticeably lower SPR and Ts values, indicating its superior scatter suppression performance. 2DASG also provided 19% higher average primary transmission that was attributed to the absence of interseptal spacers and optimized grid geometry. Our results indicate that the combined effect of lower scatter and higher primary transmission provided by 2DASG may potentially translate into more accurate CT numbers and improved contrast resolution in CBCT images. © 2017 American Association of Physicists in Medicine.
The evaluation of the Hitomi (Astro-H)/SXS spare beryllium window in 3.8-30 keV
NASA Astrophysics Data System (ADS)
Hoshino, Akio; Yoshida, Yuki; Kitamoto, Shunji; Fujimoto, Ryuichi; Yamasaki, Noriko Y.; Ina, Toshiaki; Uruga, Tomoya; Eckart, Megan; Leutenegger, Maurice
2017-08-01
During the Hitomi (Astro-H) commissioning observations the SXS dewar gate valve (GV) remained closed to protect the instrument from initial spacecraft outgassing. As a result, the optical path of the observations included the Be window installed on the GV. Both x-ray fluorescence (XRF) analysis and x-ray transmission measurements were performed in June 2016 on the flight-spare Be window which is the same lot as the flight material at SPring-8 in Japan. The beamline operating range is 3.8 - 30 keV. We used a beam spot size of 1 mm × 0.2 mm to measure two positions on the Be window, at the center of the window and at one position 6.5 mm off-center. We used simultaneous transmission measurements of standard materials for energy calibration. The transmission data clearly showed Fe and Ni K-edges, plus a marginal detection of the Mn K-edge. We found that our transmission data was best fit using the following component Be: 261.86+/-0.01μm, Cr: 3nm (fixed), Mn: 3.81+/-0.05nm, Fe: 10.83+/-0.05nm, Ni: 16.48+/-0.03nm, Cu: 5nm (fixed). The transmission is reduced 1% at the Fe K-edge. The amount of contaminated materials are comparable to the values of the value provided by the vender. The surface transmission is strained with σ = 0.11% of the unbiased standard deviation calculated variation in the residuals between the measured value and the model.
NASA Astrophysics Data System (ADS)
Merheb, B.; Deymier, P. A.; Jain, M.; Aloshyna-Lesuffleur, M.; Mohanty, S.; Berker, A.; Greger, R. W.
2008-09-01
The transmission of acoustic waves through centimeter-scale elastic and viscoelastic two-dimensional silicone rubber/air phononic crystal structures is investigated theoretically and experimentally. We introduce a finite difference time domain method for two-dimensional elastic and viscoelastic composite structures. Elastic fluid-solid phononic crystals composed of a two-dimensional array of cylindrical air inclusions in a solid rubber matrix, as well as an array of rubber cylinders in an air matrix, are shown to behave similarly to fluid-fluid composite structures. These systems exhibit very wide band gaps in their transmission spectra that extend to frequencies in the audible range of the spectrum. This effect is associated with the very low value of the transverse speed of sound in rubber compared to that of the longitudinal polarization. The difference in transmission between elastic and viscoelastic rubber/air crystals results from attenuation of transmission over a very wide frequency range, leaving only narrow passing bands at very low frequencies. These phononic crystals demonstrate the practical design of elastic or viscoelastic solid rubber/air acoustic band gap sound barriers with small dimensions.
Lucas Martínez, Néstor; Martínez Ortega, José-Fernán; Hernández Díaz, Vicente; Del Toro Matamoros, Raúl M
2016-05-12
The deployment of the nodes in a Wireless Sensor and Actuator Network (WSAN) is typically restricted by the sensing and acting coverage. This implies that the locations of the nodes may be, and usually are, not optimal from the point of view of the radio communication. Additionally, when the transmission power is tuned for those locations, there are other unpredictable factors that can cause connectivity failures, like interferences, signal fading due to passing objects and, of course, radio irregularities. A control-based self-adaptive system is a typical solution to improve the energy consumption while keeping good connectivity. In this paper, we explore how the communication range for each node evolves along the iterations of an energy saving self-adaptive transmission power controller when using different parameter sets in an outdoor scenario, providing a WSAN that automatically adapts to surrounding changes keeping good connectivity. The results obtained in this paper show how the parameters with the best performance keep a k-connected network, where k is in the range of the desired node degree plus or minus a specified tolerance value.
Lucas Martínez, Néstor; Martínez Ortega, José-Fernán; Hernández Díaz, Vicente; del Toro Matamoros, Raúl M.
2016-01-01
The deployment of the nodes in a Wireless Sensor and Actuator Network (WSAN) is typically restricted by the sensing and acting coverage. This implies that the locations of the nodes may be, and usually are, not optimal from the point of view of the radio communication. Additionally, when the transmission power is tuned for those locations, there are other unpredictable factors that can cause connectivity failures, like interferences, signal fading due to passing objects and, of course, radio irregularities. A control-based self-adaptive system is a typical solution to improve the energy consumption while keeping good connectivity. In this paper, we explore how the communication range for each node evolves along the iterations of an energy saving self-adaptive transmission power controller when using different parameter sets in an outdoor scenario, providing a WSAN that automatically adapts to surrounding changes keeping good connectivity. The results obtained in this paper show how the parameters with the best performance keep a k-connected network, where k is in the range of the desired node degree plus or minus a specified tolerance value. PMID:27187397
Viscoelastic effect on acoustic band gaps in polymer-fluid composites
NASA Astrophysics Data System (ADS)
Merheb, B.; Deymier, P. A.; Muralidharan, K.; Bucay, J.; Jain, M.; Aloshyna-Lesuffleur, M.; Greger, R. W.; Mohanty, S.; Berker, A.
2009-10-01
In this paper, we present a theoretical analysis of the propagation of acoustic waves through elastic and viscoelastic two-dimensional phononic crystal structures. Numerical calculations of transmission spectra are conducted by extending the finite-difference-time-domain method to account for linear viscoelastic materials with time-dependent moduli. We study a phononic crystal constituted of a square array of cylindrical air inclusions in a solid viscoelastic matrix. The elastic properties of the solid are those of a silicone rubber. This system exhibits very wide band gaps in its transmission spectrum that extend to frequencies in the audible range of the spectrum. These gaps are characteristic of fluid matrix/air inclusion systems and result from the very large contrast between the longitudinal and transverse speeds of sound in rubber. By treating the matrix as a viscoelastic medium within the standard linear solid (SLS) model, we demonstrate that viscoelasticity impacts the transmission properties of the rubber/air phononic crystal not only by attenuating the transmitted acoustic waves but also by shifting the passing bands frequencies toward lower values. The ranges of frequencies exhibiting attenuation or frequency shift are determined by the value of the relaxation time in the SLS model. We show that viscoelasticity can be used to decrease the frequency of pass bands (and consequently stop bands) in viscoelastic/air phononic crystals.
Biodynamic response at the palm of the human hand subjected to a random vibration.
Dong, Ren G; McDowell, Thomas W; Welcome, Daniel E
2005-01-01
This study investigated the biodynamic response (BR) distributed at the palm of the hand subjected to a random vibration. Twelve male subjects were used in the experiment. Each subject applied three coupling actions (grip-only, push-only, and combined grip and push) on a simulated tool handle at three different levels (50, 75, and 100 N) of palm force. This study found that the hand-arm system resonated mostly in the frequency range of 20 to 50 Hz, depending on the specific test treatment and individual characteristics. The maximum vibration power transmission through the palm occurred at the resonant frequency. Increasing the effective palm force generally increased the BR magnitude and resonant frequency. The apparent stiffness measured at the middle frequencies (80-100 Hz) is correlated to the BR in almost the entire frequency range (20-1,000 Hz). Under the same palm force, the push-only action corresponded to the highest BR values while the grip-only action generally produced the lowest values. Since the resonant frequency range matches the dominant vibration frequency range of many percussive tools, it is anticipated that the palm BR and vibration power transmission may have an association with vibration-induced injuries or disorders in the wrist-arm system among the workers using these tools.
Kodejska, Milos; Mokry, Pavel; Linhart, Vaclav; Vaclavik, Jan; Sluka, Tomas
2012-12-01
An adaptive system for the suppression of vibration transmission using a single piezoelectric actuator shunted by a negative capacitance circuit is presented. It is known that by using a negative-capacitance shunt, the spring constant of a piezoelectric actuator can be controlled to extreme values of zero or infinity. Because the value of spring constant controls a force transmitted through an elastic element, it is possible to achieve a reduction of transmissibility of vibrations through the use of a piezoelectric actuator by reducing its effective spring constant. Narrow frequency range and broad frequency range vibration isolation systems are analyzed, modeled, and experimentally investigated. The problem of high sensitivity of the vibration control system to varying operational conditions is resolved by applying an adaptive control to the circuit parameters of the negative capacitor. A control law that is based on the estimation of the value of the effective spring constant of a shunted piezoelectric actuator is presented. An adaptive system which achieves a self-adjustment of the negative capacitor parameters is presented. It is shown that such an arrangement allows the design of a simple electronic system which offers a great vibration isolation efficiency under variable vibration conditions.
Estimated drawdowns in the Floridan aquifer due to increased withdrawals, Duval County, Florida
Franks, Bernard J.; Phelps, G.G.
1979-01-01
Hydrologic investigations of the Floridan aquifer in Duval County, Florida, have shown that an appropriate simplified model of the aquifer system consists of a series of sub aquifers separated by semipermeable beds. Data from more than 20 aquifer tests were reanalyzed by the Hantush modified method, which takes into account leakance from all confining units. Transmissivity values range from 20,000 to 240,000 square feet per day. Leakance was estimated to be 2.5x10 to the minus 6th power and 3.3x10 to the minus 5th power per day for the upper and lower confining units, respectively. Families of steady-state distance-drawdown curves were constructed for three representative transmissivity values based on hypothetical withdrawals from a point source ranging from 5 to 50 million gallons per day. Transient effects were not considered because the system reaches steady-state conditions within the time ranges considered. Drawdown at any point can be estimated by summing the effects of any hypothetical configuration of pumping centers. The accuracy of the parameters was checked by comparing calculated drawdowns in selected observation wells to measured water-level declines. (Woodard-USGS)
Gear tooth stress measurements on the UH-60A helicopter transmission
NASA Technical Reports Server (NTRS)
Oswald, Fred B.
1987-01-01
The U.S. Army UH-60A (Black Hawk) 2200-kW (3000-hp) class twin-engine helicopter transmission was tested at the NASA Lewis Research Center. Results from these experimental (strain-gage) stress tests will enhance the data base for gear stress levels in transmissions of a similar power level. Strain-gage measurements were performed on the transmission's spiral-bevel combining pinions, the planetary Sun gear, and ring gear. Tests were performed at rated speed and at torque levels 25 to 100 percent that of rated. One measurement series was also taken at a 90 percent speed level. The largest stress found was 760 MPa (110 ksi) on the combining pinion fillet. This is 230 percent greater than the AGMA index stress. Corresponding mean and alternating stresses were 300 and 430 MPa (48 and 62 ksi). These values are within the range of successful test experience reported for other transmissions. On the fillet of the ring gear, the largest stress found was 410 MPa (59 ksi). The ring-gear peak stress was found to be 11 percent less than an analytical (computer simulation) value and it is 24 percent greater than the AGMA index stress. A peak compressive stress of 650 MPa (94 ksi) was found at the center of the Sun gear tooth root.
Effectiveness of eye drops protective against ultraviolet radiation.
Daxer, A; Blumthaler, M; Schreder, J; Ettl, A
1998-01-01
To test the effectiveness of commercially available ultraviolet (UV)-protective eye drops (8-hydroxy-1-methylchinolinium methylsulphate) which are recommended for protection against both solar and artificial UV radiation. The spectral transmission in the wavelength range from 250 to 500 nm was investigated in 1-nm steps using a high-resolution double monochromator with holographic gratings of 2,400 lines/mm and a 1,000-watt halogen lamp as light source. The transmission spectrum was measured for different values of the layer thickness. The transmission of a liquid layer of about 10 microns, which corresponds to the thickness of the human tear film, shows a cut-off at 290 nm with a transmission of about 25-50% at shorter wavelengths. For wavelengths longer than 290 nm the transmission is higher than 90%. The threshold time ratio for keratitis formation with and without eye drops is above 0.93 considering solar radiation on the earth's surface and above 0.65 considering radiation from arc-welding, respectively. The transmission spectrum of the eye drops under realistic conditions does not show a protective effect against solar UV radiation. However, there exists reduction of UVC radiation in the spectral range typical of artificial UV sources such as arc-welding. We cannot recommend the application of these eye drops as an UV-protective aid against eye damage by solar UV radiation.
Basri, Bazil; Griffin, Michael J
2014-11-01
The extent to which a seat can provide useful attenuation of vehicle vibration depends on three factors: the characteristics of the vehicle motion, the vibration transmissibility of the seat, and the sensitivity of the body to vibration. The 'seat effective amplitude transmissibility' (i.e., SEAT value) reflects how these three factors vary with the frequency and the direction of vibration so as to predict the vibration isolation efficiency of a seat. The SEAT value is mostly used to select seat cushions or seat suspensions based on the transmission of vertical vibration to the principal supporting surface of a seat. This study investigated the accuracy of SEAT values in predicting how seats with backrests influence the discomfort caused by multiple-input vibration. Twelve male subjects participated in a four-part experiment to determine equivalent comfort contours, the relative discomfort, the location of discomfort, and seat transmissibility with three foam seats and a rigid reference seat at 14 frequencies of vibration in the range 1-20 Hz at magnitudes of vibration from 0.2 to 1.6 ms(-2) r.m.s. The 'measured seat dynamic discomfort' (MSDD) was calculated for each foam seat from the ratio of the vibration acceleration required to cause similar discomfort with the foam seat and with the rigid reference seat. Using the frequency weightings in current standards, the SEAT values of each seat were calculated from the ratio of overall ride values with the foam seat to the overall ride values with the rigid reference seat, and compared to the corresponding MSDD at each frequency. The SEAT values provided good predictions of how the foam seats increased vibration discomfort at frequencies around the 4-Hz resonance but reduced vibration discomfort at frequencies greater than about 6.3 Hz, with discrepancies explained by a known limitation of the frequency weightings. Copyright © 2014 Elsevier Ltd and The Ergonomics Society. All rights reserved.
Rethinking the Heterosexual Infectivity of HIV-1: A Systematic Review and Meta-analysis
Powers, Kimberly A.; Poole, Charles; Pettifor, Audrey E.; Cohen, Myron S.
2009-01-01
Background Studies of cumulative HIV incidence suggest that co-factors such as genital ulcer disease (GUD), HIV disease stage, and circumcision influence HIV transmission; however, the heterosexual infectivity of HIV-1 is commonly cited as a fixed value (∼0·001, or 1 transmission per thousand contacts). We sought to estimate transmission co-factor effects on the heterosexual infectivity of HIV-1 and to quantify the extent to which study methods have affected infectivity estimates. Methods We conducted a systematic search (through April 2008) of PubMed, Web of Science, and relevant bibliographies to identify articles estimating the heterosexual infectivity of HIV-1. We used meta-regression and stratified random-effects meta-analysis to assess differences in infectivity by co-factors and study methods. Findings Infectivity estimates were extremely heterogeneous, ranging from zero transmissions after more than 100 penile-vaginal contacts in some sero-discordant couples to one transmission for every 3·1 episodes of heterosexual anal intercourse. Estimates were only weakly associated with study methods. Infectivity differences (95% confidence intervals), expressed as number of transmissions per 1000 contacts, were 8 (0-16) comparing uncircumcised to circumcised male susceptibles, 6 (3-9) comparing susceptible individuals with and without GUD, 2 (1-3) comparing late-stage to mid-stage index cases, and 3 (0-5) comparing early-stage to mid-stage index cases. Interpretation A single value for the heterosexual infectivity of HIV-1 fails to reflect the variation associated with important co-factors. The commonly cited value of ∼0·001 was estimated among stable couples with low prevalences of high-risk co-factors, and represents a lower bound. Co-factor effects are important to include in epidemic models, policy considerations, and prevention messages. PMID:18684670
Meinel, Felix G.; Schwab, Felix; Schleede, Simone; Bech, Martin; Herzen, Julia; Achterhold, Klaus; Auweter, Sigrid; Bamberg, Fabian; Yildirim, Ali Ö.; Bohla, Alexander; Eickelberg, Oliver; Loewen, Rod; Gifford, Martin; Ruth, Ronald; Reiser, Maximilian F.; Pfeiffer, Franz; Nikolaou, Konstantin
2013-01-01
Purpose To assess whether grating-based X-ray dark-field imaging can increase the sensitivity of X-ray projection images in the diagnosis of pulmonary emphysema and allow for a more accurate assessment of emphysema distribution. Materials and Methods Lungs from three mice with pulmonary emphysema and three healthy mice were imaged ex vivo using a laser-driven compact synchrotron X-ray source. Median signal intensities of transmission (T), dark-field (V) and a combined parameter (normalized scatter) were compared between emphysema and control group. To determine the diagnostic value of each parameter in differentiating between healthy and emphysematous lung tissue, a receiver-operating-characteristic (ROC) curve analysis was performed both on a per-pixel and a per-individual basis. Parametric maps of emphysema distribution were generated using transmission, dark-field and normalized scatter signal and correlated with histopathology. Results Transmission values relative to water were higher for emphysematous lungs than for control lungs (1.11 vs. 1.06, p<0.001). There was no difference in median dark-field signal intensities between both groups (0.66 vs. 0.66). Median normalized scatter was significantly lower in the emphysematous lungs compared to controls (4.9 vs. 10.8, p<0.001), and was the best parameter for differentiation of healthy vs. emphysematous lung tissue. In a per-pixel analysis, the area under the ROC curve (AUC) for the normalized scatter value was significantly higher than for transmission (0.86 vs. 0.78, p<0.001) and dark-field value (0.86 vs. 0.52, p<0.001) alone. Normalized scatter showed very high sensitivity for a wide range of specificity values (94% sensitivity at 75% specificity). Using the normalized scatter signal to display the regional distribution of emphysema provides color-coded parametric maps, which show the best correlation with histopathology. Conclusion In a murine model, the complementary information provided by X-ray transmission and dark-field images adds incremental diagnostic value in detecting pulmonary emphysema and visualizing its regional distribution as compared to conventional X-ray projections. PMID:23555692
Meinel, Felix G; Schwab, Felix; Schleede, Simone; Bech, Martin; Herzen, Julia; Achterhold, Klaus; Auweter, Sigrid; Bamberg, Fabian; Yildirim, Ali Ö; Bohla, Alexander; Eickelberg, Oliver; Loewen, Rod; Gifford, Martin; Ruth, Ronald; Reiser, Maximilian F; Pfeiffer, Franz; Nikolaou, Konstantin
2013-01-01
To assess whether grating-based X-ray dark-field imaging can increase the sensitivity of X-ray projection images in the diagnosis of pulmonary emphysema and allow for a more accurate assessment of emphysema distribution. Lungs from three mice with pulmonary emphysema and three healthy mice were imaged ex vivo using a laser-driven compact synchrotron X-ray source. Median signal intensities of transmission (T), dark-field (V) and a combined parameter (normalized scatter) were compared between emphysema and control group. To determine the diagnostic value of each parameter in differentiating between healthy and emphysematous lung tissue, a receiver-operating-characteristic (ROC) curve analysis was performed both on a per-pixel and a per-individual basis. Parametric maps of emphysema distribution were generated using transmission, dark-field and normalized scatter signal and correlated with histopathology. Transmission values relative to water were higher for emphysematous lungs than for control lungs (1.11 vs. 1.06, p<0.001). There was no difference in median dark-field signal intensities between both groups (0.66 vs. 0.66). Median normalized scatter was significantly lower in the emphysematous lungs compared to controls (4.9 vs. 10.8, p<0.001), and was the best parameter for differentiation of healthy vs. emphysematous lung tissue. In a per-pixel analysis, the area under the ROC curve (AUC) for the normalized scatter value was significantly higher than for transmission (0.86 vs. 0.78, p<0.001) and dark-field value (0.86 vs. 0.52, p<0.001) alone. Normalized scatter showed very high sensitivity for a wide range of specificity values (94% sensitivity at 75% specificity). Using the normalized scatter signal to display the regional distribution of emphysema provides color-coded parametric maps, which show the best correlation with histopathology. In a murine model, the complementary information provided by X-ray transmission and dark-field images adds incremental diagnostic value in detecting pulmonary emphysema and visualizing its regional distribution as compared to conventional X-ray projections.
Fiore, Alex R.
2014-01-01
Slug tests were conducted on 56 observation wells open to bedrock at the former Naval Air Warfare Center (NAWC) in West Trenton, New Jersey. Aquifer transmissivity (T) and storage coefficient (S) values for most wells were estimated from slug-test data using the Cooper-Bredehoeft-Papadopulos method. Test data from three wells exhibited fast, underdamped water-level responses and were analyzed with the Butler high-K method. The range of T at NAWC was approximately 0.07 to 10,000 square feet per day. At 11 wells, water levels did not change measurably after 20 minutes following slug insertion; transmissivity at these 11 wells was estimated to be less than 0.07 square feet per day. The range of S was approximately 10-10 to 0.01, the mode being 10-10. Water-level responses for tests at three wells fit poorly to the type curves of both methods, indicating that these methods were not appropriate for adequately estimating T and S from those data.
Garabedian, Stephen P.
1986-01-01
A nonlinear, least-squares regression technique for the estimation of ground-water flow model parameters was applied to the regional aquifer underlying the eastern Snake River Plain, Idaho. The technique uses a computer program to simulate two-dimensional, steady-state ground-water flow. Hydrologic data for the 1980 water year were used to calculate recharge rates, boundary fluxes, and spring discharges. Ground-water use was estimated from irrigated land maps and crop consumptive-use figures. These estimates of ground-water withdrawal, recharge rates, and boundary flux, along with leakance, were used as known values in the model calibration of transmissivity. Leakance values were adjusted between regression solutions by comparing model-calculated to measured spring discharges. In other simulations, recharge and leakance also were calibrated as prior-information regression parameters, which limits the variation of these parameters using a normalized standard error of estimate. Results from a best-fit model indicate a wide areal range in transmissivity from about 0.05 to 44 feet squared per second and in leakance from about 2.2x10 -9 to 6.0 x 10 -8 feet per second per foot. Along with parameter values, model statistics also were calculated, including the coefficient of correlation between calculated and observed head (0.996), the standard error of the estimates for head (40 feet), and the parameter coefficients of variation (about 10-40 percent). Additional boundary flux was added in some areas during calibration to achieve proper fit to ground-water flow directions. Model fit improved significantly when areas that violated model assumptions were removed. It also improved slightly when y-direction (northwest-southeast) transmissivity values were larger than x-direction (northeast-southwest) transmissivity values. The model was most sensitive to changes in recharge, and in some areas, to changes in transmissivity, particularly near the spring discharge area from Milner Dam to King Hill.
Rogue waves generation in a left-handed nonlinear transmission line with series varactor diodes
NASA Astrophysics Data System (ADS)
Onana Essama, B. G.; Atangana, J.; Biya Motto, F.; Mokhtari, B.; Cherkaoui Eddeqaqi, N.; Kofane, Timoleon C.
2014-07-01
We investigate the electromagnetic wave behavior and its characterization using collective variables technique. Second-order dispersion, first- and second-order nonlinearities, which strongly act in a left-handed nonlinear transmission line with series varactor diodes, are taken into account. Four frequency ranges have been found. The first one gives the so-called energetic soliton due to a perfect combination of second-order dispersion and first-order nonlinearity. The second frequency range presents a dispersive soliton leading to the collapse of the electromagnetic wave at the third frequency range. But the fourth one shows physical conditions which are able to provoke the appearance of wave trains generation with some particular waves, the rogue waves. Moreover, we demonstrate that the number of rogue waves increases with frequency. The soliton, thereafter, gains a relative stability when second-order nonlinearity comes into play with some specific values in the fourth frequency range. Furthermore, the stability conditions of the electromagnetic wave at high frequencies have been also discussed.
Laser Signature Prediction Using The VALUE Computer Program
NASA Astrophysics Data System (ADS)
Akerman, Alexander; Hoffman, George A.; Patton, Ronald
1989-09-01
A variety of enhancements are being made to the 1976-vintage LASERX computer code. These include: - Surface characterization with BDRF tabular data - Specular reflection from transparent surfaces - Generation of glint direction maps - Generation of relative range imagery - Interface to the LOWTRAN atmospheric transmission code - Interface to the LEOPS laser sensor code - User friendly menu prompting for easy setup Versions of VALUE have been written for both VAX/VMS and PC/DOS computer environments. Outputs have also been revised to be user friendly and include tables, plots, and images for (1) intensity, (2) cross section,(3) reflectance, (4) relative range, (5) region type, and (6) silhouette.
The susceptibility critical exponent for a nonaqueous ionic binary mixture near a consolute point
NASA Technical Reports Server (NTRS)
Zhang, Kai C.; Briggs, Matthew E.; Gammon, Robert W.; Levelt Sengers, J. M. H.
1992-01-01
We report turbidity measurements of a nonaqueous ionic solution of triethyl n-hexylammonium triethyl n-hexylboride in diphenyl ether. A classical susceptibility critical exponent gamma = 1.01 +/- 0.01 is obtained over the reduced temperature range t between values of 0.1 and 0.0001. The best fits of the sample transmission had a standard deviation of 0.39 percent over this range. Ising and spherical model critical exponents are firmly excluded. The correlation length amplitude xi sub 0 from fitting is 1.0 +/- 0.2 nm which is much larger than values found in neutral fluids and some aqueous binary mixtures.
The power and robustness of maximum LOD score statistics.
Yoo, Y J; Mendell, N R
2008-07-01
The maximum LOD score statistic is extremely powerful for gene mapping when calculated using the correct genetic parameter value. When the mode of genetic transmission is unknown, the maximum of the LOD scores obtained using several genetic parameter values is reported. This latter statistic requires higher critical value than the maximum LOD score statistic calculated from a single genetic parameter value. In this paper, we compare the power of maximum LOD scores based on three fixed sets of genetic parameter values with the power of the LOD score obtained after maximizing over the entire range of genetic parameter values. We simulate family data under nine generating models. For generating models with non-zero phenocopy rates, LOD scores maximized over the entire range of genetic parameters yielded greater power than maximum LOD scores for fixed sets of parameter values with zero phenocopy rates. No maximum LOD score was consistently more powerful than the others for generating models with a zero phenocopy rate. The power loss of the LOD score maximized over the entire range of genetic parameters, relative to the maximum LOD score calculated using the correct genetic parameter value, appeared to be robust to the generating models.
Muir, Jesse; Kiel, Douglas P; Rubin, Clinton T
2013-11-01
Whole body vibration devices are used as a means to augment training, and their potential to treat a range of musculoskeletal diseases and injuries is now being considered. The goal of this work is to determine the degree to which acceleration delivered by whole body vibration devices at the plantar surfaces of a standing human is transmitted through the axial and appendicular skeleton, and how this mechanical challenge corresponds to the safety threshold limit values established by the International Standards Organization ISO-2631. Non-blinded laboratory assessment of a range of whole body vibration devices as it pertains to acceleration transmission to healthy volunteers. Using skin and bite-bar mounted accelerometers, transmissibility to the tibia and cranium was determined in six healthy adults standing on a programmable whole body vibration device as a function of frequency and intensity. Measures of transmissibility were then made from three distinct types of whole body vibration platforms, which delivered a 50-fold range of peak-to-peak acceleration intensities (0.3-15.1 gp-p; where 1g is Earth's gravitational field). For a given frequency, transmissibility was independent of intensity when below 1g. Transmissibility declined non-linearly with increasing frequency. Depending on the whole body vibration device, vibration ranged from levels considered safe by ISO-2631 for up to 8h each day (0.3 gp-p @ 30 Hz), to levels that were seven times higher than what is considered a safe threshold for even 1 min of exposure each day (15.1 gp-p @ 30 Hz). Transmissibility to the cranium was markedly attenuated by the degree of flexion in the knees. Vibration can have adverse effects on a number of physiologic systems. This work indicates that readily accessible whole body vibration devices markedly exceed ISO guidelines for safety, and extreme caution must be practiced when considering their use. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
Phalet, Karen; Schonpflug, Ute
2001-01-01
Examined the impact of immigrant parents' goals and acculturation contexts on family value transmission, surveying Turkish parent-child dyads in the Netherlands. Across cultures, parents' collectivism values were transmitted. Parental goals mediated value transmission. Transmission was significant after controlling for gender and education.…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Al Din, Nasser Saad, E-mail: nsaadaldin@yahoo.com; Hussain, Nabiha, E-mail: nabihahssin@yahoo.com; Jandow, Nidhal, E-mail: nidhaljandow@yahoo.com
2016-07-25
Lead (II) Sulfide PbS thin films were deposited on glass substrates at 25°C by chemical bath deposition (CBD) method. The structural properties of the films were studied as a function of the concentration of Thiourea (CS (NH{sub 2}){sub 2}) as Source of Sulfide and deposition time. The surface morphology of the films was characterized by X-ray diffraction and SEM. The obtained results showed that the as-deposited films Polycrystalline had cubic crystalline phase that belong to S.G: Fm3m. We found that they have preferred orientation [200]. Also the thickness of thin films decrease with deposition time after certain value and, itmore » observed free sulfide had orthorhombic phase. Optical properties showed that the thin films have high transmission at visible range and low transmission at UV, IR range. The films of PbS have direct band gap (I.68 - 2.32 ev) at 300 K the values of band energy decreases with increases thickness of the Lead (II) Sulfide films.« less
Pinquart, Martin; Silbereisen, Rainer K
2004-01-01
The intergenerational transmission of values is a bidirectional process. To date, however, adolescents' influence on parental values has rarely been investigated. In the present study, we analyzed the transmission of values from adolescents (aged 11 to 17 years) to their mothers and fathers across a one-year interval in 431 mother-child dyads and 346 father-child dyads. Transmission of values from adolescents to parents was observed regarding topics that are salient in adolescence (the usefulness of new technology, beliefs concerning the traditional way of life, the importance of religion) but not regarding topics that become salient later. In addition, the transmission of adolescents' values to their parents was mainly observed in families with above-average levels of authoritative parenting (i.e., parents are receptive and supportive). However, adolescents' religious values were also transmitted to their parents in families with below-average levels of authoritative parenting. Transmission of values from parents to adolescents was also investigated.
A mathematical model of force transmission from intrafascicularly terminating muscle fibers.
Sharafi, Bahar; Blemker, Silvia S
2011-07-28
Many long skeletal muscles are comprised of fibers that terminate intrafascicularly. Force from terminating fibers can be transmitted through shear within the endomysium that surrounds fibers or through tension within the endomysium that extends from fibers to the tendon; however, it is unclear which pathway dominates in force transmission from terminating fibers. The purpose of this work was to develop mathematical models to (i) compare the efficacy of lateral (through shear) and longitudinal (through tension) force transmission in intrafascicularly terminating fibers, and (ii) determine how force transmission is affected by variations in the structure and properties of fibers and the endomysium. The models demonstrated that even though the amount of force that can be transmitted from an intrafascicularly terminating fiber is dependent on fiber resting length (the unstretched length at which passive stress is zero), endomysium shear modulus, and fiber volume fraction (the fraction of the muscle cross-sectional area that is occupied by fibers), fibers that have values of resting length, shear modulus, and volume fraction within physiologic ranges can transmit nearly all of their peak isometric force laterally through shearing of the endomysium. By contrast, the models predicted only limited force transmission ability through tension within the endomysium that extends from the fiber to the tendon. Moreover, when fiber volume fraction decreases to unhealthy ranges (less than 50%), the force-transmitting potential of terminating fibers through shearing of the endomysium decreases significantly. The models presented here support the hypothesis that lateral force transmission through shearing of the endomysium is an effective mode of force transmission in terminating fibers. Copyright © 2011 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
Roest, Annette M. C.; Dubas, Judith Semon; Gerris, Jan R. M.
2010-01-01
This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and…
Roest, Annette M C; Dubas, Judith Semon; Gerris, Jan R M
2010-02-01
This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and children's developmental phase (adolescence versus emerging adulthood). Transmissions between parents and children from 402 Dutch families on the topics of work as duty and hedonism were studied across a 5-year period using structural equation modeling. As expected, we did not find convincing support for the general models of gender socialization and developmental aging. Instead, parent-child value transmissions appeared to be qualified by value salience. Particularly, high salience of work as duty for fathers was related with great paternal involvement in transmissions on this value orientation and high salience of hedonism for sons and adolescents was linked to transmissions from these groups to parents. Copyright (c) 2009 The Association for Professionals in Services for Adolescents. Published by Elsevier Ltd. Published by Elsevier Ltd. All rights reserved.
Transmission of isotropic light across a dielectric surface in two and three dimensions.
NASA Technical Reports Server (NTRS)
Allen, W. A.
1973-01-01
Average transmittance of polarized diffuse light across a dielectric surface is calculated in both two and three dimensions. The incident light in both cases is confined to an angular range measured from the surface normal. Limiting values in three dimensions correspond to known results for two cases, (1) normal incidence, and (2) diffuse light incident from a 180 deg cone. The two-dimensional formulation is solvable in terms of elliptic functions and incomplete elliptic integrals of the first, second, and third kinds. Results are displayed graphically for values of transmittances in excess of 0.9 associated with relative indices of refraction in the range m = 1.0 to m = 2.6.
PyTranSpot: A tool for multiband light curve modeling of planetary transits and stellar spots
NASA Astrophysics Data System (ADS)
Juvan, Ines G.; Lendl, M.; Cubillos, P. E.; Fossati, L.; Tregloan-Reed, J.; Lammer, H.; Guenther, E. W.; Hanslmeier, A.
2018-02-01
Several studies have shown that stellar activity features, such as occulted and non-occulted starspots, can affect the measurement of transit parameters biasing studies of transit timing variations and transmission spectra. We present PyTranSpot, which we designed to model multiband transit light curves showing starspot anomalies, inferring both transit and spot parameters. The code follows a pixellation approach to model the star with its corresponding limb darkening, spots, and transiting planet on a two dimensional Cartesian coordinate grid. We combine PyTranSpot with a Markov chain Monte Carlo framework to study and derive exoplanet transmission spectra, which provides statistically robust values for the physical properties and uncertainties of a transiting star-planet system. We validate PyTranSpot's performance by analyzing eleven synthetic light curves of four different star-planet systems and 20 transit light curves of the well-studied WASP-41b system. We also investigate the impact of starspots on transit parameters and derive wavelength dependent transit depth values for WASP-41b covering a range of 6200-9200 Å, indicating a flat transmission spectrum.
The Role of Between-Parent Values Agreement in Parent-to-Child Transmission of Academic Values
ERIC Educational Resources Information Center
Gniewosz, Burkhard; Noack, Peter
2012-01-01
The present study investigates the intergenerational transmission of academic task values within family in early adolescence. Social learning processes are assumed to operate through the students' perceptions of their parents' values. The major goal of this study is to show that this values transmission is facilitated by between-parent value…
Filtered Rayleigh Scattering Measurements in a Buoyant Flowfield
2007-03-01
common filter used in FRS applications . Iodine is more attractive than mercury to use in a filter due to its broader range of blocking and transmission...is a 4032x2688 pixel camera with a monochrome or colored CCD imaging sensor. The binning range of the camera is (HxV) 1x1 to 2x8. The manufacturer...center position of the jet of the time averaged image . The z center position is chosen so that it is the average z value bounding helium
Bayless, E. Randall; Arihood, Leslie D.; Reeves, Howard W.; Sperl, Benjamin J.S.; Qi, Sharon L.; Stipe, Valerie E.; Bunch, Aubrey R.
2017-01-18
As part of the National Water Availability and Use Program established by the U.S. Geological Survey (USGS) in 2005, this study took advantage of about 14 million records from State-managed collections of water-well drillers’ records and created a database of hydrogeologic properties for the glaciated United States. The water-well drillers’ records were standardized to be relatively complete and error-free and to provide consistent variables and naming conventions that span all State boundaries.Maps and geospatial grids were developed for (1) total thickness of glacial deposits, (2) total thickness of coarse-grained deposits, (3) specific-capacity based transmissivity and hydraulic conductivity, and (4) texture-based estimated equivalent horizontal and vertical hydraulic conductivity and transmissivity. The information included in these maps and grids is required for most assessments of groundwater availability, in addition to having applications to studies of groundwater flow and transport. The texture-based estimated equivalent horizontal and vertical hydraulic conductivity and transmissivity were based on an assumed range of hydraulic conductivity values for coarse- and fine-grained deposits and should only be used with complete awareness of the methods used to create them. However, the maps and grids of texture-based estimated equivalent hydraulic conductivity and transmissivity may be useful for application to areas where a range of measured values is available for re-scaling.Maps of hydrogeologic information for some States are presented as examples in this report but maps and grids for all States are available electronically at the project Web site (USGS Glacial Aquifer System Groundwater Availability Study, http://mi.water.usgs.gov/projects/WaterSmart/Map-SIR2015-5105.html) and the Science Base Web site, https://www.sciencebase.gov/catalog/item/58756c7ee4b0a829a3276352.
Tam, Kim-Pong; Lee, Sau-Lai; Kim, Young-Hoon; Li, Yanmei; Chao, Melody Manchi
2012-08-01
What values do parents want to transmit to children? The intersubjective model of value transmission posits that parents want to transmit not only the values they personally endorse but also the values they perceive to be normatively important in the society. The present research shows support to this premise. Furthermore, Studies 1 and 2 revealed that the use of perceived norms is moderated by families' social contexts and parents' personality: It was particularly pronounced among parents who were immigrants, who had a stronger need for closure, and who were more conforming. In addition, Studies 3 and 4 demonstrated that parents' perceived norms can explain actual value transmission: Values parents perceived to be normatively important were to some extent internalized by children. The intersubjective model paves some new directions for value transmission research, contributes to the understanding of cultural transmission and cultural change, and extends the intersubjective approach to culture.
Yu, Yue; Li, Zhanming; Pan, Jinming
2016-01-01
Objective. The objective of this study was to investigate changes in pigment, spectral transmission and element content of chicken eggshells with different intensities of pink pigment during the incubation period. We also investigated the effects of the region (small pole, equator and large pole) and pink pigment intensity of the chicken eggshell on the percent transmission of light passing through the chicken eggshells. Method. Eggs of comparable weight from a meat-type breeder (Meihuang) were used, and divided based on three levels of pink pigment (light, medium and dark) in the eggshells. During the incubation (0-21 d), the values of the eggshell pigment (ΔE, L (∗), a (∗), b (∗)) were measured. The percent transmission of light for different regions and intensities of eggshell pigmentation was measured by using the visible wavelength range of 380-780 nm. Result. Three measured indicators of eggshell color, ΔE, L (∗) and a (∗), did not change significantly during incubation. Compared with other regions and pigment intensities, eggshell at the small pole and with light pigmentation intensity showed the highest percent transmission of light. The transmission value varied significantly (P < 0.001) with incubation time. The element analysis of eggshells with different levels of pink pigment showed that the potassium content of the eggshells for all pigment levels decreased significantly during incubation. Conclusion. In summary, pigment intensity and the region of the eggshell influenced the percent transmission of light of eggshell. Differences in the spectral characteristics of different eggshells may influence the effects of photostimulation during the incubation of eggs. All of these results will be applicable for perfecting the design of light intensity for lighted incubation to improve productivity.
Yu, Yue; Li, Zhanming
2016-01-01
Objective. The objective of this study was to investigate changes in pigment, spectral transmission and element content of chicken eggshells with different intensities of pink pigment during the incubation period. We also investigated the effects of the region (small pole, equator and large pole) and pink pigment intensity of the chicken eggshell on the percent transmission of light passing through the chicken eggshells. Method. Eggs of comparable weight from a meat-type breeder (Meihuang) were used, and divided based on three levels of pink pigment (light, medium and dark) in the eggshells. During the incubation (0–21 d), the values of the eggshell pigment (ΔE, L∗, a∗, b∗) were measured. The percent transmission of light for different regions and intensities of eggshell pigmentation was measured by using the visible wavelength range of 380–780 nm. Result. Three measured indicators of eggshell color, ΔE, L∗ and a∗, did not change significantly during incubation. Compared with other regions and pigment intensities, eggshell at the small pole and with light pigmentation intensity showed the highest percent transmission of light. The transmission value varied significantly (P < 0.001) with incubation time. The element analysis of eggshells with different levels of pink pigment showed that the potassium content of the eggshells for all pigment levels decreased significantly during incubation. Conclusion. In summary, pigment intensity and the region of the eggshell influenced the percent transmission of light of eggshell. Differences in the spectral characteristics of different eggshells may influence the effects of photostimulation during the incubation of eggs. All of these results will be applicable for perfecting the design of light intensity for lighted incubation to improve productivity. PMID:27019785
ERIC Educational Resources Information Center
Pinquart, Martin; Silbereisen, Rainer K.
2004-01-01
The intergenerational transmission of values is a bidirectional process. To date, however, adolescents' influence on parental values has rarely been investigated. In the present study, we analyzed the transmission of values from adolescents (aged 11 to 17 years) to their mothers and fathers across a one-year interval in 431 mother-child dyads and…
Balancing Dynamic Strength of Spur Gears Operated at Extended Center Distance
NASA Technical Reports Server (NTRS)
Lin, Hsiang Hsi; Liou, Chuen-Huei; Oswald, Fred B.; Townsend, Dennis P.
1996-01-01
This paper presents an analytical study on using hob offset to balance the dynamic tooth strength of spur gears operated at a center distance greater than the standard value. This study is an extension of a static study by Mabie and others. The study was limited to the offset values that assure the pinion and gear teeth will neither be undercut nor become pointed. The analysis presented in this paper was performed using DANST-PC, a new version of the NASA gear dynamics code. The operating speed of the transmission influences the amount of hob offset required to equalize the dynamic stresses in the pinion and gear. The optimum hob offset for the pinion was found to vary within a small range as the speed changes. The optimum value is generally greater than the optimum value found by static procedures. For gears that must operate over a wide range of speeds, an average offset value may be used.
Validation of a Polyimide Foam Model for Use in Transmission Loss Applications
NASA Technical Reports Server (NTRS)
Hong, Kwanwoo; Bolton, J. Stuart; Cano, Roberto J.; Weiser, Erik S.; Jensen, Brian J.; Silcox, Rich; Howerton, Brian M.; Maxon, John; Wang, Tongan; Lorenzi, Tyler
2010-01-01
The work described in this paper was focused on the use of a new polyimide foam in a double wall sound transmission loss application. Recall that polyimide foams are functionally attractive, compared to polyurethane foams, for example, owing to their fire resistance. The foam considered here was found to have a flow resistivity that was too high for conventional acoustical applications, and as a result, it was processed by partial crushing to lower the flow resistivity into an acceptable range. Procedures for measuring the flow resistivity and Young s modulus of the material have been described, as was an inverse characterization procedure for estimating the remaining Biot parameters based on standing wave tube measurements of transmission loss and absorption coefficient. The inverse characterization was performed using a finite element model implementation of the Biot poro-elastic material theory. Those parameters were then used to predict the sound transmission loss of a double panel system lined with polyimide foam, and the predictions were compared with full-scale transmission loss measurements. The agreement between the two was reasonable, especially in the high and low frequency limits; however, it was found that the SEA model resulted in an under-prediction of the transmission loss in the mid-frequency range. Nonetheless, it was concluded that the performance of polyimide foam could be predicted using conventional poro-elastic material models and that polyimide foam may offer an attractive alternative to other double wall linings in certain situations: e.g., when fire resistance is a key issue. Future work will concentrate on reducing the density of the foam to values similar to those used in current aircraft sidewall treatments, and developing procedures to improve the performance of the foam in transmission loss applications.
Finneran, James J; Branstetter, Brian K; Houser, Dorian S; Moore, Patrick W; Mulsow, Jason; Martin, Cameron; Perisho, Shaun
2014-10-01
Previous measurements of toothed whale echolocation transmission beam patterns have utilized few hydrophones and have therefore been limited to fine angular resolution only near the principal axis or poor resolution over larger azimuthal ranges. In this study, a circular, horizontal planar array of 35 hydrophones was used to measure a dolphin's transmission beam pattern with 5° to 10° resolution at azimuths from -150° to +150°. Beam patterns and directivity indices were calculated from both the peak-peak sound pressure and the energy flux density. The emitted pulse became smaller in amplitude and progressively distorted as it was recorded farther off the principal axis. Beyond ±30° to 40°, the off-axis signal consisted of two distinct pulses whose difference in time of arrival increased with the absolute value of the azimuthal angle. A simple model suggests that the second pulse is best explained as a reflection from internal structures in the dolphin's head, and does not implicate the use of a second sound source. Click energy was also more directional at the higher source levels utilized at longer ranges, where the center frequency was elevated compared to that of the lower amplitude clicks used at shorter range.
Schönpflug, Ute; Yan, Song
2014-01-01
Intergenerational intrafamilial transmission is a process by which acquired information passes from parent to offspring. The authors examined mechanisms of intergenerational transmission of individualistic and collectivistic values in 216 families with 1 adolescent child in 2 societies: East Germany and the Shanghai region in China. To clarify the impact of transmission from mother and father to son or daughter, this study analyzed the filter model by U. Schönpflug and L. Bilz (2009), including zeitgeist concerning value climate in the social context, each family member's deviation from the zeitgeist, and the familial motivation to transmit. The 2-dimensional structure (individualism and collectivism) of 10 values of the Portrait Value Questionnaire (Schwartz, Lehmann, & Rocca, 1999) differed somewhat in the 2 regions for adolescents and their fathers, but not for mothers. In East Germany, no significant direct transmission of value orientation was observed, whereas in Shanghai, fathers transmitted individualism and collectivism values. Family motivation impacted significantly on the child's value orientation in both regions. The zeitgeist measure had no significant influence on the transmission process whereas deviation from zeitgeist did. The gender of the child determined the level and transmission of collectivism, but not the transfer of individualism.
A photonic crystal waveguide with silicon on insulator in the near-infrared band
NASA Astrophysics Data System (ADS)
Tang, Hai-Xia; Zuo, Yu-Hua; Yu, Jin-Zhong; Wang, Qi-Ming
2007-07-01
A two-dimensional (2D) photonic crystal waveguide in the Γ-K direction with triangular lattice on a silicon-on-insulator (SOI) substrate in the near-infrared band is fabricated by the combination of electron beam lithography and inductively coupled plasma etching. Its transmission characteristics are analysed from the stimulated band diagram by the effective index and the 2D plane wave expansion (PWE) methods. In the experiment, the transmission band edge in a longer wavelength of the photonic crystal waveguide is about 1590 nm, which is in good qualitative agreement with the simulated value. However, there is a disagreement between the experimental and the simulated results when the wavelength ranges from 1607 to 1630 nm, which can be considered as due to the unpolarized source used in the transmission measurement.
The role of between-parent values agreement in parent-to-child transmission of academic values.
Gniewosz, Burkhard; Noack, Peter
2012-08-01
The present study investigates the intergenerational transmission of academic task values within family in early adolescence. Social learning processes are assumed to operate through the students' perceptions of their parents' values. The major goal of this study is to show that this values transmission is facilitated by between-parent value agreement. Based on a longitudinal data set including 1019 German students, their mothers (N = 847), and fathers (N = 733), structural equation models showed significant effects of the parents' task values regarding math and German language as academic subjects on the respective task values reported by the students, mediated through the student-perceived parental values. This transmission chain was only found if the between-parent agreement was high. The results are discussed in terms of parent-specific mechanisms fostering transmission if both parents agree on academic values, such as an improved perceptive accuracy as well as the increased salience and mutual reinforcement of parental messages. Copyright © 2011 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.
Asymmetric scattering by non-Hermitian potentials
NASA Astrophysics Data System (ADS)
Ruschhaupt, A.; Dowdall, T.; Simón, M. A.; Muga, J. G.
2017-10-01
The scattering of quantum particles by non-Hermitian (generally non-local) potentials in one dimension may result in asymmetric transmission and/or reflection from left and right incidence. After extending the concept of symmetry for non-Hermitian potentials, eight generalized symmetries based on the discrete Klein's four-group (formed by parity, time reversal, their product, and unity) are found. Together with generalized unitarity relations they determine selection rules for the possible and/or forbidden scattering asymmetries. Six basic device types are identified when the scattering coefficients (squared moduli of scattering amplitudes) adopt zero/one values, and transmission and/or reflection are asymmetric. They can pictorically be described as a one-way mirror, a one-way barrier (a Maxwell pressure demon), one-way (transmission or reflection) filters, a mirror with unidirectional transmission, and a transparent, one-way reflector. We design potentials for these devices and also demonstrate that the behavior of the scattering coefficients can be extended to a broad range of incident momenta.
Aucott, Walter R.
1996-01-01
Transmissivity values used in the flow simulation range from less than 1,000 feet squared per day near the updip limit of most aquifers to about 30,000 feet squared per day in the Middendorf aquifer in the Savannah River Plant area. Vertical hydraulic conductivity values used in simulation of confining units range from about 6x10-7 feet per day for the confining unit between the Middendorf and Black Creek aquifers in coastal areas to 3x10-2 feet per day for most of the confining units near their updip limits. Storage coefficients used in transient simulations were 0.15 where unconfined conditions exist and 0.0005 where confined conditions exist.
Freestanding diamond films: plates, tubes, and curved diaphragms
NASA Astrophysics Data System (ADS)
Obata, Tatsuo; Morimoto, Shingo
1990-01-01
Free-standing diamond films are prepared by CVD technique to examine their properties directly. The products have a variety of shapes such as plates, tubes and curved diaphragms. Coefficients of thermal expansion (GTE) of the tube are similar to the values of a bulk diamond in the range from 40°C to 500°C. It is found that polished diamond film has uniform infrared transmission ranging from 500cm-1 to 4000cm-1. A speaker diaphragm will be a good application for free-standing diamond film.
Experiments and error analysis of laser ranging based on frequency-sweep polarization modulation
NASA Astrophysics Data System (ADS)
Gao, Shuyuan; Ji, Rongyi; Li, Yao; Cheng, Zhi; Zhou, Weihu
2016-11-01
Frequency-sweep polarization modulation ranging uses a polarization-modulated laser beam to determine the distance to the target, the modulation frequency is swept and frequency values are measured when transmitted and received signals are in phase, thus the distance can be calculated through these values. This method gets much higher theoretical measuring accuracy than phase difference method because of the prevention of phase measurement. However, actual accuracy of the system is limited since additional phase retardation occurs in the measuring optical path when optical elements are imperfectly processed and installed. In this paper, working principle of frequency sweep polarization modulation ranging method is analyzed, transmission model of polarization state in light path is built based on the theory of Jones Matrix, additional phase retardation of λ/4 wave plate and PBS, their impact on measuring performance is analyzed. Theoretical results show that wave plate's azimuth error dominates the limitation of ranging accuracy. According to the system design index, element tolerance and error correcting method of system is proposed, ranging system is built and ranging experiment is performed. Experiential results show that with proposed tolerance, the system can satisfy the accuracy requirement. The present work has a guide value for further research about system design and error distribution.
Leuker, G; Hingst, V
1992-10-01
Using three UV-plants of different technical designs for water disinfection, we studied the conformity between experimental germ reduction using standard test organisms and calculated UV-doses under various water flow conditions. Taking into consideration the style of construction of the UV-plants, the irradiation area and the layer thickness were used as constant parameters for dose calculations. This was also employed for the irradiation intensity, since the experiments were performed for a relatively short period compared of the life span of the UV-irradiators. Both exposure time and water transmission were employed as variable parameters in the dose calculations and experimental procedures respectively. The calculated UV-dose and experimentally obtained germ reduction values were comparatively the same for two of the three UV-plants studied. However, no correlation was observed between the reduction of E. coli and the corresponding calculated UV-dose values. Therefore, the calculated UV-dose values for any given UV-plant should be considered to be relative and by no means absolute values. We are of the opinion that within a certain range of water flow rate and transmission, antimicrobial effectiveness of different UV-plants should be demonstrated independent of dose values, technical and other construction characteristics. The applicability of the UV-plants studied is discussed.
Intensity-dependent resonant transmission of x-rays in solid-density aluminum plasma
NASA Astrophysics Data System (ADS)
Cho, M. S.; Chung, H.-K.; Cho, B. I.
2018-05-01
X-ray free-electron lasers (XFELs) provide unique opportunities to generate and investigate dense plasmas. The absorption and transmission properties of x-ray photons in dense plasmas are important in characterizing the state of the plasmas. Experimental evidence shows that the transmission of x-ray photons through dense plasmas depends greatly on the incident XFEL intensity. Here, we present a detailed analysis of intensity-dependent x-ray transmission in solid-density aluminum using collisional-radiative population kinetics calculations. Reverse saturable absorption (RSA), i.e., an increase in x-ray absorption with intensity has been observed for photon energies below the K-absorption edge and in the intensity range of 1016-1017 W/cm2 for XFEL photons with 1487 eV. At higher intensities, a transition from RSA to saturable absorption (SA) is predicted; thus, the x-ray absorption decreases with intensity above a threshold value. For XFEL photon energies of 1501 eV and 1515 eV, the transition from RSA to SA occurs at XFEL intensities between 1017-1018 W/cm2. Electron temperatures are predicted to be in the range of 30-50 eV for the given experimental conditions. Detailed population kinetics of the charge states explains the intensity-dependent absorption of x-ray photons and the fast modulation of XFEL pulses for both RSA and SA.
T-COMP—A suite of programs for extracting transmissivity from MODFLOW models
Halford, Keith J.
2016-02-12
Simulated transmissivities are constrained poorly by assigning permissible ranges of hydraulic conductivities from aquifer-test results to hydrogeologic units in groundwater-flow models. These wide ranges are derived from interpretations of many aquifer tests that are categorized by hydrogeologic unit. Uncertainty is added where contributing thicknesses differ between field estimates and numerical models. Wide ranges of hydraulic conductivities and discordant thicknesses result in simulated transmissivities that frequently are much greater than aquifer-test results. Multiple orders of magnitude differences frequently occur between simulated and observed transmissivities where observed transmissivities are less than 1,000 feet squared per day.Transmissivity observations from individual aquifer tests can constrain model calibration as head and flow observations do. This approach is superior to diluting aquifer-test results into generalized ranges of hydraulic conductivities. Observed and simulated transmissivities can be compared directly with T-COMP, a suite of three FORTRAN programs. Transmissivity observations require that simulated hydraulic conductivities and thicknesses in the volume investigated by an aquifer test be extracted and integrated into a simulated transmissivity. Transmissivities of MODFLOW model cells are sampled within the volume affected by an aquifer test as defined by a well-specific, radial-flow model of each aquifer test. Sampled transmissivities of model cells are averaged within a layer and summed across layers. Accuracy of the approach was tested with hypothetical, multiple-aquifer models where specified transmissivities ranged between 250 and 20,000 feet squared per day. More than 90 percent of simulated transmissivities were within a factor of 2 of specified transmissivities.
First principle study of transport properties of a graphene nano structure
NASA Astrophysics Data System (ADS)
Kumar, Naveen; Sharma, Munish; Sharma, Jyoti Dhar; Ahluwalia, P. K.
2013-06-01
The first principle quantum transport calculations have been performed for graphene using Tran SIESTA which calculates transport properties using nonequilibrium Green's function method in conjunction with density-functional theory. Transmission functions, electron density of states and current-voltage characteristic have been calculated for a graphene nano structure using graphene electrodes. Transmission function, density of states and projected density of states show a discrete band structure which varies with applied voltage. The value of current is very low for applied voltage between 0.0 V to 5.0 V and lies in the range of pico ampere. In the V-I characteristic current shows non-linear fluctuating pattern with increase in voltage.
Deep sub-wavelength ultrasonic imaging
NASA Astrophysics Data System (ADS)
Amireddy, Kiran Kumar; Balasubramaniam, Krishnan; Rajagopal, Prabhu
2018-04-01
There is much interest in improving the resolution of ultrasonic inspection, which suffers from large wavelengths typically in the range of millimeters, due to low value of speed of sound in solid media. The authors are interested in achieving this through holey structured metamaterial lenses, and have recently demonstrated an experimental subwavelength resolution of λ/25. However the previous work was in through-transmission mode with reception using Laser Doppler Vibrometer (LDV), which may not be suitable for practical applications. This paper discusses the use of optimized holey structured metalens to achieve a deep sub-wavelength imaging up to λ/18 in through-transmission mode, but using commercially available piezoelectric ultrasonic transducers for both generation and reception of ultrasound.
Coaxial tube array space transmission line characterization
NASA Technical Reports Server (NTRS)
Switzer, Colleen A.; Bents, David J.
1987-01-01
The coaxial tube array tether/transmission line used to connect an SP-100 nuclear power system to the space station was characterized over the range of reactor-to-platform separation distances of 1 to 10 km. Characterization was done with respect to array performance, physical dimensions and masses. Using a fixed design procedure, a family of designs was generated for the same power level (300 kWe), power loss (1.5 percent), and meteoroid survival probability (99.5 percent over 10 yr). To differentiate between vacuum insulated and gas insulated lines, two different maximum values of the E field were considered: 20 kV/cm (appropriate to vacuum insulation) and 50 kV/cm (compressed SF6). Core conductor, tube, bumper, standoff, spacer and bumper support dimensions, and masses were also calculated. The results of the characterization show mainly how transmission line size and mass scale with reactor-to-platform separation distance.
Chandrashekar, Vani
2015-01-01
Light transmission aggregometry lacks in standardisation and normal reference values are not widely available. The aims of our study were to establish reference ranges for aggregation, slope and lag phase in healthy controls with platelet counts between 150 and 450 × 10(9)/l in platelet-rich plasma (PRP) as well as evaluate the influence of platelet count. Ninety-nine subjects were evaluated with four agonists and divided into two groups based on platelet count and the groups were compared by Student's t-test. There was no difference between the means of the two groups for amplitude and slope barring the lag phase for collagen. Platelet counts between 150 and 450 × 10(9)/l have no effects on light transmission aggregometry and hence adjustment of platelet count is not necessary.
Coaxial tube array space transmission line characterization
NASA Astrophysics Data System (ADS)
Switzer, Colleen A.; Bents, David J.
The coaxial tube array tether/transmission line used to connect an SP-100 nuclear power system to the space station was characterized over the range of reactor-to-platform separation distances of 1 to 10 km. Characterization was done with respect to array performance, physical dimensions and masses. Using a fixed design procedure, a family of designs was generated for the same power level (300 kWe), power loss (1.5 percent), and meteoroid survival probability (99.5 percent over 10 yr). To differentiate between vacuum insulated and gas insulated lines, two different maximum values of the E field were considered: 20 kV/cm (appropriate to vacuum insulation) and 50 kV/cm (compressed SF6). Core conductor, tube, bumper, standoff, spacer and bumper support dimensions, and masses were also calculated. The results of the characterization show mainly how transmission line size and mass scale with reactor-to-platform separation distance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Battum, LJ van; Heukelom, S
Purpose This study investigates the origin of lateral optical density (OD) variation for Gafchromic film (EBT and EBT2) scanned in transmission mode with Epson flatbed scanners (1680 Expression Pro and 10000XL). Effects investigated are: cross talk, optical path length and polarization. Methods Cross talk has been examined with triangular shaped light-transmission sheets with OD ranging from 0 to opaque. Optical path length has been studied with absorptive and reflective OD-filters (OD range 0.2 to 2.0). Dependency on light-polarization on the scanner read out has been investigated using linear polarizer sheets. All experiments have been performed at centre scanner position (normmore » point) and at several lateral scan positions, without and with (un)irradiated EBT-film. Dose values used ranged between 0.2 to 9 Gy, yielding an OD-range between 0.25 to 1.1. Results The lateral OD variation is dose dependent and increases up to 14% at most lateral position for dose up to 9 Gy. Cross talk effect contributes to 0.5% in clinical used OD ranges but equals 2% for extreme high dose gradients. Film induced optical path length will effect the lateral OD variation up to 3% at most lateral points. Light polarization is inherent present in these scanners due to multiple reflection on mirrors. In addition film induced polarization is the most important effect generating the observed lateral OD variation. Both Gafchromic film base and sensitive layer have polarizing capabilities; for the sensitive layer its influence is dose dependent. Conclusions Lateral OD variation origins from optical physics (i.e. polarization and reflection) related to scanner and film construction. Cross talk can be ignored in film dosimetry for clinical used dose values and gradients. Therefore it is recommended to determine the lateral OD variation per film type and scanner.« less
Finite-element simulation of ground-water flow in the vicinity of Yucca Mountain, Nevada-California
Czarnecki, J.B.; Waddell, R.K.
1984-01-01
A finite-element model of the groundwater flow system in the vicinity of Yucca Mountain at the Nevada Test Site was developed using parameter estimation techniques. The model simulated steady-state ground-water flow occurring in tuffaceous, volcanic , and carbonate rocks, and alluvial aquifers. Hydraulic gradients in the modeled area range from 0.00001 for carbonate aquifers to 0.19 for barriers in tuffaceous rocks. Three model parameters were used in estimating transmissivity in six zones. Simulated hydraulic-head values range from about 1,200 m near Timber Mountain to about 300 m near Furnace Creek Ranch. Model residuals for simulated versus measured hydraulic heads range from -28.6 to 21.4 m; most are less than +/-7 m, indicating an acceptable representation of the hydrologic system by the model. Sensitivity analyses of the model 's flux boundary condition variables were performed to assess the effect of varying boundary fluxes on the calculation of estimated model transmissivities. Varying the flux variables representing discharge at Franklin Lake and Furnace Creek Ranch has greater effect than varying other flux variables. (Author 's abstract)
Determination of hydraulic properties in the vicinity of a landfill near Antioch, Illinois
Kay, Robert T.; Earle, John D.
1990-01-01
A hydrogeologic investigation was conducted in and around a landfill near Antioch, Illinois, in December 1987. The investigation consisted, in part, of an aquifer test that was designed to determine the hydraulic connection between the hydrogeologic units in the area. The hydrogeologic units consist of a shallow, unconfined, sand and gravel aquifer of variable thickness that overlies an intermediate confining unit of variable thickness composed predominantly of till. Underlying the till is a deep, confined, sand and gravel aquifer that serves as the water supply for the village of Antioch. The aquifer test was conducted in the confined aquifer. Aquifer-test data were analyzed using the Hantush and Jacob method for a leaky confined aquifer with no storage in the confining unit. Calculated transmissivity of the confined aquifer ranged from 1.96x10^4 to 2.52x10^4 foot squared per day and storativity ranged from 2.10x10^-4 to 8.71x10^-4. Leakage through the confining unit ranged from 1.29x10^-4 to 7.84x10^-4 foot per day per foot, and hydraulic conductivity of the confining unit ranged from 3.22x10^-3 to 1.96x10^-2 foot per day. The Hantush method for analysis of a leaky confined aquifer with storage in the confining unit also was used to estimate aquifer and confining-unit properties. Transmissivity and storativity values calculated using the Hantush method are in good agreement with the values calculated from the Hantush and Jacob method. Properties of the confining unit were estimated using the ratio method of Neuman and Witherspoon. The estimated diffusivity of the confining unit ranged from 50.36 to 68.13 feet squared per day, A value for the vertical hydraulic conductivity of the confining unit calculated from data obtained using both the Hantush and the Neuman and Witherspoon methods was within the range of values calculated by the Hantush and Jacob method. The aquifer-test data clearly showed that the confining unit is hydraulically connected to the confined aquifer. The aquifer-test data also indicated that the unconfined aquifer becomes hydraulically connected to the deep sand and gravel aquifer within 24 hours after the start of pumping in the confined aquifer.
Ikard, Scott; Kress, Wade
2016-01-01
Transmissivity is a bulk hydraulic property that can be correlated with bulk electrical properties of an aquifer. In aquifers that are electrically-resistive relative to adjacent layers in a horizontally stratified sequence, transmissivity has been shown to correlate with bulk transverse resistance. Conversely, in aquifers that are electrically-conductive relative to adjacent layers, transmissivity has been shown to correlate with bulk longitudinal conductance. In both cases, previous investigations have relied on small datasets (on average less than eight observations) that have yielded coefficients of determination (R2) that are typically in the range of 0.6 to 0.7 to substantiate these relations. Compared to previous investigations, this paper explores hydraulic-electrical relations using a much larger dataset. Geophysical data collected from 26 boreholes in Emirate Abu Dhabi, United Arab Emirates, are used to correlate transmissivity modeled from neutron porosity logs to the bulk electrical properties of the surficial aquifer that are computed from deep-induction logs. Transmissivity is found to be highly correlated with longitudinal conductance. An R2 value of 0.853 is obtained when electrical effects caused by variations in pore-fluid salinity are taken into consideration.
Optical performance of random anti-reflection structured surfaces (rARSS) on spherical lenses
NASA Astrophysics Data System (ADS)
Taylor, Courtney D.
Random anti-reflection structured surfaces (rARSS) have been reported to improve transmittance of optical-grade fused silica planar substrates to values greater than 99%. These textures are fabricated directly on the substrates using reactive-ion/inductively-coupled plasma etching (RIE/ICP) techniques, and often result in transmitted spectra with no measurable interference effects (fringes) for a wide range of wavelengths. The RIE/ICP processes used in the fabrication process to etch the rARSS is anisotropic and thus well suited for planar components. The improvement in spectral transmission has been found to be independent of optical incidence angles for values from 0° to +/-30°. Qualifying and quantifying the rARSS performance on curved substrates, such as convex lenses, is required to optimize the fabrication of the desired AR effect on optical-power elements. In this work, rARSS was fabricated on fused silica plano-convex (PCX) and plano-concave (PCV) lenses using a planar-substrate optimized RIE process to maximize optical transmission in the range from 500 to 1100 nm. An additional set of lenses were etched in a non-optimized ICP process to provide additional comparisons. Results are presented from optical transmission and beam propagation tests (optimized lenses only) of rARSS lenses for both TE and TM incident polarizations at a wavelength of 633 nm and over a 70° full field of view in both singlet and doublet configurations. These results suggest optimization of the fabrication process is not required, mainly due to the wide angle-of-incidence AR tolerance performance of the rARSS lenses. Non-optimized recipe lenses showed low transmission enhancement, and confirmed the need to optimized etch recipes prior to process transfer of PCX/PCV lenses. Beam propagation tests indicated no major beam degradation through the optimized lens elements. Scanning electron microscopy (SEM) images confirmed different structure between optimized and non-optimized samples. SEM images also indicated isotropically-oriented surface structures on both types of lenses.
A model for the neural control of pineal periodicity
NASA Astrophysics Data System (ADS)
de Oliveira Cruz, Frederico Alan; Soares, Marilia Amavel Gomes; Cortez, Celia Martins
2016-12-01
The aim of this work was verify if a computational model associating the synchronization dynamics of coupling oscillators to a set of synaptic transmission equations would be able to simulate the control of pineal by a complex neural pathway that connects the retina to this gland. Results from the simulations showed that the frequency and temporal firing patterns were in the range of values found in literature.
NASA Astrophysics Data System (ADS)
Kiese, Sandra; Kücükpinar, Esra; Reinelt, Matthias; Miesbauer, Oliver; Ewender, Johann; Langowski, Horst-Christian
2017-02-01
Flexible organic electronic devices are often protected from degradation by encapsulation in multilayered films with very high barrier properties against moisture and oxygen. However, metrology must be improved to detect such low quantities of permeants. We therefore developed a modified ultra-low permeation measurement device based on a constant-flow carrier-gas system to measure both the transient and stationary water vapor permeation through high-performance barrier films. The accumulation of permeated water vapor before its transport to the detector allows the measurement of very low water vapor transmission rates (WVTRs) down to 2 × 10-5 g m-2 d-1. The measurement cells are stored in a temperature-controlled chamber, allowing WVTR measurements within the temperature range 23-80 °C. Differences in relative humidity can be controlled within the range 15%-90%. The WVTR values determined using the novel measurement device agree with those measured using a commercially available carrier-gas device from MOCON®. Depending on the structure and quality of the barrier film, it may take a long time for the WVTR to reach a steady-state value. However, by using a combination of the time-dependent measurement and the finite element method, we were able to estimate the steady-state WVTR accurately with significantly shorter measurement times.
Impact of particle concentration and out-of-range sizes on the measurements of the LISST
NASA Astrophysics Data System (ADS)
Zhao, Lin; Boufadel, Michel C.; King, Thomas; Robinson, Brian; Conmy, Robyn; Lee, Kenneth
2018-05-01
The instrument LISST (laser in situ scattering and transmissiometry) has been widely used for measuring the size of oil droplets in relation to oil spills and sediment particles. Major concerns associated with using the instrument include the impact of high concentrations and/or out-of-range particle (droplet) sizes on the LISST reading. These were evaluated experimentally in this study using monosized microsphere particles. The key findings include: (1) When high particle concentration reduced the optical transmission (OT) to below 30%, the measured peak value tended to underestimate the true peak value, and the accuracy of the LISST decreased by ~8% to ~28%. The maximum concentration to reach the 30% OT was about 50% of the theoretical values, suggesting a lower concentration level should be considered during the instrument deployment. (2) The out-of-range sizes of particles affected the LISST measurements when the sizes were close to the LISST measurement range. Fine below-range sizes primarily affected the data in the lowest two bins of the LISST with >75% of the volume at the smallest bin. Large out-of-range particles affected the sizes of the largest 8–10 bins only when very high concentration was present. The out-of-range particles slightly changed the size distribution of the in-range particles, but their concentration was conserved. An approach to interpret and quantify the effects of the out-of-range particles on the LISST measurement was proposed.
