System and method for air temperature control in an oxygen transport membrane based reactor
Kelly, Sean M
2016-09-27
A system and method for air temperature control in an oxygen transport membrane based reactor is provided. The system and method involves introducing a specific quantity of cooling air or trim air in between stages in a multistage oxygen transport membrane based reactor or furnace to maintain generally consistent surface temperatures of the oxygen transport membrane elements and associated reactors. The associated reactors may include reforming reactors, boilers or process gas heaters.
System and method for temperature control in an oxygen transport membrane based reactor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelly, Sean M.
A system and method for temperature control in an oxygen transport membrane based reactor is provided. The system and method involves introducing a specific quantity of cooling air or trim air in between stages in a multistage oxygen transport membrane based reactor or furnace to maintain generally consistent surface temperatures of the oxygen transport membrane elements and associated reactors. The associated reactors may include reforming reactors, boilers or process gas heaters.
NASA Astrophysics Data System (ADS)
Chen, Chun-Nan; Luo, Win-Jet; Shyu, Feng-Lin; Chung, Hsien-Ching; Lin, Chiun-Yan; Wu, Jhao-Ying
2018-01-01
Using a non-equilibrium Green’s function framework in combination with the complex energy-band method, an atomistic full-quantum model for solving quantum transport problems for a zigzag-edge graphene nanoribbon (zGNR) structure is proposed. For transport calculations, the mathematical expressions from the theory for zGNR-based device structures are derived in detail. The transport properties of zGNR-based devices are calculated and studied in detail using the proposed method.
Using GIS and Ahp for Planning Primer Transportation of Forest Products
NASA Astrophysics Data System (ADS)
Akay, A. E.; Yılmaz, B.
2017-11-01
Primer transportation is one of the most costly and time consuming forestry activities in extraction of timber from forest lands. Transportation methods are essentially determined based on terrain characteristics, especially ground slope. Besides, unsuitable machine selection and unplanned operations may cause ecological damages such as soil disturbance. Soil damage can lead to long term impacts on forest ecosystem. Thus, the optimum transportation methods should be determined by considering not only economic factors but also topographical factors and soil conditions. In recent decades, some of the advanced features of Geographical Information System (GIS) assist decision makers to solve such complex transportation problems with various constraints. In this study, it was aimed to plan forest transportation operation by using GIS integrated Analytical Hierarchy Process (AHP) method, considering ground slope, soil type, and available transportation equipment in the region. This method was implemented within the border of İnegöl Forest Enterprise Chief in the city of Bursa in Turkey. Alternative transportation method included cable system, chute system, skidder, and farm tractor. GIS-based method integrated with AHP found that skidder was the optimal transportation method for about 60% of the study area, while farm tractor was the second most suitable method with 25% ground cover. The results indicated that GIS-based decision support systems can be effectively used as rational, quick, and economic tool for forest transportation planning.
Evaluation of finite difference and FFT-based solutions of the transport of intensity equation.
Zhang, Hongbo; Zhou, Wen-Jing; Liu, Ying; Leber, Donald; Banerjee, Partha; Basunia, Mahmudunnabi; Poon, Ting-Chung
2018-01-01
A finite difference method is proposed for solving the transport of intensity equation. Simulation results show that although slower than fast Fourier transform (FFT)-based methods, finite difference methods are able to reconstruct the phase with better accuracy due to relaxed assumptions for solving the transport of intensity equation relative to FFT methods. Finite difference methods are also more flexible than FFT methods in dealing with different boundary conditions.
Assessment of sustainable urban transport development based on entropy and unascertained measure.
Li, Yancang; Yang, Jing; Shi, Huawang; Li, Yijie
2017-01-01
To find a more effective method for the assessment of sustainable urban transport development, the comprehensive assessment model of sustainable urban transport development was established based on the unascertained measure. On the basis of considering the factors influencing urban transport development, the comprehensive assessment indexes were selected, including urban economical development, transport demand, environment quality and energy consumption, and the assessment system of sustainable urban transport development was proposed. In view of different influencing factors of urban transport development, the index weight was calculated through the entropy weight coefficient method. Qualitative and quantitative analyses were conducted according to the actual condition. Then, the grade was obtained by using the credible degree recognition criterion from which the urban transport development level can be determined. Finally, a comprehensive assessment method for urban transport development was introduced. The application practice showed that the method can be used reasonably and effectively for the comprehensive assessment of urban transport development.
Assessment of sustainable urban transport development based on entropy and unascertained measure
Li, Yancang; Yang, Jing; Li, Yijie
2017-01-01
To find a more effective method for the assessment of sustainable urban transport development, the comprehensive assessment model of sustainable urban transport development was established based on the unascertained measure. On the basis of considering the factors influencing urban transport development, the comprehensive assessment indexes were selected, including urban economical development, transport demand, environment quality and energy consumption, and the assessment system of sustainable urban transport development was proposed. In view of different influencing factors of urban transport development, the index weight was calculated through the entropy weight coefficient method. Qualitative and quantitative analyses were conducted according to the actual condition. Then, the grade was obtained by using the credible degree recognition criterion from which the urban transport development level can be determined. Finally, a comprehensive assessment method for urban transport development was introduced. The application practice showed that the method can be used reasonably and effectively for the comprehensive assessment of urban transport development. PMID:29084281
Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R
2006-08-04
Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goffin, Mark A., E-mail: mark.a.goffin@gmail.com; Buchan, Andrew G.; Dargaville, Steven
2015-01-15
A method for applying goal-based adaptive methods to the angular resolution of the neutral particle transport equation is presented. The methods are applied to an octahedral wavelet discretisation of the spherical angular domain which allows for anisotropic resolution. The angular resolution is adapted across both the spatial and energy dimensions. The spatial domain is discretised using an inner-element sub-grid scale finite element method. The goal-based adaptive methods optimise the angular discretisation to minimise the error in a specific functional of the solution. The goal-based error estimators require the solution of an adjoint system to determine the importance to the specifiedmore » functional. The error estimators and the novel methods to calculate them are described. Several examples are presented to demonstrate the effectiveness of the methods. It is shown that the methods can significantly reduce the number of unknowns and computational time required to obtain a given error. The novelty of the work is the use of goal-based adaptive methods to obtain anisotropic resolution in the angular domain for solving the transport equation. -- Highlights: •Wavelet angular discretisation used to solve transport equation. •Adaptive method developed for the wavelet discretisation. •Anisotropic angular resolution demonstrated through the adaptive method. •Adaptive method provides improvements in computational efficiency.« less
Transportation optimization with fuzzy trapezoidal numbers based on possibility theory.
He, Dayi; Li, Ran; Huang, Qi; Lei, Ping
2014-01-01
In this paper, a parametric method is introduced to solve fuzzy transportation problem. Considering that parameters of transportation problem have uncertainties, this paper develops a generalized fuzzy transportation problem with fuzzy supply, demand and cost. For simplicity, these parameters are assumed to be fuzzy trapezoidal numbers. Based on possibility theory and consistent with decision-makers' subjectiveness and practical requirements, the fuzzy transportation problem is transformed to a crisp linear transportation problem by defuzzifying fuzzy constraints and objectives with application of fractile and modality approach. Finally, a numerical example is provided to exemplify the application of fuzzy transportation programming and to verify the validity of the proposed methods.
DRAINWAT--Based Methods For Estimating Nitrogen Transport in Poorly Drained Watersheds
Devendra M. Amatya; George M. Chescheir; Glenn P. Fernandez; R. Wayne Skaggs; J.W. Gilliam
2004-01-01
Methods are needed to quantify effects of land use and management practices on nutrient and sediment loads at the watershed scale. Two methods were used to apply a DRAINMOD-based watershed-scale model (DRAINWAT) to estimate total nitrogen (N) transport from a poorly drained, forested watershed. In both methods, in-stream retention or losses of N were calculated with a...
NASA Astrophysics Data System (ADS)
Matuszak, Zbigniew; Bartosz, Michał; Barta, Dalibor
2016-09-01
In the article are characterized two network methods (critical path method - CPM and program evaluation and review technique - PERT). On the example of an international furniture company's product, it presented the exemplification of methods to transport cargos (furniture elements). Moreover, the study showed diagrams for transportation of cargos from individual components' producers to the final destination - the showroom. Calculations were based on the transportation of furniture elements via small commercial vehicles.
Annotation-based inference of transporter function.
Lee, Thomas J; Paulsen, Ian; Karp, Peter
2008-07-01
We present a method for inferring and constructing transport reactions for transporter proteins based primarily on the analysis of the names of individual proteins in the genome annotation of an organism. Transport reactions are declarative descriptions of transporter activities, and thus can be manipulated computationally, unlike free-text protein names. Once transporter activities are encoded as transport reactions, a number of computational analyses are possible including database queries by transporter activity; inclusion of transporters into an automatically generated metabolic-map diagram that can be painted with omics data to aid in their interpretation; detection of anomalies in the metabolic and transport networks, such as substrates that are transported into the cell but are not inputs to any metabolic reaction or pathway; and comparative analyses of the transport capabilities of different organisms. On randomly selected organisms, the method achieves precision and recall rates of 0.93 and 0.90, respectively in identifying transporter proteins by name within the complete genome. The method obtains 67.5% accuracy in predicting complete transport reactions; if allowance is made for predictions that are overly general yet not incorrect, reaction prediction accuracy is 82.5%. The method is implemented as part of PathoLogic, the inference component of the Pathway Tools software. Pathway Tools is freely available to researchers at non-commercial institutions, including source code; a fee applies to commercial institutions. Supplementary data are available at Bioinformatics online.
Study on photon transport problem based on the platform of molecular optical simulation environment.
Peng, Kuan; Gao, Xinbo; Liang, Jimin; Qu, Xiaochao; Ren, Nunu; Chen, Xueli; Ma, Bin; Tian, Jie
2010-01-01
As an important molecular imaging modality, optical imaging has attracted increasing attention in the recent years. Since the physical experiment is usually complicated and expensive, research methods based on simulation platforms have obtained extensive attention. We developed a simulation platform named Molecular Optical Simulation Environment (MOSE) to simulate photon transport in both biological tissues and free space for optical imaging based on noncontact measurement. In this platform, Monte Carlo (MC) method and the hybrid radiosity-radiance theorem are used to simulate photon transport in biological tissues and free space, respectively, so both contact and noncontact measurement modes of optical imaging can be simulated properly. In addition, a parallelization strategy for MC method is employed to improve the computational efficiency. In this paper, we study the photon transport problems in both biological tissues and free space using MOSE. The results are compared with Tracepro, simplified spherical harmonics method (SP(n)), and physical measurement to verify the performance of our study method on both accuracy and efficiency.
Study on Photon Transport Problem Based on the Platform of Molecular Optical Simulation Environment
Peng, Kuan; Gao, Xinbo; Liang, Jimin; Qu, Xiaochao; Ren, Nunu; Chen, Xueli; Ma, Bin; Tian, Jie
2010-01-01
As an important molecular imaging modality, optical imaging has attracted increasing attention in the recent years. Since the physical experiment is usually complicated and expensive, research methods based on simulation platforms have obtained extensive attention. We developed a simulation platform named Molecular Optical Simulation Environment (MOSE) to simulate photon transport in both biological tissues and free space for optical imaging based on noncontact measurement. In this platform, Monte Carlo (MC) method and the hybrid radiosity-radiance theorem are used to simulate photon transport in biological tissues and free space, respectively, so both contact and noncontact measurement modes of optical imaging can be simulated properly. In addition, a parallelization strategy for MC method is employed to improve the computational efficiency. In this paper, we study the photon transport problems in both biological tissues and free space using MOSE. The results are compared with Tracepro, simplified spherical harmonics method (S P n), and physical measurement to verify the performance of our study method on both accuracy and efficiency. PMID:20445737
Transport Coefficients from Large Deviation Functions
NASA Astrophysics Data System (ADS)
Gao, Chloe; Limmer, David
2017-10-01
We describe a method for computing transport coefficients from the direct evaluation of large deviation function. This method is general, relying on only equilibrium fluctuations, and is statistically efficient, employing trajectory based importance sampling. Equilibrium fluctuations of molecular currents are characterized by their large deviation functions, which is a scaled cumulant generating function analogous to the free energy. A diffusion Monte Carlo algorithm is used to evaluate the large deviation functions, from which arbitrary transport coefficients are derivable. We find significant statistical improvement over traditional Green-Kubo based calculations. The systematic and statistical errors of this method are analyzed in the context of specific transport coefficient calculations, including the shear viscosity, interfacial friction coefficient, and thermal conductivity.
A multivariate quadrature based moment method for LES based modeling of supersonic combustion
NASA Astrophysics Data System (ADS)
Donde, Pratik; Koo, Heeseok; Raman, Venkat
2012-07-01
The transported probability density function (PDF) approach is a powerful technique for large eddy simulation (LES) based modeling of scramjet combustors. In this approach, a high-dimensional transport equation for the joint composition-enthalpy PDF needs to be solved. Quadrature based approaches provide deterministic Eulerian methods for solving the joint-PDF transport equation. In this work, it is first demonstrated that the numerical errors associated with LES require special care in the development of PDF solution algorithms. The direct quadrature method of moments (DQMOM) is one quadrature-based approach developed for supersonic combustion modeling. This approach is shown to generate inconsistent evolution of the scalar moments. Further, gradient-based source terms that appear in the DQMOM transport equations are severely underpredicted in LES leading to artificial mixing of fuel and oxidizer. To overcome these numerical issues, a semi-discrete quadrature method of moments (SeQMOM) is formulated. The performance of the new technique is compared with the DQMOM approach in canonical flow configurations as well as a three-dimensional supersonic cavity stabilized flame configuration. The SeQMOM approach is shown to predict subfilter statistics accurately compared to the DQMOM approach.
Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng
2013-01-01
Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059
NASA Astrophysics Data System (ADS)
Yoshida, Norio
2018-05-01
A new method for finding the minimum free energy pathway (MFEP) of ions and small molecule transportation through a protein based on the three-dimensional reference interaction site model (3D-RISM) theory combined with the string method has been proposed. The 3D-RISM theory produces the distribution function, or the potential of mean force (PMF), for transporting substances around the given protein structures. By applying the string method to the PMF surface, one can readily determine the MFEP on the PMF surface. The method has been applied to consider the Na+ conduction pathway of channelrhodopsin as an example.
Development of a graphical method for choosing the optimal mode of traffic light
NASA Astrophysics Data System (ADS)
Novikov, A. N.; Katunin, A. A.; Novikov, I. A.; Kravchenko, A. A.; Shevtsova, A. G.
2018-05-01
Changing the transportation infrastructure for improving the main characteristics of the transportation flow is the key problem in transportation planning, therefore the main question lies in the ability to plan the change of the main indicators for the long term. In this investigation, an analysis of the city’s population has been performed and the most difficult transportation segment has been identified. During its identification, the main characteristics of the transportation flow have been established. For the evaluation of these characteristics until 2025, an analysis of the available methods of establishing changes in their values has been conducted. During the analysis of the above mentioned methods of evaluation of the change in intensity, based on the method of extrapolation, three scenarios of the development of the transportation system have been identified. It has been established that the most favorable method of controlling the transportation flow in the entrance to the city is the long term control of the traffic system. For the first time, with the help of the authors, based on the investigations of foreign scientists and the mathematical analysis of the changes in intensiveness on the main routes of the given road, the method of graphically choosing the required control plan has been put forward. The effectiveness of said organization scheme of the transportation system has been rated in the Transyt-14 program, with the analysis of changes in the main characteristics of the transportation flow.
NASA Astrophysics Data System (ADS)
Yu, Wei; Tian, Xiaolin; He, Xiaoliang; Song, Xiaojun; Xue, Liang; Liu, Cheng; Wang, Shouyu
2016-08-01
Microscopy based on transport of intensity equation provides quantitative phase distributions which opens another perspective for cellular observations. However, it requires multi-focal image capturing while mechanical and electrical scanning limits its real time capacity in sample detections. Here, in order to break through this restriction, real time quantitative phase microscopy based on single-shot transport of the intensity equation method is proposed. A programmed phase mask is designed to realize simultaneous multi-focal image recording without any scanning; thus, phase distributions can be quantitatively retrieved in real time. It is believed the proposed method can be potentially applied in various biological and medical applications, especially for live cell imaging.
Discontinuous Finite Element Quasidiffusion Methods
Anistratov, Dmitriy Yurievich; Warsa, James S.
2018-05-21
Here in this paper, two-level methods for solving transport problems in one-dimensional slab geometry based on the quasi-diffusion (QD) method are developed. A linear discontinuous finite element method (LDFEM) is derived for the spatial discretization of the low-order QD (LOQD) equations. It involves special interface conditions at the cell edges based on the idea of QD boundary conditions (BCs). We consider different kinds of QD BCs to formulate the necessary cell-interface conditions. We develop two-level methods with independent discretization of the high-order transport equation and LOQD equations, where the transport equation is discretized using the method of characteristics and themore » LDFEM is applied to the LOQD equations. We also formulate closures that lead to the discretization consistent with a LDFEM discretization of the transport equation. The proposed methods are studied by means of test problems formulated with the method of manufactured solutions. Numerical experiments are presented demonstrating the performance of the proposed methods. Lastly, we also show that the method with independent discretization has the asymptotic diffusion limit.« less
Discontinuous Finite Element Quasidiffusion Methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anistratov, Dmitriy Yurievich; Warsa, James S.
Here in this paper, two-level methods for solving transport problems in one-dimensional slab geometry based on the quasi-diffusion (QD) method are developed. A linear discontinuous finite element method (LDFEM) is derived for the spatial discretization of the low-order QD (LOQD) equations. It involves special interface conditions at the cell edges based on the idea of QD boundary conditions (BCs). We consider different kinds of QD BCs to formulate the necessary cell-interface conditions. We develop two-level methods with independent discretization of the high-order transport equation and LOQD equations, where the transport equation is discretized using the method of characteristics and themore » LDFEM is applied to the LOQD equations. We also formulate closures that lead to the discretization consistent with a LDFEM discretization of the transport equation. The proposed methods are studied by means of test problems formulated with the method of manufactured solutions. Numerical experiments are presented demonstrating the performance of the proposed methods. Lastly, we also show that the method with independent discretization has the asymptotic diffusion limit.« less
Comparison of Methods for Evaluating Urban Transportation Alternatives
DOT National Transportation Integrated Search
1975-02-01
The objective of the report was to compare five alternative methods for evaluating urban transportation improvement options: unaided judgmental evaluation cost-benefit analysis, cost-effectiveness analysis based on a single measure of effectiveness, ...
Introduction to Solid Supported Membrane Based Electrophysiology
Bazzone, Andre; Costa, Wagner Steuer; Braner, Markus; Călinescu, Octavian; Hatahet, Lina; Fendler, Klaus
2013-01-01
The electrophysiological method we present is based on a solid supported membrane (SSM) composed of an octadecanethiol layer chemisorbed on a gold coated sensor chip and a phosphatidylcholine monolayer on top. This assembly is mounted into a cuvette system containing the reference electrode, a chlorinated silver wire. After adsorption of membrane fragments or proteoliposomes containing the membrane protein of interest, a fast solution exchange is used to induce the transport activity of the membrane protein. In the single solution exchange protocol two solutions, one non-activating and one activating solution, are needed. The flow is controlled by pressurized air and a valve and tubing system within a faraday cage. The kinetics of the electrogenic transport activity is obtained via capacitive coupling between the SSM and the proteoliposomes or membrane fragments. The method, therefore, yields only transient currents. The peak current represents the stationary transport activity. The time dependent transporter currents can be reconstructed by circuit analysis. This method is especially suited for prokaryotic transporters or eukaryotic transporters from intracellular membranes, which cannot be investigated by patch clamp or voltage clamp methods. PMID:23711952
Introduction to solid supported membrane based electrophysiology.
Bazzone, Andre; Costa, Wagner Steuer; Braner, Markus; Călinescu, Octavian; Hatahet, Lina; Fendler, Klaus
2013-05-11
The electrophysiological method we present is based on a solid supported membrane (SSM) composed of an octadecanethiol layer chemisorbed on a gold coated sensor chip and a phosphatidylcholine monolayer on top. This assembly is mounted into a cuvette system containing the reference electrode, a chlorinated silver wire. After adsorption of membrane fragments or proteoliposomes containing the membrane protein of interest, a fast solution exchange is used to induce the transport activity of the membrane protein. In the single solution exchange protocol two solutions, one non-activating and one activating solution, are needed. The flow is controlled by pressurized air and a valve and tubing system within a faraday cage. The kinetics of the electrogenic transport activity is obtained via capacitive coupling between the SSM and the proteoliposomes or membrane fragments. The method, therefore, yields only transient currents. The peak current represents the stationary transport activity. The time dependent transporter currents can be reconstructed by circuit analysis. This method is especially suited for prokaryotic transporters or eukaryotic transporters from intracellular membranes, which cannot be investigated by patch clamp or voltage clamp methods.
Performance planning for rural planning organizations - final report.
DOT National Transportation Integrated Search
2017-02-01
Recent federal rules place increased emphasis on performance-based management of the multimodal : transportation system and require the use of performance based methods in state, metropolitan, and : non-metropolitan transportation planning and progra...
Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng
2013-01-01
Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.
MPACT Standard Input User s Manual, Version 2.2.0
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collins, Benjamin S.; Downar, Thomas; Fitzgerald, Andrew
The MPACT (Michigan PArallel Charactistics based Transport) code is designed to perform high-fidelity light water reactor (LWR) analysis using whole-core pin-resolved neutron transport calculations on modern parallel-computing hardware. The code consists of several libraries which provide the functionality necessary to solve steady-state eigenvalue problems. Several transport capabilities are available within MPACT including both 2-D and 3-D Method of Characteristics (MOC). A three-dimensional whole core solution based on the 2D-1D solution method provides the capability for full core depletion calculations.
Analytical Fuselage and Wing Weight Estimation of Transport Aircraft
DOT National Transportation Integrated Search
1996-05-01
A method of estimating the load-bearing fuselage weight and wing weight of transport aircraft based on fundamental structural principles has been developed. This method of weight estimation represents a compromise between the rapid assessment of comp...
Comparative analysis of quantitative efficiency evaluation methods for transportation networks
He, Yuxin; Hong, Jian
2017-01-01
An effective evaluation of transportation network efficiency could offer guidance for the optimal control of urban traffic. Based on the introduction and related mathematical analysis of three quantitative evaluation methods for transportation network efficiency, this paper compares the information measured by them, including network structure, traffic demand, travel choice behavior and other factors which affect network efficiency. Accordingly, the applicability of various evaluation methods is discussed. Through analyzing different transportation network examples it is obtained that Q-H method could reflect the influence of network structure, traffic demand and user route choice behavior on transportation network efficiency well. In addition, the transportation network efficiency measured by this method and Braess’s Paradox can be explained with each other, which indicates a better evaluation of the real operation condition of transportation network. Through the analysis of the network efficiency calculated by Q-H method, it can also be drawn that a specific appropriate demand is existed to a given transportation network. Meanwhile, under the fixed demand, both the critical network structure that guarantees the stability and the basic operation of the network and a specific network structure contributing to the largest value of the transportation network efficiency can be identified. PMID:28399165
Comparative analysis of quantitative efficiency evaluation methods for transportation networks.
He, Yuxin; Qin, Jin; Hong, Jian
2017-01-01
An effective evaluation of transportation network efficiency could offer guidance for the optimal control of urban traffic. Based on the introduction and related mathematical analysis of three quantitative evaluation methods for transportation network efficiency, this paper compares the information measured by them, including network structure, traffic demand, travel choice behavior and other factors which affect network efficiency. Accordingly, the applicability of various evaluation methods is discussed. Through analyzing different transportation network examples it is obtained that Q-H method could reflect the influence of network structure, traffic demand and user route choice behavior on transportation network efficiency well. In addition, the transportation network efficiency measured by this method and Braess's Paradox can be explained with each other, which indicates a better evaluation of the real operation condition of transportation network. Through the analysis of the network efficiency calculated by Q-H method, it can also be drawn that a specific appropriate demand is existed to a given transportation network. Meanwhile, under the fixed demand, both the critical network structure that guarantees the stability and the basic operation of the network and a specific network structure contributing to the largest value of the transportation network efficiency can be identified.
NASA Astrophysics Data System (ADS)
Tian, Wenli; Cao, Chengxuan
2017-03-01
A generalized interval fuzzy mixed integer programming model is proposed for the multimodal freight transportation problem under uncertainty, in which the optimal mode of transport and the optimal amount of each type of freight transported through each path need to be decided. For practical purposes, three mathematical methods, i.e. the interval ranking method, fuzzy linear programming method and linear weighted summation method, are applied to obtain equivalents of constraints and parameters, and then a fuzzy expected value model is presented. A heuristic algorithm based on a greedy criterion and the linear relaxation algorithm are designed to solve the model.
Development of Tokamak Transport Solvers for Stiff Confinement Systems
NASA Astrophysics Data System (ADS)
St. John, H. E.; Lao, L. L.; Murakami, M.; Park, J. M.
2006-10-01
Leading transport models such as GLF23 [1] and MM95 [2] describe turbulent plasma energy, momentum and particle flows. In order to accommodate existing transport codes and associated solution methods effective diffusivities have to be derived from these turbulent flow models. This can cause significant problems in predicting unique solutions. We have developed a parallel transport code solver, GCNMP, that can accommodate both flow based and diffusivity based confinement models by solving the discretized nonlinear equations using modern Newton, trust region, steepest descent and homotopy methods. We present our latest development efforts, including multiple dynamic grids, application of two-level parallel schemes, and operator splitting techniques that allow us to combine flow based and diffusivity based models in tokamk simulations. 6pt [1] R.E. Waltz, et al., Phys. Plasmas 4, 7 (1997). [2] G. Bateman, et al., Phys. Plasmas 5, 1793 (1998).
ERIC Educational Resources Information Center
Rosen, Joshua B.; Olson, Mark H.; Kelly, Marianne
2012-01-01
Objective: The authors examined the impact of a collegiate-based emergency medical service (CBEMS) on the frequency of emergency department (ED) transports. Participants: Students transported to the ED for acute alcohol intoxication during the Fall 2008 and the Fall 2009 semesters (N = 50). Methods: The frequency of students receiving…
NASA Astrophysics Data System (ADS)
Tarigan, U.; Sidabutar, R. F.; Tarigan, U. P. P.; Chen, A.