Zidovudine for the prevention of vertical HIV transmission: a decision analytic approach.
Rouse, D J; Owen, J; Goldenberg, R L; Vermund, S H
1995-08-01
The purpose of this study was to quantify the benefits of maternal-neonatal zidovudine (ZDV) administration for the prevention of vertical human immunodeficiency virus (HIV) transmission against the potential risks of drug-induced complications in uninfected children. A decision analysis model was created with use of a Markov cohort simulation, for evaluating both survival and quality of life for two hypothetical cohorts of HIV-exposed neonates: one with in utero and neonatal exposure to preventive ZDV therapy and the other not exposed. The model included the probability of congenital HIV infection with and without ZDV treatment (estimates derived from AIDS Clinical Trials Group study 076), the yearly probability of death with and without congenital HIV infection, a range of probabilities of adverse effects from ZDV use, and a range of ages in life when any adverse effect would manifest. In a series of scenarios, the impact of different estimates for the quality-of-life decrement from any adverse ZDV effect in HIV-uninfected children was assessed, and threshold values for this estimate were established, i.e., critical values below which withholding ZDV would be the preferred choice. Across a wide range of estimates for multiple contingencies, ZDV use was associated with a greater number of quality-adjusted life years than was non-use. Only in implausible, pessimistic scenarios (i.e., a high incidence of profound adverse effects beginning early in life) would withholding ZDV be the rational choice for an asymptomatic HIV-infected pregnant woman.(ABSTRACT TRUNCATED AT 250 WORDS)
NASA Astrophysics Data System (ADS)
Majidi, Leyla; Zare, Moslem; Asgari, Reza
2018-06-01
The unusual features of the charge and spin transport characteristics are investigated in new two-dimensional heterostructures. Intraband specular Andreev reflection is realized in a topological insulator thin film normal/superconducting junction in the presence of a gate electric field. Perfect specular electron-hole conversion is shown for different excitation energy values in a wide experimentally available range of the electric field and also for all angles of incidence when the excitation energy has a particular value. It is further demonstrated that the transmission probabilities of the incoming electrons from different spin subbands to the monolayer phosphorene ferromagnetic/normal/ferromagnetic (F/N/F) hybrid structure have different behavior with the angle of incidence and perfect transmission occurs at defined angles of incidence to the proposed structure with different length of the N region, and different alignments of magnetization vectors. Moreover, the sign change of the spin-current density is demonstrated by tuning the chemical potential and exchange field of the F region.
The epidemiology of hepatitis C virus in Egypt: a systematic review and data synthesis
2013-01-01
Background Egypt has the highest prevalence of hepatitis C virus (HCV) in the world, estimated nationally at 14.7%. Our study’s objective was to delineate the evidence on the epidemiology of HCV infection among the different population groups in Egypt, and to draw analytical inferences about the nature of HCV transmission in this country. Methods We conducted a systematic review of all data on HCV prevalence and incidence in Egypt following PRISMA guidelines. The main sources of data included PubMed and Embase databases. We also used a multivariate regression model to infer the temporal trend of HCV prevalence among the general population and high risk population in Egypt. Results We identified 150 relevant records, four of which were incidence studies. HCV incidence ranged from 0.8 to 6.8 per 1,000 person-years. Overall, HCV prevalence among pregnant women ranged between 5-15%, among blood donors between 5-25%, and among other general population groups between 0-40%. HCV prevalence among multi-transfused patients ranged between 10-55%, among dialysis patients between 50-90%, and among other high risk populations between 10% and 85%. HCV prevalence varied widely among other clinical populations and populations at intermediate risk. Risk factors appear to be parenteral anti-schistosomal therapy, injections, transfusions, and surgical procedures, among others. Results of our time trend analysis suggest that there is no evidence of a statistically significant decline in HCV prevalence over time in both the general population (p-value: 0.215) and high risk population (p-value: 0.426). Conclusions Egypt is confronted with an HCV disease burden of historical proportions that distinguishes this nation from others. A massive HCV epidemic at the national level must have occurred with substantial transmission still ongoing today. HCV prevention in Egypt must become a national priority. Policymakers, and public health and medical care stakeholders need to introduce and implement further prevention measures targeting the routes of HCV transmission. PMID:23799878
Strobel, M.L.; Delin, G.N.
1996-01-01
The Neuman (1974) method for unconfined aquifers was used to analyze data collected from the two observation wells during the drawdown and recovery periods, resulting in a range of estimated aquifer hydraulic properties. Aquifer transmissivity ranged from 4,710 to 7,660 ft2/d and aquifer storativity ranged from 8.24 x 10-5 to 1.60 x 10-4. These values are generally in close agreement for all four sets of data, given the limitations of the test, indicating that the test results are accurate and representative of the aquifer hydrogeologic properties. The lack of late-time data made it impossible to accurately assess aquifer specific yield.
Arc-evaporated carbon films: Optical properties and electron mean free paths
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arakawa, E.T.; Dolfini, S.M.; Ashley, J.C.
1985-06-15
The real and imaginary parts of the complex refractive index, n(..omega..) = n(..omega..)+ik(..omega..), of arc-evaporated carbon films have been obtained over the range of photon energies h..omega.. from 0.5 to 62.0 eV. Values of k(..omega..) obtained from transmission measurements in this energy range were combined with values of k(..omega..) from the literature in the infrared and soft-x-ray regions. A Kramers-Kronig analysis then yielded the values of n(..omega..). The density of the arc-evaporated carbon films was found to be 1.90 +- 0.05 g cm/sup -3/ by the ''sink-float'' method, and their thicknesses were determined optically. A sum-rule calculation yielded the effectivemore » numbers of valence and core electrons to be 4.2 and 1.8, respectively. The experimental values determined for n(..omega..) have been used to estimate values of the inelastic mean free path ..lambda..(E) for electrons of energy E from 200 to 3000 eV in amorphous carbon. Good agreement is found between ..lambda..(E) and experimentally determined values of electron attenuation length L(E) from the literature.« less
Tojo, H; Yamada, I; Yasuhara, R; Ejiri, A; Hiratsuka, J; Togashi, H; Yatsuka, E; Hatae, T; Funaba, H; Hayashi, H; Takase, Y; Itami, K
2016-09-01
This paper evaluates the accuracy of electron temperature measurements and relative transmissivities of double-pass Thomson scattering diagnostics. The electron temperature (T e ) is obtained from the ratio of signals from a double-pass scattering system, then relative transmissivities are calculated from the measured T e and intensity of the signals. How accurate the values are depends on the electron temperature (T e ) and scattering angle (θ), and therefore the accuracy of the values was evaluated experimentally using the Large Helical Device (LHD) and the Tokyo spherical tokamak-2 (TST-2). Analyzing the data from the TST-2 indicates that a high T e and a large scattering angle (θ) yield accurate values. Indeed, the errors for scattering angle θ = 135° are approximately half of those for θ = 115°. The method of determining the T e in a wide T e range spanning over two orders of magnitude (0.01-1.5 keV) was validated using the experimental results of the LHD and TST-2. A simple method to provide relative transmissivities, which include inputs from collection optics, vacuum window, optical fibers, and polychromators, is also presented. The relative errors were less than approximately 10%. Numerical simulations also indicate that the T e measurements are valid under harsh radiation conditions. This method to obtain T e can be considered for the design of Thomson scattering systems where there is high-performance plasma that generates harsh radiation environments.
Clarkson, D McG
2006-02-21
An assessment is provided of protection factors afforded for retinal thermal hazard and blue light photochemical hazard for a range of filters used with intense pulsed light sources (IPLs). A characteristic IPL spectrum based on black body radiation at 5000 K with a low cut filter at 515 nm was identified as suitable for such estimations. Specific filters assessed included types with idealized transmission properties and also a range of types whose transmission characteristics were measured by means of a Bentham DMc150 spectroradiometer. Predicted behaviour based on these spectra is outlined which describes both the effectiveness of protection and the level of luminous transmittance afforded. The analysis showed it was possible to describe a figure of merit for a particular filter material relating the degree of protection provided and corresponding value of luminous transmittance. This consideration is important for providing users of IPL equipment with safety eyewear with adequate level of visual transmittance.
NASA Astrophysics Data System (ADS)
McG Clarkson, D.
2006-02-01
An assessment is provided of protection factors afforded for retinal thermal hazard and blue light photochemical hazard for a range of filters used with intense pulsed light sources (IPLs). A characteristic IPL spectrum based on black body radiation at 5000 K with a low cut filter at 515 nm was identified as suitable for such estimations. Specific filters assessed included types with idealized transmission properties and also a range of types whose transmission characteristics were measured by means of a Bentham DMc150 spectroradiometer. Predicted behaviour based on these spectra is outlined which describes both the effectiveness of protection and the level of luminous transmittance afforded. The analysis showed it was possible to describe a figure of merit for a particular filter material relating the degree of protection provided and corresponding value of luminous transmittance. This consideration is important for providing users of IPL equipment with safety eyewear with adequate level of visual transmittance.
Sánchez, Antonio; Blanc, Sara; Yuste, Pedro; Perles, Angel; Serrano, Juan José
2012-01-01
This paper is focused on the description of the physical layer of a new acoustic modem called ITACA. The modem architecture includes as a major novelty an ultra-low power asynchronous wake-up system implementation for underwater acoustic transmission that is based on a low-cost off-the-shelf RFID peripheral integrated circuit. This feature enables a reduced power dissipation of 10 μW in stand-by mode and registers very low power values during reception and transmission. The modem also incorporates clear channel assessment (CCA) to support CSMA-based medium access control (MAC) layer protocols. The design is part of a compact platform for a long-life short/medium range underwater wireless sensor network. PMID:22969324
Norder, Heléne; Bergström, Åsa; Uhnoo, Ingrid; Aldén, Jöran; Weiss, Lars; Czajkowski, Jan; Magnius, Lars
1998-01-01
Four hepatitis C virus transmission chains at three dialysis units were disclosed by limited sequencing; three of these were disclosed by analysis of the NS5-B region of the genome. Dialysis on the same shift as that during which infected patients were dialyzed was the common factor for seven patients in two chains. Two nurses exposed to needle sticks and their sources of infection constituted two other chains. The strains of three chains belonged to subtype 1a and formed clusters with an intrachain variability of 0 to 6 nucleotides compared to 8 to 37 nucleotides for unrelated strains within this subtype. The clusters were supported by bootstrap values ranging from 89 to 100%. PMID:9738071
Sánchez, Antonio; Blanc, Sara; Yuste, Pedro; Perles, Angel; Serrano, Juan José
2012-01-01
This paper is focused on the description of the physical layer of a new acoustic modem called ITACA. The modem architecture includes as a major novelty an ultra-low power asynchronous wake-up system implementation for underwater acoustic transmission that is based on a low-cost off-the-shelf RFID peripheral integrated circuit. This feature enables a reduced power dissipation of 10 μW in stand-by mode and registers very low power values during reception and transmission. The modem also incorporates clear channel assessment (CCA) to support CSMA-based medium access control (MAC) layer protocols. The design is part of a compact platform for a long-life short/medium range underwater wireless sensor network.
Near-infrared spectral methods for noninvasively measuring blood glucose
NASA Astrophysics Data System (ADS)
Fei, Sun; Kong, Deyi; Mei, Tao; Tao, Yongchun
2004-05-01
Determination of blood glucose concentrations in diabetic patients is a frequently occurring procedure and an important tool for diabetes management. Use of noninvasive detection techniques can relieve patients from the pain of frequent finger pokes and avoid the infection of disease via blood. This thesis discusses current research and analyzes the advantages and shortages of different measurement methods, including: optical methods (Transmission, Polarimetry and scattering), then, we give emphasis to analyze the technology of near-infrared (NIR) spectra. NIR spectral range 700 nm ~2300 nm was used because of its good transparency for biological tissue and presence of glucose absorption band. In this work, we present an outline of noninvasive blood glucose measurement. A near-infrared light beam is passed through the finger, and the spectral components of the emergent beam are measured using spectroscopic techniques. The device includes light sources having the wavelengths of 600 nm - 1800 nm to illuminate the tissue. Receptors associated with the light sources for receiving light and generating a transmission signal representing the light transmitted are also provided. Once a transmission signal is received by receptors, and the high and low values from each of the signals are stored in the device. The averaged values are then analyzed to determine the glucose concentration, which is displayed on the device.
NASA Astrophysics Data System (ADS)
Ibuot, Johnson C.; Obiora, Daniel N.; Ekpa, Moses M. M.; Okoroh, Doris O.
2017-12-01
This study was carried out employing vertical electrical sounding (VES) with Schlumberger electrode configuration. The objectives were to investigate the distribution of the geohydraulic parameters and the corrosivity of the aquifer layer within the study area. The sand-to-coarse grain sands aquifer have resistivity ranging from 8.1 to 2204 Ωm, while the thickness ranged from 7.4 to 55.3 m. These parameters were used in computing the geohydraulic parameters. Hydraulic conductivity was estimated using the Heigold equation, and its values ranged from 1.42 to 54.90 m/day. Estimated hydraulic conductivity values were employed in determining the aquifer transmissivity which ranged from 11.28 to 812.00 m2/day, fractional porosities ranged from 0.0351 to 0.0598. The longitudinarl conductance also varies from 0.01 to 1.83 Ω-1. The contour plots generated from the SURFER software package show the variation of these parameters. The ranges of these estimated parameters indicate variation in grain sizes, magnitude of pore sizes and facies changes. The corrosivity rating indicates that most of the VES points were practically non-corrosive.
DEVELOPMENT OF AN ARMY STATIONARY AXLE TEST STAND FOR LUBRICANT EFFICIENCY EVALUATION-PART II
2017-01-13
value was estimated based on the engines maximum peak torque output, multiplied by the transmissions 1st gear ratio, high range transfer case ratio...efficiency test stand to allow for laboratory based investigation of Fuel Efficient Gear Oils (FEGO) and their impact on vehicle efficiency. Development...their impact on vehicle efficiency. The test stand was designed and developed with the following goals: • Provide a lower cost alternative for
A Library of ATMO Forward Model Transmission Spectra for Hot Jupiter Exoplanets
NASA Technical Reports Server (NTRS)
Goyal, Jayesh M.; Mayne, Nathan; Sing, David K.; Drummond, Benjamin; Tremblin, Pascal; Amundsen, David S.; Evans, Thomas; Carter, Aarynn L.; Spake, Jessica; Baraffe, Isabelle;
2017-01-01
We present a grid of forward model transmission spectra, adopting an isothermal temperature-pressure profile, alongside corresponding equilibrium chemical abundances for 117 observationally significant hot exoplanets (equilibrium temperatures of 547-2710 K). This model grid has been developed using a 1D radiative-convective-chemical equilibrium model termed ATMO, with up-to-date high-temperature opacities. We present an interpretation of observations of 10 exoplanets, including best-fitting parameters and X(exp 2) maps. In agreement with previous works, we find a continuum from clear to hazy/cloudy atmospheres for this sample of hot Jupiters. The data for all the 10 planets are consistent with subsolar to solar C/O ratio, 0.005 to 10 times solar metallicity and water rather than methane-dominated infrared spectra. We then explore the range of simulated atmospheric spectra for different exoplanets, based on characteristics such as temperature, metallicity, C/O ratio, haziness and cloudiness. We find a transition value for the metallicity between 10 and 50 times solar, which leads to substantial changes in the transmission spectra. We also find a transition value of C/O ratio, from water to carbon species dominated infrared spectra, as found by previous works, revealing a temperature dependence of this transition point ranging from approximately 0.56 to approximately 1-1.3 for equilibrium temperatures from approximately 900 to approximately 2600 K. We highlight the potential of the spectral features of HCN and C2H2 to constrain the metallicities and C/O ratios of planets, using James Webb Space Telescope (JWST) observations. Finally, our entire grid (approximately 460 000 simulations) is publicly available and can be used directly with the JWST simulator PandExo for planning observations.
A library of ATMO forward model transmission spectra for hot Jupiter exoplanets
NASA Astrophysics Data System (ADS)
Goyal, Jayesh M.; Mayne, Nathan; Sing, David K.; Drummond, Benjamin; Tremblin, Pascal; Amundsen, David S.; Evans, Thomas; Carter, Aarynn L.; Spake, Jessica; Baraffe, Isabelle; Nikolov, Nikolay; Manners, James; Chabrier, Gilles; Hebrard, Eric
2018-03-01
We present a grid of forward model transmission spectra, adopting an isothermal temperature-pressure profile, alongside corresponding equilibrium chemical abundances for 117 observationally significant hot exoplanets (equilibrium temperatures of 547-2710 K). This model grid has been developed using a 1D radiative-convective-chemical equilibrium model termed ATMO, with up-to-date high-temperature opacities. We present an interpretation of observations of 10 exoplanets, including best-fitting parameters and χ2 maps. In agreement with previous works, we find a continuum from clear to hazy/cloudy atmospheres for this sample of hot Jupiters. The data for all the 10 planets are consistent with subsolar to solar C/O ratio, 0.005 to 10 times solar metallicity and water rather than methane-dominated infrared spectra. We then explore the range of simulated atmospheric spectra for different exoplanets, based on characteristics such as temperature, metallicity, C/O ratio, haziness and cloudiness. We find a transition value for the metallicity between 10 and 50 times solar, which leads to substantial changes in the transmission spectra. We also find a transition value of C/O ratio, from water to carbon species dominated infrared spectra, as found by previous works, revealing a temperature dependence of this transition point ranging from ˜0.56 to ˜1-1.3 for equilibrium temperatures from ˜900 to ˜2600 K. We highlight the potential of the spectral features of HCN and C2H2 to constrain the metallicities and C/O ratios of planets, using James Webb Space Telescope (JWST) observations. Finally, our entire grid (˜460 000 simulations) is publicly available and can be used directly with the JWST simulator PandExo for planning observations.
Interfacial phonon scattering and transmission loss in >1 μm thick silicon-on-insulator thin films
NASA Astrophysics Data System (ADS)
Jiang, Puqing; Lindsay, Lucas; Huang, Xi; Koh, Yee Kan
2018-05-01
Scattering of phonons at boundaries of a crystal (grains, surfaces, or solid/solid interfaces) is characterized by the phonon wavelength, the angle of incidence, and the interface roughness, as historically evaluated using a specularity parameter p formulated by Ziman [Electrons and Phonons (Clarendon Press, Oxford, 1960)]. This parameter was initially defined to determine the probability of a phonon specularly reflecting or diffusely scattering from the rough surface of a material. The validity of Ziman's theory as extended to solid/solid interfaces has not been previously validated. To better understand the interfacial scattering of phonons and to test the validity of Ziman's theory, we precisely measured the in-plane thermal conductivity of a series of Si films in silicon-on-insulator (SOI) wafers by time-domain thermoreflectance (TDTR) for a Si film thickness range of 1-10 μm and a temperature range of 100-300 K. The Si /SiO2 interface roughness was determined to be 0.11 ±0.04 nm using transmission electron microscopy (TEM). Furthermore, we compared our in-plane thermal conductivity measurements to theoretical calculations that combine first-principles phonon transport with Ziman's theory. Calculations using Ziman's specularity parameter significantly overestimate values from the TDTR measurements. We attribute this discrepancy to phonon transmission through the solid/solid interface into the substrate, which is not accounted for by Ziman's theory for surfaces. The phonons that are specularly transmitted into an amorphous layer will be sufficiently randomized by the time they come back to the crystalline Si layer, the effect of which is practically equivalent to a diffuse reflection at the interface. We derive a simple expression for the specularity parameter at solid/amorphous interfaces and achieve good agreement between calculations and measurement values.
Revisiting Trypanosoma rangeli Transmission Involving Susceptible and Non-Susceptible Hosts
Ferreira, Luciana de Lima; Pereira, Marcos Horácio; Guarneri, Alessandra Aparecida
2015-01-01
Trypanosoma rangeli infects several triatomine and mammal species in South America. Its transmission is known to occur when a healthy insect feeds on an infected mammal or when an infected insect bites a healthy mammal. In the present study we evaluated the classic way of T. rangeli transmission started by the bite of a single infected triatomine, as well as alternative ways of circulation of this parasite among invertebrate hosts. The number of metacyclic trypomastigotes eliminated from salivary glands during a blood meal was quantified for unfed and recently fed nymphs. The quantification showed that ~50,000 parasites can be liberated during a single blood meal. The transmission of T. rangeli from mice to R. prolixus was evaluated using infections started through the bite of a single infected nymph. The mice that served as the blood source for single infected nymphs showed a high percentage of infection and efficiently transmitted the infection to new insects. Parasites were recovered by xenodiagnosis in insects fed on mice with infections that lasted approximately four months. Hemolymphagy and co-feeding were tested to evaluate insect-insect T. rangeli transmission. T. rangeli was not transmitted during hemolymphagy. However, insects that had co-fed on mice with infected conspecifics exhibited infection rates of approximately 80%. Surprisingly, 16% of the recipient nymphs became infected when pigeons were used as hosts. Our results show that T. rangeli is efficiently transmitted between the evaluated hosts. Not only are the insect-mouse-insect transmission rates high, but parasites can also be transmitted between insects while co-feeding on a living host. We show for the first time that birds can be part of the T. rangeli transmission cycle as we proved that insect-insect transmission is feasible during a co-feeding on these hosts. PMID:26469403
NASA Astrophysics Data System (ADS)
Fang, Longjie; Zhang, Xicheng; Zuo, Haoyi; Pang, Lin; Yang, Zuogang; Du, Jinglei
2018-06-01
A method of selecting appropriate singular values of the transmission matrix to improve the precision of incident wavefront retrieval in focusing light through scattering media is proposed. The optimal singular values selected by this method can reduce the degree of ill-conditionedness of the transmission matrix effectively, which indicates that the incident wavefront retrieved from the optimal set of singular values is more accurate than the incident wavefront retrieved from other sets of singular values. The validity of this method is verified by numerical simulation and actual measurements of the incident wavefront of coherent light through ground glass.
NASA Astrophysics Data System (ADS)
George, Richard J.
1992-01-01
Hydraulic properties of deeply weathered basement rocks and variably weathered sedimentary materials were measured by pumping and slug-test methods. Results from over 200 bores in 13 catchments, and eight pumping-test sites across the eastern and central wheatbelt of Western Australia were analysed. Measurements were made in each of the major lithological units, and emphasis placed on a ubiquitous basal saprolite aquifer. Comparisons were made between alternative drilling and analytical procedures to determine the most appropriate methods of investigation. Aquifers with an average hydraulic conductivity of 0.55 m day -1 occur in variably weathered Cainozoic sediments and poorly weathered saprolite grits (0.57 m day -1). These aquifers are separated by an aquitard (0.065 m day -1) comprising the mottled and pallid zones of the deeply weathered profile. Locally higher values of hydraulic conductivity occur in the saprolite aquifer, although after prolonged periods of pumping the values decrease until they are similar to those obtained from the slug-test methods. Hydraulic conductivities measured in bores drilled with rotary auger rigs were approximately an order of magnitude lower than those measured in the same material with bores drilled by the rotary air-blast method. Wheatbelt aquifers range from predominantly unconfined (Cainozoic sediments), to confined (saprolite grit aquifer). The poorly weathered saprolite grit aquifer has moderate to high transmissivities (4-50 m 2 day -1) and is capable of producing from less than 5 to over 230 kl day -1 of ground water, which is often of a quality suitable for livestock. Yields are influenced by the variability in the permeability of isovolumetrically weathered materials from which the aquifer is derived. The overlying aquitard has a low transmissivity (< 1 m 2 day -1), especially when deeply weathered, indurated and silicified. The transmissivity of the variably weathered sedimentary materials ranges from less than 0.5 m 2 day -1 to over 10 m 2 day -1, depending on the texture of the materials and their position within the landscape. Higher transmissivity zones may occur as discrete layers of coarser textured materials. The salinity of the saprolite and sedimentary aquifers ranges from less than 2000 mgl -1 to greater than 250000 mgl -1 (total dissolved solids; TDS), depending on position within the landscape. Secondary soil salinization develops when groundwater discharge occurs from either saprolite or sedimentary aquifers.
Effects of mean flow on transmission loss of orthogonally rib-stiffened aeroelastic plates.
Xin, F X; Lu, T J
2013-06-01
This paper investigates the sound transmission loss (STL) of aeroelastic plates reinforced by two sets of orthogonal rib-stiffeners in the presence of external mean flow. Built upon the periodicity of the structure, a comprehensive theoretical model is developed by considering the convection effect of mean flow. The rib-stiffeners are modeled by employing the Bernoulli-Euler beam theory and the torsional wave equation. While the solution for the transmission loss of the structure based on plate displacement and acoustic pressures is given in the form of space-harmonic series, the corresponding coefficients are obtained from the solution of a system of linear equations derived from the plate-beam coupling vibration governing equation and Helmholtz equation. The model predictions are validated by comparing with existing theoretical and experimental results in the absence of mean flow. A parametric study is subsequently performed to quantify the effects of mean flow as well as structure geometrical parameters upon the transmission loss. It is demonstrated that the transmission loss of periodically rib-stiffened structure is increased significantly with increasing Mach number of mean flow over a wide frequency range. The STL value for the case of sound wave incident downstream is pronouncedly larger than that associated with sound wave incident upstream.
Short-range airborne transmission of expiratory droplets between two people.
Liu, L; Li, Y; Nielsen, P V; Wei, J; Jensen, R L
2017-03-01
The occurrence of close proximity infection for many respiratory diseases is often cited as evidence of large droplet and/or close contact transmission. We explored interpersonal exposure of exhaled droplets and droplet nuclei of two standing thermal manikins as affected by distance, humidity, ventilation, and breathing mode. Under the specific set of conditions studied, we found a substantial increase in airborne exposure to droplet nuclei exhaled by the source manikin when a susceptible manikin is within about 1.5 m of the source manikin, referred to as the proximity effect. The threshold distance of about 1.5 m distinguishes the two basic transmission processes of droplets and droplet nuclei, that is, short-range modes and the long-range airborne route. The short-range modes include both the conventional large droplet route and the newly defined short-range airborne transmission. We thus reveal that transmission occurring in close proximity to the source patient includes both droplet-borne (large droplet) and short-range airborne routes, in addition to the direct deposition of large droplets on other body surfaces. The mechanisms of the droplet-borne and short-range airborne routes are different; their effective control methods also differ. Neither the current droplet precautions nor dilution ventilation prevents short-range airborne transmission, so new control methods are needed. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Evaluation of the effects of electric fields on implanted cardiac pacemakers. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moss, A.J.; Carstensen, E.
1985-02-01
The effects of extra high voltage (EHV) transmission line electric fields on pacemaker function were evaluated in 11 patients with seven different implanted pacemaker models from four manufacturers. Alteration in pacemaker function was demonstrated in five unipolar units (three different models) from two manufacturers during exposure to electric fields ranging from 2 to 9 kV/m, with total body currents from 47 to 175 ..mu..A. These electric fields and body currents are representative of values that can be encountered by individuals standing beneath EHV transmission lines. Transient alterations in pacemaker function observed in this study included inappropriate triggered activity, inhibition ofmore » impulse generation, reduction in rate, and reversion from demand to asynchronous mode. Electromagnetic interference from high voltage transmission lines can induce alterations in pacemaker function in certain designs of these devices. However, pacemaker manufacturers can incorporate appropriate circuits in the pacemaker design to eliminate this problem. 8 references.« less
Lei, Chengxin; Chen, Leyi; Tang, Zhixiong; Li, Daoyong; Cheng, Zhenzhi; Tang, Shaolong; Du, Youwei
2016-02-15
The properties of optics and magneto-optical Faraday effects in a metal-dielectric tri-layer structure with subwavelength rectangular annular arrays are investigated. It is noteworthy that we obtained the strongly enhanced Faraday rotation of the desired sign along with high transmittance by optimizing the parameters of the nanostructure in the visible spectral ranges. In this system, we obtained two extraordinary optical transmission (EOT) resonant peaks with enhanced Faraday rotations, whose signs are opposite, which may provide the possibility of designing multi-channel magneto-optical devices. Study results show that the maximum of the figure of merit (FOM) of the structure can be obtained between two EOT resonant peaks accompanied by an enhanced Faraday rotation. The positions of the maximum value of the FOM and resonant peaks of transmission along with a large Faraday rotation can be tailored by simply adjusting the geometric parameters of our models. These research findings are of great importance for future applications of magneto-optical devices.
Russier, Marion; Yang, Guohua; Marinova-Petkova, Atanaska; Vogel, Peter; Kaplan, Bryan S; Webby, Richard J; Russell, Charles J
2017-03-01
A pandemic-capable influenza virus requires a hemagglutinin (HA) surface glycoprotein that is immunologically unseen by most people and is capable of supporting replication and transmission in humans. HA stabilization has been linked to 2009 pH1N1 pandemic potential in humans and H5N1 airborne transmissibility in the ferret model. Swine have served as an intermediate host for zoonotic influenza viruses, yet the evolutionary pressure exerted by this host on HA stability was unknown. For over 70 contemporary swine H1 and H3 isolates, we measured HA activation pH to range from pH 5.1 to 5.9 for H1 viruses and pH 5.3 to 5.8 for H3 viruses. Thus, contemporary swine isolates vary widely in HA stability, having values favored by both avian (pH >5.5) and human and ferret (pH ≤5.5) species. Using an early 2009 pandemic H1N1 (pH1N1) virus backbone, we generated three viruses differing by one HA residue that only altered HA stability: WT (pH 5.5), HA1-Y17H (pH 6.0), and HA2-R106K (pH 5.3). All three replicated in pigs and transmitted from pig-to-pig and pig-to-ferret. WT and R106 viruses maintained HA genotype and phenotype after transmission. Y17H (pH 6.0) acquired HA mutations that stabilized the HA protein to pH 5.8 after transmission to pigs and 5.5 after transmission to ferrets. Overall, we found swine support a broad range of HA activation pH for contact transmission and many recent swine H1N1 and H3N2 isolates have stabilized (human-like) HA proteins. This constitutes a heightened pandemic risk and underscores the importance of ongoing surveillance and control efforts for swine viruses.
Yang, Guohua; Marinova-Petkova, Atanaska; Kaplan, Bryan S.; Webby, Richard J.
2017-01-01
A pandemic-capable influenza virus requires a hemagglutinin (HA) surface glycoprotein that is immunologically unseen by most people and is capable of supporting replication and transmission in humans. HA stabilization has been linked to 2009 pH1N1 pandemic potential in humans and H5N1 airborne transmissibility in the ferret model. Swine have served as an intermediate host for zoonotic influenza viruses, yet the evolutionary pressure exerted by this host on HA stability was unknown. For over 70 contemporary swine H1 and H3 isolates, we measured HA activation pH to range from pH 5.1 to 5.9 for H1 viruses and pH 5.3 to 5.8 for H3 viruses. Thus, contemporary swine isolates vary widely in HA stability, having values favored by both avian (pH >5.5) and human and ferret (pH ≤5.5) species. Using an early 2009 pandemic H1N1 (pH1N1) virus backbone, we generated three viruses differing by one HA residue that only altered HA stability: WT (pH 5.5), HA1-Y17H (pH 6.0), and HA2-R106K (pH 5.3). All three replicated in pigs and transmitted from pig-to-pig and pig-to-ferret. WT and R106 viruses maintained HA genotype and phenotype after transmission. Y17H (pH 6.0) acquired HA mutations that stabilized the HA protein to pH 5.8 after transmission to pigs and 5.5 after transmission to ferrets. Overall, we found swine support a broad range of HA activation pH for contact transmission and many recent swine H1N1 and H3N2 isolates have stabilized (human-like) HA proteins. This constitutes a heightened pandemic risk and underscores the importance of ongoing surveillance and control efforts for swine viruses. PMID:28282440
Johansen, Elisabeth Ida; Simon, Vincent; Jacquemond, Mireille; Senoussi, Rachid
2014-01-01
The effective size of populations (Ne) determines whether selection or genetic drift is the predominant force shaping their genetic structure and evolution. Populations having high Ne adapt faster, as selection acts more intensely, than populations having low Ne, where random effects of genetic drift dominate. Estimating Ne for various steps of plant virus life cycle has been the focus of several studies in the last decade, but no estimates are available for the vertical transmission of plant viruses, although virus seed transmission is economically significant in at least 18% of plant viruses in at least one plant species. Here we study the co-dynamics of two variants of Pea seedborne mosaic virus (PSbMV) colonizing leaves of pea plants (Pisum sativum L.) during the whole flowering period, and their subsequent transmission to plant progeny through seeds. Whereas classical estimators of Ne could be used for leaf infection at the systemic level, as virus variants were equally competitive, dedicated stochastic models were needed to estimate Ne during vertical transmission. Very little genetic drift was observed during the infection of apical leaves, with Ne values ranging from 59 to 216. In contrast, a very drastic genetic drift was observed during vertical transmission, with an average number of infectious virus particles contributing to the infection of a seedling from an infected mother plant close to one. A simple model of vertical transmission, assuming a cumulative action of virus infectious particles and a virus density threshold required for vertical transmission to occur fitted the experimental data very satisfactorily. This study reveals that vertically-transmitted viruses endure bottlenecks as narrow as those imposed by horizontal transmission. These bottlenecks are likely to slow down virus adaptation and could decrease virus fitness and virulence. PMID:24415934
NASA Astrophysics Data System (ADS)
El Khakani, My A.; Gat, E.; Beaudoin, Yves; Chaker, Mohamed; Monteil, C.; Guay, Daniel; Letourneau, G.; Pepin, Henri
1995-04-01
Laser ablation deposition technique was used to deposit silicon carbide thin films on both Si(100) and quartz substrates. The deposition was accomplished by ablating SiC sintered ceramic targets, using a KrF (248 nm) excimer laser. At a laser intensity of about 1 X 109 W/cm2, substrate temperatures in the (25-700) degree(s)C range were investigated. When the deposition temperature is varied from 27 to 650 degree(s)C, (i) the density of a-SiC films increases from 2.6 to 3.0 g cm-3, while their mean roughness value (for a film thickness of about 1 micrometers ) slightly changes from 0.44 to 0.5 nm; (ii) the optical transmission of a-SiC films is significantly improved (the absorption coefficient at 632.8 nm wavelength was reduced by a factor of about 5); and (iii) their Si-C bond density, as determined by FTIR spectroscopy, increases from (13.1 +/- 1.3) to (23.4 +/- 2.4) 1022 bond cm-3. The increased number of Si-C bonds is correlated to the increase of the optical transmission. Over all the investigated deposition temperature range, the a-SiC films were found to be under high compressive stress around a mean value of about 1.26 GPa. The control of the stress of a-SiC films was achieved by means of post- thermal annealings and the annealed a-SiC films were successfully used to fabricate x-ray membranes.
ERIC Educational Resources Information Center
Gniewosz, Burkhard; Noack, Peter
2012-01-01
The present study investigates the intergenerational transmission of the valuing of math within family. We tested if there are groups of students showing differential intergenerational transmission patterns. Based on a two-wave longitudinal sample of 1198 German fifth graders, their mothers (N = 874), and fathers (N = 733), structural equation…
Giant dielectric permittivity in interrupted silver nanowires grown within mesoporous silica
NASA Astrophysics Data System (ADS)
Maity, Anupam; Samanta, Subha; Chatterjee, Soumi; Maiti, Ramaprasad; Biswas, Debasish; Saha, Shyamal K.; Chakravorty, Dipankar
2018-06-01
Nanoglasses in the system Ag2O–SiO2 were formed within the pores of mesoporous silica SBA-15 (Santa Barbara Amorphous). Silver nanowires of diameter 5 nm were grown within SBA-15 by the process of electrodeposition. The nanowires were disrupted by applying a suitable voltage pulse. Detailed transmission and scanning electron microscopy studies were carried out. The disrupted silver strands were found to have an average length of 90 nm. The density of interrupted strands was estimated from the electron micrographs and found to have values in the range (10–20) × 1010 cm‑2. Dielectric constant and dielectric loss factors of the nanocomposites of disrupted silver strand—containing Ag2O–SiO2 glass and SBA-15 were found to have values in the range 200–300 and 0.014–0.008 respectively at frequencies in the range 10 kHz–2 MHz. These values were found to be in satisfactory agreement with the theoretical model of Rice and Bernasconi emanating from the theory of Gorkhov and Eliashberg. These nanocomposites are expected to be useful in the fabrication of supercapacitors, after developing suitable electrode system for the material.
Higher Education and the Transmission of Educational Values in Today's Society.
ERIC Educational Resources Information Center
Escobar-Ortloff, Luz; Ortloff, Warren G.
Education has traditionally been the primary method of passing on a society's culture and the values it considers to be important. Higher education institutions have not been immune to the crises in the transmission of values. Typically, in higher education basic intellectual values and virtues are mostly left for students to pick up through…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delice, S., E-mail: sdelice@metu.edu.tr; Isik, M.; Gasanly, N.M.
2015-10-15
Highlights: • Optical and thermoluminescence properties of Ga{sub 4}S{sub 3}Se crystals were investigated. • Indirect and direct band gap energies were found as 2.39 and 2.53 eV, respectively. • The activation energy of the trap center was determined as 495 meV. - Abstract: Optical and thermoluminescence properties on GaS{sub 0.75}Se{sub 0.25} crystals were investigated in the present work. Transmission and reflection measurements were performed at room temperature in the wavelength range of 400–1000 nm. Analysis revealed the presence of indirect and direct transitions with band gap energies of 2.39 and 2.53 eV, respectively. TL spectra obtained at low temperatures (10–300more » K) exhibited one peak having maximum temperature of 168 K. Observed peak was analyzed using curve fitting, initial rise and peak shape methods to calculate the activation energy of the associated trap center. All applied methods were consistent with the value of 495 meV. Attempt-to-escape-frequency and capture cross section of the trap center were determined using the results of curve fitting. Heating rate dependence studies of the glow curve in the range of 0.4–0.8 K/s resulted with decrease of TL intensity and shift of the peak maximum temperature to higher values.« less
Gupta, Manoj; Gupta, T C
2017-10-01
The present study aims to accurately estimate inertial, physical, and dynamic parameters of human body vibratory model consistent with physical structure of the human body that also replicates its dynamic response. A 13 degree-of-freedom (DOF) lumped parameter model for standing person subjected to support excitation is established. Model parameters are determined from anthropometric measurements, uniform mass density, elastic modulus of individual body segments, and modal damping ratios. Elastic moduli of ellipsoidal body segments are initially estimated by comparing stiffness of spring elements, calculated from a detailed scheme, and values available in literature for same. These values are further optimized by minimizing difference between theoretically calculated platform-to-head transmissibility ratio (TR) and experimental measurements. Modal damping ratios are estimated from experimental transmissibility response using two dominant peaks in the frequency range of 0-25 Hz. From comparison between dynamic response determined form modal analysis and experimental results, a set of elastic moduli for different segments of human body and a novel scheme to determine modal damping ratios from TR plots, are established. Acceptable match between transmissibility values calculated from the vibratory model and experimental measurements for 50th percentile U.S. male, except at very low frequencies, establishes the human body model developed. Also, reasonable agreement obtained between theoretical response curve and experimental response envelop for average Indian male, affirms the technique used for constructing vibratory model of a standing person. Present work attempts to develop effective technique for constructing subject specific damped vibratory model based on its physical measurements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tojo, H., E-mail: tojo.hiroshi@qst.go.jp; Hiratsuka, J.; Yatsuka, E.
2016-09-15
This paper evaluates the accuracy of electron temperature measurements and relative transmissivities of double-pass Thomson scattering diagnostics. The electron temperature (T{sub e}) is obtained from the ratio of signals from a double-pass scattering system, then relative transmissivities are calculated from the measured T{sub e} and intensity of the signals. How accurate the values are depends on the electron temperature (T{sub e}) and scattering angle (θ), and therefore the accuracy of the values was evaluated experimentally using the Large Helical Device (LHD) and the Tokyo spherical tokamak-2 (TST-2). Analyzing the data from the TST-2 indicates that a high T{sub e} andmore » a large scattering angle (θ) yield accurate values. Indeed, the errors for scattering angle θ = 135° are approximately half of those for θ = 115°. The method of determining the T{sub e} in a wide T{sub e} range spanning over two orders of magnitude (0.01–1.5 keV) was validated using the experimental results of the LHD and TST-2. A simple method to provide relative transmissivities, which include inputs from collection optics, vacuum window, optical fibers, and polychromators, is also presented. The relative errors were less than approximately 10%. Numerical simulations also indicate that the T{sub e} measurements are valid under harsh radiation conditions. This method to obtain T{sub e} can be considered for the design of Thomson scattering systems where there is high-performance plasma that generates harsh radiation environments.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fahr, H. J.; Krimigis, S. M.; Fichtner, H.
The study addresses the question of the origin of low-energy electrons measured by Voyager 1 in the multi-keV range in the inner heliosheath. It intends to demonstrate that the observed keV-fluxes of electrons are consistent with their transmission through the termination shock under the influence of the associated electrostatic field. A power-law representation of the electron velocity distribution just downstream of the solar wind termination shock is motivated and formulated in terms of a so-called κ -distribution function. From this initial function spectral electron fluxes in the range 40–70 keV are derived and compared to the data. It is shownmore » that with κ -values between 7 and 8 the data can be satisfactorily explained. Given these comparatively high κ -values, it is concluded that the electron distribution just downstream of the termination shock relaxes toward but does not reach a Maxwellian shape in the inner heliosheath.« less
Synthesis and characterization of nano-hydroxyapatite in maltodextrin matrix
NASA Astrophysics Data System (ADS)
Phan, Bich T. N.; Nguyen, Hanh T.; Đao, Huong Q.; Pham, Lam V.; Quan, Trang T. T.; Nguyen, Duong B.; Nguyen, Huong T. L.; Vu, Thuan T.
2017-02-01
In this study, we report the direct precipitation of nano-HA in the present of maltodextrins with the different dextrose equivalent (DE) values in the range of 10-30. Characterization of the obtained samples, using X-ray diffraction and Fourier transform infrared spectrophotometry, indicated that the presence of maltodextrins, with the different DE values, does not affect the phase composition and structure of the obtained composites. Morphology studies of the samples, using field emission scanning electron microscope and transmission electron microscope, revealed that maltodextrin has obvious effect on the size, shape, and morphology of hydroxyapatite nanoparticles. In particular, in studied DE range, maltodextrin DE 28-30 with dominant structure of debranched chain is the most preferable choice to obtain the composite with highly dispersed nanoparticles. In vitro assay on pre-osteoblast MC3T3-E1 cells demonstrated the ability of the composites to stimulate alkaline phosphatase activity and mineralization during differentiation of the cells.
Modelling the Wind-Borne Spread of Highly Pathogenic Avian Influenza Virus between Farms
Ssematimba, Amos; Hagenaars, Thomas J.; de Jong, Mart C. M.
2012-01-01
A quantitative understanding of the spread of contaminated farm dust between locations is a prerequisite for obtaining much-needed insight into one of the possible mechanisms of disease spread between farms. Here, we develop a model to calculate the quantity of contaminated farm-dust particles deposited at various locations downwind of a source farm and apply the model to assess the possible contribution of the wind-borne route to the transmission of Highly Pathogenic Avian Influenza virus (HPAI) during the 2003 epidemic in the Netherlands. The model is obtained from a Gaussian Plume Model by incorporating the dust deposition process, pathogen decay, and a model for the infection process on exposed farms. Using poultry- and avian influenza-specific parameter values we calculate the distance-dependent probability of between-farm transmission by this route. A comparison between the transmission risk pattern predicted by the model and the pattern observed during the 2003 epidemic reveals that the wind-borne route alone is insufficient to explain the observations although it could contribute substantially to the spread over short distance ranges, for example, explaining 24% of the transmission over distances up to 25 km. PMID:22348042
Modelling the wind-borne spread of highly pathogenic avian influenza virus between farms.
Ssematimba, Amos; Hagenaars, Thomas J; de Jong, Mart C M
2012-01-01
A quantitative understanding of the spread of contaminated farm dust between locations is a prerequisite for obtaining much-needed insight into one of the possible mechanisms of disease spread between farms. Here, we develop a model to calculate the quantity of contaminated farm-dust particles deposited at various locations downwind of a source farm and apply the model to assess the possible contribution of the wind-borne route to the transmission of Highly Pathogenic Avian Influenza virus (HPAI) during the 2003 epidemic in the Netherlands. The model is obtained from a Gaussian Plume Model by incorporating the dust deposition process, pathogen decay, and a model for the infection process on exposed farms. Using poultry- and avian influenza-specific parameter values we calculate the distance-dependent probability of between-farm transmission by this route. A comparison between the transmission risk pattern predicted by the model and the pattern observed during the 2003 epidemic reveals that the wind-borne route alone is insufficient to explain the observations although it could contribute substantially to the spread over short distance ranges, for example, explaining 24% of the transmission over distances up to 25 km.
NASA Astrophysics Data System (ADS)
Jiang, N.; Deguchi, M.; Wang, C. L.; Won, J. H.; Jeon, H. M.; Mori, Y.; Hatta, A.; Kitabatake, M.; Ito, T.; Hirao, T.; Sasaki, T.; Hiraki, A.
1997-04-01
A transmission electron microscope (TEM) study of ion-implanted chemical-vapor-deposited (CVD) diamond is presented. CVD diamond used for transmission electron microscope observation was directly deposited onto Mo TEM grids. As-deposited specimens were irradiated by C (100 keV) ions at room temperature with a wide range of implantation doses (10 12-10 17/cm 2). Transmission electron diffraction (TED) patterns indicate that there exists a critical dose ( Dc) for the onset of amorphization of CVD diamond as a result of ion induced damage and the value of critical dose is confirmed to be about 3 × 10 15/cm 2. The ion-induced transformation process is clearly revealed by high resolution electron microscope (HREM) images. For a higher dose implantation (7 × 10 15/cm 2) a large amount of diamond phase is transformed into amorphous carbon and many tiny misoriented diamond blocks are found to be left in the amorphous solid. The average size of these misoriented diamond blocks is only about 1-2 nm. Further bombardment (10 17/cm 2) almost kills all of the diamond phase within the irradiated volume and moreover leads to local formation of micropolycrystalline graphite.
Burger, C; Goerres, G; Schoenes, S; Buck, A; Lonn, A H R; Von Schulthess, G K
2002-07-01
The CT data acquired in combined PET/CT studies provide a fast and essentially noiseless source for the correction of photon attenuation in PET emission data. To this end, the CT values relating to attenuation of photons in the range of 40-140 keV must be transformed into linear attenuation coefficients at the PET energy of 511 keV. As attenuation depends on photon energy and the absorbing material, an accurate theoretical relation cannot be devised. The transformation implemented in the Discovery LS PET/CT scanner (GE Medical Systems, Milwaukee, Wis.) uses a bilinear function based on the attenuation of water and cortical bone at the CT and PET energies. The purpose of this study was to compare this transformation with experimental CT values and corresponding PET attenuation coefficients. In 14 patients, quantitative PET attenuation maps were calculated from germanium-68 transmission scans, and resolution-matched CT images were generated. A total of 114 volumes of interest were defined and the average PET attenuation coefficients and CT values measured. From the CT values the predicted PET attenuation coefficients were calculated using the bilinear transformation. When the transformation was based on the narrow-beam attenuation coefficient of water at 511 keV (0.096 cm(-1)), the predicted attenuation coefficients were higher in soft tissue than the measured values. This bias was reduced by replacing 0.096 cm(-1) in the transformation by the linear attenuation coefficient of 0.093 cm(-1) obtained from germanium-68 transmission scans. An analysis of the corrected emission activities shows that the resulting transformation is essentially equivalent to the transmission-based attenuation correction for human tissue. For non-human material, however, it may assign inaccurate attenuation coefficients which will also affect the correction in neighbouring tissue.
Prompt increase of ultrashort laser pulse transmission through thin silver films
NASA Astrophysics Data System (ADS)
Bezhanov, S. G.; Danilov, P. A.; Klekovkin, A. V.; Kudryashov, S. I.; Rudenko, A. A.; Uryupin, S. A.
2018-03-01
We study experimentally and numerically the increase in ultrashort laser pulse transmissivity through thin silver films caused by the heating of electrons. Low to moderate energy femtosecond laser pulse transmission measurements through 40-125 nm thickness silver films were carried out. We compare the experimental data with the values of transmitted fraction of energy obtained by solving the equations for the field together with the two-temperature model. The measured values were fitted with sufficient accuracy by varying the electron-electron collision frequency whose exact values are usually poorly known. Since transmissivity experiences more pronounced changes with the increase in temperature compared to reflectivity, we suggest this technique for studying the properties of nonequilibrium metals.
Small passenger car transmission test-Chevrolet 200 transmission
NASA Technical Reports Server (NTRS)
Bujold, M. P.
1980-01-01
The small passenger car transmission was tested to supply electric vehicle manufacturers with technical information regarding the performance of commerically available transmissions which would enable them to design a more energy efficient vehicle. With this information the manufacturers could estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. A 1979 Chevrolet Model 200 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. The transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. Torque, speed and efficiency curves map the complete performance characteristics for Chevrolet Model 200 transmission.
A short-range optical wireless transmission method based on LED
NASA Astrophysics Data System (ADS)
Miao, Meiyuan; Chen, Ailin; Zhu, Mingxing; Li, Ping; Gao, Yingming; Zou, Nianyu
2016-10-01
As to electromagnetic wave interfere and only one to one transmission problem of Bluetooth, a short-range LED optical wireless transmission method is proposed to be complementary technology in this paper. Furthermore achieved image transmission through this method. The system makes C52 to be the mater controller, transmitter got data from terminals by USB and sends modulated signals with LED. Optical signal is detected by PD, through amplified, filtered with shaping wave from, and demodulated on receiver. Then send to terminals like PC and reverted back to original image. Analysis the performance from peak power and average power, power consumption of transmitter, relationship of bit error rate and modulation mode, and influence of ambient light, respectively. The results shows that image can be received accurately which uses this method. The most distant transmission distance can get to 1m with transmitter LED source of 1w, and the transfer rate is 14.4Kbit/s with OOK modulation mode on stabilization system, the ambient light effect little to LED transmission system in normal light environment. The method is a convenient to carry LED wireless short range transmission for mobile transmission equipment as a supplement of Bluetooth short-range transmission for its ISM band interfere, and the analysis method in this paper can be a reference for other similar systems. It also proves the system is feasibility for next study.
ERIC Educational Resources Information Center
Boehnke, Klaus
2001-01-01
Puts intrafamilial value transmission into a societal context, using data from a study of university student-parents triads to show why a unified research approach is necessary. All conservation values were more important to the parents than the offspring, while the reverse was found for self-transcendence versus self-enhancement values. (SM)
NASA Astrophysics Data System (ADS)
Shi, Fan; Lowe, Mike; Craster, Richard
2017-06-01
Elastic waves scattered by random rough interfaces separating two distinct media play an important role in modeling phonon scattering and impact upon thermal transport models, and are also integral to ultrasonic inspection. We introduce theoretical formulas for the diffuse field of elastic waves scattered by, and transmitted across, random rough solid-solid interfaces using the elastodynamic Kirchhoff approximation. The new formulas are validated by comparison with numerical Monte Carlo simulations, for a wide range of roughness (rms σ ≤λ /3 , correlation length λ0≥ wavelength λ ), demonstrating a significant improvement over the widely used small-perturbation approach, which is valid only for surfaces with small rms values. Physical analysis using the theoretical formulas derived here demonstrates that increasing the rms value leads to a considerable change of the scattering patterns for each mode. The roughness has different effects on the reflection and the transmission, with a strong dependence on the material properties. In the special case of a perfect match of the wave speed of the two solid media, the transmission is the same as the case for a flat interface. We pay particular attention to scattering in the specular direction, often used as an observable quantity, in terms of the roughness parameters, showing a peak at an intermediate value of rms; this rms value coincides with that predicted by the Rayleigh parameter.
Summary of studies on the blue-green autofluorescence and light transmission of the ocular lens
NASA Astrophysics Data System (ADS)
Van Best, Jaap A.; Kuppens, Esmeralda V.
1996-07-01
This paper reviews previous work done to demonstrate the clinical relevance of the measurement of blue-green autofluorescence and light transmission of the ocular lens. These can be determined quantitatively with fluorophotometry in a few seconds. Autofluorescence and transmission values are determined in healthy volunteers, in patients with insulin-dependent diabetes mellitus, and in patients with untreated glaucoma or untreated ocular hypertension. The lens autofluorescence of healthy volunteers increased linearly and transmission decreased exponentially with age. Each year of diabetes induced an increase of autofluorescence equal to one extra year of age. Untreated glaucoma or ocular hypertension had no significant effect on lens autofluorescence and transmission. Increased autofluorescence and decreased transmission values in comparison with values of a healthy population are proved to be indicative for an increased risk of developing cataract and the clinical usefulness of these measures is demonstrated. Diabetes is a risk factor for developing cataracts while untreated glaucoma or ocular hypertension is not.
NASA Technical Reports Server (NTRS)
Bhasin, K. B.; Warner, J. D.; Miranda, F. A.; Gordon, W. L.; Newman, H. S.
1991-01-01
A novel waveguide power transmission measurement technique was developed to extract the complex conductivity of superconducting thin films at microwave frequencies. The microwave conductivity was taken of two laser ablated YBa2Cu3O(7-delta) thin films on LaAlO3 with transition temperatures of approximately 86.3 and 82 K, respectively, in the temperature range 25 to 300 K. From the conductivity values, the penetration depth was found to be approximately 0.54 and 0.43 micron, and the surface resistance (R sub s) to be approximately 24 and 36 micro-Ohms at 36 GHz and 76 K for the two films under consideration. The R sub s values were compared with those obtained from the change in the Q-factor of a 36 GHz Te sub 011-mode (OFHC) copper cavity by replacing one of its end walls with the superconducting sample. This technique allows noninvasive characterization of high transition superconducting thin films at microwave frequencies.
Structural and optical properties of GaxIn1-xP layers grown by chemical beam epitaxy
NASA Astrophysics Data System (ADS)
Seong, Tae-Yeon; Yang, Jung-Ja; Ryu, Mee Yi; Song, Jong-In; Yu, Phil W.
1998-05-01
Chemical beam epitaxial (CBE) GaxIn1-xP layers (x≈0.5) grown on (001) GaAs substrates at temperatures ranging from 490 to 580°C have been investigated using transmission electron diffraction (TED), transmission electron microscopy, and photoluminescence (PL). TED examination revealed the presence of diffuse scattering 1/2{111}B positions, indicating the occurrence of typical CuPt-type ordering in the GaInP CBE layers. As the growth temperature decreased from 580 to 490°C, maxima in the intensity of the diffuse scattering moved from ½{111}B to ½{-1+δ,1-δ,0} positions, where δ is a positive value. As the growth temperature increased from 490 to 550°C, the maxima in the diffuse scattering intensity progressively approached positions of 1/2\\{bar 110\\} , i.e., the value of δ decreased from 0.25 to 0.17. Bandgap reduction (˜45 meV) was observed in the CBE GaInP layers and was attributed to the presence of ordered structures.
NASA Technical Reports Server (NTRS)
Bhasin, K. B.; Warner, J. D.; Miranda, F. A.; Gordon, W. L.; Newman, H. S.
1990-01-01
A novel waveguide power transmission measurement technique was developed to extract the complex conductivity of superconducting thin films at microwave frequencies. The microwave conductivity was taken of two laser ablated YBa2Cu3O(7-delta) thin films on LaAlO3 with transition temperatures of approx. 86.3 and 82 K, respectively, in the temperature range 25 to 300 K. From the conductivity values, the penetration depth was found to be approx. 0.54 and 0.43 micron, and the surface resistance (R sub s) to be approx. 24 and 36 micro-Ohms at 36 GHz and 76 K for the two films under consideration. The R sub s values were compared with those obtained from the change in the Q-factor of a 36 GHz Te sub 011-mode (OFHC) copper cavity by replacing one of its end walls with the superconducting sample. This technique allows noninvasive characterization of high transition temperature superconducting thin films at microwave frequencies.
Recovery of stranded costs under electric deregulation: The Winstar doctrine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Person, J.C.
This paper explores the applicability of the Winstar doctrine to the recovery of stranded costs arising from the deregulation of the electric utility industry. Such stranded costs, which have been widely estimated to be in the $100--200 billion range, represent those utility assets whose book value exceed their market value. Not addressed in this paper are the ongoing state and federal legislative initiatives to allow for the recovery of some or all of a utility`s stranded costs, such as through the assessment of competitive transmission charges (CTCs) or through stranded cost securitization. Rather, this paper presents one of several ofmore » legal arguments that could be utilized in those situations where a legislative solution either does not exist or does not allow for full book value recovery.« less
Mercer, Jerry W.
1983-01-01
Geohydrologic data have been collected in the Los Medanos area at the U.S. Department of Energy 's proposed Waste Isolation Pilot Plant (WIPP) site in southeastern New Mexico since 1975 as part of an intensive study evaluating the feasibility of storing defense-associated nuclear wastes within the bedded salt of the Salado Formation of Permian age. Drilling and hydrologic testing have identified three principal water-producing zones above the salt, including the Rustler-Salado Formational contact and the Culebra and Magenta Dolomite Members of the Permian Rustler Formation. Below the bedded salt there is another water-bearing zone, the channel sandstones of the Bell Canyon formation of the Permian Delaware Mountain Group. Most data collected from 33 hydrologic test holes indicate that the water-bearing zones are characterized by low transmissivities and contain slightly saline to briny water. Data collected from drill-stem tests in the Bell Canyon Formation indicate the channel sandstones have hydraulic conductivities ranging from 0.02 to 0.36 feet per day grade vertically and laterally into siltstones and shales of very low permeability. The Rustler Formation contains the principal water-producing zones identified at the WIPP site. The Rustler-Salado formational contact has the least transmissivity, ranging from 0.00003 to 0.003 feet squared per day. The Culebra Dolomite is the most productive unit at the WIPP site with transmissivities ranging from 0.001 to 73 feet squared per day; the greater values result from fracturing in the dolomite created by dissolution of underlying halite. Minute vertical permeabilities prevent movement of water between hydrologic units. (USGS)
Elimination of Onchocerciasis from Mexico.
Rodríguez-Pérez, Mario A; Fernández-Santos, Nadia A; Orozco-Algarra, María E; Rodríguez-Atanacio, José A; Domínguez-Vázquez, Alfredo; Rodríguez-Morales, Kristel B; Real-Najarro, Olga; Prado-Velasco, Francisco G; Cupp, Eddie W; Richards, Frank O; Hassan, Hassan K; González-Roldán, Jesús F; Kuri-Morales, Pablo A; Unnasch, Thomas R
2015-01-01
Mexico is one of the six countries formerly endemic for onchocerciasis in Latin America. Transmission has been interrupted in the three endemic foci of that country and mass drug distribution has ceased. Three years after mass drug distribution ended, post-treatment surveillance (PTS) surveys were undertaken which employed entomological indicators to check for transmission recrudescence. In-depth entomologic assessments were performed in 18 communities in the three endemic foci of Mexico. None of the 108,212 Simulium ochraceum s.l. collected from the three foci were found to contain parasite DNA when tested by polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA), resulting in a maximum upper bound of the 95% confidence interval (95%-ULCI) of the infective rate in the vectors of 0.035/2,000 flies examined. This is an order of magnitude below the threshold of a 95%-ULCI of less than one infective fly per 2,000 flies tested, the current entomological criterion for interruption of transmission developed by the international community. The point estimate of seasonal transmission potential (STP) was zero, and the upper bound of the 95% confidence interval for the STP ranged from 1.2 to 1.7 L3/person/season in the different foci. This value is below all previous estimates for the minimum transmission potential required to maintain the parasite population. The results from the in-depth entomological post treatment surveillance surveys strongly suggest that transmission has not resumed in the three foci of Mexico during the three years since the last distribution of ivermectin occurred; it was concluded that transmission remains undetectable without intervention, and Onchocerca volvulus has been eliminated from Mexico.
Reflections on the value of electron microscopy in the study of heterogeneous catalysts
2017-01-01
Electron microscopy (EM) is arguably the single most powerful method of characterizing heterogeneous catalysts. Irrespective of whether they are bulk and multiphasic, or monophasic and monocrystalline, or nanocluster and even single-atom and on a support, their structures in atomic detail can be visualized in two or three dimensions, thanks to high-resolution instruments, with sub-Ångstrom spatial resolutions. Their topography, tomography, phase-purity, composition, as well as the bonding, and valence-states of their constituent atoms and ions and, in favourable circumstances, the short-range and long-range atomic order and dynamics of the catalytically active sites, can all be retrieved by the panoply of variants of modern EM. The latter embrace electron crystallography, rotation and precession electron diffraction, X-ray emission and high-resolution electron energy-loss spectra (EELS). Aberration-corrected (AC) transmission (TEM) and scanning transmission electron microscopy (STEM) have led to a revolution in structure determination. Environmental EM is already playing an increasing role in catalyst characterization, and new advances, involving special cells for the study of solid catalysts in contact with liquid reactants, have recently been deployed. PMID:28265196
Transfer matrix method for four-flux radiative transfer.
Slovick, Brian; Flom, Zachary; Zipp, Lucas; Krishnamurthy, Srini
2017-07-20
We develop a transfer matrix method for four-flux radiative transfer, which is ideally suited for studying transport through multiple scattering layers. The model predicts the specular and diffuse reflection and transmission of multilayer composite films, including interface reflections, for diffuse or collimated incidence. For spherical particles in the diffusion approximation, we derive closed-form expressions for the matrix coefficients and show remarkable agreement with numerical Monte Carlo simulations for a range of absorption values and film thicknesses, and for an example multilayer slab.
The potential economic value of screening hospital admissions for Clostridium difficile.
Bartsch, S M; Curry, S R; Harrison, L H; Lee, B Y
2012-11-01
Asymptomatic Clostridium difficile carriage has a prevalence reported as high as 51-85 %; with up to 84 % of incident hospital-acquired infections linked to carriers. Accurately identifying carriers may limit the spread of Clostridium difficile. Since new technology adoption depends heavily on its economic value, we developed an analytic simulation model to determine the cost-effectiveness screening hospital admissions for Clostridium difficile from the hospital and third party payer perspectives. Isolation precautions were applied to patients testing positive, preventing transmission. Sensitivity analyses varied Clostridium difficile colonization rate, infection probability among secondary cases, contact isolation compliance, and screening cost. Screening was cost-effective (i.e., incremental cost-effectiveness ratio [ICER] ≤ $50,000/QALY) for every scenario tested; all ICER values were ≤ $256/QALY. Screening was economically dominant (i.e., saved costs and provided health benefits) with a ≥10.3 % colonization rate and ≥5.88 % infection probability when contact isolation compliance was ≥25 % (hospital perspective). Under some conditions screening led to cost savings per case averted (range, $53-272). Clostridium difficile screening, coupled with isolation precautions, may be a cost-effective intervention to hospitals and third party payers, based on prevalence. Limiting Clostridium difficile transmission can reduce the number of infections, thereby reducing its economic burden to the healthcare system.
NASA Astrophysics Data System (ADS)
Nesic, M.; Popovic, M.; Rabasovic, M.; Milicevic, D.; Suljovrujic, E.; Markushev, D.; Stojanovic, Z.
2018-02-01
In this work, thermal diffusivity of crystalline high-density polyethylene samples of various thickness, and prepared using different procedures, was evaluated by transmission gas-microphone frequency photoacoustics. The samples' composition analysis and their degree of crystallinity were determined from the wide-angle X-ray diffraction, which confirmed that high-density polyethylene samples, obtained by slow and fast cooling, were equivalent in composition but with different degrees of crystallinity. Structural analysis, performed by differential scanning calorimetry, demonstrated that all of the used samples had different levels of crystallinity, depending not only on the preparing procedure, but also on sample thickness. Therefore, in order to evaluate the samples' thermal diffusivity, it was necessary to modify standard photoacoustic fitting procedures (based on the normalization of photoacoustic amplitude and phase characteristics on two thickness levels) for the interpretation of photoacoustic measurements. The calculated values of thermal diffusivity were in the range of the expected literature values. Besides that, the obtained results indicate the unexpected correlation between the values of thermal diffusivity and thermal conductivity with the degree of crystallinity of the investigated geometrically thin samples. The results indicate the necessity of additional investigation of energy transport in macromolecular systems, as well as the possible employment of the photoacoustic techniques in order to clarify its mechanism.
The Potential Economic Value of Screening Hospital Admissions for Clostridium difficile
Bartsch, Sarah M.; Curry, Scott R.; Harrison, Lee H.; Lee, Bruce Y.
2012-01-01
Purpose Asymptomatic Clostridium difficile carriage has a prevalence reported as high as 51% to 85%; with up to 84% of incident hospital-acquired infections linked to carriers. Accurately identifying carriers may limit the spread of Clostridium difficile. Methods Since new technology adoption depends heavily on its economic value, we developed a analytic simulation model to determine the cost-effectiveness screening hospital admissions for Clostridium difficile from the hospital and third party payer perspectives. Isolation precautions were applied to patients testing positive, preventing transmission. Sensitivity analyses varied Clostridium difficile colonization rate, infection probability among secondary cases, contact isolation compliance, and screening cost. Results Screening was cost-effective [i.e., incremental cost-effectiveness ratio (ICER) ≤$50,000/QALY] for every scenario tested; all ICER values ≤$256/QALY. Screening was economically dominant (i.e., saved costs and provided health benefits) with a ≥10.3% colonization rate and ≥5.88% infection probability when contact isolation compliance was ≥25% (hospital perspective). Under some conditions screening led to cost-savings per case averted (range: $53 to $272). Conclusion Clostridium difficile screening, coupled with isolation precautions, may be a cost-effective intervention to hospitals and third party payers, based on prevalence. Limiting Clostridium difficile transmission can reduce the number of infections, thereby reducing its economic burden to the healthcare system. PMID:22752150
NASA Astrophysics Data System (ADS)
Nikolov, A. S.; Balchev, I. I.; Nedyalkov, N. N.; Kostadinov, I. K.; Karashanova, D. B.; Atanasova, G. B.
2017-11-01
Nanostructures of noble metal were produced by pulsed laser ablation in liquid. A solid Ag target was immersed in double distilled water and a CuBr laser in a master oscillator—power amplifier configuration oscillating at 511 nm and emitting pulses with duration of 30 ns at a repetition rate of up to 20 kHz was employed to produce different colloids. The impact was studied of the laser pulse repetition rate and the beam scanning speed on the morphology of the nanostructures formed. Further, the optical extinction spectra of the colloids in the UV/VIS range were measured and used to make an indirect assessment of the changes in the shape and size distribution of the nanostructures. The transmission values in the near UV range were used to estimate the efficiency of the ablation process under the different experimental conditions implemented. A visualization of the nanostructures was made possible by transmission electron microscopy (TEM). The structure and phase composition of the nanoparticles were studied by high-resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED), while the alteration of the target surface caused by the impact of the high-repetition-rate laser illumination was investigated by X-ray photoelectron spectroscopy (XPS). The optimal conditions were determined yielding the highest efficiency in terms of amount of ablated material.
Free space optical communication based on pulsed lasers
NASA Astrophysics Data System (ADS)
Drozd, Tadeusz; Mierczyk, Zygmunt; Zygmunt, Marek; Wojtanowski, Jacek
2016-12-01
Most of the current optical data transmission systems are based on continuous wave (cw) lasers. It results from the tendency to increase data transmission speed, and from the simplicity in implementation (straightforward modulation). Pulsed lasers, which find many applications in a variety of industrial, medical and military systems, in this field are not common. Depending on the type, pulsed lasers can generate instantaneous power which is many times greater when compared with cw lasers. As such, they seem to be very attractive to be used in data transmission technology, especially due to the potentially larger ranges of transmission, or in adverse atmospheric conditions where low power cw-lasersbased transmission is no longer feasible. It is also a very practical idea to implement data transmission capability in the pulsed laser devices that have been around and already used, increasing the functionality of this type of equipment. At the Institute of Optoelectronics at Military University of Technology, a unique method of data transmission based on pulsed laser radiation has been developed. This method is discussed in the paper in terms of both data transmission speed and transmission range. Additionally, in order to verify the theoretical assumptions, modules for voice and data transmission were developed and practically tested which is also reported, including the measurements of Bit Error Rate (BER) and performance vs. range analysis.
NASA Technical Reports Server (NTRS)
Morin, Cory; Monaghan, Andrew; Quattrochi, Dale; Crosson, William; Hayden, Mary; Ernst, Kacey
2015-01-01
Dengue fever is a mosquito-borne viral disease reemerging throughout much of the tropical Americas. Dengue virus transmission is explicitly influenced by climate and the environment through its primary vector, Aedes aegypti. Temperature regulates Ae. aegypti development, survival, and replication rates as well as the incubation period of the virus within the mosquito. Precipitation provides water for many of the preferred breeding habitats of the mosquito, including buckets, old tires, and other places water can collect. Although transmission regularly occurs along the border region in Mexico, dengue virus transmission in bordering Arizona has not occurred. Using NASA's TRMM (Tropical Rainfall Measuring Mission) satellite for precipitation input and Daymet for temperature and supplemental precipitation input, we modeled dengue transmission along a US-Mexico transect using a dynamic dengue transmission model that includes interacting vector ecology and epidemiological components. Model runs were performed for 5 cities in Sonora, Mexico and southern Arizona. Employing a Monte Carlo approach, we performed ensembles of several thousands of model simulations in order to resolve the model uncertainty arising from using different combinations of parameter values that are not well known. For cities with reported dengue case data, the top model simulations that best reproduced dengue case numbers were retained and their parameter values were extracted for comparison. These parameter values were used to run simulations in areas where dengue virus transmission does not occur or where dengue fever case data was unavailable. Additional model runs were performed to reveal how changes in climate or parameter values could alter transmission risk along the transect. The relative influence of climate variability and model parameters on dengue virus transmission is assessed to help public health workers prepare location specific infection prevention strategies.
Mountford, P J
1990-11-01
The suitability of 75 sunglasses for use by patients receiving 8-methoxypsoralen photochemotherapy (PUVA) was assessed by measuring their ultraviolet radiation (UVR) transmission spectra and comparing the results with some published proposed spectral limits. The sunglasses were classified according to whether their lenses were polarised, photochromic, reflective, graduated tint or of a miscellaneous type. The UVR transmission of 39 of these sunglasses was also measured using a PUVA source and a UVA sensitive detector. There was a difference of a factor of x7 between the maximum PUVA source transmission of the sunglasses with satisfactory spectral transmission and the minimum PUVA source transmission of those with unsatisfactory spectral transmission. Values of PUVA source transmission values corresponding to hypothetical transmission spectra close to the spectral limits were derived by calculation. It was concluded that photochromic sunglasses could be rejected for patient use without recourse to measurement unless they were claimed to have low UVR transmission, and that the transmission of all other types had to be assessed individually. It was also concluded that the PUVA source method could be adopted for routine use with a maximum acceptable transmission of 0.2%.
Fellet, Maria Raquel; Lorenzo, Marcelo Gustavo; Elliot, Simon Luke; Carrasco, David; Guarneri, Alessandra Aparecida
2014-01-01
The insect Rhodnius prolixus is responsible for the transmission of Trypanosoma cruzi, which is the etiological agent of Chagas disease in areas of Central and South America. Besides this, it can be infected by other trypanosomes such as Trypanosoma rangeli. The effects of these parasites on vectors are poorly understood and are often controversial so here we focussed on possible negative effects of these parasites on the reproductive performance of R. prolixus, specifically comparing infected and uninfected couples. While T. cruzi infection did not delay pre-oviposition time of infected couples at either temperature tested (25 and 30°C) it did, at 25°C, increase the e-value in the second reproductive cycle, as well as hatching rates. Meanwhile, at 30°C, T. cruzi infection decreased the e-value of insects during the first cycle and also the fertility of older insects. When couples were instead infected with T. rangeli, pre-oviposition time was delayed, while reductions in the e-value and hatching rate were observed in the second and third cycles. We conclude that both T. cruzi and T. rangeli can impair reproductive performance of R. prolixus, although for T. cruzi, this is dependent on rearing temperature and insect age. We discuss these reproductive costs in terms of potential consequences on triatomine behavior and survival.
Surveying colloid sedimentation by coplanar waveguides
NASA Astrophysics Data System (ADS)
Duţu, C. A.; Vlad, A.; Roda-Neve, C.; Avram, I.; Sandu, G.; Raskin, J.-P.; Melinte, S.
2016-06-01
By using coplanar waveguides, direct access to the dielectric properties of aqueous solutions of polystyrene beads with different diameters from 330 nm to 10 μm is provided. The relative variation of the transmission parameter with respect to water is monitored, ranging from ˜ {3}% obtained for a 9.5% solution with 330 nm diameter beads to ˜22% for 10 μm diameter particles at the same concentration. To highlight its applicability in biosensing, the technique was further employed to survey the clustering between biotin and streptavidin-coated beads. The transmission parameter displays a ˜50% increase for mixtures containing nine volumes of biotin and one volume of streptavidin-modified beads (4.5 ng μl-1 of streptavidin) and reaches ˜400% higher values when equal volumes of biotin and streptavidin-coated beads (22.5 ng μl-1 of streptavidin) were mixed.
Electroencephalographic compression based on modulated filter banks and wavelet transform.
Bazán-Prieto, Carlos; Cárdenas-Barrera, Julián; Blanco-Velasco, Manuel; Cruz-Roldán, Fernando
2011-01-01
Due to the large volume of information generated in an electroencephalographic (EEG) study, compression is needed for storage, processing or transmission for analysis. In this paper we evaluate and compare two lossy compression techniques applied to EEG signals. It compares the performance of compression schemes with decomposition by filter banks or wavelet Packets transformation, seeking the best value for compression, best quality and more efficient real time implementation. Due to specific properties of EEG signals, we propose a quantization stage adapted to the dynamic range of each band, looking for higher quality. The results show that the compressor with filter bank performs better than transform methods. Quantization adapted to the dynamic range significantly enhances the quality.
NASA Astrophysics Data System (ADS)
von Korff Schmising, Clemens; Weder, David; Noll, Tino; Pfau, Bastian; Hennecke, Martin; Strüber, Christian; Radu, Ilie; Schneider, Michael; Staeck, Steffen; Günther, Christian M.; Lüning, Jan; Merhe, Alaa el dine; Buck, Jens; Hartmann, Gregor; Viefhaus, Jens; Treusch, Rolf; Eisebitt, Stefan
2017-05-01
A new device for polarization control at the free electron laser facility FLASH1 at DESY has been commissioned for user operation. The polarizer is based on phase retardation upon reflection off metallic mirrors. Its performance is characterized in three independent measurements and confirms the theoretical predictions of efficient and broadband generation of circularly polarized radiation in the extreme ultraviolet spectral range from 35 eV to 90 eV. The degree of circular polarization reaches up to 90% while maintaining high total transmission values exceeding 30%. The simple design of the device allows straightforward alignment for user operation and rapid switching between left and right circularly polarized radiation.
USDA-ARS?s Scientific Manuscript database
In this study we investigated the host range, transmission and symptom development of TVCV in several species of plants, as a step toward developing management strategy against seed transmissible viruses. While several species of plants failed to show symptoms of TVCV infection, we report that bush ...
Attenuation of thermal neutrons by an imperfect single crystal
NASA Astrophysics Data System (ADS)
Naguib, K.; Adib, M.
1996-06-01
A semi-empirical formula is given which allows one to calculate the total thermal cross section of an imperfect single crystal as a function of crystal constants, temperature and neutron energy E, in the energy range between 3 meV and 10 eV. The formula also includes the contribution of the parasitic Bragg scattering to the total cross section that takes into account the crystal mosaic spread value and its orientation with respect to the neutron beam direction. A computer program (ISCANF) was developed to calculate the total attenuation of neutrons using the proposed formula. The ISCANF program was applied to investigate the neutron attenuation through a copper single crystal. The calculated values of the neutron transmission through the imperfect copper single crystal were fitted to the measured ones in the energy range 3 - 40 meV at different crystal orientations. The result of fitting shows that use of the computer program ISCANF allows one to predict the behaviour of the total cross section of an imperfect copper single crystal for the whole energy range.
Rioux, Maxime; Ledemi, Yannick; Morency, Steeve; de Lima Filho, Elton Soares; Messaddeq, Younès
2017-03-03
In recent years, the fabrication of multifunctional fibers has expanded for multiple applications that require the transmission of both light and electricity. Fibers featuring these two properties are usually composed either of a single material that supports the different characteristics or of a combination of different materials. In this work, we fabricated (i) novel single-core step-index optical fibers made of electrically conductive AgI-AgPO 3 -WO 3 glass and (ii) novel multimaterial fibers with different designs made of AgI-AgPO 3 -WO 3 glass and optically transparent polycarbonate and poly (methyl methacrylate) polymers. The multifunctional fibers produced show light transmission over a wide range of wavelengths from 500 to 1000 nm for the single-core fibers and from 400 to 1000 nm for the multimaterial fibers. Furthermore, these fibers showed excellent electrical conductivity with values ranging between 10 -3 and 10 -1 S·cm -1 at room temperature within the range of AC frequencies from 1 Hz to 1 MHz. Multimodal taper-tipped fibre microprobes were then fabricated and were characterized. This advanced design could provide promising tools for in vivo electrophysiological experiments that require light delivery through an optical core in addition to neuronal activity recording.
Rioux, Maxime; Ledemi, Yannick; Morency, Steeve; de Lima Filho, Elton Soares; Messaddeq, Younès
2017-01-01
In recent years, the fabrication of multifunctional fibers has expanded for multiple applications that require the transmission of both light and electricity. Fibers featuring these two properties are usually composed either of a single material that supports the different characteristics or of a combination of different materials. In this work, we fabricated (i) novel single-core step-index optical fibers made of electrically conductive AgI-AgPO3-WO3 glass and (ii) novel multimaterial fibers with different designs made of AgI-AgPO3-WO3 glass and optically transparent polycarbonate and poly (methyl methacrylate) polymers. The multifunctional fibers produced show light transmission over a wide range of wavelengths from 500 to 1000 nm for the single-core fibers and from 400 to 1000 nm for the multimaterial fibers. Furthermore, these fibers showed excellent electrical conductivity with values ranging between 10−3 and 10−1 S·cm−1 at room temperature within the range of AC frequencies from 1 Hz to 1 MHz. Multimodal taper-tipped fibre microprobes were then fabricated and were characterized. This advanced design could provide promising tools for in vivo electrophysiological experiments that require light delivery through an optical core in addition to neuronal activity recording. PMID:28256608
Reciprocal relations for transmission coefficients - Theory and application
NASA Technical Reports Server (NTRS)
Qu, Jianmin; Achenbach, Jan D.; Roberts, Ronald A.
1989-01-01
The authors present a rigorous proof of certain intuitively plausible reciprocal relations for time harmonic plane-wave transmission and reflection at the interface between a fluid and an anisotropic elastic solid. Precise forms of the reciprocity relations for the transmission coefficients and for the transmitted energy fluxes are derived, based on the reciprocity theorem of elastodynamics. It is shown that the reciprocity relations can be used in conjunction with measured values of peak amplitudes for transmission through a slab of the solid (water-solid-water) to obtain the water-solid coefficients. Experiments were performed for a slab of a unidirectional fiber-reinforced composite. Good agreement of the experimentally measured transmission coefficients with theoretical values was obtained.
The measurement of the transmission loss of single leaf walls and panels by an impulse method
NASA Astrophysics Data System (ADS)
Balilah, Y. A.; Gibbs, B. M.
1988-06-01
The standard methods of measurement and rating of sound insulation of panels and walls are generally time-consuming and require expensive and often bulky equipment. In addition, the methods establish only that there has been failure to comply with insulation requirements without indicating the mode of failure. An impulse technique is proposed for the measurement of walls and partitions in situ. The method requires the digital capture of a short duration signal generated by a loudspeaker, and the isolation of the direct component from other reflected and scattered components by time-of-flight methods and windowing. The signal, when transferred from the time to frequency domain by means of fast Fourier transforms, can yield the sound insulation of a partition expressed as a transfer function. Experimental problems in the use of this technique, including those resulting from sphericity of the incident wave front and concentric bending excitation of the partition, are identified and methods proposed for their elimination. Most of the results presented are of single leaf panels subjected to sound at normal incidence, although some measurements were undertaken at oblique incidence. The range of surface densities considered was 7-500 kg/m 2, the highest value corresponding to a brick and plaster wall of thickness 285 mm. Measurement is compared with theoretical prediction, at one-third octave intervals in a frequency range of 100-5000 Hz, or as a continuous function of frequency with a typical resolution of 12·5 Hz. The dynamic range of the measurement equipment sets an upper limit to the measurable transmission loss. For the equipment eventually employed this was represented by a random incidence value of 50 dB.
Felzen, Marc; Brokmann, Jörg C; Beckers, Stefan K; Czaplik, Michael; Hirsch, Frederik; Tamm, Miriam; Rossaint, Rolf; Bergrath, Sebastian
2017-04-01
Introduction Telemedical concepts in emergency medical services (EMS) lead to improved process times and patient outcomes, but their technical performance has thus far been insufficient; nevertheless, the concept was transferred into EMS routine care in Aachen, Germany. This study evaluated the system's technical performance and compared it to a precursor system. Methods The telemedicine system was implemented on seven ambulances and a teleconsultation centre staffed with experienced EMS physicians was established in April 2014. Telemedical applications included mobile vital data, 12-lead, picture transmission and video streaming from inside the ambulances. The tele-EMS physician filled in a questionnaire regarding the technical performance of the applications, background noise and assessed clinical values of the transmitted pictures and videos after each mission between 15 May 2014-15 October 2014. Results Teleconsultation was established during 539 emergency cases. In 83% of the cases ( n = 447), only the paramedics and the tele-EMS physician were involved. Transmission success rates ranged from 98% (audio connection) to 93% (12-lead electrocardiogram (ECG) transmission). All functionalities, except video transmission, were significantly better than the pilot project ( p < 0.05). Severe background noise was detected to a lesser extent ( p = 0.0004) and the clinical value of the pictures and videos were considered significantly more valuable. Discussion The multifunctional system is now sufficient for routine use and is the most reliable mobile emergency telemedicine system compared to other published projects. Dropouts were due to user errors and network coverage problems. These findings enable widespread use of this system in the future, reducing the critical time intervals until medical therapy is started.
Offset Compound Gear Inline Two-Speed Drive
NASA Technical Reports Server (NTRS)
Stevens, Mark A. (Inventor); Handschuh, Robert F. (Inventor); Lewicki, David G. (Inventor)
2012-01-01
A two-speed transmission having an input shaft and an output shaft, the transmission being capable of transitioning between fixed ratios, the high-range ratio being direct 1:1 and the low-range ratio being about 2:1. The transmission is a simple lightweight, yet robust, configuration utilizing only two gear meshes, being comprised of an input gear, a cluster gear, and an output gear. The transmission is controlled with a clutch and a sprag and with the input and output shafts turning in the same direction.
Offset Compound Gear Inline Two-Speed Drive
NASA Technical Reports Server (NTRS)
Stevens, Mark A. (Inventor); Handschuh, Robert F. (Inventor); Lewicki, David G. (Inventor)
2014-01-01
A two-speed transmission having an input shaft and an output shaft, the transmission being capable of transitioning between fixed ratios, the high-range ratio being direct 1:1 and the low-range ratio being about 2:1. The transmission is a simple lightweight, yet robust, configuration utilizing only two gear meshes, being comprised of an input gear, a cluster gear, and an output gear. The transmission is controlled with a clutch and a sprag and with the input and output shafts turning in the same direction.
Iglesias, I; Muñoz, M J; Montes, F; Perez, A; Gogin, A; Kolbasov, D; de la Torre, A
2016-12-01
African swine fever (ASF) has caused the swine industry of the Russian Federation substantial economic losses over the last 7 years, and the disease spread from there to a number of neighbouring countries. Wild boar has been involved in the spread of the disease both at local and at transboundary levels. Understanding ASF dynamics in wild boars is prerequisite to preventing the spread and to designing and applying effective surveillance and control plans. The reproductive ratio (R 0 ) is an epidemiological indicator commonly used to quantify the extent of disease spread. Here, it was estimated in nine spatio-temporal clusters of ASF in wild boar cases in the Russian Federation (2007-2013). Clusters were defined by exploring the maximum distance of association of ASF cases using K Ripley analysis and spatio-temporal scan statistics. A maximum spatial association of 133 km in wild boar cases was identified which is within de the conventional radius of surveillance zone (100-150 km). The mean range value of R 0 = 1.58 (1.13-3.77) was lower compared to values previously estimated for ASF transmission within farms but similar to early estimates between farm (R 0 = 2-3), in domestic pigs using notification data in the Russian Federation. Results obtained provide quantitative knowledge on the epidemiology of ASF in wild boars in the Russian Federation. They identify the ASF transmission rate value in affected natural wild populations, for the first time, which could provide basis for modelling ASF transmission and suggest that current surveillance radius should be reviewed to make surveillance in wild nature more targeted and effective. © 2015 Blackwell Verlag GmbH.
Valuation of Electric Power System Services and Technologies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kintner-Meyer, Michael C. W.; Homer, Juliet S.; Balducci, Patrick J.
Accurate valuation of existing and new technologies and grid services has been recognized to be important to stimulate investment in grid modernization. Clear, transparent, and accepted methods for estimating the total value (i.e., total benefits minus cost) of grid technologies and services are necessary for decision makers to make informed decisions. This applies to home owners interested in distributed energy technologies, as well as to service providers offering new demand response services, and utility executives evaluating best investment strategies to meet their service obligation. However, current valuation methods lack consistency, methodological rigor, and often the capabilities to identify and quantifymore » multiple benefits of grid assets or new and innovative services. Distributed grid assets often have multiple benefits that are difficult to quantify because of the locational context in which they operate. The value is temporally, operationally, and spatially specific. It varies widely by distribution systems, transmission network topology, and the composition of the generation mix. The Electric Power Research Institute (EPRI) recently established a benefit-cost framework that proposes a process for estimating multiple benefits of distributed energy resources (DERs) and the associated cost. This document proposes an extension of this endeavor that offers a generalizable framework for valuation that quantifies the broad set of values for a wide range of technologies (including energy efficiency options, distributed resources, transmission, and generation) as well as policy options that affect all aspects of the entire generation and delivery system of the electricity infrastructure. The extension includes a comprehensive valuation framework of monetizable and non-monetizable benefits of new technologies and services beyond the traditional reliability objectives. The benefits are characterized into the following categories: sustainability, affordability, and security, flexibility, and resilience. This document defines the elements of a generic valuation framework and process as well as system properties and metrics by which value streams can be derived. The valuation process can be applied to determine the value on the margin of incremental system changes. This process is typically performed when estimating the value of a particular project (e.g., value of a merchant generator, or a distributed photovoltaic (PV) rooftop installation). Alternatively, the framework can be used when a widespread change in the grid operation, generation mix, or transmission topology is to be valued. In this case a comprehensive system analysis is required.« less
Sound transmission loss of composite sandwich panels
NASA Astrophysics Data System (ADS)
Zhou, Ran
Light composite sandwich panels are increasingly used in automobiles, ships and aircraft, because of the advantages they offer of high strength-to-weight ratios. However, the acoustical properties of these light and stiff structures can be less desirable than those of equivalent metal panels. These undesirable properties can lead to high interior noise levels. A number of researchers have studied the acoustical properties of honeycomb and foam sandwich panels. Not much work, however, has been carried out on foam-filled honeycomb sandwich panels. In this dissertation, governing equations for the forced vibration of asymmetric sandwich panels are developed. An analytical expression for modal densities of symmetric sandwich panels is derived from a sixth-order governing equation. A boundary element analysis model for the sound transmission loss of symmetric sandwich panels is proposed. Measurements of the modal density, total loss factor, radiation loss factor, and sound transmission loss of foam-filled honeycomb sandwich panels with different configurations and thicknesses are presented. Comparisons between the predicted sound transmission loss values obtained from wave impedance analysis, statistical energy analysis, boundary element analysis, and experimental values are presented. The wave impedance analysis model provides accurate predictions of sound transmission loss for the thin foam-filled honeycomb sandwich panels at frequencies above their first resonance frequencies. The predictions from the statistical energy analysis model are in better agreement with the experimental transmission loss values of the sandwich panels when the measured radiation loss factor values near coincidence are used instead of the theoretical values for single-layer panels. The proposed boundary element analysis model provides more accurate predictions of sound transmission loss for the thick foam-filled honeycomb sandwich panels than either the wave impedance analysis model or the statistical energy analysis model.
NASA Astrophysics Data System (ADS)
Gibbs, M.; Oughton, E. J.; Hapgood, M. A.
2017-12-01
The socio-economic impacts of space weather have been under-researched, despite this threat featuring on the UK's National Risk Register. In this paper, a range of Realistic Disaster Scenarios due to failure in electricity transmission infrastructure are tested. We use regional Geomagnetically Induced Current (GIC) studies to identify areas in the UK high-voltage power system deemed to be high-risk. The potential level of disruption arising from a large geomagnetic disturbance in these `hot spots' on local economic activity is explored. Electricity is a necessary factor of production without which businesses cannot operate, so even short term power loss can cause significant loss of value. We utilise a spatially disaggregated approach that focuses on quantifying employment disruption by industrial sector, and relating this to direct Gross Value Added loss. We then aggregate this direct loss into a set of shocks to undertake macroeconomic modelling of different scenarios, to obtain the total economic impact which includes both direct and indirect supply chain disruption effects. These results are reported for a range of temporal periods, with the minimum increment being a one-hour blackout. This work furthers our understanding of the economic impacts of space weather, and can inform future reviews of the UK's National Risk Register. The key contribution of the paper is that the results can be used in the future cost-benefit analysis of investment in space weather forecasting.
NASA Astrophysics Data System (ADS)
Das, Anindya Sundar; Kuiri, Probodh Kumar; Patra, Ardhendu Sekhar
2015-06-01
In this paper a novel architecture has been proposed and developed for full-duplex transmission of 80 channel CATV signal over 80 km single mode fiber (SMF) using various techniques such as mutually injection locking, optical carrier suppression (OCS) and remodulation etc. The up/downlink transmission performances are observed by the low bit error rate (BER) values and impressive eye diagrams. The satisfactory values of CNR, CBT and CSO verify the successful transmission of CATV signals through our proposed configuration.
ERIC Educational Resources Information Center
Gniewosz, Burkhard; Noack, Peter
2012-01-01
The present research addresses processes involved in academic value transmission within family. Drawing on expectancy x value and social learning theory, a two-wave longitudinal study based on data from 1014 students, 878 mothers, and 748 fathers was conducted to examine the mechanisms of parental influence. Structural equation modeling provided…
Universal Faraday Rotation in HgTe Wells with Critical Thickness.
Shuvaev, A; Dziom, V; Kvon, Z D; Mikhailov, N N; Pimenov, A
2016-09-09
The universal value of the Faraday rotation angle close to the fine structure constant (α≈1/137) is experimentally observed in thin HgTe quantum wells with a thickness on the border between trivial insulating and the topologically nontrivial Dirac phases. The quantized value of the Faraday angle remains robust in the broad range of magnetic fields and gate voltages. Dynamic Hall conductivity of the holelike carriers extracted from the analysis of the transmission data shows a theoretically predicted universal value of σ_{xy}=e^{2}/h, which is consistent with the doubly degenerate Dirac state. On shifting the Fermi level by the gate voltage, the effective sign of the charge carriers changes from positive (holes) to negative (electrons). The electronlike part of the dynamic response does not show quantum plateaus and is well described within the classical Drude model.
Design for a broad non-transmission band gap of three-color filters using photonic heterostructures
NASA Astrophysics Data System (ADS)
Li, Hongfei; Guan, Huihuan; Han, Peide; Li, Yuping; Zhang, Caili
2013-01-01
The bandgap characteristics of one-dimensional (1D) photonic crystal (PC) heterostructures containing defects are studied using the transfer matrix method. The key is to search for the best combination style for different 1D PCs to form heterostructures containing Si/MgF2 multilayer films. The non-transmission range over the entire visible range can be enlarged substantially, and the phenomenon of three-color PC filters in blue-green-red light can be realized by adjusting the repeat cycle counts of various PCs. With perfect omnidirectional and high peak transmission three-color filters for the electric magnetic (TE) mode, this optimization design opens a promising way to fabricate three-color PC filters with a wide non-transmission range in the visible range, which can be applied to white LEDs.
Masbruch, Melissa D.; Gardner, Philip M.; Brooks, Lynette E.
2014-01-01
Snake Valley and surrounding areas, along the Utah-Nevada state border, are part of the Great Basin carbonate and alluvial aquifer system. The groundwater system in the study area consists of water in unconsolidated deposits in basins and water in consolidated rock underlying the basins and in the adjacent mountain blocks. Most recharge occurs from precipitation on the mountain blocks and most discharge occurs from the lower altitude basin-fill deposits mainly as evapotranspiration, springflow, and well withdrawals.The Snake Valley area regional groundwater system was simulated using a three-dimensional model incorporating both groundwater flow and heat transport. The model was constructed with MODFLOW-2000, a version of the U.S. Geological Survey’s groundwater flow model, and MT3DMS, a transport model that simulates advection, dispersion, and chemical reactions of solutes or heat in groundwater systems. Observations of groundwater discharge by evapotranspiration, springflow, mountain stream base flow, and well withdrawals; groundwater-level altitudes; and groundwater temperatures were used to calibrate the model. Parameter values estimated by regression analyses were reasonable and within the range of expected values.This study represents one of the first regional modeling efforts to include calibration to groundwater temperature data. The inclusion of temperature observations reduced parameter uncertainty, in some cases quite significantly, over using just water-level altitude and discharge observations. Of the 39 parameters used to simulate horizontal hydraulic conductivity, uncertainty on 11 of these parameters was reduced to one order of magnitude or less. Other significant reductions in parameter uncertainty occurred in parameters representing the vertical anisotropy ratio, drain and river conductance, recharge rates, and well withdrawal rates.The model provides a good representation of the groundwater system. Simulated water-level altitudes range over almost 2,000 meters (m); 98 percent of the simulated values of water-level altitudes in wells are within 30 m of observed water-level altitudes, and 58 percent of them are within 12 m. Nineteen of 20 simulated discharges are within 30 percent of observed discharge. Eighty-one percent of the simulated values of groundwater temperatures in wells are within 2 degrees Celsius (°C) of the observed values, and 55 percent of them are within 0.75 °C. The numerical model represents a more robust quantification of groundwater budget components than previous studies because the model integrates all components of the groundwater budget. The model also incorporates new data including (1) a detailed hydrogeologic framework, and (2) more observations, including several new water-level altitudes throughout the study area, several new measurements of spring discharge within Snake Valley which had not previously been monitored, and groundwater temperature data. Uncertainty in the estimates of subsurface flow are less than those of previous studies because the model balanced recharge and discharge across the entire simulated area, not just in each hydrographic area, and because of the large dataset of observations (water-level altitudes, discharge, and temperatures) used to calibrate the model and the resulting transmissivity distribution.Groundwater recharge from precipitation and unconsumed irrigation in Snake Valley is 160,000 acre-feet per year (acre-ft/yr), which is within the range of previous estimates. Subsurface inflow from southern Spring Valley to southern Snake Valley is 13,000 acre-ft/yr and is within the range of previous estimates; subsurface inflow from Spring Valley to Snake Valley north of the Snake Range, however, is only 2,200 acre-ft/yr, which is much less than has been previously estimated. Groundwater discharge from groundwater evapotranspiration and springs is 100,000 acre-ft/yr, and discharge to mountain streams is 3,300 acre-ft/yr; these are within the range of previous estimates. Current well withdrawals are 28,000 acre-ft/yr. Subsurface outflow from Snake Valley moves into Pine Valley (2,000 acre-ft/yr), Wah Wah Valley (23 acre-ft/yr), Tule Valley (33,000 acre-ft/yr), Fish Springs Flat (790 acre-ft/yr), and outside of the study area towards Great Salt Lake Desert (8,400 acre-ft/yr); these outflows, totaling about 44,000 acre-ft/yr, are within the range of previous estimates.The subsurface flow amounts indicate the degree of connectivity between hydrographic areas within the study area. The simulated transmissivity and locations of natural discharge, however, provide a better estimate of the effect of groundwater withdrawals on groundwater resources than does the amount and direction of subsurface flow between hydrographic areas. The distribution of simulated transmissivity throughout the study area includes many areas of high transmissivity within and between hydrographic areas. Increased well withdrawals within these high transmissivity areas will likely affect a large part of the study area, resulting in declining groundwater levels, as well as leading to a decrease in natural discharge to springs and evapotranspiration.
Hernández, Marta I; Bartolomei, Massimiliano; Campos-Martínez, José
2015-10-29
Recent progress in the production of new two-dimensional (2D) nanoporous materials is attracting considerable interest for applications to isotope separation in gases. In this paper we report a computational study of the transmission of (4)He and (3)He through the (subnanometer) pores of graphdiyne, a recently synthesized 2D carbon material. The He-graphdiyne interaction is represented by a force field parametrized upon ab initio calculations, and the (4)He/(3)He selectivity is analyzed by tunneling-corrected transition state theory. We have found that both zero point energy (of the in-pore degrees of freedom) and tunneling effects play an extraordinary role at low temperatures (≈20-30 K). However, both quantum features work in opposite directions in such a way that the selectivity ratio does not reach an acceptable value. Nevertheless, the efficiency of zero point energy is in general larger, so that (4)He tends to diffuse faster than (3)He through the graphdiyne membrane, with a maximum performance at 23 K. Moreover, it is found that the transmission rates are too small in the studied temperature range, precluding practical applications. It is concluded that the role of the in-pore degrees of freedom should be included in computations of the transmission probabilities of molecules through nanoporous materials.
NASA Astrophysics Data System (ADS)
Viswanathan, V. R.; Makhoul, J.; Schwartz, R. M.; Huggins, A. W. F.
1982-04-01
The variable frame rate (VFR) transmission methodology developed, implemented, and tested in the years 1973-1978 for efficiently transmitting linear predictive coding (LPC) vocoder parameters extracted from the input speech at a fixed frame rate is reviewed. With the VFR method, parameters are transmitted only when their values have changed sufficiently over the interval since their preceding transmission. Two distinct approaches to automatic implementation of the VFR method are discussed. The first bases the transmission decisions on comparisons between the parameter values of the present frame and the last transmitted frame. The second, which is based on a functional perceptual model of speech, compares the parameter values of all the frames that lie in the interval between the present frame and the last transmitted frame against a linear model of parameter variation over that interval. Also considered is the application of VFR transmission to the design of narrow-band LPC speech coders with average bit rates of 2000-2400 bts/s.
Chan, K L Andrew; Kazarian, Sergei G
2013-01-15
Transmission mode is one of the most common sampling methods for FT-IR spectroscopic imaging because the spectra obtained generally have a reasonable signal-to-noise ratio. However, dispersion and refraction of infrared light occurs when samples are sandwiched between infrared windows or placed underneath a layer of liquid. Dispersion and refraction cause infrared light to focus with different focal lengths depending on the wavelength (wavenumber) of the light. As a result, images obtained are in focus only at a particular wavenumber while they are defocused at other wavenumber values. In this work, a solution to correct this spread of focus by means of adding a lens on top of the infrared transparent window, such that a pseudo hemisphere is formed, has been investigated. Through this lens (or pseudo hemisphere), refraction of light is removed and the light across the spectral range has the same focal depth. Furthermore, the lens acts as a solid immersion objective and an increase of both magnification and spatial resolution (by 1.4 times) is demonstrated. The spatial resolution was investigated using an USAF resolution target, showing that the Rayleigh criterion can be achieved, as well as a sample with a sharp polymer interface to indicate the spatial resolution that can be expected in real samples. The reported approach was used to obtain chemical images of cross sections of cancer tissue and hair samples sandwiched between infrared windows showing the versatility and applicability of the method. In addition to the improved spatial resolution, the results reported herein also demonstrate that the lens can reduce the effect of scattering near the edges of tissue samples. The advantages of the presented approach, obtaining FT-IR spectroscopic images in transmission mode with the same focus across all wavenumber values and simultaneous improvement in spatial resolution, will have wide implications ranging from studies of live cells to sorption of drugs into tissues.
Interfacial phonon scattering and transmission loss in > 1 µm thick silicon-on-insulator thin films
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Puqing; Lindsay, Lucas R.; Huang, Xi
Scattering of phonons at boundaries of a crystal (grains, surfaces, or solid/solid interfaces) is characterized by the phonon wavelength, the angle of incidence, and the interface roughness, as historically evaluated using a specularity parameter p formulated by Ziman [Electrons and Phonons (Clarendon Press, Oxford, 1960)]. This parameter was initially defined to determine the probability of a phonon specularly reflecting or diffusely scattering from the rough surface of a material. The validity of Ziman's theory as extended to solid/solid interfaces has not been previously validated. Here, to better understand the interfacial scattering of phonons and to test the validity of Ziman'smore » theory, we precisely measured the in-plane thermal conductivity of a series of Si films in silicon-on-insulator (SOI) wafers by time-domain thermoreflectance (TDTR) for a Si film thickness range of 1–10 μm and a temperature range of 100–300 K. The Si/SiO 2 interface roughness was determined to be 0.11±0.04nm using transmission electron microscopy (TEM). Furthermore, we compared our in-plane thermal conductivity measurements to theoretical calculations that combine first-principles phonon transport with Ziman's theory. Calculations using Ziman's specularity parameter significantly overestimate values from the TDTR measurements. We attribute this discrepancy to phonon transmission through the solid/solid interface into the substrate, which is not accounted for by Ziman's theory for surfaces. The phonons that are specularly transmitted into an amorphous layer will be sufficiently randomized by the time they come back to the crystalline Si layer, the effect of which is practically equivalent to a diffuse reflection at the interface. Finally, we derive a simple expression for the specularity parameter at solid/amorphous interfaces and achieve good agreement between calculations and measurement values.« less
Interfacial phonon scattering and transmission loss in > 1 µm thick silicon-on-insulator thin films
Jiang, Puqing; Lindsay, Lucas R.; Huang, Xi; ...
2018-05-17
Scattering of phonons at boundaries of a crystal (grains, surfaces, or solid/solid interfaces) is characterized by the phonon wavelength, the angle of incidence, and the interface roughness, as historically evaluated using a specularity parameter p formulated by Ziman [Electrons and Phonons (Clarendon Press, Oxford, 1960)]. This parameter was initially defined to determine the probability of a phonon specularly reflecting or diffusely scattering from the rough surface of a material. The validity of Ziman's theory as extended to solid/solid interfaces has not been previously validated. Here, to better understand the interfacial scattering of phonons and to test the validity of Ziman'smore » theory, we precisely measured the in-plane thermal conductivity of a series of Si films in silicon-on-insulator (SOI) wafers by time-domain thermoreflectance (TDTR) for a Si film thickness range of 1–10 μm and a temperature range of 100–300 K. The Si/SiO 2 interface roughness was determined to be 0.11±0.04nm using transmission electron microscopy (TEM). Furthermore, we compared our in-plane thermal conductivity measurements to theoretical calculations that combine first-principles phonon transport with Ziman's theory. Calculations using Ziman's specularity parameter significantly overestimate values from the TDTR measurements. We attribute this discrepancy to phonon transmission through the solid/solid interface into the substrate, which is not accounted for by Ziman's theory for surfaces. The phonons that are specularly transmitted into an amorphous layer will be sufficiently randomized by the time they come back to the crystalline Si layer, the effect of which is practically equivalent to a diffuse reflection at the interface. Finally, we derive a simple expression for the specularity parameter at solid/amorphous interfaces and achieve good agreement between calculations and measurement values.« less
Quantifying the risk of pandemic influenza virus evolution by mutation and re-assortment.
Reperant, Leslie A; Grenfell, Bryan T; Osterhaus, Albert D M E
2015-12-08
Large outbreaks of zoonotic influenza A virus (IAV) infections may presage an influenza pandemic. However, the likelihood that an airborne-transmissible variant evolves upon zoonotic infection or co-infection with zoonotic and seasonal IAVs remains poorly understood, as does the relative importance of accumulating mutations versus re-assortment in this process. Using discrete-time probabilistic models, we determined quantitative probability ranges that transmissible variants with 1-5 mutations and transmissible re-assortants evolve after a given number of zoonotic IAV infections. The systematic exploration of a large population of model parameter values was designed to account for uncertainty and variability in influenza virus infection, epidemiological and evolutionary processes. The models suggested that immunocompromised individuals are at high risk of generating IAV variants with pandemic potential by accumulation of mutations. Yet, both immunocompetent and immunocompromised individuals could generate high viral loads of single and double mutants, which may facilitate their onward transmission and the subsequent accumulation of additional 1-2 mutations in newly-infected individuals. This may result in the evolution of a full transmissible genotype along short chains of contact transmission. Although co-infection with zoonotic and seasonal IAVs was shown to be a rare event, it consistently resulted in high viral loads of re-assortants, which may facilitate their onward transmission among humans. The prevention or limitation of zoonotic IAV infection in immunocompromised and contact individuals, including health care workers, as well as vaccination against seasonal IAVs-limiting the risk of co-infection-should be considered fundamental tools to thwart the evolution of a novel pandemic IAV by accumulation of mutations and re-assortment. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Elimination of Onchocerciasis from Mexico
Rodríguez-Pérez, Mario A.; Fernández-Santos, Nadia A.; Orozco-Algarra, María E.; Rodríguez-Atanacio, José A.; Domínguez-Vázquez, Alfredo; Rodríguez-Morales, Kristel B.; Real-Najarro, Olga; Prado-Velasco, Francisco G.; Cupp, Eddie W.; Richards, Frank O.; Hassan, Hassan K.; González-Roldán, Jesús F.; Kuri-Morales, Pablo A.; Unnasch, Thomas R.
2015-01-01
Background Mexico is one of the six countries formerly endemic for onchocerciasis in Latin America. Transmission has been interrupted in the three endemic foci of that country and mass drug distribution has ceased. Three years after mass drug distribution ended, post-treatment surveillance (PTS) surveys were undertaken which employed entomological indicators to check for transmission recrudescence. Methodology/Principal findings In-depth entomologic assessments were performed in 18 communities in the three endemic foci of Mexico. None of the 108,212 Simulium ochraceum s.l. collected from the three foci were found to contain parasite DNA when tested by polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA), resulting in a maximum upper bound of the 95% confidence interval (95%-ULCI) of the infective rate in the vectors of 0.035/2,000 flies examined. This is an order of magnitude below the threshold of a 95%-ULCI of less than one infective fly per 2,000 flies tested, the current entomological criterion for interruption of transmission developed by the international community. The point estimate of seasonal transmission potential (STP) was zero, and the upper bound of the 95% confidence interval for the STP ranged from 1.2 to 1.7 L3/person/season in the different foci. This value is below all previous estimates for the minimum transmission potential required to maintain the parasite population. Conclusions/Significance The results from the in-depth entomological post treatment surveillance surveys strongly suggest that transmission has not resumed in the three foci of Mexico during the three years since the last distribution of ivermectin occurred; it was concluded that transmission remains undetectable without intervention, and Onchocerca volvulus has been eliminated from Mexico. PMID:26161558
Hundessa, Samuel; Li, Shanshan; Liu, De Li; Guo, Jinpeng; Guo, Yuming; Zhang, Wenyi; Williams, Gail
2018-04-01
The proportion of imported malaria cases in China has increased over recent years, and has presented challenges for the malaria elimination program in China. However, little is known about the geographic distribution and environmental suitability for malaria transmission under projected climate change scenarios. Using the MaxEnt model based on malaria presence-only records, we produced environmental suitability maps and examined the relative contribution of topographic, demographic, and environmental risk factors for P. vivax and P. falciparum malaria in China. The MaxEnt model estimated that environmental suitability areas (ESAs) for malaria cover the central, south, southwest, east and northern regions, with a slightly wider range of ESAs extending to the northeast region for P. falciparum. There was spatial agreement between the location of imported cases and area environmentally suitable for malaria transmission. The ESAs of P. vivax and P. falciparum are projected to increase in some parts of southwest, south, central, north and northeast regions in the 2030s, 2050s, and 2080s, by a greater amount for P. falciparum under the RCP8.5 scenario. Temperature and NDVI values were the most influential in defining the ESAs for P. vivax, and temperature and precipitation the most influential for P. falciparum malaria. This study estimated that the ESA for malaria transmission in China will increase with climate change and highlights the potential establishment of further local transmission. This model should be used to support malaria control by targeting areas where interventions on malaria transmission need to be enhanced. Copyright © 2017 Elsevier Inc. All rights reserved.
stochastic estimation of transmissivity fields conditioned to flow connectivity data
NASA Astrophysics Data System (ADS)
Freixas, Genis; Fernàndez-Garcia, Daniel; Sanchez-vila, Xavier
2017-04-01
Most methods for hydraulic parameter interpretation rely on a number of simplifications regarding the homogeneity of the underlying porous media. This way, the actual heterogeneity of any natural parameter, such as transmissivity, is transferred to the estimated in a way heavily dependent on the interpretation method used. An example is a pumping test, in most cases interpreted by means of the Cooper-Jacob method, which implicitly assumes a homogeneous isotropic confined aquifer. It was shown that the estimates obtained from this method when applied to a real site are not local values, but still have a physical meaning; the estimated transmissivity is equal to the effective transmissivity characteristic of the regional scale, while the log-ratio of the estimated storage coefficient with respect to the actual real value (assumed constant), indicated by , is an indicator of flow connectivity, representative of the scale given by the distance between the pumping and the observation wells. In this work we propose a methodology to use together with actual measurements of the log transmissivity at selected points to obtain a map of the best local transmissivity estimates using cokriging. Since the interpolation involves two variables measured at different support scales, a critical point is the estimation of the covariance and crosscovariance matrices, involving some quadratures that are obtained using some simplified approach. The method was applied to a synthetic field displaying statistical anisotropy, showing that the use of connectivity indicators mixed with the local values provide a better representation of the local value map, in particular regarding the enhanced representation of the continuity of structures corresponding to either high or low values.
Hydrogeologic evaluation of the Upper Floridan aquifer in the southwestern Albany area, Georgia
Warner, Debbie
1997-01-01
A cooperative study by the Albany Water, Gas, and Light Commission and the U.S. Geological Survey was conducted to evaluate the hydrogeology of the Upper Floridan aquifer in an area southwest of Albany and west of the Flint River in Dougherty County, Ga. The study area lies in the Dougherty Plain district of the Coastal Plain physiographic province. In this area, the Upper Floridan aquifer is comprised of the upper Eocene Ocala Limestone, confined below by the middle Eocene Lisbon Formation, and semiconfined above by the undifferentiated Quaternary overburden. The overburden ranges in thickness from about 30 to 50 feet and consists of fine to coarse quartz sand, clayey sand, sandy clay, and clay. The Upper Floridan aquifer has been subdivided into an upper water-bearing zone and a lower water-bearing zone based on differences in lithology and yield. In the study area, the upper water-bearing zone generally consists of dense, highly weathered limestone of low permeability and ranges in thickness from 40 to 80 feet. The lower water-bearing zone consists of hard, slightly weathered limestone that exhibits a high degree of secondary permeability that has developed along fractures and joints, and ranges in thickness from about 60 to 80 feet. Borehole geophysical logs and borehole video surveys indicate two areas of high permeability in the lower water-bearing zone-one near the top and one near the base of the zone. A wellfield consisting of one production well and five observation-well clusters (one deep, intermediate, and shallow well in each cluster) was constructed for this study. Spinner flowmeter tests were conducted in the production well between the depths of 110 and 140 feet below land surface to determine the relative percentages of water contributed by selected vertical intervals of the lower water-bearing zone. Pumping rates during these tests were 1,080, 2,200, and 3,400 gallons per minute. The results of these pumping tests show that the interval between 118 and 124 feet below land surface contributes a significant percentage of the total yield to the well. An aquifer test was conducted by pumping the production well at a constant rate of 3,300 gallons per minute for about 49 hours. Time-dependent water-level data were collected throughout the pumping and recovery phases of the test in the pumped well and the observation wells. The maximum measured drawdown in the observation wells was about 2.6 ft. At about 0.5 mile from the pumped well, there was little measurable effect from pumping. Water levels increased during the test in wells located within about 3.75 miles of the Flint River (about 0.5 miles east of the pumping well). This water-level increase correlated with a 3.5-feet increase in the stage of the Flint River. The hydraulic characteristics of the Upper Floridan aquifer were evaluated using the Hantush-Jacob curve-matching and Jacob straight-line methods. Using the Hantush-Jacob method, values for transmissivity ranged from about 120,000 to 506,000 feet squared per day; values for storage coefficient ranged from 1.4 x 10-4 to 6.3 x 10-4; and values for vertical hydraulic conductivity of the overlying sediments ranged from 4.9 to 6.8 feet per day. Geometric averages for these values of transmissivity, storage coefficient, and vertical hydraulic conductivity were calculated to be 248,000 feet squared per day, 2.7 x 10-4, and 5.5 feet per day, respectively. If a dual porosity aquifer model (fracture flow plus matrix flow) is assumed instead of leakage, and the Jacob straight-line method is used with late time-drawdown data, the calculated transmissivity of the fractures ranged from about 233,000 to 466,000 feet squared per day; and storage coefficient of the fractures plus the matrix ranged from 5.1 x 10-4 to 2.9 x 10-2.
Mikhaylov, Alexander; Uudsemaa, Merle; Trummal, Aleksander; Arias, Eduardo; Moggio, Ivana; Ziolo, Ronald; Cooper, Thomas M; Rebane, Aleksander
2018-04-19
Change of the permanent molecular electric dipole moment, Δμ, in a series of nominally centrosymmetric and noncentrosymmteric ferrocene-phenyleneethynylene oligomers was estimated by measuring the two-photon absorption cross-section spectra of the lower energy metal-to-ligand charge-transfer transitions using femtosecond nonlinear transmission method and was found to vary in the range up to 12 D, with the highest value corresponding to the most nonsymmetric system. Calculations of the Δμ performed by the TD-DFT method show quantitative agreement with the experimental values and reveal that facile rotation of the ferrocene moieties relative to the organic ligand breaks the ground-state inversion symmetry in the nominally symmetric structures.
High Accuracy Ultraviolet Index of Refraction Measurements Using a Fourier Transform Spectrometer
Gupta, Rajeev; Kaplan, Simon G.
2003-01-01
We have constructed a new facility at the National Institute of Standards and Technology (NIST) to measure the index of refraction of transmissive materials in the wavelength range from the visible to the vacuum ultraviolet. An etalon of the material is illuminated with synchrotron radiation, and the interference fringes in the transmittance spectrum are measured using a Fourier transform spectrometer. The refractive index of calcium fluoride, CaF2, has been measured from 600 nm to 175 nm and the resulting values agree with a traditional goniometric measurement to within 1 × 10−5. The uncertainty in the index values is currently limited by the uncertainty in the thickness measurement of the etalon. PMID:27413620
Tunable Microstrip Filters Using Selectively Etched Ferroelectric Thin-Film Varactors for Coupling
NASA Technical Reports Server (NTRS)
Mueller, Carl H.; VanKeuls, Frederick W.; Romanofsky, Robert R.; Subramanyam, Guru; Miranda, Felix A.
2006-01-01
We report on the use of patterned ferroelectric films to fabricate proof of concept tunable one-pole microstrip filters with excellent transmission and mismatch/reflection properties at frequencies up to 24 GHz. By controlling the electric field distribution within the coupling region between the resonator and input/output lines, sufficiently high loaded and unloaded Q values are maintained so as to be useful for microstrip filter design, with low mismatch loss. In the 23 - 24 GHz region, the filter was tunable over a 100 MHz range, the loaded and unloaded Q values were 29 and 68, respectively, and the reflection losses were below -16 dB, which demonstrates the suitability of these films for practical microwave applications.
Peng, Li-Qing; Yu, Wen-Yan; Xu, Jing-Jing; Cao, Jun
2018-01-15
A simple, green and effective extraction method, namely, pyridinium ionic liquid- (IL) based liquid-solid extraction (LSE), was first designed to extract the main inorganic and organic iodine compounds (I - , monoiodo-tyrosine (MIT) and diiodo-tyrosine (DIT)). The optimal extraction conditions were as follows: ultrasonic intensity 100W, IL ([EPy]Br) concentration 200mM, extraction time 30min, liquid/solid ratio 10mL/g, and pH value 6.5. The morphologies of Laminaria were studied by scanning electron microscopy and transmission electron microscopy. The recovery values of I - , MIT and DIT from Laminaria were in the range of 88% to 94%, and limits of detection were in the range of 59.40 to 283.6ng/g. The proposed method was applied to the extraction and determination of iodine compounds in three Laminaria. The results showed that IL-based LSE could be a promising method for rapid extraction of bioactive iodine from complex food matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.
Re-active Passive (RAP) Devices for Control of Noise Transmission through a Panel
NASA Technical Reports Server (NTRS)
Carneal, James P.; Giovanardi, Marco; Fuller, Chris R.; Palumbo, Daniel L.
2008-01-01
Re-Active Passive (RAP) devices have been developed to control low frequency (<1000 Hz) noise transmission through a panel. These devices use a combination of active, re-active, and passive technologies packaged into a single unit to control a broad frequency range utilizing the strength of each technology over its best suited frequency range. The RAP device uses passive constrained layer damping to cover the relatively high frequency range (>200 Hz), reactive distributed vibration absorber) to cover the medium frequency range (75 to 250 Hz), and active control for controlling low frequencies (<200 Hz). The device was applied to control noise transmission through a panel mounted in a transmission loss test facility. Experimental results are presented for the bare panel, and combinations of passive treatment, reactive treatment, and active control. Results indicate that three RAP devices were able to increase the overall broadband (15-1000 Hz) transmission loss by 9.4 dB. These three devices added a total of 285 grams to the panel mass of 6.0 kg, or approximately 5%, not including control electronics.
Re-Active Passive devices for control of noise transmission through a panel
NASA Astrophysics Data System (ADS)
Carneal, James P.; Giovanardi, Marco; Fuller, Chris R.; Palumbo, Dan
2008-01-01
Re-Active Passive devices have been developed to control low-frequency (<1000 Hz) noise transmission through a panel. These devices use a combination of active, re-active, and passive technologies packaged into a single unit to control a broad frequency range utilizing the strength of each technology over its best suited frequency range. The Re-Active Passive device uses passive constrained layer damping to cover relatively high-frequency range (>150 Hz), reactive distributed vibration absorber to cover the medium-frequency range (50-200 Hz), and active control for controlling low frequencies (<150 Hz). The actuator was applied to control noise transmission through a panel mounted in the Transmission Loss Test Facility at Virginia Tech. Experimental results are presented for the bare panel, and combinations of passive treatment, reactive treatment, and active control. Results indicate that three Re-Active Passive devices were able to increase the overall broadband (15-1000 Hz) transmission loss by 9.4 dB. These three devices added a total of 285 g to the panel mass of 6.0 kg, or approximately 5%, not including control electronics.
Akyil, Yudum; Prouty, Anne; Blanchard, Amy; Lyness, Kevin
2016-06-01
Intergenerational value transmission affects parent-child relationships and necessitates constant negotiation in families. Families with adolescents from rapidly changing societies face unique challenges in balancing the traditional collectivistic family values that promote harmony with emerging values that promote autonomy. Using modern Turkey as an example of such a culture, the authors examine the transmission process in families that hold more traditional and collectivistic values than their adolescent children. Special consideration is given to generational and cultural differences in the autonomy and relatedness dimensions. © 2015 Family Process Institute.
NASA Technical Reports Server (NTRS)
Itoh, Tatsuo
1991-01-01
The analysis and modeling of superconducting planar transmission lines were performed. Theoretically, the highest possible Q values of superconducting microstrip line was calculated and, as a result, it provided the Q value that the experiment can aim for. As an effort to search for a proper superconducting transmission line structure, the superconducting microstrip line and coplanar waveguide were compared in terms of loss characteristics and their design aspects. Also, the research was expanded to a superconducting coplanar waveguide family in the microwave packaging environment. Theoretically, it was pointed out that the substrate loss is critical in the superconducting transmission line structures.
Shiba, Kenji; Nagato, Tomohiro; Tsuji, Toshio; Koshiji, Kohji
2008-07-01
This paper reports on the electromagnetic influences on the analysis of biological tissue surrounding a prototype energy transmission system for a wireless capsule endoscope. Specific absorption rate (SAR) and current density were analyzed by electromagnetic simulator in a model consisting of primary coil and a human trunk including the skin, fat, muscle, small intestine, backbone, and blood. First, electric and magnetic strength in the same conditions as the analytical model were measured and compared to the analytical values to confirm the validity of the analysis. Then, SAR and current density as a function of frequency and output power were analyzed. The validity of the analysis was confirmed by comparing the analytical values with the measured ones. The SAR was below the basic restrictions of the International Commission on Nonionizing Radiation Protection (ICNIRP). At the same time, the results for current density show that the influence on biological tissue was lowest in the 300-400 kHz range, indicating that it was possible to transmit energy safely up to 160 mW. In addition, we confirmed that the current density has decreased by reducing the primary coil's current.
Single crystal to polycrystal neutron transmission simulation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dessieux, Luc Lucius; Stoica, Alexandru Dan; Bingham, Philip R.
A collection of routines for calculation of the total cross section that determines the attenuation of neutrons by crystalline solids is presented. The total cross section is calculated semi-empirically as a function of crystal structure, neutron energy, temperature, and crystal orientation. The semi-empirical formula includes the contribution of parasitic Bragg scattering to the total cross section using both the crystal’s mosaic spread value and its orientation with respect to the neutron beam direction as parameters. These routines allow users to enter a distribution of crystal orientations for calculation of total cross sections of user defined powder or pseudo powder distributions,more » which enables simulation of non-uniformities such as texture and strain. In conclusion, the spectra for neutron transmission simulations in the neutron thermal energy range (2 meV–100 meV) are presented for single crystal and polycrystal samples and compared to measurements.« less
High-efficient entanglement distillation from photon loss and decoherence.
Wang, Tie-Jun; Wang, Chuan
2015-11-30
We illustrate an entanglement distillation protocol (EDP) for a mixed photon-ensemble which composed of four kinds of entangled states and vacuum states. Exploiting the linear optics and local entanglement resource (four-qubit entangled GHZ state), we design the nondemolition parity-checking and qubit amplifying (PCQA) setup for photonic polarization degree of freedom which are the key device of our scheme. With the PCQA setup, a high-fidelity entangled photon-pair system can be achieved against the transmission losses and the decoherence in noisy channels. And in the available purification range for our EDP, the fidelity of this ensemble can be improved to the maximal value through iterated operations. Compared to the conventional entanglement purification schemes, our scheme largely reduces the initialization requirement of the distilled mixed quantum system, and overcomes the difficulties posed by inherent channel losses during photon transmission. All these advantages make this scheme more useful in the practical applications of long-distance quantum communication.
High frequency power distribution system
NASA Technical Reports Server (NTRS)
Patel, Mikund R.
1986-01-01
The objective of this project was to provide the technology of high frequency, high power transmission lines to the 100 kW power range at 20 kHz frequency. In addition to the necessary design studies, a 150 m long, 600 V, 60 A transmission line was built, tested and delivered for full vacuum tests. The configuration analysis on five alternative configurations resulted in the final selection of the three parallel Litz straps configuration, which gave a virtually concentric design in the electromagnetic sense. Low inductance, low EMI and flexibility in handling are the key features of this configuration. The final design was made after a parametric study to minimize the losses, weight and inductance. The construction of the cable was completed with no major difficulties. The R,L,C parameters measured on the cable agreed well with the calculated values. The corona tests on insulation samples showed a safety factor of 3.
Extension of photonic band gap in one-dimensional ternary metal-dielectric photonic crystal
NASA Astrophysics Data System (ADS)
Pandey, G. N.; Thapa, Khem B.
2018-05-01
In this paper, the photonic band gap structure in the visible and near infrared for a ternary metal dielectric photonic crystal has been theoretically investigated. At the normal incidence, the high reflectance range can be significantly enlarged at a thicker metal film. The transmission of the structure containing Cu has large compared to the other metals like Al and Ag metals. The transmission properties of the metal are dependent upon the value of the plasma frequency. In this paper we consider the effect of the variation of the thickness of the metal on the reflection bands of ternary metallic-dielectric photonic crystal (MDPC). Finally we find that the enlargement of band gap in MDPC is due to the addition of increase of the thickness of metallic film at normal incidence. All the theoretical calculations are made based on the transfer matrix method together with the Drude model of metal.
Modeling fluctuations in default-mode brain network using a spiking neural network.
Yamanishi, Teruya; Liu, Jian-Qin; Nishimura, Haruhiko
2012-08-01
Recently, numerous attempts have been made to understand the dynamic behavior of complex brain systems using neural network models. The fluctuations in blood-oxygen-level-dependent (BOLD) brain signals at less than 0.1 Hz have been observed by functional magnetic resonance imaging (fMRI) for subjects in a resting state. This phenomenon is referred to as a "default-mode brain network." In this study, we model the default-mode brain network by functionally connecting neural communities composed of spiking neurons in a complex network. Through computational simulations of the model, including transmission delays and complex connectivity, the network dynamics of the neural system and its behavior are discussed. The results show that the power spectrum of the modeled fluctuations in the neuron firing patterns is consistent with the default-mode brain network's BOLD signals when transmission delays, a characteristic property of the brain, have finite values in a given range.
Transmittance measurements at DIRT-II
NASA Astrophysics Data System (ADS)
Curcio, J. A.; Haught, K. M.; Woytko, M. A.
1980-07-01
This is a report on the NRL experiments at the DIRT-II tests sponsored by the Atmospheric Sciences Laboratory at the White Sands Missile Range in July 1970. The NRL experiment was designed to measure spectral transmittance through smoke and dust clouds generated by detonations of various explosive charges and also by impact of artillery rounds. Spectral transmission data as a function of time for 0.55 micrometers, 1.06 micrometers, and 10.37 micrometers were obtained for 63 events comprised of static detonations and artillery rounds. Transmission data for 1.06 micrometers, in most cases were similar and equal to 0.55 micrometers. In dry soil conditions the 10.37 micrometers channel showed higher transmittance values than the visible channel. There are indications that 10.37 micrometers transmittance in wet soil events is lower than visible presumably because of strong liquid water absorption at the IR wavelength.
Single crystal to polycrystal neutron transmission simulation
Dessieux, Luc Lucius; Stoica, Alexandru Dan; Bingham, Philip R.
2018-02-02
A collection of routines for calculation of the total cross section that determines the attenuation of neutrons by crystalline solids is presented. The total cross section is calculated semi-empirically as a function of crystal structure, neutron energy, temperature, and crystal orientation. The semi-empirical formula includes the contribution of parasitic Bragg scattering to the total cross section using both the crystal’s mosaic spread value and its orientation with respect to the neutron beam direction as parameters. These routines allow users to enter a distribution of crystal orientations for calculation of total cross sections of user defined powder or pseudo powder distributions,more » which enables simulation of non-uniformities such as texture and strain. In conclusion, the spectra for neutron transmission simulations in the neutron thermal energy range (2 meV–100 meV) are presented for single crystal and polycrystal samples and compared to measurements.« less
Gerbi, Gemechu B; Habtemariam, Tsegaye; Tameru, Berhanu; Nganwa, David; Robnett, Vinaida
2012-01-01
The objective of this study is to conduct a quantitative risk assessment of multiple factors influencing HIV/AIDS transmission through unprotected sexual practices among HIV-seropositive men. A knowledgebase was developed by reviewing different published sources. The data were collected from different sources including Centers for Disease Control and Prevention, selected journals, and reports. The risk pathway scenario tree was developed based on a comprehensive review of published literature. The variables are organized into nine major parameter categories. Monte Carlo simulations for the quantitative risk assessment of HIV/AIDS transmission was executed with the software @Risk 4.0 (Palisade Corporation). Results show that the value for the likelihood of unprotected sex due to having less knowledge about HIV/AIDS and negative attitude toward condom use and safer sex ranged from 1.24 × 10(-5) to 8.47 × 10(-4) with the mean and standard deviation of 1.83 × 10(-4) and 8.63 × 10(-5), respectively. The likelihood of unprotected sex due to having greater anger-hostility, anxiety, less satisfied with aspects of life, and greater depressive symptoms ranged from 2.76 × 10(-9) to 5.34 × 10(-7) with the mean and standard deviation of 5.23 × 10(-8) and 3.58 × 10(-8), respectively. The findings suggest that HIV/AIDS research and intervention programs must be focused on behavior, and the broader setting within which individual risky behaviors occur.
Transmission-enabled fiber Fabry-Perot cavity based on a deeply etched slotted micromirror.
Othman, Muhammad A; Sabry, Yasser M; Sadek, Mohamed; Nassar, Ismail M; Khalil, Diaa A
2018-06-01
In this work, we report the analysis, fabrication, and characterization of an optical cavity built using a Bragg-coated fiber (BCF) mirror and a metal-coated microelectromechanical systems (MEMS) slotted micromirror, where the latter allows transmission output from the cavity. Theoretical modeling, using Fourier optics analysis for the cavity response based on tracing the propagation of light back and forth between the mirrors, is presented. Detailed simulation analysis is carried out for the spectral response of the cavity under different design conditions. MEMS chips of the slotted micromirror are fabricated using deep reactive ion etching of a silicon-on-insulator substrate with different device-etching depths of 150 μm and 80 μm with aluminum and gold metal coating, respectively. The cavity is characterized as an optical filter using a BCF with reflectivity that is larger than 95% in a 300 nm range across the E-band and the L-band. Versatile filter characteristics were obtained for different values of the MEMS micromirror slit width and cavity length. A free spectral range (FSR) of about 33 nm and a quality factor of about 196 were obtained for a 5.5 μm width aluminum slit, while an FSR of about 148 nm and a quality factor of about 148 were obtained for a 1.5 μm width gold slit. The presented structure opens the door for wide spectral response transmission-type MEMS filters.
NASA Astrophysics Data System (ADS)
Everett, Samantha
2010-10-01
A transmission curve experiment was carried out to measure the range of beta particles in aluminum in the health physics laboratory located on the campus of Texas Southern University. The transmission count rate through aluminum for varying radiation lengths was measured using beta particles emitted from a low activity (˜1 μCi) Sr-90 source. The count rate intensity was recorded using a Geiger Mueller tube (SGC N210/BNC) with an active volume of 61 cm^3 within a systematic detection accuracy of a few percent. We compared these data with a realistic simulation of the experimental setup using the Geant4 Monte Carlo toolkit (version 9.3). The purpose of this study was to benchmark our Monte Carlo for future experiments as part of a more comprehensive research program. Transmission curves were simulated based on the standard and low-energy electromagnetic physics models, and using the radioactive decay module for the electrons primary energy distribution. To ensure the validity of our measurements, linear extrapolation techniques were employed to determine the in-medium beta particle range from the measured data and was found to be 1.87 g/cm^2 (˜0.693 cm), in agreement with literature values. We found that the general shape of the measured data and simulated curves were comparable; however, a discrepancy in the relative count rates was observed. The origin of this disagreement is still under investigation.
Chen, Yi-Ting; Horng, Mong-Fong; Lo, Chih-Cheng; Chu, Shu-Chuan; Pan, Jeng-Shyang; Liao, Bin-Yih
2013-03-20
Transmission power optimization is the most significant factor in prolonging the lifetime and maintaining the connection quality of wireless sensor networks. Un-optimized transmission power of nodes either interferes with or fails to link neighboring nodes. The optimization of transmission power depends on the expected node degree and node distribution. In this study, an optimization approach to an energy-efficient and full reachability wireless sensor network is proposed. In the proposed approach, an adjustment model of the transmission range with a minimum node degree is proposed that focuses on topology control and optimization of the transmission range according to node degree and node density. The model adjusts the tradeoff between energy efficiency and full reachability to obtain an ideal transmission range. In addition, connectivity and reachability are used as performance indices to evaluate the connection quality of a network. The two indices are compared to demonstrate the practicability of framework through simulation results. Furthermore, the relationship between the indices under the conditions of various node degrees is analyzed to generalize the characteristics of node densities. The research results on the reliability and feasibility of the proposed approach will benefit the future real deployments.
Chen, Yi-Ting; Horng, Mong-Fong; Lo, Chih-Cheng; Chu, Shu-Chuan; Pan, Jeng-Shyang; Liao, Bin-Yih
2013-01-01
Transmission power optimization is the most significant factor in prolonging the lifetime and maintaining the connection quality of wireless sensor networks. Un-optimized transmission power of nodes either interferes with or fails to link neighboring nodes. The optimization of transmission power depends on the expected node degree and node distribution. In this study, an optimization approach to an energy-efficient and full reachability wireless sensor network is proposed. In the proposed approach, an adjustment model of the transmission range with a minimum node degree is proposed that focuses on topology control and optimization of the transmission range according to node degree and node density. The model adjusts the tradeoff between energy efficiency and full reachability to obtain an ideal transmission range. In addition, connectivity and reachability are used as performance indices to evaluate the connection quality of a network. The two indices are compared to demonstrate the practicability of framework through simulation results. Furthermore, the relationship between the indices under the conditions of various node degrees is analyzed to generalize the characteristics of node densities. The research results on the reliability and feasibility of the proposed approach will benefit the future real deployments. PMID:23519351
Syh, J; Patel, B; Syh, J; Wu, H; Rosen, L; Durci, M; Katz, S; Sibata, C
2012-06-01
To evaluate the characteristics of commercial-grade flatbed scanners and medical-grade scanners for radiochromic EBT film dosimetry. Performance aspects of a Vidar Dosimetry Pro Advantage (Red), Epson 750 Pro, Microtek ArtixScan 1800f, and Microtek ScanMaker 8700 scanner for EBT2 Gafchromic film were evaluated in the categories of repeatability, maximum distinguishable optical density (OD) differentiation, OD variance, and dose curve characteristics. OD step film by Stouffer Industries containing 31 steps ranging from 0.05 to 3.62 OD was used. EBT films were irradiated with dose ranging from 20 to 600 cGy in 6×6 cm 2 field sizes and analyzed 24 hours later using RIT113 and Tomotherapy Film Analyzer software. Scans were performed in transmissive mode, landscape orientation, 16-bit image. The mean and standard deviation Analog to Digital (A/D) scanner value was measured by selecting a 3×3 mm 2 uniform area in the central region of each OD step from a total of 20 scans performed over several weeks. Repeatability was determined from the variance of OD step 0.38. Maximum distinguishable OD was defined as the last OD step whose range of A/D values does not overlap with its neighboring step. Repeatability uncertainty ranged from 0.1% for Vidar to 4% for Epson. Average standard deviation of OD steps ranged from 0.21% for Vidar to 6.4% for ArtixScan 1800f. Maximum distinguishable optical density ranged from 3.38 for Vidar to 1.32 for ScanMaker 8700. A/D range of each OD step corresponds to a dose range. Dose ranges of OD steps varied from 1% for Vidar to 20% for ScanMaker 8700. The Vidar exhibited a dose curve that utilized a broader range of OD values than the other scanners. Vidar exhibited higher maximum distinguishable OD, smaller variance in repeatability, smaller A/D value deviation per OD step, and a shallower dose curve with respect to OD. © 2012 American Association of Physicists in Medicine.
Modeling power flow in the induction cavity with a two dimensional circuit simulation
NASA Astrophysics Data System (ADS)
Guo, Fan; Zou, Wenkang; Gong, Boyi; Jiang, Jihao; Chen, Lin; Wang, Meng; Xie, Weiping
2017-02-01
We have proposed a two dimensional (2D) circuit model of induction cavity. The oil elbow and azimuthal transmission line are modeled with one dimensional transmission line elements, while 2D transmission line elements are employed to represent the regions inward the azimuthal transmission line. The voltage waveforms obtained by 2D circuit simulation and transient electromagnetic simulation are compared, which shows satisfactory agreement. The influence of impedance mismatch on the power flow condition in the induction cavity is investigated with this 2D circuit model. The simulation results indicate that the peak value of load voltage approaches the maximum if the azimuthal transmission line roughly matches the pulse forming section. The amplitude of output transmission line voltage is strongly influenced by its impedance, but the peak value of load voltage is insensitive to the actual output transmission line impedance. When the load impedance raises, the voltage across the dummy load increases, and the pulse duration at the oil elbow inlet and insulator stack regions also slightly increase.
Millimeter wave transmission systems and related devices
NASA Technical Reports Server (NTRS)
Hebert, L. M.
1984-01-01
A survey was made of the state-of-the-art in millimeter (20 GHz to 300 GHz) wave transmission systems and related devices. The survey includes summaries of analytical studies and theoretical results that were obtained for various transmission line structures. This material was supplemented by further analysis where appropriate. The transmission line structures are evaluated in terms of electrical performance, ease of manufacture, usefulness for building other devices and compatibility with solid state devices. Descriptions of waveguide transmission lines which have commonly been used in the microwave frequency range are provided along with special attention given to the problems that these guides face when their use is extended into the millimeter wave range. Also, guides which have been introduced specifically to satisfy the requirements of millimeter wave transmission are discussed in detail.