2018-04-01
Manufacturers engaged in the business, producing CPO and kernels whose raw materials are oil palm fresh fruit bunches taken from their own plantation, generally face problems of transporting from plantation to factory where there is often a change of distance traveled by the truck the carrier of FFB is due to non-specific transport instructions. The research was conducted to determine the optimal transportation route in terms of distance, time and route number. The determination of this transportation route is solved using Nearest Neighbours and Clarke & Wright Savings methods. Based on the calculations performed then found in area I with method Nearest Neighbours has a distance of 200.78 Km while Clarke & Wright Savings as with a result of 214.09 Km. As for the harvest area, II obtained results with Nearest Neighbours method of 264.37 Km and Clarke & Wright Savings method with a total distance of 264.33 Km. Based on the calculation of the time to do all the activities of transporting FFB juxtaposed with the work time of the driver got the reduction of conveyance from 8 units to 5 units. There is also improvement of fuel efficiency by 0.8%.
Research on crude oil storage and transportation based on optimization algorithm
NASA Astrophysics Data System (ADS)
Yuan, Xuhua
2018-04-01
At present, the optimization theory and method have been widely used in the optimization scheduling and optimal operation scheme of complex production systems. Based on C++Builder 6 program development platform, the theoretical research results are implemented by computer. The simulation and intelligent decision system of crude oil storage and transportation inventory scheduling are designed. The system includes modules of project management, data management, graphics processing, simulation of oil depot operation scheme. It can realize the optimization of the scheduling scheme of crude oil storage and transportation system. A multi-point temperature measuring system for monitoring the temperature field of floating roof oil storage tank is developed. The results show that by optimizing operating parameters such as tank operating mode and temperature, the total transportation scheduling costs of the storage and transportation system can be reduced by 9.1%. Therefore, this method can realize safe and stable operation of crude oil storage and transportation system.
Exploring a potential energy surface by machine learning for characterizing atomic transport
NASA Astrophysics Data System (ADS)
Kanamori, Kenta; Toyoura, Kazuaki; Honda, Junya; Hattori, Kazuki; Seko, Atsuto; Karasuyama, Masayuki; Shitara, Kazuki; Shiga, Motoki; Kuwabara, Akihide; Takeuchi, Ichiro
2018-03-01
We propose a machine-learning method for evaluating the potential barrier governing atomic transport based on the preferential selection of dominant points for atomic transport. The proposed method generates numerous random samples of the entire potential energy surface (PES) from a probabilistic Gaussian process model of the PES, which enables defining the likelihood of the dominant points. The robustness and efficiency of the method are demonstrated on a dozen model cases for proton diffusion in oxides, in comparison with a conventional nudge elastic band method.
A method for radiological characterization based on fluence conversion coefficients
NASA Astrophysics Data System (ADS)
Froeschl, Robert
2018-06-01
Radiological characterization of components in accelerator environments is often required to ensure adequate radiation protection during maintenance, transport and handling as well as for the selection of the proper disposal pathway. The relevant quantities are typical the weighted sums of specific activities with radionuclide-specific weighting coefficients. Traditional methods based on Monte Carlo simulations are radionuclide creation-event based or the particle fluences in the regions of interest are scored and then off-line weighted with radionuclide production cross sections. The presented method bases the radiological characterization on a set of fluence conversion coefficients. For a given irradiation profile and cool-down time, radionuclide production cross-sections, material composition and radionuclide-specific weighting coefficients, a set of particle type and energy dependent fluence conversion coefficients is computed. These fluence conversion coefficients can then be used in a Monte Carlo transport code to perform on-line weighting to directly obtain the desired radiological characterization, either by using built-in multiplier features such as in the PHITS code or by writing a dedicated user routine such as for the FLUKA code. The presented method has been validated against the standard event-based methods directly available in Monte Carlo transport codes.
Risk Evaluation of Railway Coal Transportation Network Based on Multi Level Grey Evaluation Model
NASA Astrophysics Data System (ADS)
Niu, Wei; Wang, Xifu
2018-01-01
The railway transport mode is currently the most important way of coal transportation, and now China’s railway coal transportation network has become increasingly perfect, but there is still insufficient capacity, some lines close to saturation and other issues. In this paper, the theory and method of risk assessment, analytic hierarchy process and multi-level gray evaluation model are applied to the risk evaluation of coal railway transportation network in China. Based on the example analysis of Shanxi railway coal transportation network, to improve the internal structure and the competitiveness of the market.
A comparison of transport algorithms for premixed, laminar steady state flames
NASA Technical Reports Server (NTRS)
Coffee, T. P.; Heimerl, J. M.
1980-01-01
The effects of different methods of approximating multispecies transport phenomena in models of premixed, laminar, steady state flames were studied. Five approximation methods that span a wide range of computational complexity were developed. Identical data for individual species properties were used for each method. Each approximation method is employed in the numerical solution of a set of five H2-02-N2 flames. For each flame the computed species and temperature profiles, as well as the computed flame speeds, are found to be very nearly independent of the approximation method used. This does not indicate that transport phenomena are unimportant, but rather that the selection of the input values for the individual species transport properties is more important than the selection of the method used to approximate the multispecies transport. Based on these results, a sixth approximation method was developed that is computationally efficient and provides results extremely close to the most sophisticated and precise method used.
An efficient transport solver for tokamak plasmas
Park, Jin Myung; Murakami, Masanori; St. John, H. E.; ...
2017-01-03
A simple approach to efficiently solve a coupled set of 1-D diffusion-type transport equations with a stiff transport model for tokamak plasmas is presented based on the 4th order accurate Interpolated Differential Operator scheme along with a nonlinear iteration method derived from a root-finding algorithm. Here, numerical tests using the Trapped Gyro-Landau-Fluid model show that the presented high order method provides an accurate transport solution using a small number of grid points with robust nonlinear convergence.
A Primer for Agent-Based Simulation and Modeling in Transportation Applications
DOT National Transportation Integrated Search
2013-11-01
Agent-based modeling and simulation (ABMS) methods have been applied in a spectrum of research domains. This primer focuses on ABMS in the transportation interdisciplinary domain, describes the basic concepts of ABMS and the recent progress of ABMS i...
NASA Astrophysics Data System (ADS)
Chen, Shaopei; Tan, Jianjun; Ray, C.; Claramunt, C.; Sun, Qinqin
2008-10-01
Diversity is one of the main characteristics of transportation data collected from multiple sources or formats, which can be extremely complex and disparate. Moreover, these multimodal transportation data are usually characterised by spatial and temporal properties. Multimodal transportation network data modelling involves both an engineering and research domain that has attracted the design of a number of spatio-temporal data models in the geographic information system (GIS). However, the application of these specific models to multimodal transportation network is still a challenging task. This research addresses this challenge from both integrated multimodal data organization and object-oriented modelling perspectives, that is, how a complex urban transportation network should be organized, represented and modeled appropriately when considering a multimodal point of view, and using object-oriented modelling method. We proposed an integrated GIS-based data model for multimodal urban transportation network that lays a foundation to enhance the multimodal transportation network analysis and management. This modelling method organizes and integrates multimodal transit network data, and supports multiple representations for spatio-temporal objects and relationship as both visual and graphic views. The data model is expressed by using a spatio-temporal object-oriented modelling method, i.e., the unified modelling language (UML) extended to spatial and temporal plug-in for visual languages (PVLs), which provides an essential support to the spatio-temporal data modelling for transportation GIS.
Aspheric surface testing by irradiance transport equation
NASA Astrophysics Data System (ADS)
Shomali, Ramin; Darudi, Ahmad; Nasiri, Sadollah; Asgharsharghi Bonab, Armir
2010-10-01
In this paper a method for aspheric surface testing is presented. The method is based on solving the Irradiance Transport Equation (ITE).The accuracy of ITE normally depends on the amount of the pick to valley of the phase distribution. This subject is investigated by a simulation procedure.
DOT National Transportation Integrated Search
1997-03-06
This testimony describes how innovation in federal research, financing and contracting methods has the potential for improving the performance of the nation's surface transportation system. The testimony is based on three reports on the reauthorizati...
Brondeel, Ruben; Kestens, Yan; Chaix, Basile
2017-10-23
Physical inactivity is widely recognized as one of the leading causes of mortality, and transport accounts for a large part of people's daily physical activity. This study develops a simulation approach to evaluate the impact of the Ile-de-France Urban Mobility Plan (2010-2020) on physical activity, under the hypothesis that the intended transport mode shifts are realized. Based on the Global Transport Survey (2010, n = 21,332) and on the RECORD GPS Study (2012-2013, n = 229) from the French capital region of Paris (Ile-de-France), a simulation method was designed and tested. The simulation method used accelerometer data and random forest models to predict the impact of the transport mode shifts anticipated in the Mobility Plan on transport-related moderate-to-vigorous physical activity (T-MVPA). The transport mode shifts include less private motorized trips in favor of more public transport, walking, and biking trips. The simulation model indicated a mean predicted increase of 2 min per day of T-MVPA, in case the intended transport mode shifts in the Ile-de-France Urban Mobility Plan were realized. The positive effect of the transport mode shifts on T-MVPA would, however, be larger for people with a higher level of education. This heterogeneity in the positive effect would further increase the existing inequality in transport-related physical activity by educational level. The method presented in this paper showed a significant increase in transport-related physical activity in case the intended mode shifts in the Ile-de-France Urban Mobility Plan were realized. This simulation method could be applied on other important health outcomes, such as exposure to noise or air pollution, making it a useful tool to anticipate the health impact of transport interventions or policies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Juxiu Tong; Bill X. Hu; Hai Huang
2014-03-01
With growing importance of water resources in the world, remediations of anthropogenic contaminations due to reactive solute transport become even more important. A good understanding of reactive rate parameters such as kinetic parameters is the key to accurately predicting reactive solute transport processes and designing corresponding remediation schemes. For modeling reactive solute transport, it is very difficult to estimate chemical reaction rate parameters due to complex processes of chemical reactions and limited available data. To find a method to get the reactive rate parameters for the reactive urea hydrolysis transport modeling and obtain more accurate prediction for the chemical concentrations,more » we developed a data assimilation method based on an ensemble Kalman filter (EnKF) method to calibrate reactive rate parameters for modeling urea hydrolysis transport in a synthetic one-dimensional column at laboratory scale and to update modeling prediction. We applied a constrained EnKF method to pose constraints to the updated reactive rate parameters and the predicted solute concentrations based on their physical meanings after the data assimilation calibration. From the study results we concluded that we could efficiently improve the chemical reactive rate parameters with the data assimilation method via the EnKF, and at the same time we could improve solute concentration prediction. The more data we assimilated, the more accurate the reactive rate parameters and concentration prediction. The filter divergence problem was also solved in this study.« less
A Customized Transportation Intervention for Persons with Visual Impairments
ERIC Educational Resources Information Center
Crudden, Adele; Antonelli, Karla; O'Mally, Jamie
2017-01-01
Introduction: Transportation can be an employment barrier for persons with disabilities, particularly those with visual impairments. A customized transportation intervention for people with visual impairments, based on concepts associated with customized employment, was devised, implemented, and evaluated. Methods: A pretest and posttest…
Cycling transport safety quantification
NASA Astrophysics Data System (ADS)
Drbohlav, Jiri; Kocourek, Josef
2018-05-01
Dynamic interest in cycling transport brings the necessity to design safety cycling infrastructure. In las few years, couple of norms with safety elements have been designed and suggested for the cycling infrastructure. But these were not fully examined. The main parameter of suitable and fully functional transport infrastructure is the evaluation of its safety. Common evaluation of transport infrastructure safety is based on accident statistics. These statistics are suitable for motor vehicle transport but unsuitable for the cycling transport. Cycling infrastructure evaluation of safety is suitable for the traffic conflicts monitoring. The results of this method are fast, based on real traffic situations and can be applied on any traffic situations.
A Car Transportation System in Cooperation by Multiple Mobile Robots for Each Wheel: iCART II
NASA Astrophysics Data System (ADS)
Kashiwazaki, Koshi; Yonezawa, Naoaki; Kosuge, Kazuhiro; Sugahara, Yusuke; Hirata, Yasuhisa; Endo, Mitsuru; Kanbayashi, Takashi; Shinozuka, Hiroyuki; Suzuki, Koki; Ono, Yuki
The authors proposed a car transportation system, iCART (intelligent Cooperative Autonomous Robot Transporters), for automation of mechanical parking systems by two mobile robots. However, it was difficult to downsize the mobile robot because the length of it requires at least the wheelbase of a car. This paper proposes a new car transportation system, iCART II (iCART - type II), based on “a-robot-for-a-wheel” concept. A prototype system, MRWheel (a Mobile Robot for a Wheel), is designed and downsized less than half the conventional robot. First, a method for lifting up a wheel by MRWheel is described. In general, it is very difficult for mobile robots such as MRWheel to move to desired positions without motion errors caused by slipping, etc. Therefore, we propose a follower's motion error estimation algorithm based on the internal force applied to each follower by extending a conventional leader-follower type decentralized control algorithm for cooperative object transportation. The proposed algorithm enables followers to estimate their motion errors and enables the robots to transport a car to a desired position. In addition, we analyze and prove the stability and convergence of the resultant system with the proposed algorithm. In order to extract only the internal force from the force applied to each robot, we also propose a model-based external force compensation method. Finally, proposed methods are applied to the car transportation system, the experimental results confirm their validity.
Requirements for transportation of fast pyrolysis bio-oil in Finland
NASA Astrophysics Data System (ADS)
Karhunen, Antti; Laihanen, Mika; Ranta, Tapio
2016-11-01
The purpose of this paper is to discuss the requirements and challenges of pyrolysis oil's transportation in Finland. Pyrolysis oil is a new type of renewable liquid fuel that can be utilised in applications such as heat and electricity production. It has never been transported on a large scale in Finland. Possible options are transport by road, rail and waterway. The most significant requirements in its transportation are created by acidity and high density of pyrolysis oil, which impose requirements for the materials and transport equipment. The study described here shows that constant domestic transportation of pyrolysis oil is most reasonably operated with tank trucks. Rail-based transport may have potential for domestic fixed routes, and transport by water could be utilised in exporting. All transportation methods have limitations and advantages relative to each other. Ultimately, the production site and end-user's locations will determine the most suitable transport method.
Oxygen transport membrane based advanced power cycle with low pressure synthesis gas slip stream
Kromer, Brian R.; Litwin, Michael M.; Kelly, Sean M.
2016-09-27
A method and system for generating electrical power in which a high pressure synthesis gas stream generated in a gasifier is partially oxidized in an oxygen transport membrane based reactor, expanded and thereafter, is combusted in an oxygen transport membrane based boiler. A low pressure synthesis gas slip stream is split off downstream of the expanders and used as the source of fuel in the oxygen transport membrane based partial oxidation reactors to allow the oxygen transport membrane to operate at low fuel pressures with high fuel utilization. The combustion within the boiler generates heat to raise steam to in turn generate electricity by a generator coupled to a steam turbine. The resultant flue gas can be purified to produce a carbon dioxide product.
Development of Advanced Methods of Structural and Trajectory Analysis for Transport Aircraft
NASA Technical Reports Server (NTRS)
Ardema, Mark D.
1996-01-01
In this report the author describes: (1) development of advanced methods of structural weight estimation, and (2) development of advanced methods of flight path optimization. A method of estimating the load-bearing fuselage weight and wing weight of transport aircraft based on fundamental structural principles has been developed. This method of weight estimation represents a compromise between the rapid assessment of component weight using empirical methods based on actual weights of existing aircraft and detailed, but time-consuming, analysis using the finite element method. The method was applied to eight existing subsonic transports for validation and correlation. Integration of the resulting computer program, PDCYL, has been made into the weights-calculating module of the AirCraft SYNThesis (ACSYNT) computer program. ACSYNT bas traditionally used only empirical weight estimation methods; PDCYL adds to ACSYNT a rapid, accurate means of assessing the fuselage and wing weights of unconventional aircraft. PDCYL also allows flexibility in the choice of structural concept, as well as a direct means of determining the impact of advanced materials on structural weight.
Assessment of parametric uncertainty for groundwater reactive transport modeling,
Shi, Xiaoqing; Ye, Ming; Curtis, Gary P.; Miller, Geoffery L.; Meyer, Philip D.; Kohler, Matthias; Yabusaki, Steve; Wu, Jichun
2014-01-01
The validity of using Gaussian assumptions for model residuals in uncertainty quantification of a groundwater reactive transport model was evaluated in this study. Least squares regression methods explicitly assume Gaussian residuals, and the assumption leads to Gaussian likelihood functions, model parameters, and model predictions. While the Bayesian methods do not explicitly require the Gaussian assumption, Gaussian residuals are widely used. This paper shows that the residuals of the reactive transport model are non-Gaussian, heteroscedastic, and correlated in time; characterizing them requires using a generalized likelihood function such as the formal generalized likelihood function developed by Schoups and Vrugt (2010). For the surface complexation model considered in this study for simulating uranium reactive transport in groundwater, parametric uncertainty is quantified using the least squares regression methods and Bayesian methods with both Gaussian and formal generalized likelihood functions. While the least squares methods and Bayesian methods with Gaussian likelihood function produce similar Gaussian parameter distributions, the parameter distributions of Bayesian uncertainty quantification using the formal generalized likelihood function are non-Gaussian. In addition, predictive performance of formal generalized likelihood function is superior to that of least squares regression and Bayesian methods with Gaussian likelihood function. The Bayesian uncertainty quantification is conducted using the differential evolution adaptive metropolis (DREAM(zs)) algorithm; as a Markov chain Monte Carlo (MCMC) method, it is a robust tool for quantifying uncertainty in groundwater reactive transport models. For the surface complexation model, the regression-based local sensitivity analysis and Morris- and DREAM(ZS)-based global sensitivity analysis yield almost identical ranking of parameter importance. The uncertainty analysis may help select appropriate likelihood functions, improve model calibration, and reduce predictive uncertainty in other groundwater reactive transport and environmental modeling.
Analytical Fuselage and Wing Weight Estimation of Transport Aircraft
NASA Technical Reports Server (NTRS)
Chambers, Mark C.; Ardema, Mark D.; Patron, Anthony P.; Hahn, Andrew S.; Miura, Hirokazu; Moore, Mark D.
1996-01-01
A method of estimating the load-bearing fuselage weight and wing weight of transport aircraft based on fundamental structural principles has been developed. This method of weight estimation represents a compromise between the rapid assessment of component weight using empirical methods based on actual weights of existing aircraft, and detailed, but time-consuming, analysis using the finite element method. The method was applied to eight existing subsonic transports for validation and correlation. Integration of the resulting computer program, PDCYL, has been made into the weights-calculating module of the AirCraft SYNThesis (ACSYNT) computer program. ACSYNT has traditionally used only empirical weight estimation methods; PDCYL adds to ACSYNT a rapid, accurate means of assessing the fuselage and wing weights of unconventional aircraft. PDCYL also allows flexibility in the choice of structural concept, as well as a direct means of determining the impact of advanced materials on structural weight. Using statistical analysis techniques, relations between the load-bearing fuselage and wing weights calculated by PDCYL and corresponding actual weights were determined.
Development of a specification for flexible base construction.
DOT National Transportation Integrated Search
2014-01-01
The Texas Department of Transportation (TxDOT) currently uses Item 247 Flexible Base to specify a : pavement foundation course. The goal of this project was to evaluate the current method of base course : acceptance and investigate methods to r...
Geometry of quantum Hall states: Gravitational anomaly and transport coefficients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Can, Tankut, E-mail: tcan@scgp.stonybrook.edu; Laskin, Michael; Wiegmann, Paul B.
2015-11-15
We show that universal transport coefficients of the fractional quantum Hall effect (FQHE) can be understood as a response to variations of spatial geometry. Some transport properties are essentially governed by the gravitational anomaly. We develop a general method to compute correlation functions of FQH states in a curved space, where local transformation properties of these states are examined through local geometric variations. We introduce the notion of a generating functional and relate it to geometric invariant functionals recently studied in geometry. We develop two complementary methods to study the geometry of the FQHE. One method is based on iteratingmore » a Ward identity, while the other is based on a field theoretical formulation of the FQHE through a path integral formalism.« less
Yan, Zhifeng; Yang, Xiaofan; Li, Siliang; ...
2017-09-05
The lattice Boltzmann method (LBM) based on single-relaxation-time (SRT) or multiple-relaxation-time (MRT) collision operators is widely used in simulating flow and transport phenomena. The LBM based on two-relaxation-time (TRT) collision operators possesses strengths from the SRT and MRT LBMs, such as its simple implementation and good numerical stability, although tedious mathematical derivations and presentations of the TRT LBM hinder its application to a broad range of flow and transport phenomena. This paper describes the TRT LBM clearly and provides a pseudocode for easy implementation. Various transport phenomena were simulated using the TRT LBM to illustrate its applications in subsurface environments.more » These phenomena include advection-diffusion in uniform flow, Taylor dispersion in a pipe, solute transport in a packed column, reactive transport in uniform flow, and bacterial chemotaxis in porous media. Finally, the TRT LBM demonstrated good numerical performance in terms of accuracy and stability in predicting these transport phenomena. Therefore, the TRT LBM is a powerful tool to simulate various geophysical and biogeochemical processes in subsurface environments.« less
NASA Astrophysics Data System (ADS)
Yan, Zhifeng; Yang, Xiaofan; Li, Siliang; Hilpert, Markus
2017-11-01
The lattice Boltzmann method (LBM) based on single-relaxation-time (SRT) or multiple-relaxation-time (MRT) collision operators is widely used in simulating flow and transport phenomena. The LBM based on two-relaxation-time (TRT) collision operators possesses strengths from the SRT and MRT LBMs, such as its simple implementation and good numerical stability, although tedious mathematical derivations and presentations of the TRT LBM hinder its application to a broad range of flow and transport phenomena. This paper describes the TRT LBM clearly and provides a pseudocode for easy implementation. Various transport phenomena were simulated using the TRT LBM to illustrate its applications in subsurface environments. These phenomena include advection-diffusion in uniform flow, Taylor dispersion in a pipe, solute transport in a packed column, reactive transport in uniform flow, and bacterial chemotaxis in porous media. The TRT LBM demonstrated good numerical performance in terms of accuracy and stability in predicting these transport phenomena. Therefore, the TRT LBM is a powerful tool to simulate various geophysical and biogeochemical processes in subsurface environments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan, Zhifeng; Yang, Xiaofan; Li, Siliang
The lattice Boltzmann method (LBM) based on single-relaxation-time (SRT) or multiple-relaxation-time (MRT) collision operators is widely used in simulating flow and transport phenomena. The LBM based on two-relaxation-time (TRT) collision operators possesses strengths from the SRT and MRT LBMs, such as its simple implementation and good numerical stability, although tedious mathematical derivations and presentations of the TRT LBM hinder its application to a broad range of flow and transport phenomena. This paper describes the TRT LBM clearly and provides a pseudocode for easy implementation. Various transport phenomena were simulated using the TRT LBM to illustrate its applications in subsurface environments.more » These phenomena include advection-diffusion in uniform flow, Taylor dispersion in a pipe, solute transport in a packed column, reactive transport in uniform flow, and bacterial chemotaxis in porous media. Finally, the TRT LBM demonstrated good numerical performance in terms of accuracy and stability in predicting these transport phenomena. Therefore, the TRT LBM is a powerful tool to simulate various geophysical and biogeochemical processes in subsurface environments.« less
NASA Astrophysics Data System (ADS)
Barajas-Solano, D. A.; Tartakovsky, A. M.
2017-12-01
We present a multiresolution method for the numerical simulation of flow and reactive transport in porous, heterogeneous media, based on the hybrid Multiscale Finite Volume (h-MsFV) algorithm. The h-MsFV algorithm allows us to couple high-resolution (fine scale) flow and transport models with lower resolution (coarse) models to locally refine both spatial resolution and transport models. The fine scale problem is decomposed into various "local'' problems solved independently in parallel and coordinated via a "global'' problem. This global problem is then coupled with the coarse model to strictly ensure domain-wide coarse-scale mass conservation. The proposed method provides an alternative to adaptive mesh refinement (AMR), due to its capacity to rapidly refine spatial resolution beyond what's possible with state-of-the-art AMR techniques, and the capability to locally swap transport models. We illustrate our method by applying it to groundwater flow and reactive transport of multiple species.
In-service inspection methods for graphite-epoxy structures on commercial transport aircraft
NASA Technical Reports Server (NTRS)
Phelps, M. L.
1981-01-01
In-service inspection methods for graphite-epoxy composite structures on commercial transport aircraft are determined. Graphite/epoxy structures, service incurred defects, current inspection practices and concerns of the airline and manufacturers, and other related information were determind by survey. Based on this information, applicable inspection nondestructive inspection methods are evaluated and inspection techniques determined. Technology is developed primarily in eddy current inspection.
Zhang, Zelun; Poslad, Stefan
2013-11-01
Wearable and accompanied sensors and devices are increasingly being used for user activity recognition. However, typical GPS-based and accelerometer-based (ACC) methods face three main challenges: a low recognition accuracy; a coarse recognition capability, i.e., they cannot recognise both human posture (during travelling) and transportation mode simultaneously, and a relatively high computational complexity. Here, a new GPS and Foot-Force (GPS + FF) sensor method is proposed to overcome these challenges that leverages a set of wearable FF sensors in combination with GPS, e.g., in a mobile phone. User mobility activities that can be recognised include both daily user postures and common transportation modes: sitting, standing, walking, cycling, bus passenger, car passenger (including private cars and taxis) and car driver. The novelty of this work is that our approach provides a more comprehensive recognition capability in terms of reliably recognising both human posture and transportation mode simultaneously during travel. In addition, by comparing the new GPS + FF method with both an ACC method (62% accuracy) and a GPS + ACC based method (70% accuracy) as baseline methods, it obtains a higher accuracy (95%) with less computational complexity, when tested on a dataset obtained from ten individuals.
Research on assessment methods for urban public transport development in China.
Zou, Linghong; Dai, Hongna; Yao, Enjian; Jiang, Tian; Guo, Hongwei
2014-01-01
In recent years, with the rapid increase in urban population, the urban travel demands in Chinese cities have been increasing dramatically. As a result, developing comprehensive urban transport systems becomes an inevitable choice to meet the growing urban travel demands. In urban transport systems, public transport plays the leading role to promote sustainable urban development. This paper aims to establish an assessment index system for the development level of urban public transport consisting of a target layer, a criterion layer, and an index layer. Review on existing literature shows that methods used in evaluating urban public transport structure are dominantly qualitative. To overcome this shortcoming, fuzzy mathematics method is used for describing qualitative issues quantitatively, and AHP (analytic hierarchy process) is used to quantify expert's subjective judgment. The assessment model is established based on the fuzzy AHP. The weight of each index is determined through the AHP and the degree of membership of each index through the fuzzy assessment method to obtain the fuzzy synthetic assessment matrix. Finally, a case study is conducted to verify the rationality and practicability of the assessment system and the proposed assessment method.