Nöth, Ulrike; Laufs, Helmut; Stoermer, Robert; Deichmann, Ralf
2012-03-01
To describe heating effects to be expected in simultaneous electroencephalography (EEG) and magnetic resonance imaging (MRI) when deviating from the EEG manufacturer's instructions; to test which anatomical MRI sequences have a sufficiently low specific absorption rate (SAR) to be performed with the EEG equipment in place; and to suggest precautions to reduce the risk of heating. Heating was determined in vivo below eight EEG electrodes, using both head and body coil transmission and sequences covering the whole range of SAR values. Head transmit coil: temperature increases were below 2.2°C for low SAR sequences, but reached 4.6°C (one subject, clavicle) for high SAR sequences; the equilibrium temperature T(eq) remained below 39°C. Body transmit coil: temperature increases were higher and more frequent over subjects and electrodes, with values below 2.6°C for low SAR sequences, reaching 6.9°C for high SAR sequences (T8 electrode) with T(eq) exceeding a critical level of 40°C. Anatomical imaging should be based on T1-weighted sequences (FLASH, MPRAGE, MDEFT) with an SAR below values for functional MRI sequences based on gradient echo planar imaging. Anatomical sequences with a high SAR can pose a significant risk, which is reduced by using head coil transmission. Copyright © 2011 Wiley-Liss, Inc.
Woolfenden, L.R.; Martin, Peter; Baharie, Brian
1988-01-01
Ground-water use in the Stovepipe Wells Hotel area in Death Valley National Monument is expected to increase significantly if the nonpotable, as well as potable, water supply is treated by reverse osmosis. During the peak tourist season, October through March, ground-water pumpage could increase by 37,500 gallons per day, or 76%. The effects of this additional pumpage on water levels in the area, particularly near a strand of phreatophytes about 10,000 feet east of the well field, are of concern. In order to evaluate the effects of increased pumpage on water levels in the Stovepipe Wells Hotel area well field, two aquifer tests were performed at the well field to determine the transmissivity and storage coefficients of the aquifer. Analysis of the aquifer test determined that a transmissivity of 1,360 feet squared per day was representative of the aquifer. The estimated value of transmissivity and the storage-coefficient values that are representative of confined (1.2 x .0004) and unconfined (0.25) conditions were used in the Theis equation to calculate the additional drawdown that might occur after 1, 10, and 50 years of increased pumpage. The drawdown calculated by using the lower storage-coefficient value represents the maximum additional drawdown that might be expected from the assumed increase in pumpage; the drawdown calculated by using the higher storage-coefficient value represents the minimum additional drawdown. Calculated additional drawdowns after 50 years of pumping range from 7.8 feet near the pumped well to 2.4 feet at the phreatophyte stand assuming confined conditions, and from 5.7 feet near the pumped well to 0.3 foot at the phreatophyte stand assuming unconfined conditions. Actual drawdowns probably will be somewhere between these values. Drawdowns measured in observation wells during 1973-85, in response to an average pumpage of 34,200 gallons per day at the Stovepipe Wells Hotel well field, are similar to the drawdowns calculated by the Theis equation for the assumed increase in pumpage. (Author 's abstract)
Hanson, R.T.; McLean, J.S.; Miller, Ryan S.
1994-01-01
The bolson-fill aquifer, the major water-yielding unit in the Mimbres Basin, southwestern New Mexico, ranges in thickness from 0 to about 3,700 feet. Recharge to the bolson-fill aquifer occurs by infiltration of ephemeral streams that cross the basin margin, infiltration from precipitation and streamflow, ground-water underflow from adjacent basins, and infiltration of springflow from adjacent bedrock units within the basin. Ground water generally flows southward from the northern highland areas of the basin. Ground-water discharge consists of pumpage from wells, transpiration by plants, outflow to playas and springs in the Los Muertos Basin in Mexico, discharge to the Mimbres River, and ground-water flow to the Mesilla Basin near Mason Draw. Before 1910, ground-water recharge and discharge were approximately equal; by 1975, however, about 75 percent of the 146,000 acre-feet withdrawn annually was ground water, most of it from aquifer storage. The transmissivity of the bolson-fill aquifer determined from aquifer tests and specific-capacity data ranges from 10 to 50,000 feet squared per day. Hydraulic conductivity, calculated from saturated thickness and transmissivity, ranges from 0.03 to 800 feet per day, with median values of about 18 feet per day in the Deming area and 6 feet per day elsewhere. Reported storage-coefficient values representing confined parts of the aquifer range from 0.00036 to 0.0036, and those representing unconfined parts of the aquifer range from 0.02 to 0.24. Water quality in the north and central parts of the Mimbres Basin is suitable for most uses. Due to its large salinity and alkalinity, some of the ground water in the south and southeastern areas of the bolson-fill aquifer may not be suitable for irrigation or domestic use. A preliminary two-dimensional digital model was constructed to evaluate ground-water flow in the bolson-fill aquifer. The model was divided into zones of uniform hydraulic conductivity corresponding to the major structural elements of the basin. For simulation purposes, hydraulic conductivity in the central part of the basin ranged from 2.2 to 4.4 feet per day, whereas locally along the edges of the aquifer less certain values ranged from 0.003 to 62 feet per day Analysis of the results of this predevelopment model indicated that use of the mountain-front recharge method overestimates total recharge and that evapotranspiration is substantial. The simulated total inflow was about 55 percent of that estimated in a water budget for the Mimbres Basin.Ground-water development between 1930 and 1985 was simulated using storage-coefficient values of 0.01 and 0.02 for the Gila Conglomerate, 0.04 to 0.17 for bolson-fill deposits, and 0.001 for bolson fill capped with lacustrine clay. The simulated transient water budget indicated that most of the water pumped by 1985 came from storage, and lesser but substantial amounts came from reductions in evapotranspiration.
NASA Astrophysics Data System (ADS)
Gremaud, R.; Baldi, A.; Gonzalez-Silveira, M.; Dam, B.; Griessen, R.
2008-04-01
A multisite lattice gas approach is used to model pressure-optical-transmission isotherms (PTIs) recorded by hydrogenography on MgyTi1-yHx sputtered thin films. The model reproduces the measured PTIs well and allows us to determine the chemical short-range order parameter s . The s values are in good agreement with those determined from extended x-ray absorption fine structure measurements. Additionally, the PTI multisite modeling yields a parameter L that accounts for the local lattice deformations with respect to the average MgyTi1-y lattice given by Vegard’s law. It is thus possible to extract two essential characteristics of a metastable alloy from hydrogenographic data.
NASA Astrophysics Data System (ADS)
Jen, H. R.; Ma, K. Y.; Stringfellow, G. B.
1989-03-01
Results are presented of transmission electron diffraction (TED) observations, demonstrating, for the first time, a CuPt-type ordering in InAs(1-x)Sb(x) alloys, over a wide range of x values (from x = 0.22 to 0.88). The InAsSb alloys were prepared by OMVPE on (001) oriented undoped InSb or InAs substrates. The ordering-induced spots on the TED patterns show the highest intensity for x of about 0.5 and the lowest intensity toward each binary end compound. Only two of the four variants are formed during growth. In some areas, the degree of order for these two variants, 1/2(-1 1 1) and 1/2(1 -1 1), is equal, and in other areas, one variant dominates.
Transmission expansion with smart switching under demand uncertainty and line failures
Schumacher, Kathryn M.; Chen, Richard Li-Yang; Cohn, Amy E. M.
2016-06-07
One of the major challenges in deciding where to build new transmission lines is that there is uncertainty regarding future loads, renewal generation output and equipment failures. We propose a robust optimization model whose transmission expansion solutions ensure that demand can be met over a wide range of conditions. Specifically, we require feasible operation for all loads and renewable generation levels within given ranges, and for all single transmission line failures. Furthermore, we consider transmission switching as an allowable recovery action. This relatively inexpensive method of redirecting power flows improves resiliency, but introduces computational challenges. Lastly, we present a novelmore » algorithm to solve this model. Computational results are discussed.« less
Cator, Lauren J; Thomas, Shalu; Paaijmans, Krijn P; Ravishankaran, Sangamithra; Justin, Johnson A; Mathai, Manu T; Read, Andrew F; Thomas, Matthew B; Eapen, Alex
2013-03-02
Environmental temperature is an important driver of malaria transmission dynamics. Both the parasite and vector are sensitive to mean ambient temperatures and daily temperature variation. To understand transmission ecology, therefore, it is important to determine the range of microclimatic temperatures experienced by malaria vectors in the field. A pilot study was conducted in the Indian city of Chennai to determine the temperature variation in urban microclimates and characterize the thermal ecology of the local transmission setting. Temperatures were measured in a range of probable indoor and outdoor resting habitats of Anopheles stephensi in two urban slum malaria sites. Mean temperatures and daily temperature fluctuations in local transmission sites were compared with standard temperature measures from the local weather station. The biological implications of the different temperatures were explored using temperature-dependent parasite development models to provide estimates of the extrinsic incubation period (EIP) of Plasmodium vivax and Plasmodium falciparum. Mean daily temperatures within the urban transmission sites were generally warmer than those recorded at the local weather station. The main reason was that night-time temperatures were higher (and hence diurnal temperature ranges smaller) in the urban settings. Mean temperatures and temperature variation also differed between specific resting sites within the transmission environments. Most differences were of the order of 1-3°C but were sufficient to lead to important variation in predicted EIPs and hence, variation in estimates of transmission intensity. Standard estimates of environmental temperature derived from local weather stations do not necessarily provide realistic measures of temperatures within actual transmission environments. Even the small differences in mean temperatures or diurnal temperature ranges reported in this study can lead to large variations in key mosquito and/or parasite life history traits that determine transmission intensity. Greater effort should be directed at quantifying adult mosquito resting behaviour and determining the temperatures actually experienced by mosquitoes and parasites in local transmission environments. In the absence of such highly resolved data, the approach used in the current study provides a framework for improved thermal characterization of transmission settings.
Characterizing microclimate in urban malaria transmission settings: a case study from Chennai, India
2013-01-01
Background Environmental temperature is an important driver of malaria transmission dynamics. Both the parasite and vector are sensitive to mean ambient temperatures and daily temperature variation. To understand transmission ecology, therefore, it is important to determine the range of microclimatic temperatures experienced by malaria vectors in the field. Methods A pilot study was conducted in the Indian city of Chennai to determine the temperature variation in urban microclimates and characterize the thermal ecology of the local transmission setting. Temperatures were measured in a range of probable indoor and outdoor resting habitats of Anopheles stephensi in two urban slum malaria sites. Mean temperatures and daily temperature fluctuations in local transmission sites were compared with standard temperature measures from the local weather station. The biological implications of the different temperatures were explored using temperature-dependent parasite development models to provide estimates of the extrinsic incubation period (EIP) of Plasmodium vivax and Plasmodium falciparum. Results Mean daily temperatures within the urban transmission sites were generally warmer than those recorded at the local weather station. The main reason was that night-time temperatures were higher (and hence diurnal temperature ranges smaller) in the urban settings. Mean temperatures and temperature variation also differed between specific resting sites within the transmission environments. Most differences were of the order of 1-3°C but were sufficient to lead to important variation in predicted EIPs and hence, variation in estimates of transmission intensity. Conclusions Standard estimates of environmental temperature derived from local weather stations do not necessarily provide realistic measures of temperatures within actual transmission environments. Even the small differences in mean temperatures or diurnal temperature ranges reported in this study can lead to large variations in key mosquito and/or parasite life history traits that determine transmission intensity. Greater effort should be directed at quantifying adult mosquito resting behaviour and determining the temperatures actually experienced by mosquitoes and parasites in local transmission environments. In the absence of such highly resolved data, the approach used in the current study provides a framework for improved thermal characterization of transmission settings. PMID:23452620
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Justin C; Braunecker, Wade A; Hurst, Katherine E
A two-dimensional imine-based covalent organic framework (COF) was designed and synthesized such that phenyl and perfluorophenyl structural units can seamlessly alternate between layers of the framework. X-ray diffraction of the COF powders reveals a striking increase in crystallinity for the COF with self-complementary phenyl/perfluorophenyl interactions (FASt-COF). Whereas measured values of the Brunauer-Emmet-Teller (BET) surface areas for the nonfluorinated Base-COF and the COF employing hydrogen bonding were ~37% and 59%, respectively, of their theoretical Connolly surface areas, the BET value for FASt-COF achieves >90% of its theoretical value (~1700 m2/g). Transmission electron microscopy images also revealed unique micron-sized rodlike features inmore » FASt-COF that were not present in the other materials. The results highlight a promising approach for improving surface areas and long-range order in two-dimensional COFs.« less
NASA Astrophysics Data System (ADS)
Awasarmol, V. V.; Gaikwad, D. K.; Raut, S. D.; Pawar, P. P.
The mass attenuation coefficients (μm) for organic nonlinear optical materials measured at 122-1330 keV photon energies were investigated on the basis of mixture rule and compared with obtained values of WinXCOM program. It is observed that there is a good agreement between theoretical and experimental values of the samples. All samples were irradiated with six radioactive sources such as 57Co, 133Ba, 22Na, 137Cs, 54Mn and 60Co using transmission arrangement. Effective atomic and electron numbers or electron densities (Zeff and Neff), molar extinction coefficient (ε), mass energy absorption coefficient (μen/ρ) and effective atomic energy absorption cross section (σa,en) were determined experimentally and theoretically using the obtained μm values for investigated samples and graphs have been plotted. The graph shows that the variation of all samples decreases with increasing photon energy.
Universal Faraday Rotation in HgTe Wells with Critical Thickness
NASA Astrophysics Data System (ADS)
Shuvaev, A.; Dziom, V.; Kvon, Z. D.; Mikhailov, N. N.; Pimenov, A.
2016-09-01
The universal value of the Faraday rotation angle close to the fine structure constant (α ≈1 /137 ) is experimentally observed in thin HgTe quantum wells with a thickness on the border between trivial insulating and the topologically nontrivial Dirac phases. The quantized value of the Faraday angle remains robust in the broad range of magnetic fields and gate voltages. Dynamic Hall conductivity of the holelike carriers extracted from the analysis of the transmission data shows a theoretically predicted universal value of σx y=e2/h , which is consistent with the doubly degenerate Dirac state. On shifting the Fermi level by the gate voltage, the effective sign of the charge carriers changes from positive (holes) to negative (electrons). The electronlike part of the dynamic response does not show quantum plateaus and is well described within the classical Drude model.
Anatomy-based transmission factors for technique optimization in portable chest x-ray
NASA Astrophysics Data System (ADS)
Liptak, Christopher L.; Tovey, Deborah; Segars, William P.; Dong, Frank D.; Li, Xiang
2015-03-01
Portable x-ray examinations often account for a large percentage of all radiographic examinations. Currently, portable examinations do not employ automatic exposure control (AEC). To aid in the design of a size-specific technique chart, acrylic slabs of various thicknesses are often used to estimate x-ray transmission for patients of various body thicknesses. This approach, while simple, does not account for patient anatomy, tissue heterogeneity, and the attenuation properties of the human body. To better account for these factors, in this work, we determined x-ray transmission factors using computational patient models that are anatomically realistic. A Monte Carlo program was developed to model a portable x-ray system. Detailed modeling was done of the x-ray spectrum, detector positioning, collimation, and source-to-detector distance. Simulations were performed using 18 computational patient models from the extended cardiac-torso (XCAT) family (9 males, 9 females; age range: 2-58 years; weight range: 12-117 kg). The ratio of air kerma at the detector with and without a patient model was calculated as the transmission factor. Our study showed that the transmission factor decreased exponentially with increasing patient thickness. For the range of patient thicknesses examined (12-28 cm), the transmission factor ranged from approximately 21% to 1.9% when the air kerma used in the calculation represented an average over the entire imaging field of view. The transmission factor ranged from approximately 21% to 3.6% when the air kerma used in the calculation represented the average signals from two discrete AEC cells behind the lung fields. These exponential relationships may be used to optimize imaging techniques for patients of various body thicknesses to aid in the design of clinical technique charts.
NASA Astrophysics Data System (ADS)
Chakrabarti, Aloknath; Mohapatra, Smrutiranjan
2013-09-01
Two problems of scattering of surface water waves involving a semi-infinite elastic plate and a pair of semi-infinite elastic plates, separated by a gap of finite width, floating horizontally on water of finite depth, are investigated in the present work for a two-dimensional time-harmonic case. Within the frame of linear water wave theory, the solutions of the two boundary value problems under consideration have been represented in the forms of eigenfunction expansions. Approximate values of the reflection and transmission coefficients are obtained by solving an over-determined system of linear algebraic equations in each problem. In both the problems, the method of least squares as well as the singular value decomposition have been employed and tables of numerical values of the reflection and transmission coefficients are presented for specific choices of the parameters for modelling the elastic plates. Our main aim is to check the energy balance relation in each problem which plays a very important role in the present approach of solutions of mixed boundary value problems involving Laplace equations. The main advantage of the present approach of solutions is that the results for the values of reflection and transmission coefficients obtained by using both the methods are found to satisfy the energy-balance relations associated with the respective scattering problems under consideration. The absolute values of the reflection and transmission coefficients are presented graphically against different values of the wave numbers.
Template-free synthesis of ZnWO{sub 4} powders via hydrothermal process in a wide pH range
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hojamberdiev, Mirabbos, E-mail: mirabbos_uz@yahoo.com; Zhu, Gangqiang; Xu, Yunhua
ZnWO{sub 4} powders with different morphologies were fabricated through a template-free hydrothermal method at 180 {sup o}C for 8 h in a wide pH range. X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), UV-visible and luminescence spectrophotometers were applied to study the effects of pH values on crystallinity, morphology, optical and luminescence properties. The XRD results showed that the WO{sub 3} + ZnWO{sub 4}, ZnWO{sub 4}, and ZnO phases could form after hydrothermal processing at 180 {sup o}C for 8 h with the pH values of 1, 3-11, and 13, respectively. The SEM and TEM observation revealedmore » that the morphological transformation of ZnWO{sub 4} powders occurred with an increase in pH values as follows: star anise-, peony-, and desert rose-like microstructures and soya bean- and rod-like nanostructures. The highest luminescence intensity was found to be in sample consisting of star anise-like crystallites among all the samples due to the presence of larger particles with high crystallinity resulted from the favorable pH under the current hydrothermal conditions.« less
Analysis of three tests of the unconfined aquifer in southern Nassau County, Long Island, New York
Lindner, J.B.; Reilly, T.E.
1982-01-01
Drawdown and recovery data from three 2-day aquifer tests (OF) the unconfined (water-table) aquifer in southern Nassau County, N.Y., during the fall of 1979, were analyzed. Several simple analytical solutions, a typecurve-matching procedure, and a Galerkin finite-element radial-flow model were used to determine hydraulic conductivity, ratio of horizontal to vertical hydraulic conductivity, and specific yield. Results of the curve-matching procedure covered a broad range of values that could be narrowed through consideration of data from other sources such as published reports, drillers ' logs, or values determined by analytical solutions. Analysis by the radial-flow model was preferred because it allows for vertical variability in aquifer properties and solves the system for all observation points simultaneously, whereas the other techniques treat the aquifer as homogeneous and must treat each observation well separately. All methods produced fairly consistent results. The ranges of aquifer values at the three sites were: horizontal hydraulic conductivity, 140 to 380 feet per day; transmissivity 11,200 to 17,100 feet squared per day; ratio of horizontal to vertical hydraulic conductivity 2.4:1 to 7:1, and specific yield , 0.13 to 0.23. (USGS)
Diaphragm correction factors for the FAC-IR-300 free-air ionization chamber.
Mohammadi, Seyed Mostafa; Tavakoli-Anbaran, Hossein
2018-02-01
A free-air ionization chamber FAC-IR-300, designed by the Atomic Energy Organization of Iran, is used as the primary Iranian national standard for the photon air kerma. For accurate air kerma measurements, the contribution from the scattered photons to the total energy released in the collecting volume must be eliminated. One of the sources of scattered photons is the chamber's diaphragm. In this paper, the diaphragm scattering correction factor, k dia , and the diaphragm transmission correction factor, k tr , were introduced. These factors represent corrections to the measured charge (or current) for the photons scattered from the diaphragm surface and the photons penetrated through the diaphragm volume, respectively. The k dia and k tr values were estimated by Monte Carlo simulations. The simulations were performed for the mono-energetic photons in the energy range of 20 - 300keV. According to the simulation results, in this energy range, the k dia values vary between 0.9997 and 0.9948, and k tr values decrease from 1.0000 to 0.9965. The corrections grow in significance with increasing energy of the primary photons. Copyright © 2017 Elsevier Ltd. All rights reserved.
Small passenger car transmission test: Dodge Omni A-404 transmission
NASA Technical Reports Server (NTRS)
Bujold, M. P.
1980-01-01
The small passenger car transmission test was initiated to supply electric vehicle manufacturers with technical information regarding the performance of commercially available transmissions. This transmission was tested in accordance with a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the mid eighty percent range for both drive performance test and coast performance tests.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, X; Wang, Y
Purpose: Due to limited commissioning time, we previously only released our True beam non-FFF mode for prostate treatment. Clinical demand now pushes us to release the non-FFF mode for SRT/SBRT treatment. When re-planning on True beam previously treated SRT/SBRT cases on iX machine we found the patient specific QA pass rate was worse than iX’s, though the 2Gy/fx prostate Result had been as good. We hypothesize that in TPS the True beam DLG and MLC transmission values, of those measured during commissioning could not yet provide accurate SRS/SBRT dosimetry. Hence this work is to investigate how the TPS DLG andmore » transmission value affects Rapid Arc plans’ dosimetric accuracy. Methods: We increased DLG and transmission value of True beam in TPS such that their percentage differences against the measured matched those of iX’s. We re-calculated 2 SRT, 1 SBRT and 2 prostate plans, performed patient specific QA on these new plans and compared the results to the previous. Results: With DLG and transmission value set respectively 40 and 8% higher than the measured, the patient specific QA pass rate (at 3%/3mm) improved from 95.0 to 97.6% vs previous iX’s 97.8% in the case of SRT. In the case of SBRT, the pass rate improved from 75.2 to 93.9% vs previous iX’s 92.5%. In the case of prostate, the pass rate improved from 99.3 to 100%. The maximum dose difference in plans before and after adjusting DLG and transmission was approximately 1% of the prescription dose among all plans. Conclusion: The impact of adjusting DLG and transmission value on dosimetry might be the same among all Rapid Arc plans regardless hypofractionated or not. The large variation observed in patient specific QA pass rate might be due to the data analysis method in the QA software being more sensitive to hypofractionated plans.« less
Kharrati, Hedi; Agrebi, Amel; Karoui, Mohamed Karim
2012-10-01
A simulation of buildup factors for ordinary concrete, steel, lead, plate glass, lead glass, and gypsum wallboard in broad beam geometry for photons energies from 10 keV to 150 keV at 5 keV intervals is presented. Monte Carlo N-particle radiation transport computer code has been used to determine the buildup factors for the studied shielding materials. An example concretizing the use of the obtained buildup factors data in computing the broad beam transmission for tube potentials at 70, 100, 120, and 140 kVp is given. The half value layer, the tenth value layer, and the equilibrium tenth value layer are calculated from the broad beam transmission for these tube potentials. The obtained values compared with those calculated from the published data show the ability of these data to predict shielding transmission curves. Therefore, the buildup factors data can be combined with primary, scatter, and leakage x-ray spectra to provide a computationally based solution to broad beam transmission for barriers in shielding x-ray facilities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kharrati, Hedi; Agrebi, Amel; Karoui, Mohamed Karim
2012-10-15
Purpose: A simulation of buildup factors for ordinary concrete, steel, lead, plate glass, lead glass, and gypsum wallboard in broad beam geometry for photons energies from 10 keV to 150 keV at 5 keV intervals is presented. Methods: Monte Carlo N-particle radiation transport computer code has been used to determine the buildup factors for the studied shielding materials. Results: An example concretizing the use of the obtained buildup factors data in computing the broad beam transmission for tube potentials at 70, 100, 120, and 140 kVp is given. The half value layer, the tenth value layer, and the equilibrium tenthmore » value layer are calculated from the broad beam transmission for these tube potentials. Conclusions: The obtained values compared with those calculated from the published data show the ability of these data to predict shielding transmission curves. Therefore, the buildup factors data can be combined with primary, scatter, and leakage x-ray spectra to provide a computationally based solution to broad beam transmission for barriers in shielding x-ray facilities.« less
Whole-body vibration exposure study in U.S. railroad locomotives--an ergonomic risk assessment.
Johanning, Eckardt; Fischer, Siegfried; Christ, Eberhard; Göres, Benno; Landsbergis, Paul
2002-01-01
Whole-body vibration exposure of locomotive engineers and the vibration attenuation of seats in 22 U.S. locomotives (built between 1959 and 2000) was studied during normal revenue service and following international measurement guidelines. Triaxial vibration measurements (duration mean 155 min, range 84-383 min) on the seat and on the floor were compared. In addition to the basic vibration evaluation (aw rms), the vector sum (av), the maximum transient vibration value (MTVV/aw), the vibration dose value (VDV/(aw T1/4)), and the vibration seat effective transmissibility factor (SEAT) were calculated. The power spectral densities are also reported. The mean basic vibration level (aw rms) was for the fore-aft axis x = 0.18 m/sec2, the lateral axis y = 0.28 m/sec2, and the vertical axis z = 0.32 m/sec2. The mean vector sum was 0.59 m/sec2 (range 0.27 to 1.44). The crest factors were generally at or above 9 in the horizontal and vertical axis. The mean MTVV/aw was 5.3 (x), 5.1 (y), and 4.8 (z), and the VDV/(aw T1/4) values ranged from 1.32 to 2.3 (x-axis), 1.33 to 1.7 (y-axis), and 1.38 to 1.86 (z-axis), generally indicating high levels of shocks. The mean seat transmissibility factor (SEAT) was 1.4 (x) and 1.2 (y) and 1 (z), demonstrating a general ineffectiveness of any of the seat suspension systems. In conclusion, these data indicate that locomotive rides are characterized by relatively high shock content (acceleration peaks) of the vibration signal in all directions. Locomotive vertical and lateral vibrations are similar, which appears to be characteristic for rail vehicles compared with many road/off-road vehicles. Tested locomotive cab seats currently in use (new or old) appear inadequate to reduce potentially harmful vibration and shocks transmitted to the seated operator, and older seats particularly lack basic ergonomic features regarding adjustability and postural support.
Davies, Bethan; Anderson, Sarah-Jane; Turner, Katy M E; Ward, Helen
2014-01-30
Transmission dynamic models linked to economic analyses often form part of the decision making process when introducing new chlamydia screening interventions. Outputs from these transmission dynamic models can vary depending on the values of the parameters used to describe the infection. Therefore these values can have an important influence on policy and resource allocation. The risk of progression from infection to pelvic inflammatory disease has been extensively studied but the parameters which govern the transmission dynamics are frequently neglected. We conducted a systematic review of transmission dynamic models linked to economic analyses of chlamydia screening interventions to critically assess the source and variability of the proportion of infections that are asymptomatic, the duration of infection and the transmission probability. We identified nine relevant studies in Pubmed, Embase and the Cochrane database. We found that there is a wide variation in their natural history parameters, including an absolute difference in the proportion of asymptomatic infections of 25% in women and 75% in men, a six-fold difference in the duration of asymptomatic infection and a four-fold difference in the per act transmission probability. We consider that much of this variation can be explained by a lack of consensus in the literature. We found that a significant proportion of parameter values were referenced back to the early chlamydia literature, before the introduction of nucleic acid modes of diagnosis and the widespread testing of asymptomatic individuals. In conclusion, authors should use high quality contemporary evidence to inform their parameter values, clearly document their assumptions and make appropriate use of sensitivity analysis. This will help to make models more transparent and increase their utility to policy makers.
Wanja, Elizabeth; Achilla, Rachel; Obare, Peter; Adeny, Rose; Moseti, Caroline; Otieno, Victor; Morang'a, Collins; Murigi, Ephantus; Nyamuni, John; Monthei, Derek R; Ogutu, Bernhards; Buff, Ann M
2017-05-25
One objective of the Kenya National Malaria Strategy 2009-2017 is scaling access to prompt diagnosis and effective treatment. In 2013, a quality assurance (QA) pilot was implemented to improve accuracy of malaria diagnostics at selected health facilities in low-transmission counties of Kenya. Trends in malaria diagnostic and QA indicator performance during the pilot are described. From June to December 2013, 28 QA officers provided on-the-job training and mentoring for malaria microscopy, malaria rapid diagnostic tests and laboratory QA/quality control (QC) practices over four 1-day visits at 83 health facilities. QA officers observed and recorded laboratory conditions and practices and cross-checked blood slides for malaria parasite presence, and a portion of cross-checked slides were confirmed by reference laboratories. Eighty (96%) facilities completed the pilot. Among 315 personnel at pilot initiation, 13% (n = 40) reported malaria diagnostics training within the previous 12 months. Slide positivity ranged from 3 to 7%. Compared to the reference laboratory, microscopy sensitivity ranged from 53 to 96% and positive predictive value from 39 to 53% for facility staff and from 60 to 96% and 52 to 80%, respectively, for QA officers. Compared to reference, specificity ranged from 88 to 98% and negative predictive value from 98 to 99% for health-facility personnel and from 93 to 99% and 99%, respectively, for QA officers. The kappa value ranged from 0.48-0.66 for facility staff and 0.57-0.84 for QA officers compared to reference. The only significant test performance improvement observed for facility staff was for specificity from 88% (95% CI 85-90%) to 98% (95% CI 97-99%). QA/QC practices, including use of positive-control slides, internal and external slide cross-checking and recording of QA/QC activities, all increased significantly across the pilot (p < 0.001). Reference material availability also increased significantly; availability of six microscopy job aids and seven microscopy standard operating procedures increased by a mean of 32 percentage points (p < 0.001) and 38 percentage points (p < 0.001), respectively. Significant gains were observed in malaria QA/QC practices over the pilot. However, these advances did not translate into improved accuracy of malaria diagnostic performance perhaps because of the limited duration of the QA pilot implementation.
Maximum Interconnectedness and Availability for Directional Airborne Range Extension Networks
2016-08-29
2 IEEE TRANSACTIONS ON WIRELESS COMMUNICATIONS I. INTRODUCTION Tactical military networks both on land and at sea often have restricted transmission ...ranges due to limits on terminal transmission power , geographic features that block line-of-sight, and poor over-the-horizon signal propagation...IEEE TRANSACTIONS ON WIRELESS COMMUNICATIONS 1 Maximum Interconnectedness and Availability for Directional Airborne Range Extension Networks Thomas
Role of alloying elements on twin growth and twin transmission in magnesium alloys
Kumar, Mariyappan Arul; Beyerlein, Irene Jane; Lebensohn, Ricardo A.; ...
2017-08-24
A spatially-resolved crystal plasticity Fast Fourier Transform (FFT)-based model is employed to study the effect of alloying addition on twin thickening and twin transmission in hexagonal close packed (HCP) magnesium. In the simulations, the influence of alloying additions is represented through the differences in the critical resolved shear stress (CRSS) of different slip and twinning modes. The results show that for the same grain orientation, twin type and boundary conditions, anisotropy in the CRSS values have a significant effect on twin thickening and twin transmission. Those with large differences in CRSS favor both twin thickening and twin transmission, and vicemore » versa for those with small differences. Furthermore, less difference among the CRSS values enhances the dependence of thickening and transmission on the neighboring grain orientation.« less
Role of alloying elements on twin growth and twin transmission in magnesium alloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Mariyappan Arul; Beyerlein, Irene Jane; Lebensohn, Ricardo A.
A spatially-resolved crystal plasticity Fast Fourier Transform (FFT)-based model is employed to study the effect of alloying addition on twin thickening and twin transmission in hexagonal close packed (HCP) magnesium. In the simulations, the influence of alloying additions is represented through the differences in the critical resolved shear stress (CRSS) of different slip and twinning modes. The results show that for the same grain orientation, twin type and boundary conditions, anisotropy in the CRSS values have a significant effect on twin thickening and twin transmission. Those with large differences in CRSS favor both twin thickening and twin transmission, and vicemore » versa for those with small differences. Furthermore, less difference among the CRSS values enhances the dependence of thickening and transmission on the neighboring grain orientation.« less
NASA Astrophysics Data System (ADS)
Won, Changdok; Hong, Hanlie; Cheng, Feng; Fang, Qian; Wang, Chaowen; Zhao, Lulu; Churchman, Gordon Jock
2018-03-01
To understand climate changes recorded in the Luochuan loess-palaeosols, Shaanxi province, northwestern China, clay mineralogy was studied using X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM), and scanning electron microscopy (SEM) methods. XRD results show that clay mineral compositions in the Luochuan loess-palaeosols are dominantly illite, with minor chlorite, kaolinite, smectite, and illite-smectite mixed-layer clays (I/S). Illite is the most abundant species in the sediments, with a content of 61%-83%. The content of chlorite ranges from 5%-22%, and the content of kaolinite ranges from 5%-19%. Smectite (or I/S) occurs discontinuously along the loess profile, with a content of 0-8%. The Kübler index of illite (IC) ranges from 0.255°-0.491°, and the illite chemical index (ICI) ranges from 0.294-0.394. The CIA values of the loesspalaeosols are 61.9-69.02, and the R3+/(R3+ + R2+ + M+) values are 0.508-0.589. HRTEM observations show that transformation of illite to illite-smectite has occurred in both the loess and palaeosol, suggesting that the Luochuan loess-palaeosols have experienced a certain degree of chemical weathering. The Luochuan loess-palaeosols have the same clay mineral assemblage along the profile. However, the relative contents of clay mineral species, CIA, ICI, and IC values fluctuate frequently along the profile, and all these parameters display a similar trend. Moreover, climate changes suggested by the clay index are consistent with variations in the deep-sea δ18O records and the magnetic susceptibility value, and thus, climate changes in the Luochuan region have been controlled by global climate change.
222Rn transport in a fractured crystalline rock aquifer: Results from numerical simulations
Folger, P.F.; Poeter, E.; Wanty, R.B.; Day, W.; Frishman, D.
1997-01-01
Dissolved 222Rn concentrations in ground water from a small wellfield underlain by fractured Middle Proterozoic Pikes Peak Granite southwest of Denver, Colorado range from 124 to 840 kBq m-3 (3360-22700 pCi L-1). Numerical simulations of flow and transport between two wells show that differences in equivalent hydraulic aperture of transmissive fractures, assuming a simplified two-fracture system and the parallel-plate model, can account for the different 222Rn concentrations in each well under steady-state conditions. Transient flow and transport simulations show that 222Rn concentrations along the fracture profile are influenced by 222Rn concentrations in the adjoining fracture and depend on boundary conditions, proximity of the pumping well to the fracture intersection, transmissivity of the conductive fractures, and pumping rate. Non-homogeneous distribution (point sources) of 222Rn parent radionuclides, uranium and 226Ra, can strongly perturb the dissolved 222Rn concentrations in a fracture system. Without detailed information on the geometry and hydraulic properties of the connected fracture system, it may be impossible to distinguish the influence of factors controlling 222Rn distribution or to determine location of 222Rn point sources in the field in areas where ground water exhibits moderate 222Rn concentrations. Flow and transport simulations of a hypothetical multifracture system consisting of ten connected fractures, each 10 m in length with fracture apertures ranging from 0.1 to 1.0 mm, show that 222Rn concentrations at the pumping well can vary significantly over time. Assuming parallel-plate flow, transmissivities of the hypothetical system vary over four orders of magnitude because transmissivity varies with the cube of fracture aperture. The extreme hydraulic heterogeneity of the simple hypothetical system leads to widely ranging 222Rn values, even assuming homogeneous distribution of uranium and 226Ra along fracture walls. Consequently, it is concluded that 222Rn concentrations vary, not only with the geometric and stress factors noted above, but also according to local fracture aperture distribution, local groundwater residence time, and flux of 222Rn from parent radionuclides along fracture walls.
The feature extraction of "cat-eye" targets based on bi-spectrum
NASA Astrophysics Data System (ADS)
Zhang, Tinghua; Fan, Guihua; Sun, Huayan
2016-10-01
In order to resolve the difficult problem of detection and identification of optical targets in complex background or in long-distance transmission, this paper mainly study the range profiles of "cat-eye" targets using bi-spectrum. For the problems of laser echo signal attenuation serious and low Signal-Noise Ratio (SNR), the multi-pulse laser signal echo signal detection algorithm which is based on high-order cumulant, filter processing and the accumulation of multi-pulse is proposed. This could improve the detection range effectively. In order to extract the stable characteristics of the one-dimensional range profile coming from the cat-eye targets, a method is proposed which extracts the bi-spectrum feature, and uses the singular value decomposition to simplify the calculation. Then, by extracting data samples of different distance, type and incidence angle, verify the stability of the eigenvector and effectiveness extracted by bi-spectrum.
Estimating the reproductive numbers for the 2008–2009 cholera outbreaks in Zimbabwe
Mukandavire, Zindoga; Liao, Shu; Wang, Jin; Gaff, Holly; Smith, David L.; Morris, J. Glenn
2011-01-01
Cholera remains an important global cause of morbidity and mortality, capable of causing periodic epidemic disease. Beginning in August 2008, a major cholera epidemic occurred in Zimbabwe, with 98,585 reported cases and 4,287 deaths. The dynamics of such outbreaks, particularly in nonestuarine regions, are not well understood. We explored the utility of mathematical models in understanding transmission dynamics of cholera and in assessing the magnitude of interventions necessary to control epidemic disease. Weekly data on reported cholera cases were obtained from the Zimbabwe Ministry of Health and Child Welfare (MoHCW) for the period from November 13, 2008 to July 31, 2009. A mathematical model was formulated and fitted to cumulative cholera cases to estimate the basic reproductive numbers R0 and the partial reproductive numbers from all 10 provinces for the 2008–2009 Zimbabwe cholera epidemic. Estimated basic reproductive numbers were highly heterogeneous, ranging from a low value of just above unity to 2.72. Partial reproductive numbers were also highly heterogeneous, suggesting that the transmission routes varied by province; human-to-human transmission accounted for 41–95% of all transmission. Our models suggest that the underlying patterns of cholera transmission varied widely from province to province, with a corresponding variation in the amenability of outbreaks in different provinces to control measures such as immunization. These data underscore the heterogeneity of cholera transmission dynamics, potentially linked to differences in environment, socio-economic conditions, and cultural practices. The lack of traditional estuarine reservoirs combined with these estimates of R0 suggest that mass vaccination against cholera deployed strategically in Zimbabwe and surrounding regions could prevent future cholera epidemics and eventually eliminate cholera from the region. PMID:21518855
Global and local threshold in a metapopulational SEIR model with quarantine
NASA Astrophysics Data System (ADS)
Gomes, Marcelo F. C.; Rossi, Luca; Pastore Y Piontti, Ana; Vespignani, Alessandro
2013-03-01
Diseases which have the possibility of transmission before the onset of symptoms pose a challenging threat to healthcare since it is hard to track spreaders and implement quarantine measures. More precisely, one main concerns regarding pandemic spreading of diseases is the prediction-and eventually control-of local outbreaks that will trigger a global invasion of a particular disease. We present a metapopulation disease spreading model with transmission from both symptomatic and asymptomatic agents and analyze the role of quarantine measures and mobility processes between subpopulations. We show that, depending on the disease parameters, it is possible to separate in the parameter space the local and global thresholds and study the system behavior as a function of the fraction of asymptomatic transmissions. This means that it is possible to have a range of parameters values where although we do not achieve local control of the outbreak it is possible to control the global spread of the disease. We validate the analytic picture in data-driven model that integrates commuting, air traffic flow and detailed information about population size and structure worldwide. Laboratory for the Modeling of Biological and Socio-Technical Systems (MoBS)
Vibration characteristics of bone conducted sound in vitro.
Stenfelt, S; Håkansson, B; Tjellström, A
2000-01-01
A dry skull added with damping material was used to investigate the vibratory pattern of bone conducted sound. Three orthogonal vibration responses of the cochleae were measured, by means of miniature accelerometers, in the frequency range 0.1-10 kHz. The exciter was attached to the temporal, parietal, and frontal bones, one at the time. In the transmission response to the ipsilateral cochlea, a profound low frequency antiresonance (attenuation) was found, verified psycho-acoustically, and shown to yield a distinct lateralization effect. It was also shown that, for the ipsilateral side, the direction of excitation coincides with that of maximum response. At the contralateral cochlea, no such dominating response direction was found for frequencies above the first skull resonance. An overall higher response level was achieved, for the total energy transmission in general and specifically for the direction of excitation, at the ipsilateral cochlea when the transducer was attached to the excitation point closest to the cochlea. The transranial attenuation was found to be frequency dependent, with values from -5 to 10 dB for the energy transmission and -30 to 40 dB for measurements in a single direction, with a tendency toward higher attenuation at the higher frequencies.
NASA Astrophysics Data System (ADS)
Kang, Ming; Zhu, Weiren; Rukhlenko, Ivan D.
2017-12-01
The exceptional point (EP), which is one of the most important branch-type singularities exclusive to non-Hermitian systems, has been observed recently in various synthetic materials, giving rise to counterintuitive phenomena due to the nontrivial topology of the EP. Here, we present a direct experimental observation of the topological structure of the EPs via the angle-resolved transmission measurement of a hybridized metamaterial. Both eigenvalues and eigenvectors show branch-point singularities in the investigated biparametric space of frequency and incident angle. Importantly, the angle-resolved transmission coefficients provide all the information about the eigenvalues as well as the corresponding eigenvectors in the biparametric space, revealing the nontrivial topological structure of the EP, such as mode switching and the topological phase for a parameter loop encircling the EP. It is shown that the appearance of the EP in the scattering matrix is related directly to the perfect unidirectional transmission and the chirality of the EP corresponds to the maximum or minimum value of the asymmetric factor. Our investigation uncovers the capabilities of metamaterials for exploring the physics of EPs and their potential for having extreme optical properties, which provide potential applications in the spectral band ranging from microwaves to visible frequencies.
Small passenger car transmission test: Mercury Lynx ATX transmission
NASA Technical Reports Server (NTRS)
Bujold, M. P.
1981-01-01
The testing of a Mercury Lynx automatic transmission is reported. The transmission was tested in accordance with a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these conditions, the transmission attained maximum efficiencies in the mid-ninety percent range both for drive performance test and coast performance tests. The torque, speed, and efficiency curves are presented, which provide the complete performance characteristics for the Mercury Lynx automatic transmission.
The Relationship Between School Holidays and Transmission of Influenza in England and Wales
Jackson, Charlotte; Vynnycky, Emilia; Mangtani, Punam
2016-01-01
Abstract School closure is often considered as an influenza control measure, but its effects on transmission are poorly understood. We used 2 approaches to estimate how school holidays affect the contact parameter (the per capita rate of contact sufficient for infection transmission) for influenza using primary care data from England and Wales (1967–2000). Firstly, we fitted an age-structured susceptible-infectious-recovered model to each year's data to estimate the proportional change in the contact parameter during school holidays as compared with termtime. Secondly, we calculated the percentage difference in the contact parameter between holidays and termtime from weekly values of the contact parameter, estimated directly from simple mass-action models. Estimates were combined using random-effects meta-analysis, where appropriate. From fitting to the data, the difference in the contact parameter among children aged 5–14 years during holidays as compared with termtime ranged from a 36% reduction to a 17% increase; estimates were too heterogeneous for meta-analysis. Based on the simple mass-action model, the contact parameter was 17% (95% confidence interval: 10, 25) lower during holidays than during termtime. Results were robust to the assumed proportions of infections that were reported and individuals who were susceptible when the influenza season started. We conclude that school closure may reduce transmission during influenza outbreaks. PMID:27744384
1980-05-01
102 17. A Feasibility Study: Application of Lidar Transmission Measurement in the Slant Visual Range Problem - Ronald H. Kohl 108 18. Multiwavelength ...discrete filters gives greater spectral resolution over the whole band. The success of the Model 14-703 System led to the development of a more advanced...REQUIREMENTS Success in a wide range of atmospheric transmission measurement applications has led to the reqi,-st for more advanced capabilities which are listed
Nelson, Richard E; Jones, Makoto; Leecaster, Molly; Samore, Matthew H; Ray, William; Huttner, Angela; Huttner, Benedikt; Khader, Karim; Stevens, Vanessa W; Gerding, Dale; Schweizer, Marin L; Rubin, Michael A
2016-01-01
A number of strategies exist to reduce Clostridium difficile (C. difficile) transmission. We conducted an economic evaluation of "bundling" these strategies together. We constructed an agent-based computer simulation of nosocomial C. difficile transmission and infection in a hospital setting. This model included the following components: interactions between patients and health care workers; room contamination via C. difficile shedding; C. difficile hand carriage and removal via hand hygiene; patient acquisition of C. difficile via contact with contaminated rooms or health care workers; and patient antimicrobial use. Six interventions were introduced alone and "bundled" together: (a) aggressive C. difficile testing; (b) empiric isolation and treatment of symptomatic patients; (c) improved adherence to hand hygiene and (d) contact precautions; (e) improved use of soap and water for hand hygiene; and (f) improved environmental cleaning. Our analysis compared these interventions using values representing 3 different scenarios: (1) base-case (BASE) values that reflect typical hospital practice, (2) intervention (INT) values that represent implementation of hospital-wide efforts to reduce C. diff transmission, and (3) optimal (OPT) values representing the highest expected results from strong adherence to the interventions. Cost parameters for each intervention were obtained from published literature. We performed our analyses assuming low, normal, and high C. difficile importation prevalence and transmissibility of C. difficile. INT levels of the "bundled" intervention were cost-effective at a willingness-to-pay threshold of $100,000/quality-adjusted life-year in all importation prevalence and transmissibility scenarios. OPT levels of intervention were cost-effective for normal and high importation prevalence and transmissibility scenarios. When analyzed separately, hand hygiene compliance, environmental decontamination, and empiric isolation and treatment were the interventions that had the greatest impact on both cost and effectiveness. A combination of available interventions to prevent CDI is likely to be cost-effective but the cost-effectiveness varies for different levels of intensity of the interventions depending on epidemiological conditions such as C. difficile importation prevalence and transmissibility.
Randolph, S E; Craine, N G
1995-11-01
Models of tick-borne diseases must take account of the particular biological features of ticks that contrast with those of insect vectors. A general framework is proposed that identifies the parameters of the transmission dynamics of tick-borne diseases to allow a quantitative assessment of the relative contributions of different host species and alternative transmission routes to the basic reproductive number, Ro, of such diseases. Taking the particular case of the transmission of the Lyme borreliosis spirochaete, Borrelia burgdorferi, by Ixodes ticks in Europe, and using the best, albeit still inadequate, estimates of the parameter values and a set of empirical data from Thetford Forest, England, we show that squirrels and the transovarial transmission route make quantitatively very significant contributions to Ro. This approach highlights the urgent need for more robust estimates of certain crucial parameter values, particularly the coefficients of transmission between ticks and vertebrates, before we can progress to full models that incorporate seasonality and heterogeneity among host populations for the natural dynamics of transmission of borreliosis and other tick-borne diseases.
Nelms, D.L.; Harlow, G.E.; Hayes, Donald C.
1995-01-01
Growth within the Valley and Ridge, Blue Ridge, and Piedmont Physiographic Provinces of Virginia has focussed concern about allocation of surface-water flow and increased demands on the ground-water resources. The purpose of this report is to (1) describe the base-flow characteristics of streams, (2) identify regional differences in these flow characteristics, and (3) describe, if possible, the potential surface-water and ground-water yields of basins on the basis of the base-flow character- istics. Base-flow characteristics are presented for streams in the Valley and Ridge, Blue Ridge, and Piedmont Physiographic Provinces of Virginia. The provinces are separated into five regions: (1) Valley and Ridge, (2) Blue Ridge, (3) Piedmont/Blue Ridge transition, (4) Piedmont northern, and (5) Piedmont southern. Different flow statistics, which represent streamflows predominantly comprised of base flow, were determined for 217 continuous-record streamflow-gaging stations from historical mean daily discharge and for 192 partial-record streamflow-gaging stations by means of correlation of discharge measurements. Variability of base flow is represented by a duration ratio developed during this investigation. Effective recharge rates were also calculated. Median values for the different flow statistics range from 0.05 cubic foot per second per square mile for the 90-percent discharge on the streamflow-duration curve to 0.61 cubic foot per second per square mile for mean base flow. An excellent estimator of mean base flow for the Piedmont/Blue Ridge transition region and Piedmont southern region is the 50-percent discharge on the streamflow-duration curve, but tends to under- estimate mean base flow for the remaining regions. The base-flow variability index ranges from 0.07 to 2.27, with a median value of 0.55. Effective recharge rates range from 0.07 to 33.07 inches per year, with a median value of 8.32 inches per year. Differences in the base-flow characteristics exist between regions. The median discharges for the Valley and Ridge, Blue Ridge, and Piedmont/Blue Ridge transition regions are higher than those for the Piedmont regions. Results from statistical analysis indicate that the regions can be ranked in terms of base-flow characteristics from highest to lowest as follows: (1) Piedmont/Blue Ridge transition, (2) Valley and Ridge and Blue Ridge, (3) Piedmont southern, and (4) Piedmont northern. The flow statistics are consistently higher and the values for base-flow variability are lower for basins within the Piedmont/Blue Ridge transition region relative to those from the other regions, whereas the basins within the Piedmont northern region show the opposite pattern. The group rankings of the base-flow characteristics were used to designate the potential surface-water yield for the regions. In addition, an approach developed for this investigation assigns a rank for potential surface- water yield to a basin according to the quartiles in which the values for the base-flow character- istics are located. Both procedures indicate that the Valley and Ridge, Blue Ridge, and Piedmont/Blue Ridge transition regions have moderate-to-high potential surface-water yield and the Piedmont regions have low-to-moderate potential surface- water yield. In order to indicate potential ground-water yield from base-flow characteristics, aquifer properties for 51 streamflow-gaging stations with continuous record of streamflow data were determined by methods that use streamflow records and basin characteristics. Areal diffusivity ranges from 17,100 to 88,400 feet squared per day, with a median value of 38,400 feet squared per day. Areal transmissivity ranges from 63 to 830 feet squared per day, with a median value of 270 feet squared per day. Storage coefficients, which were estimated by dividing areal transmissivity by areal diffusivity, range from approximately 0.001 to 0.019 (dimensionless), with a median value of 0.007. The median value for areal diffus
A Quantitative Transmission Line Experiment
ERIC Educational Resources Information Center
Johnston, D. C.; Silbernagel, B. G.
1969-01-01
Describes modifications of a commercially available strip-type transmission line, which makes possible reproducible measurements of standing waves on the line. Experimental data yield values for the characteristic impedance, phase velocity and line wavelength of radiation in the transmission line, and the dielectric constant of material in the…
The Transmission of Values and the Transition into Adulthood within the Context of Home Education
ERIC Educational Resources Information Center
Hoelzle, Braden Ryan
2013-01-01
The current study explored the transmission of values and beliefs and the transition into adulthood within the context of home education through semi-structured open-ended interviews with four formerly home-educated young adults. The interviewees described their relationship with their parents as strong both now and while homeschooling but the…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thiede, Christian, E-mail: christian.thiede@uni-muenster.de; Schmidt, Anke B.; Donath, Markus
2015-08-15
Bandpass photon detectors are widely used in inverse photoemission in the isochromat mode at energies in the vacuum-ultraviolet spectral range. The energy bandpass of gas-filled counters is usually formed by the ionization threshold of the counting gas as high-pass filter and the transmission cutoff of an alkaline earth fluoride window as low-pass filter. The transmission characteristics of the window have, therefore, a crucial impact on the detector performance. We present transmission measurements in the vacuum-ultraviolet spectral range for alkaline earth fluoride window crystals in the vicinity of the transmission cutoff as a function of crystal purity, surface finish, surface contamination,more » temperature, and thickness. Our findings reveal that the transmission characteristics of the window crystal and, thus, the detector performance depend critically on these window parameters.« less
NASA Astrophysics Data System (ADS)
Bock, Carlos; Prat, Josep
2005-04-01
A hybrid WDM/TDM PON architecture implemented by means of two cascaded Arrayed Waveguide Gratings (AWG) is presented. Using the Free Spectral Range (FSR) periodicity of AWGs we transmit unicast and multicast traffic on different wavelengths to each Optical Network Unit (ONU). The OLT is equipped with two laser stacks, a tunable one for unicast transmission and a fixed one for multicast transmission. We propose the ONU to be reflective in order to avoid any light source at the Costumer Premises Equipment (CPE). Optical transmission tests demonstrate correct transmission at 2.5 Gbps up to 30 km.
Metal Standards for Waveguide Characterization of Materials
NASA Technical Reports Server (NTRS)
Lambert, Kevin M.; Kory, Carol L.
2009-01-01
Rectangular-waveguide inserts that are made of non-ferromagnetic metals and are sized and shaped to function as notch filters have been conceived as reference standards for use in the rectangular- waveguide method of characterizing materials with respect to such constitutive electromagnetic properties as permittivity and permeability. Such standards are needed for determining the accuracy of measurements used in the method, as described below. In this method, a specimen of a material to be characterized is cut to a prescribed size and shape and inserted in a rectangular- waveguide test fixture, wherein the specimen is irradiated with a known source signal and detectors are used to measure the signals reflected by, and transmitted through, the specimen. Scattering parameters [also known as "S" parameters (S11, S12, S21, and S22)] are computed from ratios between the transmitted and reflected signals and the source signal. Then the permeability and permittivity of the specimen material are derived from the scattering parameters. Theoretically, the technique for calculating the permeability and permittivity from the scattering parameters is exact, but the accuracy of the results depends on the accuracy of the measurements from which the scattering parameters are obtained. To determine whether the measurements are accurate, it is necessary to perform comparable measurements on reference standards, which are essentially specimens that have known scattering parameters. To be most useful, reference standards should provide the full range of scattering-parameter values that can be obtained from material specimens. Specifically, measurements of the backscattering parameter (S11) from no reflection to total reflection and of the forward-transmission parameter (S21) from no transmission to total transmission are needed. A reference standard that functions as a notch (band-stop) filter can satisfy this need because as the signal frequency is varied across the frequency range for which the filter is designed, the scattering parameters vary over the ranges of values between the extremes of total reflection and total transmission. A notch-filter reference standard in the form of a rectangular-waveguide insert that has a size and shape similar to that of a material specimen is advantageous because the measurement configuration used for the reference standard can be the same as that for a material specimen. Typically a specimen is a block of material that fills a waveguide cross-section but occupies only a small fraction of the length of the waveguide. A reference standard of the present type (see figure) is a metal block that fills part of a waveguide cross section and contains a slot, the long dimension of which can be chosen to tailor the notch frequency to a desired value. The scattering parameters and notch frequency can be estimated with high accuracy by use of commercially available electromagnetic-field-simulating software. The block can be fabricated to the requisite precision by wire electrical-discharge machining. In use, the accuracy of measurements is determined by comparison of (1) the scattering parameters calculated from the measurements with (2) the scattering parameters calculated by the aforementioned software.
Electric vehicle drive train with direct coupling transmission
Tankersley, J.B.; Boothe, R.W.; Konrad, C.E.
1995-04-04
An electric vehicle drive train includes an electric motor and an associated speed sensor, a transmission operable in a speed reduction mode or a direct coupled mode, and a controller responsive to the speed sensor for operating the transmission in the speed reduction mode when the motor is below a predetermined value, and for operating the motor in the direct coupled mode when the motor speed is above a predetermined value. The controller reduces the speed of the motor, such as by regeneratively braking the motor, when changing from the speed reduction mode to the direct coupled mode. The motor speed may be increased when changing from the direct coupled mode to the speed reduction mode. The transmission is preferably a single stage planetary gearbox. 6 figures.
Electric vehicle drive train with direct coupling transmission
Tankersley, Jerome B.; Boothe, Richard W.; Konrad, Charles E.
1995-01-01
An electric vehicle drive train includes an electric motor and an associated speed sensor, a transmission operable in a speed reduction mode or a direct coupled mode, and a controller responsive to the speed sensor for operating the transmission in the speed reduction mode when the motor is below a predetermined value, and for operating the motor in the direct coupled mode when the motor speed is above a predetermined value. The controller reduces the speed of the motor, such as by regeneratively braking the motor, when changing from the speed reduction mode to the direct coupled mode. The motor speed may be increased when changing from the direct coupled mode to the speed reduction mode. The transmission is preferably a single stage planetary gearbox.
Microwave transmission system for space power
NASA Technical Reports Server (NTRS)
Dickinson, R. M.
1976-01-01
A small total system model and a large subsystem element similar to those that could be eventually used for wireless power transmission experiments in space have been successfully demonstrated by NASA. The short range, relatively low-power laboratory system achieved a dc-to-dc transmission efficiency of 54%. A separate high-power-level receiving subsystem, tested over a 1.54-km range at Goldstone, California, has achieved the transportation of over 30 kW of dc output power. Both tests used 12-cm wavelength microwaves.
Estimation of the transmissivity of thin leaky-confined aquifers from single-well pumping tests
NASA Astrophysics Data System (ADS)
Worthington, Paul F.
1981-01-01
Data from the quasi-equilibrium phases of a step-drawdown test are used to evaluate the coefficient of non-linear head losses subject to the assumption of a constant effective well radius. After applying a well-loss correction to the observed drawdowns of the first step, an approximation method is used to estimate a pseudo-transmissivity of the aquifer from a single value of time-variant drawdown. The pseudo-transmissivities computed for each of a sequence of values of time pass through a minimum when there is least manifestation of casing-storage and leakage effects, phenomena to which pumping-test data of this kind are particularly susceptible. This minimum pseudo-transmissivity, adjusted for partial penetration effects where appropriate, constitutes the best possible estimate of aquifer transmissivity. The ease of application of the overall procedure is illustrated by a practical example.
Herrera, Carlos M; Alonso, Conchita; Medrano, Mónica; Pérez, Ricardo; Bazaga, Pilar
2018-04-01
The ecological and evolutionary significance of natural epigenetic variation (i.e., not based on DNA sequence variants) variation will depend critically on whether epigenetic states are transmitted from parents to offspring, but little is known on epigenetic inheritance in nonmodel plants. We present a quantitative analysis of transgenerational transmission of global DNA cytosine methylation (= proportion of all genomic cytosines that are methylated) and individual epigenetic markers (= methylation status of anonymous MSAP markers) in the shrub Lavandula latifolia. Methods based on parent-offspring correlations and parental variance component estimation were applied to epigenetic features of field-growing plants ('maternal parents') and greenhouse-grown progenies. Transmission of genetic markers (AFLP) was also assessed for reference. Maternal parents differed significantly in global DNA cytosine methylation (range = 21.7-36.7%). Greenhouse-grown maternal families differed significantly in global methylation, and their differences were significantly related to maternal origin. Methylation-sensitive amplified polymorphism (MSAP) markers exhibited significant transgenerational transmission, as denoted by significant maternal variance component of marker scores in greenhouse families and significant mother-offspring correlations of marker scores. Although transmission-related measurements for global methylation and MSAP markers were quantitatively lower than those for AFLP markers taken as reference, this study has revealed extensive transgenerational transmission of genome-wide global cytosine methylation and anonymous epigenetic markers in L. latifolia. Similarity of results for global cytosine methylation and epigenetic markers lends robustness to this conclusion, and stresses the value of considering both types of information in epigenetic studies of nonmodel plants. © 2018 Botanical Society of America.
Hydrogeological delineation of groundwater potential zones in the Nabogo basin, Ghana
NASA Astrophysics Data System (ADS)
Nsiah, Emmanuel; Appiah-Adjei, Emmanuel K.; Adjei, Kwaku A.
2018-07-01
This study has delineated groundwater potential zones of the Nabogo basin and categorized the northern and eastern parts, representing about 35% of the total basin, as the most suitable areas for groundwater prospecting. The inhabitants of the basin depend on rainfall and small surface reservoirs for their various water supply needs, which become very scarce and unsustainable in the dry seasons due to the arid to semi-arid conditions of the basin. Thus, groundwater is increasingly being exploited to supplement the water needs of the populace. However, groundwater development in the basin is sometimes hindered by relatively low success rate of boreholes. Therefore, this study was aimed at delineating the groundwater potential zones of the basin to improve on development of the resource for supply to the populace. The methodology used involved acquisition of data on well-distributed boreholes in the basin, computation of transmissivity and specific capacity values from the data, and delineation of potential groundwater zones through integration of borehole yields, regolith thickness, static water level and transmissivity using the weighted overlay technique in a GIS environment. The study results indicate that transmissivity ranges from 0.1 to 535 m2/day with a mean of 19.7 m2/day while the specific capacity ranges from 0.25 to 170.88 m3/day/m with a mean of 13.42 m3/day/m. A groundwater potential map generated categorizes the basin into poor, moderate and high zones covering 652.52 km2, 1250.45 km2 and 1002.23 km2 respectively, which would be very useful for groundwater development.
Optimization of the Al2O3/GaSb Interface and a High-Mobility GaSb pMOSFET
2011-10-01
explored the use of in situ deposition of Al2O3 on GaSb grown on InP using molecular beam epitaxy and reported Dit values in the low 1012/cm2eV range near...M. Heyns, M. Caymax, and J. Dekoster, “GaSb mole- cular beam epitaxial growth on p-InP(001) and passivation with in situ deposited Al2O3 gate oxide...transmission electron microscopy. Capacitors were made on these films using platinum (Pt) electrode deposited in an e- beam evaporator through a shadow
Stanton, Gregory P.; Thomas, Jonathan V.; Stoval, Jeffery
2009-01-01
Logs collected in monitoring well PTX06–1068 during ambient conditions indicate a static environment with no flow. During pumping there was upward vertical flow at rates ranging from 0.4 to 4.8 gallons per minute. During pumping, a gradual trend of more positive flowmeter values (upward flow) with distance up the well was observed. Estimated total transmissivity for four production zones identified from Flow–B numerical model results taken together was calculated to be about 200 feet squared per day.
Optical vortex beam transmission with different OAM in scattering beads and brain tissue media
NASA Astrophysics Data System (ADS)
Wang, W. B.; Shi, Lingyan; Lindwasser, Lukas; Marque, Paulo; Lavery, M. P. J.; Alfano, R. R.
2016-03-01
Light transmission of Laguerre Gaussian (LG) vortex beams with different orbital angular momentum (OAM) values (L) in scattering beads and mouse brain tissue media were experimentally investigated for the first time in comparison with Gaussian (G) beams. The LG beams with different OAM were generated using a spatial light modulator (SLM) in reflection mode. The scattering beads media consist of various sizes and concentrations of latex beads in water solutions. The transmissions of LG and G beams through scattering beads and brain tissue media were measured with different ratios of sample thicknesses (z) to scattering mean free path (ls) of the turbid media, z/ls. The results indicate that within the ballistic region where z/ls is small, the LG and G beams show no significant difference, while in the diffusive region where z/ls is higher, the vortex beams show higher transmission than G beams. In the diffusive region, the LG beams with higher L values show higher transmission than the beams with lower L values due to the eigen channels in the media. The transition points from the ballistic to diffusive regions for different scattering beads and brain tissue media were studied.
Turney, G.L.; Dion, N.P.; Sumioka, S.S.
1986-01-01
Thirteen lakes in Mount Rainier National Park were evaluated for general chemical characteristics, sensitivity to acidification by acidic precipitation, and degree of existing acidification. The lakes studies were Allen, one of the Chenuis group, Crescent , Crystal, Eleanor, Fan, one of the Golden group, Marsh, Mowich, Mystic, Shriner, and two unnamed lakes. The lakes were sampled in August 1983. Specific conductance values were generally 21 microsiemens/cm at 25 C or less, and dissolved solids concentrations were generally 20 mg/L or less. The major cations were calcium and sodium, and the major anion was bicarbonate. Alkalinity concentrations ranged from 2.1 to 9.0 mg/L in 12 of the lakes. Allen Lake was the exception, having an alkalinity concentration of 27 mg/L. The pH values for all of the lakes ranged from 5.8 to 6.5. In most of the lakes, vertical profiles of temperature, dissolved oxygen, pH, and specific conductance were relatively uniform. In the deeper lakes, temperature decreased with depth and dissolved-oxygen concentrations increased to about 20 feet, remained constant to 80 ft, then decreased with increasing depth. Exceptions to general water quality patterns were observed in three lakes. Allen Lake had a specific conductance value of 58 Microsiemens/cm. The lake of the Golden group was anaerobic at the bottom and had relatively high concentrations of dissolved organic carbon and dissolved metals, and a lower light transmission than the other lakes studied. One of the unnamed lakes had relatively high concentrations of phytoplankton and dissolved organic carbon and relatively low levels of light transmission. Comparisons of lake data to acid-sensitivity thresholds for specific conductance and alkalinity indicated that all of the lakes except Allen would be sensitive to acidic precipitation. The small sizes of the lakes, and their locations in basins of high precipitation and weathering-resistant rock types, enhance their sensitivity. None of the lakes in this study appeared to be presently acidified. (Lantz-PTT)
PSHFT - COMPUTERIZED LIFE AND RELIABILITY MODELLING FOR TURBOPROP TRANSMISSIONS
NASA Technical Reports Server (NTRS)
Savage, M.
1994-01-01
The computer program PSHFT calculates the life of a variety of aircraft transmissions. A generalized life and reliability model is presented for turboprop and parallel shaft geared prop-fan aircraft transmissions. The transmission life and reliability model is a combination of the individual reliability models for all the bearings and gears in the main load paths. The bearing and gear reliability models are based on the statistical two parameter Weibull failure distribution method and classical fatigue theories. The computer program developed to calculate the transmission model is modular. In its present form, the program can analyze five different transmissions arrangements. Moreover, the program can be easily modified to include additional transmission arrangements. PSHFT uses the properties of a common block two-dimensional array to separate the component and transmission property values from the analysis subroutines. The rows correspond to specific components with the first row containing the values for the entire transmission. Columns contain the values for specific properties. Since the subroutines (which determine the transmission life and dynamic capacity) interface solely with this property array, they are separated from any specific transmission configuration. The system analysis subroutines work in an identical manner for all transmission configurations considered. Thus, other configurations can be added to the program by simply adding component property determination subroutines. PSHFT consists of a main program, a series of configuration specific subroutines, generic component property analysis subroutines, systems analysis subroutines, and a common block. The main program selects the routines to be used in the analysis and sequences their operation. The series of configuration specific subroutines input the configuration data, perform the component force and life analyses (with the help of the generic component property analysis subroutines), fill the property array, call up the system analysis routines, and finally print out the analysis results for the system and components. PSHFT is written in FORTRAN 77 and compiled on a MicroSoft FORTRAN compiler. The program will run on an IBM PC AT compatible with at least 104k bytes of memory. The program was developed in 1988.
Robust Accurate Non-Invasive Analyte Monitor
Robinson, Mark R.
1998-11-03
An improved method and apparatus for determining noninvasively and in vivo one or more unknown values of a known characteristic, particularly the concentration of an analyte in human tissue. The method includes: (1) irradiating the tissue with infrared energy (400 nm-2400 nm) having at least several wavelengths in a given range of wavelengths so that there is differential absorption of at least some of the wavelengths by the tissue as a function of the wavelengths and the known characteristic, the differential absorption causeing intensity variations of the wavelengths incident from the tissue; (2) providing a first path through the tissue; (3) optimizing the first path for a first sub-region of the range of wavelengths to maximize the differential absorption by at least some of the wavelengths in the first sub-region; (4) providing a second path through the tissue; and (5) optimizing the second path for a second sub-region of the range, to maximize the differential absorption by at least some of the wavelengths in the second sub-region. In the preferred embodiment a third path through the tissue is provided for, which path is optimized for a third sub-region of the range. With this arrangement, spectral variations which are the result of tissue differences (e.g., melanin and temperature) can be reduced. At least one of the paths represents a partial transmission path through the tissue. This partial transmission path may pass through the nail of a finger once and, preferably, twice. Also included are apparatus for: (1) reducing the arterial pulsations within the tissue; and (2) maximizing the blood content i the tissue.
Application of the diagnostic radiological index of protection to protective garments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasciak, Alexander S.; Jones, A. Kyle, E-mail: kyle.jones@mdanderson.org; Wagner, Louis K.
2015-02-15
Purpose: Previously, the diagnostic radiological index of protection (DRIP) was proposed as a metric for quantifying the protective value of radioprotective garments. The DRIP is a weighted sum of the percent transmissions of different radiation beams through a garment. Ideally, the beams would represent the anticipated stray radiation encountered during clinical use. However, it is impractical to expect a medical physicist to possess the equipment necessary to accurately measure transmission of scattered radiation. Therefore, as a proof of concept, the authors tested a method that applied the DRIP to clinical practice. Methods: Primary beam qualities used in interventional cardiology andmore » radiology were observed and catalogued. Based on the observed range of beam qualities, five representative clinical primary beam qualities, specified by kV and added filtration, were selected for this evaluation. Monte Carlo simulations were performed using these primary beams as source definitions to generate scattered spectra from the clinical primary beams. Using numerical optimization, ideal scatter mimicking primary beams, specified by kV and added aluminum filtration, were matched to the scattered spectra according to half- and quarter-value layers and spectral shape. To within reasonable approximation, these theoretical scatter-mimicking primary beams were reproduced experimentally in laboratory x ray beams and used to measure transmission through pure lead and protective garments. For this proof of concept, the DRIP for pure lead and the garments was calculated by assigning equal weighting to percent transmission measurements for each of the five beams. Finally, the areal density of lead and garments was measured for consideration alongside the DRIP to assess the protective value of each material for a given weight. Results: The authors identified ideal scatter mimicking primary beams that matched scattered spectra to within 0.01 mm for half- and quarter-value layers in copper and within 5% for the shape function. The corresponding experimental scatter-mimicking primary beams matched the Monte Carlo generated scattered spectra with maximum deviations of 6.8% and 6.6% for half- and quarter-value layers. The measured DRIP for 0.50 mm lead sheet was 2.0, indicating that it transmitted, on average, 2% of incident radiation. The measured DRIP for a lead garment and one lead-alternative garment closely matched that for pure lead of 0.50 mm thickness. The DRIP for other garments was substantially higher than 0.50 mm lead (3.9–5.4), indicating they transmitted about twice as much radiation. When the DRIP was plotted versus areal density, it was clear that, of the garments tested, none were better than lead on a weight-by-weight basis. Conclusions: A method for measuring the DRIP for protective garments using scatter-mimicking primary beams was developed. There was little discernable advantage in protective value per unit weight for lead-alternative versus lead-only garments. Careful consideration must be given to the balance of protection and weight when choosing a lead-alternative protective garment with a lower specified “lead equivalence,” e.g., 0.35 mm. The DRIP has the potential to resolve this dilemma. Reporting the DRIP relative to areal density is an ideal metric for objective comparisons of protective garment performance, considering both protective value in terms of transmission of radiation and garment weight.« less
Steep and flat bandpass filter using linearly chirped and apodized fiber Bragg grating
NASA Astrophysics Data System (ADS)
Wu, Xunqi; Jacquet, Jo"l.; Duan, Guanghua
2010-02-01
The development of new optical systems requires the design of novel components that fulfill the market constraints. In particular, low loss, high optical rejection and low cost narrowband filters can play an important role for the introduction of the Wavelength Division Multiplexing (WDM) technology in the local network. So, a novel fiber filter is proposed in this article, with a special combined apodized Linearly Chirped Fiber Bragg Grating (LCFBG) which presents the preferable flat-top and steep-edge characteristics. In the design, we use a continuum cavity condition which is obtained when the effective round-trip phase of oscillated wavelength band is kept identical over the whole Bragg wavelength range. And the transmission spectra are calculated by the reconstruction of the matrixes with the continuum oscillation condition. Therefore, our works show that the ideal square shaped filter is obtained with a lower chirp value relatively together with symmetric reflectivity on both mirrors. The coupling coefficient of the FBG is adjusted to get the same reflectivity values and then to get a transmission filter close to unity. We have then introduced an apodization function of the filter to get a flatter transfer function. Various apodizations schemes have been tested. In this paper, we design and analyze a type of continuum fiber filter with the cavity formed between mirror and apodized LCFBG as reflectors. We calculate firstly the reflectivity, the transmissivity and the group time delay of LCFBG modeled by a simple and practical Transfer Matrix Method (TMM), and then the cavity is reconstructed by TMM, the length of the oscillated cavity is calculated by the continuum oscillation condition, so the output of transmission from the side of LCFBG is continuous in the corresponded reflected bandwidth of LCFBG. We obtain the results and discuss some characteristics of this type of continuum fiber filter.
Retrieving atmospheric transmissivity for biologically active daily dose, in various european sites
NASA Astrophysics Data System (ADS)
de La Casinière, A.; Touré, M. L.; Lenoble, J.; Cabot, T.
2003-04-01
In the frame of the European Project EDUCE, global UV irradiance spectra recorded all along the year in several European sites are stored in a common database located in Finland. From the spectra set of some of these stations, are calculated atmospheric transmissivities for daily doses of four biologically active UV radiation, namely: UV-B, erythema, DNA damage, and plant damage. A transmissivity is defined as the ratio of the ground level value of the daily dose of interest to its corresponding extra-atmospheric value. Multiple linear correlation of the various transmissivities with three predictors (daily sunshine fraction, cosine of the daily minimum SZA, and daily total ozone column) assumed to be independent variables, are done for year 2000. The coefficients obtained from year 2000 correlation in a given site are expected to retrieve, from the local predictors, the daily dose for year 2001 in the same site, the average error being lesser than 10% for monthly mean values, and lesser than 5% for three-monthly mean values, depending on the daily dose type. Comparison of yearly mean daily doses retrieved in a given site from coefficients obtained in other sites is also presented.
Entomological indicators during transmission season of dengue in Silvassa (India).
Khan, V; Zala, D B; Srivastava, H C
2015-06-01
The entomological surveillance was conducted in urban, semi-urban/slum, industrial and residential areas during main transmission period from June to November 2012. In residential sites house index was 41.7-35.0, breteau index 71.7-136.7 and container index 11.6-20.2. During transmission period all the values ware much higher than the threshold level. The causes of high values of entomological indicator appeared to be rapid industrialization, unawareness of the conditions or factors that can exacerbate mosquito breeding, water storage habits in community and un-implementation of health related legislation.
Shenoy, Erica S; Lee, Hang; Ryan, Erin E; Hou, Taige; Walensky, Rochelle P; Ware, Winston; Hooper, David C
2018-02-01
Hospitalized patients are assigned to available staffed beds based on patient acuity and services required. In hospitals with double-occupancy rooms, patients must be additionally matched by gender. Patients with methicillin-resistant Staphylococcus aureus (MRSA) or vancomycin-resistant Enterococcus (VRE) must be bedded in single-occupancy rooms or cohorted with other patients with similar MRSA/VRE flags. We developed a discrete event simulation (DES) model of patient flow through an acute care hospital. Patients are matched to beds based on acuity, service, gender, and known MRSA/VRE colonization. Outcomes included time to bed arrival, length of stay, patient-bed acuity mismatches, occupancy, idle beds, acuity-related transfers, rooms with discordant MRSA/VRE colonization, and transmission due to discordant colonization. Observed outcomes were well-approximated by model-generated outcomes for time-to-bed arrival (6.7 v. 6.2 to 6.5 h) and length of stay (3.3 v. 2.9 to 3.0 days), with overlapping 90% coverage intervals. Patient-bed acuity mismatches, where patient acuity exceeded bed acuity and where patient acuity was lower than bed acuity, ranged from 0.6 to 0.9 and 8.6 to 11.1 mismatches per h, respectively. Values for observed occupancy, total idle beds, and acuity-related transfers compared favorably to model-predicted values (91% v. 86% to 87% occupancy, 15.1 v. 14.3 to 15.7 total idle beds, and 27.2 v. 22.6 to 23.7 transfers). Rooms with discordant colonization status and transmission due to discordance were modeled without an observed value for comparison. One-way and multi-way sensitivity analyses were performed for idle beds and rooms with discordant colonization. We developed and validated a DES model of patient flow incorporating MRSA/VRE flags. The model allowed for quantification of the substantial impact of MRSA/VRE flags on hospital efficiency and potentially avoidable nosocomial transmission.
NASA Astrophysics Data System (ADS)
Revesz, K.; Shapiro, A. M.; Tiedeman, C.; Goode, D. J.; Lacombe, P. J.; Imbrigiotta, T. E.
2008-12-01
The isotopic ratio of 13C/12C, expressed in delta13CVPDB per mill for trichloroethene (TCE), can differentiate between microbial degradation and other processes (dilution, dispersion, and sorption) that can also affect the concentration of TCE and its degradation products. The delta13C of TCE isotopically fractionates during microbial degradation; however, it remains practically unchanged during other processes. The isotope fractionation factor (alpha) estimated under laboratory conditions, however, may not be representative of microbial degradation in natural ground waters. Estimating alpha under field conditions provides evidence of the presence or absence of in situ microbial degradation and provides valuable information on the in situ processes that affect the fate and transport of chlorinated hydrocarbons. Our modified analytical method of analyzing for the isotopic ratio proved to be comparable to previously published methods. Isotope values were stable within analytical uncertainty in sample sizes ranging from 22 to 2200 nanomoles. Prepared standard mixtures of TCE and DCEs (trans- and cis- dichloroethene) were analyzed after every five field samples, and were stable during the time period that field samples were processed (a year). Water samples were collected from multiple boreholes completed in the fractured mudstone underlying the former Naval Air Warfare Center, West Trenton, NJ, and analyzed for delta13C of the chlorinated hydrocarbons. The results showed an ongoing natural microbial degradation following the typical dehalogenation pathway: TCE to DCE (trans- and cis-dichloroethene) to VC (vinyl chloride). The carbon isotope enrichment due to fractionation was smaller between TCE to DCE degradation than the enrichment between DCE to VC degradation, which is consistent with previous investigations. Results also showed a correlation between delta13C of TCE and the transmissivity of the boreholes where water samples were collected. We assumed that boreholes with extremely low transmissivity behaved analogously to microbial batch reactors. The value of alpha obtained from the borehole interval with the lowest transmissivity was 0.99345, which is in the range of published values: 0.9862 to 0.9934. We consider this value to represent the "field alpha" for microbial degradation in the absence of other processes. Values of alpha in other boreholes that differ from the field alpha could point to other processes affecting the delta13C and concentration of TCE. The value of alpha from the various monitored intervals is referred to as the "apparent alpha". The apparent alpha is characteristic of the borehole and the time at which the concentrations and the isotope values were measured. The difference between the apparent alpha and the field alpha provides insight into hydrologic conditions around the well. Results from one well showed fluctuation in the TCE concentrations, which were correlated with the calculated apparent alpha, and pointed to the recent introduction of TCE into the ground water that had not been significantly degraded. Recent drilling in the vicinity of this well may have remobilized free-phase TCE.
Small passenger car transmission test; Chevrolet LUV transmission
NASA Technical Reports Server (NTRS)
Bujold, M. P.
1980-01-01
A 1978 Chevrolet LUV manual transmission tested per the applicable portions of a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the upper ninety percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Chevrolet LUV transmission.
Small passenger car transmission test; Ford C4 transmission
NASA Technical Reports Server (NTRS)
Bujold, M. P.
1980-01-01
A 1979 Ford C4 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Ford C4 transmission.
Williams, Richard AJ; Peterson, A Townsend
2009-01-01
Background The emerging highly pathogenic avian influenza strain H5N1 ("HPAI-H5N1") has spread broadly in the past decade, and is now the focus of considerable concern. We tested the hypothesis that spatial distributions of HPAI-H5N1 cases are related consistently and predictably to coarse-scale environmental features in the Middle East and northeastern Africa. We used ecological niche models to relate virus occurrences to 8 km resolution digital data layers summarizing parameters of monthly surface reflectance and landform. Predictive challenges included a variety of spatial stratification schemes in which models were challenged to predict case distributions in broadly unsampled areas. Results In almost all tests, HPAI-H5N1 cases were indeed occurring under predictable sets of environmental conditions, generally predicted absent from areas with low NDVI values and minimal seasonal variation, and present in areas with a broad range of and appreciable seasonal variation in NDVI values. Although we documented significant predictive ability of our models, even between our study region and West Africa, case occurrences in the Arabian Peninsula appear to follow a distinct environmental regime. Conclusion Overall, we documented a variable environmental "fingerprint" for areas suitable for HPAI-H5N1 transmission. PMID:19619336
Engelkes, Vincent B; Beebe, Jeremy M; Frisbie, C Daniel
2004-11-03
Nanoscopic tunnel junctions were formed by contacting Au-, Pt-, or Ag-coated atomic force microscopy (AFM) tips to self-assembled monolayers (SAMs) of alkanethiol or alkanedithiol molecules on polycrystalline Au, Pt, or Ag substrates. Current-voltage traces exhibited sigmoidal behavior and an exponential attenuation with molecular length, characteristic of nonresonant tunneling. The length-dependent decay parameter, beta, was found to be approximately 1.1 per carbon atom (C(-1)) or 0.88 A(-)(1) and was independent of applied bias (over a voltage range of +/-1.5 V) and electrode work function. In contrast, the contact resistance, R(0), extrapolated from resistance versus molecular length plots showed a notable decrease with both applied bias and increasing electrode work function. The doubly bound alkanedithiol junctions were observed to have a contact resistance approximately 1 to 2 orders of magnitude lower than the singly bound alkanethiol junctions. However, both alkanethiol and dithiol junctions exhibited the same length dependence (beta value). The resistance versus length data were also used to calculate transmission values for each type of contact (e.g., Au-S-C, Au/CH(3), etc.) and the transmission per C-C bond (T(C)(-)()(C)).
Bioinspired Superhydrophobic Highly Transmissive Films for Optical Applications.
Vüllers, Felix; Gomard, Guillaume; Preinfalk, Jan B; Klampaftis, Efthymios; Worgull, Matthias; Richards, Bryce; Hölscher, Hendrik; Kavalenka, Maryna N
2016-11-01
Inspired by the transparent hair layer on water plants Salvinia and Pistia, superhydrophobic flexible thin films, applicable as transparent coatings for optoelectronic devices, are introduced. Thin polymeric nanofur films are fabricated using a highly scalable hot pulling technique, in which heated sandblasted steel plates are used to create a dense layer of nano- and microhairs surrounding microcavities on a polymer surface. The superhydrophobic nanofur surface exhibits water contact angles of 166 ± 6°, sliding angles below 6°, and is self-cleaning against various contaminants. Additionally, subjecting thin nanofur to argon plasma reverses its surface wettability to hydrophilic and underwater superoleophobic. Thin nanofur films are transparent and demonstrate reflection values of less than 4% for wavelengths ranging from 300 to 800 nm when attached to a polymer substrate. Moreover, used as translucent self-standing film, the nanofur exhibits transmission values above 85% and high forward scattering. The potential of thin nanofur films for extracting substrate modes from organic light emitting diodes is tested and a relative increase of the luminous efficacy of above 10% is observed. Finally, thin nanofur is optically coupled to a multicrystalline silicon solar cell, resulting in a relative gain of 5.8% in photogenerated current compared to a bare photovoltaic device. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Gellasch, Christopher A.; Bradbury, Kenneth R.; Hart, David J.; Bahr, Jean M.
2013-03-01
In order to protect public supply wells from a wide range of contaminants, it is imperative to understand physical flow and transport mechanisms in the aquifer system. Although flow through fractures has typically been associated with either crystalline or carbonate rocks, there is growing evidence that it can be an important component of flow in relatively permeable sandstone formations. The objective of this work is to determine the role that fractures serve in the transport of near-surface contaminants such as wastewater from leaking sewers, to public supply wells in a deep bedrock aquifer. A part of the Cambrian aquifer system in Madison, Wisconsin (USA), was studied using a combination of geophysical, geochemical, and hydraulic testing in a borehole adjacent to a public supply well. Data suggest that bedrock fractures are important transport pathways from the surface to the deep aquifer. These fractured intervals have transmissivity values several orders of magnitude higher than non-fractured intervals. With respect to rapid transport of contaminants, high transmissivity values of individual fractures make them the most likely preferential flow pathways. Results suggest that in a siliciclastic aquifer near a public supply well, fractures may have an important role in the transport of sewer-derived wastewater contaminants.
Broadband direction-dependent transmission of light with photonic crystal heterostructure grating
NASA Astrophysics Data System (ADS)
Yilmaz, D.; Giden, I. H.; Kurt, H.
2018-01-01
Direction-dependent light transmission is a remarkable phenomenon owing to its great potential to be used in optical communication processing systems such as optical diodes, isolators and rectifiers. All these applications require optical reciprocity breaking mechanisms such as magneto-optical effect. Keeping the reciprocity intact, it is possible to manipulate the amount and spatial form of the two oppositely propagating lights exiting from a passive photonic medium. In this paper, a photonic crystal diffraction grating (PCDG) configuration is studied for the investigation of asymmetric light transport due to the spatial inversion symmetry breaking in the designed compact all-dielectric PC heterostructure. Thanks to the periodic corrugations at the back-surface of the designed structure, the backward transmission of the zero-order diffracted wave is notably suppressed while the efficient unidirectional forward transmission is achieved. Numerical calculations show that up to 73% of the incoming electromagnetic energy is transmitted in the forward illumination whereas it reduces down to a value of 6% (which corresponds to 10.85 dB beam suppression) in the case of backward illumination. That asymmetric light transmission leads to a contrast ratio (CR) of above 0.55 (CR = (T +x - T -x )/(T +x + T -x ), in which T -x and T +x are the transmission efficiencies in the -x and +x directions, respectively). The highest contrast ratio of CR = 0.99 is calculated at the incident frequency of a/λ = 0.5338 having the forward and backward transmissions of {T +x ,T -x } = {42%,0.1%}, which corresponds to the beam suppression of 26.23 dB. Furthermore, the proposed PCDG exhibits the diffraction grating effect at the considerable range of angle of incidence up to ±20° at certain frequencies indicating that the proposed grating system is durable to source misalignments.
NASA Astrophysics Data System (ADS)
Shvartsman, Leonid D.; Fine, Ilya
2001-06-01
We develop theoretical models of light transmission through whole blood considering RBC aggregation. RBC aggregates are considered to be the main centers of scattering in red/near- infrared spectral region. In pulsatile blood flow the periodic changes of aggregate geometry cause oscillations of light scattering. Thus scattering-assisted mechanism has to be taken into account in pulse oximeter calibration. In case of over-systolic vessel occlusion the size of aggregates grows, and the light transmission rises. Light diffraction on a single scatterer makes the transmission growth non- monotonic for certain spectral range. For the most typical set of aggregate parameters this range corresponds to wavelengths below 760 nm, and this prediction fits well both in vivo and in vitro experimental results. This spectral range depends on the refraction index mismatch and the geometry of aggregates. Both of them may be affected by the chemistry of blood. For instance, changes of glucose and hemoglobin have different effect on light transmission time response. Consequently, their content may be determined from time evolution of optical transmission.
Cobotic architecture for prosthetics.
Faulring, Eeic L; Colgate, J Edward; Peshkin, Michael A
2006-01-01
We envision cobotic infinitely-variable transmissions (IVTs) as an enabling technology for haptics and prosthetics that will allow for increases in the dynamic range of these devices while simultaneously permitting reductions in actuator size and power requirements. Use of cobotic IVTs eliminates the need to make compromises on output flow and effort, which are inherent to choosing a fixed transmission ratio drivetrain. The result is a mechanism with enhanced dynamic range that extends continuously from a completely clutched state to a highly backdrivable state. This high dynamic range allows cobotic devices to control impedance with a high level of fidelity. In this paper, we discuss these and other motivations for using parallel cobotic transmission architecture in prosthetic devices.
NASA Astrophysics Data System (ADS)
Robinson, Donald Arthur
1984-06-01
A method is presented to predict airborne and barrier transmission loss of an audible signal as it travels from a corridor based octave band sound source to a room based receiver location. Flanking pathways are not considered in the prediction model. Although the central focus of the research is on the propagation of the signal, a comprehensive review of the source, path and receiver are presented as related to emergency audible signal propagation. Linear attenuation of the signal and end wall reflection is applied along the corridor path incorporating research conducted by T. L. Redmore of Essex, England. Classical room acoustics are applied to establish the onset of linear attenuation beyond the near field. The "coincidence effect" is applied to the transmission loss through the room door barrier. A constant barrier door transmission loss from corridor-to-room is applied throughout the 250 - 8000 Hertz octave bands. In situ measurements were conducted in two separate dormitories on the University of Massachusetts Amherst campus to verify the validity of the approach. All of the experimental data points follow the corresponding points predicted by the model with all correlations exceeding 0.9. The 95 percent confidence intervals for the absolute difference between predicted and measured values ranged from 0.76 dB to 4.5 dB based on five Leq dB levels taken at each octave band along the length of the corridor. For the corridor to room attenuation in the six test rooms, with the door closed and edge sealed, the predicted minus measured levels ranged from an interval of 0.54 to 2.90 dB Leq at octave bands from 250 to 8000 Hertz. Given the inherent difficulty of in situ tests compared to laboratory or modeling approaches the confidence intervals obtained confirm the usefulness of the prediction model presented.
A novel automated rat catalepsy bar test system based on a RISC microcontroller.
Alvarez-Cervera, Fernando J; Villanueva-Toledo, Jairo; Moo-Puc, Rosa E; Heredia-López, Francisco J; Alvarez-Cervera, Margarita; Pineda, Juan C; Góngora-Alfaro, José L
2005-07-15
Catalepsy tests performed in rodents treated with drugs that interfere with dopaminergic transmission have been widely used for the screening of drugs with therapeutic potential in the treatment of Parkinson's disease. The basic method for measuring catalepsy intensity is the "standard" bar test. We present here an easy to use microcontroller-based automatic system for recording bar test experiments. The design is simple, compact, and has a low cost. Recording intervals and total experimental time can be programmed within a wide range of values. The resulting catalepsy times are stored, and up to five simultaneous experiments can be recorded. A standard personal computer interface is included. The automated system also permits the elimination of human error associated with factors such as fatigue, distraction, and data transcription, occurring during manual recording. Furthermore, a uniform criterion for timing the cataleptic condition can be achieved. Correlation values between the results obtained with the automated system and those reported by two independent observers ranged between 0.88 and 0.99 (P<0.0001; three treatments, nine animals, 144 catalepsy time measurements).
NASA Astrophysics Data System (ADS)
Dhak, Prasanta; Adak, Mrinal Kanti; Dhak, Debasis
2016-02-01
Nanocrystalline Ba1-3xTi1-3xLa2xMn4xO3, [x = 0.006, 0.008, 0.01 and 0.05] (abbreviated hereafter as BTLM) by chemical route. The phase formation and purity were checked by X-ray diffraction (XRD) study and transmission electron microscopy (TEM). The grain morphology after sintering was studied by scanning electron microscopy (SEM). The crystallite sizes range from 21 nm to 30 nm, while the particle size ranges between 27 nm and 38 nm. The grain size 212 nm and grain density 96.8% were found to be maximum for BTLM x = 0.05 and x = 0.01, respectively. The temperature dependence of dielectric constants was found to be more diffused and the peak value of the dielectric constant was decreased and more flat with the increase of the substituent concentration. The tangent loss was found to be decreased and reached to the minimum value of 0.032 for BTLM x = 0.05. The remnant polarization Pr, was 10 μC/cm2 for BTLM x = 0.01.
Reactive ion-beam-sputtering of fluoride coatings for the UV/VUV range
NASA Astrophysics Data System (ADS)
Schink, Harald; Kolbe, Jurgen; Zimmermann, F.; Ristau, Detlev; Welling, Herbert
1991-06-01
Fluoride coatings produced by thermal evaporation suffer from high scatter losses ageing and cracking due to high tensile stress. These problems impose severe limitations to the production of low loss multilayer coatings for the VUV range. A key position for improved performance is the microstructure of the layers. The aim of our investigations is to improve the microstructure of A1F3- and LaF3-'' films by ionbeamsputtering. Scatter measurements of single layers revealed lower values for lBS than for boat evaporation. Unfortunately sputtered fluoride films nave high absorption losses caused by decomposition of the coating material. By sputtering in reactive atmospheres and annealing we were able to reduce the absorption losses significantly. Antireflective as well as high reflective coatings were produced. Reflection and transmission values were obtained with a VUV-spectrophotometer. Damage tests at the 193 mu ArF laser wavelength were performed at the Laser-Laboratorium Gttingen. Key words: ion-beamsputtering fluoride films UVcoatings VUV-coatings color-center laser damage A]. F3 MgF2 LaF3. 1.
Equations for Automotive-Transmission Performance
NASA Technical Reports Server (NTRS)
Chazanoff, S.; Aston, M. B.; Chapman, C. P.
1984-01-01
Curve-fitting procedure ensures high confidence levels. Threedimensional plot represents performance of small automatic transmission coasting in second gear. In equation for plot, PL power loss, S speed and T torque. Equations applicable to manual and automatic transmissions over wide range of speed, torque, and efficiency.
Effect of 60Co γ-irradiation on structural and optical properties of thin films of Ga10Se80Hg10
NASA Astrophysics Data System (ADS)
Ahmad, Shabir; Asokan, K.; Shahid Khan, Mohd.; Zulfequar, M.
2015-08-01
Thin films of Ga10Se80Hg10 have been deposited onto a chemically cleaned Al2O3 substrates by thermal evaporation technique under vacuum. The investigated thin films are irradiated by 60Co γ-rays in the dose range of 50-150 kGy. X-ray diffraction patterns of the investigated thin films confirm the preferred crystallite growth occurs in the tetragonal phase structure. It also shows, the average crystallite size increases after γ-exposure, which indicates the crystallinity of the material increases after γ-irradiation. These results were further supported by surface morphological analysis carried out by scanning electron microscope and atomic force microscope which also shows the crystallinity of the material increases with increasing the γ-irradiation dose. The optical transmission spectra of the thin films at normal incidence were investigated in the spectral range from 190 to 1100 nm. Using the transmission spectra, the optical constants like refractive index (n) and extinction coefficient (k) were calculated based on Swanepoel's method. The optical band gap (Eg) was also estimated using Tauc's extrapolation procedure. The optical analysis shows: the value of optical band gap of investigated thin films decreases and the corresponding absorption coefficient increases continuously with increasing dose of γ-irradiation.
NASA Astrophysics Data System (ADS)
Ding, Xia; Xue, Long-fei; Wang, Xiu-chun; Ding, Kai-hong; Cui, Sheng-li; Sun, Yong-cong; Li, Mu-sen
2016-10-01
The effect of bath PH value on formation, microstructure and corrosion resistance of the phosphate chemical conversion (PCC) coatings as well as the effect on the magnetic property of the magnets is investigated in this paper. The results show that the coating mass and thickness increase with the decrease of the bath PH value. Scanning electron microscopy observation demonstrates that the PCC coatings are in a blocky structure with different grain size. Transmission electron microscope and X-ray diffractometer tests reveal the coatings are polycomponent and are mainly composed of neodymium phosphate hydrate and praseodymium phosphate hydrate. The electrochemical analysis and static immersion corrosion test show the corrosion resistance of the PCC coatings prepared at bath PH value of 0.52 is worst. Afterwards the corrosion resistance increases first and then decreases with the increasing of the bath PH values. The magnetic properties of all the samples with PCC treatment are decreased. The biggest loss is occurred when the bath PH value is 0.52. Taken together, the optimum PH range of 1.00-1.50 for the phosphate solution has been determined.
NASA Astrophysics Data System (ADS)
Zhang, L.; Jia, M. C.; Gong, J. J.; Xia, W. M.
2017-12-01
The mass attenuation coefficient of various Lead-Boron Polyethylene samples which can be used as the photon shielding materials in marine reactor, have been simulated using the MCNP-5 code, and compared with the theoretical values at the photon energy range 0.001MeV—20MeV. A good agreement has been observed. The variations of mass attenuation coefficient, linear attenuation coefficient and mean free path with photon energy between 0.001MeV to 100MeV have been plotted. The result shows that all the coefficients strongly depends on the photon energy, material atomic composition and density. The dose transmission factors for source Cesium-137 and Cobalt-60 have been worked out and their variations with the thickness of various sample materials have also been plotted. The variations show that with the increase of materials thickness the dose transmission factors decrease continuously. The results of this paper can provide some reference for the use of the high effective shielding material Lead-Boron Polyethyene.
Nondestructive assay of EBR-II blanket elements using resonance transmission analysis
NASA Astrophysics Data System (ADS)
Klann, Raymond Todd
1998-10-01
Resonance transmission analysis utilizing a filtered reactor beam was examined as a means of determining the 239Pu content in Experimental Breeder Reactor - II depleted uranium blanket elements. The technique uses cadmium and gadolinium filters along with a 239Pu fission chamber to isolate the 0.3 eV resonance in 239Pu. In the energy range of this resonance (0.1 eV to 0.5 eV), the total microscopic cross-section of 239Pu is significantly greater than the cross- sections of 238U and 235U. This large difference allows small changes in the 239Pu content of a sample to result in large changes in the mass signal response. Tests with small stacks of depleted uranium and 239Pu foils indicate a significant change in response based on the 239Pu content of the foil stack. In addition, the tests indicate good agreement between the measured and predicted values of 239Pu up to approximately two weight percent.
Radar signal transmission and switching over optical networks
NASA Astrophysics Data System (ADS)
Esmail, Maged A.; Ragheb, Amr; Seleem, Hussein; Fathallah, Habib; Alshebeili, Saleh
2018-03-01
In this paper, we experimentally demonstrate a radar signal distribution over optical networks. The use of fiber enables us to distribute radar signals to distant sites with a low power loss. Moreover, fiber networks can reduce the radar system cost, by sharing precise and expensive radar signal generation and processing equipment. In order to overcome the bandwidth challenges in electrical switches, a semiconductor optical amplifier (SOA) is used as an all-optical device for wavelength conversion to the desired port (or channel) of a wavelength division multiplexing (WDM) network. Moreover, the effect of chromatic dispersion in double sideband (DSB) signals is combated by generating optical single sideband (OSSB) signals. The optimal values of the SOA device parameters required to generate an OSSB with a high sideband suppression ratio (SSR) are determined. We considered various parameters such as injection current, pump power, and probe power. In addition, the effect of signal wavelength conversion and transmission over fiber are studied in terms of signal dynamic range.
Quantum key distribution in a multi-user network at gigahertz clock rates
NASA Astrophysics Data System (ADS)
Fernandez, Veronica; Gordon, Karen J.; Collins, Robert J.; Townsend, Paul D.; Cova, Sergio D.; Rech, Ivan; Buller, Gerald S.
2005-07-01
In recent years quantum information research has lead to the discovery of a number of remarkable new paradigms for information processing and communication. These developments include quantum cryptography schemes that offer unconditionally secure information transport guaranteed by quantum-mechanical laws. Such potentially disruptive security technologies could be of high strategic and economic value in the future. Two major issues confronting researchers in this field are the transmission range (typically <100km) and the key exchange rate, which can be as low as a few bits per second at long optical fiber distances. This paper describes further research of an approach to significantly enhance the key exchange rate in an optical fiber system at distances in the range of 1-20km. We will present results on a number of application scenarios, including point-to-point links and multi-user networks. Quantum key distribution systems have been developed, which use standard telecommunications optical fiber, and which are capable of operating at clock rates of up to 2GHz. They implement a polarization-encoded version of the B92 protocol and employ vertical-cavity surface-emitting lasers with emission wavelengths of 850 nm as weak coherent light sources, as well as silicon single-photon avalanche diodes as the single photon detectors. The point-to-point quantum key distribution system exhibited a quantum bit error rate of 1.4%, and an estimated net bit rate greater than 100,000 bits-1 for a 4.2 km transmission range.
Code of Federal Regulations, 2011 CFR
2011-10-01
...) Subtract the value determined in the previous step from the authorized effective radiated power (“ERP”) of... ERP must be expressed in decibels above one kilowatt: ERP(dBk) = 10 log ERP(kW); (4) Convert the ERP calculated in the previous step to units of kilowatts; and (5) The ERP value determined through the above...
Transmission dynamics and elimination potential of zoonotic tuberculosis in morocco
Justus Bless, Philipp; Crump, Lisa; Lohmann, Petra; Laager, Mirjam; Chitnis, Nakul; Zinsstag, Jakob
2017-01-01
Bovine tuberculosis (BTB) is an endemic zoonosis in Morocco caused by Mycobacterium bovis, which infects many domestic animals and is transmitted to humans through consumption of raw milk or from contact with infected animals. The prevalence of BTB in Moroccan cattle is estimated at 18%, and 33% at the individual and the herd level respectively, but the human M. bovis burden needs further clarification. The current control strategy based on test and slaughter should be improved through local context adaptation taking into account a suitable compensation in order to reduce BTB prevalence in Morocco and decrease the disease burden in humans and animals. We established a simple compartmental deterministic mathematical model for BTB transmission in cattle and humans to provide a general understanding of BTB, in particular regarding transmission to humans. Differential equations were used to model the different pathways between the compartments for cattle and humans. Scenarios of test and slaughter were simulated to determine the effects of varying the proportion of tested animals (p) on the time to elimination of BTB (individual animal prevalence of less than one in a thousand) in cattle and humans. The time to freedom from disease ranged from 75 years for p = 20% to 12 years for p = 100%. For p > 60% the time to elimination was less than 20 years. The cumulated cost was largely stable: for p values higher than 40%, cost ranged from 1.47 to 1.60 billion euros with a time frame of 12 to 32 years to reach freedom from disease. The model simulations also suggest that using a 2mm cut off instead of a 4mm cut off in the Single Intradermal Comparative Cervical Tuberculin skin test (SICCT) would result in cheaper and quicker elimination programs. This analysis informs Moroccan bovine tuberculosis control policy regarding time frame, range of cost and levels of intervention. However, further research is needed to clarify the national human-bovine tuberculosis ratio in Morocco. PMID:28152056
Transmission dynamics and elimination potential of zoonotic tuberculosis in morocco.
Abakar, Mahamat Fayiz; Yahyaoui Azami, Hind; Justus Bless, Philipp; Crump, Lisa; Lohmann, Petra; Laager, Mirjam; Chitnis, Nakul; Zinsstag, Jakob
2017-02-01
Bovine tuberculosis (BTB) is an endemic zoonosis in Morocco caused by Mycobacterium bovis, which infects many domestic animals and is transmitted to humans through consumption of raw milk or from contact with infected animals. The prevalence of BTB in Moroccan cattle is estimated at 18%, and 33% at the individual and the herd level respectively, but the human M. bovis burden needs further clarification. The current control strategy based on test and slaughter should be improved through local context adaptation taking into account a suitable compensation in order to reduce BTB prevalence in Morocco and decrease the disease burden in humans and animals. We established a simple compartmental deterministic mathematical model for BTB transmission in cattle and humans to provide a general understanding of BTB, in particular regarding transmission to humans. Differential equations were used to model the different pathways between the compartments for cattle and humans. Scenarios of test and slaughter were simulated to determine the effects of varying the proportion of tested animals (p) on the time to elimination of BTB (individual animal prevalence of less than one in a thousand) in cattle and humans. The time to freedom from disease ranged from 75 years for p = 20% to 12 years for p = 100%. For p > 60% the time to elimination was less than 20 years. The cumulated cost was largely stable: for p values higher than 40%, cost ranged from 1.47 to 1.60 billion euros with a time frame of 12 to 32 years to reach freedom from disease. The model simulations also suggest that using a 2mm cut off instead of a 4mm cut off in the Single Intradermal Comparative Cervical Tuberculin skin test (SICCT) would result in cheaper and quicker elimination programs. This analysis informs Moroccan bovine tuberculosis control policy regarding time frame, range of cost and levels of intervention. However, further research is needed to clarify the national human-bovine tuberculosis ratio in Morocco.
A field technique for estimating aquifer parameters using flow log data
Paillet, Frederick L.
2000-01-01
A numerical model is used to predict flow along intervals between producing zones in open boreholes for comparison with measurements of borehole flow. The model gives flow under quasi-steady conditions as a function of the transmissivity and hydraulic head in an arbitrary number of zones communicating with each other along open boreholes. The theory shows that the amount of inflow to or outflow from the borehole under any one flow condition may not indicate relative zone transmissivity. A unique inversion for both hydraulic-head and transmissivity values is possible if flow is measured under two different conditions such as ambient and quasi-steady pumping, and if the difference in open-borehole water level between the two flow conditions is measured. The technique is shown to give useful estimates of water levels and transmissivities of two or more water-producing zones intersecting a single interval of open borehole under typical field conditions. Although the modeling technique involves some approximation, the principle limit on the accuracy of the method under field conditions is the measurement error in the flow log data. Flow measurements and pumping conditions are usually adjusted so that transmissivity estimates are most accurate for the most transmissive zones, and relative measurement error is proportionately larger for less transmissive zones. The most effective general application of the borehole-flow model results when the data are fit to models that systematically include more production zones of progressively smaller transmissivity values until model results show that all accuracy in the data set is exhausted.A numerical model is used to predict flow along intervals between producing zones in open boreholes for comparison with measurements of borehole flow. The model gives flow under quasi-steady conditions as a function of the transmissivity and hydraulic head in an arbitrary number of zones communicating with each other along open boreholes. The theory shows that the amount of inflow to or outflow from the borehole under any one flow condition may not indicate relative zone transmissivity. A unique inversion for both hydraulic-head and transmissivity values is possible if flow is measured under two different conditions such as ambient and quasi-steady pumping, and if the difference in open-borehole water level between the two flow conditions is measured. The technique is shown to give useful estimates of water levels and transmissivities of two or more water-producing zones intersecting a single interval of open borehole under typical field conditions. Although the modeling technique involves some approximation, the principle limit on the accuracy of the method under field conditions is the measurement error in the flow log data. Flow measurements and pumping conditions are usually adjusted so that transmissivity estimates are most accurate for the most transmissive zones, and relative measurement error is proportionately larger for less transmissive zones. The most effective general application of the borehole-flow model results when the data are fit to models that symmetrically include more production zones of progressively smaller transmissivity values until model results show that all accuracy in the data set is exhausted.
NASA Technical Reports Server (NTRS)
Lund, G. F.; Westbrook, R. M.; Fryer, T. B.
1980-01-01
The design details and rationale for a versatile, long-range, long-life telemetry data acquisition system for heart rates and body temperatures at multiple locations from free-ranging animals are presented. The design comprises an implantable transmitter for short to medium range transmission, a receiver retransmitter collar to be worn for long-range transmission, and a signal conditioner interface circuit to assist in signal discrimination and demodulation of receiver or tape-recorded audio outputs. Implanted electrodes are used to obtain an ECG, from which R-wave characteristics are selected to trigger a short RF pulse. Pulses carrying heart rate information are interrupted periodically by a series of pulse interval modulated RF pulses conveying temperature information sensed at desired locations by thermistors. Pulse duration and pulse sequencing are used to discriminate between heart rate and temperature pulses as well as radio frequency interference. The implanted transmitter may be used alone for medium and short-range tracking, or with a receiver-transmitter collar that employs commercial tracking equipment for transmissions of up to 12 km. A system prototype has been tested on a dog.
The Complex Relationship between Weather and Dengue Virus Transmission in Thailand
Campbell, Karen M.; Lin, C. D.; Iamsirithaworn, Sopon; Scott, Thomas W.
2013-01-01
Using a novel analytical approach, weather dynamics and seasonal dengue virus transmission cycles were profiled for each Thailand province, 1983–2001, using monthly assessments of cases, temperature, humidity, and rainfall. We observed systematic differences in the structure of seasonal transmission cycles of different magnitude, the role of weather in regulating seasonal cycles, necessary versus optimal transmission “weather-space,” basis of large epidemics, and predictive indicators that estimate risk. Larger epidemics begin earlier, develop faster, and are predicted at Onset change-point when case counts are low. Temperature defines a viable range for transmission; humidity amplifies the potential within that range. This duality is central to transmission. Eighty percent of 1.2 million severe dengue cases occurred when mean temperature was 27–29.5°C and mean humidity was > 75%. Interventions are most effective when applied early. Most cases occur near Peak, yet small reductions at Onset can substantially reduce epidemic magnitude. Monitoring the Quiet-Phase is fundamental in effectively targeting interventions pre-emptively. PMID:23958906
The complex relationship between weather and dengue virus transmission in Thailand.
Campbell, Karen M; Lin, C D; Iamsirithaworn, Sopon; Scott, Thomas W
2013-12-01
Using a novel analytical approach, weather dynamics and seasonal dengue virus transmission cycles were profiled for each Thailand province, 1983-2001, using monthly assessments of cases, temperature, humidity, and rainfall. We observed systematic differences in the structure of seasonal transmission cycles of different magnitude, the role of weather in regulating seasonal cycles, necessary versus optimal transmission "weather-space," basis of large epidemics, and predictive indicators that estimate risk. Larger epidemics begin earlier, develop faster, and are predicted at Onset change-point when case counts are low. Temperature defines a viable range for transmission; humidity amplifies the potential within that range. This duality is central to transmission. Eighty percent of 1.2 million severe dengue cases occurred when mean temperature was 27-29.5°C and mean humidity was > 75%. Interventions are most effective when applied early. Most cases occur near Peak, yet small reductions at Onset can substantially reduce epidemic magnitude. Monitoring the Quiet-Phase is fundamental in effectively targeting interventions pre-emptively.
Paton, Susan; Thompson, Katy-Anne; Parks, Simon R; Bennett, Allan M
2015-08-01
The aim of this study was to quantify reaerosolization of microorganisms caused by walking on contaminated flooring to assess the risk to individuals accessing areas contaminated with pathogenic organisms, for example, spores of Bacillus anthracis. Industrial carpet and polyvinyl chloride (PVC) floor coverings were contaminated with aerosolized spores of Bacillus atrophaeus by using an artist airbrush to produce deposition of ∼10(3) to 10(4) CFU · cm(-2). Microbiological air samplers were used to quantify the particle size distribution of the aerosol generated when a person walked over the floorings in an environmental chamber. Results were expressed as reaerosolization factors (percent per square centimeter per liter), to represent the ratio of air concentration to surface concentration generated. Walking on carpet generated a statistically significantly higher reaerosolization factor value than did walking on PVC (t = 20.42; P < 0.001). Heavier walking produced a statistically significantly higher reaerosolization factor value than did lighter walking (t = 12.421; P < 0.001). Height also had a statistically significant effect on the reaerosolization factor, with higher rates of recovery of B. atrophaeus at lower levels, demonstrating a height-dependent gradient of particle reaerosolization. Particles in the respirable size range were recovered in all sampling scenarios (mass mean diameters ranged from 2.6 to 4.1 μm). The results of this study can be used to produce a risk assessment of the potential aerosol exposure of a person accessing areas with contaminated flooring in order to inform the choice of appropriate respiratory protective equipment and may aid in the selection of the most suitable flooring types for use in health care environments, to reduce aerosol transmission in the event of contamination. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Thompson, Katy-Anne; Parks, Simon R.; Bennett, Allan M.
2015-01-01
The aim of this study was to quantify reaerosolization of microorganisms caused by walking on contaminated flooring to assess the risk to individuals accessing areas contaminated with pathogenic organisms, for example, spores of Bacillus anthracis. Industrial carpet and polyvinyl chloride (PVC) floor coverings were contaminated with aerosolized spores of Bacillus atrophaeus by using an artist airbrush to produce deposition of ∼103 to 104 CFU · cm−2. Microbiological air samplers were used to quantify the particle size distribution of the aerosol generated when a person walked over the floorings in an environmental chamber. Results were expressed as reaerosolization factors (percent per square centimeter per liter), to represent the ratio of air concentration to surface concentration generated. Walking on carpet generated a statistically significantly higher reaerosolization factor value than did walking on PVC (t = 20.42; P < 0.001). Heavier walking produced a statistically significantly higher reaerosolization factor value than did lighter walking (t = 12.421; P < 0.001). Height also had a statistically significant effect on the reaerosolization factor, with higher rates of recovery of B. atrophaeus at lower levels, demonstrating a height-dependent gradient of particle reaerosolization. Particles in the respirable size range were recovered in all sampling scenarios (mass mean diameters ranged from 2.6 to 4.1 μm). The results of this study can be used to produce a risk assessment of the potential aerosol exposure of a person accessing areas with contaminated flooring in order to inform the choice of appropriate respiratory protective equipment and may aid in the selection of the most suitable flooring types for use in health care environments, to reduce aerosol transmission in the event of contamination. PMID:25979883
An assessment of mumps vaccine effectiveness by dose during an outbreak in Canada
Deeks, Shelley L.; Lim, Gillian H.; Simpson, Mary Anne; Gagné, Louise; Gubbay, Jonathan; Kristjanson, Erik; Fung, Cecilia; Crowcroft, Natasha S.
2011-01-01
Background This investigation was done to assess vaccine effectiveness of one and two doses of the measles, mumps and rubella (MMR) vaccine during an outbreak of mumps in Ontario. The level of coverage required to reach herd immunity and interrupt community transmission of mumps was also estimated. Methods Information on confirmed cases of mumps was retrieved from Ontario’s integrated Public Health Information System. Cases that occurred between Sept. 1, 2009, and June 10, 2010, were included. Selected health units supplied coverage data from the Ontario Immunization Record Information System. Vaccine effectiveness by dose was calculated using the screening method. The basic reproductive number (R0) represents the average number of new infections per case in a fully susceptile population, and R0 values of between 4 and 10 were considered for varying levels of vaccine effectiveness. Results A total of 134 confirmed cases of mumps were identified. Information on receipt of MMR vaccine was available for 114 (85.1%) cases, of whom 63 (55.3%) reported having received only one dose of vaccine; 32 (28.1%) reported having received two doses. Vaccine effectiveness of one dose of the MMR vaccine ranged from 49.2% to 81.6%, whereas vaccine effectiveness of two doses ranged from 66.3% to 88.0%. If we assume vaccine effectiveness of 85% for two doses of the vaccine, vaccine coverage of 88.2% and 98.0% would be needed to interrupt community transmission of mumps if the corresponding reproductive values were four and six. Interpretation Our estimates of vaccine effectiveness of one and two doses of mumps-containing vaccine were consistent with the estimates that have been reported in other outbreaks. Outbreaks occurring in Ontario and elsewhere serve as a warning against complacency over vaccination programs. PMID:21576295
An assessment of mumps vaccine effectiveness by dose during an outbreak in Canada.
Deeks, Shelley L; Lim, Gillian H; Simpson, Mary Anne; Gagné, Louise; Gubbay, Jonathan; Kristjanson, Erik; Fung, Cecilia; Crowcroft, Natasha S
2011-06-14
This investigation was done to assess vaccine effectiveness of one and two doses of the measles, mumps and rubella (MMR) vaccine during an outbreak of mumps in Ontario. The level of coverage required to reach herd immunity and interrupt community transmission of mumps was also estimated. Information on confirmed cases of mumps was retrieved from Ontario's integrated Public Health Information System. Cases that occurred between Sept. 1, 2009, and June 10, 2010, were included. Selected health units supplied coverage data from the Ontario Immunization Record Information System. Vaccine effectiveness by dose was calculated using the screening method. The basic reproductive number (R(0)) represents the average number of new infections per case in a fully susceptible population, and R(0) values of between 4 and 10 were considered for varying levels of vaccine effectiveness. A total of 134 confirmed cases of mumps were identified. Information on receipt of MMR vaccine was available for 114 (85.1%) cases, of whom 63 (55.3%) reported having received only one dose of vaccine; 32 (28.1%) reported having received two doses. Vaccine effectiveness of one dose of the MMR vaccine ranged from 49.2% to 81.6%, whereas vaccine effectiveness of two doses ranged from 66.3% to 88.0%. If we assume vaccine effectiveness of 85% for two doses of the vaccine, vaccine coverage of 88.2% and 98.0% would be needed to interrupt community transmission of mumps if the corresponding reproductive values were four and six. Our estimates of vaccine effectiveness of one and two doses of mumps-containing vaccine were consistent with the estimates that have been reported in other outbreaks. Outbreaks occurring in Ontario and elsewhere serve as a warning against complacency over vaccination programs.
Frequent Detection and Genetic Diversity of Human Bocavirus in Urban Sewage Samples.
Iaconelli, M; Divizia, M; Della Libera, S; Di Bonito, P; La Rosa, Giuseppina
2016-12-01
The prevalence and genetic diversity of human bocaviruses (HBoVs) in sewage water samples are largely unknown. In this study, 134 raw sewage samples from 25 wastewater treatment plants (WTPs) in Italy were analyzed by nested PCR and sequencing using species-specific primer pairs and broad-range primer pairs targeting the capsid proteins VP1/VP2. A large number of samples (106, 79.1 %) were positive for HBoV. Out of these, 49 were classified as HBoV species 2, and 27 as species 3. For the remaining 30 samples, sequencing results showed mixed electropherograms. By cloning PCR amplicons and sequencing, we confirmed the copresence of species 2 and 3 in 29 samples and species 2 and 4 in only one sample. A real-time PCR assay was also performed, using a newly designed TaqMan assay, for quantification of HBoVs in sewage water samples. Viral load quantification ranged from 5.51E+03 to 1.84E+05 GC/L (mean value 4.70E+04 GC/L) for bocavirus 2 and from 1.89E+03 to 1.02E+05 GC/L (mean value 2.27E+04 GC/L) for bocavirus 3. The wide distribution of HBoV in sewages suggests that this virus is common in the population, and the most prevalent are the species 2 and 3. HBoV-4 was also found, representing the first detection of this species in Italy. Although there is no indication of waterborne transmission for HBoV, the significant presence in sewage waters suggests that HBoV may spread to other water environments, and therefore, a potential role of water in the HBoV transmission should not be neglected.
Utilization of barite/cement composites for gamma rays attenuation
NASA Astrophysics Data System (ADS)
Sakr, Khaled; Ramadan, Wageeh; Sayed, Magda; El-Zakla, Tarek; El-Desouqy, Mohamed; El-Faramawy, Nabil
2018-04-01
The present work is directed to investigate the contribution of adding barite aggregates to cement as a shielding material for radioactive wastes disposal facilities. The percentages of barite from 5% up to 20% mixed with cement with different grain sizes were examined. Mechanical and physical properties such as compressive strength, wet and dry densities, water absorption, and porosity have been investigated. The thermogravimetric analysis and X-ray diffraction were used to examine the thermal stability and the characterizations of studied samples, respectively. The linear attenuation coefficient, mean free path, half value layer, and transmission fraction were evaluated. All the nuclear shielding parameters revealed the uppermost values for cement mixed with 5% barite of size range 250-600 µm. The attenuation coefficient of the investigated samples displayed an increase by more than 125% than that of neat cement.
Complex band structure and electronic transmission eigenchannels
NASA Astrophysics Data System (ADS)
Jensen, Anders; Strange, Mikkel; Smidstrup, Søren; Stokbro, Kurt; Solomon, Gemma C.; Reuter, Matthew G.
2017-12-01
It is natural to characterize materials in transport junctions by their conductance length dependence, β. Theoretical estimations of β are made employing two primary theories: complex band structure and density functional theory (DFT) Landauer transport. It has previously been shown that the β value derived from total Landauer transmission can be related to the β value from the smallest |ki| complex band; however, it is an open question whether there is a deeper relationship between the two. Here we probe the details of the relationship between transmission and complex band structure, in this case individual eigenchannel transmissions and different complex bands. We present calculations of decay constants for the two most conductive states as determined by complex band structure and standard DFT Landauer transport calculations for one semi-conductor and two molecular junctions. The molecular junctions show that both the length dependence of the total transmission and the individual transmission eigenvalues can be, almost always, found through the complex band structure. The complex band structure of the semi-conducting material, however, does not predict the length dependence of the total transmission but only of the individual channels, at some k-points, due to multiple channels contributing to transmission. We also observe instances of vertical bands, some of which are the smallest |ki| complex bands, that do not contribute to transport. By understanding the deeper relationship between complex bands and individual transmission eigenchannels, we can make a general statement about when the previously accepted wisdom linking transmission and complex band structure will fail, namely, when multiple channels contribute significantly to the transmission.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Syh, J
2014-06-01
Purpose: This study was conducted to ensure that various lead shield apron manufacturers provided accurate attenuation factors regardless of whether the apron was made of lead-based or lead-free equivalent material. Methods: A calibrated ionization survey meter was placed at chest height and 36 cm horizontally away from a solid water phantom on a simulator couch. Measurements were done with or without apron. Radiation field was set to 24cmx24cm with the phantom at 100cm source-to-surface distance. Irradiation time was set for 1 minute at voltages of 60, 80, 100 and 120 kVp. Current was set at 6mA. Results: Between 60 kVpmore » and 120 kVp, the transmission through 0.50 mm of lead-based apron was between 1.0% and 6.5% with a mean value of 3.2% and a standard deviation (s.d.) of 1.4%. The transmissions through the 0.50 mm lead-free aprons were 1.0 % to 12.0% with a mean value of 6.1% and s.d. of 2.6%. At 120 kVp, the transmission value was 6.5% for 0.50 mm lead-based apron and 11.1% to 12.0% for 0.50 mm lead-free aprons. The radiation transmissions at 80 kVp, measured in two different 0.5 mm lead-free aprons, were 4.3% each. However, only 1.4% transmission was found through the lead-based apron. Overall, the radiation transmitted through the lead-based apron was 1/3 transmission of lead-free at 80kVp, and half value of lead-free aprons at 100 and 120 kVp. Conclusion: Even though lead-based and lead-free aprons all claimed to have the same lead equivalent thickness, the transmission might not be the same. The precaution was needed to exercise diligence in quality assurance program to assure adequate protection to staff who wear it during diagnostic procedures. The requirement for aprons not only should be in certain thickness to meet state regulation but also to keep reasonably achievable low exposure with the accurate labeling from manufacturers.« less
Nelson, Richard E.; Jones, Makoto; Leecaster, Molly; Samore, Matthew H.; Ray, William; Huttner, Angela; Huttner, Benedikt; Khader, Karim; Stevens, Vanessa W.; Gerding, Dale; Schweizer, Marin L.; Rubin, Michael A.
2016-01-01
Background A number of strategies exist to reduce Clostridium difficile (C. difficile) transmission. We conducted an economic evaluation of “bundling” these strategies together. Methods We constructed an agent-based computer simulation of nosocomial C. difficile transmission and infection in a hospital setting. This model included the following components: interactions between patients and health care workers; room contamination via C. difficile shedding; C. difficile hand carriage and removal via hand hygiene; patient acquisition of C. difficile via contact with contaminated rooms or health care workers; and patient antimicrobial use. Six interventions were introduced alone and "bundled" together: (a) aggressive C. difficile testing; (b) empiric isolation and treatment of symptomatic patients; (c) improved adherence to hand hygiene and (d) contact precautions; (e) improved use of soap and water for hand hygiene; and (f) improved environmental cleaning. Our analysis compared these interventions using values representing 3 different scenarios: (1) base-case (BASE) values that reflect typical hospital practice, (2) intervention (INT) values that represent implementation of hospital-wide efforts to reduce C. diff transmission, and (3) optimal (OPT) values representing the highest expected results from strong adherence to the interventions. Cost parameters for each intervention were obtained from published literature. We performed our analyses assuming low, normal, and high C. difficile importation prevalence and transmissibility of C. difficile. Results INT levels of the “bundled” intervention were cost-effective at a willingness-to-pay threshold of $100,000/quality-adjusted life-year in all importation prevalence and transmissibility scenarios. OPT levels of intervention were cost-effective for normal and high importation prevalence and transmissibility scenarios. When analyzed separately, hand hygiene compliance, environmental decontamination, and empiric isolation and treatment were the interventions that had the greatest impact on both cost and effectiveness. Conclusions A combination of available interventions to prevent CDI is likely to be cost-effective but the cost-effectiveness varies for different levels of intensity of the interventions depending on epidemiological conditions such as C. difficile importation prevalence and transmissibility. PMID:27031464
NASA Astrophysics Data System (ADS)
Smirnov, A. V.; Tarduno, J. A.
2002-12-01
To evaluate the magnetic properties of submarine and subaerial basaltic glass recovered by drilling during ODP Leg 197 at Detroit Seamount (ODP Site 1203) and Koko Seamount (ODP Site 1206) we have conducted a series of rock magnetic measurements and transmission electron microscopy (TEM) analyses. These glass samples have very low natural remanent magnetizations (NRM < 50 nAm2/g) and their magnetic hysteresis properties are dominated by paramagnetism. After correction for the large paramagnetic signal, samples which show a ferromagnetic component have pseudo-single domain behavior, implying magnetic grain sizes larger than those reported for Holocene glasses. Transmission electron microscopy confirms a very low concentration of crystalline inclusions in the glass. A striking feature often observed during the TEM analyses is the partial (or complete) melting of samples by the electron beam and the apparent formation of new crystalline particles. Thellier experiments on submarine basaltic glass (SBG) show a rapid acquisition of thermoremanent magnetization (TRM) with respect to NRM demagnetization which, taken at face value, implies magnetization in a very weak (<17 μT) ambient field. Yet monitoring of magnetic hysteresis properties during the Thellier experiments (on splits used for paleointensity determinations) indicates a systematic variation in values over the same temperature range where rapid TRM acquisition is observed. We suggest that the experimental data can be explained by the partial melting and neocrystallization of magnetic grains in our SBG samples during the thermal treatments required by the Thellier method, resulting in paleointensity values biased to low values. Magnetic hysteresis monitoring may provide a straight-forward means of detecting partial melting during Thellier experiments.
NASA Technical Reports Server (NTRS)
Timofeyev, Y. M.
1979-01-01
In order to test the error of calculation in assumed values of the transmission function for Soviet and American radiometers sounding the atmosphere thermally from orbiting satellites, the assumptions of the transmission calculation is varied with respect to atmospheric CO2 content, transmission frequency, and atmospheric absorption. The error arising from variations of the assumptions from the standard basic model is calculated.
The Relationship Between School Holidays and Transmission of Influenza in England and Wales.
Jackson, Charlotte; Vynnycky, Emilia; Mangtani, Punam
2016-11-01
School closure is often considered as an influenza control measure, but its effects on transmission are poorly understood. We used 2 approaches to estimate how school holidays affect the contact parameter (the per capita rate of contact sufficient for infection transmission) for influenza using primary care data from England and Wales (1967-2000). Firstly, we fitted an age-structured susceptible-infectious-recovered model to each year's data to estimate the proportional change in the contact parameter during school holidays as compared with termtime. Secondly, we calculated the percentage difference in the contact parameter between holidays and termtime from weekly values of the contact parameter, estimated directly from simple mass-action models. Estimates were combined using random-effects meta-analysis, where appropriate. From fitting to the data, the difference in the contact parameter among children aged 5-14 years during holidays as compared with termtime ranged from a 36% reduction to a 17% increase; estimates were too heterogeneous for meta-analysis. Based on the simple mass-action model, the contact parameter was 17% (95% confidence interval: 10, 25) lower during holidays than during termtime. Results were robust to the assumed proportions of infections that were reported and individuals who were susceptible when the influenza season started. We conclude that school closure may reduce transmission during influenza outbreaks. © The Author 2016. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Asfahani, Jamal
2016-05-01
A new alternative approach based on using Vertical electrical sounding (VES) technique is proposed for computing the hydraulic conductivity K of an aquifer. The approach takes only the salinity of the groundwater into consideration. VES measurements in the locations, where available water samples exist, are required in such an approach, in order to calibrate and establish empirical relationships between transverse resistance Dar-Zarrouck TR parameter and modified transverse resistance MTR, and between MTR and transmissivity T. Those relationships are thereafter used to extrapolate the transmissivity even in the VES points where no water samples exist. This approach is tested and practiced in the Khanasser valley, Northern Syria, where the hydraulic conductivity of the Quaternary aquifer is computed. An acceptable agreement is found between the hydraulic conductivity values obtained by the proposed approach and those obtained by the pumping test which range between 0.864 and 8.64 m/day (10-5 and 10-4 m/s). The Quaternary aquifer transmissivity of the Khanasser Valley, has been characterized by using this approach and by adapting the MTR parameter. The transmissivity varies between a minimum of 79 m2/day and a maximum of 814 m2/day, with an average of 283 m2/day and a standard deviation of 145 m2/day. The easy and inexpensive approach proposed in this paper can be applied in other semi arid regions.
47 CFR 73.322 - FM stereophonic sound transmission standards.
Code of Federal Regulations, 2014 CFR
2014-10-01
... transmission, modulation of the carrier by audio components within the baseband range of 50 Hz to 15 kHz shall... the carrier by audio components within the audio baseband range of 23 kHz to 99 kHz shall not exceed... method described in (a), must limit the modulation of the carrier by audio components within the audio...
47 CFR 73.322 - FM stereophonic sound transmission standards.
Code of Federal Regulations, 2013 CFR
2013-10-01
... transmission, modulation of the carrier by audio components within the baseband range of 50 Hz to 15 kHz shall... the carrier by audio components within the audio baseband range of 23 kHz to 99 kHz shall not exceed... method described in (a), must limit the modulation of the carrier by audio components within the audio...
47 CFR 73.322 - FM stereophonic sound transmission standards.
Code of Federal Regulations, 2011 CFR
2011-10-01
... transmission, modulation of the carrier by audio components within the baseband range of 50 Hz to 15 kHz shall... the carrier by audio components within the audio baseband range of 23 kHz to 99 kHz shall not exceed... method described in (a), must limit the modulation of the carrier by audio components within the audio...
47 CFR 73.322 - FM stereophonic sound transmission standards.
Code of Federal Regulations, 2012 CFR
2012-10-01
... transmission, modulation of the carrier by audio components within the baseband range of 50 Hz to 15 kHz shall... the carrier by audio components within the audio baseband range of 23 kHz to 99 kHz shall not exceed... method described in (a), must limit the modulation of the carrier by audio components within the audio...
Clinical review: Update of avian influenza A infections in humans
Sandrock, Christian; Kelly, Terra
2007-01-01
Influenza A viruses have a wide host range for infection, from wild waterfowl to poultry to humans. Recently, the cross-species transmission of avian influenza A, particularly subtype H5N1, has highlighted the importance of the non-human subtypes and their incidence in the human population has increased over the past decade. During cross-species transmission, human disease can range from the asymptomatic to mild conjunctivitis to fulminant pneumonia and death. With these cases, however, the risk for genetic change and development of a novel virus increases, heightening the need for public health and hospital measures. This review discusses the epidemiology, host range, human disease, outcome, treatment, and prevention of cross-transmission of avian influenza A into humans. PMID:17419881
When are pathogen genome sequences informative of transmission events?
Ferguson, Neil; Jombart, Thibaut
2018-01-01
Recent years have seen the development of numerous methodologies for reconstructing transmission trees in infectious disease outbreaks from densely sampled whole genome sequence data. However, a fundamental and as of yet poorly addressed limitation of such approaches is the requirement for genetic diversity to arise on epidemiological timescales. Specifically, the position of infected individuals in a transmission tree can only be resolved by genetic data if mutations have accumulated between the sampled pathogen genomes. To quantify and compare the useful genetic diversity expected from genetic data in different pathogen outbreaks, we introduce here the concept of ‘transmission divergence’, defined as the number of mutations separating whole genome sequences sampled from transmission pairs. Using parameter values obtained by literature review, we simulate outbreak scenarios alongside sequence evolution using two models described in the literature to describe transmission divergence of ten major outbreak-causing pathogens. We find that while mean values vary significantly between the pathogens considered, their transmission divergence is generally very low, with many outbreaks characterised by large numbers of genetically identical transmission pairs. We describe the impact of transmission divergence on our ability to reconstruct outbreaks using two outbreak reconstruction tools, the R packages outbreaker and phybreak, and demonstrate that, in agreement with previous observations, genetic sequence data of rapidly evolving pathogens such as RNA viruses can provide valuable information on individual transmission events. Conversely, sequence data of pathogens with lower mean transmission divergence, including Streptococcus pneumoniae, Shigella sonnei and Clostridium difficile, provide little to no information about individual transmission events. Our results highlight the informational limitations of genetic sequence data in certain outbreak scenarios, and demonstrate the need to expand the toolkit of outbreak reconstruction tools to integrate other types of epidemiological data. PMID:29420641
Evaluating the Value of High Spatial Resolution in National Capacity Expansion Models using ReEDS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krishnan, Venkat; Cole, Wesley
2016-11-14
Power sector capacity expansion models (CEMs) have a broad range of spatial resolutions. This paper uses the Regional Energy Deployment System (ReEDS) model, a long-term national scale electric sector CEM, to evaluate the value of high spatial resolution for CEMs. ReEDS models the United States with 134 load balancing areas (BAs) and captures the variability in existing generation parameters, future technology costs, performance, and resource availability using very high spatial resolution data, especially for wind and solar modeled at 356 resource regions. In this paper we perform planning studies at three different spatial resolutions--native resolution (134 BAs), state-level, and NERCmore » region level--and evaluate how results change under different levels of spatial aggregation in terms of renewable capacity deployment and location, associated transmission builds, and system costs. The results are used to ascertain the value of high geographically resolved models in terms of their impact on relative competitiveness among renewable energy resources.« less
Mavrogordatos, Th K; Morris, S M; Castles, F; Hands, P J W; Ford, A D; Coles, H J; Wilkinson, T D
2012-07-01
We calculate the density of photon states (DOS) of the normal modes in dye-doped chiral nematic liquid crystal (LC) cells in the presence of various loss mechanisms. Losses and gain are incorporated into the transmission characteristics through the introduction of a small imaginary part in the dielectric constant perpendicular and along the director, for which we assume no frequency dispersion. Theoretical results are presented on the DOS in the region of the photonic band gap for a range of values of the loss coefficient and different values of the optical anisotropy. The obtained values of the DOS at the photonic band gap edges predict a reversal of the dominant modes in the structure. Our results are found to be in good agreement with the experimentally obtained excitation thresholds in chiral nematic LC lasers. The behavior of the DOS is also discussed for amplifying LC cells providing additional insight to the lasing mechanism of these structures.
Papagiannis, P; Baltas, D; Granero, D; Pérez-Calatayud, J; Gimeno, J; Ballester, F; Venselaar, J L M
2008-11-01
To address the limited availability of radiation shielding data for brachytherapy as well as some disparity in existing data, Monte Carlo simulation was used to generate radiation transmission data for 60Co, 137CS, 198Au, 192Ir 169Yb, 170Tm, 131Cs, 125I, and 103pd photons through concrete, stainless steel, lead, as well as lead glass and baryte concrete. Results accounting for the oblique incidence of radiation to the barrier, spectral variation with barrier thickness, and broad beam conditions in a realistic geometry are compared to corresponding data in the literature in terms of the half value layer (HVL) and tenth value layer (TVL) indices. It is also shown that radiation shielding calculations using HVL or TVL values could overestimate or underestimate the barrier thickness required to achieve a certain reduction in radiation transmission. This questions the use of HVL or TVL indices instead of the actual transmission data. Therefore, a three-parameter model is fitted to results of this work to facilitate accurate and simple radiation shielding calculations.
Hydraulic characteristics of, and ground-water flow in, coal-bearing rocks of southwestern Virginia
Harlow, George E.; LeCain, Gary D.
1993-01-01
This report presents the results of a study by the U.S Geological Survey, in cooperation with the Virginia Department of Mines, Minerals, and Energy, Division of Mined Land Reclamation, and the Powell River Project, to describe the hydraulic characteristics of major water-bearing zones in the coal-bearing rocks of southwestern Virginia and to develop a conceptual model of the ground-water-flow system. Aquifer testing in1987 and 1988 of 9-ft intervals in coal-exploration coreholes indicates that transmissivity decreases with increasing depth. Most rock types are permeable to a depth of approximately 100 ft; however, only coal seams are consistently permeable (transmissivity greater than 0.001 ft/d) at depths greater than 200 ft . Constant-head injection testing of rock intervals adjacent to coal seams usually indicated lower values of transmissivity than those values obtained when coal seams were isolated within the test interval; thus, large values of horizontal hydraulic conductivity at depth are associated with coal seams. Potentiometric-head measurements indicate that high topographic areas (ridges) function as recharge areas; water infiltrates through the surface, percolates into regolith, and flows downward and laterally through fractures in the shallow bedrock. Hydraulic conductivity decreases with increasing depth, and ground water flows primarily in the lateral direction along fractures or bedding planes or through coal seams. If vertical hydraulic conductivity is negligible, ground water continues to flow laterally, discharging as springs or seeps on hill slopes. Where vertical hydraulic conductivity is appreciable, groundwater follows a stair step path through the regolith, fractures, bedding planes, and coal seams, discharging to streams and (or) recharging coal seams at depth. Permeable coal seams probably underlie valleys in the region; however, aquifer-test data indicate that the horizontal hydraulic conductivity of coal is a function of depth and probably decreases under ridges because of increased overburden pressures. Ground water beneath valleys that does not discharge to streams probably flows down gradient as underflow beneath the streams. Topographic relief in the area provides large hydraulic-head differences (greater than 300 ft in some instances) for the ground-water-flow system. Transmissivity data from the range of depths tested during this study indicate that most ground-water flow takes place at moderate depths (less than 300 ft) and that little deep regional ground-water flow occurs.
Performance Evaluation of High Speed Multicarrier System for Optical Wireless Communication
NASA Astrophysics Data System (ADS)
Mathur, Harshita; Deepa, T.; Bartalwar, Sophiya
2018-04-01
Optical wireless communication (OWC) in the infrared and visible range is quite impressive solution, especially where radio communication face challenges. Visible light communication (VLC) uses visible light over a range of 400 and 800 THz and is a subdivision of OWC technologies. With an increasing demand for use of wireless communications, wireless access via Wi-Fi is facing many challenges especially in terms of capacity, availability, security and efficiency. VLC uses intensity modulation and direct detection (IM/DD) techniques and hence they require the signals to certainly be real valued positive sequences. These constraints pose limitation on digital modulation techniques. These limitations result in spectrum-efficiency or power-efficiency losses. In this paper, we investigate an amplitude shift keying (ASK) based orthogonal frequency division multiplexing (OFDM) signal transmission scheme using LabVIEW for VLC technology.
NASA Astrophysics Data System (ADS)
Krzyścin, J. W.; Jaroslawski, J.; Sobolewski, P.