McDermott, Jason E.; Bruillard, Paul; Overall, Christopher C.; ...
2015-03-09
There are many examples of groups of proteins that have similar function, but the determinants of functional specificity may be hidden by lack of sequencesimilarity, or by large groups of similar sequences with different functions. Transporters are one such protein group in that the general function, transport, can be easily inferred from the sequence, but the substrate specificity can be impossible to predict from sequence with current methods. In this paper we describe a linguistic-based approach to identify functional patterns from groups of unaligned protein sequences and its application to predict multi-drug resistance transporters (MDRs) from bacteria. We first showmore » that our method can recreate known patterns from PROSITE for several motifs from unaligned sequences. We then show that the method, MDRpred, can predict MDRs with greater accuracy and positive predictive value than a collection of currently available family-based models from the Pfam database. Finally, we apply MDRpred to a large collection of protein sequences from an environmental microbiome study to make novel predictions about drug resistance in a potential environmental reservoir.« less
A new multistage groundwater transport inverse method: presentation, evaluation, and implications
Anderman, Evan R.; Hill, Mary C.
1999-01-01
More computationally efficient methods of using concentration data are needed to estimate groundwater flow and transport parameters. This work introduces and evaluates a three‐stage nonlinear‐regression‐based iterative procedure in which trial advective‐front locations link decoupled flow and transport models. Method accuracy and efficiency are evaluated by comparing results to those obtained when flow‐ and transport‐model parameters are estimated simultaneously. The new method is evaluated as conclusively as possible by using a simple test case that includes distinct flow and transport parameters, but does not include any approximations that are problem dependent. The test case is analytical; the only flow parameter is a constant velocity, and the transport parameters are longitudinal and transverse dispersivity. Any difficulties detected using the new method in this ideal situation are likely to be exacerbated in practical problems. Monte‐Carlo analysis of observation error ensures that no specific error realization obscures the results. Results indicate that, while this, and probably other, multistage methods do not always produce optimal parameter estimates, the computational advantage may make them useful in some circumstances, perhaps as a precursor to using a simultaneous method.
The Science of Transportation Analysis and Simulation
NASA Astrophysics Data System (ADS)
Gleibe, John
2010-03-01
Transportation Science focuses on methods developed to model and analyze the interaction between human behavior and transportation systems. From the human behavioral, or demand, perspective, we are interested in how person and households organize their activities across space and time, with travel viewed as an enabling activity. We have a particular interest in how to model the range of responses to public policy and transportation system changes, which leads to the consideration of both short- and long-term decision-making, interpersonal dependencies, and non-transportation-related opportunities and constraints, including household budgets, land use systems and economic systems. This has led to the development of complex structural econometric modeling systems as well as agent-based simulations. From the transportation systems, or supply, perspective we are interested in the level of service provide by transportation facilities, be it auto, transit or multi-modal systems. This has led to the development of network models and equilibrium concepts as well as hybrid simulation systems based on concepts borrowed from physics, such as fluid flow models, and cellular automata-type models. In this presentation, we review a representative sample of these methods and their use in transportation planning and public policy analysis.
Dissipative time-dependent quantum transport theory.
Zhang, Yu; Yam, Chi Yung; Chen, GuanHua
2013-04-28
A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.
NASA Astrophysics Data System (ADS)
Khe Sun, Pak; Vorona-Slivinskaya, Lubov; Voskresenskay, Elena
2017-10-01
The article highlights the necessity of a complex approach to assess economic security of municipalities, which would consider municipal management specifics. The approach allows comparing the economic security level of municipalities, but it does not describe parameter differences between compared municipalities. Therefore, there is a second method suggested: parameter rank order method. Applying these methods allowed to figure out the leaders and outsiders of the economic security among municipalities and rank all economic security parameters according to the significance level. Complex assessment of the economic security of municipalities, based on the combination of the two approaches, allowed to assess the security level more accurate. In order to assure economic security and equalize its threshold values, one should pay special attention to transportation system development in municipalities. Strategic aims of projects in the area of transportation infrastructure development in municipalities include the following issues: contribution into creating and elaborating transportation logistics and manufacture transport complexes, development of transportation infrastructure with account of internal and external functions of the region, public transport development, improvement of transport security and reducing its negative influence on the environment.
NASA Technical Reports Server (NTRS)
Langtry, R. B.; Menter, F. R.; Likki, S. R.; Suzen, Y. B.; Huang, P. G.; Volker, S.
2006-01-01
A new correlation-based transition model has been developed, which is built strictly on local variables. As a result, the transition model is compatible with modern computational fluid dynamics (CFD) methods using unstructured grids and massive parallel execution. The model is based on two transport equations, one for the intermittency and one for the transition onset criteria in terms of momentum thickness Reynolds number. The proposed transport equations do not attempt to model the physics of the transition process (unlike, e.g., turbulence models), but form a framework for the implementation of correlation-based models into general-purpose CFD methods.
Optimization-based method for automated road network extraction
DOT National Transportation Integrated Search
2001-09-18
Automated road information extraction has significant applicability in transportation. : It provides a means for creating, maintaining, and updating transportation network databases that : are needed for purposes ranging from traffic management to au...
A simulation-based probabilistic design method for arctic sea transport systems
NASA Astrophysics Data System (ADS)
Martin, Bergström; Ove, Erikstad Stein; Sören, Ehlers
2016-12-01
When designing an arctic cargo ship, it is necessary to consider multiple stochastic factors. This paper evaluates the merits of a simulation-based probabilistic design method specifically developed to deal with this challenge. The outcome of the paper indicates that the incorporation of simulations and probabilistic design parameters into the design process enables more informed design decisions. For instance, it enables the assessment of the stochastic transport capacity of an arctic ship, as well as of its long-term ice exposure that can be used to determine an appropriate level of ice-strengthening. The outcome of the paper also indicates that significant gains in transport system cost-efficiency can be obtained by extending the boundaries of the design task beyond the individual vessel. In the case of industrial shipping, this allows for instance the consideration of port-based cargo storage facilities allowing for temporary shortages in transport capacity and thus a reduction in the required fleet size / ship capacity.
Development of a point-kinetic verification scheme for nuclear reactor applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
Demazière, C., E-mail: demaz@chalmers.se; Dykin, V.; Jareteg, K.
In this paper, a new method that can be used for checking the proper implementation of time- or frequency-dependent neutron transport models and for verifying their ability to recover some basic reactor physics properties is proposed. This method makes use of the application of a stationary perturbation to the system at a given frequency and extraction of the point-kinetic component of the system response. Even for strongly heterogeneous systems for which an analytical solution does not exist, the point-kinetic component follows, as a function of frequency, a simple analytical form. The comparison between the extracted point-kinetic component and its expectedmore » analytical form provides an opportunity to verify and validate neutron transport solvers. The proposed method is tested on two diffusion-based codes, one working in the time domain and the other working in the frequency domain. As long as the applied perturbation has a non-zero reactivity effect, it is demonstrated that the method can be successfully applied to verify and validate time- or frequency-dependent neutron transport solvers. Although the method is demonstrated in the present paper in a diffusion theory framework, higher order neutron transport methods could be verified based on the same principles.« less
Transport induced by mean-eddy interaction: I. Theory, and relation to Lagrangian lobe dynamics
NASA Astrophysics Data System (ADS)
Ide, Kayo; Wiggins, Stephen
2015-02-01
In this paper we develop a method for the estimation of Transport Induced by the Mean-Eddy interaction (TIME) in two-dimensional unsteady flows. The method is based on the dynamical systems approach to fluid transport and can be viewed as a hybrid combination of Lagrangian and Eulerian methods. The (Eulerian) boundaries across which we consider (Lagrangian) transport are kinematically defined by appropriately chosen streamlines of the mean flow. By evaluating the impact of the mean-eddy interaction on transport, the TIME method can be used as a diagnostic tool for transport processes that occur during a specified time interval along a specified boundary segment. We introduce two types of TIME functions: one that quantifies the accumulation of flow properties and another that measures the displacement of the transport geometry. The spatial geometry of transport is described by the so-called pseudo-lobes, and temporal evolution of transport by their dynamics. In the case where the TIME functions are evaluated along a separatrix, the pseudo-lobes have a relationship to the lobes of Lagrangian transport theory. In fact, one of the TIME functions is identical to the Melnikov function that is used to measure the distance, at leading order in a small parameter, between the two invariant manifolds that define the Lagrangian lobes. We contrast the similarities and differences between the TIME and Lagrangian lobe dynamics in detail. An application of the TIME method is carried out for inter-gyre transport in the wind-driven oceanic circulation model and a comparison with the Lagrangian transport theory is made.
Effective description of a 3D object for photon transportation in Monte Carlo simulation
NASA Astrophysics Data System (ADS)
Suganuma, R.; Ogawa, K.
2000-06-01
Photon transport simulation by means of the Monte Carlo method is an indispensable technique for examining scatter and absorption correction methods in SPECT and PET. The authors have developed a method for object description with maximum size regions (maximum rectangular regions: MRRs) to speed up photon transport simulation, and compared the computation time with that for conventional object description methods, a voxel-based (VB) method and an octree method, in the simulations of two kinds of phantoms. The simulation results showed that the computation time with the proposed method became about 50% of that with the VD method and about 70% of that with the octree method for a high resolution MCAT phantom. Here, details of the expansion of the MRR method to three dimensions are given. Moreover, the effectiveness of the proposed method was compared with the VB and octree methods.
The transport of nuclear power plant components. [via airships
NASA Technical Reports Server (NTRS)
Keating, S. J., Jr.
1975-01-01
The problems of transporting nuclear power plant components to landlocked sites where the usual mode of transport by barge cannot be used are considered. Existing methods of ground-based overland transport are discussed and their costs presented. Components are described and traffic density projections made to the year 2000. Plots of units transported versus distance transported are provided for units booked in 1973 and booked and proposed in 1974. It is shown that, for these cases, overland transport requirements for the industry will be over 5,000,000 ton-miles/year while a projection based on increasing energy demands shows that this figure will increase significantly by the year 2000. The payload size, distances, and costs of existing overland modes are significant enough to consider development of a lighter than air (LTA) mode for transporting NSSS components.
Validation and application of Acoustic Mapping Velocimetry
NASA Astrophysics Data System (ADS)
Baranya, Sandor; Muste, Marian
2016-04-01
The goal of this paper is to introduce a novel methodology to estimate bedload transport in rivers based on an improved bedform tracking procedure. The measurement technique combines components and processing protocols from two contemporary nonintrusive instruments: acoustic and image-based. The bedform mapping is conducted with acoustic surveys while the estimation of the velocity of the bedforms is obtained with processing techniques pertaining to image-based velocimetry. The technique is therefore called Acoustic Mapping Velocimetry (AMV). The implementation of this technique produces a whole-field velocity map associated with the multi-directional bedform movement. Based on the calculated two-dimensional bedform migration velocity field, the bedload transport estimation is done using the Exner equation. A proof-of-concept experiment was performed to validate the AMV based bedload estimation in a laboratory flume at IIHR-Hydroscience & Engineering (IIHR). The bedform migration was analysed at three different flow discharges. Repeated bed geometry mapping, using a multiple transducer array (MTA), provided acoustic maps, which were post-processed with a particle image velocimetry (PIV) method. Bedload transport rates were calculated along longitudinal sections using the streamwise components of the bedform velocity vectors and the measured bedform heights. The bulk transport rates were compared with the results from concurrent direct physical samplings and acceptable agreement was found. As a first field implementation of the AMV an attempt was made to estimate bedload transport for a section of the Ohio river in the United States, where bed geometry maps, resulted by repeated multibeam echo sounder (MBES) surveys, served as input data. Cross-sectional distributions of bedload transport rates from the AMV based method were compared with the ones obtained from another non-intrusive technique (due to the lack of direct samplings), ISSDOTv2, developed by the US Army Corps of Engineers. The good agreement between the results from the two different methods is encouraging and suggests further field tests in varying hydro-morphological situations.
A PERFECT MATCH CONDITION FOR POINT-SET MATCHING PROBLEMS USING THE OPTIMAL MASS TRANSPORT APPROACH
CHEN, PENGWEN; LIN, CHING-LONG; CHERN, I-LIANG
2013-01-01
We study the performance of optimal mass transport-based methods applied to point-set matching problems. The present study, which is based on the L2 mass transport cost, states that perfect matches always occur when the product of the point-set cardinality and the norm of the curl of the non-rigid deformation field does not exceed some constant. This analytic result is justified by a numerical study of matching two sets of pulmonary vascular tree branch points whose displacement is caused by the lung volume changes in the same human subject. The nearly perfect match performance verifies the effectiveness of this mass transport-based approach. PMID:23687536
Geomorphically based predictive mapping of soil thickness in upland watersheds
NASA Astrophysics Data System (ADS)
Pelletier, Jon D.; Rasmussen, Craig
2009-09-01
The hydrologic response of upland watersheds is strongly controlled by soil (regolith) thickness. Despite the need to quantify soil thickness for input into hydrologic models, there is currently no widely used, geomorphically based method for doing so. In this paper we describe and illustrate a new method for predictive mapping of soil thicknesses using high-resolution topographic data, numerical modeling, and field-based calibration. The model framework works directly with input digital elevation model data to predict soil thicknesses assuming a long-term balance between soil production and erosion. Erosion rates in the model are quantified using one of three geomorphically based sediment transport models: nonlinear slope-dependent transport, nonlinear area- and slope-dependent transport, and nonlinear depth- and slope-dependent transport. The model balances soil production and erosion locally to predict a family of solutions corresponding to a range of values of two unconstrained model parameters. A small number of field-based soil thickness measurements can then be used to calibrate the local value of those unconstrained parameters, thereby constraining which solution is applicable at a particular study site. As an illustration, the model is used to predictively map soil thicknesses in two small, ˜0.1 km2, drainage basins in the Marshall Gulch watershed, a semiarid drainage basin in the Santa Catalina Mountains of Pima County, Arizona. Field observations and calibration data indicate that the nonlinear depth- and slope-dependent sediment transport model is the most appropriate transport model for this site. The resulting framework provides a generally applicable, geomorphically based tool for predictive mapping of soil thickness using high-resolution topographic data sets.
Research on Evaluation of resource allocation efficiency of transportation system based on DEA
NASA Astrophysics Data System (ADS)
Zhang, Zhehui; Du, Linan
2017-06-01
In this paper, we select the time series data onto 1985-2015 years, construct the land (shoreline) resources, capital and labor as inputs. The index system of the output is freight volume and passenger volume, we use Quantitative analysis based on DEA method evaluated the resource allocation efficiency of railway, highway, water transport and civil aviation in China. Research shows that the resource allocation efficiency of various modes of transport has obvious difference, and the impact on scale efficiency is more significant. The most important two ways to optimize the allocation of resources to improve the efficiency of the combination of various modes of transport is promoting the co-ordination of various modes of transport and constructing integrated transportation system.
Intercomparison of 3D pore-scale flow and solute transport simulation methods
Mehmani, Yashar; Schoenherr, Martin; Pasquali, Andrea; ...
2015-09-28
Multiple numerical approaches have been developed to simulate porous media fluid flow and solute transport at the pore scale. These include 1) methods that explicitly model the three-dimensional geometry of pore spaces and 2) methods that conceptualize the pore space as a topologically consistent set of stylized pore bodies and pore throats. In previous work we validated a model of the first type, using computational fluid dynamics (CFD) codes employing a standard finite volume method (FVM), against magnetic resonance velocimetry (MRV) measurements of pore-scale velocities. Here we expand that validation to include additional models of the first type based onmore » the lattice Boltzmann method (LBM) and smoothed particle hydrodynamics (SPH), as well as a model of the second type, a pore-network model (PNM). The PNM approach used in the current study was recently improved and demonstrated to accurately simulate solute transport in a two-dimensional experiment. While the PNM approach is computationally much less demanding than direct numerical simulation methods, the effect of conceptualizing complex three-dimensional pore geometries on solute transport in the manner of PNMs has not been fully determined. We apply all four approaches (FVM-based CFD, LBM, SPH and PNM) to simulate pore-scale velocity distributions and (for capable codes) nonreactive solute transport, and intercompare the model results. Comparisons are drawn both in terms of macroscopic variables (e.g., permeability, solute breakthrough curves) and microscopic variables (e.g., local velocities and concentrations). Generally good agreement was achieved among the various approaches, but some differences were observed depending on the model context. The intercomparison work was challenging because of variable capabilities of the codes, and inspired some code enhancements to allow consistent comparison of flow and transport simulations across the full suite of methods. This paper provides support for confidence in a variety of pore-scale modeling methods and motivates further development and application of pore-scale simulation methods.« less
Intercomparison of 3D pore-scale flow and solute transport simulation methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Xiaofan; Mehmani, Yashar; Perkins, William A.
2016-09-01
Multiple numerical approaches have been developed to simulate porous media fluid flow and solute transport at the pore scale. These include 1) methods that explicitly model the three-dimensional geometry of pore spaces and 2) methods that conceptualize the pore space as a topologically consistent set of stylized pore bodies and pore throats. In previous work we validated a model of the first type, using computational fluid dynamics (CFD) codes employing a standard finite volume method (FVM), against magnetic resonance velocimetry (MRV) measurements of pore-scale velocities. Here we expand that validation to include additional models of the first type based onmore » the lattice Boltzmann method (LBM) and smoothed particle hydrodynamics (SPH), as well as a model of the second type, a pore-network model (PNM). The PNM approach used in the current study was recently improved and demonstrated to accurately simulate solute transport in a two-dimensional experiment. While the PNM approach is computationally much less demanding than direct numerical simulation methods, the effect of conceptualizing complex three-dimensional pore geometries on solute transport in the manner of PNMs has not been fully determined. We apply all four approaches (FVM-based CFD, LBM, SPH and PNM) to simulate pore-scale velocity distributions and (for capable codes) nonreactive solute transport, and intercompare the model results. Comparisons are drawn both in terms of macroscopic variables (e.g., permeability, solute breakthrough curves) and microscopic variables (e.g., local velocities and concentrations). Generally good agreement was achieved among the various approaches, but some differences were observed depending on the model context. The intercomparison work was challenging because of variable capabilities of the codes, and inspired some code enhancements to allow consistent comparison of flow and transport simulations across the full suite of methods. This study provides support for confidence in a variety of pore-scale modeling methods and motivates further development and application of pore-scale simulation methods.« less
Intercomparison of 3D pore-scale flow and solute transport simulation methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Xiaofan; Mehmani, Yashar; Perkins, William A.
2016-09-01
Multiple numerical approaches have been developed to simulate porous media fluid flow and solute transport at the pore scale. These include methods that 1) explicitly model the three-dimensional geometry of pore spaces and 2) those that conceptualize the pore space as a topologically consistent set of stylized pore bodies and pore throats. In previous work we validated a model of class 1, based on direct numerical simulation using computational fluid dynamics (CFD) codes, against magnetic resonance velocimetry (MRV) measurements of pore-scale velocities. Here we expand that validation to include additional models of class 1 based on the immersed-boundary method (IMB),more » lattice Boltzmann method (LBM), smoothed particle hydrodynamics (SPH), as well as a model of class 2 (a pore-network model or PNM). The PNM approach used in the current study was recently improved and demonstrated to accurately simulate solute transport in a two-dimensional experiment. While the PNM approach is computationally much less demanding than direct numerical simulation methods, the effect of conceptualizing complex three-dimensional pore geometries on solute transport in the manner of PNMs has not been fully determined. We apply all four approaches (CFD, LBM, SPH and PNM) to simulate pore-scale velocity distributions and nonreactive solute transport, and intercompare the model results with previously reported experimental observations. Experimental observations are limited to measured pore-scale velocities, so solute transport comparisons are made only among the various models. Comparisons are drawn both in terms of macroscopic variables (e.g., permeability, solute breakthrough curves) and microscopic variables (e.g., local velocities and concentrations).« less
Ma, Changxi; Hao, Wei; Pan, Fuquan; Xiang, Wang
2018-01-01
Route optimization of hazardous materials transportation is one of the basic steps in ensuring the safety of hazardous materials transportation. The optimization scheme may be a security risk if road screening is not completed before the distribution route is optimized. For road screening issues of hazardous materials transportation, a road screening algorithm of hazardous materials transportation is built based on genetic algorithm and Levenberg-Marquardt neural network (GA-LM-NN) by analyzing 15 attributes data of each road network section. A multi-objective robust optimization model with adjustable robustness is constructed for the hazardous materials transportation problem of single distribution center to minimize transportation risk and time. A multi-objective genetic algorithm is designed to solve the problem according to the characteristics of the model. The algorithm uses an improved strategy to complete the selection operation, applies partial matching cross shift and single ortho swap methods to complete the crossover and mutation operation, and employs an exclusive method to construct Pareto optimal solutions. Studies show that the sets of hazardous materials transportation road can be found quickly through the proposed road screening algorithm based on GA-LM-NN, whereas the distribution route Pareto solutions with different levels of robustness can be found rapidly through the proposed multi-objective robust optimization model and algorithm.
Transport phenomena in polymer electrolyte membrane fuel cells via voltage loss breakdown
NASA Astrophysics Data System (ADS)
Flick, Sarah; Dhanushkodi, Shankar R.; Mérida, Walter
2015-04-01
This study presents a voltage loss breakdown method based on in-situ experimental data to systematically analyze the different overpotentials of a polymer electrolyte membrane fuel cell. This study includes a systematic breakdown of the anodic overpotentials via the use of a reference electrode system. This work demonstrates the de-convolution of the individual overpotentials for both anode and cathode side, including the distinction between mass-transport overpotentials in cathode porous transport layer (PTL) and electrode, based on in-situ polarization tests under different operating conditions. This method is used to study the relationship between mass-transport losses inside the cathode catalyst layer (CL) and the PTL for both a single layer and two-layer PTL configuration. We conclude that the micro-porous layer (MPL) significantly improves the water removal within the cell, especially inside the cathode electrode, and therefore the mass transport within the cathode CL. This study supports the theory that the MPL on the cathode leads to an increase in water permeation from cathode to anode due to its function as a capillary barrier. This is reflected in increased anodic mass-transport overpotential, decreased ohmic losses and decreased cathode mass-transport losses, especially in the cathode electrode.
Application of State Quantization-Based Methods in HEP Particle Transport Simulation
NASA Astrophysics Data System (ADS)
Santi, Lucio; Ponieman, Nicolás; Jun, Soon Yung; Genser, Krzysztof; Elvira, Daniel; Castro, Rodrigo
2017-10-01
Simulation of particle-matter interactions in complex geometries is one of the main tasks in high energy physics (HEP) research. An essential aspect of it is an accurate and efficient particle transportation in a non-uniform magnetic field, which includes the handling of volume crossings within a predefined 3D geometry. Quantized State Systems (QSS) is a family of numerical methods that provides attractive features for particle transportation processes, such as dense output (sequences of polynomial segments changing only according to accuracy-driven discrete events) and lightweight detection and handling of volume crossings (based on simple root-finding of polynomial functions). In this work we present a proof-of-concept performance comparison between a QSS-based standalone numerical solver and an application based on the Geant4 simulation toolkit, with its default Runge-Kutta based adaptive step method. In a case study with a charged particle circulating in a vacuum (with interactions with matter turned off), in a uniform magnetic field, and crossing up to 200 volume boundaries twice per turn, simulation results showed speedups of up to 6 times in favor of QSS while it being 10 times slower in the case with zero volume boundaries.
Research on Assessment Methods for Urban Public Transport Development in China
Zou, Linghong; Guo, Hongwei
2014-01-01
In recent years, with the rapid increase in urban population, the urban travel demands in Chinese cities have been increasing dramatically. As a result, developing comprehensive urban transport systems becomes an inevitable choice to meet the growing urban travel demands. In urban transport systems, public transport plays the leading role to promote sustainable urban development. This paper aims to establish an assessment index system for the development level of urban public transport consisting of a target layer, a criterion layer, and an index layer. Review on existing literature shows that methods used in evaluating urban public transport structure are dominantly qualitative. To overcome this shortcoming, fuzzy mathematics method is used for describing qualitative issues quantitatively, and AHP (analytic hierarchy process) is used to quantify expert's subjective judgment. The assessment model is established based on the fuzzy AHP. The weight of each index is determined through the AHP and the degree of membership of each index through the fuzzy assessment method to obtain the fuzzy synthetic assessment matrix. Finally, a case study is conducted to verify the rationality and practicability of the assessment system and the proposed assessment method. PMID:25530756
Transport characteristics of nanoparticle-based ferrofluids in a gel model of the brain
Basak, Soubir; Brogan, David; Dietrich, Hans; Ritter, Rogers; Dacey, Ralph G; Biswas, Pratim
2009-01-01
A current advance in nanotechnology is the selective targeting of therapeutics by external magnetic field-guided delivery. This is an important area of research in medicine. The use of magnetic forces results in the formation of agglomerated structures in the field region. The transport characteristics of these agglomerated structures are explored. A nonintrusive method based on in situ light-scattering techniques is used to characterize the velocity of such particles in a magnetic field gradient. A transport model for the chain-like agglomerates is developed based on these experimental observations. The transport characteristics of magnetic nanoparticle drug carriers are then explored in gel-based simulated models of the brain. Results of such measurements demonstrate decreased diffusion of magnetic nanoparticles when placed in a high magnetic field gradient. PMID:19421367
Zhang, Zelun; Poslad, Stefan
2013-01-01
Wearable and accompanied sensors and devices are increasingly being used for user activity recognition. However, typical GPS-based and accelerometer-based (ACC) methods face three main challenges: a low recognition accuracy; a coarse recognition capability, i.e., they cannot recognise both human posture (during travelling) and transportation mode simultaneously, and a relatively high computational complexity. Here, a new GPS and Foot-Force (GPS + FF) sensor method is proposed to overcome these challenges that leverages a set of wearable FF sensors in combination with GPS, e.g., in a mobile phone. User mobility activities that can be recognised include both daily user postures and common transportation modes: sitting, standing, walking, cycling, bus passenger, car passenger (including private cars and taxis) and car driver. The novelty of this work is that our approach provides a more comprehensive recognition capability in terms of reliably recognising both human posture and transportation mode simultaneously during travel. In addition, by comparing the new GPS + FF method with both an ACC method (62% accuracy) and a GPS + ACC based method (70% accuracy) as baseline methods, it obtains a higher accuracy (95%) with less computational complexity, when tested on a dataset obtained from ten individuals. PMID:24189333
DOE Office of Scientific and Technical Information (OSTI.GOV)
Teja, A.S.; King, R.K.; Sun, T.F.