2001-10-01
A forecast of the UV index for the following day is presented. The standard approach to the UV index modelling is applied, i.e., the clear-sky UV index is multiplied by the UV cloud transmission factor. The input to the clear-sky model (tropospheric ultraviolet and visible-TUV model, Madronich, in: M. Tevini (Ed.), Environmental Effects of Ultraviolet Radiation, Lewis Publisher, Boca Raton, /1993, p. 17) consists of the total ozone forecast (by a regression model using the observed and forecasted meteorological variables taken as the initial values of aviation (AVN) global model and their 24-hour forecasts, respectively) and aerosols optical depth (AOD) forecast (assumed persistence). The cloud transmission factor forecast is inferred from the 24-h AVN model run for the total (Sun/+sky) solar irradiance at noon. The model is validated comparing the UV index forecasts with the observed values, which are derived from the daily pattern of the UV erythemal irradiance taken at Belsk (52°N,21°E), Poland, by means of the UV Biometer Solar model 501A for the period May-September 1999. Eighty-one percent and 92% of all forecasts fall into /+/-1 and /+/-2 index unit range, respectively. Underestimation of UV index occurs only in 15%. Thus, the model gives a high security in Sun protection for the public. It is found that in /~35% of all cases a more accurate forecast of AOD is needed to estimate the daily maximum of clear-sky irradiance with the error not exceeding 5%. The assumption of the persistence of the cloud characteristics appears as an alternative to the 24-h forecast of the cloud transmission factor in the case when the AVN prognoses are not available.
Epidemiological study of air filtration systems for preventing PRRSV infection in large sow herds.
Alonso, Carmen; Murtaugh, Michael P; Dee, Scott A; Davies, Peter R
2013-10-01
Porcine reproductive and respiratory syndrome virus (PRRSV) is the most economically significant pathogen in the US swine industry. Aerosol transmission among herds is a major concern in pig dense regions and filtration of incoming air, in combination with standard biosecurity procedures, has been demonstrated to prevent transmission of PRRSV into susceptible herds. To quantify the impact of air filtration on reducing risk of PRRSV outbreaks, we compared the incidence rate of new PRRSV introductions in 20 filtered and 17 non-filtered control sow herds in a swine dense region of North America during a 7 year study period. Events of novel virus introduction were ascertained by phylogenetic analysis of PRRSV ORF5 gene sequences. Putative new viruses were defined as exogenous (introduced) based on ORF5 nucleotide sequence differences compared to previous farm isolates. The influence of sequence difference cut-off values ranging from 2 to 10% on case definition and relative risk were evaluated. Non-filtered farms incurred about 0.5 outbreaks per year, with a seasonal increase in risk in cooler periods. Baseline risk, prior to filtration, in treatment farms was approximately 0.75 per year, approximately 50% higher than in control farms. Air filtration significantly reduced risk of PRRSV introduction events to 0.06-0.22 outbreaks per year, depending on the cut-off values used to classify a virus isolate as new to the herd. Overall, air filtration led to an approximately 80% reduction in risk of introduction of novel PRRSV, indicating that on large sow farms with good biosecurity in swine-dense regions, approximately four-fifths of PRRSV outbreaks may be attributable to aerosol transmission. Copyright © 2013 Elsevier B.V. All rights reserved.
Transmissible Spongiform Encephalopathy and Meat Safety
NASA Astrophysics Data System (ADS)
Ward, Hester J. T.; Knight, Richard S. G.
Prion diseases or transmissible spongiform encephalopathies (TSEs) comprise a wide-ranging group of neurodegenerative diseases found in animals and humans. They have diverse causes and geographical distributions, but have similar pathological features, transmissibility and, are ultimately, fatal. Central to all TSEs is the presence of an abnormal form of a normal host protein, namely the prion protein. Because of their potential transmissibility, these diseases have wide public health ramifications.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Experimental Study of Split-Path Transmission Load Sharing
NASA Technical Reports Server (NTRS)
Krantz, Timothy L.; Delgado, Irebert R.
1996-01-01
Split-path transmissions are promising, attractive alternatives to the common planetary transmissions for helicopters. The split-path design offers two parallel paths for transmitting torque from the engine to the rotor. Ideally, the transmitted torque is shared equally between the two load paths; however, because of manufacturing tolerances, the design must be sized to allow for other than equal load sharing. To study the effect of tolerances, experiments were conducted using the NASA split-path test gearbox. Two gearboxes, nominally identical except for manufacturing tolerances, were tested. The clocking angle was considered to be a design parameter and used to adjust the load sharing of an otherwise fixed design. The torque carried in each path was measured for a matrix of input torques and clocking angles. The data were used to determine the optimal value and a tolerance for the clocking angles such that the most heavily loaded split path carried no greater than 53 percent of an input shaft torque of 367 N-m. The range of clocking angles satisfying this condition was -0.0012 +/- 0.0007 rad for box 1 and -0.0023 +/- 0.0009 rad for box 2. This study indicates that split-path gearboxes can be used successfully in rotorcraft and can be manufactured with existing technology.
Okal, Jerry; Luchters, Stanley; Geibel, Scott; Chersich, Matthew F; Lango, Daniel; Temmerman, Marleen
2009-11-01
Knowledge about sexual practices and life experiences of men having sex with men in Kenya, and indeed in East Africa, is limited. Although the impact of male same-sex HIV transmission in Africa is increasingly acknowledged, HIV prevention initiatives remain focused largely on heterosexual and mother-to-child transmission. Using data from ten in-depth interviews and three focus group discussions (36 men), this analysis explores social and behavioural determinants of sexual risks among men who sell sex to men in Mombasa, Kenya. Analysis showed a range and variation of men by age and social class. First male same-sex experiences occurred for diverse reasons, including love and pleasure, as part of sexual exploration, economic exchange and coercion. Condom use is erratic and subject to common constraints, including notions of sexual interference and motivations of clients. Low knowledge compounds sexual risk taking, with a widespread belief that the risk of HIV transmission through anal sex is lower than vaginal sex. Traditional family values, stereotypes of abnormality, gender norms and cultural and religious influences underlie intense stigma and discrimination. This information is guiding development of peer education programmes and sensitisation of health providers, addressing unmet HIV prevention needs. Such changes are required throughout Eastern Africa.
The Storage Cell for the Tri-Experiment at COSY-JÜLICH
NASA Astrophysics Data System (ADS)
Felden, O.; Gebel, R.; Glende, M.; Lehrach, A.; Maier, R.; Prasuhn, D.; von Rossen, P.; Bisplinghoff, J.; Eversheim, P. D.; Hinterberger, F.
2002-04-01
At the EDDA experiment in the cooler synchrotron COSY in Jülich an atomic beam target is used which provides the designed polarization and density distribution. To increase the target density significantly a storage cell has been developed and implemented. This will contribute to a higher accuracy for the test of Time Reversal Invariance (TRI) which will be performed at the EDDA target place. To obtain the higher luminosity the target density and the transmission of the COSY beam through the cell were determined in their dependence on the cell aperture. Low storage cell apertures increase the target density in the cell but reduce the transmission of the circulating proton beam. To find the optimal cell design the transmission of the COSY beam was measured with movable scrapers and tested with an aperture at EDDA simulating the storage cell. The target density was calculated by Monte Carlo simulations for several cell geometries. An additional gain in target density is achieved by cooling the cell. A Teflon
Mass-stiffness substructuring of an elastic metasurface for full transmission beam steering
NASA Astrophysics Data System (ADS)
Lee, Hyuk; Lee, Jun Kyu; Seung, Hong Min; Kim, Yoon Young
2018-03-01
The metasurface concept has a significant potential due to its novel wavefront-shaping functionalities that can be critically useful for ultrasonic and solid wave-based applications. To achieve the desired functionalities, elastic metasurfaces should cover full 2π phase shift and also acquire full transmission within subwavelength scale. However, they have not been explored much with respect to the elastic regime, because the intrinsic proportionality of mass-stiffness within the continuum elastic media causes an inevitable trade-off between abrupt phase shift and sufficient transmission. Our goal is to engineer an elastic metasurface that can realize an inverse relation between (amplified) effective mass and (weakened) stiffness in order to satisfy full 2π phase shift as well as full transmission. To achieve this goal, we propose a continuum elastic metasurface unit cell that is decomposed into two substructures, namely a mass-tuning substructure with a local dipolar resonator and a stiffness-tuning substructure composed of non-resonant multiply-perforated slits. We demonstrate analytically, numerically, and experimentally that this unique substructured unit cell can satisfy the required phase shift with high transmission. The substructuring enables independent tuning of the elastic properties over a wide range of values. We use a mass-spring model of the proposed continuum unit cell to investigate the working mechanism of the proposed metasurface. With the designed metasurface consisting of substructured unit cells embedded in an aluminum plate, we demonstrate that our metasurface can successfully realize anomalous steering and focusing of in-plane longitudinal ultrasonic beams. The proposed substructuring concept is expected to provide a new principle for the design of general elastic metasurfaces that can be used to efficiently engineer arbitrary wave profiles.
Booker, Sam A; Pires, Nuno; Cobb, Stuart; Soares-da-Silva, Patrício; Vida, Imre
2015-06-01
This study assessed the anticonvulsant and seizure generation effects of carbamazepine (CBZ), oxcarbazepine (OXC) and eslicarbazepine (S-Lic) in wild-type mice. Electrophysiological recordings were made to discriminate potential cellular and synaptic mechanisms underlying anti- and pro-epileptic actions. The anticonvulsant and pro-convulsant effects were evaluated in the MES, the 6-Hz and the Irwin tests. Whole-cell patch-clamp recordings were used to investigate the effects on fast excitatory and inhibitory synaptic transmission in hippocampal area CA1. The safety window for CBZ, OXC and eslicarbazepine (ED50 value against the MES test and the dose that produces grade 5 convulsions in all mice), was 6.3, 6.0 and 12.5, respectively. At high concentrations the three drugs reduced synaptic transmission. CBZ and OXC enhanced excitatory postsynaptic currents (EPSCs) at low, therapeutically-relevant concentrations. These effects were associated with no change in inhibitory postsynaptic currents (IPSCs) resulting in altered balance between excitation and inhibition. S-Lic had no effect on EPSC or IPSC amplitudes over the same concentration range. The CBZ mediated enhancement of EPSCs was blocked by DPCPX, a selective antagonist, and occluded by CCPA, a selective agonist of the adenosine A1 receptor. Furthermore, reduction of endogenous adenosine by application of the enzyme adenosine deaminase also abolished the CBZ- and OXC-induced increase of EPSCs, indicating that the two drugs act as antagonists at native adenosine receptors. In conclusion, CBZ and OXC possess pro-epileptic actions at clinically-relevant concentrations through the enhancement of excitatory synaptic transmission. S-Lic by comparison has no such effect on synaptic transmission, explaining its lack of seizure exacerbation. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Lobanov, Nikolai R.; Tunningley, Thomas; Linardakis, Peter
2018-04-01
Tandem electrostatic accelerators often require the flexibility to operate at a variety of terminal voltages to accommodate various user requirements. However, the ion beam transmission will only be optimal for a limited range of terminal voltages. This paper describes the operational performance of a novel focusing system that expands the range of terminal voltages for optimal transmission. This is accomplished by controlling the gradient of the entrance of the low-energy tube, providing an additional focusing element. In this specific case it is achieved by applying up to 150 kV to the fifth electrode of the first unit of the accelerator tube. Numerical simulations and beam transmission tests have been performed to confirm the effectiveness of the lens. An analytical expression has been derived describing its focal properties. These tests demonstrate that the entrance lens control eliminates the need to short out sections of the tube for operation at low terminal voltage.
Simulation analysis of the unconfined aquifer, Raft River geothermal area, Idaho-Utah
Nichols, William D.
1979-01-01
This study covers about 1,000 mi2 (2,600 km2 ) of the southern Raft River drainage basin in south-central Idaho and northwest Utah. The main area of interest, approximately 200 mi2 (520 km2 ) of semiarid agricultural and rangeland in the southern Raft River Valley that includes the known Geothermal Resource Area near Bridge, Idaho, was modelled numerically to evaluate the hydrodynamics of the unconfined aquifer. Computed and estimated transmissivity values range from 1,200 feet squared per day (110 meters squared per day) to 73,500 feet squared per day (6,830 meters squared per day). Water budgets, including ground-water recharge and discharge for approximate equilibrium conditions, have been computed by several previous investigators; their estimates of available ground-water recharge range from about 46,000 acre-feet per year (57 cubic hectometers per year) to 100,000 acre-feet per year (123 cubic hectometers per year).Simulation modeling of equilibrium conditions represented by 1952 water levels suggests: (1) recharge to the water-table aquifer is about 63,000 acre-feet per year (77 cubic hectometers per year); (2) a significant volume of ground water is discharged through evapotranspiration by phreatophytes growing on the valley bottomlands; (3) the major source of recharge may be from upward leakage of water from a deeper, confined reservoir; and (4) the aquifer transmissivity probably does not exceed about 12,000 feet squared per day (3,100 meters squared per day). Additional analysis carried out by simulating transient conditions from 1952 to 1965 strongly suggests that aquifer transmissivity does not exceed about 7,700 feet squared per day (700 meters squared per day). The model was calibrated using slightly modified published pumpage data; it satisfactorily reproduced the historic water-level decline over the period 1952-65.
Grammer, K. B.; Alarcon, R.; Barrón-Palos, L.; ...
2015-05-08
Liquid hydrogen is a dense Bose fluid whose equilibrium properties are both calculable from first principles using various theoretical approaches and of interest for the understanding of a wide range of questions in many-body physics. Unfortunately, the pair correlation function g(r) inferred from neutron scattering measurements of the differential cross section dσ/dΩ from different measurements reported in the literature are inconsistent. We have measured the energy dependence of the total cross section and the scattering cross section for slow neutrons with energies between 0.43 and 16.1 meV on liquid hydrogen at 15.6 K (which is dominated by the parahydrogen component)more » using neutron transmission measurements on the hydrogen target of the NPDGamma collaboration at the Spallation Neutron Source at Oak Ridge National Laboratory. The relationship between the neutron transmission measurement we perform and the total cross section is unambiguous, and the energy range accesses length scales where the pair correlation function is rapidly varying. At 1 meV our measurement is a factor of 3 below the data from previous work. We present evidence that these previous measurements of the hydrogen cross section, which assumed that the equilibrium value for the ratio of orthohydrogen and parahydrogen has been reached in the target liquid, were in fact contaminated with an extra nonequilibrium component of orthohydrogen. Liquid parahydrogen is also a widely used neutron moderator medium, and an accurate knowledge of its slow neutron cross section is essential for the design and optimization of intense slow neutron sources. Furthermore, we describe our measurements and compare them with previous work.« less
Data transmission optical link for RF-GUN project
NASA Astrophysics Data System (ADS)
Olowski, Krzysztof; Zielinski, Jerzy; Jalmuzna, Wojciech; Pozniak, Krzysztof; Romaniuk, Ryszard
2005-09-01
Today, the fast optical data transmission is one of the fundamentals of modern distributed control systems. The fibers are widely use as multi-gigabit data stream medium. For a short range transmission, the multimode fibers are in common use. The data rate for this kind of transmission exceeds 10 Gbps for 10 Gigabit Ethernet and 10G Fibre Channel protocols. The Field Programmable Gate Arrays are one of the opportunities of managing the optical transmission. This article is concerning a synchronous optical transmission system via a multimode fiber. The transmission is controlled by the FPGA of two manufacturers: Xilinx and Altera. This paper contains the newest technology overview and market device parameters. It also describes a board for the optical transmission, technical details of the transmission and optical transmission results.
Srinivasan, Rajagopalbabu; Riley, David; Diffie, Stan; Shrestha, Anita; Culbreath, Albert
2014-04-01
Thrips-transmitted Tomato spotted wilt virus (TSWV) has a broad host range including crops and weeds. In Georgia, TSWV is known to consistently affect peanut, tomato, pepper, and tobacco production. These crops are grown from March through November. In the crop-free period, weeds are presumed to serve as a green bridge for thrips and TSWV. Previous studies have identified several winter weeds as TSWV and thrips hosts. However, their ability to influence TSWV transmission in crops is still not completely understood. To further understand these interactions, population dynamics of two prevalent vectors, viz., Frankliniella fusca (Hinds) and Frankliniella occidentalis (Pergande), on selected winter weeds were monitored from October through April in four counties from 2004 to 2008. Peak populations were typically recorded in March. F. fusca and F. occidentalis adults were found on winter weeds and their percentages ranged from 0 to 68% in comparison with other adults. Immatures outnumbered all adults. Microcosm experiments indicated that the selected winter weeds differentially supported F. fusca reproduction and development. The time required to complete one generation (adult to adult) ranged from 11 to 16 d. Adult recovery ranged from 0.97 to 2.2 per female released. In addition, transmission assays revealed that thrips efficiently transmitted TSWV from peanut to weeds, the incidence of infection ranged from 10 to 55%. Back transmission assays with thrips from TSWV-infected weeds resulted in up to 75% TSWV infection in peanut. These whole-plant transmission and back transmission assays provide the basis for TSWV persistence in farmscapes year round.
Radiant Heat Transfer in Reusable Surface Insulation
NASA Technical Reports Server (NTRS)
Hughes, T. A.; Linford, R. M. F.; Chmitt, R. J.; Christensen, H. E.
1973-01-01
During radiant testing of mullite panels, temperatures in the insulation and support structure exceeded those predicted on the basis of guarded hot plate thermal conductivity tests. Similar results were obtained during arc tunnel tests of mullite specimens. The differences between effective conductivity and guarded hot plate values suggested that radiant transfer through the mullite was occurring. To study the radiant transport, measurements were made of the infrared transmission through various insulating materials and fibers of interest to the shuttle program, using black body sources over the range of 780 to 2000 K. Experimental data were analyzed and scattering coefficients were derived for a variety of materials, fiber diameters, and source temperature.
Gerbil middle-ear sound transmission from 100 Hz to 60 kHz1
Ravicz, Michael E.; Cooper, Nigel P.; Rosowski, John J.
2008-01-01
Middle-ear sound transmission was evaluated as the middle-ear transfer admittance HMY (the ratio of stapes velocity to ear-canal sound pressure near the umbo) in gerbils during closed-field sound stimulation at frequencies from 0.1 to 60 kHz, a range that spans the gerbil’s audiometric range. Similar measurements were performed in two laboratories. The HMY magnitude (a) increased with frequency below 1 kHz, (b) remained approximately constant with frequency from 5 to 35 kHz, and (c) decreased substantially from 35 to 50 kHz. The HMY phase increased linearly with frequency from 5 to 35 kHz, consistent with a 20–29 μs delay, and flattened at higher frequencies. Measurements from different directions showed that stapes motion is predominantly pistonlike except in a narrow frequency band around 10 kHz. Cochlear input impedance was estimated from HMY and previously-measured cochlear sound pressure. Results do not support the idea that the middle ear is a lossless matched transmission line. Results support the ideas that (1) middle-ear transmission is consistent with a mechanical transmission line or multiresonant network between 5 and 35 kHz and decreases at higher frequencies, (2) stapes motion is pistonlike over most of the gerbil auditory range, and (3) middle-ear transmission properties are a determinant of the audiogram. PMID:18646983
NASA Astrophysics Data System (ADS)
Orlianges, Jean-Christophe; Crunteanu, Aurelian; Pothier, Arnaud; Merle-Mejean, Therese; Blondy, Pierre; Champeaux, Corinne
2012-12-01
Titanium dioxide presents a wide range of technological application possibilities due to its dielectric, electrochemical, photocatalytic and optical properties. The three TiO2 allotropic forms: anatase, rutile and brookite are also interesting, since they exhibit different properties, stabilities and growth modes. For instance, rutile has a high dielectric permittivity, of particular interest for the integration as dielectric in components such as microelectromechanical systems (MEMS) for radio frequency (RF) devices. In this study, titanium dioxide thin films are deposited by pulsed laser deposition. Characterizations by Raman spectroscopy and X-ray diffraction show the evolution of the structural properties. Thin films optical properties are investigated using spectroscopic ellipsometry and transmission measurements from UV to IR range. Co-planar waveguide (CPW) devices are fabricated based on these films. Their performances are measured in the RF domain and compared to simulation, leading to relative permittivity values in the range 30-120, showing the potentialities of the deposited material for capacitive switches applications.
Transmission of vibration through glove materials: effects of contact force.
Md Rezali, Khairil Anas; Griffin, Michael J
2018-04-26
This study investigated effects of applied force on the apparent mass of the hand, the dynamic stiffness of glove materials and the transmission of vibration through gloves to the hand. For 10 subjects, 3 glove materials and 3 contact forces, apparent masses and glove transmissibilities were measured at the palm and at a finger at frequencies in the range 5-300 Hz. The dynamic stiffnesses of the materials were also measured. With increasing force, the dynamic stiffnesses of the materials increased, the apparent mass at the palm increased at frequencies greater than the resonance and the apparent mass at the finger increased at low frequencies. The effects of force on transmissibilities therefore differed between materials and depended on vibration frequency, but changes in apparent mass and dynamic stiffness had predictable effects on material transmissibility. Depending on the glove material, the transmission of vibration through a glove can be increased or decreased when increasing the applied force. Practitioner summary: Increasing the contact force (i.e. push force or grip force) can increase or decrease the transmission of vibration through a glove. The vibration transmissibilities of gloves should be assessed with a range of contact forces to understand their likely influence on the exposure of the hand and fingers to vibration.
Lardeux, Frédéric; Aliaga, Claudia; Tejerina, Rosenka; Torrez, Libia
2013-08-13
Anopheles (Anopheles) pseudopunctipennis is a recognized malaria vector in the slopes of the Andes of Bolivia. There, other species might be involved in malaria transmission and one candidate could be Anopheles argyritarsis. Although it is generally admitted that this species is not a malaria vector in the neotropical region, its potential role in transmission is still controversial and this situation has to be cleared, at least for Bolivia. Comparing the vectorial efficiency of An. pseudopunctipennis with that of An. argyritarsis could solve the question. The two species were sampled throughout Bolivia to estimate their degree of co-existence in their distribution range. Vectorial efficiencies of the two species were compared in two ecologically different localities where the species were sympatric by analysing their vectorial capacities and components (i e, human biting rates, human biting index, survival, durations of the gonotrophic cycle and extrinsic cycle), and the entomological inoculation rates (EIR). Mosquitoes were sampled monthly during more than one year in the two localities. A monthly sample consisted in hourly captures in four houses (inside and outside) in each locality, during four consecutive nights. Climatic variables (temperature, humidity, potential evapo-transpiration and precipitations) were recorded to better understand variability in the entomological parameters. Relationships were analysed using multivariate methods. Anopheles pseudopunctipennis and An. argyritarsis are "altitude" species, sharing the same geographical distribution range in the Andes of Bolivia. No Plasmodium parasite was identified in An. argyritarsis and estimates of the vectorial capacity indicated that it is not a malaria vector in the two studied localities, unlike An. pseudopunctipennis which showed positive EIRs. This latter species, although not a very good malaria vector, exhibited better life traits values and better behavioural characteristics in favour of transmission as compared to An. argyritarsis. In the Andes of Bolivia, above 1000 m of altitude, An. pseudopunctipennis is likely to be the only malaria vector. There, it is present almost everywhere and priority control effort should be directed toward this species. Below 1000 m of altitude, vector incrimination should also be focused on other sympatric species (likely not An. argyritarsis) that might be locally important. From the present study, candidates would be among Anopheles rangeli, Anopheles triannulatus s.l., Anopheles trinkae, Anopheles nuneztovari s.l., Anopheles oswaldoi s.l. and Anopheles benarrochi s.l.
2013-01-01
Background Anopheles (Anopheles) pseudopunctipennis is a recognized malaria vector in the slopes of the Andes of Bolivia. There, other species might be involved in malaria transmission and one candidate could be Anopheles argyritarsis. Although it is generally admitted that this species is not a malaria vector in the neotropical region, its potential role in transmission is still controversial and this situation has to be cleared, at least for Bolivia. Comparing the vectorial efficiency of An. pseudopunctipennis with that of An. argyritarsis could solve the question. Methods The two species were sampled throughout Bolivia to estimate their degree of co-existence in their distribution range. Vectorial efficiencies of the two species were compared in two ecologically different localities where the species were sympatric by analysing their vectorial capacities and components (i e, human biting rates, human biting index, survival, durations of the gonotrophic cycle and extrinsic cycle), and the entomological inoculation rates (EIR). Mosquitoes were sampled monthly during more than one year in the two localities. A monthly sample consisted in hourly captures in four houses (inside and outside) in each locality, during four consecutive nights. Climatic variables (temperature, humidity, potential evapo-transpiration and precipitations) were recorded to better understand variability in the entomological parameters. Relationships were analysed using multivariate methods. Results Anopheles pseudopunctipennis and An. argyritarsis are “altitude” species, sharing the same geographical distribution range in the Andes of Bolivia. No Plasmodium parasite was identified in An. argyritarsis and estimates of the vectorial capacity indicated that it is not a malaria vector in the two studied localities, unlike An. pseudopunctipennis which showed positive EIRs. This latter species, although not a very good malaria vector, exhibited better life traits values and better behavioural characteristics in favour of transmission as compared to An. argyritarsis. Conclusions In the Andes of Bolivia, above 1000 m of altitude, An. pseudopunctipennis is likely to be the only malaria vector. There, it is present almost everywhere and priority control effort should be directed toward this species. Below 1000 m of altitude, vector incrimination should also be focused on other sympatric species (likely not An. argyritarsis) that might be locally important. From the present study, candidates would be among Anopheles rangeli, Anopheles triannulatus s.l., Anopheles trinkae, Anopheles nuneztovari s.l., Anopheles oswaldoi s.l. and Anopheles benarrochi s.l. PMID:23941216
Song, Tao; Zhang, Feng-ping; Liu, Yao-min; Wu, Zong-wen; Suo, You-rui
2012-08-01
In the present research, a novel method was established for determination of five fatty acids in soybean oil by transmission reflection-near infrared spectroscopy. The optimum conditions of mathematics model of five components (C16:0, C18:0, C18:1, C18:2 and C18:3) were studied, including the sample set selection, chemical value analysis, the detection methods and condition. Chemical value was analyzed by gas chromatography. One hundred fifty eight samples were selected, 138 for modeling set, 10 for testing set and 10 for unknown sample set. All samples were placed in sample pools and scanned by transmission reflection-near infrared spectrum after sonicleaning for 10 minute. The 1100-2500 nm spectral region was analyzed. The acquisition interval was 2 nm. Modified partial least square method was chosen for calibration mode creating. Result demonstrated that the 1-VR of five fatty acids between the reference value of the modeling sample set and the near infrared spectrum predictive value were 0.8839, 0.5830, 0.9001, 0.9776 and 0.9596, respectively. And the SECV of five fatty acids between the reference value of the modeling sample set and the near infrared spectrum predictive value were 0.42, 0.29, 0.83, 0.46 and 0.21, respectively. The standard error of the calibration (SECV) of five fatty acids between the reference value of testing sample set and the near infrared spectrum predictive value were 0.891, 0.790, 0.900, 0.976 and 0.942, respectively. It was proved that the near infrared spectrum predictive value was linear with chemical value and the mathematical model established for fatty acids of soybean oil was feasible. For validation, 10 unknown samples were selected for analysis by near infrared spectrum. The result demonstrated that the relative standard deviation between predict value and chemical value was less than 5.50%. That was to say that transmission reflection-near infrared spectroscopy had a good veracity in analysis of fatty acids of soybean oil.
Universal optical transmission features in periodic and quasiperiodic hole arrays.
Pacifici, Domenico; Lezec, Henri J; Sweatlock, Luke A; Walters, Robert J; Atwater, Harry A
2008-06-09
We investigate the influence of array order in the optical transmission properties of subwavelength hole arrays, by comparing the experimental spectral transmittance of periodic and quasiperiodic hole arrays as a function of frequency. We find that periodicity and long-range order are not necessary requirements for obtaining enhanced and suppressed optical transmission, provided short-range order is maintained. Transmission maxima and minima are shown to result, respectively, from constructive and destructive interference at each hole, between the light incident upon and exiting from a given hole, and surface plasmon polaritons (SPPs) arriving from individual neighboring holes. These SPPs are launched along both illuminated and exit surfaces, by diffraction of the incident and emerging light at the neighboring individual subwavelength holes. By characterizing the optical transmission of a pair of subwavelength holes as a function of hole-hole distance, we demonstrate that a subwavelength hole can launch SPPs with an efficiency up to 35%, and with an experimentally determined launch phase phi = pi /2, for both input-side and exit-side SPPs. This characteristic phase has a crucial influence on the shape of the transmission spectra, determining transmission minima in periodic arrays at those frequencies where grating coupling arguments would instead predict maxima.
A method of transmissibility design for dual-chamber pneumatic vibration isolator
NASA Astrophysics Data System (ADS)
Lee, Jeung-Hoon; Kim, Kwang-Joon
2009-06-01
Dual-chamber pneumatic vibration isolators have a wide range of applications for vibration isolation of vibration-sensitive equipment. Recent advances in precision machine tools and instruments such as medical devices and those related to nano-technology require better isolation performance, which can be efficiently achieved by precise modeling- and design- of the isolation system. This paper discusses an efficient transmissibility design method of a pneumatic vibration isolator wherein a complex stiffness model of a dual-chamber pneumatic spring developed in our previous study is employed. Three design parameters, the volume ratio between the two pneumatic chambers, the geometry of the capillary tube connecting the two pneumatic chambers, and, finally, the stiffness of the diaphragm employed for prevention of air leakage, were found to be important factors in transmissibility design. Based on a design technique that maximizes damping of the dual-chamber pneumatic spring, trade-offs among the resonance frequency of transmissibility, peak transmissibility, and transmissibility in high frequency range were found, which were not ever stated in previous researches. Furthermore, this paper discusses the negative role of the diaphragm in transmissibility design. The design method proposed in this paper is illustrated through experimental measurements.
Short-sighted evolution of virulence in parasitic honeybee workers ( Apis mellifera capensis Esch.)
NASA Astrophysics Data System (ADS)
Moritz, Robin F. A.; Pirk, Christian W. W.; Hepburn, H. Randall; Neumann, Peter
2008-06-01
The short-sighted selection hypothesis for parasite virulence predicts that winners of within-host competition are poorer at transmission to new hosts. Social parasitism by self-replicating, female-producing workers occurs in the Cape honeybee Apis mellifera capensis, and colonies of other honeybee subspecies are susceptible hosts. We found high within-host virulence but low transmission rates in a clone of social parasitic A. m. capensis workers invading the neighbouring subspecies A. m. scutellata. In contrast, parasitic workers from the endemic range of A. m. capensis showed low within-host virulence but high transmission rates. This suggests a short-sighted selection scenario for the host-parasite co-evolution in the invasive range of the Cape honeybee, probably facilitated by beekeeping-assisted parasite transmission in apiaries.
Biadgo, Belete; Shiferaw, Elias; Woldu, Berhanu; Alene, Kefyalew Addis; Melku, Mulugeta
2017-01-01
Transfusion-transmissible viral infections, such as hepatitis C virus (HCV), hepatitis B virus (HBV), and human immunodeficiency virus (HIV), remain a major public health problem in developing countries. The prevalence of these viral infections among blood donors may reflect the burden of these diseases among populations. Therefore, the aim of this study was to assess the sero-prevalence of transfusion-transmissible viral infections among blood donors. A retrospective study was conducted using data obtained from registration books of blood donors from the Ethiopian North Gondar District Blood Bank from 2010 to 2012. Descriptive statistics, such as percentages, medians and interquartile ranges were computed. A binary logistic regression model was fitted to identify factors associated with each viral infection. The odds ratio with a 99% confidence interval was calculated. A p-value < 0.01 was considered statistically significant. A total of 6,471 blood donors were included in the study. Of these, 5,311 (82.1%) were male, and 382 (5.9%) were voluntary blood donors. Overall, 424 (6.55%) of the blood donors were sero-reactive for at least one transfusion-transmissible viral infection. Of all study participants, 233 (3.6%) were sero-reactive for HBV, 145 (2.24%) were sero-reactive for HIV, and 51 (0.8%) were sero-reactive for HCV. Four (0.062%) of the study's participants were co-infected: 3 (75%) with HBV-HCV and 1 (25%) with HIV-HBV-HCV. Being a farmer, unemployed or employed donor was significantly associated with transfusion-transmissible viral infections compared to being a student donor. The prevalence of transfusion-transmissible viral infections is substantial and has increased overtime. Hence, it demands more vigilance in routine screening of donated blood prior to transfusion. Further community-based studies to identify societal risk factors are necessary.
Short-term electric power demand forecasting based on economic-electricity transmission model
NASA Astrophysics Data System (ADS)
Li, Wenfeng; Bai, Hongkun; Liu, Wei; Liu, Yongmin; Wang, Yubin Mao; Wang, Jiangbo; He, Dandan
2018-04-01
Short-term electricity demand forecasting is the basic work to ensure safe operation of the power system. In this paper, a practical economic electricity transmission model (EETM) is built. With the intelligent adaptive modeling capabilities of Prognoz Platform 7.2, the econometric model consists of three industrial added value and income levels is firstly built, the electricity demand transmission model is also built. By multiple regression, moving averages and seasonal decomposition, the problem of multiple correlations between variables is effectively overcome in EETM. The validity of EETM is proved by comparison with the actual value of Henan Province. Finally, EETM model is used to forecast the electricity consumption of the 1-4 quarter of 2018.
Neutron Transmission of Single-crystal Sapphire Filters
NASA Astrophysics Data System (ADS)
Adib, M.; Kilany, M.; Habib, N.; Fathallah, M.
2005-05-01
An additive formula is given that permits the calculation of the nuclear capture, thermal diffuse and Bragg scattering cross-sections as a function of sapphire temperature and crystal parameters. We have developed a computer program that allows calculations of the thermal neutron transmission for the sapphire rhombohedral structure and its equivalent trigonal structure. The calculated total cross-section values and effective attenuation coefficient for single-crystalline sapphire at different temperatures are compared with measured values. Overall agreement is indicated between the formula and experimental data. We discuss the use of sapphire single crystal as a thermal neutron filter in terms of the optimum cystal thickness, mosaic spread, temperature, cutting plane and tuning for efficient transmission of thermal-reactor neutrons.
Non-flickering 100 m RGB visible light communication transmission based on a CMOS image sensor.
Chow, Chi-Wai; Shiu, Ruei-Jie; Liu, Yen-Chun; Liu, Yang; Yeh, Chien-Hung
2018-03-19
We demonstrate a non-flickering 100 m long-distance RGB visible light communication (VLC) transmission based on a complementary-metal-oxide-semiconductor (CMOS) camera. Experimental bit-error rate (BER) measurements under different camera ISO values and different transmission distances are evaluated. Here, we also experimentally reveal that the rolling shutter effect- (RSE) based VLC system cannot work at long distance transmission, and the under-sampled modulation- (USM) based VLC system is a good choice.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Syh, J; Patel, B; Syh, J
2015-06-15
Purpose: Several vendors of diagnostic lead apron used routinely in radiology/fluoroscopy claim to manufacture 0.5 mm lead equivalent shielding. The purpose of this investigation was to address the concern of the weight of lead aprons versus the radiation protection they provide. Methods: Seven diagnostic lead aprons were measured and compared for their radiation transmission and attenuation characteristics. The measurements were performed on a Philips Integris. Two settings were used, normal (76 kVp, 14.3 mA) and high (110 kVp, 12.3 mA) to represent typical patient and large patient thickness. Plastic water was placed on the table to represent patient scatter. Amore » Capintec PM-500 ion chamber was placed at approximate chest height where hospital personnel would stand. An uncovered, i.e. lead-unhindered, ion chamber reading was taken to establish the baseline reading of an unprotected personnel. The ion chamber was then wrapped with 0.5mm 99.9% pure Pb material to establish the measurement reading when a diagnostic lead apron attenuates as adequately as 0.5mm Pb. The lead aprons were measured one at a time with the ion chamber fully covered and enclosed within the aprons. Results: On Normal fluoroscopy setting, the 0.5mm pure Pb showed a transmission of 0.4%. No aprons showed a transmission value as low as 0.5mm Pb. The lowest transmission value measured from the aprons was 2.0%, having a 1.5% higher transmission than pure lead. On High fluoroscopy setting, the lowest apron transmission measurement was at 2.8%, which was comparable to the 0.5mm pure Pb which gave a transmission of 3.0%. Conclusion: At Normal fluoroscopy setting, the 0.5mm Pb provided an attenuation that could not be matched by any apron measured. At High fluoroscopy setting, only one apron exhibited comparable transmission values as 0.5mm pure Pb.« less
Preparation and characterization of conductive and transparent ruthenium dioxide sol-gel films.
Allhusen, John S; Conboy, John C
2013-11-27
RuO2 conductive thin films were synthesized using the sol-gel method and deposited onto transparent insulating substrates. The optical transmission, film thickness, surface morphology and composition, resistivity, and spectroelectrochemical performance have been characterized. The optical transmission values of these films ranged from 70 to 89% in the visible region and from 56 to 88% in the infrared region. Resistivity values of the RuO2 sol-gel films varied from 1.02 × 10(-3) to 1.13 Ω cm and are highly dependent on the initial solution concentration of RuO2 in the sol-gel. The RuO2 sol-gel films were used as electrodes for the electrochemical oxidation and reduction of ferrocenemethanol. The electrochemical behavior of our novel RuO2 sol-gel films was compared to that of a standard platinum disk electrode and showed no appreciable differences in the half-wave potential (E1/2). The mechanical and chemical stability of the coatings was tested by physical abrasion and exposure to highly acidic, oxidizing Piranha solution. Repeated exposure to these extreme conditions did not result in any appreciable decline in electrochemical performance. Finally, the use of the novel RuO2 sol-gel conductive and transparent films was demonstrated in a spectroelectrochemistry experiment in which the oxidation and reduction of ferrocenemethanol was monitored via UV-vis spectroscopy as the applied potential was cycled.
Park, H K; Bradley, J S
2009-07-01
This paper reports the results of an evaluation of the merits of standard airborne sound insulation measures with respect to subjective ratings of the annoyance and loudness of transmitted sounds. Subjects listened to speech and music sounds modified to represent transmission through 20 different walls with sound transmission class (STC) ratings from 34 to 58. A number of variations in the standard measures were also considered. These included variations in the 8-dB rule for the maximum allowed deficiency in the STC measure as well as variations in the standard 32-dB total allowed deficiency. Several spectrum adaptation terms were considered in combination with weighted sound reduction index (R(w)) values as well as modifications to the range of included frequencies in the standard rating contour. A STC measure without an 8-dB rule and an R(w) rating with a new spectrum adaptation term were better predictors of annoyance and loudness ratings of speech sounds. R(w) ratings with one of two modified C(tr) spectrum adaptation terms were better predictors of annoyance and loudness ratings of transmitted music sounds. Although some measures were much better predictors of responses to one type of sound than were the standard STC and R(w) values, no measure was remarkably improved for predicting annoyance and loudness ratings of both music and speech sounds.
Giner Martínez-Sierra, J; Santamaria-Fernandez, R; Hearn, R; Marchante Gayón, J M; García Alonso, J I
2010-04-14
In this work, a multi-collector inductively coupled plasma mass spectrometer (MC-ICP-MS) was evaluated for the direct measurement of sulfur stable isotope ratios in beers as a first step toward a general study of the natural isotope variability of sulfur in foods and beverages. Sample preparation consisted of a simple dilution of the beers with 1% (v/v) HNO(3). It was observed that different sulfur isotope ratios were obtained for different dilutions of the same sample indicating that matrix effects affected differently the transmission of the sulfur ions at masses 32, 33, and 34 in the mass spectrometer. Correction for mass bias related matrix effects was evaluated using silicon internal standardization. For that purpose, silicon isotopes at masses 29 and 30 were included in the sulfur cup configuration and the natural silicon content in beers used for internal mass bias correction. It was observed that matrix effects on differential ion transmission could be corrected adequately using silicon internal standardization. The natural isotope variability of sulfur has been evaluated by measuring 26 different beer brands. Measured delta(34)S values ranged from -0.2 to 13.8 per thousand. Typical combined standard uncertainties of the measured delta(34)S values were < or = 2 per thousand. The method has therefore great potential to study sulfur isotope variability in foods and beverages.
NASA Astrophysics Data System (ADS)
Wegmann, K.; Adam, L.-E.; Livieratos, L.; Zaers, J.; Bailey, D. L.; Brix, G.
1999-08-01
The fraction of detected scattered radiation in transmission measurements with a single photon transmission (SPT) source of Cesium-137 was investigated by means of Monte Carlo (MC) techniques. The scatter contamination was determined for different energy thresholds and the use of interplane septa. The simulations were validated with measurements performed at the whole-body 3D PET scanner ECAT EXACT 3D (CTI/Siemens, Knoxville, TN), which uses a SPT source. The comparison of the results from the simulations and the measurements shows good agreement. Transmission through a water-filled cylinder (o=20 cm) gave values of the scatter fraction SF of about 27% at a lower level discriminator (LLD) value of 500 keV in the center of the projection. A reduction to 17% was achieved by an increase of the LLD to 600 keV; a relative decrease of 37%. But a corresponding loss of counts by a factor of 1.5 was observed. Furthermore, simulations of the ECAT EXACT HR/sup +/ have been performed, a whale-body PET scanner which can be operated in 2D and 3D mode, but has no SPT mode yet. At a value of the LLD of 500 keV, the simulations showed a decrease of the SF in the 2D mode of 45% relative to the 3D mode for the transmission of the water-filled cylinder.
Riley, Pete; Ben-Nun, Michal; Armenta, Richard; Linker, Jon A; Eick, Angela A; Sanchez, Jose L; George, Dylan; Bacon, David P; Riley, Steven
2013-01-01
Rapidly characterizing the amplitude and variability in transmissibility of novel human influenza strains as they emerge is a key public health priority. However, comparison of early estimates of the basic reproduction number during the 2009 pandemic were challenging because of inconsistent data sources and methods. Here, we define and analyze influenza-like-illness (ILI) case data from 2009-2010 for the 50 largest spatially distinct US military installations (military population defined by zip code, MPZ). We used publicly available data from non-military sources to show that patterns of ILI incidence in many of these MPZs closely followed the pattern of their enclosing civilian population. After characterizing the broad patterns of incidence (e.g. single-peak, double-peak), we defined a parsimonious SIR-like model with two possible values for intrinsic transmissibility across three epochs. We fitted the parameters of this model to data from all 50 MPZs, finding them to be reasonably well clustered with a median (mean) value of 1.39 (1.57) and standard deviation of 0.41. An increasing temporal trend in transmissibility ([Formula: see text], p-value: 0.013) during the period of our study was robust to the removal of high transmissibility outliers and to the removal of the smaller 20 MPZs. Our results demonstrate the utility of rapidly available - and consistent - data from multiple populations.
Riley, Pete; Ben-Nun, Michal; Armenta, Richard; Linker, Jon A.; Eick, Angela A.; Sanchez, Jose L.; George, Dylan; Bacon, David P.; Riley, Steven
2013-01-01
Rapidly characterizing the amplitude and variability in transmissibility of novel human influenza strains as they emerge is a key public health priority. However, comparison of early estimates of the basic reproduction number during the 2009 pandemic were challenging because of inconsistent data sources and methods. Here, we define and analyze influenza-like-illness (ILI) case data from 2009–2010 for the 50 largest spatially distinct US military installations (military population defined by zip code, MPZ). We used publicly available data from non-military sources to show that patterns of ILI incidence in many of these MPZs closely followed the pattern of their enclosing civilian population. After characterizing the broad patterns of incidence (e.g. single-peak, double-peak), we defined a parsimonious SIR-like model with two possible values for intrinsic transmissibility across three epochs. We fitted the parameters of this model to data from all 50 MPZs, finding them to be reasonably well clustered with a median (mean) value of 1.39 (1.57) and standard deviation of 0.41. An increasing temporal trend in transmissibility (, p-value: 0.013) during the period of our study was robust to the removal of high transmissibility outliers and to the removal of the smaller 20 MPZs. Our results demonstrate the utility of rapidly available – and consistent – data from multiple populations. PMID:23696723
Praveena, K; Srinath, S
2014-06-01
The Cobalt ferrite (CoFe2O4) powders were synthesized by Co-precipitation method. The as prepared ferrite powders were incorporated into a polyaniline matrix at various volumetric ratios. The as prepared composites of ferrite and polyaniline powders were characterized using X-ray diffraction (XRD), transmission electron microscope (TEM). The particle size of CoFe2O4 is found to be 20 nm. The saturation magnetization (M(s)) of all the composites was found to be decreasing with decrease of ferrite content, while coercivity (H(c)) remained at the value corresponding to pure cobalt ferrite nanopowders. The complex permittivity (epsilon' and epsilon") and permeability (mu' and mu") of composite samples were measured in the range of 1 MHz to 1.1 GHz. The value of epsilon' and mu' found to be increased with ferrite volume concentration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krishnan, Venkat; Cole, Wesley
Power sector capacity expansion models (CEMs) have a broad range of spatial resolutions. This paper uses the Regional Energy Deployment System (ReEDS) model, a long-term national scale electric sector CEM, to evaluate the value of high spatial resolution for CEMs. ReEDS models the United States with 134 load balancing areas (BAs) and captures the variability in existing generation parameters, future technology costs, performance, and resource availability using very high spatial resolution data, especially for wind and solar modeled at 356 resource regions. In this paper we perform planning studies at three different spatial resolutions--native resolution (134 BAs), state-level, and NERCmore » region level--and evaluate how results change under different levels of spatial aggregation in terms of renewable capacity deployment and location, associated transmission builds, and system costs. The results are used to ascertain the value of high geographically resolved models in terms of their impact on relative competitiveness among renewable energy resources.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deibler, Lisa Anne; Brown, Arthur; Puskar, Joseph D.
Drawn 304L stainless steel tubing was subjected to 42 different annealing heat treatments with the goal of initializing a microstructural model to select a heat treatment to soften the tubing from a hardness of 305 Knoop to 225–275 Knoop. The amount of recrystallization and grain size caused by 18 heat treatments were analyzed via optical microscopy and image analysis, revealing the full range of recrystallization from 0 to 100%. The formation of carbides during the longer duration and higher-temperature heat treatments was monitored via transmission electron microscope evaluation. The experimental results informed a model which includes recovery, recrystallization, and grainmore » growth to predict microstructure and hardness. After initialization of the model, it was able to predict hardness with a R 2 value of 0.95 and recrystallization with an R 2 value of 0.99. As a result, the model was then utilized in the design and testing of a heat treatment to soften the tubing.« less
NASA Astrophysics Data System (ADS)
Jaya, T. P.; Pradyumnan, P. P.
2017-12-01
Transparent crystalline n-indium tin oxide/p-copper indium oxide diode structures were fabricated on quartz substrates by plasma vapor deposition using radio frequency (RF) magnetron sputtering. The p-n heterojunction diodes were highly transparent in the visible region and exhibited rectifying current-voltage (I-V) characteristics with a good ideality factor. The sputter power during fabrication of the p-layer was found to have a profound effect on I-V characteristics, and the diode with the p-type layer deposited at a maximum power of 200 W exhibited the highest value of the diode ideality factor (η value) of 2.162, which suggests its potential use in optoelectronic applications. The ratio of forward current to reverse current exceeded 80 within the range of applied voltages of -1.5 to +1.5 V in all cases. The diode structure possessed an optical transmission of 60-70% in the visible region.
Akman, F; Durak, R; Turhan, M F; Kaçal, M R
2015-07-01
The effective atomic numbers and electron densities of some samarium compounds were determined using the experimental total mass attenuation coefficient values near the K edge in the X-ray energy range from 36.847 up to 57.142 keV. The measurements, in the region from 36.847 to 57.142 keV, were done in a transmission geometry utilizing the Kα2, Kα1, Kβ1 and Kβ2 X-rays from different secondary source targets excited by the 59.54 keV gamma-photons from an Am-241 annular source. This paper presents the first measurement of the effective atomic numbers and electron densities for some samarium compounds near the K edge. The results of the study showed that the measured values were in good agreement with the theoretically calculated ones. Copyright © 2015 Elsevier Ltd. All rights reserved.
Thermoelectric properties of conducting polyaniline/BaTiO3 nanoparticle composite films
NASA Astrophysics Data System (ADS)
Anno, H.; Yamaguchi, K.; Nakabayashi, T.; Kurokawa, H.; Akagi, F.; Hojo, M.; Toshima, N.
2011-05-01
Conducting polyaniline (PANI)/BaTiO3 nanoparticle composite films with different molar ratio values R=1, 5, 10, and 100 have been prepared on a quartz substrate by casting the m-cresol solution of PANI, (±)-10-camphorsulfonic acid (CSA) and BaTiO3 nanoparticle with an average diameter of about 20 nm. The CSA-doped PANI/BaTiO3 composite films were characterized by x-ray diffraction, Fourier transform infrared spectroscopy, and UV-Vis transmission spectroscopy. The Seebeck coefficient and the electrical conductivity of the films with different R values, together with CSA-doped PANI films, were measured in the temperature range from room temperature to ~400 K. The relation between the Seebeck coefficient and the electrical conductivity in the composite films are discussed from a comparison of them with those of CSA-doped PANI films and other PANI composite films.
CAD of 0.1- to 10-GHz GaAs MMIC SPST switch
NASA Astrophysics Data System (ADS)
Yadav, Ramchandra; Kirty, V. S. R.
1998-04-01
The design of the SPST switch provides an insertion loss less than 2 dB, isolation more than 40 dB and return loss better than 17.5 dB in the frequency range of 0.1 GHz to 10 GHz. The insertion loss is improved by treating SPST switch as a 50 (Omega) artificial transmission line with incorporation of inductor in series arm and the capacitance of MESFET in the shunt arm. High isolation is ensured by the lower value of `ON' resistance of MESFET in shunt arm. Also good return loss is achieved by paralleling a 50 (Omega) resistor with capacitance of MESFET in series arm. The absence of DC blocking capacitors and replacement of large value bias chokes with 5 K(Omega) resistors effectively improved the performance of SPST switch at low frequency and also reduced the chip size. The overall chip dimension is 2.2 mm X 1.7 mm.
Hydrogeology of shallow basin-fill deposits in areas of Salt Lake Valley, Salt Lake County, Utah
Thiros, Susan A.
2003-01-01
A study of recently developed residential/commercial areas of Salt Lake Valley, Utah, was done from 1999 to 2001 in areas in which shallow ground water has the potential to move to a deeper aquifer that is used for public supply. Thirty monitoring wells were drilled and sampled in 1999 as part of the study. The ground water was either under unconfined or confined conditions, depending on depth to water and the presence or absence of fine-grained deposits. The wells were completed in the shallowest water-bearing zone capable of supplying water. Monitoring-well depths range from 23 to 154 feet. Lithologic, geophysical, hydraulic-conductivity, transmissivity, water-level, and water-temperature data were obtained for or collected from the wells.Silt and clay layers noted on lithologic logs correlate with increases in electrical conductivity and natural gamma radiation shown on many of the electromagnetic-induction and natural gamma logs. Relatively large increases in electrical conductivity, determined from the electromagnetic-induction logs, with no major changes in natural gamma radiation are likely caused by increased dissolved-solids content in the ground water. Some intervals with high electrical conductivity correspond to areas in which water was present during drilling.Unconfined conditions were present at 7 of 20 monitoring wells on the west side and at 2 of 10 wells on the east side of Salt Lake Valley. Fine-grained deposits confine the ground water. Anthropogenic compounds were detected in water sampled from most of the wells, indicating a connection with the land surface. Data were collected from 20 of the monitoring wells to estimate the hydraulic conductivity and transmissivity of the shallow ground-water system. Hydraulic-conductivity values of the shallow aquifer ranged from 30 to 540 feet per day. Transmissivity values of the shallow aquifer ranged from 3 to 1,070 feet squared per day. There is a close linear relation between transmissivity determined from slug-test analysis and transmissivity estimated from specific capacity.Water-level fluctuations were measured in the 30 monitoring wells from 1999 to July 2001. Generally, water-level changes measured in wells on the west side of the valley followed a seasonal trend and wells on the east side showed less fluctuation or a gradual decline during the 2-year period. This may indicate that a larger percentage of recharge to the shallow ground-water system on the west side is from somewhat consistent seasonal sources, such as canals and unconsumed irrigation water, as compared to sources on the east side. Water levels measured in monitoring wells completed in the shallow ground-water system near large-capacity public-supply wells varied in response to ground-water withdrawals from the deeper confined aquifer. Water temperature was monitored in 23 wells. Generally, little or no change in water temperature was measured in monitoring wells with a depth to water greater than about 40 feet. The shallower the water level in the well, the greater the water-temperature change measured during the study.Comparison of water levels measured in the monitoring wells and deeper wells in the same area indicate a downward gradient on the east side of the valley. Water levels in the shallow and deeper aquifers in the secondary recharge area on the west side of the valley were similar to those on the east side. Water levels measured in the monitoring wells and nearby wells completed in the deeper aquifer indicate that the vertical gradient can change with time and stresses on the system.
Zhang, Lin; Yin, Na; Fu, Xiong; Lin, Qiaomin; Wang, Ruchuan
2017-01-01
With the development of wireless sensor networks, certain network problems have become more prominent, such as limited node resources, low data transmission security, and short network life cycles. To solve these problems effectively, it is important to design an efficient and trusted secure routing algorithm for wireless sensor networks. Traditional ant-colony optimization algorithms exhibit only local convergence, without considering the residual energy of the nodes and many other problems. This paper introduces a multi-attribute pheromone ant secure routing algorithm based on reputation value (MPASR). This algorithm can reduce the energy consumption of a network and improve the reliability of the nodes’ reputations by filtering nodes with higher coincidence rates and improving the method used to update the nodes’ communication behaviors. At the same time, the node reputation value, the residual node energy and the transmission delay are combined to formulate a synthetic pheromone that is used in the formula for calculating the random proportion rule in traditional ant-colony optimization to select the optimal data transmission path. Simulation results show that the improved algorithm can increase both the security of data transmission and the quality of routing service. PMID:28282894
Kang, Jong-Gu; Jeong, Yeri; Shin, Jeong Hee; Choi, Ji-Woong; Sohn, Jung Inn; Cha, Seung Nam; Jang, Jae Eun
2014-11-01
For biomedical implanted devices, a wireless power or a signal transmission is essential to protect an infection and to enhance durability. In this study, we present a magnetic induction technique for a power transmission without any wire connection between transmitter (Tx) and receiver (Rx) in a micro scale. Due to a micro size effect of a flat spiral coil, a magnetic inductance is not high. To enhance the magnetic inductance, a three dimensional magnetic core is added to an antenna structure, which is consisted of ZnO nano wires coated by a nickel (Ni) layer. ZnO nano wires easily supply a large effective surface area with a vertical structural effect to the magnetic core structure, which induces a higher magnetic inductance with a ferro-magnetic material Ni. The magnetic induction antenna with the magnetic core shows a high inductance value, a low reflection power and a strong power transmission. The power transmission efficiencies are tested under the air and the water medium are almost the same values, so that the magnetic induction technique is quite proper to body implanted systems.
NASA Astrophysics Data System (ADS)
Wang, W. B.; Gozali, Richard; Nguyen, Thien An; Alfano, R. R.
2015-03-01
Light scattering and transmission of optical Laguerre Gaussian (LG) vortex beams with different orbital angular momentum (OAM) states in turbid scattering media were investigated in comparison with Gaussian (G) beam. The scattering media used in the experiments consist of various sizes and concentrations of latex beads in water solutions. The LG beams were generated using a spatial light modulator in reflection mode. The ballistic transmissions of LG and G beams were measured with different ratios of thickness of samples (z) to scattering mean free path (ls) of the turbid media, z/ls. The results show that in the ballistic region where z/ls is small, the LG and G beams show no significant difference, while in the diffusive region where z/ls is large, LG beams show higher transmission than Gaussian beam. In the diffusive region, the LG beams with higher orbital angular momentum L values show higher transmission than the beams with lower L values. The transition points from ballistic to diffusive regions for different scattering media were studied and determined.
NASA Astrophysics Data System (ADS)
Marín, M. J.; Serrano, D.; Utrillas, M. P.; Núñez, M.; Martínez-Lozano, J. A.
2017-10-01
Partly cloudy skies with liquid water clouds have been analysed, founding that it is essential to distinguish data if the Sun is obstructed or not by clouds. Both cases can be separated considering simultaneously the Cloud Modification Factor (CMF) and the clearness index (kt). For partly cloudy skies and the Sun obstructed the effective cloud optical depth (τ) has been obtained by the minimization method for overcast skies. This method was previously developed by the authors but, in this case, taking into account partial cloud cover. This study has been conducted for the years 2011-2015 with the multiple scattering model SBDART and irradiance measurements for the UV Erythemal Radiation (UVER) and the broadband ranges. Afterwards a statistical analysis of τ has shown that the maximum value is much lower than for overcast skies and there is more discrepancy between the two spectral ranges regarding the results for overcast skies. In order to validate these results the effective cloud optical depth has been correlated with several transmission factors, giving similar fit parameters to those obtained for overcast skies except for the clearness index in the UVER range. As our method is not applicable for partly cloudy skies with the visible Sun, the enhancement of radiation caused by clouds when the Sun is visible has been studied. Results show that the average enhancement CMF values are the same for both ranges although enhancement is more frequent for low cloud cover in the UVER and medium-high cloud cover in the broadband range and it does not depend on the solar zenith angle.
Effect of pH on structure, function, and stability of mitochondrial carbonic anhydrase VA.
Idrees, Danish; Shahbaaz, Mohd; Bisetty, Krishna; Islam, Asimul; Ahmad, Faizan; Hassan, Md Imtaiyaz
2017-02-01
Mitochondrial carbonic anhydrase VA (CAVA) catalyzes the hydration of carbon dioxide to produce proton and bicarbonate which is primarily expressed in the mitochondrial matrix of liver, and involved in numerous physiological processes including lipogenesis, insulin secretion from pancreatic cells, ureagenesis, gluconeogenesis, and neuronal transmission. To understand the effect of pH on the structure, function, and stability of CAVA, we employed spectroscopic techniques such as circular dichroism, fluorescence, and absorbance measurements in wide range of pH (from pH 2.0 to pH 11.5). CAVA showed an aggregation at acidic pH range from pH 2.0 to pH 5.0. However, it remains stable and maintains its secondary structure in the pH range, pH 7.0-pH 11.5. Furthermore, this enzyme has an appreciable activity at more than pH 7.0 (7.0 < pH ≤ 11.5) with maximum activity at pH 9.0. The maximal values of k cat and k cat /K m at pH 9.0 are 3.7 × 10 6 s -1 and 5.5 × 10 7 M -1 s -1 , respectively. However, this enzyme loses its activity in the acidic pH range. We further performed 20-ns molecular dynamics simulation of CAVA to see the dynamics at different pH values. An excellent agreement was observed between in silico and in vitro studies. This study provides an insight into the activity of CAVA in the pH range of subcellular environment.
Exposure to whole-body vibration and seat transmissibility in a large sample of earth scrapers.
Salmoni, Alan; Cann, Adam; Gillin, Kent
2010-01-01
It is often difficult to access a large sample of vehicles in various work environments to evaluate worker exposure to vibration such as in construction and mining. Thus the main purpose of the present research was to test vibration exposure in a relatively large number of earth scrapers. The second aim was to assess vibration exposure values on seat transmissibility. 33earth scrapers were assessed for both exposure to whole-body vibration and seat transmissibility. Two triaxial accelerometers, one placed on the seat and one on the floor directly below the seat, were used to gather whole-body vibration values (a(w)). Each machine was tested for a minimum of three complete work cycles: idling, scraping, travelling full, dumping, travelling empty back to the scrape site. Results showed that idling and scraping produced low levels of vibration when compared to travelling and dumping. Second, when the a(w) values were compared to the EU safety standards for an eight hour work day, the data (z axis) exceeded the exposure action value (0.5 m/s2) in all machines, and the exposure limit value (1.15 m/s2) in some. Implications; Operators of the scrapers were being exposed to unsafe levels of whole-body vibration. When the seats were assessed to see whether they were attenuating operator exposure to vibration, many of the seat effective amplitude transmissibility (SEAT) values exceeded 1.0. This meant that some of the seats were actually amplifying the vibration present at the floor, particularly in the y axis. Travelways should be kept smooth, operating speeds reduced, and new seats, effective in all three axes, designed.
Lubricant Effects on Efficiency of a Helicopter Transmission
NASA Technical Reports Server (NTRS)
Mitchell, A. M.; Coy, J. J.
1982-01-01
Eleven different lubricants were used in efficiency tests conducted on the OH-58A helicopter main transmission using the NASA Lewis Research Center's 500 hp torque regenerative helicopter transmission test stand. Tests were run at oil-in temperatures of 355 K and 372 K. The efficiency was calculated from a heat balance on the water running through an oil to water heat exchanger which the transmission was heavily insulated. Results show an efficiency range from 98.3% to 98.8% which is a 50% variation relative to the losses associated with the maximum efficiency measured. For a given lubricant, the efficiency increased as temperature increased and viscosity decreased. There were two exceptions which could not be explained. Between lubricants, efficiency was not correlated with viscosity. There were relatively large variations in efficiency with the different lubricants whose viscosity generally fell in the 5 to 7 centistoke range. The lubricants had no significant effect on the vibration signature of the transmission.
Hydrology and subsidence potential of proposed coal-lease tracts in Delta County, Colorado
Brooks, Tom
1983-01-01
Potential subsidence from underground coal mining and associated hydrologic impacts were investigated at two coal-lease tracts in Delta County, Colorado. Alteration of existing flow systems could affect water users in the surrounding area. The Mesaverde Formation transmits little ground water because of the neglibile transmissivity of the 1,300 feet of fine-grained sandstone, coal , and shale comprising the formation. The transmissivities of coal beds within the lower Mesaverde Formation ranged from 1.5 to 16.7 feet squared per day, and the transmissivity of the upper Mesaverde Formation, based on a single test, was 0.33 foot squared per day. Transmissivities of the alluvium ranged from 108 to 230 feet squared per day. The transmissivity of unconsolidated Quaternary deposits, determined from an aquifer test, was about 1,900 feet squared per day. Mining beneath Stevens Gulch and East Roatcap Creek could produce surface expressions of subsidence. Subsidence fractures could partly drain alluvial valley aquifers or streamflow in these mines. (USGS)
Experimental Transmission of Mayaro Virus by Aedes aegypti
Long, Kanya C.; Ziegler, Sarah A.; Thangamani, Saravanan; Hausser, Nicole L.; Kochel, Tadeusz J.; Higgs, Stephen; Tesh, Robert B.
2011-01-01
Outbreaks of Mayaro fever have been associated with a sylvatic cycle of Mayaro virus (MAYV) transmission in South America. To evaluate the potential for a common urban mosquito to transmit MAYV, laboratory vector competence studies were performed with Aedes aegypti from Iquitos, Peru. Oral infection in Ae. aegypti ranged from 0% (0/31) to 84% (31/37), with blood meal virus titers between 3.4 log10 and 7.3 log10 plaque-forming units (PFU)/mL. Transmission of MAYV by 70% (21/30) of infected mosquitoes was shown by saliva collection and exposure to suckling mice. Amount of viral RNA in febrile humans, determined by real-time polymerase chain reaction, ranged from 2.7 to 5.3 log10 PFU equivalents/mL. Oral susceptibility of Ae. aegypti to MAYV at titers encountered in viremic humans may limit opportunities to initiate an urban cycle; however, transmission of MAYV by Ae. aegypti shows the vector competence of this species and suggests potential for urban transmission. PMID:21976583
Large-scale entomologic assessment of Onchocerca volvulus transmission by poolscreen PCR in Mexico.
Rodríguez-Pérez, Mario A; Katholi, Charles R; Hassan, Hassan K; Unnasch, Thomas R
2006-06-01
To study the impact of mass Mectizan treatment on Onchocerca volvulus transmission in Mexico, entomological surveys were carried out in the endemic foci of Oaxaca, Southern Chiapas, and Northern Chiapas. Collected flies were screened by polymerase chain reaction (PCR) for O. volvulus parasites. The prevalence of infected and infective flies was estimated using the PoolScreen algorithm and with a novel probability-based method. O. volvulus infective larvae were not detected in flies from 6/13 communities. In 7/13 communities, infective flies were detected, with prevalences ranging from 1.6/10,000 to 29.0/10,000 and seasonal transmission potentials ranging from 0.4 to 3.3. Infected and infective flies were found in a community in Northern Chiapas, suggesting that, according to World Health Organization criteria, autochthonous transmission exists in this focus. These data suggest that O. volvulus transmission in Mexico has been suppressed or brought to a level that may be insufficient to sustain the parasite population.
NASA Astrophysics Data System (ADS)
Wang, Yiguang; Huang, Xingxing; Shi, Jianyang; Wang, Yuan-quan; Chi, Nan
2016-05-01
Visible light communication (VLC) has no doubt become a promising candidate for future wireless communications due to the increasing trends in the usage of light-emitting diodes (LEDs). In addition to indoor high-speed wireless access and positioning applications, VLC usage in outdoor scenarios, such as vehicle networks and intelligent transportation systems, are also attracting significant interest. However, the complex outdoor environment and ambient noise are the key challenges for long-range high-speed VLC outdoor applications. To improve system performance and transmission distance, we propose to use receiver diversity technology in an outdoor VLC system. Maximal ratio combining-based receiver diversity technology is utilized in two receivers to achieve the maximal signal-to-noise ratio. A 400-Mb/s VLC transmission using a phosphor-based white LED and a 1-Gb/s wavelength division multiplexing VLC transmission using a red-green-blue LED are both successfully achieved over a 100-m outdoor distance with the bit error rate below the 7% forward error correction limit of 3.8×10-3. To the best of our knowledge, this is the highest data rate at 100-m outdoor VLC transmission ever achieved. The experimental results clearly prove the benefit and feasibility of receiver diversity technology for long-range high-speed outdoor VLC systems.
Outage analysis of relay-assisted underwater wireless optical communication systems
NASA Astrophysics Data System (ADS)
Tabeshnezhad, Azadeh; Pourmina, Mohammad Ali
2017-12-01
In this paper, we theoretically evaluate the outage probabilities of underwater wireless optical communication (UWOC) systems. Our derivations are general as the channel model under consideration takes into account all of the channel degrading effects, namely absorption, scattering, and turbulence-induced fading. We numerically show that the UWOC systems, due to the severe channel impairments, cannot typically support longer link ranges than 100 m. Therefore, in this paper, in order to increase the transmission reliability and hence extend the viable communication range of UWOC systems, we apply decode-and-forward (DF) relay-assisted communications either in the form of multi-hop transmission, where multiple intermediate relays are serially employed between the source and destination, or parallel relaying in which multiple DF relays are distributed among the source-to-destination path to cooperate in the end-to-end transmission. Our numerical results reveal that multi-hop transmission, owing to the distance-dependency of all of the channel degrading effects, can tremendously improve the end-to-end outage probability and increase the accessible link ranges to hundreds of meter. For example, a dual-hop transmission in a 45 m coastal water link can provide up to 41 dB performance improvement at the outage probability of 10-9.
Antireflective surface structures in glass by self-assembly of SiO2 nanoparticles and wet etching.
Maier, Thomas; Bach, David; Müllner, Paul; Hainberger, Rainer; Brückl, Hubert
2013-08-26
We describe the fabrication of an antireflective surface structure with sub-wavelength dimensions on a glass surface using scalable low-cost techniques involving sol-gel coating, thermal annealing, and wet chemical etching. The glass surface structure consists of sand dune like protrusions with 250 nm periodicity and a maximum peak-to-valley height of 120 nm. The antireflective structure increases the transmission of the glass up to 0.9% at 700 nm, and the transmission remains enhanced over a wide spectral range and for a wide range of incident angles. Our measurements reveal a strong polarization dependence of the transmission change.
Infrared wire-grid polarizer with sol-gel zirconia grating
NASA Astrophysics Data System (ADS)
Yamada, Itsunari; Ishihara, Yoshiro
2017-05-01
The infrared wire-grid polarizer consisting of an Al grating, Si, and sol-gel derived zirconia grating film was fabricated by soft imprint process and Al shadow coating processes. A silicone mold was used because of its low surface energy, flexibility, and capability of transferring submicrosized patterns. As a result, the Al grating with a pitch of 400 nm and a depth of 100 nm was obtained on the zirconia grating film. The fabricated polarizer exhibited a polarization function with the TM transmittance greater than that of the Si substrate in the specific wavelength range of 3.6-8.5 μm, because the zirconia film acted as an antireflection film. The maximum value was 63% at a wavelength of 5.2 μm. This increment of the TM transmission spectrum results in interference within the zirconia film. Also, the extinction ratio exceeded almost 20 dB in the 3-8.8 μm wavelength range.
Ultrawide low frequency band gap of phononic crystal in nacreous composite material
NASA Astrophysics Data System (ADS)
Yin, J.; Huang, J.; Zhang, S.; Zhang, H. W.; Chen, B. S.
2014-06-01
The band structure of a nacreous composite material is studied by two proposed models, where an ultrawide low frequency band gap is observed. The first model (tension-shear chain model) with two phases including brick and mortar is investigated to describe the wave propagation in the nacreous composite material, and the dispersion relation is calculated by transfer matrix method and Bloch theorem. The results show that the frequency ranges of the pass bands are quite narrow, because a special tension-shear chain motion in the nacreous composite material is formed by some very slow modes. Furthermore, the second model (two-dimensional finite element model) is presented to investigate its band gap by a multi-level substructure scheme. Our findings will be of great value to the design and synthesis of vibration isolation materials in a wide and low frequency range. Finally, the transmission characteristics are calculated to verify the results.