1999-01-01
Two methods are presented for the correlation and prediction of the viscosities and thermal conductivities of refrigerants R11, R12, R22, R32, R124, R125, R134a, R141b, and R152 and their mixtures. The first (termed RHS1) is a modified rough-hard-sphere method based on the smooth hard-sphere correlations of Assael et al. The method requires two or three parameters for characterizing each refrigerant but is able to correlate transport properties over wide ranges of pressure and temperature. The second method (RHS2) is also a modified rough-hard-sphere method, but based on an effective hard-sphere diameter for Lennard-Jones (LJ) fluids. The LJ parameters and themore » effective hard-sphere diameter required in this method are determined from a knowledge of the density-temperature behavior of the fluid at saturation. Comparisons with the rough-hard-sphere method of Assael and co-workers (RHS3) are shown. They also show that the RHS2 method can be used to correlate as well as predict the transport properties of refrigerants.« less
Li, Jiaqian; Zhou, Xiaofeng; Li, Jing; Che, Lufeng; Yao, Jun; McHale, Glen; Chaudhury, Manoj K.; Wang, Zuankai
2017-01-01
The last two decades have witnessed an explosion of interest in the field of droplet-based microfluidics for their multifarious applications. Despite rapid innovations in strategies to generate small-scale liquid transport on these devices, the speed of motion is usually slow, the transport distance is limited, and the flow direction is not well controlled because of unwanted pinning of contact lines by defects on the surface. We report a new method of microscopic liquid transport based on a unique topological structure. This method breaks the contact line pinning through efficient conversion of excess surface energy to kinetic energy at the advancing edge of the droplet while simultaneously arresting the reverse motion of the droplet via strong pinning. This results in a novel topological fluid diode that allows for a rapid, directional, and long-distance transport of virtually any kind of liquid without the need for an external energy input. PMID:29098182
Alternative methods of flexible base compaction acceptance.
DOT National Transportation Integrated Search
2012-05-01
In the Texas Department of Transportation, flexible base construction is governed by a series of stockpile : and field tests. A series of concerns with these existing methods, along with some premature failures in the : field, led to this project inv...
NASA Astrophysics Data System (ADS)
Oh, Dong Keun; Hong, Sung Mok; Lee, Cheol Eui; Kim, B.-S.; Jin, J.-I.
2005-12-01
Using the time of flight (ToF) method, we investigated the bipolar charge transport for two glass-forming molecules containing carbazole and cyano-carbazole moiety. The enhanced electron mobility was observed in the cyano-carbazole compound. From the numerical method based the Laplace formalism, the distribution of hole trapping energy was obtained for the carbazole compound. This result was compared with the exponential distribution extracted from dispersion parameter for the cyano-carbazole material. Considering charge-dipole interactions as a reason for the disordered trapping mechanism, we discussed dispersive charge transport induced by a strong dipolar (i.e. cyano) group by comparing the distributions of hole trapping sites for two compounds.
NASA Astrophysics Data System (ADS)
Oliveira, R.; Bijeljic, B.; Blunt, M. J.; Colbourne, A.; Sederman, A. J.; Mantle, M. D.; Gladden, L. F.
2017-12-01
Mixing and reactive processes have a large impact on the viability of enhanced oil and gas recovery projects that involve acid stimulation and CO2 injection. To achieve a successful design of the injection schemes an accurate understanding of the interplay between pore structure, flow and reactive transport is necessary. Dependent on transport and reactive conditions, this complex coupling can also be dependent on initial rock heterogeneity across a variety of scales. To address these issues, we devise a new method to study transport and reactive flow in porous media at multiple scales. The transport model is based on an efficient Particle Tracking Method based on Continuous Time Random Walks (CTRW-PTM) on a lattice. Transport is modelled using an algorithm described in Rhodes and Blunt (2006) and Srinivasan et al. (2010); this model is expanded to enable for reactive flow predictions in subsurface rock undergoing a first-order fluid/solid chemical reaction. The reaction-induced alteration in fluid/solid interface is accommodated in the model through changes in porosity and flow field, leading to time dependent transport characteristics in the form of transit time distributions which account for rock heterogeneity change. This also enables the study of concentration profiles at the scale of interest. Firstly, we validate transport model by comparing the probability of molecular displacement (propagators) measured by Nuclear Magnetic Resonance (NMR) with our modelled predictions for concentration profiles. The experimental propagators for three different porous media of increasing complexity, a beadpack, a Bentheimer sandstone and a Portland carbonate, show a good agreement with the model. Next, we capture the time evolution of the propagators distribution in a reactive flow experiment, where hydrochloric acid is injected into a limestone rock. We analyse the time-evolving non-Fickian signatures for the transport during reactive flow and observe an increase in transport heterogeneity at latter times, representing the increase in rock heterogeneity. Evolution of transit time distribution is associated with the evolution of concentration profiles, thus highlighting the impact of initial rock structure on the reactive transport for a range of Pe and Da numbers.
Characterization of transport phenomena in porous transport layers using X-ray microtomography
NASA Astrophysics Data System (ADS)
Hasanpour, S.; Hoorfar, M.; Phillion, A. B.
2017-06-01
Among different methods available for estimating the transport properties of porous transport layers (PTLs) of polymer electrolyte membrane fuel cells, X-ray micro computed tomography (X-μCT) imaging in combination with image-based numerical simulation has been recognized as a viable tool. In this study, four commercially-available single-layer and dual-layer PTLs are analyzed using this method in order to compare and contrast transport properties between different PTLs, as well as the variability within a single sheet. Complete transport property datasets are created for each PTL. The simulation predictions indicate that PTLs with high porosity show considerable variability in permeability and effective diffusivity, while PTLs with low porosity do not. Furthermore, it is seen that the Tomadakis-Sotirchos (TS) analytical expressions for porous media match the image-based simulations when porosity is relatively low but predict higher permeability and effective diffusivity for porosity values greater than 80%. Finally, the simulations show that cracks within MPL of dual-layer PTLs have a significant effect on the overall permeability and effective diffusivity of the PTLs. This must be considered when estimating the transport properties of dual-layer PTLs. These findings can be used to improve macro-scale models of product and reactant transport within fuel cells, and ultimately, fuel cell efficiency.
Li, Haiquan; Dai, Xinbin; Zhao, Xuechun
2008-05-01
Membrane transport proteins play a crucial role in the import and export of ions, small molecules or macromolecules across biological membranes. Currently, there are a limited number of published computational tools which enable the systematic discovery and categorization of transporters prior to costly experimental validation. To approach this problem, we utilized a nearest neighbor method which seamlessly integrates homologous search and topological analysis into a machine-learning framework. Our approach satisfactorily distinguished 484 transporter families in the Transporter Classification Database, a curated and representative database for transporters. A five-fold cross-validation on the database achieved a positive classification rate of 72.3% on average. Furthermore, this method successfully detected transporters in seven model and four non-model organisms, ranging from archaean to mammalian species. A preliminary literature-based validation has cross-validated 65.8% of our predictions on the 11 organisms, including 55.9% of our predictions overlapping with 83.6% of the predicted transporters in TransportDB.
Zamek-Gliszczynski, MJ; Lee, CA; Poirier, A; Bentz, J; Chu, X; Ellens, H; Ishikawa, T; Jamei, M; Kalvass, JC; Nagar, S; Pang, KS; Korzekwa, K; Swaan, PW; Taub, ME; Zhao, P; Galetin, A
2013-01-01
This white paper provides a critical analysis of methods for estimating transporter kinetics and recommendations on proper parameter calculation in various experimental systems. Rational interpretation of transporter-knockout animal findings and application of static and dynamic physiologically based modeling approaches for prediction of human transporter-mediated pharmacokinetics and drug–drug interactions (DDIs) are presented. The objective is to provide appropriate guidance for the use of in vitro, in vivo, and modeling tools in translational transporter science. PMID:23588311
Engineering intracellular active transport systems as in vivo biomolecular tools.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bachand, George David; Carroll-Portillo, Amanda
2006-11-01
Active transport systems provide essential functions in terms of cell physiology and metastasis. These systems, however, are also co-opted by invading viruses, enabling directed transport of the virus to and from the cell's nucleus (i.e., the site of virus replication). Based on this concept, fundamentally new approaches for interrogating and manipulating the inner workings of living cells may be achievable by co-opting Nature's active transport systems as an in vivo biomolecular tool. The overall goal of this project was to investigate the ability to engineer kinesin-based transport systems for in vivo applications, specifically the collection of effector proteins (e.g., transcriptionalmore » regulators) within single cells. In the first part of this project, a chimeric fusion protein consisting of kinesin and a single chain variable fragment (scFv) of an antibody was successfully produced through a recombinant expression system. The kinesin-scFv retained both catalytic and antigenic functionality, enabling selective capture and transport of target antigens. The incorporation of a rabbit IgG-specific scFv into the kinesin established a generalized system for functionalizing kinesin with a wide range of target-selective antibodies raised in rabbits. The second objective was to develop methods of isolating the intact microtubule network from live cells as a platform for evaluating kinesin-based transport within the cytoskeletal architecture of a cell. Successful isolation of intact microtubule networks from two distinct cell types was demonstrated using glutaraldehyde and methanol fixation methods. This work provides a platform for inferring the ability of kinesin-scFv to function in vivo, and may also serve as a three-dimensional scaffold for evaluating and exploiting kinesin-based transport for nanotechnological applications. Overall, the technology developed in this project represents a first-step in engineering active transport system for in vivo applications. Further development could potentially enable selective capture of intracellular antigens, targeted delivery of therapeutic agents, or disruption of the transport systems and consequently the infection and pathogenesis cycle of biothreat agents.« less
NASA Technical Reports Server (NTRS)
Stern, Martin O.
1992-01-01
This report describes a study to evaluate the benefits of advanced propulsion technologies for transporting materials between low Earth orbit and the Moon. A relatively conventional reference transportation system, and several other systems, each of which includes one advanced technology component, are compared in terms of how well they perform a chosen mission objective. The evaluation method is based on a pairwise life-cycle cost comparison of each of the advanced systems with the reference system. Somewhat novel and economically important features of the procedure are the inclusion not only of mass payback ratios based on Earth launch costs, but also of repair and capital acquisition costs, and of adjustments in the latter to reflect the technological maturity of the advanced technologies. The required input information is developed by panels of experts. The overall scope and approach of the study are presented in the introduction. The bulk of the paper describes the evaluation method; the reference system and an advanced transportation system, including a spinning tether in an eccentric Earth orbit, are used to illustrate it.
NASA Astrophysics Data System (ADS)
Zahid, F.; Paulsson, M.; Polizzi, E.; Ghosh, A. W.; Siddiqui, L.; Datta, S.
2005-08-01
We present a transport model for molecular conduction involving an extended Hückel theoretical treatment of the molecular chemistry combined with a nonequilibrium Green's function treatment of quantum transport. The self-consistent potential is approximated by CNDO (complete neglect of differential overlap) method and the electrostatic effects of metallic leads (bias and image charges) are included through a three-dimensional finite element method. This allows us to capture spatial details of the electrostatic potential profile, including effects of charging, screening, and complicated electrode configurations employing only a single adjustable parameter to locate the Fermi energy. As this model is based on semiempirical methods it is computationally inexpensive and flexible compared to ab initio models, yet at the same time it is able to capture salient qualitative features as well as several relevant quantitative details of transport. We apply our model to investigate recent experimental data on alkane dithiol molecules obtained in a nanopore setup. We also present a comparison study of single molecule transistors and identify electronic properties that control their performance.
Advanced space-based InSAR risk analysis of planned and existing transportation infrastructure.
DOT National Transportation Integrated Search
2017-03-21
The purpose of this document is to summarize activities by Stanford University and : MDA Geospatial Services Inc. (MDA) to estimate surface deformation and associated : risk to transportation infrastructure using SAR Interferometric methods for the :...
Production of synthetic winds for the Global Reference Atmosphere Model (GRAM)
DOT National Transportation Integrated Search
2010-12-15
The Aerospace Corporation was tasked by the Volpe National Transportation systems Center to provide technical support to the Federal Aviation Administration, Office of Commercial Space Transportation (FAA/AST), in developing a method based on Princip...
NASA Astrophysics Data System (ADS)
Alcuson, J. A.; Reynolds-Barredo, J. M.; Mier, J. A.; Sanchez, Raul; Del-Castillo-Negrete, Diego; Newman, David E.; Tribaldos, V.
2015-11-01
A method to determine fractional transport exponents in systems dominated by fluid or plasma turbulence is proposed. The method is based on the estimation of the integro-differential kernel that relates values of the fluxes and gradients of the transported field, and its comparison with the family of analytical kernels of the linear fractional transport equation. Although use of this type of kernels has been explored before in this context, the methodology proposed here is rather unique since the connection with specific fractional equations is exploited from the start. The procedure has been designed to be particularly well-suited for application in experimental setups, taking advantage of the fact that kernel determination only requires temporal data of the transported field measured on an Eulerian grid. The simplicity and robustness of the method is tested first by using fabricated data from continuous-time random walk models built with prescribed transport characteristics. Its strengths are then illustrated on numerical Eulerian data gathered from simulations of a magnetically confined turbulent plasma in a near-critical regime, that is known to exhibit superdiffusive radial transport
NASA Astrophysics Data System (ADS)
de Smet, Jeroen H.; van den Berg, Arie P.; Vlaar, Nico J.; Yuen, David A.
2000-03-01
Purely advective transport of composition is of major importance in the Geosciences, and efficient and accurate solution methods are needed. A characteristics-based method is used to solve the transport equation. We employ a new hybrid interpolation scheme, which allows for the tuning of stability and accuracy through a threshold parameter ɛth. Stability is established by bilinear interpolations, and bicubic splines are used to maintain accuracy. With this scheme, numerical instabilities can be suppressed by allowing numerical diffusion to work in time and locally in space. The scheme can be applied efficiently for preliminary modelling purposes. This can be followed by detailed high-resolution experiments. First, the principal effects of this hybrid interpolation method are illustrated and some tests are presented for numerical solutions of the transport equation. Second, we illustrate that this approach works successfully for a previously developed continental evolution model for the convecting upper mantle. In this model the transport equation contains a source term, which describes the melt production in pressure-released partial melting. In this model, a characteristic phenomenon of small-scale melting diapirs is observed (De Smet et al.1998; De Smet et al. 1999). High-resolution experiments with grid cells down to 700m horizontally and 515m vertically result in highly detailed observations of the diapiric melting phenomenon.
Structural analysis for preliminary design of High Speed Civil Transport (HSCT)
NASA Technical Reports Server (NTRS)
Bhatia, Kumar G.
1992-01-01
In the preliminary design environment, there is a need for quick evaluation of configuration and material concepts. The simplified beam representations used in the subsonic, high aspect ratio wing platform are not applicable for low aspect ratio configurations typical of supersonic transports. There is a requirement to develop methods for efficient generation of structural arrangement and finite element representation to support multidisciplinary analysis and optimization. In addition, empirical data bases required to validate prediction methods need to be improved for high speed civil transport (HSCT) type configurations.
NASA Astrophysics Data System (ADS)
Fathirad, Iraj; Devlin, John; Jiang, Frank
2012-09-01
The key-exchange and authentication are two crucial elements of any network security mechanism. IPsec, SSL/TLS, PGP and S/MIME are well-known security approaches in providing security service to network, transport and application layers; these protocols use different methods (based on their requirements) to establish keying materials and authenticates key-negotiation and participated parties. This paper studies and compares the authenticated key negotiation methods in mentioned protocols.
Incorporating Decoherence in the Dynamic Disorder Model of Organic Semiconductors
NASA Astrophysics Data System (ADS)
Si, Wei; Yao, Yao; Wu, Chang-Qin
2014-03-01
The transport phenomena in crystalline organic semiconductors, such as pentacene, have drawn much attention recently, where the electron-phonon interaction plays a crucial role. An important advance is the dynamic disorder model proposed by Troisi et. al., which is successful in determining the carrier mobility and explaining the optical conductivity measurements. In this work, we aim to incorporate the decoherence effects in the dynamic disorder model, which is essential for the self-consistent description of the carrier dynamics. The method is based on the energy-based decoherence correction widely used in the surface hopping algorithm. The resulting dynamics shows a diffusion process of wave packets with finite localization length, which scales with the decoherence time. In addition, the calculated mobility decreases with increasing temperature. Thus the method could describe a band-like transport based on localized states, which is the type of transport anticipated in these materials.
Transport induced by mean-eddy interaction: II. Analysis of transport processes
NASA Astrophysics Data System (ADS)
Ide, Kayo; Wiggins, Stephen
2015-03-01
We present a framework for the analysis of transport processes resulting from the mean-eddy interaction in a flow. The framework is based on the Transport Induced by the Mean-Eddy Interaction (TIME) method presented in a companion paper (Ide and Wiggins, 2014) [1]. The TIME method estimates the (Lagrangian) transport across stationary (Eulerian) boundaries defined by chosen streamlines of the mean flow. Our framework proceeds after first carrying out a sequence of preparatory steps that link the flow dynamics to the transport processes. This includes the construction of the so-called "instantaneous flux" as the Hovmöller diagram. Transport processes are studied by linking the signals of the instantaneous flux field to the dynamical variability of the flow. This linkage also reveals how the variability of the flow contributes to the transport. The spatio-temporal analysis of the flux diagram can be used to assess the efficiency of the variability in transport processes. We apply the method to the double-gyre ocean circulation model in the situation where the Rossby-wave mode dominates the dynamic variability. The spatio-temporal analysis shows that the inter-gyre transport is controlled by the circulating eddy vortices in the fast eastward jet region, whereas the basin-scale Rossby waves have very little impact.
NASA Astrophysics Data System (ADS)
Matiatos, Ioannis; Varouhakis, Emmanouil A.; Papadopoulou, Maria P.
2015-04-01
As the sustainable use of groundwater resources is a great challenge for many countries in the world, groundwater modeling has become a very useful and well established tool for studying groundwater management problems. Based on various methods used to numerically solve algebraic equations representing groundwater flow and contaminant mass transport, numerical models are mainly divided into Finite Difference-based and Finite Element-based models. The present study aims at evaluating the performance of a finite difference-based (MODFLOW-MT3DMS), a finite element-based (FEFLOW) and a hybrid finite element and finite difference (Princeton Transport Code-PTC) groundwater numerical models simulating groundwater flow and nitrate mass transport in the alluvial aquifer of Trizina region in NE Peloponnese, Greece. The calibration of groundwater flow in all models was performed using groundwater hydraulic head data from seven stress periods and the validation was based on a series of hydraulic head data for two stress periods in sufficient numbers of observation locations. The same periods were used for the calibration of nitrate mass transport. The calibration and validation of the three models revealed that the simulated values of hydraulic heads and nitrate mass concentrations coincide well with the observed ones. The models' performance was assessed by performing a statistical analysis of these different types of numerical algorithms. A number of metrics, such as Mean Absolute Error (MAE), Root Mean Square Error (RMSE), Bias, Nash Sutcliffe Model Efficiency (NSE) and Reliability Index (RI) were used allowing the direct comparison of models' performance. Spatiotemporal Kriging (STRK) was also applied using separable and non-separable spatiotemporal variograms to predict water table level and nitrate concentration at each sampling station for two selected hydrological stress periods. The predictions were validated using the respective measured values. Maps of water table level and nitrate concentrations were produced and compared with those obtained from groundwater and mass transport numerical models. Preliminary results showed similar efficiency of the spatiotemporal geostatistical method with the numerical models. However data requirements of the former model were significantly less. Advantages and disadvantages of the methods performance were analysed and discussed indicating the characteristics of the different approaches.
Compressible cavitation with stochastic field method
NASA Astrophysics Data System (ADS)
Class, Andreas; Dumond, Julien
2012-11-01
Non-linear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally the simulation of pdf transport requires Monte-Carlo codes based on Lagrange particles or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic field method solving pdf transport based on Euler fields has been proposed which eliminates the necessity to mix Euler and Lagrange techniques or prescribed pdf assumptions. In the present work, part of the PhD Design and analysis of a Passive Outflow Reducer relying on cavitation, a first application of the stochastic field method to multi-phase flow and in particular to cavitating flow is presented. The application considered is a nozzle subjected to high velocity flow so that sheet cavitation is observed near the nozzle surface in the divergent section. It is demonstrated that the stochastic field formulation captures the wide range of pdf shapes present at different locations. The method is compatible with finite-volume codes where all existing physical models available for Lagrange techniques, presumed pdf or binning methods can be easily extended to the stochastic field formulation.
Guan, YaoYao; Gravitt, Patti E.; Howard, Roslyn; Eby, Yolanda J.; Wang, Shaoming; Li, Belinda; Feng, Changyan; Qiao, You-Lin; Castle, Philip E.
2016-01-01
The current method of transporting self-collected cervicovaginal specimen for HPV DNA testing relies on liquid based medium, which is challenging and expensive to transport. A novel, dry storage and transportation device, Whatman indicating FTA™ Elute Cartridge, avoids some of the pitfalls of liquid-based medium. This method has been shown to be comparable to liquid-based collection medium, but relative performance of self-collected (SC) and clinician-collected (CC) samples onto FTA cards has not been reported. The objective of this study is to compare the analytic performance of self- and clinician-collected samples onto FTA cartridges for the detection of carcinogenic HPV using Linear Array. There was a 91% agreement, 69% positive agreement, and kappa of 0.75 between the clinician-collected and self-collected specimens for detection of any carcinogenic HPV genotype. When the HPV results were categorized hierarchically according to cervical cancer risk, there was no difference in the distribution of the HPV results for the clinician- and self-collected specimens (p = 0.7). This study concludes that FTA elute cartridge is a promising method of specimen transport for cervical cancer screening programs considering using self-collected specimen and HPV testing. Larger studies with clinical endpoints are now needed to assess the clinical performance. PMID:23370404
A new method for estimating carbon dioxide emissions from transportation at fine spatial scales
Shu, Yuqin; Reams, Margaret
2016-01-01
Detailed estimates of carbon dioxide (CO2) emissions at fine spatial scales are useful to both modelers and decision makers who are faced with the problem of global warming and climate change. Globally, transport related emissions of carbon dioxide are growing. This letter presents a new method based on the volume-preserving principle in the areal interpolation literature to disaggregate transportation-related CO2 emission estimates from the county-level scale to a 1 km2 grid scale. The proposed volume-preserving interpolation (VPI) method, together with the distance-decay principle, were used to derive emission weights for each grid based on its proximity to highways, roads, railroads, waterways, and airports. The total CO2 emission value summed from the grids within a county is made to be equal to the original county-level estimate, thus enforcing the volume-preserving property. The method was applied to downscale the transportation-related CO2 emission values by county (i.e. parish) for the state of Louisiana into 1 km2 grids. The results reveal a more realistic spatial pattern of CO2 emission from transportation, which can be used to identify the emission ‘hot spots’. Of the four highest transportation-related CO2 emission hotspots in Louisiana, high-emission grids literally covered the entire East Baton Rouge Parish and Orleans Parish, whereas CO2 emission in Jefferson Parish (New Orleans suburb) and Caddo Parish (city of Shreveport) were more unevenly distributed. We argue that the new method is sound in principle, flexible in practice, and the resultant estimates are more accurate than previous gridding approaches. PMID:26997973
Predicting commuter flows in spatial networks using a radiation model based on temporal ranges
NASA Astrophysics Data System (ADS)
Ren, Yihui; Ercsey-Ravasz, Mária; Wang, Pu; González, Marta C.; Toroczkai, Zoltán
2014-11-01
Understanding network flows such as commuter traffic in large transportation networks is an ongoing challenge due to the complex nature of the transportation infrastructure and human mobility. Here we show a first-principles based method for traffic prediction using a cost-based generalization of the radiation model for human mobility, coupled with a cost-minimizing algorithm for efficient distribution of the mobility fluxes through the network. Using US census and highway traffic data, we show that traffic can efficiently and accurately be computed from a range-limited, network betweenness type calculation. The model based on travel time costs captures the log-normal distribution of the traffic and attains a high Pearson correlation coefficient (0.75) when compared with real traffic. Because of its principled nature, this method can inform many applications related to human mobility driven flows in spatial networks, ranging from transportation, through urban planning to mitigation of the effects of catastrophic events.
DOT National Transportation Integrated Search
2010-07-01
The Transportation Statistics Office (TranStat) of the Florida Department of Transportation (FDOT) provides training for district data collection technicians in both office- and field-based Roadway Characteristics Inventory (RCI) methods. The current...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geihe, Erika; Trantow, Brian; Wender, Paul
The introduction of tools to study, control or expand the inner-workings of algae has been slow to develop. Provided are embodiments of a molecular method based on guanidinium-rich molecular transporters (GR-MoTrs) for bringing molecular cargos into algal cells. The methods of the disclosure have been shown to work in wild-type algae that have an intact cell wall. Developed using Chlamydomonas reinhardtii, this method is also successful with less studied algae, including Neochloris oleoabundans and Scenedesmus dimorphus, thus providing a new and versatile tool for algal research and modification. The method of delivering a cargo compound to an algal cell comprisesmore » contacting an algal cell with a guanidinium-rich delivery vehicle comprising a guanidinium-rich molecular transporter (GR-MoTr) linked to a cargo compound desired to be delivered to the algal cell, whereby the guanidinium-rich molecular transporter can traverse the algal cell wall, thereby delivering the cargo compound to the algal cell.« less
NASA Astrophysics Data System (ADS)
Iwase, Shigeru; Futamura, Yasunori; Imakura, Akira; Sakurai, Tetsuya; Tsukamoto, Shigeru; Ono, Tomoya
2018-05-01
We propose an efficient computational method for evaluating the self-energy matrices of electrodes to study ballistic electron transport properties in nanoscale systems. To reduce the high computational cost incurred in large systems, a contour integral eigensolver based on the Sakurai-Sugiura method combined with the shifted biconjugate gradient method is developed to solve an exponential-type eigenvalue problem for complex wave vectors. A remarkable feature of the proposed algorithm is that the numerical procedure is very similar to that of conventional band structure calculations. We implement the developed method in the framework of the real-space higher-order finite-difference scheme with nonlocal pseudopotentials. Numerical tests for a wide variety of materials validate the robustness, accuracy, and efficiency of the proposed method. As an illustration of the method, we present the electron transport property of the freestanding silicene with the line defect originating from the reversed buckled phases.
An accurate computational method for the diffusion regime verification
NASA Astrophysics Data System (ADS)
Zhokh, Alexey A.; Strizhak, Peter E.
2018-04-01
The diffusion regime (sub-diffusive, standard, or super-diffusive) is defined by the order of the derivative in the corresponding transport equation. We develop an accurate computational method for the direct estimation of the diffusion regime. The method is based on the derivative order estimation using the asymptotic analytic solutions of the diffusion equation with the integer order and the time-fractional derivatives. The robustness and the computational cheapness of the proposed method are verified using the experimental methane and methyl alcohol transport kinetics through the catalyst pellet.
Using GPS, GIS, and Accelerometer Data to Predict Transportation Modes.
Brondeel, Ruben; Pannier, Bruno; Chaix, Basile
2015-12-01
Active transportation is a substantial source of physical activity, which has a positive influence on many health outcomes. A survey of transportation modes for each trip is challenging, time-consuming, and requires substantial financial investments. This study proposes a passive collection method and the prediction of modes at the trip level using random forests. The RECORD GPS study collected real-life trip data from 236 participants over 7 d, including the transportation mode, global positioning system, geographical information systems, and accelerometer data. A prediction model of transportation modes was constructed using the random forests method. Finally, we investigated the performance of models on the basis of a limited number of participants/trips to predict transportation modes for a large number of trips. The full model had a correct prediction rate of 90%. A simpler model of global positioning system explanatory variables combined with geographical information systems variables performed nearly as well. Relatively good predictions could be made using a model based on the 991 trips of the first 30 participants. This study uses real-life data from a large sample set to test a method for predicting transportation modes at the trip level, thereby providing a useful complement to time unit-level prediction methods. By enabling predictions on the basis of a limited number of observations, this method may decrease the workload for participants/researchers and provide relevant trip-level data to investigate relations between transportation and health.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Womble, David E.
Unified collision operator demonstrated for both radiation transport and PIC-DSMC. A side-by-side comparison between the DSMC method and the radiation transport method was conducted for photon attenuation in the atmosphere over 2 kilometers in physical distance with a reduction of photon density of six orders of magnitude. Both DSMC and traditional radiation transport agreed with theory to two digits. This indicates that PIC-DSMC operators can be unified with the radiation transport collision operators into a single code base and that physics kernels can remain unique to the actual collision pairs. This simulation example provides an initial validation of the unifiedmore » collision theory approach that will later be implemented into EMPIRE.« less
NASA Technical Reports Server (NTRS)
Hill, Geoffrey A.; Olson, Erik D.
2004-01-01
Due to the growing problem of noise in today's air transportation system, there have arisen needs to incorporate noise considerations in the conceptual design of revolutionary aircraft. Through the use of response surfaces, complex noise models may be converted into polynomial equations for rapid and simplified evaluation. This conversion allows many of the commonly used response surface-based trade space exploration methods to be applied to noise analysis. This methodology is demonstrated using a noise model of a notional 300 passenger Blended-Wing-Body (BWB) transport. Response surfaces are created relating source noise levels of the BWB vehicle to its corresponding FAR-36 certification noise levels and the resulting trade space is explored. Methods demonstrated include: single point analysis, parametric study, an optimization technique for inverse analysis, sensitivity studies, and probabilistic analysis. Extended applications of response surface-based methods in noise analysis are also discussed.
A FRAP-Based Method for Monitoring Molecular Transport in Ciliary Photoreceptor Cells In Vivo.
Wunderlich, Kirsten A; Wolfrum, Uwe
2016-01-01
The outer segment of rod and cone photoreceptor cells represents a highly modified primary sensory cilium. It renews on a daily basis throughout lifetime and effective vectorial transport to the cilium is essential for the maintenance of the photoreceptor cell function. Defects in molecules of transport modules lead to severe retinal ciliopathies. We have recently established a fluorescence recovery after photobleaching (FRAP)-based method to monitor molecular trafficking in living rodent photoreceptor cells. We irreversibly bleach the fluorescence of tagged molecules (e.g. eGFP-Rhodopsin) in photoreceptor cells of native vibratome sections through the retina by high laser intensity. In the laser scanning microscope, the recovery of the fluorescent signal is monitored over time and the kinetics of movements of molecules can be quantitatively ascertained.
A flow-control mechanism for distributed systems
NASA Technical Reports Server (NTRS)
Maitan, J.
1991-01-01
A new approach to the rate-based flow control in store-and-forward networks is evaluated. Existing methods display oscillations in the presence of transport delays. The proposed scheme is based on the explicit use of an embedded dynamic model of a store-and-forward buffer in a controller's feedback loop. It is shown that the use of the model eliminates the oscillations caused by the transport delays. The paper presents simulation examples and assesses the applicability of the scheme in the new generation of high-speed photonic networks where transport delays must be considered.
Exploration of microfluidic devices based on multi-filament threads and textiles: A review
Nilghaz, A.; Ballerini, D. R.; Shen, W.
2013-01-01
In this paper, we review the recent progress in the development of low-cost microfluidic devices based on multifilament threads and textiles for semi-quantitative diagnostic and environmental assays. Hydrophilic multifilament threads are capable of transporting aqueous and non-aqueous fluids via capillary action and possess desirable properties for building fluid transport pathways in microfluidic devices. Thread can be sewn onto various support materials to form fluid transport channels without the need for the patterned hydrophobic barriers essential for paper-based microfluidic devices. Thread can also be used to manufacture fabrics which can be patterned to achieve suitable hydrophilic-hydrophobic contrast, creating hydrophilic channels which allow the control of fluids flow. Furthermore, well established textile patterning methods and combination of hydrophilic and hydrophobic threads can be applied to fabricate low-cost microfluidic devices that meet the low-cost and low-volume requirements. In this paper, we review the current limitations and shortcomings of multifilament thread and textile-based microfluidics, and the research efforts to date on the development of fluid flow control concepts and fabrication methods. We also present a summary of different methods for modelling the fluid capillary flow in microfluidic thread and textile-based systems. Finally, we summarized the published works of thread surface treatment methods and the potential of combining multifilament thread with other materials to construct devices with greater functionality. We believe these will be important research focuses of thread- and textile-based microfluidics in future. PMID:24086179
Image-based modeling of flow and reactive transport in porous media
NASA Astrophysics Data System (ADS)
Qin, Chao-Zhong; Hoang, Tuong; Verhoosel, Clemens V.; Harald van Brummelen, E.; Wijshoff, Herman M. A.
2017-04-01
Due to the availability of powerful computational resources and high-resolution acquisition of material structures, image-based modeling has become an important tool in studying pore-scale flow and transport processes in porous media [Scheibe et al., 2015]. It is also playing an important role in the upscaling study for developing macroscale porous media models. Usually, the pore structure of a porous medium is directly discretized by the voxels obtained from visualization techniques (e.g. micro CT scanning), which can avoid the complex generation of computational mesh. However, this discretization may considerably overestimate the interfacial areas between solid walls and pore spaces. As a result, it could impact the numerical predictions of reactive transport and immiscible two-phase flow. In this work, two types of image-based models are used to study single-phase flow and reactive transport in a porous medium of sintered glass beads. One model is from a well-established voxel-based simulation tool. The other is based on the mixed isogeometric finite cell method [Hoang et al., 2016], which has been implemented in the open source Nutils (http://www.nutils.org). The finite cell method can be used in combination with isogeometric analysis to enable the higher-order discretization of problems on complex volumetric domains. A particularly interesting application of this immersed simulation technique is image-based analysis, where the geometry is smoothly approximated by segmentation of a B-spline level set approximation of scan data [Verhoosel et al., 2015]. Through a number of case studies by the two models, we will show the advantages and disadvantages of each model in modeling single-phase flow and reactive transport in porous media. Particularly, we will highlight the importance of preserving high-resolution interfaces between solid walls and pore spaces in image-based modeling of porous media. References Hoang, T., C. V. Verhoosel, F. Auricchio, E. H. van Brummelen, and A. Reali (2016), Mixed Isogeometric Finite Cell Methods for the Stokes problem, Computer Methods in Applied Mechanics and Engineering, doi:10.1016/j.cma.2016.07.027. Scheibe, T. D., W. A. Perkins, M. C. Richmond, M. I. McKinley, P. D. J. Romero-Gomez, M. Oostrom, T. W. Wietsma, J. A. Serkowski, and J. M. Zachara (2015), Pore-scale and multiscale numerical simulation of flow and transport in a laboratory-scale column, Water Resources Research, 51(2), 1023-1035, doi:10.1002/2014WR015959. Verhoosel, C. V., G. J. van Zwieten, B. van Rietbergen, and R. de Borst (2015), Image-based goal-oriented adaptive isogeometric analysis with application to the micro-mechanical modeling of trabecular bone, Computer Methods in Applied Mechanics and Engineering, 284(February), 138-164, doi:10.1016/j.cma.2014.07.009.
NASA Astrophysics Data System (ADS)
Jin, Juliang; Li, Lei; Wang, Wensheng; Zhang, Ming
2006-10-01
The optimal selection of schemes of water transportation projects is a process of choosing a relatively optimal scheme from a number of schemes of water transportation programming and management projects, which is of importance in both theory and practice in water resource systems engineering. In order to achieve consistency and eliminate the dimensions of fuzzy qualitative and fuzzy quantitative evaluation indexes, to determine the weights of the indexes objectively, and to increase the differences among the comprehensive evaluation index values of water transportation project schemes, a projection pursuit method, named FPRM-PP for short, was developed in this work for selecting the optimal water transportation project scheme based on the fuzzy preference relation matrix. The research results show that FPRM-PP is intuitive and practical, the correction range of the fuzzy preference relation matrix
Numerical computation of diffusion on a surface.
Schwartz, Peter; Adalsteinsson, David; Colella, Phillip; Arkin, Adam Paul; Onsum, Matthew
2005-08-09
We present a numerical method for computing diffusive transport on a surface derived from image data. Our underlying discretization method uses a Cartesian grid embedded boundary method for computing the volume transport in a region consisting of all points a small distance from the surface. We obtain a representation of this region from image data by using a front propagation computation based on level set methods for solving the Hamilton-Jacobi and eikonal equations. We demonstrate that the method is second-order accurate in space and time and is capable of computing solutions on complex surface geometries obtained from image data of cells.
NASA Astrophysics Data System (ADS)
Xu, Yongbin; Xie, Haihong; Wu, Liuyi
2018-05-01
The share of coal transportation in the total railway freight volume is about 50%. As is widely acknowledged, coal industry is vulnerable to the economic situation and national policies. Coal transportation volume fluctuates significantly under the new economic normal. Grasp the overall development trend of railway coal transportation market, have important reference and guidance significance to the railway and coal industry decision-making. By analyzing the economic indicators and policy implications, this paper expounds the trend of the coal transportation volume, and further combines the economic indicators with the high correlation with the coal transportation volume with the traditional traffic prediction model to establish a combined forecasting model based on the back propagation neural network. The error of the prediction results is tested, which proves that the method has higher accuracy and has practical application.
Beam transport program for FEL project
NASA Astrophysics Data System (ADS)
Sugimoto, Masayoshi; Takao, Masaru
1992-07-01
A beam transport program is developed to design the beam transport line of the free electron laser system at JAERI and to assist the beam diagnosis. The program traces a beam matrix through the elements in the beam transport line and the accelerators. The graphical user interface is employed to access the parameters and to represent the results. The basic computational method is based on the LANL-TRACE program and it is rewritten for personal computers in Pascal.
Nerada, Zsuzsanna; Hegyi, Zoltán; Szepesi, Áron; Tóth, Szilárd; Hegedüs, Csilla; Várady, György; Matula, Zsolt; Homolya, László; Sarkadi, Balázs; Telbisz, Ágnes
2016-09-01
ABC multidrug transporters are key players in cancer multidrug resistance and in determining the ADME-Tox properties of drugs and xenobiotics. The most sensitive and specific detection of these transporters is based on functional assays. Assessment of the transporter-dependent reduction of cellular uptake of the fluorescent dyes, such as Hoechst 33342 (Ho) and more recently DyeCycle Violet (DCV), have been widely advocated for the characterization of both ABCB1 and ABCG2 multidrug transporters. Detailed comparison of these supravital DNA-binding dyes revealed that DCV is less toxic to ABCG2- and ABCB1-expressing cells than Ho. ATPase measurements imply that DCV and Ho are similarly handled by ABCB1, whereas ABCG2 seems to transport DVC more effectively. In addition, we have developed an image-based high content microscopy screening method for simultaneous in situ measurement of the cellular activity and expression of the ABCG2 multidrug transporter. We demonstrated the applicability of this method for identifying ABCG2-positive cells in heterogeneous cell population by a single dye uptake measurement. These results may promote multidrug transporter studies at a single cell level and allow the quantitative detection of clinically important drug-resistant sub-populations. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.
Fission matrix-based Monte Carlo criticality analysis of fuel storage pools
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farlotti, M.; Ecole Polytechnique, Palaiseau, F 91128; Larsen, E. W.
2013-07-01
Standard Monte Carlo transport procedures experience difficulties in solving criticality problems in fuel storage pools. Because of the strong neutron absorption between fuel assemblies, source convergence can be very slow, leading to incorrect estimates of the eigenvalue and the eigenfunction. This study examines an alternative fission matrix-based Monte Carlo transport method that takes advantage of the geometry of a storage pool to overcome this difficulty. The method uses Monte Carlo transport to build (essentially) a fission matrix, which is then used to calculate the criticality and the critical flux. This method was tested using a test code on a simplemore » problem containing 8 assemblies in a square pool. The standard Monte Carlo method gave the expected eigenfunction in 5 cases out of 10, while the fission matrix method gave the expected eigenfunction in all 10 cases. In addition, the fission matrix method provides an estimate of the error in the eigenvalue and the eigenfunction, and it allows the user to control this error by running an adequate number of cycles. Because of these advantages, the fission matrix method yields a higher confidence in the results than standard Monte Carlo. We also discuss potential improvements of the method, including the potential for variance reduction techniques. (authors)« less
Non-local transport in turbulent MHD convection
NASA Technical Reports Server (NTRS)
Miesch, Mark; Brandenburg, Axel; Zweibel, Ellen; Toomre, Juri
1995-01-01
The nonlocal non-diffusive transport of passive scalars in turbulent magnetohydrodynamic (MHD) convection is investigated using transilient matrices. These matrices describe the probability that a tracer particle beginning at one position in a flow will be advected to another position after some time. A method for the calculation of these matrices from simulation data which involves following the trajectories of passive tracer particles and calculating their transport statistics, is presented. The method is applied to study the transport in several simulations of turbulent, rotating, three dimensional compressible, penetrative MDH convection. Transport coefficients and other diagnostics are used to quantify the transport, which is found to resemble advection more closely than diffusion. Some of the results are found to have direct relevance to other physical problems, such as the light element depletion in sun-type stars. The large kurtosis found for downward moving particles at the base of the convection zone implies several extreme events.
NASA Astrophysics Data System (ADS)
Yousefzadeh, M.; Battiato, I.
2017-12-01
Flow and reactive transport problems in porous media often involve complex geometries with stationary or evolving boundaries due to absorption and dissolution processes. Grid based methods (e.g. finite volume, finite element, etc.) are a vital tool for studying these problems. Yet, implementing these methods requires one to answer a very first question of what type of grid is to be used. Among different possible answers, Cartesian grids are one of the most attractive options as they possess simple discretization stencil and are usually straightforward to generate at roughly no computational cost. The Immersed Boundary Method, a Cartesian based methodology, maintains most of the useful features of the structured grids while exhibiting a high-level resilience in dealing with complex geometries. These features make it increasingly more attractive to model transport in evolving porous media as the cost of grid generation reduces greatly. Yet, stability issues and severe time-step restriction due to explicit-time implementation combined with limited studies on the implementation of Neumann (constant flux) and linear and non-linear Robin (e.g. reaction) boundary conditions (BCs) have significantly limited the applicability of IBMs to transport in porous media. We have developed an implicit IBM capable of handling all types of BCs and addressed some numerical issues, including unconditional stability criteria, compactness and reduction of spurious oscillations near the immersed boundary. We tested the method for several transport and flow scenarios, including dissolution processes in porous media, and demonstrate its capabilities. Successful validation against both experimental and numerical data has been carried out.
NASA Astrophysics Data System (ADS)
Leal, Allan M. M.; Kulik, Dmitrii A.; Kosakowski, Georg
2016-02-01
We present a numerical method for multiphase chemical equilibrium calculations based on a Gibbs energy minimization approach. The method can accurately and efficiently determine the stable phase assemblage at equilibrium independently of the type of phases and species that constitute the chemical system. We have successfully applied our chemical equilibrium algorithm in reactive transport simulations to demonstrate its effective use in computationally intensive applications. We used FEniCS to solve the governing partial differential equations of mass transport in porous media using finite element methods in unstructured meshes. Our equilibrium calculations were benchmarked with GEMS3K, the numerical kernel of the geochemical package GEMS. This allowed us to compare our results with a well-established Gibbs energy minimization algorithm, as well as their performance on every mesh node, at every time step of the transport simulation. The benchmark shows that our novel chemical equilibrium algorithm is accurate, robust, and efficient for reactive transport applications, and it is an improvement over the Gibbs energy minimization algorithm used in GEMS3K. The proposed chemical equilibrium method has been implemented in Reaktoro, a unified framework for modeling chemically reactive systems, which is now used as an alternative numerical kernel of GEMS.
A novel in-situ method for real-time monitoring of gas transport in soil
NASA Astrophysics Data System (ADS)
Laemmel, Thomas; Maier, Martin; Schack-Kirchner, Helmer; Lang, Friederike
2017-04-01
Gas exchange between soil and atmosphere is important for the biogeochemistry of soils. Gas transport in soil is commonly assumed to be governed by molecular diffusion and is usually described by the soil gas diffusion coefficient DS characterizing the ability of the soil to "transport passively" gas through the soil. One way to determine DS is sampling soil cores in the field and measuring DS in the lab. Unfortunately this method is destructive and laborious. Moreover, a few previous field studies identified other gas transport processes in soil to significantly enhance the diffusive gas transport. However, until now, no method is available to measure gas transport in situ in the soil. We developed a novel method to monitor gas transport in soil in situ. The method includes a custom made gas sampling device, the continuous injection of an inert tracer gas and inverse gas transport modelling in the soil. The gas sampling device has several sampling depths and can be easily installed into a vertical hole drilled by an auger, which allows for fast installation of the system. Helium (He) as inert tracer gas was injected continuously at the lower end of the device. The resulting steady state distribution of He was used to deduce the depth profile of DS. Gas transport in the soil surrounding the gas-sampling-device/soil system was modeled using the Finite Element Modeling program COMSOL . We tested our new method both in the lab and during two short field studies and compared the results with a reference method using soil cores. DS profiles obtained by our in-situ method were consistent with DS profiles determined based on soil core analyses. During a longer monitoring field campaign, typical soil-moisture effects upon gas diffusivity such as an increase during a drying period or a decrease after rain could be observed consistently. Under windy conditions we additionally measured for the first time the direct enhancement of gas transport in soil due to wind-induced pressure-pumping which could increase the effective DS up to 30% in the topsoil. Our novel monitoring method can be quickly and easily installed and allows for monitoring continuously soil gas transport over a long time. It allows monitoring physical modifications of soil gas diffusivity due to rain events or evaporation but it also allows studying non-diffusive gas transport processes in the soil.
NASA Astrophysics Data System (ADS)
Song, Linze; Shi, Qiang
2017-02-01
We present a theoretical approach to study nonequilibrium quantum heat transport in molecular junctions described by a spin-boson type model. Based on the Feynman-Vernon path integral influence functional formalism, expressions for the average value and high-order moments of the heat current operators are derived, which are further obtained directly from the auxiliary density operators (ADOs) in the hierarchical equations of motion (HEOM) method. Distribution of the heat current is then derived from the high-order moments. As the HEOM method is nonperturbative and capable of treating non-Markovian system-environment interactions, the method can be applied to various problems of nonequilibrium quantum heat transport beyond the weak coupling regime.
The Detection of Transport Land-Use Data Using Crowdsourcing Taxi Trajectory
NASA Astrophysics Data System (ADS)
Ai, T.; Yang, W.
2016-06-01
This study tries to explore the question of transport land-use change detection by large volume of vehicle trajectory data, presenting a method based on Deluanay triangulation. The whole method includes three steps. The first one is to pre-process the vehicle trajectory data including the point anomaly removing and the conversion of trajectory point to track line. Secondly, construct Deluanay triangulation within the vehicle trajectory line to detect neighborhood relation. Considering the case that some of the trajectory segments are too long, we use a interpolation measure to add more points for the improved triangulation. Thirdly, extract the transport road by cutting short triangle edge and organizing the polygon topology. We have conducted the experiment of transport land-use change discovery using the data of taxi track in Beijing City. We extract not only the transport land-use area but also the semantic information such as the transformation speed, the traffic jam distribution, the main vehicle movement direction and others. Compared with the existed transport network data, such as OpenStreet Map, our method is proved to be quick and accurate.
Vadose Zone Transport Field Study: Detailed Test Plan for Simulated Leak Tests
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, Anderson L.; Gee, Glendon W.
2000-06-23
This report describes controlled transport experiments at well-instrumented field tests to be conducted during FY 2000 in support of DOE?s Vadose Zone Transport Field Study (VZTFS). The VZTFS supports the Groundwater/Vadose Zone Integration Project Science and Technology Initiative. The field tests will improve understanding of field-scale transport and lead to the development or identification of efficient and cost-effective characterization methods. These methods will capture the extent of contaminant plumes using existing steel-cased boreholes. Specific objectives are to 1) identify mechanisms controlling transport processes in soils typical of the hydrogeologic conditions of Hanford?s waste disposal sites; 2) reduce uncertainty in conceptualmore » models; 3) develop a detailed and accurate data base of hydraulic and transport parameters for validation of three-dimensional numerical models; and 4) identify and evaluate advanced, cost-effective characterization methods with the potential to assess changing conditions in the vadose zone, particularly as surrogates of currently undetectable high-risk contaminants. Pacific Northwest National Laboratory (PNNL) manages the VZTFS for DOE.« less
Seki, Shiro; Tsuzuki, Seiji; Hayamizu, Kikuko; Serizawa, Nobuyuki; Ono, Shimpei; Takei, Katsuhito; Doi, Hiroyuki; Umebayashi, Yasuhiro
2014-05-01
We have measured physicochemical properties of five alkyltrimethylammonium cation-based room-temperature ionic liquids and compared them with those obtained from computational methods. We have found that static properties (density and refractive index) and transport properties (ionic conductivity, self-diffusion coefficient, and viscosity) of these ionic liquids show close relations with the length of the alkyl chain. In particular, static properties obtained by experimental methods exhibit a trend complementary to that by computational methods (refractive index ∝ [polarizability/molar volume]). Moreover, the self-diffusion coefficient obtained by molecular dynamics (MD) simulation was consistent with the data obtained by the pulsed-gradient spin-echo nuclear magnetic resonance technique, which suggests that computational methods can be supplemental tools to predict physicochemical properties of room-temperature ionic liquids.
Cellular water distribution, transport, and its investigation methods for plant-based food material.
Khan, Md Imran H; Karim, M A
2017-09-01
Heterogeneous and hygroscopic characteristics of plant-based food material make it complex in structure, and therefore water distribution in its different cellular environments is very complex. There are three different cellular environments, namely the intercellular environment, the intracellular environment, and the cell wall environment inside the food structure. According to the bonding strength, intracellular water is defined as loosely bound water, cell wall water is categorized as strongly bound water, and intercellular water is known as free water (FW). During food drying, optimization of the heat and mass transfer process is crucial for the energy efficiency of the process and the quality of the product. For optimizing heat and mass transfer during food processing, understanding these three types of waters (strongly bound, loosely bound, and free water) in plant-based food material is essential. However, there are few studies that investigate cellular level water distribution and transport. As there is no direct method for determining the cellular level water distributions, various indirect methods have been applied to investigate the cellular level water distribution, and there is, as yet, no consensus on the appropriate method for measuring cellular level water in plant-based food material. Therefore, the main aim of this paper is to present a comprehensive review on the available methods to investigate the cellular level water, the characteristics of water at different cellular levels and its transport mechanism during drying. The effect of bound water transport on quality of food product is also discussed. This review article presents a comparative study of different methods that can be applied to investigate cellular water such as nuclear magnetic resonance (NMR), bioelectric impedance analysis (BIA), differential scanning calorimetry (DSC), and dilatometry. The article closes with a discussion of current challenges to investigating cellular water. Copyright © 2017 Elsevier Ltd. All rights reserved.
Pupils' Response to a Model for Water Transport.
ERIC Educational Resources Information Center
Johnstone, A. H.; Mahmoud, N. A.
1981-01-01
Described is a model, based on the physical sciences, designed to teach secondary students about water transport through the use of an animated film. Pupils (N=440) taught by this method developed a self-consistent, although reduced, picture and understanding of osmosis. (Author/DC)
DOT National Transportation Integrated Search
2012-11-01
New methods are proposed for mitigating risk in hazardous materials (hazmat) transportation, based on Conditional : Value-at-Risk (CVaR) measure, on time-dependent vehicular networks. While the CVaR risk measure has been : popularly used in financial...
Feng, Kai; Liu, Yuanyuan; Cheng, Miaomiao
2015-12-01
Owing to its distinct non-contact and oil-free characteristics, a self-running sliding stage based on near-field acoustic levitation can be used in an environment, which demands clean rooms and zero noise. This paper presents a numerical analysis on the lifting and transportation capacity of a non-contact transportation system. Two simplified structure models, namely, free vibration and force vibration models, are proposed for the study of the displacement amplitude distribution of two cases using the finite element method. After coupling the stage displacement into the film thickness, the Reynolds equation is solved by the finite difference method to obtain the lifting and thrusting forces. Parametric analyses of the effects of amplitude, frequency, and standing wave ratio (SWR) on the sliding stage dynamic performance are investigated. Numerical results show good agreement with published experimental values. The predictions also reveal that greater transportation capacity of the self-running sliding stage is generally achieved at less SWR and at higher amplitude.
Improving lab compaction specifications for flexible bases within the Texas DOT.
DOT National Transportation Integrated Search
2009-04-01
In Test Methods Tex-113-E and Tex-114-E, the Texas Department of Transportation (TxDOT) employs an impact hammer method of sample compaction for laboratory preparation of road base and subgrade materials for testing. In this third and final report do...
Vertical electronic transport in van de waals heterostructures
NASA Astrophysics Data System (ADS)
Qiao, Zhenhua; Zhenhua Qiao's Group Team
In this work, we will introduce the theoretical investigation of the vertical electronic transport in various heterostructrues by using both tight-binding method and first-principles calculations. Counterintuitively, we find that the maximum electronic transport is achieved at very limited scattering regions but not at large overlapped catering regions. Based on this finding, we design a special setup to measure the tunneling effect in rotated bilayer systems.