Electromagnetic wave absorbing properties of amorphous carbon nanotubes.
Zhao, Tingkai; Hou, Cuilin; Zhang, Hongyan; Zhu, Ruoxing; She, Shengfei; Wang, Jungao; Li, Tiehu; Liu, Zhifu; Wei, Bingqing
2014-07-10
Amorphous carbon nanotubes (ACNTs) with diameters in the range of 7-50 nm were used as absorber materials for electromagnetic waves. The electromagnetic wave absorbing composite films were prepared by a dip-coating method using a uniform mixture of rare earth lanthanum nitrate doped ACNTs and polyvinyl chloride (PVC). The microstructures of ACNTs and ACNT/PVC composites were characterized using transmission electron microscope and X-ray diffraction, and their electromagnetic wave absorbing properties were measured using a vector-network analyzer. The experimental results indicated that the electromagnetic wave absorbing properties of ACNTs are superior to multi-walled CNTs, and greatly improved by doping 6 wt% lanthanum nitrate. The reflection loss (R) value of a lanthanum nitrate doped ACNT/PVC composite was -25.02 dB at 14.44 GHz, and the frequency bandwidth corresponding to the reflector loss at -10 dB was up to 5.8 GHz within the frequency range of 2-18 GHz.
Temperature dependence of current polarization in Ni80Fe20 by spin wave Doppler measurements
NASA Astrophysics Data System (ADS)
Zhu, Meng; Dennis, Cindi; McMichael, Robert
2010-03-01
The temperature dependence of current polarization in ferromagnetic metals will be important for operation of spin-torque switched memories and domain wall devices in a wide temperature range. Here, we use the spin wave Doppler technique[1] to measure the temperature dependence of both the magnetization drift velocity v(T) and the current polarization P(T) in Ni80Fe20. We obtain these values from current-dependent shifts of the spin wave transmission resonance frequency for fixed-wavelength spin waves in current-carrying wires. For current densities of 10^11 A/m^2, we obtain v(T) decreasing from 4.8 ±0.3 m/s to 4.1 ±0.1 m/s and P(T) dropping from 0.75±0.05 to 0.58±0.02 over a temperature range from 80 K to 340 K. [1] V. Vlaminck et al. Science 322, 410 (2008);
NASA Astrophysics Data System (ADS)
Wasly, H. S.; El-Sadek, M. S. Abd; Henini, Mohamed
2018-01-01
Influence of synthesis temperature and reaction time on the structural and optical properties of ZnO nanoparticles synthesized by the hydrothermal method was investigated using X-ray diffraction (XRD), high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray, Fourier transform infra-red spectroscopy, and UV-visible and fluorescence spectroscopy. The XRD pattern and HR-TEM images confirmed the presence of crystalline hexagonal wurtzite ZnO nanoparticles with average crystallite size in the range 30-40 nm. Their energy gap determined by fluorescence was found to depend on the synthesis temperature and reaction time with values in the range 2.90-3.78 eV. Thermal analysis, thermogravimetric and the differential scanning calorimetry were used to study the thermal reactions and weight loss with heat of the prepared ZnO nanoparticles.
The development of fluorides for high power laser optics
NASA Astrophysics Data System (ADS)
Ready, J. F.; Vora, H.
1980-07-01
The laser assisted thermonuclear fusion program has need for improved optical materials with high transmission in the ultraviolet, and with low values of nonlinear index of refraction. Lithium fluoride possesses a combination of optical properties which are of use. Single crystalline LiF is limited by low mechanical strength. The technique of press forging to increase the mechanical strength is investigated. LiF single crystals were press forged over the temperature range 300 - 600 deg C to produce fine grained polycrystalline material. Optical homogenity at 633, stress birefringence, scattering at 633, residual absorption over the spectral range 339 - 3800 nm, and laser damage thresholds for 1 ns, 1064 nm and 700 ps, 266 nm laser pulses are evaluated. Single crystals can be press forged without seriously degrading their optical properties. Yield strength in compression, proportional limit and fracture strength in 3 and 4 point bending, fracture energy, and threshold for microyield are discussed.
Baig, Hassam A; Dorman, Daniel B; Bulka, Ben A; Shivers, Bethany L; Chancey, Valeta C; Winkelstein, Beth A
2014-10-01
Whole body vibration has been postulated to contribute to the onset of back pain. However, little is known about the relationship between vibration exposure, the biomechanical response, and the physiological responses of the seated human. The aim of this study was to measure the frequency and corresponding muscle responses of seated male volunteers during whole body vibration exposures along the vertical and anteroposterior directions to define the transmissibility and associated muscle activation responses for relevant whole body vibration exposures. Seated human male volunteers underwent separate whole body vibration exposures in the vertical (Z-direction) and anteroposterior (X-direction) directions using sinusoidal sweeps ranging from 2 to 18 Hz, with a constant amplitude of 0.4 g. For each vibration exposure, the accelerations and displacements of the seat and lumbar and thoracic spines were recorded. In addition, muscle activity in the lumbar and thoracic spines was recorded using electromyography (EMG) and surface electrodes in the lumbar and thoracic region. Transmissibility was determined, and peak transmissibility, displacement, and muscle activity were compared in each of the lumbar and thoracic regions. The peak transmissibility for vertical vibrations occurred at 4 Hz for both the lumbar (1.55 ± 0.34) and thoracic (1.49 ± 0.21) regions. For X-directed seat vibrations, the transmissibility ratio in both spinal regions was highest at 2 Hz but never exceeded a value of 1. The peak muscle response in both spinal regions occurred at frequencies corresponding to the peak transmissibility, regardless of the direction of imposed seat vibration: 4 Hz for the Z-direction and 2-3 Hz for the X-direction. In both vibration directions, spinal displacements occurred primarily in the direction of seat vibration, with little off-axis motion. The occurrence of peak muscle responses at frequencies of peak transmissibility suggests that such frequencies may induce greater muscle activity, leading to muscle fatigue, which could be a contributing mechanism of back pain.
NASA Astrophysics Data System (ADS)
Ndao, A.; Salvi, J.; Salut, R.; Bernal, M.-P.; Alaridhee, T.; Belkhir, A.; Baida, F. I.
2014-12-01
We demonstrate enhanced transmission through annular aperture arrays (AAA) by the excitation of the transverse electromagnetic (TEM) guided mode. A complete numerical study is performed to correctly design the structure before it is experimentally characterized. Actually, the challenge was to get efficient TEM-based transmission in the visible range. It turned out to be a hard task because of the strong absorption associated with this guided mode. Nevertheless, we have succeeded to experimentally prove its excitation thanks to the enhanced transmission measured in the far-field. This is the first time we demonstrate experimental evidence of this phenomenon with such AAA structure illuminated at oblique incidence in the visible range. This increases the potential applications of such structures as well, single molecule spectroscopy, photovoltaic, spectral filtering, optical trapping, etc...
Both Parents and Adolescents Project Their Own Values When Perceiving Each Other's Values
ERIC Educational Resources Information Center
Stattin, Håkan; Kim, Yunhwan
2018-01-01
How parents and adolescents perceive each other's life values is a key to understanding successful value transmission. In the value socializations literature, it has been proposed that parents' values become internalized when children correctly perceive their parents' values and decide to adopt them as their own. In the current study, we propose…
Transmission data for shielding diagnostic x-ray facilities.
Simpkin, D J
1995-05-01
Recently published exposure transmission curves for broad diagnostic x-ray beams in lead, concrete, gypsum wallboard, steel, plate glass, and wood have been used to calculate the transmission in 5 kVp increments over the 25 to 35 kVp range for molybdenum-anode tubes and 50 to 150 kVp for tungsten-anode tubes. The data are fit to a three parameter model for ease in calculating the x-ray transmission with computers or calculators.
Influenza transmission during extreme indoor conditions in a low-resource tropical setting
NASA Astrophysics Data System (ADS)
Tamerius, James; Ojeda, Sergio; Uejio, Christopher K.; Shaman, Jeffrey; Lopez, Brenda; Sanchez, Nery; Gordon, Aubree
2017-04-01
Influenza transmission occurs throughout the planet across wide-ranging environmental conditions. However, our understanding of the environmental factors mediating transmission is evaluated using outdoor environmental measurements, which may not be representative of the indoor conditions where influenza is transmitted. In this study, we examined the relationship between indoor environment and influenza transmission in a low-resource tropical population. We used a case-based ascertainment design to enroll 34 households with a suspected influenza case and then monitored households for influenza, while recording indoor temperature and humidity data in each household. We show that the indoor environment is not commensurate with outdoor conditions and that the relationship between indoor and outdoor conditions varies significantly across homes. We also show evidence of influenza transmission in extreme indoor environments. Specifically, our data suggests that indoor environments averaged 29 °C, 18 g/kg specific humidity, and 68 % relative humidity across 15 transmission events observed. These indoor settings also exhibited significant temporal variability with temperatures as high as 39 °C and specific and relative humidity increasing to 22 g/kg and 85 %, respectively, during some transmission events. However, we were unable to detect differences in the transmission efficiency by indoor temperature or humidity conditions. Overall, these results indicate that laboratory studies investigating influenza transmission and virus survival should increase the range of environmental conditions that they assess and that observational studies investigating the relationship between environment and influenza activity should use caution using outdoor environmental measurements since they can be imprecise estimates of the conditions that mediate transmission indoors.
Influenza transmission during extreme indoor conditions in a low-resource tropical setting.
Tamerius, James; Ojeda, Sergio; Uejio, Christopher K; Shaman, Jeffrey; Lopez, Brenda; Sanchez, Nery; Gordon, Aubree
2017-04-01
Influenza transmission occurs throughout the planet across wide-ranging environmental conditions. However, our understanding of the environmental factors mediating transmission is evaluated using outdoor environmental measurements, which may not be representative of the indoor conditions where influenza is transmitted. In this study, we examined the relationship between indoor environment and influenza transmission in a low-resource tropical population. We used a case-based ascertainment design to enroll 34 households with a suspected influenza case and then monitored households for influenza, while recording indoor temperature and humidity data in each household. We show that the indoor environment is not commensurate with outdoor conditions and that the relationship between indoor and outdoor conditions varies significantly across homes. We also show evidence of influenza transmission in extreme indoor environments. Specifically, our data suggests that indoor environments averaged 29 °C, 18 g/kg specific humidity, and 68 % relative humidity across 15 transmission events observed. These indoor settings also exhibited significant temporal variability with temperatures as high as 39 °C and specific and relative humidity increasing to 22 g/kg and 85 %, respectively, during some transmission events. However, we were unable to detect differences in the transmission efficiency by indoor temperature or humidity conditions. Overall, these results indicate that laboratory studies investigating influenza transmission and virus survival should increase the range of environmental conditions that they assess and that observational studies investigating the relationship between environment and influenza activity should use caution using outdoor environmental measurements since they can be imprecise estimates of the conditions that mediate transmission indoors.
An Energy Efficient Power Control Protocol for Ad Hoc Networks Using Directional Antennas
NASA Astrophysics Data System (ADS)
Quiroz-Perez, Carlos; Gulliver, T. Aaron
A wireless ad hoc network is a collection of mobile nodes that can communicate with each other. Typically, nodes employ omnidirectional antennas. The use of directional antennas can increase spatial reuse, reduce the number of hops to a destination, reduce interference, and increase the transmission range in a specific direction. This is because omnidirectional antennas radiate equally in all directions, limiting the transmission range.
NASA Astrophysics Data System (ADS)
Huang, Y.; Zhan, H.; Knappett, P.
2017-12-01
Past studies modeling stream-aquifer interactions commonly account for vertical anisotropy, but rarely address horizontal anisotropy, which does exist in certain geological settings. Horizontal anisotropy is impacted by sediment deposition rates, orientation of sediment particles and orientations of fractures etc. We hypothesize that horizontal anisotropy controls the volume of recharge a pumped aquifer captures from the river. To test this hypothesis, a new mathematical model was developed to describe the distribution of drawdown from stream-bank pumping with a well screened across a horizontally anisotropic, confined aquifer, laterally bounded by a river. This new model was used to determine four aquifer parameters including the magnitude and directions of major and minor principal transmissivities and storativity based on the observed drawdown-time curves within a minimum of three non-collinear observation wells. By comparing the aquifer parameters values estimated from drawdown data generated known values, the discrepancies of the major and minor transmissivities, horizontal anisotropy ratio, storativity and the direction of major transmissivity were 13.1, 8.8, 4, 0 and <1 percent, respectively. These discrepancies are well within acceptable ranges of uncertainty for aquifer parameters estimation, when compared with other pumping test interpretation methods, which typically estimate uncertainty for the estimated parameters of 20 or 30 percent. Finally, the stream depletion rate was calculated as a function of stream-bank pumping. Unique to horizontally anisotropic aquifer, the stream depletion rate at any given pumping rate depends on the horizontal anisotropy ratio and the direction of the principle transmissivity. For example, when horizontal anisotropy ratios are 5 and 50 respectively, the corresponding depletion rate under pseudo steady-state condition are 86 m3/day and 91 m3/day. The results of this research fill a knowledge gap on predicting the response of horizontally anisotropic aquifers connected to streams. We further provide a method to estimate aquifer properties and predict stream depletion rates from observed drawdown. This new model can be used by water resources managers to exploit groundwater resource reasonably while protecting stream ecosystem.
Roughness-Dominated Hydraulic Fracture Propagation
NASA Astrophysics Data System (ADS)
Garagash, D.
2015-12-01
Current understanding suggests that the energy to propagate a hydraulic fracture is defined by the viscous fluid pressure drop along the fracture channel, while the energy dissipation in the immediate vicinity of the fracture front (i.e. fracture toughness) is negligible. This status quo relies on the assumption of Poiseuille flow in the fracture, which transmissivity varies as cube of the aperture. We re-evaluate this assumption in the vicinity of the fracture tip, where the aperture roughness and/or branching of the fracture path may lead to very significant deviations from the cubic law. Existing relationships suggest rough fracture transmissivity power laws ~ wr with 4.5 ≤ r ≤ 6, when aperture w is smaller than the roughness. Solving for the tip region of a steadily propagating hydraulic fracture with the "rough fracture" transmissivity, we are able to show (a) larger energy dissipation than predicted by the Poiseuille flow model; (b) localization of the fluid pressure drop into the low-transmissivity, rough tip region; and (c) emergence of potentially preeminent "toughness-dominated" fracture propagation regime where most of the energy is dissipated at the tip and can be described in the context of classical fracture mechanics by invoking the effective fracture toughness dependent upon the details of the pressure drop in the rough tip. We establish that the ratio of the roughness scale wc to the viscous aperture scale wμ = μVE / σ02, controls the pressure drop localization. (Here V - propagation speed, μ - fluid viscosity, E - rock modulus, and σ0 - in-situ stress). For a range of industrial fracturing fluids (from slick-water to linear gels) and treatment conditions, wc/wμ is large, suggesting a fully-localized pressure drop and energy dissipation. The latter is adequately described by the effective toughness - a function of the propagation velocity, confining stress and material parameters, which estimated values are much larger than the "dry" rock fracture toughness measured in the lab. Using the effective, velocity-dependent fracture toughness to predict the evolution of a penny-shape fracture, we are able to show how/when the classical viscosity-dominated and toughness-dominated solutions based upon the Poiseuille law and the "dry", laboratory fracture toughness values, respectively, may become inadequate.
Limits of Kirchhoff's Laws in Plasmonics.
Razinskas, Gary; Biagioni, Paolo; Hecht, Bert
2018-01-30
The validity of Kirchhoff's laws in plasmonic nanocircuitry is investigated by studying a junction of plasmonic two-wire transmission lines. We find that Kirchhoff's laws are valid for sufficiently small values of a phenomenological parameter κ relating the geometrical parameters of the transmission line with the effective wavelength of the guided mode. Beyond such regime, for large values of the phenomenological parameter, increasing deviations occur and the equivalent impedance description (Kirchhoff's laws) can only provide rough, but nevertheless useful, guidelines for the design of more complex plasmonic circuitry. As an example we investigate a system composed of a two-wire transmission line and a nanoantenna as the load. By addition of a parallel stub designed according to Kirchhoff's laws we achieve maximum signal transfer to the nanoantenna.
Widdice, Lea; Ma, Yifei; Jonte, Janet; Farhat, Sepideh; Breland, David; Shiboski, Stephen; Moscicki, Anna-Barbara
2013-01-01
Background. Because many human papillomavirus (HPV) infections are transient, rates of transmission may be miscalculated if the interval between testing spans several months. We examined rates of concordance and transmission in heterosexual couples over short intervals. Methods. Twenty-five adult couples were enrolled and sampled for HPV DNA from the genitals, hand, and mouth 5 times over a 6-week period, including 24 hours after sexual intercourse and after 48 hours of abstinence. Concordance and transmission patterns were described. Results. Concordance between the couple's genital sites ranged from 64% to 95% for at least 1 HPV type. The highest rates of concordance were observed 24 hours after sexual intercourse. A similar peak in concordance was not seen between genital and nongenital anatomic sites. Transmission rates for female genital to male genital ranged from 26.8 to 187.5 per 100 person-months and for male genital to female genital from 14.5 to 100 per 100 person-months. Conclusions. High rates of concordance shortly after intercourse suggest that some DNA detections in the genital area are contaminants from a partner and not established HPV infections. Female-to-male transmission appeared more common than male-to-female transmission. PMID:23319742
Disorder-induced transparency in a one-dimensional waveguide side coupled with optical cavities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yongyou, E-mail: yyzhang@bit.edu.cn; Dong, Guangda; Zou, Bingsuo
2014-05-07
Disorder influence on photon transmission behavior is theoretically studied in a one-dimensional waveguide side coupled with a series of optical cavities. For this sake, we propose a concept of disorder-induced transparency appearing on the low-transmission spectral background. Two kinds of disorders, namely, disorders of optical cavity eigenfrequencies and relative phases in the waveguide side coupled with optical cavities are considered to show the disorder-induced transparency. They both can induce the optical transmission peaks on the low-transmission backgrounds. The statistical mean value of the transmission also increases with increasing the disorders of the cavity eigenfrequencies and relative phases.
Design-Parameters Setup for Power-Split Dual-Regime IVT
NASA Astrophysics Data System (ADS)
Preda, Ion; Ciolan, Gheorghe; Covaciu, Dinu
2017-10-01
To analyze the working possibilities of power-split infinitely variable transmissions (IVTs) it is necessary to follow a systematic approach. The method proposed in this paper consists of generating a block diagram of the transmission and then, based on this diagram, to derive the kinematics and dynamics equations of the transmission. For an actual numerical case, the derived equations are used to find characteristic values of the transmission components (gear and chain drives, planetary units) necessary to calculate the speed ratios, the speeds, torques and powers acting on the shafts and coupling (control) elements, and even to estimate the overall efficiency of the transmission.
The Interfacial Thermal Conductance of Epitaxial Metal-Semiconductor Interfaces
NASA Astrophysics Data System (ADS)
Ye, Ning
Understanding heat transport at nanometer and sub-nanometer lengthscales is critical to solving a wide range of technological challenges related to thermal management and energy conversion. In particular, finite Interfacial Thermal Conductance (ITC) often dominates transport whenever multiple interfaces are closely spaced together or when heat originates from sources that are highly confined by interfaces. Examples of the former include superlattices, thin films, quantum cascade lasers, and high density nanocomposites. Examples of the latter include FinFET transistors, phase-change memory, and the plasmonic transducer of a heat-assisted magnetic recording head. An understanding of the physics of such interfaces is still lacking, in part because experimental investigations to-date have not bothered to carefully control the structure of interfaces studied, and also because the most advanced theories have not been compared to the most robust experimental data. This thesis aims to resolve this by investigating ITC between a range of clean and structurally well-characterized metal-semiconductor interfaces using the Time-Domain Thermoreflectance (TDTR) experimental technique, and by providing theoretical/computational comparisons to the experimental data where possible. By studying the interfaces between a variety of materials systems, each with unique aspects to their tunability, I have been able to answer a number of outstanding questions regarding the importance of interfacial quality (epitaxial/non-epitaxial interfaces), semiconductor doping, matching of acoustic and optical phonon band structure, and the role of phonon transport mechanisms apart from direct elastic transmission on ITC. In particular, we are able to comment on the suitability of the diffuse mismatch model (DMM) to describe the transport across epitaxial interfaces. To accomplish this goal, I studied interfacial thermal transport across CoSi2, TiSi2, NiSi and PtSi - Si(100) and Si(111), (silicides-silicon), interfaces with varying levels of disorder (epitaxial and non-epitaxial). The ITC values of silicides-silicon interfaces observed in this study are higher than those of other metallic interfaces to Si found in literature. Most surprisingly, it is experimentally found that ITC values are independent of interfacial quality and substrate orientation. Computationally, it is found that the non-equilibrium atomistic Green's Function technique (NEGF), which is specically designed to simulate coherent elastic phonon transport across interfaces, significantly underpredicts ITC values for CoSi2-Si interfaces, suggesting that energy transport does not occur purely by coherent transmission of phonons, even for epitaxial interfaces. In contrast, the Diffuse Mismatch Model closely mimics the experimentally observed ITC values for CoSi 2-Si, NiSi-Si and TiSi2-Si interfaces, and only slightly overestimating the same for PtSi-Si interfaces. Furthermore, the results also show that ITC is independent of degenerate doping up to doping levels of ≈1 x 1019 cm-3, indicating there is no significant direct electronic transport or transport effects which depend on long-range metal-semiconductor band alignment. Then, I study the effect of phonon band structure on ITC through measurements of epitaxial NiAl1-xGax-GaAs interfaces for varying levels of alloy composition, which independently tunes the mass of the metal's heavy atom without much affect on the lattice structure or interatomic force constants. The ITC values are found to linearly increase with increasing Ga content, consistent with the disappearance of a phonon band gap in NiAl 1-xGax films with increasing Ga content, which enhances the phonon transmission coefficients due to a better density of states overlap between the two (NiAl1-xGax, GaAs) materials. Finally, I study a unique subset of epitaxial rocksalt interfaces between the Group IV metal nitrides (TiN, ZrN, and HfN) to MgO substrates as well as ScN layers. Prior to the currrent study, TiN-MgO was the only measured interface of this type, and maintained the record for the highest reported ITC for a metal-semiconductor interface. By varying the Group IV metal, the mass of the metal's light atom was independently tuned, allowing the ability to tune the acoustic phonon frequencies in the metal without significant effect to optical phonon band structure. We find that the ITC of all the studied interfaces are quite high, significantly exceeding the DMM predictions, and in the case of XN-ScN interfaces even exceed the radiative limit for elastic phonon transport. The results imply that mechanisms such as anharmonic phonon transmission, strong cross-interfacial electron phonon coupling, or direct electric transmission are required to explain the transport. The TiN-ScN interface conductance is the highest room temperature metal-dielectric conductance ever reported.
NASA Astrophysics Data System (ADS)
Lee, Hana; Kim, Jhoon; Kim, Woogyung; Lee, Yun Gon; Cho, Hi Ku
2015-04-01
In recent years, there have been substantial attempts to model the radiative transfer for climatological and biological purposes. However, the incorporation of clouds, aerosols and ozone into the modeling process is one of the difficult tasks due to their variable transmission in both temporal and space domains. In this study we quantify the atmospheric transmissions by clouds, aerosol optical depth (AOD at 320 nm) and total ozone (Ozone) together with all skies in three solar radiation components of the global solar (GS 305-2800nm), total ultraviolet (TUV 290-363nm) and the erythemal weighted ultraviolet (EUV 290-325nm) irradiances with statistical methods using the data at Seoul. The purpose of this study also is to clarify the different characteristics between cloud, AOD and Ozone in the wavelength-dependent solar radiation components. The ozone, EUV and TUV used in this study (March 2003 - February 2014) have been measured with Dobson Spectrophotometer (Beck #124) and Brewer Spectrophotometer (SCI-TEC#148) at Yonsei University, respectively. GS, Cloud Cover (CC) are available from the Korean Meteorological Agency. The measured total (effect of cloud, aerosol, and ozone) transmissions on annual average showed 74%, 76% and 80% of GS, TUV and EUV irradiance, respectively. For the comparison of the measured values with modeled, we have also constructed a multiple linear regression model for the total transmission. The average ratio of measured to modeled total transmission were 0.94, 0.96 and 0.96 with higher measured than modeled value in the three components, respectively, The individual transmission by clouds under the constant AOD and Ozone atmosphere on average showed 68%, 71% and 76% and further the overcast clouds reduced the transmissions to the 45%, 54% and 59% of the clear sky irradiance in the GS, TUV and EUV, respectively. The annual transmissions by AOD showed on average 67%, 70% and 74% and further the high loadings 2.5-4.0 AOD reduced the transmission to 50%, 52% and 55% of clear sky irradiance under the contact cloud and ozone atmosphere in the GS, TUV and EUV, respectively. And annual average EUV transmission by Ozone was 75 % of the clear-sky value under the constant CC and AOD. In future study, we are compare OMI data with ground-based instruments in order to use measured data for scientific studies.
Medical tomograph system using ultrasonic transmission
NASA Technical Reports Server (NTRS)
Heyser, Richard C. (Inventor); Nathan, Robert (Inventor)
1978-01-01
Ultrasonic energy transmission in rectilinear array scanning patterns of soft tissue provides projection density values of the tissue which are recorded as a function of scanning position and angular relationship, .theta., of the subject with a fixed coordinate system. A plurality of rectilinear scan arrays in the same plane for different angular relationships .theta..sub.1 . . . .theta..sub.n thus recorded are superimposed. The superimposition of intensity values thus yields a tomographic image of an internal section of the tissue in the scanning plane.
Mullett, Mark; Fornarelli, Roberta; Ralph, David
2014-01-01
Two nanofiltration membranes, a Dow NF 270 polyamide thin film and a TriSep TS 80 polyamide thin film, were investigated for their retention of ionic species when filtering mine influenced water streams at a range of acidic pH values. The functional iso-electric point of the membranes, characterized by changes in retention over a small pH range, were examined by filtering solutions of sodium sulphate. Both membranes showed changes in retention at pH 3, suggesting a zero net charge on the membranes at this pH. Copper mine drainage and synthetic solutions of mine influenced water were filtered using the same membranes. These solutions were characterized by pH values within 2 and 5, thus crossing the iso-electric point of both membranes. Retention of cations was maximized when the feed solution pH was less than the iso-electric point of the membrane. In these conditions, the membrane has a net positive charge, reducing the transmission rate of cations. From the recoveries of a range of cations, the suitability of nanofiltration was discussed relative to the compliance with mine water discharge criteria and the recovery of valuable commodity metals. The nanofiltration process was demonstrated to offer advantages in metal recovery from mine waste streams, concomitantly enabling discharge criteria for the filtrate disposal to be met. PMID:24957170
On the Probabilistic Deployment of Smart Grid Networks in TV White Space.
Cacciapuoti, Angela Sara; Caleffi, Marcello; Paura, Luigi
2016-05-10
To accommodate the rapidly increasing demand for wireless broadband communications in Smart Grid (SG) networks, research efforts are currently ongoing to enable the SG networks to utilize the TV spectrum according to the Cognitive Radio paradigm. To this aim, in this letter, we develop an analytical framework for the optimal deployment of multiple closely-located SG Neighborhood Area Networks (NANs) concurrently using the same TV spectrum. The objective is to derive the optimal values for both the number of NANs and their coverage. More specifically, regarding the number of NANs, we derive the optimal closed-form expression, i.e., the closed-form expression that assures the deployment of the maximum number of NANs in the considered region satisfying a given collision constraint on the transmissions of the NANs. Regarding the NAN coverage, we derive the optimal closed-form expression, i.e., the closed-form expression of the NAN transmission range that assures the maximum coverage of each NAN in the considered region satisfying the given collision constraint. All the theoretical results are derived by adopting a stochastic approach. Finally, numerical results validate the theoretical analysis.
Keegan, Lindsay; Dushoff, Jonathan
2014-05-01
The basic reproductive number, R0, provides a foundation for evaluating how various factors affect the incidence of infectious diseases. Recently, it has been suggested that, particularly for vector-transmitted diseases, R0 should be modified to account for the effects of finite host population within a single disease transmission generation. Here, we use a transmission factor approach to calculate such "finite-population reproductive numbers," under the assumption of homogeneous mixing, for both vector-borne and directly transmitted diseases. In the case of vector-borne diseases, we estimate finite-population reproductive numbers for both host-to-host and vector-to-vector generations, assuming that the vector population is effectively infinite. We find simple, interpretable formulas for all three of these quantities. In the direct case, we find that finite-population reproductive numbers diverge from R0 before R0 reaches half of the population size. In the vector-transmitted case, we find that the host-to-host number diverges at even lower values of R0, while the vector-to-vector number diverges very little over realistic parameter ranges.
Mahbub, Parvez; Leis, John; Macka, Mirek
2018-05-15
Modeling the propagation of light from LED sources is problematic since the emission covers a broad range of wavelengths and thus cannot be considered as monochromatic. Furthermore, the lack of directivity of such sources is also problematic. Both attributes are characteristic of LEDs. Here we propose a HITRAN ( high-resolution transmission molecular absorption database) based chemometric approach that incorporates not-perfect-monochromaticity and spatial directivity of near-infrared (NIR) LED for absorbance calculations in 1-6% methane (CH 4 ) in air, considering CH 4 as a model absorbing gas. We employed the absorbance thus calculated using HITRAN to validate the experimentally measured absorbance of CH 4 . The maximum error between the measured and calculated absorbance values were within 1%. The approach can be generalized as a chemometric calibration technique for measuring gases and gas mixtures that absorb emissions from polychromatic or not-perfect-monochromatic sources, provided the gas concentration, optical path length, as well as blank and attenuated emission spectra of the light source are incorporated into the proposed chemometric approach.
Transmission Magnitude and Phase Control for Polarization-Preserving Reflectionless Metasurfaces
NASA Astrophysics Data System (ADS)
Kwon, Do-Hoon; Ptitcyn, Grigorii; Díaz-Rubio, Ana; Tretyakov, Sergei A.
2018-03-01
For transmissive applications of electromagnetic metasurfaces, an array of subwavelength Huygens' meta-atoms are typically used to eliminate reflection and achieve a high-transmission power efficiency together with a wide transmission phase coverage. We show that the underlying principle of low reflection and full control over transmission is asymmetric scattering into the specular reflection and transmission directions that results from a superposition of symmetric and antisymmetric scattering components, with Huygens' meta-atoms being one example configuration. Available for oblique illumination in TM polarization, a meta-atom configuration comprising normal and tangential electric polarizations is presented, which is capable of reflectionless, full-power transmission and a 2 π transmission phase coverage as well as full absorption. For lossy metasurfaces, we show that a complete phase coverage is still available for reflectionless designs for any value of absorptance. Numerical examples in the microwave and optical regimes are provided.
Limits of optical transmission measurements with application to particle sizing techniques.
Swanson, N L; Billard, B D; Gennaro, T L
1999-09-20
Considerable confusion exists regarding the applicability limits of the Bouguer-Lambert-Beer law of optical transmission. We review the derivation of the law and discuss its application to the optical thickness of the light-scattering medium. We demonstrate the range of applicability by presenting a method for determining particle size by measuring optical transmission at two wavelengths.
Continuously Variable Transmission
NASA Technical Reports Server (NTRS)
Grana, D. C.
1985-01-01
Chain slides along two cones, in novel transmission concept. Transmission includes chain drive between two splined shafts. Chain sprockets follow surfaces of two cones. As one chain sprocket moves toward smaller diameter other chain sprocket moves toward larger diameter, thereby changing "gear" ratio. Movement initiated by tension applied to chain by planetary gear mechanism. Device positive, simple, and efficient over wide range of speed ratios.
Frédéric M. Hamelin; Frank M. Hilker; T. Anthony Sun; Michael J. Jeger; M. Reza Hajimorad; Linda J.S. Allen; Holly R. Prendeville
2017-01-01
Virusâplant interactions range from parasitism to mutualism. Viruses have been shown to increase fecundity of infected plants in comparison with uninfected plants under certain environmental conditions. Increased fecundity of infected plants may benefit both the plant and the virus as seed transmission is one of the main virus transmission pathways, in addition to...
Social network analysis provides insights into African swine fever epidemiology.
Lichoti, Jacqueline Kasiiti; Davies, Jocelyn; Kitala, Philip M; Githigia, Samuel M; Okoth, Edward; Maru, Yiheyis; Bukachi, Salome A; Bishop, Richard P
2016-04-01
Pig movements play a significant role in the spread of economically important infectious diseases such as the African swine fever. Characterization of movement networks between pig farms and through other types of farm and household enterprises that are involved in pig value chains can provide useful information on the role that different participants in the networks play in pathogen transmission. Analysis of social networks that underpin these pig movements can reveal pathways that are important in the transmission of disease, trade in commodities, the dissemination of information and the influence of behavioural norms. We assessed pig movements among pig keeping households within West Kenya and East Uganda and across the shared Kenya-Uganda border in the study region, to gain insight into within-country and trans-boundary pig movements. Villages were sampled using a randomized cluster design. Data were collected through interviews in 2012 and 2013 from 683 smallholder pig-keeping households in 34 villages. NodeXL software was used to describe pig movement networks at village level. The pig movement and trade networks were localized and based on close social networks involving family ties, friendships and relationships with neighbours. Pig movement network modularity ranged from 0.2 to 0.5 and exhibited good community structure within the network implying an easy flow of knowledge and adoption of new attitudes and beliefs, but also promoting an enhanced rate of disease transmission. The average path length of 5 defined using NodeXL, indicated that disease could easily reach every node in a cluster. Cross-border boar service between Uganda and Kenya was also recorded. Unmonitored trade in both directions was prevalent. While most pig transactions in the absence of disease, were at a small scale (<5km) and characterized by regular agistment, most pig sales during ASF outbreaks were to traders or other farmers from outside the sellers' village at a range of >10km. The close social relationships between actors in pig movement networks indicate the potential for possible interventions to develop shared norms and mutually accepted protocols amongst smallholder pig keepers to better manage the risk of ASF introduction and transmission. Copyright © 2016 Elsevier B.V. All rights reserved.
Kelly-Hope, Louise A; McKenzie, F Ellis
2009-01-01
Plasmodium falciparum malaria is a serious tropical disease that causes more than one million deaths each year, most of them in Africa. It is transmitted by a range of Anopheles mosquitoes and the risk of disease varies greatly across the continent. The "entomological inoculation rate" is the commonly-used measure of the intensity of malaria transmission, yet the methods used are currently not standardized, nor do they take the ecological, demographic, and socioeconomic differences across populations into account. To better understand the multiplicity of malaria transmission, this study examines the distribution of transmission intensity across sub-Saharan Africa, reviews the range of methods used, and explores ecological parameters in selected locations. It builds on an extensive geo-referenced database and uses geographical information systems to highlight transmission patterns, knowledge gaps, trends and changes in methodologies over time, and key differences between land use, population density, climate, and the main mosquito species. The aim is to improve the methods of measuring malaria transmission, to help develop the way forward so that we can better assess the impact of the large-scale intervention programmes, and rapid demographic and environmental change taking place across Africa. PMID:19166589
Vibration characteristics of OH-58A helicopter main rotor transmission
NASA Technical Reports Server (NTRS)
Lewicki, David G.; Coy, John J.
1987-01-01
Experimental vibration tests covering a range of torque and speed conditions were performed on the OH-58A helicopter main rotor transmission at the NASA Lewis Research Center. Signals from accelerometers located on the transmission housing were analyzed by using Fourier spectra, power spectral density functions, and averaging techniques. Most peaks of the Fourier spectra occurred at the spiral bevel and planetary gear mesh harmonics. The highest level of vibration occurred at the spiral bevel meshing frequency. Transmission speed and vibration measurement location had a significant effect on measured vibration; transmission torque and measurement direction had a small effect.
NASA Astrophysics Data System (ADS)
Andrianov, M. N.; Kostenko, V. I.; Likhachev, S. F.
2018-01-01
The algorithms for achieving a practical increase in the rate of data transmission on the space-craft-ground tracking station line has been considered. This increase is achieved by applying spectral-effective modulation techniques, the technology of orthogonal frequency compression of signals using millimeterrange radio waves. The advantages and disadvantages of each of three algorithms have been revealed. A significant advantage of data transmission in the millimeter range has been indicated.
NASA Astrophysics Data System (ADS)
Lozano, A. I.; Oller, J. C.; Krupa, K.; Ferreira da Silva, F.; Limão-Vieira, P.; Blanco, F.; Muñoz, A.; Colmenares, R.; García, G.
2018-06-01
A novel experimental setup has been implemented to provide accurate electron scattering cross sections from molecules at low and intermediate impact energies (1-300 eV) by measuring the attenuation of a magnetically confined linear electron beam from a molecular target. High-resolution electron energy is achieved through confinement in a magnetic gas trap where electrons are cooled by successive collisions with N2. Additionally, we developed and present a method to correct systematic errors arising from energy and angular resolution limitations. The accuracy of the entire measurement procedure is validated by comparing the N2 total scattering cross section in the considered energy range with benchmark values available in the literature.
Balakrishnan, T; Ramamurthi, K
2007-10-01
Glycine zinc sulphate salt was synthesized and the solubility and metastable zonewidth were estimated from the aqueous solution. Single crystals of glycine zinc sulphate were grown by solvent evaporation method from aqueous solution. Grown crystals were characterized by X-ray diffraction and FT-IR spectral analyses. The range and percentage of optical transmission was ascertained by recording UV-vis-NIR spectrum. Thermal properties of the crystal were investigated by thermogravimetric analysis. Microhardness study was carried out on (01-1) face of the grown crystal. Its powder second harmonic generation efficiency was measured using Nd:YAG laser and the value was observed to be 0.7 times that of potassium dihydrogen orthophosphate.
Stratospheric ozone as viewed from the Chappuis band. [long term pollution monitoring
NASA Technical Reports Server (NTRS)
Angione, R. J.; Medeiros, E. J.; Roosen, R. G.
1976-01-01
Total stratospheric ozone values above high-altitude stations in southern California from 1912 to 1950 and northern Chile from 1918 to 1948 are determined using data obtained by the Smithsonian Astrophysical Observatory, including transmission measurements made in the Chappuis band (0.5 to 0.7 micron). The results show that at both sites, total ozone amounts commonly exhibit variations of as much as 20% to 30% on time scales ranging from months to decades. Consideration of the amount of incident solar energy absorbed by the Chappuis band suggests that ozone acts as a shutter on the incoming solar radiation and provides a trigger mechanism between solar activity and climatic change.
Strong, light, multifunctional fibers of carbon nanotubes with ultrahigh conductivity.
Behabtu, Natnael; Young, Colin C; Tsentalovich, Dmitri E; Kleinerman, Olga; Wang, Xuan; Ma, Anson W K; Bengio, E Amram; ter Waarbeek, Ron F; de Jong, Jorrit J; Hoogerwerf, Ron E; Fairchild, Steven B; Ferguson, John B; Maruyama, Benji; Kono, Junichiro; Talmon, Yeshayahu; Cohen, Yachin; Otto, Marcin J; Pasquali, Matteo
2013-01-11
Broader applications of carbon nanotubes to real-world problems have largely gone unfulfilled because of difficult material synthesis and laborious processing. We report high-performance multifunctional carbon nanotube (CNT) fibers that combine the specific strength, stiffness, and thermal conductivity of carbon fibers with the specific electrical conductivity of metals. These fibers consist of bulk-grown CNTs and are produced by high-throughput wet spinning, the same process used to produce high-performance industrial fibers. These scalable CNT fibers are positioned for high-value applications, such as aerospace electronics and field emission, and can evolve into engineered materials with broad long-term impact, from consumer electronics to long-range power transmission.
Interaction of Individual Skyrmions in a Nanostructured Cubic Chiral Magnet
NASA Astrophysics Data System (ADS)
Du, Haifeng; Zhao, Xuebing; Rybakov, Filipp N.; Borisov, Aleksandr B.; Wang, Shasha; Tang, Jin; Jin, Chiming; Wang, Chao; Wei, Wensheng; Kiselev, Nikolai S.; Zhang, Yuheng; Che, Renchao; Blügel, Stefan; Tian, Mingliang
2018-05-01
We report direct evidence of the field-dependent character of the interaction between individual magnetic skyrmions as well as between skyrmions and edges in B 20 -type FeGe nanostripes observed by means of high-resolution Lorentz transmission electron microscopy. It is shown that above certain critical values of an external magnetic field the character of such long-range skyrmion interactions changes from attraction to repulsion. Experimentally measured equilibrium inter-skyrmion and skyrmion-edge distances as a function of the applied magnetic field shows quantitative agreement with the results of micromagnetic simulations. The important role of demagnetizing fields and the internal symmetry of three-dimensional magnetic skyrmions are discussed in detail.
Determining photon energy absorption parameters for different soil samples
Kucuk, Nil; Tumsavas, Zeynal; Cakir, Merve
2013-01-01
The mass attenuation coefficients (μs) for five different soil samples were measured at 661.6, 1173.2 and 1332.5 keV photon energies. The soil samples were separately irradiated with 137Cs and 60Co (370 kBq) radioactive point gamma sources. The measurements were made by performing transmission experiments with a 2″ × 2″ NaI(Tl) scintillation detector, which had an energy resolution of 7% at 0.662 MeV for the gamma-rays from the decay of 137Cs. The effective atomic numbers (Zeff) and the effective electron densities (Neff) were determined experimentally and theoretically using the obtained μs values for the soil samples. Furthermore, the Zeff and Neff values of the soil samples were computed for the total photon interaction cross-sections using theoretical data over a wide energy region ranging from 1 keV to 15 MeV. The experimental values of the soils were found to be in good agreement with the theoretical values. Sandy loam and sandy clay loam soils demonstrated poor photon energy absorption characteristics. However, clay loam and clay soils had good photon energy absorption characteristics. PMID:23179375
NASA Astrophysics Data System (ADS)
Yi, Yong; Chen, Zhengying; Wang, Liming
2018-05-01
Corona-originated discharge of DC transmission lines is the main reason for the radiated electromagnetic interference (EMI) field in the vicinity of transmission lines. A joint time-frequency analysis technique was proposed to extract the radiated EMI current (excitation current) of DC corona based on corona current statistical measurements. A reduced-scale experimental platform was setup to measure the statistical distributions of current waveform parameters of aluminum conductor steel reinforced. Based on the measured results, the peak value, root-mean-square value and average value with 9 kHz and 200 Hz band-with of 0.5 MHz radiated EMI current were calculated by the technique proposed and validated with conventional excitation function method. Radio interference (RI) was calculated based on the radiated EMI current and a wire-to-plate platform was built for the validity of the RI computation results. The reason for the certain deviation between the computations and measurements was detailed analyzed.
Terahertz transmission properties of an individual slit in a thin metallic plate.
Lee, J W; Park, T H; Nordlander, Peter; Mittleman, Daniel M
2009-07-20
We report on the terahertz transmission properties through a single slit in a thin metallic film. The properties are studied by comparing the transmissions of TE- and TM-polarized electromagnetic waves over a broad spectral range from the geometrical regime to the subwavelength limit. In the geometrical regime, the remarkable terahertz transmission due to guided modes is observed even without the contribution of surface waves. Whereas in the subwavelength limit, the surface charge oscillations associated with the TM-polarized guided mode give rise to strong transmission enhancement. The nature of the mechanisms for the terahertz transmission is elucidated using theoretical simulations of the near-field distributions and electromagnetic energy flow.
Soil clay content underlies prion infection odds
David Walter, W.; Walsh, Daniel P.; Farnsworth, Matthew L.; Winkelman, Dana L.; Miller, Michael W.
2011-01-01
Environmental factors—especially soil properties—have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings. PMID:21326232
Soil clay content underlies prion infection odds.
David Walter, W; Walsh, Daniel P; Farnsworth, Matthew L; Winkelman, Dana L; Miller, Michael W
2011-02-15
Environmental factors-especially soil properties-have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings.
NASA Astrophysics Data System (ADS)
Ren, Tao; Modest, Michael F.; Fateev, Alexander; Clausen, Sønnik
2015-01-01
In this study, we present an inverse calculation model based on the Levenberg-Marquardt optimization method to reconstruct temperature and species concentration from measured line-of-sight spectral transmissivity data for homogeneous gaseous media. The high temperature gas property database HITEMP 2010 (Rothman et al. (2010) [1]), which contains line-by-line (LBL) information for several combustion gas species, such as CO2 and H2O, was used to predict gas spectral transmissivities. The model was validated by retrieving temperatures and species concentrations from experimental CO2 and H2O transmissivity measurements. Optimal wavenumber ranges for CO2 and H2O transmissivity measured across a wide range of temperatures and concentrations were determined according to the performance of inverse calculations. Results indicate that the inverse radiation model shows good feasibility for measurements of temperature and gas concentration.
Nanohole-array-based device for 2D snapshot multispectral imaging
Najiminaini, Mohamadreza; Vasefi, Fartash; Kaminska, Bozena; Carson, Jeffrey J. L.
2013-01-01
We present a two-dimensional (2D) snapshot multispectral imager that utilizes the optical transmission characteristics of nanohole arrays (NHAs) in a gold film to resolve a mixture of input colors into multiple spectral bands. The multispectral device consists of blocks of NHAs, wherein each NHA has a unique periodicity that results in transmission resonances and minima in the visible and near-infrared regions. The multispectral device was illuminated over a wide spectral range, and the transmission was spectrally unmixed using a least-squares estimation algorithm. A NHA-based multispectral imaging system was built and tested in both reflection and transmission modes. The NHA-based multispectral imager was capable of extracting 2D multispectral images representative of four independent bands within the spectral range of 662 nm to 832 nm for a variety of targets. The multispectral device can potentially be integrated into a variety of imaging sensor systems. PMID:24005065
Design studies of continuously variable transmissions for electric vehicles
NASA Technical Reports Server (NTRS)
Parker, R. J.; Loewenthal, S. H.; Fischer, G. K.
1981-01-01
Preliminary design studies were performed on four continuously variable transmission (CVT) concepts for use with a flywheel equipped electric vehicle of 1700 kg gross weight. Requirements of the CVT's were a maximum torque of 450 N-m (330 lb-ft), a maximum output power of 75 kW (100 hp), and a flywheel speed range of 28,000 to 14,000 rpm. Efficiency, size, weight, cost, reliability, maintainability, and controls were evaluated for each of the four concepts which included a steel V-belt type, a flat rubber belt type, a toroidal traction type, and a cone roller traction type. All CVT's exhibited relatively high calculated efficiencies (68 percent to 97 percent) over a broad range of vehicle operating conditions. Estimated weight and size of these transmissions were comparable to or less than equivalent automatic transmission. The design of each concept was carried through the design layout stage.
Yao, Yuhan; Liu, He; Wang, Yifei; Li, Yuanrui; Song, Boxiang; Wang, Richard P; Povinelli, Michelle L; Wu, Wei
2016-07-11
Optical devices with asymmetric transmission have important applications in optical systems, but optical isolators with the modal asymmetry can only be built using magneto-optical or nonlinear materials, as dictated by the Lorentz reciprocity theorem. However, optical devices with the power asymmetry can be achieved by linear materials such as metals and dielectrics. In this paper, we report a large-area, nanoimprint-defined meta-surface (stacked subwavelength gratings) with high-contrast asymmetric transmittance in the visible-to-infrared wavelength range for TM-polarized light. The physical origin of asymmetric transmission through the meta-surface is studied by analyzing the scattering matrix.
NASA Astrophysics Data System (ADS)
Sánchez, A.; Guerra, K. Y.; Porta, A. V.; Orozco, S.
2018-02-01
The opto-fluidics systems can be used for label free refractometric and biosensensing applications. In this work transmission properties of one-dimensional polycarbonate-liquid photonic arrays are studied, where methanol and ethanol were proposed as liquid components. The band structure and the transmission spectrum were calculated using the transference matrix method, in which we consider the dispersion relation for the refractive index n(w) of each material in the visible range. Using lattice parameters of 1 µm, 10 µm, and 4 µm, we obtained forbidden bandgaps in the visible region. When lattice parameters of 1000 µm were considered, we obtained several narrow bandgaps in the visible range.
Assessing Capacity Value of Wind Power
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frew, Bethany A.
This presentation provides a high-level overview of assessing capacity value of wind power, including Impacts of multiple-year data sets, impacts of transmission assumptions, and future research needs.
Effect of a gap opening on the conductance of graphene with magnetic barrier structures
NASA Astrophysics Data System (ADS)
Esmailpour, Mohammad
2018-04-01
In the present study Klein tunneling in a single-layer gapped graphene was investigated by transfer matrix method under normal magnetic field for one and two magnetic barriers. Calculations show that electron transmission through a magnetic barrier is deflected to positive angles and reduces as the magnitude of magnetic field and especially the energy gap increases. This reduction is even more significant in larger fields so that after reaching a specific value of energy gap, an effective confinement for fermions and suppression of Klein tunneling is reached particularly in normal incidence and the conductance becomes zero. Unlike one barrier, the process of tunneling through two magnetic barriers induces symmetric transmission probability versus the incident angle; even, for lower energy gaps, electron transmission probability increases which in turn reduces total conductance via proper changes in the value of the magnetic field and energy gap. In general, it is concluded that confining electrons in asymmetric transmission through one barrier is conducted better than two barriers.
Gall, O; Bouhassira, D; Chitour, D; Le Bars, D
1999-04-01
Stimulus intensity is a major determinant of the antinociceptive activity of opiates. This study focused on the influence of the spatial characteristics of nociceptive stimuli, on opiate-induced depressions of nociceptive transmission at the level of the spinal cord. Anesthetized rats were prepared to allow extracellular recordings to be made from convergent neurons in the lumbar dorsal horn. The effects of systemic morphine (1 and 10 mg/kg) were compared with those of saline for thermal stimuli of constant intensity, applied to the area of skin surrounding the excitatory receptive field (1.9 cm2) or to a much larger adjacent area (18 cm2). The responses (mean +/- SD) elicited by the 1.9-cm2 stimulus were not modified by 1 mg/kg intravenous morphine, although they were decreased by the 10-mg/kg dose (to 11+/-4% of control values compared with saline; P < 0.05). In contrast, when the 18-cm2 stimulus was applied, 1 mg/kg intravenous morphine produced a paradoxical facilitation of the neuronal responses (159+/-36% of control values; P < 0.05) and 10 mg/kg intravenous morphine resulted in a weaker depression of the responses (to 42+/-24% of control values; P < 0.05) than was observed with the smaller stimulus. Doses of systemic morphine in the analgesic range for rats had dual effects on nociceptive transmission at the level of the spinal cord, depending on the surface area that was stimulated. Such effects are difficult to explain in terms of accepted pharmacodynamic concepts and may reflect an opioid-induced depression of descending inhibitory influences triggered by spatial summation.
Elderd, Bret D.; Dwyer, Greg; Dukic, Vanja
2013-01-01
Estimates of a disease’s basic reproductive rate R0 play a central role in understanding outbreaks and planning intervention strategies. In many calculations of R0, a simplifying assumption is that different host populations have effectively identical transmission rates. This assumption can lead to an underestimate of the overall uncertainty associated with R0, which, due to the non-linearity of epidemic processes, may result in a mis-estimate of epidemic intensity and miscalculated expenditures associated with public-health interventions. In this paper, we utilize a Bayesian method for quantifying the overall uncertainty arising from differences in population-specific basic reproductive rates. Using this method, we fit spatial and non-spatial susceptible-exposed-infected-recovered (SEIR) models to a series of 13 smallpox outbreaks. Five outbreaks occurred in populations that had been previously exposed to smallpox, while the remaining eight occurred in Native-American populations that were naïve to the disease at the time. The Native-American outbreaks were close in a spatial and temporal sense. Using Bayesian Information Criterion (BIC), we show that the best model includes population-specific R0 values. These differences in R0 values may, in part, be due to differences in genetic background, social structure, or food and water availability. As a result of these inter-population differences, the overall uncertainty associated with the “population average” value of smallpox R0 is larger, a finding that can have important consequences for controlling epidemics. In general, Bayesian hierarchical models are able to properly account for the uncertainty associated with multiple epidemics, provide a clearer understanding of variability in epidemic dynamics, and yield a better assessment of the range of potential risks and consequences that decision makers face. PMID:24021521
NASA Astrophysics Data System (ADS)
Xie, Yiyuan; Zhang, Zhendong; Song, Tingting; He, Chao; Li, Jiachao; Wang, Guijin
2016-05-01
Crosstalk noise and transmission loss are two key elements in determining the performance of optical routers. We propose a universal method for crosstalk noise and transmission loss analysis for the N-port nonblocking optical router used in photonic networks-on-chip. Utilizing this method, we study the crosstalk noise and transmission loss for the five-, six-, seven-, and eight-port optical routers. We ascertain that the crosstalk noise and transmission loss are different for different input-output pairs. For the five-port optical router, the maximum crosstalk noise ranges from 0 to -7.07 dBm, and the transmission loss ranges from -9.05 to -0.51 dB. Furthermore, based on the crosstalk noise and transmission loss, we analyze optical signal-to-noise ratio (OSNR) and bit error ratio (BER) for the five-, six-, seven-, and eight-port nonblocking optical routers. As the number of ports increases, the minimum average OSNR decreases and the average BER increases. In addition, in order to present the performance of the routers more visually, a fiber-optic communications system is designed to simulate the transmission processes of the signals of the different paths of the routers in Optisystem. The results show that the power amplitude of the input signal is obviously higher than the corresponding output signal. With this method, we can easily evaluate the transmission loss, crosstalk noise, OSNR, and BER of high-radix nonblocking optical routers and conveniently study the performance of the N-port optical router.
Highly efficient holograms based on c-Si metasurfaces in the visible range.
Martins, Augusto; Li, Juntao; da Mota, Achiles F; Wang, Yin; Neto, Luiz G; do Carmo, João P; Teixeira, Fernando L; Martins, Emiliano R; Borges, Ben-Hur V
2018-04-16
This paper reports on the first hologram in transmission mode based on a c-Si metasurface in the visible range. The hologram shows high fidelity and high efficiency, with measured transmission and diffraction efficiencies of ~65% and ~40%, respectively. Although originally designed to achieve full phase control in the range [0-2π] at 532 nm, these holograms have also performed well at 444.9 nm and 635 nm. The high tolerance to both fabrication and wavelength variations demonstrate that holograms based on c-Si metasurfaces are quite attractive for diffractive optics applications, and particularly for full-color holograms.
A method for the estimation of dual transmissivities from slug tests
NASA Astrophysics Data System (ADS)
Wolny, Filip; Marciniak, Marek; Kaczmarek, Mariusz
2018-03-01
Aquifer homogeneity is usually assumed when interpreting the results of pumping and slug tests, although aquifers are essentially heterogeneous. The aim of this study is to present a method of determining the transmissivities of dual-permeability water-bearing formations based on slug tests such as the pressure-induced permeability test. A bi-exponential rate-of-rise curve is typically observed during many of these tests conducted in heterogeneous formations. The work involved analyzing curves deviating from the exponential rise recorded at the Belchatow Lignite Mine in central Poland, where a significant number of permeability tests have been conducted. In most cases, bi-exponential movement was observed in piezometers with a screen installed in layered sediments, each with a different hydraulic conductivity, or in fissured rock. The possibility to identify the flow properties of these geological formations was analyzed. For each piezometer installed in such formations, a set of two transmissivity values was calculated piecewise based on the interpretation algorithm of the pressure-induced permeability test—one value for the first (steeper) part of the obtained rate-of-rise curve, and a second value for the latter part of the curve. The results of transmissivity estimation for each piezometer are shown. The discussion presents the limitations of the interpretational method and suggests future modeling plans.
NASA Astrophysics Data System (ADS)
Endo, N.; Eltahir, E. A. B.
2015-12-01
Malaria transmission is closely linked to climatology, hydrology, environment, and the biology of local vectors. These factors interact with each other and non-linearly influence malaria transmission dynamics, making prediction and prevention challenging. Our work attempts to find a universality in the multi-dimensional system of malaria transmission and to develop a theory to predict emergence of malaria given a limited set of environmental and biological inputs.A credible malaria transmission dynamics model, HYDREMATS (Bomblies et al., 2008), was used under hypothetical settings to investigate the role of spatial and temporal distribution of vector breeding pools. HYDREMATS is a mechanistic model and capable of simulating the basic reproduction rate (Ro) without bold assumptions even under dynamic conditions. The spatial distribution of pools is mainly governed by hydrological factors; the impact of pool persistence and rainy season length on malaria transmission were investigated. Also analyzed was the impact of the temporal distribution of pools relative to human houses. We developed non-dimensional variables combining the hydrological and biological parameters. Simulated values of Ro from HYDREMATS are presented in a newly-introduced non-dimensional plane, which leads to a some-what universal theory describing the condition for sustainable malaria transmission. The findings were tested against observations both from the West Africa and the Ethiopian Highland, representing diverse hydroclimatological conditions. Predicated Ro values from the theory over the two regions are in good agreement with the observed malaria transmission data.
Steinmeyer, P.A.
1992-11-24
A radiation filter for filtering radiation beams of wavelengths within a preselected range of wavelengths comprises a radiation transmissive substrate and an attenuating layer deposited on the substrate. The attenuating layer may be deposited by a sputtering process or a vacuum process. Beryllium may be used as the radiation transmissive substrate. In addition, a second radiation filter comprises an attenuating layer interposed between a pair of radiation transmissive layers. 4 figs.
Steinmeyer, Peter A.
1992-11-24
A radiation filter for filtering radiation beams of wavelengths within a preselected range of wavelengths comprises a radiation transmissive substrate and an attenuating layer deposited on the substrate. The attenuating layer may be deposited by a sputtering process or a vacuum process. Beryllium may be used as the radiation transmissive substrate. In addition, a second radiation filter comprises an attenuating layer interposed between a pair of radiation transmissive layers.
Badgers prefer cattle pasture but avoid cattle: implications for bovine tuberculosis control.
Woodroffe, Rosie; Donnelly, Christl A; Ham, Cally; Jackson, Seth Y B; Moyes, Kelly; Chapman, Kayna; Stratton, Naomi G; Cartwright, Samantha J
2016-10-01
Effective management of infectious disease relies upon understanding mechanisms of pathogen transmission. In particular, while models of disease dynamics usually assume transmission through direct contact, transmission through environmental contamination can cause different dynamics. We used Global Positioning System (GPS) collars and proximity-sensing contact-collars to explore opportunities for transmission of Mycobacterium bovis [causal agent of bovine tuberculosis] between cattle and badgers (Meles meles). Cattle pasture was badgers' most preferred habitat. Nevertheless, although collared cattle spent 2914 collar-nights in the home ranges of contact-collared badgers, and 5380 collar-nights in the home ranges of GPS-collared badgers, we detected no direct contacts between the two species. Simultaneous GPS-tracking revealed that badgers preferred land > 50 m from cattle. Very infrequent direct contact indicates that badger-to-cattle and cattle-to-badger M. bovis transmission may typically occur through contamination of the two species' shared environment. This information should help to inform tuberculosis control by guiding both modelling and farm management. © 2016 John Wiley & Sons Ltd/CNRS.
Controllable asymmetric transmission via gap-tunable acoustic metasurface
NASA Astrophysics Data System (ADS)
Liu, Bingyi; Jiang, Yongyuan
2018-04-01
In this work, we utilize the acoustic gradient metasurface (AGM) of a bilayer configuration to realize the controllable asymmetric transmission. Relying on the adjustable gap between the two composing layers, the metasurface could switch from symmetric transmission to asymmetric transmission at a certain gap value. The underlying mechanism is attributed to the interference between the forward diffracted waves scattered by the surface bound waves at two air-AGM interfaces, which is apparently influenced by the interlayer distance. We further utilize the hybrid acoustic elements to construct the desired gradient metasurface with a tunable gap and validate the controllable asymmetric transmission with full-wave simulations. Our work provides the solution for actively controlling the transmission property of an acoustic element, which shows potential application in acoustic communication as a dynamic tunable acoustic diode.
NASA Astrophysics Data System (ADS)
Supriatna, A. K.; Anggriani, N.
2015-03-01
One of important factors which always appears in most of dengue transmission mathematical model is the number of new susceptible recruited into the susceptible compartment. In this paper we discuss the effect of different rates of recruitment on the transmission of dengue disease. We choose a dengue transmission model with the most realistic form of recruitment rate and analyze the effect of environmental change to the transmission of dengue based on the selected model. We model the effect of environmental change by considering that it can alter the value of mosquito's carrying capacity and mosquito's death rate. We found that the most prevalent effect of the environmental change to the transmission of dengue is when it can alter the death rate of the mosquitoes.
NASA Astrophysics Data System (ADS)
Lazo, Edmundo; Saavedra, Eduardo; Humire, Fernando; Castro, Cristobal; Cortés-Cortés, Francisco
2015-09-01
We study the localization properties of direct transmission lines when we distribute two values of inductances LA and LB according to a generalized Thue-Morse aperiodic sequence generated by the inflation rule: A → ABm-1, B → BAm-1, m ≥ 2 and integer. We regain the usual Thue-Morse sequence for m = 2. We numerically study the changes produced in the localization properties of the I (ω) electric current function with increasing m values. We demonstrate that the m = 2 case does not belong to the family m ≥ 3, because when m changes from m = 2 to m = 3, the number of extended states decreases significantly. However, for m ≫ 3, the localization properties become similar to the m = 2 case. Also, the
Clostridium difficile infection: epidemiology, diagnosis and understanding transmission.
Martin, Jessica S H; Monaghan, Tanya M; Wilcox, Mark H
2016-04-01
Clostridium difficile infection (CDI) continues to affect patients in hospitals and communities worldwide. The spectrum of clinical disease ranges from mild diarrhoea to toxic megacolon, colonic perforation and death. However, this bacterium might also be carried asymptomatically in the gut, potentially leading to 'silent' onward transmission. Modern technologies, such as whole-genome sequencing and multi-locus variable-number tandem-repeat analysis, are helping to track C. difficile transmission across health-care facilities, countries and continents, offering the potential to illuminate previously under-recognized sources of infection. These typing strategies have also demonstrated heterogeneity in terms of CDI incidence and strain types reflecting different stages of epidemic spread. However, comparison of CDI epidemiology, particularly between countries, is challenging due to wide-ranging approaches to sampling and testing. Diagnostic strategies for C. difficile are complicated both by the wide range of bacterial targets and tests available and the need to differentiate between toxin-producing and non-toxigenic strains. Multistep diagnostic algorithms have been recommended to improve sensitivity and specificity. In this Review, we describe the latest advances in the understanding of C. difficile epidemiology, transmission and diagnosis, and discuss the effect of these developments on the clinical management of CDI.
NASA Technical Reports Server (NTRS)
Roskam, J.
1983-01-01
The transmission loss characteristics of panels using the acoustic intensity technique is presented. The theoretical formulation, installation of hardware, modifications to the test facility, and development of computer programs and test procedures are described. A listing of all the programs is also provided. The initial test results indicate that the acoustic intensity technique is easily adapted to measure transmission loss characteristics of panels. Use of this method will give average transmission loss values. The fixtures developed to position the microphones along the grid points are very useful in plotting the intensity maps of vibrating panels.
Hydrogeology of the surficial aquifer system, Dade County, Florida
Fish, J.E.; Stewart, M.T.
1991-01-01
An investigation of the surficial aquifer system in Dade County, begun in 1983, is part of a regional study of the aquifer system in southeastern Florida. Test drilling for lithologic samples, flow measurements during drilling, aquifer testing, and analyses of earlier data permitted delineation of the hydraulic conductivity distribution (on hydrogeologic sections), the aquifers in the system, the generalized transmissivity distribution, and interpretation of the ground-water flow system. The surficial aquifer system, in which an unconfined ground-water flow system exists, is composed of the sediments from land surface downward to the top of a regionally extensive zone of sediments of low permeability called the intermediate confining unit. The aquifer system units, which vary in composition from clay-size sediments to cavernous limestone, are hydro stratigraphically divided into the Biscayne aquifer at the top; an intervening semiconfining unit that consists principally of clayey sand; a predominantly gray limestone aquifer in the Tamiami Formation in western and west-central Dade County; and sand or clayey sand near the base of the surficial aquifer system. The base of the surficial aquifer system ranges from a depth of about 175 to 210 feet below land surface in westernmost Dade County to greater than 270 feet in northeastern Dade County. Test drilling and aquifer-test data indicate a complex hydraulic conductivity distribution. Hydraulic conductivities of the very highly permeable zone of the Biscayne aquifer commonly exceed 10,000 feet per day; in the gray limestone aquifer, they range from 210 to 780 feet per day. Transmissivities of the surficial aquifer system vary locally but have a recognizable areal trend. Estimated values generally are about 300,000 feet squared per day or greater in nearly all of central and eastern Dade County. Transmissivity is lower to the west, decreasing to less than 75,000 feet squared per day in western Dade County. High transmissivity usually is associated with thick sections of the Fort Thompson Formation within the Biscayne aquifer. The gray limestone aquifer of the Tamiami Formation has transmissivities that range from 5,800 to 39,000 feet squared per day in western Dade County. The transition from high transmissivity to relatively low transmissivity is often only a few miles wide and coincides with the decrease in thickness of the very highly permeable Fort Thompson Formation, which marks the western boundary of the Biscayne aquifer. More effective drainage as a result of extensive canal systems and large-scale pumping from municipal well fields has greatly altered the predevelopment flow system in eastern Dade County by: (1) eliminating or greatly reducing a seasonal and coastal ground-water ridge; (2) reducing deep circulation; (3) reducing or eliminating seasonal westward movement of ground water; (4) causing accelerated stormwater runoff and short ground-water flow paths; and (5) generally lowering the water table and inducing saltwater intrusion. Under predevelopment conditions in western Dade County, water entered the gray limestone aquifer by lateral movement from Broward and Collier Counties, and by downward seepage from The Everglades and the Biscayne aquifer, and moved southward and southeastward into Dade County to coastal discharge areas. Circulation in the Biscayne aquifer inland also was primarily to the south and southeast. In eastern Dade County, the seasonal ground-water ridge that formed under predevelopment conditions supported both easterly and westerly ground-water flow away from the ridge axis. This seasonal flow created a zone of lower dissolved solids.
NASA Astrophysics Data System (ADS)
Smausz, T.; Kondász, B.; Gera, T.; Ajtai, T.; Utry, N.; Pintér, M.; Kiss-Albert, G.; Budai, J.; Bozóki, Z.; Szabó, G.; Hopp, B.
2017-10-01
Absorption coefficient of graphite bulk pressed from 1 to 5 μm-sized crystalline grains was measured in UV-Vis-NIR range with three different methods: (i) determination of pulsed laser ablation rate as the function of laser fluence for different wavelengths (248, 337, 532, and 1064 nm, respectively); (ii) production of aerosol particles by UV laser ablation of the bulk graphite in inert atmosphere and determination of the mass-specific absorption coefficient with a four-wavelength (266, 355, 532, and 1064 nm, respectively) photoacoustic spectrometer, and (iii) spectroscopic ellipsometry in 250-1000 nm range. Taking into account the wide range of the absorption coefficients of different carbon structures, an overall relatively good agreement was observed for the three methods. The ellipsometric results fit well with the ablation rate measurement, and the data obtained with photoacoustic method are also similar in the UV and NIR region; however, the values were somewhat higher in visible and near-UV range. Taking into account the limitations of the methods, they can be promising candidates for the determination of absorption coefficient when the samples are strongly scattering and there is no possibility to perform transmissivity measurements.
One-way quasiplanar terahertz absorbers using nonstructured polar dielectric layers
NASA Astrophysics Data System (ADS)
Rodríguez-Ulibarri, P.; Beruete, M.; Serebryannikov, A. E.
2017-10-01
A concept of quasiplanar one-way transparent terahertz absorbers made of linear isotropic materials is presented. The resulting structure consists of a homogeneous absorbing layer of polar dielectric, GaAs, a dispersion-free substrate, and an ultrathin frequency-selective reflector. It is demonstrated that perfect absorption can be obtained for forward illumination, along with total reflection at backward illumination and transparency windows in the adjacent bands. The design is particularized for the polaritonic gap range where permittivity of GaAs varies in a wide range and includes epsilon-near-zero and transparency regimes. The underlying physics can be explained with the aid of a unified equivalent-circuit (EC) analytical model. Perfect matching of input impedance in forward operation and, simultaneously, strong mismatch in the backward case are the universal criteria of one-way absorption. It is shown that perfect one-way absorption can be achieved at rather arbitrary permittivity values, provided these criteria are fulfilled. The EC results are in good agreement with full-wave simulations in a wide range of material and geometrical parameters. The resulting one-way absorbers are very compact and geometrically simple, and enable transparency in the neighboring frequency ranges and, hence, multifunctionality that utilizes both absorption- and transmission-related regimes.
Thuma, Philip E.; Mharakurwa, Sungano; Norris, Douglas E.