Impact of the Topological Surface State on the Thermoelectric Transport in Sb2Te3 Thin Films.
Hinsche, Nicki F; Zastrow, Sebastian; Gooth, Johannes; Pudewill, Laurens; Zierold, Robert; Rittweger, Florian; Rauch, Tomáš; Henk, Jürgen; Nielsch, Kornelius; Mertig, Ingrid
2015-04-28
Ab initio electronic structure calculations based on density functional theory and tight-binding methods for the thermoelectric properties of p-type Sb2Te3 films are presented. The thickness-dependent electrical conductivity and the thermopower are computed in the diffusive limit of transport based on the Boltzmann equation. Contributions of the bulk and the surface to the transport coefficients are separated, which enables to identify a clear impact of the topological surface state on the thermoelectric properties. When the charge carrier concentration is tuned, a crossover between a surface-state-dominant and a Fuchs-Sondheimer transport regime is achieved. The calculations are corroborated by thermoelectric transport measurements on Sb2Te3 films grown by atomic layer deposition.
Kumar, Amit; Sokhansanj, Shahab; Flynn, Peter C
2006-01-01
This study details multicriteria assessment methodology that integrates economic, social, environmental, and technical factors in order to rank alternatives for biomass collection and transportation systems. Ranking of biomass collection systems is based on cost of delivered biomass, quality of biomass supplied, emissions during collection, energy input to the chain operations, and maturity of supply system technologies. The assessment methodology is used to evaluate alternatives for collecting 1.8 x 10(6) dry t/yr based on assumptions made on performance of various assemblies of biomass collection systems. A proposed collection option using loafer/ stacker was shown to be the best option followed by ensiling and baling. Ranking of biomass transport systems is based on cost of biomass transport, emissions during transport, traffic congestion, and maturity of different technologies. At a capacity of 4 x 10(6) dry t/yr, rail transport was shown to be the best option, followed by truck transport and pipeline transport, respectively. These rankings depend highly on assumed maturity of technologies and scale of utilization. These may change if technologies such as loafing or ensiling (wet storage) methods are proved to be infeasible for large-scale collection systems.
Multilevel acceleration of scattering-source iterations with application to electron transport
Drumm, Clif; Fan, Wesley
2017-08-18
Acceleration/preconditioning strategies available in the SCEPTRE radiation transport code are described. A flexible transport synthetic acceleration (TSA) algorithm that uses a low-order discrete-ordinates (S N) or spherical-harmonics (P N) solve to accelerate convergence of a high-order S N source-iteration (SI) solve is described. Convergence of the low-order solves can be further accelerated by applying off-the-shelf incomplete-factorization or algebraic-multigrid methods. Also available is an algorithm that uses a generalized minimum residual (GMRES) iterative method rather than SI for convergence, using a parallel sweep-based solver to build up a Krylov subspace. TSA has been applied as a preconditioner to accelerate the convergencemore » of the GMRES iterations. The methods are applied to several problems involving electron transport and problems with artificial cross sections with large scattering ratios. These methods were compared and evaluated by considering material discontinuities and scattering anisotropy. Observed accelerations obtained are highly problem dependent, but speedup factors around 10 have been observed in typical applications.« less
Guan, Yaoyao; Gravitt, Patti E; Howard, Roslyn; Eby, Yolanda J; Wang, Shaoming; Li, Belinda; Feng, Changyan; Qiao, You-Lin; Castle, Philip E
2013-04-01
The current method of transporting self-collected cervicovaginal specimen for HPV DNA testing relies on liquid based medium, which is challenging and expensive to transport. A novel, dry storage and transportation device, Whatman indicating FTA™ Elute Cartridge, avoids some of the pitfalls of liquid-based medium. This method has been shown to be comparable to liquid-based collection medium, but relative performance of self-collected (SC) and clinician-collected (CC) samples onto FTA cards has not been reported. The objective of this study is to compare the analytic performance of self- and clinician-collected samples onto FTA cartridges for the detection of carcinogenic HPV using Linear Array. There was a 91% agreement, 69% positive agreement, and kappa of 0.75 between the clinician-collected and self-collected specimens for detection of any carcinogenic HPV genotype. When the HPV results were categorized hierarchically according to cervical cancer risk, there was no difference in the distribution of the HPV results for the clinician- and self-collected specimens (p=0.7). This study concludes that FTA elute cartridge is a promising method of specimen transport for cervical cancer screening programs considering using self-collected specimen and HPV testing. Larger studies with clinical endpoints are now needed to assess the clinical performance. Copyright © 2012 Elsevier B.V. All rights reserved.
Design of a fuzzy differential evolution algorithm to predict non-deposition sediment transport
NASA Astrophysics Data System (ADS)
Ebtehaj, Isa; Bonakdari, Hossein
2017-12-01
Since the flow entering a sewer contains solid matter, deposition at the bottom of the channel is inevitable. It is difficult to understand the complex, three-dimensional mechanism of sediment transport in sewer pipelines. Therefore, a method to estimate the limiting velocity is necessary for optimal designs. Due to the inability of gradient-based algorithms to train Adaptive Neuro-Fuzzy Inference Systems (ANFIS) for non-deposition sediment transport prediction, a new hybrid ANFIS method based on a differential evolutionary algorithm (ANFIS-DE) is developed. The training and testing performance of ANFIS-DE is evaluated using a wide range of dimensionless parameters gathered from the literature. The input combination used to estimate the densimetric Froude number ( Fr) parameters includes the volumetric sediment concentration ( C V ), ratio of median particle diameter to hydraulic radius ( d/R), ratio of median particle diameter to pipe diameter ( d/D) and overall friction factor of sediment ( λ s ). The testing results are compared with the ANFIS model and regression-based equation results. The ANFIS-DE technique predicted sediment transport at limit of deposition with lower root mean square error (RMSE = 0.323) and mean absolute percentage of error (MAPE = 0.065) and higher accuracy ( R 2 = 0.965) than the ANFIS model and regression-based equations.
DOT National Transportation Integrated Search
2014-04-01
The U. S. Department of Transportations (U.S. DOT) Research and Innovative Technology Administrations (RITA) John A. Volpe National Transportation Systems Center (Volpe Center), under the direction of the U.S. DOT Federal Railroad Administratio...
Study on multimodal transport route under low carbon background
NASA Astrophysics Data System (ADS)
Liu, Lele; Liu, Jie
2018-06-01
Low-carbon environmental protection is the focus of attention around the world, scientists are constantly researching on production of carbon emissions and living carbon emissions. However, there is little literature about multimodal transportation based on carbon emission at home and abroad. Firstly, this paper introduces the theory of multimodal transportation, the multimodal transport models that didn't consider carbon emissions and consider carbon emissions are analyzed. On this basis, a multi-objective programming 0-1 programming model with minimum total transportation cost and minimum total carbon emission is proposed. The idea of weight is applied to Ideal point method for solving problem, multi-objective programming is transformed into a single objective function. The optimal solution of carbon emission to transportation cost under different weights is determined by a single objective function with variable weights. Based on the model and algorithm, an example is given and the results are analyzed.
Mesh quality oriented 3D geometric vascular modeling based on parallel transport frame.
Guo, Jixiang; Li, Shun; Chui, Yim Pan; Qin, Jing; Heng, Pheng Ann
2013-08-01
While a number of methods have been proposed to reconstruct geometrically and topologically accurate 3D vascular models from medical images, little attention has been paid to constantly maintain high mesh quality of these models during the reconstruction procedure, which is essential for many subsequent applications such as simulation-based surgical training and planning. We propose a set of methods to bridge this gap based on parallel transport frame. An improved bifurcation modeling method and two novel trifurcation modeling methods are developed based on 3D Bézier curve segments in order to ensure the continuous surface transition at furcations. In addition, a frame blending scheme is implemented to solve the twisting problem caused by frame mismatch of two successive furcations. A curvature based adaptive sampling scheme combined with a mesh quality guided frame tilting algorithm is developed to construct an evenly distributed, non-concave and self-intersection free surface mesh for vessels with distinct radius and high curvature. Extensive experiments demonstrate that our methodology can generate vascular models with better mesh quality than previous methods in terms of surface mesh quality criteria. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tartakovsky, Alexandre M.; Trask, Nathaniel; Pan, K.
2016-03-11
Smoothed Particle Hydrodynamics (SPH) is a Lagrangian method based on a meshless discretization of partial differential equations. In this review, we present SPH discretization of the Navier-Stokes and Advection-Diffusion-Reaction equations, implementation of various boundary conditions, and time integration of the SPH equations, and we discuss applications of the SPH method for modeling pore-scale multiphase flows and reactive transport in porous and fractured media.
Thermal transport in nanocrystalline Si and SiGe by ab initio based Monte Carlo simulation.
Yang, Lina; Minnich, Austin J
2017-03-14
Nanocrystalline thermoelectric materials based on Si have long been of interest because Si is earth-abundant, inexpensive, and non-toxic. However, a poor understanding of phonon grain boundary scattering and its effect on thermal conductivity has impeded efforts to improve the thermoelectric figure of merit. Here, we report an ab-initio based computational study of thermal transport in nanocrystalline Si-based materials using a variance-reduced Monte Carlo method with the full phonon dispersion and intrinsic lifetimes from first-principles as input. By fitting the transmission profile of grain boundaries, we obtain excellent agreement with experimental thermal conductivity of nanocrystalline Si [Wang et al. Nano Letters 11, 2206 (2011)]. Based on these calculations, we examine phonon transport in nanocrystalline SiGe alloys with ab-initio electron-phonon scattering rates. Our calculations show that low energy phonons still transport substantial amounts of heat in these materials, despite scattering by electron-phonon interactions, due to the high transmission of phonons at grain boundaries, and thus improvements in ZT are still possible by disrupting these modes. This work demonstrates the important insights into phonon transport that can be obtained using ab-initio based Monte Carlo simulations in complex nanostructured materials.
Thermal transport in nanocrystalline Si and SiGe by ab initio based Monte Carlo simulation
Yang, Lina; Minnich, Austin J.
2017-01-01
Nanocrystalline thermoelectric materials based on Si have long been of interest because Si is earth-abundant, inexpensive, and non-toxic. However, a poor understanding of phonon grain boundary scattering and its effect on thermal conductivity has impeded efforts to improve the thermoelectric figure of merit. Here, we report an ab-initio based computational study of thermal transport in nanocrystalline Si-based materials using a variance-reduced Monte Carlo method with the full phonon dispersion and intrinsic lifetimes from first-principles as input. By fitting the transmission profile of grain boundaries, we obtain excellent agreement with experimental thermal conductivity of nanocrystalline Si [Wang et al. Nano Letters 11, 2206 (2011)]. Based on these calculations, we examine phonon transport in nanocrystalline SiGe alloys with ab-initio electron-phonon scattering rates. Our calculations show that low energy phonons still transport substantial amounts of heat in these materials, despite scattering by electron-phonon interactions, due to the high transmission of phonons at grain boundaries, and thus improvements in ZT are still possible by disrupting these modes. This work demonstrates the important insights into phonon transport that can be obtained using ab-initio based Monte Carlo simulations in complex nanostructured materials. PMID:28290484
A continuum mechanics-based musculo-mechanical model for esophageal transport
NASA Astrophysics Data System (ADS)
Kou, Wenjun; Griffith, Boyce E.; Pandolfino, John E.; Kahrilas, Peter J.; Patankar, Neelesh A.
2017-11-01
In this work, we extend our previous esophageal transport model using an immersed boundary (IB) method with discrete fiber-based structural model, to one using a continuum mechanics-based model that is approximated based on finite elements (IB-FE). To deal with the leakage of flow when the Lagrangian mesh becomes coarser than the fluid mesh, we employ adaptive interaction quadrature points to deal with Lagrangian-Eulerian interaction equations based on a previous work (Griffith and Luo [1]). In particular, we introduce a new anisotropic adaptive interaction quadrature rule. The new rule permits us to vary the interaction quadrature points not only at each time-step and element but also at different orientations per element. This helps to avoid the leakage issue without sacrificing the computational efficiency and accuracy in dealing with the interaction equations. For the material model, we extend our previous fiber-based model to a continuum-based model. We present formulations for general fiber-reinforced material models in the IB-FE framework. The new material model can handle non-linear elasticity and fiber-matrix interactions, and thus permits us to consider more realistic material behavior of biological tissues. To validate our method, we first study a case in which a three-dimensional short tube is dilated. Results on the pressure-displacement relationship and the stress distribution matches very well with those obtained from the implicit FE method. We remark that in our IB-FE case, the three-dimensional tube undergoes a very large deformation and the Lagrangian mesh-size becomes about 6 times of Eulerian mesh-size in the circumferential orientation. To validate the performance of the method in handling fiber-matrix material models, we perform a second study on dilating a long fiber-reinforced tube. Errors are small when we compare numerical solutions with analytical solutions. The technique is then applied to the problem of esophageal transport. We use two fiber-reinforced models for the esophageal tissue: a bi-linear model and an exponential model. We present three cases on esophageal transport that differ in the material model and the muscle fiber architecture. The overall transport features are consistent with those observed from the previous model. We remark that the continuum-based model can handle more realistic and complicated material behavior. This is demonstrated in our third case where a spatially varying fiber architecture is included based on experimental study. We find that this unique muscle fiber architecture could generate a so-called pressure transition zone, which is a luminal pressure pattern that is of clinical interest. This suggests an important role of muscle fiber architecture in esophageal transport.
NASA Astrophysics Data System (ADS)
Zhul'Kina, A. L.; Ivantsova, E. L.; Filatova, A. G.; Kosenko, R. Yu.; Gumargalieva, K. Z.; Iordanskii, A. L.
2009-05-01
Complex investigation of the equilibrium sorption of water, diffusive transport of antiseptic, and morphology of mixed compositions based on polyoxybutirate and polyamide resin 54C has been performed to develop and analyze new biodegradable polymer compositions for controlled release of medicinal substances. Samples of mixtures were prepared by two methods: pressing under pressure and solvent evaporation from a polymer solution. The samples were compared and their morphology was analyzed by scanning electron microscopy. It is shown that the component ratio in the obtained mixtures affects their morphological, transport, and sorption characteristics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhul'kina, A. L.; Ivantsova, E. L.; Filatova, A. G.
2009-05-15
Complex investigation of the equilibrium sorption of water, diffusive transport of antiseptic, and morphology of mixed compositions based on polyoxybutirate and polyamide resin 54C has been performed to develop and analyze new biodegradable polymer compositions for controlled release of medicinal substances. Samples of mixtures were prepared by two methods: pressing under pressure and solvent evaporation from a polymer solution. The samples were compared and their morphology was analyzed by scanning electron microscopy. It is shown that the component ratio in the obtained mixtures affects their morphological, transport, and sorption characteristics.
Jones, Reese E; Mandadapu, Kranthi K
2012-04-21
We present a rigorous Green-Kubo methodology for calculating transport coefficients based on on-the-fly estimates of: (a) statistical stationarity of the relevant process, and (b) error in the resulting coefficient. The methodology uses time samples efficiently across an ensemble of parallel replicas to yield accurate estimates, which is particularly useful for estimating the thermal conductivity of semi-conductors near their Debye temperatures where the characteristic decay times of the heat flux correlation functions are large. Employing and extending the error analysis of Zwanzig and Ailawadi [Phys. Rev. 182, 280 (1969)] and Frenkel [in Proceedings of the International School of Physics "Enrico Fermi", Course LXXV (North-Holland Publishing Company, Amsterdam, 1980)] to the integral of correlation, we are able to provide tight theoretical bounds for the error in the estimate of the transport coefficient. To demonstrate the performance of the method, four test cases of increasing computational cost and complexity are presented: the viscosity of Ar and water, and the thermal conductivity of Si and GaN. In addition to producing accurate estimates of the transport coefficients for these materials, this work demonstrates precise agreement of the computed variances in the estimates of the correlation and the transport coefficient with the extended theory based on the assumption that fluctuations follow a Gaussian process. The proposed algorithm in conjunction with the extended theory enables the calculation of transport coefficients with the Green-Kubo method accurately and efficiently.
NASA Astrophysics Data System (ADS)
Jones, Reese E.; Mandadapu, Kranthi K.
2012-04-01
We present a rigorous Green-Kubo methodology for calculating transport coefficients based on on-the-fly estimates of: (a) statistical stationarity of the relevant process, and (b) error in the resulting coefficient. The methodology uses time samples efficiently across an ensemble of parallel replicas to yield accurate estimates, which is particularly useful for estimating the thermal conductivity of semi-conductors near their Debye temperatures where the characteristic decay times of the heat flux correlation functions are large. Employing and extending the error analysis of Zwanzig and Ailawadi [Phys. Rev. 182, 280 (1969)], 10.1103/PhysRev.182.280 and Frenkel [in Proceedings of the International School of Physics "Enrico Fermi", Course LXXV (North-Holland Publishing Company, Amsterdam, 1980)] to the integral of correlation, we are able to provide tight theoretical bounds for the error in the estimate of the transport coefficient. To demonstrate the performance of the method, four test cases of increasing computational cost and complexity are presented: the viscosity of Ar and water, and the thermal conductivity of Si and GaN. In addition to producing accurate estimates of the transport coefficients for these materials, this work demonstrates precise agreement of the computed variances in the estimates of the correlation and the transport coefficient with the extended theory based on the assumption that fluctuations follow a Gaussian process. The proposed algorithm in conjunction with the extended theory enables the calculation of transport coefficients with the Green-Kubo method accurately and efficiently.
An Approach for Economic Analysis of Intermodal Transportation
Sahin, Bahri; Ust, Yasin; Guneri, Ali Fuat; Gulsun, Bahadir; Turan, Eda
2014-01-01
A different intermodal transportation model based on cost analysis considering technical, economical, and operational parameters is presented. The model consists of such intermodal modes as sea-road, sea-railway, road-railway, and multimode of sea-road-railway. A case study of cargo transportation has been carried out by using the suggested model. Then, the single road transportation mode has been compared to intermodal modes in terms of transportation costs. This comparison takes into account the external costs of intermodal transportation. The research reveals that, in the short distance transportation, single transportation modes always tend to be advantageous. As the transportation distance gets longer, intermodal transportation advantages begin to be effective on the costs. In addition, the proposed method in this study leads to determining the fleet size and capacity for transportation and the appropriate transportation mode. PMID:25152919
An approach for economic analysis of intermodal transportation.
Sahin, Bahri; Yilmaz, Huseyin; Ust, Yasin; Guneri, Ali Fuat; Gulsun, Bahadir; Turan, Eda
2014-01-01
A different intermodal transportation model based on cost analysis considering technical, economical, and operational parameters is presented. The model consists of such intermodal modes as sea-road, sea-railway, road-railway, and multimode of sea-road-railway. A case study of cargo transportation has been carried out by using the suggested model. Then, the single road transportation mode has been compared to intermodal modes in terms of transportation costs. This comparison takes into account the external costs of intermodal transportation. The research reveals that, in the short distance transportation, single transportation modes always tend to be advantageous. As the transportation distance gets longer, intermodal transportation advantages begin to be effective on the costs. In addition, the proposed method in this study leads to determining the fleet size and capacity for transportation and the appropriate transportation mode.
Tan, Kaeling; Roberts, Anthony J.; Chonofsky, Mark; Egan, Martin J.; Reck-Peterson, Samara L.
2014-01-01
The timely delivery of membranous organelles and macromolecules to specific locations within the majority of eukaryotic cells depends on microtubule-based transport. Here we describe a screening method to identify mutations that have a critical effect on intracellular transport and its regulation using mutagenesis, multicolor-fluorescence microscopy, and multiplex genome sequencing. This screen exploits the filamentous fungus Aspergillus nidulans, which has many of the advantages of yeast molecular genetics but uses long-range microtubule-based transport in a manner more similar to metazoan cells. Using this method, we identified seven mutants that represent novel alleles of components of the intracellular transport machinery: specifically, kinesin-1, cytoplasmic dynein, and the dynein regulators Lis1 and dynactin. The two dynein mutations identified in our screen map to dynein's AAA+ catalytic core. Single-molecule studies reveal that both mutations reduce dynein's velocity in vitro. In vivo these mutants severely impair the distribution and velocity of endosomes, a known dynein cargo. In contrast, another dynein cargo, the nucleus, is positioned normally in these mutants. These results reveal that different dynein functions have distinct stringencies for motor performance. PMID:24403603
A cavitation model based on Eulerian stochastic fields
NASA Astrophysics Data System (ADS)
Magagnato, F.; Dumond, J.
2013-12-01
Non-linear phenomena can often be described using probability density functions (pdf) and pdf transport models. Traditionally the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian "particles" or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and in particular to cavitating flow. To validate the proposed stochastic-field cavitation model, two applications are considered. Firstly, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.
Profiling optimization for big data transfer over dedicated channels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yun, D.; Wu, Qishi; Rao, Nageswara S
The transfer of big data is increasingly supported by dedicated channels in high-performance networks, where transport protocols play an important role in maximizing applicationlevel throughput and link utilization. The performance of transport protocols largely depend on their control parameter settings, but it is prohibitively time consuming to conduct an exhaustive search in a large parameter space to find the best set of parameter values. We propose FastProf, a stochastic approximation-based transport profiler, to quickly determine the optimal operational zone of a given data transfer protocol/method over dedicated channels. We implement and test the proposed method using both emulations based onmore » real-life performance measurements and experiments over physical connections with short (2 ms) and long (380 ms) delays. Both the emulation and experimental results show that FastProf significantly reduces the profiling overhead while achieving a comparable level of end-to-end throughput performance with the exhaustive search-based approach.« less
Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen
2016-07-30
Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.
Alternative methods of flexible base compaction acceptance.
DOT National Transportation Integrated Search
2012-11-01
"This report presents the results from the second year of research work investigating issues with flexible base acceptance testing within the Texas Department of Transportation. This second year of work focused on shadow testing non-density-based acc...
PHT3D-UZF: A reactive transport model for variably-saturated porous media
Wu, Ming Zhi; Post, Vincent E. A.; Salmon, S. Ursula; Morway, Eric D.; Prommer, H.
2016-01-01
A modified version of the MODFLOW/MT3DMS-based reactive transport model PHT3D was developed to extend current reactive transport capabilities to the variably-saturated component of the subsurface system and incorporate diffusive reactive transport of gaseous species. Referred to as PHT3D-UZF, this code incorporates flux terms calculated by MODFLOW's unsaturated-zone flow (UZF1) package. A volume-averaged approach similar to the method used in UZF-MT3DMS was adopted. The PHREEQC-based computation of chemical processes within PHT3D-UZF in combination with the analytical solution method of UZF1 allows for comprehensive reactive transport investigations (i.e., biogeochemical transformations) that jointly involve saturated and unsaturated zone processes. Intended for regional-scale applications, UZF1 simulates downward-only flux within the unsaturated zone. The model was tested by comparing simulation results with those of existing numerical models. The comparison was performed for several benchmark problems that cover a range of important hydrological and reactive transport processes. A 2D simulation scenario was defined to illustrate the geochemical evolution following dewatering in a sandy acid sulfate soil environment. Other potential applications include the simulation of biogeochemical processes in variably-saturated systems that track the transport and fate of agricultural pollutants, nutrients, natural and xenobiotic organic compounds and micropollutants such as pharmaceuticals, as well as the evolution of isotope patterns.
NASA Astrophysics Data System (ADS)
Savic, Ivana; Mingo, Natalio; Donadio, Davide; Galli, Giulia
2010-03-01
It has been recently proposed that Si and SiGe based nanostructured materials may exhibit low thermal conductivity and overall promising properties for thermoelectric applications. Hence there is a considerable interest in developing accurate theoretical and computational methods which can help interpret recent measurements, identify the physical origin of the reduced thermal conductivity, as well as shed light on the interplay between disorder and nanostructuring in determining a high figure of merit. In this work, we investigate the capability of an atomistic Green's function method [1] to describe phonon transport in several types of Si and SiGe based systems: amorphous Si, SiGe alloys, planar and nanodot Si/SiGe multilayers. We compare our results with experimental data [2,3], and with the findings of molecular dynamics simulations and calculations based on the Boltzmann transport equation. [1] I. Savic, N. Mingo, and D. A. Stewart, Phys. Rev. Lett. 101, 165502 (2008). [2] S.-M. Lee, D. G. Cahill, and R. Venkatasubramanian, Appl. Phys. Lett. 70, 2957 (1997). [3] G. Pernot et al., submitted.
A method for improving predictions of bed-load discharges to reservoirs
Lopes, V.L.; Osterkamp, W.R.; Bravo-Espinosa, M.
2007-01-01
Effective management options for mitigating the loss of reservoir water storage capacity to sedimentation depend on improved predictions of bed-load discharges into the reservoirs. Most predictions of bed-load discharges, however, are based on the assumption that the rates of bed-load sediment availability equal the transport capacity of the flow, ignoring the spatio-temporal variability of the sediment supply. This paper develops a semiquantitative method to characterize bed-load sediment transport in alluvial channels, assuming a channel reach is non-supply limited when the bed-load discharge of a given sediment particle-size class is functionally related to the energy that is available to transport that fraction of the total bed-load. The method was applied to 22 alluvial stream channels in the USA to determine whether a channel reach had a supply-limited or non-supply-limited bed-load transport regime. The non-supply-limited transport regime was further subdivided into two groups on the basis of statistical tests. The results indicated the pattern of bed-load sediment transport in alluvial channels depends on the complete spectrum of sediment particle sizes available for transport rather than individual particle-size fractions represented by one characteristic particle size. The application of the method developed in this paper should assist reservoir managers in selecting bed-load sediment transport equations to improve predictions of bed-load discharge in alluvial streams, thereby significantly increasing the efficiency of management options for maintaining the storage capacity of waterbodies. ?? 2007 Blackwell Publishing Asia Pty Ltd.
Neisch, Amanda L.; Avery, Adam W.; Machame, James B.; Li, Min-gang; Hays, Thomas S.
2017-01-01
Proper neuronal function critically depends on efficient intracellular transport and disruption of transport leads to neurodegeneration. Molecular pathways that support or regulate neuronal transport are not fully understood. A greater understanding of these pathways will help reveal the pathological mechanisms underlying disease. Drosophila melanogaster is the premier model system for performing large-scale genetic functional screens. Here we describe methods to carry out primary and secondary genetic screens in Drosophila aimed at identifying novel gene products and pathways that impact neuronal intracellular transport. These screens are performed using whole animal or live cell imaging of intact neural tissue to ensure integrity of neurons and their cellular environment. The primary screen is used to identify gross defects in neuronal function indicative of a disruption in microtubule-based transport. The secondary screens, conducted in both motoneurons and dendritic arborization neurons, will confirm the function of candidate gene products in intracellular transport. Together, the methodologies described here will support labs interested in identifying and characterizing gene products that alter intracellular transport in Drosophila. PMID:26794520
Modeling water exchange and contaminant transport through a Baltic coastal region.
Engqvist, Anders; Döös, Kristofer; Andrejev, Oleg
2006-12-01
The water exchange of the Baltic coastal zone is characterized by its seasonally varying regimes. In the safety assessment of a potential repository for spent nuclear fuel, it is important to assess the consequences of a hypothetical leak of radionuclides through the seabed into a waterborne transport phase. In particular, estimates of the associated residence times in the near-shore coastal zone are of interest. There are several methods to quantify such measures, of which three are presented here. Using the coastal location of Forsmark (Sweden) as an example, methods based on passive tracers, particle trajectories, and the average age distribution of exogeneous water parcels are compared for a representative one-year cycle. Tracer-based methods can simulate diffusivity more realistically than the other methods. Trajectory-based methods can handle Lagrangian dispersion processes due to advection but neglect diffusion on the sub-grid scale. The method based on the concept of average age (AvA) of exogeneous water can include all such sources simultaneously not only boundary water bodies but also various (fresh)-water discharges. Due to the inclusion of sub-grid diffusion this method gives a smoother measure of the water renewal. It is shown that backward in time trajectories and AvA-times are basically equipollent methods, yielding correlated results within the limits set by the diffusivity.
A comparison of acceleration methods for solving the neutron transport k-eigenvalue problem
NASA Astrophysics Data System (ADS)
Willert, Jeffrey; Park, H.; Knoll, D. A.
2014-10-01
Over the past several years a number of papers have been written describing modern techniques for numerically computing the dominant eigenvalue of the neutron transport criticality problem. These methods fall into two distinct categories. The first category of methods rewrite the multi-group k-eigenvalue problem as a nonlinear system of equations and solve the resulting system using either a Jacobian-Free Newton-Krylov (JFNK) method or Nonlinear Krylov Acceleration (NKA), a variant of Anderson Acceleration. These methods are generally successful in significantly reducing the number of transport sweeps required to compute the dominant eigenvalue. The second category of methods utilize Moment-Based Acceleration (or High-Order/Low-Order (HOLO) Acceleration). These methods solve a sequence of modified diffusion eigenvalue problems whose solutions converge to the solution of the original transport eigenvalue problem. This second class of methods is, in our experience, always superior to the first, as most of the computational work is eliminated by the acceleration from the LO diffusion system. In this paper, we review each of these methods. Our computational results support our claim that the choice of which nonlinear solver to use, JFNK or NKA, should be secondary. The primary computational savings result from the implementation of a HOLO algorithm. We display computational results for a series of challenging multi-dimensional test problems.
High-resolution two dimensional advective transport
Smith, P.E.; Larock, B.E.
1989-01-01
The paper describes a two-dimensional high-resolution scheme for advective transport that is based on a Eulerian-Lagrangian method with a flux limiter. The scheme is applied to the problem of pure-advection of a rotated Gaussian hill and shown to preserve the monotonicity property of the governing conservation law.
SIERRA Multimechanics Module: Aria User Manual Version 4.44
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sierra Thermal /Fluid Team
2017-04-01
Aria is a Galerkin fnite element based program for solving coupled-physics problems described by systems of PDEs and is capable of solving nonlinear, implicit, transient and direct-to-steady state problems in two and three dimensions on parallel architectures. The suite of physics currently supported by Aria includes thermal energy transport, species transport, and electrostatics as well as generalized scalar, vector and tensor transport equations. Additionally, Aria includes support for manufacturing process fows via the incompressible Navier-Stokes equations specialized to a low Reynolds number ( %3C 1 ) regime. Enhanced modeling support of manufacturing processing is made possible through use of eithermore » arbitrary Lagrangian- Eulerian (ALE) and level set based free and moving boundary tracking in conjunction with quasi-static nonlinear elastic solid mechanics for mesh control. Coupled physics problems are solved in several ways including fully-coupled Newton's method with analytic or numerical sensitivities, fully-coupled Newton- Krylov methods and a loosely-coupled nonlinear iteration about subsets of the system that are solved using combinations of the aforementioned methods. Error estimation, uniform and dynamic h -adaptivity and dynamic load balancing are some of Aria's more advanced capabilities. Aria is based upon the Sierra Framework.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sierra Thermal/Fluid Team
Aria is a Galerkin fnite element based program for solving coupled-physics problems described by systems of PDEs and is capable of solving nonlinear, implicit, transient and direct-to-steady state problems in two and three dimensions on parallel architectures. The suite of physics currently supported by Aria includes thermal energy transport, species transport, and electrostatics as well as generalized scalar, vector and tensor transport equations. Additionally, Aria includes support for manufacturing process fows via the incompressible Navier-Stokes equations specialized to a low Reynolds number ( %3C 1 ) regime. Enhanced modeling support of manufacturing processing is made possible through use of eithermore » arbitrary Lagrangian- Eulerian (ALE) and level set based free and moving boundary tracking in conjunction with quasi-static nonlinear elastic solid mechanics for mesh control. Coupled physics problems are solved in several ways including fully-coupled Newton's method with analytic or numerical sensitivities, fully-coupled Newton- Krylov methods and a loosely-coupled nonlinear iteration about subsets of the system that are solved using combinations of the aforementioned methods. Error estimation, uniform and dynamic h -adaptivity and dynamic load balancing are some of Aria's more advanced capabilities. Aria is based upon the Sierra Framework.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sierra Thermal /Fluid Team
Aria is a Galerkin finite element based program for solving coupled-physics problems described by systems of PDEs and is capable of solving nonlinear, implicit, transient and direct-to-steady state problems in two and three dimensions on parallel architectures. The suite of physics currently supported by Aria includes thermal energy transport, species transport, and electrostatics as well as generalized scalar, vector and tensor transport equations. Additionally, Aria includes support for manufacturing process flows via the incompressible Navier-Stokes equations specialized to a low Reynolds number (Re %3C 1) regime. Enhanced modeling support of manufacturing processing is made possible through use of either arbitrarymore » Lagrangian- Eulerian (ALE) and level set based free and moving boundary tracking in conjunction with quasi-static nonlinear elastic solid mechanics for mesh control. Coupled physics problems are solved in several ways including fully-coupled Newton's method with analytic or numerical sensitivities, fully-coupled Newton- Krylov methods and a loosely-coupled nonlinear iteration about subsets of the system that are solved using combinations of the aforementioned methods. Error estimation, uniform and dynamic h-adaptivity and dynamic load balancing are some of Aria's more advanced capabilities. Aria is based upon the Sierra Framework.« less
Multi-fidelity methods for uncertainty quantification in transport problems
NASA Astrophysics Data System (ADS)
Tartakovsky, G.; Yang, X.; Tartakovsky, A. M.; Barajas-Solano, D. A.; Scheibe, T. D.; Dai, H.; Chen, X.
2016-12-01
We compare several multi-fidelity approaches for uncertainty quantification in flow and transport simulations that have a lower computational cost than the standard Monte Carlo method. The cost reduction is achieved by combining a small number of high-resolution (high-fidelity) simulations with a large number of low-resolution (low-fidelity) simulations. We propose a new method, a re-scaled Multi Level Monte Carlo (rMLMC) method. The rMLMC is based on the idea that the statistics of quantities of interest depends on scale/resolution. We compare rMLMC with existing multi-fidelity methods such as Multi Level Monte Carlo (MLMC) and reduced basis methods and discuss advantages of each approach.
NASA Astrophysics Data System (ADS)
Haworth, Daniel
2013-11-01
The importance of explicitly accounting for the effects of unresolved turbulent fluctuations in Reynolds-averaged and large-eddy simulations of chemically reacting turbulent flows is increasingly recognized. Transported probability density function (PDF) methods have emerged as one of the most promising modeling approaches for this purpose. In particular, PDF methods provide an elegant and effective resolution to the closure problems that arise from averaging or filtering terms that correspond to nonlinear point processes, including chemical reaction source terms and radiative emission. PDF methods traditionally have been associated with studies of turbulence-chemistry interactions in laboratory-scale, atmospheric-pressure, nonluminous, statistically stationary nonpremixed turbulent flames; and Lagrangian particle-based Monte Carlo numerical algorithms have been the predominant method for solving modeled PDF transport equations. Recent advances and trends in PDF methods are reviewed and discussed. These include advances in particle-based algorithms, alternatives to particle-based algorithms (e.g., Eulerian field methods), treatment of combustion regimes beyond low-to-moderate-Damköhler-number nonpremixed systems (e.g., premixed flamelets), extensions to include radiation heat transfer and multiphase systems (e.g., soot and fuel sprays), and the use of PDF methods as the basis for subfilter-scale modeling in large-eddy simulation. Examples are provided that illustrate the utility and effectiveness of PDF methods for physics discovery and for applications to practical combustion systems. These include comparisons of results obtained using the PDF method with those from models that neglect unresolved turbulent fluctuations in composition and temperature in the averaged or filtered chemical source terms and/or the radiation heat transfer source terms. In this way, the effects of turbulence-chemistry-radiation interactions can be isolated and quantified.
NASA Astrophysics Data System (ADS)
Yan, Jiawei; Ke, Youqi
2016-07-01
Electron transport properties of nanoelectronics can be significantly influenced by the inevitable and randomly distributed impurities/defects. For theoretical simulation of disordered nanoscale electronics, one is interested in both the configurationally averaged transport property and its statistical fluctuation that tells device-to-device variability induced by disorder. However, due to the lack of an effective method to do disorder averaging under the nonequilibrium condition, the important effects of disorders on electron transport remain largely unexplored or poorly understood. In this work, we report a general formalism of Green's function based nonequilibrium effective medium theory to calculate the disordered nanoelectronics. In this method, based on a generalized coherent potential approximation for the Keldysh nonequilibrium Green's function, we developed a generalized nonequilibrium vertex correction method to calculate the average of a two-Keldysh-Green's-function correlator. We obtain nine nonequilibrium vertex correction terms, as a complete family, to express the average of any two-Green's-function correlator and find they can be solved by a set of linear equations. As an important result, the averaged nonequilibrium density matrix, averaged current, disorder-induced current fluctuation, and averaged shot noise, which involve different two-Green's-function correlators, can all be derived and computed in an effective and unified way. To test the general applicability of this method, we applied it to compute the transmission coefficient and its fluctuation with a square-lattice tight-binding model and compared with the exact results and other previously proposed approximations. Our results show very good agreement with the exact results for a wide range of disorder concentrations and energies. In addition, to incorporate with density functional theory to realize first-principles quantum transport simulation, we have also derived a general form of conditionally averaged nonequilibrium Green's function for multicomponent disorders.
Recent developments in multidimensional transport methods for the APOLLO 2 lattice code
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zmijarevic, I.; Sanchez, R.
1995-12-31
A usual method of preparation of homogenized cross sections for reactor coarse-mesh calculations is based on two-dimensional multigroup transport treatment of an assembly together with an appropriate leakage model and reaction-rate-preserving homogenization technique. The actual generation of assembly spectrum codes based on collision probability methods is capable of treating complex geometries (i.e., irregular meshes of arbitrary shape), thus avoiding the modeling error that was introduced in codes with traditional tracking routines. The power and architecture of current computers allow the treatment of spatial domains comprising several mutually interacting assemblies using fine multigroup structure and retaining all geometric details of interest.more » Increasing safety requirements demand detailed two- and three-dimensional calculations for very heterogeneous problems such as control rod positioning, broken Pyrex rods, irregular compacting of mixed- oxide (MOX) pellets at an MOX-UO{sub 2} interface, and many others. An effort has been made to include accurate multi- dimensional transport methods in the APOLLO 2 lattice code. These include extension to three-dimensional axially symmetric geometries of the general-geometry collision probability module TDT and the development of new two- and three-dimensional characteristics methods for regular Cartesian meshes. In this paper we discuss the main features of recently developed multidimensional methods that are currently being tested.« less
Quantitative evaluation of analyte transport on microfluidic paper-based analytical devices (μPADs).
Ota, Riki; Yamada, Kentaro; Suzuki, Koji; Citterio, Daniel
2018-02-07
The transport efficiency during capillary flow-driven sample transport on microfluidic paper-based analytical devices (μPADs) made from filter paper has been investigated for a selection of model analytes (Ni 2+ , Zn 2+ , Cu 2+ , PO 4 3- , bovine serum albumin, sulforhodamine B, amaranth) representing metal cations, complex anions, proteins and anionic molecules. For the first time, the transport of the analytical target compounds rather than the sample liquid, has been quantitatively evaluated by means of colorimetry and absorption spectrometry-based methods. The experiments have revealed that small paperfluidic channel dimensions, additional user operation steps (e.g. control of sample volume, sample dilution, washing step) as well as the introduction of sample liquid wicking areas allow to increase analyte transport efficiency. It is also shown that the interaction of analytes with the negatively charged cellulosic paper substrate surface is strongly influenced by the physico-chemical properties of the model analyte and can in some cases (Cu 2+ ) result in nearly complete analyte depletion during sample transport. The quantitative information gained through these experiments is expected to contribute to the development of more sensitive μPADs.
Development of an Acoustic Levitation Linear Transportation System Based on a Ring-Type Structure.
Thomas, Gilles P L; Andrade, Marco A B; Adamowski, Julio Cezar; Silva, Emilio Carlos Nelli
2017-05-01
A linear acoustic levitation transportation system based on a ring-type vibrator is presented. The system is composed by two 21-kHz Langevin transducers connected to a ring-shaped structure formed by two semicircular sections and two flat plates. In this system, a flexural standing wave is generated along the ring structure, producing an acoustic standing wave between the vibrating ring and a plane reflector located at a distance of approximately a half wavelength from the ring. The acoustic standing wave in air has a series of pressure nodes, where small particles can be levitated and transported. The ring-type transportation system was designed and analyzed by using the finite element method. Additionally, a prototype was built and the acoustic levitation and transport of a small polystyrene particle was demonstrated.
Carrier transport dynamics in Mn-doped CdSe quantum dot sensitized solar cells
NASA Astrophysics Data System (ADS)
Poudyal, Uma; Maloney, Francis S.; Sapkota, Keshab; Wang, Wenyong
2017-10-01
In this work quantum dot sensitized solar cells (QDSSCs) were fabricated with CdSe and Mn-doped CdSe quantum dots (QDs) using the SILAR method. QDSSCs based on Mn-doped CdSe QDs exhibited improved incident photon-to-electron conversion efficiency. Carrier transport dynamics in the QDSSCs were studied using the intensity modulated photocurrent/photovoltage spectroscopy technique, from which transport and recombination time constants could be derived. Compared to CdSe QDSSCs, Mn-CdSe QDSSCs exhibited shorter transport time constant, longer recombination time constant, longer diffusion length, and higher charge collection efficiency. These observations suggested that Mn doping in CdSe QDs could benefit the performance of solar cells based on such nanostructures.
Local and nonlocal parallel heat transport in general magnetic fields
DOE Office of Scientific and Technical Information (OSTI.GOV)
Del-Castillo-Negrete, Diego B; Chacon, Luis
2011-01-01
A novel approach for the study of parallel transport in magnetized plasmas is presented. The method avoids numerical pollution issues of grid-based formulations and applies to integrable and chaotic magnetic fields with local or nonlocal parallel closures. In weakly chaotic fields, the method gives the fractal structure of the devil's staircase radial temperature profile. In fully chaotic fields, the temperature exhibits self-similar spatiotemporal evolution with a stretched-exponential scaling function for local closures and an algebraically decaying one for nonlocal closures. It is shown that, for both closures, the effective radial heat transport is incompatible with the quasilinear diffusion model.
NASA Astrophysics Data System (ADS)
Liu, Shaoying; King, Michael A.; Brill, Aaron B.; Stabin, Michael G.; Farncombe, Troy H.
2008-02-01
Monte Carlo (MC) is a well-utilized tool for simulating photon transport in single photon emission computed tomography (SPECT) due to its ability to accurately model physical processes of photon transport. As a consequence of this accuracy, it suffers from a relatively low detection efficiency and long computation time. One technique used to improve the speed of MC modeling is the effective and well-established variance reduction technique (VRT) known as forced detection (FD). With this method, photons are followed as they traverse the object under study but are then forced to travel in the direction of the detector surface, whereby they are detected at a single detector location. Another method, called convolution-based forced detection (CFD), is based on the fundamental idea of FD with the exception that detected photons are detected at multiple detector locations and determined with a distance-dependent blurring kernel. In order to further increase the speed of MC, a method named multiple projection convolution-based forced detection (MP-CFD) is presented. Rather than forcing photons to hit a single detector, the MP-CFD method follows the photon transport through the object but then, at each scatter site, forces the photon to interact with a number of detectors at a variety of angles surrounding the object. This way, it is possible to simulate all the projection images of a SPECT simulation in parallel, rather than as independent projections. The result of this is vastly improved simulation time as much of the computation load of simulating photon transport through the object is done only once for all projection angles. The results of the proposed MP-CFD method agrees well with the experimental data in measurements of point spread function (PSF), producing a correlation coefficient (r2) of 0.99 compared to experimental data. The speed of MP-CFD is shown to be about 60 times faster than a regular forced detection MC program with similar results.
Carbon agent chemical vapor transport growth of Ga2O3 crystal
NASA Astrophysics Data System (ADS)
Jie, Su; Tong, Liu; Jingming, Liu; Jun, Yang; Guiying, Shen; Yongbiao, Bai; Zhiyuan, Dong; Youwen, Zhao
2016-10-01
Beta-type gallium oxide (β-Ga2O3) is a new attractive material for optoelectronic devices. Different methods had been tried to grow high quality β-Ga2O3 crystals. In this work, crystal growth of Ga2O3 has been carried out by chemical vapor transport (CVT) method in a closed quartz tube using C as transport agent and sapphire wafer as seed. The CVT mass flux has been analyzed by theoretical calculations based on equilibrium thermodynamics and 1D diffusional mass transport. The crystal growth experimental results are in agreement with the theoretical predictions. Influence factors of Ga2O3 crystal growth, such as temperature distribution, amount of C as transport agent used, have also been discussed. Structural (XRD) and optical (Raman spectroscopy, photoluminescence spectrum) properties of the CVT-Ga2O3 crystal are presented. Project supported by the National Natural Science Foundation of China (Nos. 61474104, 61504131).
Inverse transport calculations in optical imaging with subspace optimization algorithms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ding, Tian, E-mail: tding@math.utexas.edu; Ren, Kui, E-mail: ren@math.utexas.edu
2014-09-15
Inverse boundary value problems for the radiative transport equation play an important role in optics-based medical imaging techniques such as diffuse optical tomography (DOT) and fluorescence optical tomography (FOT). Despite the rapid progress in the mathematical theory and numerical computation of these inverse problems in recent years, developing robust and efficient reconstruction algorithms remains a challenging task and an active research topic. We propose here a robust reconstruction method that is based on subspace minimization techniques. The method splits the unknown transport solution (or a functional of it) into low-frequency and high-frequency components, and uses singular value decomposition to analyticallymore » recover part of low-frequency information. Minimization is then applied to recover part of the high-frequency components of the unknowns. We present some numerical simulations with synthetic data to demonstrate the performance of the proposed algorithm.« less
On-chip microfluid induced by oscillation of microrobot for noncontact cell transportation
NASA Astrophysics Data System (ADS)
Feng, Lin; Liang, Shuzhang; Zhou, Xiangcong; Yang, Jianlei; Jiang, Yonggang; Zhang, Deyuan; Arai, Fumihito
2017-11-01
The importance of cell manipulation and cultivation is increasing rapidly in various fields, such as drug discovery, regenerative medicine, and investigation of new energy sources. This paper presents a method to transport cells in a microfluidic chip without contact. A local vortex was generated when high-frequency oscillation of a microtool was induced in a microfluidic chip. The vortex was controlled by tuning the tool's oscillation parameters, such as the oscillation amplitude and frequency. The cells were then transported in the chip based on the direction of the tool's movement, and their position, posture, and trajectories were controlled. Bovine oocyte manipulations, that is, transportation and rotation, were conducted to demonstrate the capability of the proposed method, without any contact by the microrobot with high-frequency oscillation.
Texture mapping via optimal mass transport.
Dominitz, Ayelet; Tannenbaum, Allen
2010-01-01
In this paper, we present a novel method for texture mapping of closed surfaces. Our method is based on the technique of optimal mass transport (also known as the "earth-mover's metric"). This is a classical problem that concerns determining the optimal way, in the sense of minimal transportation cost, of moving a pile of soil from one site to another. In our context, the resulting mapping is area preserving and minimizes angle distortion in the optimal mass sense. Indeed, we first begin with an angle-preserving mapping (which may greatly distort area) and then correct it using the mass transport procedure derived via a certain gradient flow. In order to obtain fast convergence to the optimal mapping, we incorporate a multiresolution scheme into our flow. We also use ideas from discrete exterior calculus in our computations.
Svatos, M.; Zankowski, C.; Bednarz, B.
2016-01-01
Purpose: The future of radiation therapy will require advanced inverse planning solutions to support single-arc, multiple-arc, and “4π” delivery modes, which present unique challenges in finding an optimal treatment plan over a vast search space, while still preserving dosimetric accuracy. The successful clinical implementation of such methods would benefit from Monte Carlo (MC) based dose calculation methods, which can offer improvements in dosimetric accuracy when compared to deterministic methods. The standard method for MC based treatment planning optimization leverages the accuracy of the MC dose calculation and efficiency of well-developed optimization methods, by precalculating the fluence to dose relationship within a patient with MC methods and subsequently optimizing the fluence weights. However, the sequential nature of this implementation is computationally time consuming and memory intensive. Methods to reduce the overhead of the MC precalculation have been explored in the past, demonstrating promising reductions of computational time overhead, but with limited impact on the memory overhead due to the sequential nature of the dose calculation and fluence optimization. The authors propose an entirely new form of “concurrent” Monte Carlo treat plan optimization: a platform which optimizes the fluence during the dose calculation, reduces wasted computation time being spent on beamlets that weakly contribute to the final dose distribution, and requires only a low memory footprint to function. In this initial investigation, the authors explore the key theoretical and practical considerations of optimizing fluence in such a manner. Methods: The authors present a novel derivation and implementation of a gradient descent algorithm that allows for optimization during MC particle transport, based on highly stochastic information generated through particle transport of very few histories. A gradient rescaling and renormalization algorithm, and the concept of momentum from stochastic gradient descent were used to address obstacles unique to performing gradient descent fluence optimization during MC particle transport. The authors have applied their method to two simple geometrical phantoms, and one clinical patient geometry to examine the capability of this platform to generate conformal plans as well as assess its computational scaling and efficiency, respectively. Results: The authors obtain a reduction of at least 50% in total histories transported in their investigation compared to a theoretical unweighted beamlet calculation and subsequent fluence optimization method, and observe a roughly fixed optimization time overhead consisting of ∼10% of the total computation time in all cases. Finally, the authors demonstrate a negligible increase in memory overhead of ∼7–8 MB to allow for optimization of a clinical patient geometry surrounded by 36 beams using their platform. Conclusions: This study demonstrates a fluence optimization approach, which could significantly improve the development of next generation radiation therapy solutions while incurring minimal additional computational overhead. PMID:27277051
Map data-driven assessment of urban areas accessibility
NASA Astrophysics Data System (ADS)
Parygin, D. S.; Aleshkevich, A. A.; Golubev, A. V.; Smykovskaya, T. K.; Finogeev, A. G.
2018-05-01
The study analyzes the existing approaches to assessment of the city territory transport accessibility. The method for the city territory sections connectedness assessment through the personal and public transport was developed. The assessment of transport accessibility is proposed based on an analysis of open cartographic data. The technology of calculation and visualization of urban areas interconnectedness with the use of a street network graph and public transport routes, data obtained from Internet map services have been developed. An example of territory accessibility assessments visualization on an online map is given.
Lahmann, John M; Benson, James D; Higgins, Adam Z
2018-02-01
For more than fifty years the human red blood cell (RBC) has been a widely studied model for transmembrane mass transport. Existing literature spans myriad experimental designs with varying results and physiologic interpretations. In this review, we examine the kinetics and mechanisms of membrane transport in the context of RBC cryopreservation. We include a discussion of the pathways for water and glycerol permeation through the cell membrane and the implications for mathematical modeling of the membrane transport process. In particular, we examine the concentration dependence of water and glycerol transport and provide equations for estimating permeability parameters as a function of concentration based on a synthesis of literature data. This concentration-dependent transport model may allow for design of improved methods for post-thaw removal of glycerol from cryopreserved blood. More broadly, the consideration of the concentration dependence of membrane permeability parameters may be important for other cell types as well, especially for design of methods for equilibration with the highly concentrated solutions used for vitrification. Copyright © 2017 Elsevier Inc. All rights reserved.
Light transport and general aviation aircraft icing research requirements
NASA Technical Reports Server (NTRS)
Breeze, R. K.; Clark, G. M.
1981-01-01
A short term and a long term icing research and technology program plan was drafted for NASA LeRC based on 33 separate research items. The specific items listed resulted from a comprehensive literature search, organized and assisted by a computer management file and an industry/Government agency survey. Assessment of the current facilities and icing technology was accomplished by presenting summaries of ice sensitive components and protection methods; and assessments of penalty evaluation, the experimental data base, ice accretion prediction methods, research facilities, new protection methods, ice protection requirements, and icing instrumentation. The intent of the research plan was to determine what icing research NASA LeRC must do or sponsor to ultimately provide for increased utilization and safety of light transport and general aviation aircraft.
An open, object-based modeling approach for simulating subsurface heterogeneity
NASA Astrophysics Data System (ADS)
Bennett, J.; Ross, M.; Haslauer, C. P.; Cirpka, O. A.
2017-12-01
Characterization of subsurface heterogeneity with respect to hydraulic and geochemical properties is critical in hydrogeology as their spatial distribution controls groundwater flow and solute transport. Many approaches of characterizing subsurface heterogeneity do not account for well-established geological concepts about the deposition of the aquifer materials; those that do (i.e. process-based methods) often require forcing parameters that are difficult to derive from site observations. We have developed a new method for simulating subsurface heterogeneity that honors concepts of sequence stratigraphy, resolves fine-scale heterogeneity and anisotropy of distributed parameters, and resembles observed sedimentary deposits. The method implements a multi-scale hierarchical facies modeling framework based on architectural element analysis, with larger features composed of smaller sub-units. The Hydrogeological Virtual Reality simulator (HYVR) simulates distributed parameter models using an object-based approach. Input parameters are derived from observations of stratigraphic morphology in sequence type-sections. Simulation outputs can be used for generic simulations of groundwater flow and solute transport, and for the generation of three-dimensional training images needed in applications of multiple-point geostatistics. The HYVR algorithm is flexible and easy to customize. The algorithm was written in the open-source programming language Python, and is intended to form a code base for hydrogeological researchers, as well as a platform that can be further developed to suit investigators' individual needs. This presentation will encompass the conceptual background and computational methods of the HYVR algorithm, the derivation of input parameters from site characterization, and the results of groundwater flow and solute transport simulations in different depositional settings.