2014-01-01
Transmission of Plasmodium falciparum is hyperendemic in southern Zambia. However, no data on the entomologic aspects of malaria transmission have been published from Zambia in more than 25 years. We evaluated seasonal malaria transmission by Anopheles arabiensis and An. funestus s.s. and characterized the blood feeding behavior of An. arabiensis in two village areas. Transmission during the 2004–2005 rainy season was nearly zero because of widespread drought. During 2005–2006, the estimated entomologic inoculation rate values were 1.6 and 18.3 infective bites per person per transmission season in each of the two village areas, respectively. Finally, with a human blood index of 0.923, An. arabiensis was substantially more anthropophilic in our study area than comparable samples of indoor-resting An. arabiensis throughout Africa and was the primary vector responsible for transmission of P. falciparum. PMID:17297034
A study on the trinucleotide repeat associated with Huntington`s disease in the Chinese
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bing-wen Soong; Jih-tsuu Wang
1994-09-01
Analysis of the polymorphic (CAG)n repeat in the hungingtin gene in the chinese confirmed the presence of an expanded repeat on all Huntington`s disease chromosomes. Measurement of the specific CAG repeat sequence in 34 HD chromosomes from 15 unrelated families and 190 control chromosomes from the Chinese population showed a range from 9 to 29 repeats in normal subjects and 40 to 58 in affected subjects. The size distributions of normal and affected alleles did not overlap. A clear correlation bewteen early onset of symptoms and very high repeat number was seen, but the spread of the age-at-onset in themore » major repeat range producing characteristic HD it too wide to be of diagnostic value. There was also variability in the transmitted repeat size for both sexes in the HD size range. Maternal HD alleles showed a moderate instability with a preponderance of size decrease, while paternal HD alleles had a tendency to increase in repeat size on transmission, the degree of which appeared proportional to the initial size.« less
Robust edge states in amorphous gyromagnetic photonic lattices
NASA Astrophysics Data System (ADS)
Mansha, Shampy; Chong, Y. D.
2017-09-01
We numerically study amorphous analogs of a two-dimensional photonic Chern insulator. The amorphous lattices consist of gyromagnetic rods that break time-reversal symmetry, with the lattice sites generated by a close-packing algorithm. The level of short-range order is adjustable, and there is no long-range order. The topologically nontrivial gaps of the photonic Chern insulator are found to persist into the amorphous regime, so long as there is sufficient short-range order. Strongly nonreciprocal robust transmission occurs via edge states, which are shown to propagate ballistically despite the absence of long-range order, and to be exponentially localized along the lattice edge. Interestingly, there is an enhancement of nonreciprocal transmission even at very low levels of short-range order, where there are no discernible spectral gaps.
Numerical modeling of the transmission dynamics of drug-sensitive and drug-resistant HSV-2
NASA Astrophysics Data System (ADS)
Gumel, A. B.
2001-03-01
A competitive finite-difference method will be constructed and used to solve a modified deterministic model for the spread of herpes simplex virus type-2 (HSV-2) within a given population. The model monitors the transmission dynamics and control of drug-sensitive and drug-resistant HSV-2. Unlike the fourth-order Runge-Kutta method (RK4), which fails when the discretization parameters exceed certain values, the novel numerical method to be developed in this paper gives convergent results for all parameter values.
Geologic history and hydrogeologic setting of the Edwards-Trinity aquifer system, west-central Texas
Barker, R.A.; Bush, P.W.; Baker, E.T.
1994-01-01
Because the diagenetic effects of cementation, recrystallization, and mineral replacement diminish the hydraulic conductivity of most rocks composing the Trinity and Edwards-Trinity aquifers, transmissivity values average less than 10,000 feet squared per day over more than 90 percent of the study area. However, the effects of tectonic fractures and dissolution in the Balcones fault zone cause transmissivity values to average about 750,000 feet squared per day in the Edwards aquifer, which occupies less than 10 percent of the study area.
NASA Astrophysics Data System (ADS)
Andrianova, Olga; Lomakov, Gleb; Manturov, Gennady
2017-09-01
The neutron transmission experiments are one of the main sources of information about the neutron cross section resonance structure and effect in the self-shielding. Such kind of data for niobium and silicon nuclides in energy range 7 keV to 3 MeV can be obtained from low-resolution transmission measurements performed earlier in Russia (with samples of 0.027 to 0.871 atom/barn for niobium and 0.076 to 1.803 atom/barn for silicon). A significant calculation-to-experiment discrepancy in energy range 100 to 600 keV and 300 to 800 keV for niobium and silicon, respectively, obtained using the evaluated nuclear data library ROSFOND, were found. The EVPAR code was used for estimation the average resonance parameters in energy range 7 to 600 keV for niobium. For silicon a stochastic optimization method was used to modify the resolved resonance parameters in energy range 300 to 800 keV. The improved ROSFOND evaluated nuclear data files were tested in calculation of ICSBEP integral benchmark experiments.
Hoferer, Marc; Braun, Anne; Sting, Reinhard
2017-07-01
Standards are pivotal for pathogen quantification by real-time PCR (qPCR); however, the creation of a complete and universally applicable virus particle standard is challenging. In the present study a procedure based on purification of bovine herpes virus type 1 (BoHV-1) and subsequent quantification by transmission electron microscopy (TEM) is described. Accompanying quantitative quality controls of the TEM preparation procedure using qPCR yielded recovery rates of more than 95% of the BoHV-1 virus particles on the grid used for virus counting, which was attributed to pre-treatment of the grid with 5% bovine albumin. To compare the value of the new virus particle standard for use in qPCR, virus counter based quantification and established pure DNA standards represented by a plasmid and an oligonucleotide were included. It could be shown that the numbers of virus particles, plasmid and oligonucleotide equivalents were within one log10 range determined on the basis of standard curves indicating that different approaches provide comparable quantitative values. However, only virus particles represent a complete, universally applicable quantitative virus standard that meets the high requirements of an RNA and DNA virus gold standard. In contrast, standards based on pure DNA have to be considered as sub-standard due to limited applications. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
A Chemical Alphabet for Macromolecular Communications.
Giannoukos, Stamatios; McGuiness, Daniel Tunç; Marshall, Alan; Smith, Jeremy; Taylor, Stephen
2018-06-08
Molecular communications in macroscale environments is an emerging field of study driven by the intriguing prospect of sending coded information over olfactory networks. For the first time, this article reports two signal modulation techniques (on-off keying-OOK, and concentration shift keying-CSK) which have been used to encode and transmit digital information using odors over distances of 1-4 m. Molecular transmission of digital data was experimentally investigated for the letter "r" with a binary value of 01110010 (ASCII) for a gas stream network channel (up to 4 m) using mass spectrometry (MS) as the main detection-decoding system. The generation and modulation of the chemical signals was achieved using an automated odor emitter (OE) which is based on the controlled evaporation of a chemical analyte and its diffusion into a carrier gas stream. The chemical signals produced propagate within a confined channel to reach the demodulator-MS. Experiments were undertaken for a range of volatile organic compounds (VOCs) with different diffusion coefficient values in air at ambient conditions. Representative compounds investigated include acetone, cyclopentane, and n-hexane. For the first time, the binary code ASCII (American Standard Code for Information Interchange) is combined with chemical signaling to generate a molecular representation of the English alphabet. Transmission experiments of fixed-width molecular signals corresponding to letters of the alphabet over varying distances are shown. A binary message corresponding to the word "ion" was synthesized using chemical signals and transmitted within a physical channel over a distance of 2 m.
Bordetella pertussis transmission
Trainor, Elizabeth A.; Nicholson, Tracy L.; Merkel, Tod J.
2015-01-01
Bordetella pertussis and B. bronchiseptica are Gram-negative bacterial respiratory pathogens. Bordetella pertussis is the causative agent of whooping cough and is considered a human-adapted variant of B. bronchiseptica. Bordetella pertussis and B. bronchiseptica share mechanisms of pathogenesis and are genetically closely related. However, despite the close genetic relatedness, these Bordetella species differ in several classic fundamental aspects of bacterial pathogens such as host range, pathologies and persistence. The development of the baboon model for the study of B. pertussis transmission, along with the development of the swine and mouse model for the study of B. bronchiseptica, has enabled the investigation of different aspects of transmission including the route, attack rate, role of bacterial and host factors, and the impact of vaccination on transmission. This review will focus on B. pertussis transmission and how animal models of B. pertussis transmission and transmission models using the closely related B. bronchiseptica have increased our understanding of B. pertussis transmission. PMID:26374235
Bengtsson, Linus; Lu, Xin; Liljeros, Fredrik; Thanh, Hoang Huy; Thorson, Anna
2014-01-15
Survey data from men who have sex with men (MSM) in Asian cities indicate ongoing and drastic increases in HIV prevalence. It is unknown which behavioural factors are most important in driving these epidemics. We aimed to analyse detailed sexual behaviour data among MSM in Vietnam and to model HIV transmission using improved assumptions on sexual network structure. Vietnam. Internet-using men who had ever had sex (any type) with a man, aged ≥18 years and living in Vietnam. The study was cross-sectional, population-based and performed in 2012, using online respondent-driven sampling. The Internet-based survey instrument was completed by 982 participants, of which 857 were eligible. Questions included sociodemography and retrospective sexual behaviour, including number of unprotected anal sex (UAS) acts per partner. Estimated basic reproductive number over 3 months as a function of transmission risk per UAS act; frequency distributions of number of UAS partners and UAS acts during last 3 months. 36% (CI 32% to 42%) reported UAS at least once during the last 3 months. 36% (CI 32% to 41%) had ever taken an HIV test and received the result. UAS partner numbers and number of UAS acts were both highly skewed and positively correlated. Using a weighted configuration model, taking into account partner numbers, frequency of UAS and their correlations, we estimated the basic reproductive number (R0) over 3 months. The results indicated rapid transmission over a wide range of values of per-act transmissibility. Men with multiple partners had unexpectedly high UAS frequency per partner, paired with low HIV testing rates. The study highlights the importance of collecting data on frequency of UAS acts and indicates the need to rapidly scale-up HIV prevention services and testing opportunities for MSM in Vietnam.
Hybrid dispersive media with controllable wave propagation: A new take on smart materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bergamini, Andrea E., E-mail: andrea.bergamini@empa.ch; Zündel, Manuel; Flores Parra, Edgar A.
In this paper, we report on the wave transmission characteristics of a hybrid one dimensional (1D) medium. The hybrid characteristic is the result of the coupling between a 1D mechanical waveguide in the form of an elastic beam, supporting the propagation of transverse waves and a discrete electrical transmission line, consisting of a series of inductors connected to ground through capacitors. The capacitors correspond to a periodic array of piezoelectric patches that are bonded to the beam and that couple the two waveguides. The coupling leads to a hybrid medium that is characterized by a coincidence condition for the frequency/wavenumbermore » value corresponding to the intersection of the branches of the two waveguides. In the frequency range centered at coincidence, the hybrid medium features strong attenuation of wave motion as a result of the energy transfer towards the electrical transmission line. This energy transfer, and the ensuing attenuation of wave motion, is alike the one obtained through internal resonating units of the kind commonly used in metamaterials. However, the distinct shape of the dispersion curves suggests how this energy transfer is not the result of a resonance and is therefore fundamentally different. This paper presents the numerical investigation of the wave propagation in the considered media, it illustrates experimental evidence of wave transmission characteristics and compares the performance of the considered configuration with that of internal resonating metamaterials. In addition, the ability to conveniently tune the dispersion properties of the electrical transmission line is exploited to adapt the periodicity of the domain and to investigate diatomic periodic configurations that are characterized by a richer dispersion spectrum and broader bandwidth of wave attenuation at coincidence. The medium consisting of mechanical, piezoelectric, and analog electronic elements can be easily interfaced to digital devices to offer a novel approach to smart materials.« less
NASA Astrophysics Data System (ADS)
Zammouri, Mounira; Ribeiro, Luis
2017-05-01
Groundwater flow model of the transboundary Saharan aquifer system is developed in 2003 and used for management and decision-making by Algeria, Tunisia and Libya. In decision-making processes, reliability plays a decisive role. This paper looks into the reliability assessment of the Saharan aquifers model. It aims to detect the shortcomings of the model considered properly calibrated. After presenting the calibration results of the effort modelling in 2003, the uncertainty in the model which arising from the lack of the groundwater level and the transmissivity data is analyzed using kriging technique and stochastic approach. The structural analysis of piezometry in steady state and logarithms of transmissivity were carried out for the Continental Intercalaire (CI) and the Complexe Terminal (CT) aquifers. The available data (piezometry and transmissivity) were compared to the calculated values, using geostatistics approach. Using a stochastic approach, 2500 realizations of a log-normal random transmissivity field of the CI aquifer has been performed to assess the errors of the model output, due to the uncertainty in transmissivity. Two types of bad calibration are shown. In some regions, calibration should be improved using the available data. In others areas, undertaking the model refinement requires gathering new data to enhance the aquifer system knowledge. Stochastic simulations' results showed that the calculated drawdowns in 2050 could be higher than the values predicted by the calibrated model.
ERIC Educational Resources Information Center
Briley, Daniel A.; Harden, K. Paige; Tucker-Drob, Elliot M.
2014-01-01
Parents' expectations for their children's ultimate educational attainment have been hypothesized to play an instrumental role in socializing academically relevant child behaviors, beliefs, and abilities. In addition to social transmission of educationally relevant values from parents to children, parental expectations and child…
Elastic behavior of brain simulants in comparison to porcine brain at different loading velocities.
Falland-Cheung, Lisa; Scholze, Mario; Hammer, Niels; Waddell, J Neil; Tong, Darryl C; Brunton, Paul A
2018-01-01
Blunt force impacts to the head and the resulting internal force transmission to the brain and other cranial tissue are difficult to measure. To model blunt force impact scenarios, the compressive properties resembling tissue elasticity are of importance. Therefore, this study investigated and compared the elastic behavior of gelatin, alginate, agar/glycerol and agar/glycerol/water simulant materials to that of porcine brain in a fresh and unfixed condition. Specimens, 10 × 10 × 10mm 3 , were fabricated and tested at 22°C, apart from gelatin which was conditioned to 4°C prior to testing. For comparison, fresh porcine brains were sourced and prepared to the same dimensions as the simulants. Specimens underwent compression tests at crosshead displacement rates of 2.5, 10 and 16mms -1 (equivalent to strain rates of 0.25, 1 and 1.6s -1 ), obtaining apparent elastic moduli values at different strain rate intervals (0-0.2, 0.2-0.4 and 0.4-0.5). The results of this study indicate that overall all simulant materials had an apparent elastic moduli similar in magnitude across all strain ranges compared to brain, even though comparatively higher, especially the apparent elastic moduli values of alginate. In conclusion, while agar/glycerol/water and agar/glycerol had similar apparent elastic moduli in magnitude and the closest apparent elastic moduli in the initial strain range (E 1 ), gelatin showed the most similar values to fresh porcine brain at the transitional (E 2 ) and higher strain range (E 3 ). The simulant materials and the fresh porcine brain exhibited strain rate dependent behavior, with increasing elastic moduli upon increasing loading velocities. Copyright © 2017 Elsevier Ltd. All rights reserved.
Code of Federal Regulations, 2011 CFR
2011-01-01
... INSULATION 460.5 R-value tests. R-value measures resistance to heat flow. R-values given in labels, fact...) All types of insulation except aluminum foil must be tested with ASTM C 177-04, “Standard Test Method for Steady-State Heat Flux Measurements and Thermal Transmission Properties by Means of the Guarded...
Code of Federal Regulations, 2010 CFR
2010-01-01
... INSULATION 460.5 R-value tests. R-value measures resistance to heat flow. R-values given in labels, fact...) All types of insulation except aluminum foil must be tested with ASTM C 177-04, “Standard Test Method for Steady-State Heat Flux Measurements and Thermal Transmission Properties by Means of the Guarded...
Code of Federal Regulations, 2012 CFR
2012-01-01
... INSULATION 460.5 R-value tests. R-value measures resistance to heat flow. R-values given in labels, fact...) All types of insulation except aluminum foil must be tested with ASTM C 177-04, “Standard Test Method for Steady-State Heat Flux Measurements and Thermal Transmission Properties by Means of the Guarded...
Code of Federal Regulations, 2013 CFR
2013-01-01
... INSULATION 460.5 R-value tests. R-value measures resistance to heat flow. R-values given in labels, fact...) All types of insulation except aluminum foil must be tested with ASTM C 177-04, “Standard Test Method for Steady-State Heat Flux Measurements and Thermal Transmission Properties by Means of the Guarded...
Code of Federal Regulations, 2014 CFR
2014-01-01
... INSULATION 460.5 R-value tests. R-value measures resistance to heat flow. R-values given in labels, fact...) All types of insulation except aluminum foil must be tested with ASTM C 177-04, “Standard Test Method for Steady-State Heat Flux Measurements and Thermal Transmission Properties by Means of the Guarded...
1991-05-06
Phys- (loosely) Quantum Chaos Theory entific Paradigm ics - atomistic move- ments Value Claims transmutes values value isolated into Values incorporat...infant care 3. immunizations 4. sexually transmissible disease services 5. high blood pressure control 6. toxic agent control 7. occupational safety and
Design and tolerance analysis of a transmission sphere by interferometer model
NASA Astrophysics Data System (ADS)
Peng, Wei-Jei; Ho, Cheng-Fong; Lin, Wen-Lung; Yu, Zong-Ru; Huang, Chien-Yao; Hsu, Wei-Yao
2015-09-01
The design of a 6-in, f/2.2 transmission sphere for Fizeau interferometry is presented in this paper. To predict the actual performance during design phase, we build an interferometer model combined with tolerance analysis in Zemax. Evaluating focus imaging is not enough for a double pass optical system. Thus, we study the interferometer model that includes system error, wavefronts reflected from reference surface and tested surface. Firstly, we generate a deformation map of the tested surface. Because of multiple configurations in Zemax, we can get the test wavefront and the reference wavefront reflected from the tested surface and the reference surface of transmission sphere respectively. According to the theory of interferometry, we subtract both wavefronts to acquire the phase of tested surface. Zernike polynomial is applied to transfer the map from phase to sag and to remove piston, tilt and power. The restored map is the same as original map; because of no system error exists. Secondly, perturbed tolerances including fabrication of lenses and assembly are considered. The system error occurs because the test and reference beam are no longer common path perfectly. The restored map is inaccurate while the system error is added. Although the system error can be subtracted by calibration, it should be still controlled within a small range to avoid calibration error. Generally the reference wavefront error including the system error and the irregularity of the reference surface of 6-in transmission sphere is measured within peak-to-valley (PV) 0.1 λ (λ=0.6328 um), which is not easy to approach. Consequently, it is necessary to predict the value of system error before manufacture. Finally, a prototype is developed and tested by a reference surface with PV 0.1 λ irregularity.
Pasler, Marlies; Michel, Kilian; Marrazzo, Livia; Obenland, Michael; Pallotta, Stefania; Björnsgard, Mari; Lutterbach, Johannes
2017-09-01
The purpose of this study was to characterize a new single large-area ionization chamber, the integral quality monitor system (iRT, Germany), for online and real-time beam monitoring. Signal stability, monitor unit (MU) linearity and dose rate dependence were investigated for static and arc deliveries and compared to independent ionization chamber measurements. The dose verification capability of the transmission detector system was evaluated by comparing calculated and measured detector signals for 15 volumetric modulated arc therapy plans. The error detection sensitivity was tested by introducing MLC position and linac output errors. Deviations in dose distributions between the original and error-induced plans were compared in terms of detector signal deviation, dose-volume histogram (DVH) metrics and 2D γ-evaluation (2%/2 mm and 3%/3 mm). The detector signal is linearly dependent on linac output and shows negligible (<0.4%) dose rate dependence up to 460 MU min -1 . Signal stability is within 1% for cumulative detector output; substantial variations were observed for the segment-by-segment signal. Calculated versus measured cumulative signal deviations ranged from -0.16%-2.25%. DVH, mean 2D γ-value and detector signal evaluations showed increasing deviations with regard to the respective reference with growing MLC and dose output errors; good correlation between DVH metrics and detector signal deviation was found (e.g. PTV D mean : R 2 = 0.97). Positional MLC errors of 1 mm and errors in linac output of 2% were identified with the transmission detector system. The extensive tests performed in this investigation show that the new transmission detector provides a stable and sensitive cumulative signal output and is suitable for beam monitoring during patient treatment.
NASA Astrophysics Data System (ADS)
Pasler, Marlies; Michel, Kilian; Marrazzo, Livia; Obenland, Michael; Pallotta, Stefania; Björnsgard, Mari; Lutterbach, Johannes
2017-09-01
The purpose of this study was to characterize a new single large-area ionization chamber, the integral quality monitor system (iRT, Germany), for online and real-time beam monitoring. Signal stability, monitor unit (MU) linearity and dose rate dependence were investigated for static and arc deliveries and compared to independent ionization chamber measurements. The dose verification capability of the transmission detector system was evaluated by comparing calculated and measured detector signals for 15 volumetric modulated arc therapy plans. The error detection sensitivity was tested by introducing MLC position and linac output errors. Deviations in dose distributions between the original and error-induced plans were compared in terms of detector signal deviation, dose-volume histogram (DVH) metrics and 2D γ-evaluation (2%/2 mm and 3%/3 mm). The detector signal is linearly dependent on linac output and shows negligible (<0.4%) dose rate dependence up to 460 MU min-1. Signal stability is within 1% for cumulative detector output; substantial variations were observed for the segment-by-segment signal. Calculated versus measured cumulative signal deviations ranged from -0.16%-2.25%. DVH, mean 2D γ-value and detector signal evaluations showed increasing deviations with regard to the respective reference with growing MLC and dose output errors; good correlation between DVH metrics and detector signal deviation was found (e.g. PTV D mean: R 2 = 0.97). Positional MLC errors of 1 mm and errors in linac output of 2% were identified with the transmission detector system. The extensive tests performed in this investigation show that the new transmission detector provides a stable and sensitive cumulative signal output and is suitable for beam monitoring during patient treatment.
Hoffmann, John P.; Carruth, Rob; Meyer, William
1998-01-01
A study of the geology, ground-water occurrence, and estimated well yields from the Mariana Limestone was done to investigate ground-water availability in the Kagman area, Saipan. The Mariana and Tagpochau Limestone formations form the major aquifer in the Kagman drainage basin. The Mariana Limestone, which is the major water-bearing unit in the Kagman area, ranges in thickness from 300 to 500 feet and contains intermittent, thin clay stringers. The calcareous rocks of the Tagpochau Limestone range in thickness from 500 to 1,000 feet and are more sandy than those of the Mariana Limestone. Ground water is unconfined in the Mariana Limestone and ranges from unconfined to confined in the Tagpochau Limestone. The fresh ground-water lens (that part of the lens with less than 2-percent of the chloride-ion concentration in seawater) in the Mariana Limestone is relatively thin, ranging from about 15 to 21 feet. Altitude of the water table ranges from about 1.5 to 2.5 feet above mean sea level. Freshwater in the Mariana Limestone is underlain by seawater and is separated by a transition zone about 8 to 25 feet thick. Hydraulic conductivity and transmissivity of the Mariana Limestone were calculated from data collected at six test wells. Using the Newman method, estimated hydraulic conductivity and transmissivity range from 290 to 2,500 feet per day and 7,600 to 62,000 feet squared per day, respectively. The higher values probably are indicative of average conditions in the Mariana Limestone. The estimated storage coefficient of the Mariana Limestone is about 0.1. The availability of water from the Mariana Limestone is restricted by the thinness of the freshwater lens. Results of the study indicate that fresh ground water can be obtained from the Mariana Limestone when wells are designed for minimum drawdown, effectively skimming freshwater from the top of the lens. Wells that are shallow, widely spaced, and pumped at low uniform rates can prevent saltwater intrusion. Calculated long-term yields of wells are about 30 gallons per minute or less for potable water.
Multicarrier airborne ultrasound transmission with piezoelectric transducers.
Ens, Alexander; Reindl, Leonhard M
2015-05-01
In decentralized localization systems, the received signal has to be assigned to the sender. Therefore, longrange airborne ultrasound communication enables the transmission of an identifier of the sender within the ultrasound signal to the receiver. Further, in areas with high electromagnetic noise or electromagnetic free areas, ultrasound communication is an alternative. Using code division multiple access (CDMA) to transmit data is ineffective in rooms due to high echo amplitudes. Further, piezoelectric transducers generate a narrow-band ultrasound signal, which limits the data rate. This work shows the use of multiple carrier frequencies in orthogonal frequency division multiplex (OFDM) and differential quadrature phase shift keying modulation with narrowband piezoelectric devices to achieve a packet length of 2.1 ms. Moreover, the adapted channel coding increases data rate by correcting transmission errors. As a result, a 2-carrier ultrasound transmission system on an embedded system achieves a data rate of approximately 5.7 kBaud. Within the presented work, a transmission range up to 18 m with a packet error rate (PER) of 13% at 10-V supply voltage is reported. In addition, the transmission works up to 22 m with a PER of 85%. Moreover, this paper shows the accuracy of the frame synchronization over the distance. Consequently, the system achieves a standard deviation of 14 μs for ranges up to 10 m.
Zoonotic Transmission of Waterborne Disease: A Mathematical Model.
Waters, Edward K; Hamilton, Andrew J; Sidhu, Harvinder S; Sidhu, Leesa A; Dunbar, Michelle
2016-01-01
Waterborne parasites that infect both humans and animals are common causes of diarrhoeal illness, but the relative importance of transmission between humans and animals and vice versa remains poorly understood. Transmission of infection from animals to humans via environmental reservoirs, such as water sources, has attracted attention as a potential source of endemic and epidemic infections, but existing mathematical models of waterborne disease transmission have limitations for studying this phenomenon, as they only consider contamination of environmental reservoirs by humans. This paper develops a mathematical model that represents the transmission of waterborne parasites within and between both animal and human populations. It also improves upon existing models by including animal contamination of water sources explicitly. Linear stability analysis and simulation results, using realistic parameter values to describe Giardia transmission in rural Australia, show that endemic infection of an animal host with zoonotic protozoa can result in endemic infection in human hosts, even in the absence of person-to-person transmission. These results imply that zoonotic transmission via environmental reservoirs is important.
Motivations and contents of parent-child value transmission.
Barni, Daniela; Donato, Silvia; Rosnati, Rosa; Danioni, Francesca
2017-01-01
This study focused on parents' motivations to transmit values to their adolescent children. According to Self-Determination Theory, controlled motivations (i.e., external and introjected)-which refer to doing something because it leads to approval or rewards-and autonomous motivations (i.e., identified and integrated)-which refer to doing something because it is perceived as inherently worthy-were examined. 325 Italian parental couples, with one child aged between 14 and 18 years, filled out a self-report questionnaire. Results showed that in value transmission, both parents were primarily moved by autonomous motivations, although for fathers, external motivations were more important than for mothers. Both paternal and maternal motivations resulted to be related with the values parents would like their children to endorse. In particular, the more parents felt volitional in transmitting values, the more they gave importance to self-transcendence in their children's socialization; the more parents were guided by controlled motivations, the more they would like their children to endorse conservation values. Implications of this research and its possible developments are discussed.
Analysis of soft x-ray/VUV transmission characteristics of Si and Al filters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Joseph, Aby; Modi, Mohammed H.; Singh, Amol
Ultrathin filters of Al (1500A) and Si (1200A) should exhibit more than 65% transmission above their Labsorption edges in the soft x-ray/vacuum ultra violet region(Si L-edge: 124 A and Al L-edge: 170 A). However, the measured transmission characteristics of these filters showed {approx}40% transmission. The transmission measurements of these filters were carried at the reflectivity beamline of Indus-1 synchrotron source out over a large wavelength range of 120-360A. In order to understand the measured transmission performance a detailed model fitting is performed using the Paratt formalism. It is found that the oxidation of the surface region of the filters ismore » responsible for the reduced transmission performance. Effects of higher harmonics of the toroidal grating monochromator are also considered in the data analysis.« less
Paynter, Stuart; Yakob, Laith; Simões, Eric A. F.; Lucero, Marilla G.; Tallo, Veronica; Nohynek, Hanna; Ware, Robert S.; Weinstein, Philip; Williams, Gail; Sly, Peter D.
2014-01-01
We used a mathematical transmission model to estimate when ecological drivers of respiratory syncytial virus (RSV) transmissibility would need to act in order to produce the observed seasonality of RSV in the Philippines. We estimated that a seasonal peak in transmissibility would need to occur approximately 51 days prior to the observed peak in RSV cases (range 49 to 67 days). We then compared this estimated seasonal pattern of transmissibility to the seasonal patterns of possible ecological drivers of transmissibility: rainfall, humidity and temperature patterns, nutritional status, and school holidays. The timing of the seasonal patterns of nutritional status and rainfall were both consistent with the estimated seasonal pattern of transmissibility and these are both plausible drivers of the seasonality of RSV in this setting. PMID:24587222
Effective seat-to-head transmissibility in whole-body vibration: Effects of posture and arm position
NASA Astrophysics Data System (ADS)
Rahmatalla, Salam; DeShaw, Jonathan
2011-12-01
Seat-to-head transmissibility is a biomechanical measure that has been widely used for many decades to evaluate seat dynamics and human response to vibration. Traditionally, transmissibility has been used to correlate single-input or multiple-input with single-output motion; it has not been effectively used for multiple-input and multiple-output scenarios due to the complexity of dealing with the coupled motions caused by the cross-axis effect. This work presents a novel approach to use transmissibility effectively for single- and multiple-input and multiple-output whole-body vibrations. In this regard, the full transmissibility matrix is transformed into a single graph, such as those for single-input and single-output motions. Singular value decomposition and maximum distortion energy theory were used to achieve the latter goal. Seat-to-head transmissibility matrices for single-input/multiple-output in the fore-aft direction, single-input/multiple-output in the vertical direction, and multiple-input/multiple-output directions are investigated in this work. A total of ten subjects participated in this study. Discrete frequencies of 0.5-16 Hz were used for the fore-aft direction using supported and unsupported back postures. Random ride files from a dozer machine were used for the vertical and multiple-axis scenarios considering two arm postures: using the armrests or grasping the steering wheel. For single-input/multiple-output, the results showed that the proposed method was very effective in showing the frequencies where the transmissibility is mostly sensitive for the two sitting postures and two arm positions. For multiple-input/multiple-output, the results showed that the proposed effective transmissibility indicated higher values for the armrest-supported posture than for the steering-wheel-supported posture.
Unravelling Responses for the Canadian National Seismic Network
NASA Astrophysics Data System (ADS)
Mulder, T. L.
2009-12-01
There are a number of attendant difficulties any network must deal with that range from defining the transfer function to instrument naming conventions to choices of final local file format representation. These choices ultimately result in the ease of conversion to other data formats and therefore directly impact useability. In particular, the ease of data exhange and use of established software that is dependent on standard data types is impacted. This becomes particularly critical with large (terabyte) dataset processing and when integrating external datasets into analysis procedures. Transfer functions, often referred to as instrument responses, are a key component in describing instrumentation. The transfer function describes the complete response of the seismic system. The seismic system is designed to be a linear system that can be decomposed into discrete components. Analogue or digital convolution can be represented as multiplication in the frequency domain. The two basic elements of a seismic system are the sensor and datalogger. The analogue sensor can be represented mathmatically as poles and zeroes. The datalogger can be further broken down into its discrete analogue and digital components: the preamp, A/D converter, and fir filters. The Canadian seismic network (CNSN) digitizers have an additional complication. To save telemetry band-width, the 32 bit signal from the digitizer has a transmission gain removed. The transmission gain (txgain) represents the number of the least significant bits truncated from the sample (2^txgain) after which the data is compressed and transmitted. While telemetry band-width is not the issue it was, now that many sites have ip connectivity, this user programmable transmission gain is still in use and can vary from station to station. The processes receiving the transmitted data do not restore the pre-transmission scaling, consequently the archived waveform files can vary in bit weight over time from station to station depending on the value of the transmission gain. Consequently the transmission gain must be factored into the transfer function. This presentation describes the process for generating the transfer function based on the constituent components discussed here. A matlab routine run on the database generates the transfer function plots for the network.
Spinocerebellar ataxia type 7.
Martin, Jean-Jacques
2012-01-01
Spinocerebellar ataxia type 7 (SCA7) is associated with progressive blindness, dominant transmission, and marked anticipation. SCA7 represents one of the polyglutamine expansion diseases with increase of CAG repeats. The gene maps to chromosome 3p12-p21.1. Normal values of CAG repeats range from 4 to 18. The SCA7 gene encodes a protein of largely unknown function, called ataxin-7. SCA7 is reported in many countries and ethnic groups. Its phenotypic expression depends on the number of expanded repeats. The infantile phenotype is very severe, with more than 100 repeats. The classic type has 50 to 55 repeats and is characterized by a combination of visual and ataxic disturbances lasting for 20-40 years.When the number of CAG repeats is between 36 and 43, the evolution is much slower, with few or no retinal abnormalities. A CAG repeat number from 18 to 35 is asymptomatic but predisposes to the development of the disorder when expanding to the pathological range through transmission. The diagnosis is made by molecular genetics. The neuropathology of the disorder includes atrophy of the spinocerebellar pathways, pyramidal tracts, and motor nuclei in the brainstem and spinal cord, a cone-rod sytrophy of the retina, and ataxin-7 immunoreactive neuronal intranuclear inclusions. The neuropathological features vary as a function of the number of CAG repeats. Present research deals mainly with the study of ataxin-7 in transfected neural cells and transgenic mouse models. 2012 Elsevier B.V. All rights reserved.
Predicting Daily Insolation with Hourly Cloud Height and Coverage.
NASA Astrophysics Data System (ADS)
Meyers, T. P.; Dale, R. F.
1983-04-01
Solar radiation information is used in crop growth, boundary layer, entomological and plant pathological models, and in determining the potential use of active and passive solar energy systems. Yet solar radiation is among the least measured meteorological variables.A semi-physical model based on standard meteorological data was developed to estimate solar radiation received at the earth's surface. The radiation model includes the effects of Rayleigh scattering, absorption by water vapor and permanent gases, and absorption and scattering by aerosols and clouds. Cloud attenuation is accounted for by assigning transmission coefficients based on cloud height and amount. The cloud transmission coefficients for various heights and coverages were derived empirically from hourly observations of solar radiation in conjunction with corresponding cloud observations at West Lafayette, Indiana. The model was tested with independent data from West Lafayette and Indianapolis, Madison, WI, Omaha, NE, Columbia, MO, Nashville, TN, Seattle, WA, Los Angeles, CA, Phoenix, AZ, Lake Charles, LA, Miami, FL, and Sterling, VA. For each of these locations a 16% random sample of days was drawn within each of the 12 months in a year for testing the model. Excellent agreement between predicted and observed radiation values was obtained for all stations tested. Mean absolute errors ranged from 1.05 to 1.80 MJ m2 day1 and root-mean-square errors ranged from 1.31 to 2.32 MJ m2 day1. The model's performance judged by relative error was found to be independent of season and cloud amount for all locations tested.
What Do You Teach Here: Staff Development
ERIC Educational Resources Information Center
Richardson, Thomas E.
1975-01-01
The author maintains that college students are a key to value diffusion in our society and that student personnel workers hold unique opportunities in value transmission to students and, hence, to society. (Author/HMV)
ERIC Educational Resources Information Center
Roest, Annette M. C.; Dubas, Judith Semon; Gerris, Jan R. M.; Engels, Rutger C. M. E.
2009-01-01
In research on value similarity and transmission between parents and adolescents, no consensus exists on the level of value similarity. Reports of high-value similarities coexist with reports of low-value similarities within the family. The present study shows that different conclusions may be explained by the use of different measurement…
The basic reproductive ratio of Barbour's two-host schistosomiasis model with seasonal fluctuations.
Gao, Shu-Jing; Cao, Hua-Hua; He, Yu-Ying; Liu, Yu-Jiang; Zhang, Xiang-Yu; Yang, Guo-Jing; Zhou, Xiao-Nong
2017-01-25
Motivated by the first mathematical model for schistosomiasis proposed by Macdonald and Barbour's classical schistosomiasis model tracking the dynamics of infected human population and infected snail hosts in a community, in our previous study, we incorporated seasonal fluctuations into Barbour's model, but ignored the effect of bovine reservoir host in the transmission of schistosomiasis. Inspired by the findings from our previous work, the model was further improved by integrating two definitive hosts (human and bovine) and seasonal fluctuations, so as to understand the transmission dynamics of schistosomiasis japonica and evaluate the ongoing control measures in Liaonan village, Xingzi County, Jiangxi Province. The basic reproductive ratio R 0 and its computation formulae were derived by using the operator theory in functional analysis and the monodromy matrix theory. The mathematical methods for global dynamics of periodic systems were used in order to show that R 0 serves as a threshold value that determines whether there was disease outbreak or not. The parameter fitting and the ratio calculation were performed with surveillance data obtained from the village of Liaonan using numerical simulation. Sensitivity analysis was carried out in order to understand the impact of R 0 on seasonal fluctuations and snail host control. The modified basic reproductive ratios were compared with known results to illustrate the infection risk. The Barbour's two-host model with seasonal fluctuations was proposed. The implicit expression of R 0 for the model was given by the spectral radius of next infection operator. The R 0 s for the model ranged between 1.030 and 1.097 from 2003 to 2010 in the village of Liaonan, Xingzi County, China, with 1.097 recorded as the maximum value in 2005 but declined dramatically afterwards. In addition, we proved that the disease goes into extinction when R 0 is less than one and persists when R 0 is greater than one. Comparisons of the different improved models were also made. Based on the mechanism and characteristics of schistosomiasis transmission, Barbour's model was improved by considering seasonality. The implicit formula of R 0 for the model and its calculation were given. Theoretical results showed that R 0 gave a sharp threshold that determines whether the disease dies out or not. Simulations concluded that: (i) ignoring seasonality would overestimate the transmission risk of schistosomiasis, and (ii) mollusiciding is an effective control measure to curtail schistosomiasis transmission in Xingzi County when the removal rate of infected snails is small.
Simulation Analysis of Wireless Power Transmission System for Biomedical Applications
NASA Astrophysics Data System (ADS)
Yang, Zhao; Wei, Zhiqiang; Chi, Haokun; Yin, Bo; Cong, Yanping
2018-03-01
In recent years, more and more implantable medical devices have been used in the medical field. Some of these devices, such as brain pacemakers, require long-term power support. The WPT(wireless power transmission) technology which is more convenient and economical than replacing the battery by surgery, has become the first choice of many patients. In this paper, we design a WPT system that can be used in implantable medical devices, simulate the transmission efficiency of the system in the air and in the head model, and simulate the SAR value when the system working in the head model. The results show that when implantation depth of the secondary coil is 3 mm, the efficiency of the system can reach 45%, and the maximum average SAR value is 2.19 W / kg, slightly higher than the standard of IEEE.
Light transmission coefficients by subwavelength aluminum gratings with dielectric layers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blinov, L. M., E-mail: lev39blinov@gmail.com; Lazarev, V. V.; Yudin, S. G.
2016-11-15
Spectral positions of plasmon resonances related to boundaries between a thin aluminum layer and dielectrics (air, glass, VDF–TrFE 65/35 ferroelectric copolymer, and indium tin oxide (ITO)) have been determined in the transmission spectra of aluminum gratings of three types with 30 × 30 μm{sup 2} dimensions and 350-, 400-, and 450-nm line periods. Experimental results agree well with spectral positions of plasmon resonances calculated for the normal incidence of TM-polarized light. In addition, maximum values of transmission coefficients in the region of λ ≈ 900–950 nm have been determined for glass–Al–copolymer and glass–ITO–Al–copolymer structures. These values are close to 100%,more » which shows that the effective optical aperture is two times greater than the geometric areas of slits.« less
An overview of the Galileo Optical Experiment (GOPEX)
NASA Technical Reports Server (NTRS)
Wilson, K. E.; Lesh, J. R.
1993-01-01
Uplink optical communication to a deep-space vehicle was demonstrated. In the Galileo Optical Experiment (GOPEX), optical transmissions were beamed to the Galileo spacecraft by Earth-based transmitters at the Table Mountain Facility (TMF), California, and Starfire Optical Range (SOR), New Mexico. The demonstration took place over an eight-day period (9 Dec. through 16 Dec. 1992) as Galileo receded from Earth on its way to Jupiter, and covered ranges from 1-6 million km. At 6 million km (15 times the Earth-Moon distance), the laser beam transmitted from TMF eight days after Earth flyby covered the longest known range for transmission and detection.
Michaud, Mark; Leong, Thomas; Swiergon, Piotr; Juliano, Pablo; Knoerzer, Kai
2015-09-01
This work validated, in a higher frequency range, the theoretical predictions made by Boyle around 1930, which state that the optimal transmission of sound pressure through a metal plate occurs when the plate thickness equals a multiple of half the wavelength of the sound wave. Several reactor design parameters influencing the transmission of high frequency ultrasonic waves through a stainless steel plate were examined. The transmission properties of steel plates of various thicknesses (1-7 mm) were studied for frequencies ranging from 400 kHz to 2 MHz and at different distances between plates and transducers. It was shown that transmission of sound pressure through a steel plate showed high dependence of the thickness of the plate to the frequency of the sound wave (thickness ratio). Maximum sound pressure transmission of ∼ 60% of the incident pressure was observed when the ratio of the plate thickness to the applied frequency was a multiple of a half wavelength (2 MHz, 6mm stainless steel plate). In contrast, minimal sound pressure transmission (∼ 10-20%) was measured for thickness ratios that were not a multiple of a half wavelength. Furthermore, the attenuation of the sound pressure in the transmission region was also investigated. As expected, it was confirmed that higher frequencies have more pronounced sound pressure attenuation than lower frequencies. The spatial distribution of the sound pressure transmitted through the plate characterized by sonochemiluminescence measurements using luminol emission, supports the validity of the pressure measurements in this study. Copyright © 2015 Elsevier B.V. All rights reserved.
Qumar, Shamsul; Majid, Mohammad; Kumar, Narender; Tiwari, Sumeet K; Semmler, Torsten; Devi, Savita; Baddam, Ramani; Hussain, Arif; Shaik, Sabiha; Ahmed, Niyaz
2017-01-01
Some life-threatening, foodborne, and zoonotic infections are transmitted through poultry birds. Inappropriate and indiscriminate use of antimicrobials in the livestock industry has led to an increased prevalence of multidrug-resistant bacteria with epidemic potential. Here, we present a functional molecular epidemiological analysis entailing the phenotypic and whole-genome sequence-based characterization of 11 H. pullorum isolates from broiler and free-range chickens sampled from retail wet markets in Hyderabad City, India. Antimicrobial susceptibility tests revealed all of the isolates to be resistant to multiple antibiotic classes such as fluoroquinolones, cephalosporins, sulfonamides, and macrolides. The isolates were also found to be extended-spectrum β-lactamase producers and were even resistant to clavulanic acid. Whole-genome sequencing and comparative genomic analysis of these isolates revealed the presence of five or six well-characterized antimicrobial resistance genes, including those encoding a resistance-nodulation-division efflux pump(s). Phylogenetic analysis combined with pan-genome analysis revealed a remarkable degree of genetic diversity among the isolates from free-range chickens; in contrast, a high degree of genetic similarity was observed among broiler chicken isolates. Comparative genomic analysis of all publicly available H. pullorum genomes, including our isolates (n = 16), together with the genomes of 17 other Helicobacter species, revealed a high number (8,560) of H. pullorum-specific protein-encoding genes, with an average of 535 such genes per isolate. In silico virulence screening identified 182 important virulence genes and also revealed high strain-specific gene content in isolates from free-range chickens (average, 34) compared to broiler chicken isolates. A significant prevalence of prophages (ranging from 1 to 9) and a significant presence of genomic islands (0 to 4) were observed in free-range and broiler chicken isolates. Taken together, these observations provide significant baseline data for functional molecular infection epidemiology of nonpyloric Helicobacter species such as H. pullorum by unraveling their evolution in chickens and their possible zoonotic transmission to humans. Globally, the poultry industry is expanding with an ever-growing consumer base for chicken meat. Given this, food-associated transmission of multidrug-resistant bacteria represents an important health care issue. Our study involves a critical baseline approach directed at genome sequence-based epidemiology and transmission dynamics of H. pullorum, a poultry pathogen having established zoonotic potential. We believe our studies would facilitate the development of surveillance systems that ensure the safety of food for humans and guide public health policies related to the use of antibiotics in animal feed in countries such as India. We sequenced 11 new genomes of H. pullorum as a part of this study. These genomes would provide much value in addition to the ongoing comparative genomic studies of helicobacters. Copyright © 2016 American Society for Microbiology.
NASA Astrophysics Data System (ADS)
Zhang, Sai; Xu, Bai-qiang; Cao, Wenwu
2018-03-01
We have investigated low-frequency forbidden transmission (LFT) of acoustic waves with frequency lower than the first Bragg bandgap in a solid-fluid superlattice (SFSL). LFT is formed when the acoustic planar wave impinges on the interface of a SFSL within a certain angle range. However, for the SFSL comprised of metallic material and water, the angle range of LFT is extremely narrow, which restricts its practical applications. The variation characteristics of the angle range have been comprehensively studied here by the control variable method. The results suggest that the filling ratio, layer number, wave velocity, and mass density of the constituent materials have a significant impact on the angle range. Based on our results, an effective strategy for obtaining LFT with a broad angle range is provided, which will be useful for potential applications of LFT in various devices, such as low frequency filters and subwavelength one-way diodes.
Varghese, Bright; Supply, Philip; Shoukri, Mohammed; Allix-Beguec, Caroline; Memish, Ziad; Abuljadayel, Naila; Al-Hakeem, Raafat; AlRabiah, Fahad; Al-Hajoj, Sahal
2013-01-01
Background Eastern province of Saudi Arabia is an industrial zone with large immigrant population and high level of tuberculosis case notification among immigrants. The impact of immigration and current trends of tuberculosis transmission among immigrants and autochthonous population in the region had not been investigated so far using molecular tools. Methodology During 2009- 2011, a total of 524 Mycobacterium tuberculosis isolates were collected from the central tuberculosis reference laboratory, representing an estimated 79.2% of the culture-positive tuberculosis cases over the study period in the province. These isolates were genotyped by using 24 locus-based MIRU-VNTR typing and spoligotyping followed by first line drug susceptibility testing. The molecular clustering profiles and phylogenetic diversity of isolates were determined and compared to the geographical origins of the patients. Principle Findings Genotyping showed an overall predominance of Delhi/CAS (29.4%), EAI (23.8%) and Ghana (13.3%) lineages, with slightly higher proportions of Delhi/CAS among autochthonous population (33.3 %) and EAI (30.9%) among immigrants. Rate of any drug resistance was 20.2% with 2.5% of multi-drug resistance. Strain cluster analysis indicated 42 clusters comprising 210 isolates, resulting in a calculated recent transmission index of 32.1%. Overall shared cluster ratio was 78.6% while 75.8% were shared between autochthonous population and immigrant population with a predominance of immigrants from South east Asia (40.7%). In contrast, cross national transmission within the immigrant population was limited (24.2%). Younger age (15-30- p value-0.043, 16-45, p value 0.030), Saudi nationality (p value-0.004) and South East Asian origin (p value-0.011) were identified as significant predisposing factors for molecular strain clustering. Conclusions The high proportion of molecular clusters shared among the autochthonous and immigrant populations suggests a high permeability of tuberculosis transmission between both populations in the province. These results prompt for the need to strengthen the current tuberculosis control strategies and surveillance programs. PMID:24147042
Kusano, Maggie; Caldwell, Curtis B
2014-07-01
A primary goal of nuclear medicine facility design is to keep public and worker radiation doses As Low As Reasonably Achievable (ALARA). To estimate dose and shielding requirements, one needs to know both the dose equivalent rate constants for soft tissue and barrier transmission factors (TFs) for all radionuclides of interest. Dose equivalent rate constants are most commonly calculated using published air kerma or exposure rate constants, while transmission factors are most commonly calculated using published tenth-value layers (TVLs). Values can be calculated more accurately using the radionuclide's photon emission spectrum and the physical properties of lead, concrete, and/or tissue at these energies. These calculations may be non-trivial due to the polyenergetic nature of the radionuclides used in nuclear medicine. In this paper, the effects of dose equivalent rate constant and transmission factor on nuclear medicine dose and shielding calculations are investigated, and new values based on up-to-date nuclear data and thresholds specific to nuclear medicine are proposed. To facilitate practical use, transmission curves were fitted to the three-parameter Archer equation. Finally, the results of this work were applied to the design of a sample nuclear medicine facility and compared to doses calculated using common methods to investigate the effects of these values on dose estimates and shielding decisions. Dose equivalent rate constants generally agreed well with those derived from the literature with the exception of those from NCRP 124. Depending on the situation, Archer fit TFs could be significantly more accurate than TVL-based TFs. These results were reflected in the sample shielding problem, with unshielded dose estimates agreeing well, with the exception of those based on NCRP 124, and Archer fit TFs providing a more accurate alternative to TVL TFs and a simpler alternative to full spectral-based calculations. The data provided by this paper should assist in improving the accuracy and tractability of dose and shielding calculations for nuclear medicine facility design.
NASA Astrophysics Data System (ADS)
Šimunović, Mara; Reić Ercegovac, Ina; Burušić, Josip
2018-06-01
The success of science education in classroom and out-of-school settings can be influenced by parents' behaviours and STEM-related values. The present study investigated pathways in parent-to-child transmission of STEM (science, technology, engineering, mathematics) values by examining at same time parents' values and behaviours, along with their children's perceptions of these parental influences. The study included 1071 students (Mage = 12.15) and the same number of their parents. Path analysis revealed that children's importance value of the STEM school fields was best explained by their perceptions of parental values and behaviours in STEM. On the other hand, parents' self-reported values and behaviours had a weak effect in predicting children's values, which can be explained by inaccurate children's perceptions of their parents. The results suggest that parents more easily convey beliefs about the utility than the attainment value of STEM. Namely, parents' utility value had a larger effect in predicting children's value, partly mediated through children's perception of parents' encouragement of STEM interests. The study highlights the role of children's perceptions of their parents' beliefs and behaviours and the importance of communicating STEM-related values within the family. Practical implications for parents and science educators are discussed.
A new method to estimate average hourly global solar radiation on the horizontal surface
NASA Astrophysics Data System (ADS)
Pandey, Pramod K.; Soupir, Michelle L.
2012-10-01
A new model, Global Solar Radiation on Horizontal Surface (GSRHS), was developed to estimate the average hourly global solar radiation on the horizontal surfaces (Gh). The GSRHS model uses the transmission function (Tf,ij), which was developed to control hourly global solar radiation, for predicting solar radiation. The inputs of the model were: hour of day, day (Julian) of year, optimized parameter values, solar constant (H0), latitude, and longitude of the location of interest. The parameter values used in the model were optimized at a location (Albuquerque, NM), and these values were applied into the model for predicting average hourly global solar radiations at four different locations (Austin, TX; El Paso, TX; Desert Rock, NV; Seattle, WA) of the United States. The model performance was assessed using correlation coefficient (r), Mean Absolute Bias Error (MABE), Root Mean Square Error (RMSE), and coefficient of determinations (R2). The sensitivities of parameter to prediction were estimated. Results show that the model performed very well. The correlation coefficients (r) range from 0.96 to 0.99, while coefficients of determination (R2) range from 0.92 to 0.98. For daily and monthly prediction, error percentages (i.e. MABE and RMSE) were less than 20%. The approach we proposed here can be potentially useful for predicting average hourly global solar radiation on the horizontal surface for different locations, with the use of readily available data (i.e. latitude and longitude of the location) as inputs.
A simulation analysis to characterize the dynamics of vaccinating behaviour on contact networks.
Perisic, Ana; Bauch, Chris T
2009-05-28
Human behavior influences infectious disease transmission, and numerous "prevalence-behavior" models have analyzed this interplay. These previous analyses assumed homogeneously mixing populations without spatial or social structure. However, spatial and social heterogeneity are known to significantly impact transmission dynamics and are particularly relevant for certain diseases. Previous work has demonstrated that social contact structure can change the individual incentive to vaccinate, thus enabling eradication of a disease under a voluntary vaccination policy when the corresponding homogeneous mixing model predicts that eradication is impossible due to free rider effects. Here, we extend this work and characterize the range of possible behavior-prevalence dynamics on a network. We simulate transmission of a vaccine-preventable infection through a random, static contact network. Individuals choose whether or not to vaccinate on any given day according to perceived risks of vaccination and infection. We find three possible outcomes for behavior-prevalence dynamics on this type of network: small final number vaccinated and final epidemic size (due to rapid control through voluntary ring vaccination); large final number vaccinated and significant final epidemic size (due to imperfect voluntary ring vaccination), and little or no vaccination and large final epidemic size (corresponding to little or no voluntary ring vaccination). We also show that the social contact structure enables eradication under a broad range of assumptions, except when vaccine risk is sufficiently high, the disease risk is sufficiently low, or individuals vaccinate too late for the vaccine to be effective. For populations where infection can spread only through social contact network, relatively small differences in parameter values relating to perceived risk or vaccination behavior at the individual level can translate into large differences in population-level outcomes such as final size and final number vaccinated. The qualitative outcome of rational, self interested behaviour under a voluntary vaccination policy can vary substantially depending on interactions between social contact structure, perceived vaccine and disease risks, and the way that individual vaccination decision-making is modelled.
QoSLight: a new quality of service FSO software
NASA Astrophysics Data System (ADS)
Chabane, Mourad; Alnaboulsi, Maher; Sizun, Herve; Bouchet, Olivier
2003-08-01
The atmospheric optical links (FSO) in visible and infrared wavelengths constitute an interesting alternative to creation of new transmission channels for the cordless phone, data-processing networks and high definition television. One finds a choice of varied manufacturers and they propose products whose performances are characterized by a raised rate of transmission, from 2 Mbps to 10 Gbps. But the announced ranges are very important, from 100 to 10,000 meters, in spite of the fact that many manufacturers try to indicate the possible ranges according to time, these indications completely miss standardization and are hardly exploitable because, generally, it is very difficult to know the percentage of time during which a value is reached or exceeded. Availability and reliability of a FSO link depend on used systems but also on climatic and atmospheric parameters such as rain, snow or fog. Library search underlined the lack of reliable data to be able to lay down, in a precise way, the statistical availability of such links, like one usually does for the radio transmission. Before to implement an effective FSO links, we need to know their availability and their reliability. It is the purpose of our study. Its finality is a software which integrate (1) Results of a library search (geometrical attenuation, aerosols, scintillation, environment light, etc), (2) English and French integrated surface weather data, hour per hour, over several years (1995-1999). The result is the presentation of this software, "QoSLight" (Quality of Service Light), making it possible to predict; starting from the data of equipment (power, wavelength, receiver sensibility), geographical situation of a site in France or England (geographical coordinates, altitude, height/ground) and climatic and atmospheric parameter (relative humidity, ground rugosity, albedo, solar radiation, etc) the availability of a FSO link for the following period (year, the most unfavourable month, 8am to 8pm period and 8 am period. The interruption probabilities for each type of attenuation are also mentioned (aerosols, scintillation, ambient solar light, rain, snow, etc).
NASA Astrophysics Data System (ADS)
Mikkelsen, T.; Alexandersen, S.; Astrup, P.; Champion, H. J.; Donaldson, A. I.; Dunkerley, F. N.; Gloster, J.; Sørensen, J. H.; Thykier-Nielsen, S.
2003-11-01
Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed domesticated and wild animals. The highly contagious nature of FMD is a reflection of the wide range of host species, the enormous quantities of virus liberated by infected animals, the range of excretions and secretions which can be infectious, the stability of the virus in the environment, the multiplicity of routes of infection and the very small doses of the virus that can initiate infection. One of the mechanisms of spread is the carriage of droplets and droplet nuclei exhaled in the breath of infected animals. Such spread can be rapid and extensive, and it is known in certain circumstances to have transmitted disease over a distance of several hundred kilometres. During the 2001 FMD epidemic in the United Kingdom (UK), atmospheric dispersion models were applied in real time in order to assess the potential for atmospheric dispersion of the disease. The operational value of such modelling is primarily to identify premises which may have been exposed so that the human resources for surveillance and disease control purposes are employed most effectively.
The paper describes the combined modelling techniques and presents the results obtained of detailed analyses performed during the early stages of the UK 2001 epidemic. This paper investigates the potential for disease spread in relation to two outbreaks (Burnside Farm, Heddon-on-the-Wall and Prestwick Hall Farm, Ponteland, Northumberland). A separate paper (Gloster et al., 2002) provides a more detailed analysis of the airborne disease transmission in the vicinity of Burnside Farm.
The combined results are consistent with airborne transmission of disease to livestock in the Heddon-on-the-Wall area. Local topography may have played a significant role in influencing the pattern of disease spread.
NASA Astrophysics Data System (ADS)
Mikkelsen, T.; Alexandersen, S.; Astrup, P.; Champion, H. J.; Donaldson, A. I.; Dunkerley, F. N.; Gloster, J.; Sørensen, J. H.; Thykier-Nielsen, S.
2003-02-01
Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed domesticated and wild animals. The highly contagious nature of FMD is a reflection of the wide range of host species, the enormous quantities of virus liberated by infected animals, the range of excretions and secretions which can be infectious, the stability of the virus in the environment, the multiplicity of routes of infection and the very small doses of the virus that can initiate infection. One of the mechanisms of spread is the carriage of droplets and droplet nuclei exhaled in the breath of infected animals. Such spread can be rapid and extensive, and it is known in certain circumstances to have transmitted disease over a distance of several hundred kilometres. During the 2001 FMD epidemic in the United Kingdom (UK), atmospheric dispersion models were applied in real time in order to assess the potential for atmospheric dispersion of the disease. The operational value of such modelling is primarily to identify premises which may have been exposed so that the human resources for surveillance and disease control purposes are employed most effectively. The paper describes the combined modelling techniques and presents the results obtained of detailed analyses performed during the early stages of the UK 2001 epidemic. This paper investigates the potential for disease spread in relation to two outbreaks (Burnside Farm, Heddon-on-the-Wall and Prestwick Hall Farm, Ponteland, Northumberland). A separate paper (Gloster et al., 2002) provides a more detailed analysis of the airborne disease transmission in the vicinity of Burnside Farm. The combined results are consistent with airborne transmission of disease to livestock in the Heddon-on-the Wall area. Local topography may have played a significant role in influencing the pattern of disease spread.
Mallampati, Divya; MacLean, Rachel L; Shapiro, Roger; Dabis, Francois; Engelsmann, Barbara; Freedberg, Kenneth A; Leroy, Valeriane; Lockman, Shahin; Walensky, Rochelle; Rollins, Nigel; Ciaranello, Andrea
2018-04-01
In 2010, the WHO recommended women living with HIV breastfeed for 12 months while taking antiretroviral therapy (ART) to balance breastfeeding benefits against HIV transmission risks. To inform the 2016 WHO guidelines, we updated prior research on the impact of breastfeeding duration on HIV-free infant survival (HFS) by incorporating maternal ART duration, infant/child mortality and mother-to-child transmission data. Using the Cost-Effectiveness of Preventing AIDS Complications (CEPAC)-Infant model, we simulated the impact of breastfeeding duration on 24-month HFS among HIV-exposed, uninfected infants. We defined "optimal" breastfeeding durations as those maximizing 24-month HFS. We varied maternal ART duration, mortality rates among breastfed infants/children, and relative risk of mortality associated with replacement feeding ("RRRF"), modelled as a multiplier on all-cause mortality for replacement-fed infants/children (range: 1 [no additional risk] to 6). The base-case simulated RRRF = 3, median infant mortality, and 24-month maternal ART duration. In the base-case, HFS ranged from 83.1% (no breastfeeding) to 90.2% (12-months breastfeeding). Optimal breastfeeding durations increased with higher RRRF values and longer maternal ART durations, but did not change substantially with variation in infant mortality rates. Optimal breastfeeding durations often exceeded the previous WHO recommendation of 12 months. In settings with high RRRF and long maternal ART durations, HFS is maximized when mothers breastfeed longer than the previously-recommended 12 months. In settings with low RRRF or short maternal ART durations, shorter breastfeeding durations optimize HFS. If mothers are supported to use ART for longer periods of time, it is possible to reduce transmission risks and gain the benefits of longer breastfeeding durations. © 2018 The Authors. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of the International AIDS Society.
A simulation analysis to characterize the dynamics of vaccinating behaviour on contact networks
2009-01-01
Background Human behavior influences infectious disease transmission, and numerous "prevalence-behavior" models have analyzed this interplay. These previous analyses assumed homogeneously mixing populations without spatial or social structure. However, spatial and social heterogeneity are known to significantly impact transmission dynamics and are particularly relevant for certain diseases. Previous work has demonstrated that social contact structure can change the individual incentive to vaccinate, thus enabling eradication of a disease under a voluntary vaccination policy when the corresponding homogeneous mixing model predicts that eradication is impossible due to free rider effects. Here, we extend this work and characterize the range of possible behavior-prevalence dynamics on a network. Methods We simulate transmission of a vaccine-prevetable infection through a random, static contact network. Individuals choose whether or not to vaccinate on any given day according to perceived risks of vaccination and infection. Results We find three possible outcomes for behavior-prevalence dynamics on this type of network: small final number vaccinated and final epidemic size (due to rapid control through voluntary ring vaccination); large final number vaccinated and significant final epidemic size (due to imperfect voluntary ring vaccination), and little or no vaccination and large final epidemic size (corresponding to little or no voluntary ring vaccination). We also show that the social contact structure enables eradication under a broad range of assumptions, except when vaccine risk is sufficiently high, the disease risk is sufficiently low, or individuals vaccinate too late for the vaccine to be effective. Conclusion For populations where infection can spread only through social contact network, relatively small differences in parameter values relating to perceived risk or vaccination behavior at the individual level can translate into large differences in population-level outcomes such as final size and final number vaccinated. The qualitative outcome of rational, self interested behaviour under a voluntary vaccination policy can vary substantially depending on interactions between social contact structure, perceived vaccine and disease risks, and the way that individual vaccination decision-making is modelled. PMID:19476616
Selariu, Anca; Powers, Jenny G; Nalls, Amy; Brandhuber, Monica; Mayfield, Amber; Fullaway, Stephenie; Wyckoff, Christy A; Goldmann, Wilfred; Zabel, Mark M; Wild, Margaret A; Hoover, Edward A; Mathiason, Candace K
2015-11-01
The presence of disease-associated prions in tissues and bodily fluids of chronic wasting disease (CWD)-infected cervids has received much investigation, yet little is known about mother-to-offspring transmission of CWD. Our previous work demonstrated that mother-to-offspring transmission is efficient in an experimental setting. To address the question of relevance in a naturally exposed free-ranging population, we assessed maternal and fetal tissues derived from 19 elk dam-calf pairs collected from free-ranging Rocky Mountain elk from north-central Colorado, a known CWD endemic region. Conventional immunohistochemistry identified three of 19 CWD-positive dams, whereas a more sensitive assay [serial protein misfolding cyclic amplification (sPMCA)] detected CWD prion seeding activity (PrPCWD) in 15 of 19 dams. PrPCWD distribution in tissues was widespread, and included the central nervous system (CNS), lymphoreticular system, and reproductive, secretory, excretory and adipose tissues. Interestingly, five of 15 sPMCA-positive dams showed no evidence of PrPCWD in either CNS or lymphoreticular system, sites typically assessed in diagnosing CWD. Analysis of fetal tissues harvested from the 15 sPMCA-positive dams revealed PrPCWD in 80 % of fetuses (12 of 15), regardless of gestational stage. These findings demonstrated that PrPCWD is more abundant in peripheral tissues of CWD-exposed elk than current diagnostic methods suggest, and that transmission of prions from mother to offspring may contribute to the efficient transmission of CWD in naturally exposed cervid populations.
Selariu, Anca; Powers, Jenny G.; Nalls, Amy; Brandhuber, Monica; Mayfield, Amber; Fullaway, Stephenie; Wyckoff, Christy A.; Goldmann, Wilfred; Zabel, Mark M.; Wild, Margaret A.; Hoover, Edward A.
2015-01-01
The presence of disease-associated prions in tissues and bodily fluids of chronic wasting disease (CWD)-infected cervids has received much investigation, yet little is known about mother-to-offspring transmission of CWD. Our previous work demonstrated that mother-to-offspring transmission is efficient in an experimental setting. To address the question of relevance in a naturally exposed free-ranging population, we assessed maternal and fetal tissues derived from 19 elk dam–calf pairs collected from free-ranging Rocky Mountain elk from north-central Colorado, a known CWD endemic region. Conventional immunohistochemistry identified three of 19 CWD-positive dams, whereas a more sensitive assay [serial protein misfolding cyclic amplification (sPMCA)] detected CWD prion seeding activity (PrPCWD) in 15 of 19 dams. PrPCWD distribution in tissues was widespread, and included the central nervous system (CNS), lymphoreticular system, and reproductive, secretory, excretory and adipose tissues. Interestingly, five of 15 sPMCA-positive dams showed no evidence of PrPCWD in either CNS or lymphoreticular system, sites typically assessed in diagnosing CWD. Analysis of fetal tissues harvested from the 15 sPMCA-positive dams revealed PrPCWD in 80 % of fetuses (12 of 15), regardless of gestational stage. These findings demonstrated that PrPCWD is more abundant in peripheral tissues of CWD-exposed elk than current diagnostic methods suggest, and that transmission of prions from mother to offspring may contribute to the efficient transmission of CWD in naturally exposed cervid populations. PMID:26358706
DeLorenzo, Matthew C; Yang, Kai; Li, Xinhua; Liu, Bob
2018-04-01
The purpose of the study was to measure, evaluate, and model the broad-beam x-ray transmission of the patient supports from representative modern fluoroscopy-guided interventional systems, for patient skin dose calculation. Broad-beam transmission was evaluated by varying incident angle, kVp, added copper (Cu) filter, and x-ray field size for three fluoroscopy systems: General Electric (GE) Innova 4100 with Omega V table and pad, Siemens Axiom Artis with Siemens tabletop "narrow" (CARD) table and pad, and Siemens Zeego with Trumpf TruSystem 7500 table and pad. Field size was measured on the table using a lead ruler for all setups in this study. Exposure rates were measured in service mode using a calibrated Radcal 10 × 6-60 ion chamber above the patient support at the assumed skin location. Broad-beam transmission factors were calculated by the ratio of air kerma rates measured with and without a patient support in the beam path. First, angle dependency was investigated on the GE system, with the chamber at isocenter, for angles of 0°, 15°, 30°, and 40°, for a variety of kVp, added Cu filters, and for two field sizes (small and large). Second, the broad-beam transmission factor at normal incidence was evaluated for all three fluoroscopes by varying kVp, added Cu filter, and field size (small, medium, and large). An analytical equation was created to fit the data as to maximize R 2 and minimize maximum percentage difference across all measurements for each system. For all patient supports, broad-beam transmission factor increased with field size, kVp, and added Cu filtration and decreased with incident angle. Oblique incidence measurements show that the transmission decreased by about 1%, 3%, and 6% for incident angles of 15°, 30°, and 40°, respectively. The broad-beam transmission factors at 0° for the table and table plus pad ranged from 0.73 to 0.96 and from 0.59 to 0.89, respectively. The GE and Siemens transmission factors were comparable, while the Trumpf transmission factors were the lowest. The data were successfully fitted to a function of angle, field size, kVp, and added Cu filtration using nine parameters, with an average R 2 value of 0.977 and maximum percentage difference of 4.08%. This study evaluated the broad-beam transmission for three representative fluoroscopy systems and their dependency on angle, kVp, added Cu filter, and field size. The comprehensive data provided for patient support transmission will facilitate accurate calculation of peak skin dose (PSD) and may potentially be integrated into real-time and retrospective dose monitoring with access to Radiation Dose Structured Reports (RDSR) and radiation event data. © 2018 American Association of Physicists in Medicine.
Boundary Control Systems, Assessment Remedial Investigation, Version 2. 1. Volume 1
1988-12-01
ALLUVIAL WELLS CALCULATED TRANSMISSIVITY VALUES. AND ALLUVIAL WELLS MONITORED. . FOR WATER LEVELS FY87 A.? WELL SITING RATIONALE 10 A-3 WELL COMPLETION...29 Contour Map of Transmissivity of the Alluvial Aquifer 3rd Quarter FY 1987 B-30 Potentiometric Surface, Denver Formation Sand Zone 4 3rd Quarter FY...Monitoring 2-10 2.2-2 Chemical Analysis - Task 25 Anal-tical Program ;-14 4.1-1 Transmissivity (T), Hydraulic Conductivity (K), and 4-12 Apparent Specific
Munoz, Francisco D.; Watson, Jean -Paul; Hobbs, Benjamin F.
2015-06-04
In this study, the anticipated magnitude of needed investments in new transmission infrastructure in the U.S. requires that these be allocated in a way that maximizes the likelihood of achieving society's goals for power system operation. The use of state-of-the-art optimization tools can identify cost-effective investment alternatives, extract more benefits out of transmission expansion portfolios, and account for the huge economic, technology, and policy uncertainties that the power sector faces over the next several decades.