The obtaining and properties of asymmetric ion transport membrane for separating of oxygen from air
NASA Astrophysics Data System (ADS)
Solovieva, A. A.; Kulbakin, I. V.
2018-04-01
The bilayer oxygen-permeable membrane, consisting of a thin-film dense composite based on Co3O4 - 36 wt. % Bi2O3, and of a porous ceramic substrate of Co2SiO4, was synthesized and characterized. The way for obtaining of porous ceramic based on cobalt silicate was found, while the microstructure and the mechanical properties of porous ceramic were studied. Layered casting with post-pressing was used to cover the surface of porous support of Co2SiO4 by the Co3O4 - 36 wt. % Bi2O3 - based film. Transport properties of the asymmetric membrane have been studied, the kinetic features of oxygen transport have been established, and the characteristic thickness of the membrane has been estimated. The methods to prevent the high-temperature creep of ion transport membranes based on solid/molten oxides, which are the promising ones for obtaining of pure oxygen from air, are proposed and discussed.
Information needs for increasing log transport efficiency
Timothy P. McDonald; Steven E. Taylor; Robert B. Rummer; Jorge Valenzuela
2001-01-01
Three methods of dispatching trucks to loggers were tested using a log transport simulation model: random allocation, fixed assignment of trucks to loggers, and dispatch based on knowledge of the current status of trucks and loggers within the system. This 'informed' dispatch algorithm attempted to minimize the difference in time between when a logger would...
40 CFR 278.3 - Criteria for use of chat in Federally funded transportation projects.
Code of Federal Regulations, 2010 CFR
2010-07-01
... funded transportation projects. 278.3 Section 278.3 Protection of Environment ENVIRONMENTAL PROTECTION... Leaching Procedure (SPLP) tests are conducted on the proposed material using EPA SW-846 Method 1312...) EPA (or a State environmental Agency, if it chooses to do so) has determined, based on a site-specific...
Lagrangian based methods for coherent structure detection
NASA Astrophysics Data System (ADS)
Allshouse, Michael R.; Peacock, Thomas
2015-09-01
There has been a proliferation in the development of Lagrangian analytical methods for detecting coherent structures in fluid flow transport, yielding a variety of qualitatively different approaches. We present a review of four approaches and demonstrate the utility of these methods via their application to the same sample analytic model, the canonical double-gyre flow, highlighting the pros and cons of each approach. Two of the methods, the geometric and probabilistic approaches, are well established and require velocity field data over the time interval of interest to identify particularly important material lines and surfaces, and influential regions, respectively. The other two approaches, implementing tools from cluster and braid theory, seek coherent structures based on limited trajectory data, attempting to partition the flow transport into distinct regions. All four of these approaches share the common trait that they are objective methods, meaning that their results do not depend on the frame of reference used. For each method, we also present a number of example applications ranging from blood flow and chemical reactions to ocean and atmospheric flows.
Li, Xiang-Guo; Chu, Iek-Heng; Zhang, X. -G.; ...
2015-05-28
Electron transport in graphene is along the sheet but junction devices are often made by stacking different sheets together in a “side-contact” geometry which causes the current to flow perpendicular to the sheets within the device. Such geometry presents a challenge to first-principles transport methods. We solve this problem by implementing a plane-wave-based multiple-scattering theory for electron transport. In this study, this implementation improves the computational efficiency over the existing plane-wave transport code, scales better for parallelization over large number of nodes, and does not require the current direction to be along a lattice axis. As a first application, wemore » calculate the tunneling current through a side-contact graphene junction formed by two separate graphene sheets with the edges overlapping each other. We find that transport properties of this junction depend strongly on the AA or AB stacking within the overlapping region as well as the vacuum gap between two graphene sheets. Finally, such transport behaviors are explained in terms of carbon orbital orientation, hybridization, and delocalization as the geometry is varied.« less
Yang, Xiaobin; Chen, Zhilong; Guo, Dongjun
2015-07-01
Urban underground transportation projects are introduced to address problems of scarce green land and traffic pollution. As construction of urban underground transportation is still in its infancy, there is no definite quantitative measurement on whether the construction is beneficial and what influences it will place on the region in China. This study intends to construct a comprehensive evaluation method for evaluating social, economic and environmental benefits of urban underground transportation projects and proposes the concept, role and principle for evaluation of environmental and economic benefits. It figures out relationship between the environment and factors of city development. It also summarizes three relevant factors, including transportation, biophysics and social economy, and works out indicators to evaluate the influence of urban underground transportation construction. Based on Contingent Valuation Method (CVM), Cost of Illness Approach (CIA), Human Capital Approach (HCA), this paper constructs 13 monetization calculation models for social, economic and environmental benefits in response to seven aspects, namely, reducing noise pollution and air pollution, using land efficiently, improving traffic safety, reducing traffic congestion, saving shipping time and minimizing transportation costs.
NASA Astrophysics Data System (ADS)
Qiao, Y.
2013-12-01
As China's economic development, water pollution incidents happened frequently. For example, the cyanobacterial bloom events repeatedly occur in Taihu Lake. In this research, we investigate the pollutants solute transport start at different points, such as the eutrophication substances Nitrogen and Phosphorus et al, with the Lattice Boltzmann Method (LBM) performed on real pore geometries. The LBM has emerged as a powerful tool for simulating the behaviour of multi-component fluid systems in complex pore networks. We will build a quick response simulation system, which is base on the high resolution GIS figure, using the LBM numerical method.When the start two deferent points at the Meiliang Bay nearby the Wuxi City, it is shown that the pollutants solute can't transport out of the bay to influence the Taihu Lake and the diffusion areas are similar. On the other hand, when the start point at central region of the Taihu Lake, it is found that the pollutants solute covered the almost whole area of the lake and the cyanobacterial bloom with good condition. In the same way, if the cyanobacterial bloom transport in the central area, then it will pollute the whole Taihu Lake. Therefore, when we monitor and deal with the eutrophication substances, we need to focus on the central area of lake.
NASA Astrophysics Data System (ADS)
Matin, Rastin; Hernandez, Anier; Misztal, Marek; Mathiesen, Joachim
2015-04-01
Many hydrodynamic phenomena ranging from flows at micron scale in porous media, large Reynolds numbers flows, non-Newtonian and multiphase flows have been simulated on computers using the lattice Boltzmann (LB) method. By solving the Lattice Boltzmann Equation on unstructured meshes in three dimensions, we have developed methods to efficiently model the fluid flow in real rock samples. We use this model to study the spatio-temporal statistics of the velocity field inside three-dimensional real geometries and investigate its relation to the, in general, anomalous transport of passive tracers for a wide range of Peclet and Reynolds numbers. We extend this model by free-energy based method, which allows us to simulate binary systems with large-density ratios in a thermodynamically consistent way and track the interface explicitly. In this presentation we will present our recent results on both anomalous transport and multiphase segregation.
Biosensor discovery of thyroxine transport disrupting chemicals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marchesini, Gerardo R.; Meimaridou, Anastasia; Haasnoot, Willem
2008-10-01
Ubiquitous chemicals may interfere with the thyroid system that is essential in the development and physiology of vertebrates. We applied a surface plasmon resonance (SPR) biosensor-based screening method for the fast screening of chemicals with thyroxine (T4) transport disrupting activity. Two inhibition assays using the main thyroid hormone transport proteins, T4 binding globulin (TBG) and transthyretin (TTR), in combination with a T4-coated biosensor chip were optimized and automated for screening chemical libraries. The transport protein-based biosensor assays were rapid, high throughput and bioeffect-related. A library of 62 chemicals including the natural hormones, polychlorinated biphenyls (PCBs), polybrominated diphenylethers (PBDEs) and metabolites,more » halogenated bisphenol A (BPA), halogenated phenols, pharmaceuticals, pesticides and other potential environmentally relevant chemicals was tested with the two assays. We discovered ten new active compounds with moderate to high affinity for TBG with the TBG assay. Strikingly, the most potent binding was observed with hydroxylated metabolites of the brominated diphenyl ethers (BDEs) BDE 47, BDE 49 and BDE 99, that are commonly found in human plasma. The TTR assay confirmed the activity of previously identified hydroxylated metabolites of PCBs and PBDEs, halogenated BPA and genistein. These results show that the hydroxylated metabolites of the ubiquitous PBDEs not only target the T4 transport at the TTR level, but also, and to a great extent, at the TBG level where most of the T4 in humans is circulating. The optimized SPR biosensor-based transport protein assay is a suitable method for high throughput screening of large libraries for potential thyroid hormone disrupting compounds.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahnema, Farzad; Garimeela, Srinivas; Ougouag, Abderrafi
2013-11-29
This project will develop a 3D, advanced coarse mesh transport method (COMET-Hex) for steady- state and transient analyses in advanced very high-temperature reactors (VHTRs). The project will lead to a coupled neutronics and thermal hydraulic (T/H) core simulation tool with fuel depletion capability. The computational tool will be developed in hexagonal geometry, based solely on transport theory without (spatial) homogenization in complicated 3D geometries. In addition to the hexagonal geometry extension, collaborators will concurrently develop three additional capabilities to increase the code’s versatility as an advanced and robust core simulator for VHTRs. First, the project team will develop and implementmore » a depletion method within the core simulator. Second, the team will develop an elementary (proof-of-concept) 1D time-dependent transport method for efficient transient analyses. The third capability will be a thermal hydraulic method coupled to the neutronics transport module for VHTRs. Current advancements in reactor core design are pushing VHTRs toward greater core and fuel heterogeneity to pursue higher burn-ups, efficiently transmute used fuel, maximize energy production, and improve plant economics and safety. As a result, an accurate and efficient neutron transport, with capabilities to treat heterogeneous burnable poison effects, is highly desirable for predicting VHTR neutronics performance. This research project’s primary objective is to advance the state of the art for reactor analysis.« less
Zhou, Y.; Ojeda-May, P.; Nagaraju, M.; Pu, J.
2016-01-01
Adenosine triphosphate (ATP)-binding cassette (ABC) transporters are ubiquitous ATP-dependent membrane proteins involved in translocations of a wide variety of substrates across cellular membranes. To understand the chemomechanical coupling mechanism as well as functional asymmetry in these systems, a quantitative description of how ABC transporters hydrolyze ATP is needed. Complementary to experimental approaches, computer simulations based on combined quantum mechanical and molecular mechanical (QM/MM) potentials have provided new insights into the catalytic mechanism in ABC transporters. Quantitatively reliable determination of the free energy requirement for enzymatic ATP hydrolysis, however, requires substantial statistical sampling on QM/MM potential. A case study shows that brute force sampling of ab initio QM/MM (AI/MM) potential energy surfaces is computationally impractical for enzyme simulations of ABC transporters. On the other hand, existing semiempirical QM/MM (SE/MM) methods, although affordable for free energy sampling, are unreliable for studying ATP hydrolysis. To close this gap, a multiscale QM/MM approach named reaction path–force matching (RP–FM) has been developed. In RP–FM, specific reaction parameters for a selected SE method are optimized against AI reference data along reaction paths by employing the force matching technique. The feasibility of the method is demonstrated for a proton transfer reaction in the gas phase and in solution. The RP–FM method may offer a general tool for simulating complex enzyme systems such as ABC transporters. PMID:27498639
Synthetic Sediments and Stochastic Groundwater Hydrology
NASA Astrophysics Data System (ADS)
Wilson, J. L.
2002-12-01
For over twenty years the groundwater community has pursued the somewhat elusive goal of describing the effects of aquifer heterogeneity on subsurface flow and chemical transport. While small perturbation stochastic moment methods have significantly advanced theoretical understanding, why is it that stochastic applications use instead simulations of flow and transport through multiple realizations of synthetic geology? Allan Gutjahr was a principle proponent of the Fast Fourier Transform method for the synthetic generation of aquifer properties and recently explored new, more geologically sound, synthetic methods based on multi-scale Markov random fields. Focusing on sedimentary aquifers, how has the state-of-the-art of synthetic generation changed and what new developments can be expected, for example, to deal with issues like conceptual model uncertainty, the differences between measurement and modeling scales, and subgrid scale variability? What will it take to get stochastic methods, whether based on moments, multiple realizations, or some other approach, into widespread application?
A Rapid Empirical Method for Estimating the Gross Takeoff Weight of a High Speed Civil Transport
NASA Technical Reports Server (NTRS)
Mack, Robert J.
1999-01-01
During the cruise segment of the flight mission, aircraft flying at supersonic speeds generate sonic booms that are usually maximum at the beginning of cruise. The pressure signature with the shocks causing these perceived booms can be predicted if the aircraft's geometry, Mach number, altitude, angle of attack, and cruise weight are known. Most methods for estimating aircraft weight, especially beginning-cruise weight, are empirical and based on least- square-fit equations that best represent a body of component weight data. The empirical method discussed in this report used simplified weight equations based on a study of performance and weight data from conceptual and real transport aircraft. Like other weight-estimation methods, weights were determined at several points in the mission. While these additional weights were found to be useful, it is the determination of beginning-cruise weight that is most important for the prediction of the aircraft's sonic-boom characteristics.
A Correlation-Based Transition Model using Local Variables. Part 1; Model Formation
NASA Technical Reports Server (NTRS)
Menter, F. R.; Langtry, R. B.; Likki, S. R.; Suzen, Y. B.; Huang, P. G.; Volker, S.
2006-01-01
A new correlation-based transition model has been developed, which is based strictly on local variables. As a result, the transition model is compatible with modern computational fluid dynamics (CFD) approaches, such as unstructured grids and massive parallel execution. The model is based on two transport equations, one for intermittency and one for the transition onset criteria in terms of momentum thickness Reynolds number. The proposed transport equations do not attempt to model the physics of the transition process (unlike, e.g., turbulence models) but from a framework for the implementation of correlation-based models into general-purpose CFD methods.
Ma, Xiaolei; Dai, Zhuang; He, Zhengbing; Ma, Jihui; Wang, Yong; Wang, Yunpeng
2017-04-10
This paper proposes a convolutional neural network (CNN)-based method that learns traffic as images and predicts large-scale, network-wide traffic speed with a high accuracy. Spatiotemporal traffic dynamics are converted to images describing the time and space relations of traffic flow via a two-dimensional time-space matrix. A CNN is applied to the image following two consecutive steps: abstract traffic feature extraction and network-wide traffic speed prediction. The effectiveness of the proposed method is evaluated by taking two real-world transportation networks, the second ring road and north-east transportation network in Beijing, as examples, and comparing the method with four prevailing algorithms, namely, ordinary least squares, k-nearest neighbors, artificial neural network, and random forest, and three deep learning architectures, namely, stacked autoencoder, recurrent neural network, and long-short-term memory network. The results show that the proposed method outperforms other algorithms by an average accuracy improvement of 42.91% within an acceptable execution time. The CNN can train the model in a reasonable time and, thus, is suitable for large-scale transportation networks.
Ma, Xiaolei; Dai, Zhuang; He, Zhengbing; Ma, Jihui; Wang, Yong; Wang, Yunpeng
2017-01-01
This paper proposes a convolutional neural network (CNN)-based method that learns traffic as images and predicts large-scale, network-wide traffic speed with a high accuracy. Spatiotemporal traffic dynamics are converted to images describing the time and space relations of traffic flow via a two-dimensional time-space matrix. A CNN is applied to the image following two consecutive steps: abstract traffic feature extraction and network-wide traffic speed prediction. The effectiveness of the proposed method is evaluated by taking two real-world transportation networks, the second ring road and north-east transportation network in Beijing, as examples, and comparing the method with four prevailing algorithms, namely, ordinary least squares, k-nearest neighbors, artificial neural network, and random forest, and three deep learning architectures, namely, stacked autoencoder, recurrent neural network, and long-short-term memory network. The results show that the proposed method outperforms other algorithms by an average accuracy improvement of 42.91% within an acceptable execution time. The CNN can train the model in a reasonable time and, thus, is suitable for large-scale transportation networks. PMID:28394270
Lattice hydrodynamic model based traffic control: A transportation cyber-physical system approach
NASA Astrophysics Data System (ADS)
Liu, Hui; Sun, Dihua; Liu, Weining
2016-11-01
Lattice hydrodynamic model is a typical continuum traffic flow model, which describes the jamming transition of traffic flow properly. Previous studies in lattice hydrodynamic model have shown that the use of control method has the potential to improve traffic conditions. In this paper, a new control method is applied in lattice hydrodynamic model from a transportation cyber-physical system approach, in which only one lattice site needs to be controlled in this control scheme. The simulation verifies the feasibility and validity of this method, which can ensure the efficient and smooth operation of the traffic flow.
Unified Description of Inelastic Propensity Rules for Electron Transport through Nanoscale Junctions
NASA Astrophysics Data System (ADS)
Paulsson, Magnus; Frederiksen, Thomas; Ueba, Hiromu; Lorente, Nicolás; Brandbyge, Mads
2008-06-01
We present a method to analyze the results of first-principles based calculations of electronic currents including inelastic electron-phonon effects. This method allows us to determine the electronic and vibrational symmetries in play, and hence to obtain the so-called propensity rules for the studied systems. We show that only a few scattering states—namely those belonging to the most transmitting eigenchannels—need to be considered for a complete description of the electron transport. We apply the method on first-principles calculations of four different systems and obtain the propensity rules in each case.
Unconventional tail configurations for transport aircraft
NASA Astrophysics Data System (ADS)
Sánchez-Carmona, A.; Cuerno-Rejado, C.; García-Hernández, L.
2017-06-01
This article presents the bases of a methodology in order to size unconventional tail configurations for transport aircraft. The case study of this paper is a V-tail con¦guration. Firstly, an aerodynamic study is developed for determining stability derivatives and aerodynamic forces. The objective is to size a tail such as it develops at least the same static stability derivatives than a conventional reference aircraft. The optimum is obtained minimizing its weight. The weight is estimated through two methods: adapted Farrar£s method and a statistical method. The solution reached is heavier than the reference, but it reduces the wetted area.
The improvement of the method of equivalent cross section in HTR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guo, J.; Li, F.
The Method of Equivalence Cross-Sections (MECS) is a combined transport-diffusion method. By appropriately adjusting the diffusion coefficient of homogenized absorber region, the diffusion theory could yield satisfactory results for the full core model with strong neutron absorber material, for example the control rod in High temperature gas cooled reactor (HTR). Original implementation of MECS based on 1-D cell transport model has some limitation on accuracy and applicability, a new implementation of MECS based on 2-D transport model are proposed and tested in this paper. This improvement can extend the MECS to the calculation of twin small absorber ball system whichmore » have a non-circular boring in graphite reflector and different radial position. A least-square algorithm for the calculation of equivalent diffusion coefficient is adopted, and special treatment for diffusion coefficient for higher energy group is proposed in the case that absorber is absent. Numerical results to adopt MECS into control rod calculation in HTR are encouraging. However, there are some problems left. (authors)« less
Quantitative phase microscopy for cellular dynamics based on transport of intensity equation.
Li, Ying; Di, Jianglei; Ma, Chaojie; Zhang, Jiwei; Zhong, Jinzhan; Wang, Kaiqiang; Xi, Teli; Zhao, Jianlin
2018-01-08
We demonstrate a simple method for quantitative phase imaging of tiny transparent objects such as living cells based on the transport of intensity equation. The experiments are performed using an inverted bright field microscope upgraded with a flipping imaging module, which enables to simultaneously create two laterally separated images with unequal defocus distances. This add-on module does not include any lenses or gratings and is cost-effective and easy-to-alignment. The validity of this method is confirmed by the measurement of microlens array and human osteoblastic cells in culture, indicating its potential in the applications of dynamically measuring living cells and other transparent specimens in a quantitative, non-invasive and label-free manner.
Refractive-Index-Based Screening of Membrane-Protein-Mediated Transfer across Biological Membranes
Brändén, Magnus; Tabaei, Seyed R.; Fischer, Gerhard; Neutze, Richard; Höök, Fredrik
2010-01-01
Abstract Numerous membrane-transport proteins are major drug targets, and therefore a key ingredient in pharmaceutical development is the availability of reliable, efficient tools for membrane transport characterization and inhibition. Here, we present the use of evanescent-wave sensing for screening of membrane-protein-mediated transport across lipid bilayer membranes. This method is based on a direct recording of the temporal variations in the refractive index that occur upon a transfer-dependent change in the solute concentration inside liposomes associated to a surface plasmon resonance (SPR) active sensor surface. The applicability of the method is demonstrated by a functional study of the aquaglyceroporin PfAQP from the malaria parasite Plasmodium falciparum. Assays of the temperature dependence of facilitated diffusion of sugar alcohols on a single set of PfAQP-reconstituted liposomes reveal that the activation energies for facilitated diffusion of xylitol and sorbitol are the same as that previously measured for glycerol transport in the aquaglyceroporin of Escherichia coli (5 kcal/mole). These findings indicate that the aquaglyceroporin selectivity filter does not discriminate sugar alcohols based on their length, and that the extra energy cost of dehydration of larger sugar alcohols, upon entering the pore, is compensated for by additional hydrogen-bond interactions within the aquaglyceroporin pore. PMID:20655840
Modeling and Simulation of Cardiogenic Embolic Particle Transport to the Brain
NASA Astrophysics Data System (ADS)
Mukherjee, Debanjan; Jani, Neel; Shadden, Shawn C.
2015-11-01
Emboli are aggregates of cells, proteins, or fatty material, which travel along arteries distal to the point of their origin, and can potentially block blood flow to the brain, causing stroke. This is a prominent mechanism of stroke, accounting for about a third of all cases, with the heart being a prominent source of these emboli. This work presents our investigations towards developing numerical simulation frameworks for modeling the transport of embolic particles originating from the heart along the major arteries supplying the brain. The simulations are based on combining discrete particle method with image based computational fluid dynamics. Simulations of unsteady, pulsatile hemodynamics, and embolic particle transport within patient-specific geometries, with physiological boundary conditions, are presented. The analysis is focused on elucidating the distribution of particles, transport of particles in the head across the major cerebral arteries connected at the Circle of Willis, the role of hemodynamic variables on the particle trajectories, and the effect of considering one-way vs. two-way coupling methods for the particle-fluid momentum exchange. These investigations are aimed at advancing our understanding of embolic stroke using computational fluid dynamics techniques. This research was supported by the American Heart Association grant titled ``Embolic Stroke: Anatomic and Physiologic Insights from Image-Based CFD.''
Refractive-index-based screening of membrane-protein-mediated transfer across biological membranes.
Brändén, Magnus; Tabaei, Seyed R; Fischer, Gerhard; Neutze, Richard; Höök, Fredrik
2010-07-07
Numerous membrane-transport proteins are major drug targets, and therefore a key ingredient in pharmaceutical development is the availability of reliable, efficient tools for membrane transport characterization and inhibition. Here, we present the use of evanescent-wave sensing for screening of membrane-protein-mediated transport across lipid bilayer membranes. This method is based on a direct recording of the temporal variations in the refractive index that occur upon a transfer-dependent change in the solute concentration inside liposomes associated to a surface plasmon resonance (SPR) active sensor surface. The applicability of the method is demonstrated by a functional study of the aquaglyceroporin PfAQP from the malaria parasite Plasmodium falciparum. Assays of the temperature dependence of facilitated diffusion of sugar alcohols on a single set of PfAQP-reconstituted liposomes reveal that the activation energies for facilitated diffusion of xylitol and sorbitol are the same as that previously measured for glycerol transport in the aquaglyceroporin of Escherichia coli (5 kcal/mole). These findings indicate that the aquaglyceroporin selectivity filter does not discriminate sugar alcohols based on their length, and that the extra energy cost of dehydration of larger sugar alcohols, upon entering the pore, is compensated for by additional hydrogen-bond interactions within the aquaglyceroporin pore. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Israelsson, Ulf E. (Inventor); Strayer, Donald M. (Inventor)
1992-01-01
A contact-less method for determining transport critical current density and flux penetration depth in bulk superconductor material. A compressor having a hollow interior and a plunger for selectively reducing the free space area for distribution of the magnetic flux therein are formed of superconductor material. Analytical relationships, based upon the critical state model, Maxwell's equations and geometrical relationships define transport critical current density and flux penetration depth in terms of the initial trapped magnetic flux density and the ratio between initial and final magnetic flux densities whereby data may be reliably determined by means of the simple test apparatus for evaluating the current density and flux penetration depth.
Determining transport coefficients for a microscopic simulation of a hadron gas
NASA Astrophysics Data System (ADS)
Pratt, Scott; Baez, Alexander; Kim, Jane
2017-02-01
Quark-gluon plasmas produced in relativistic heavy-ion collisions quickly expand and cool, entering a phase consisting of multiple interacting hadronic resonances just below the QCD deconfinement temperature, T ˜155 MeV. Numerical microscopic simulations have emerged as the principal method for modeling the behavior of the hadronic stage of heavy-ion collisions, but the transport properties that characterize these simulations are not well understood. Methods are presented here for extracting the shear viscosity and two transport parameters that emerge in Israel-Stewart hydrodynamics. The analysis is based on studying how the stress-energy tensor responds to velocity gradients. Results are consistent with Kubo relations if viscous relaxation times are twice the collision time.
NASA Astrophysics Data System (ADS)
Ebrahimnejad, Ali
2015-08-01
There are several methods, in the literature, for solving fuzzy variable linear programming problems (fuzzy linear programming in which the right-hand-side vectors and decision variables are represented by trapezoidal fuzzy numbers). In this paper, the shortcomings of some existing methods are pointed out and to overcome these shortcomings a new method based on the bounded dual simplex method is proposed to determine the fuzzy optimal solution of that kind of fuzzy variable linear programming problems in which some or all variables are restricted to lie within lower and upper bounds. To illustrate the proposed method, an application example is solved and the obtained results are given. The advantages of the proposed method over existing methods are discussed. Also, one application of this algorithm in solving bounded transportation problems with fuzzy supplies and demands is dealt with. The proposed method is easy to understand and to apply for determining the fuzzy optimal solution of bounded fuzzy variable linear programming problems occurring in real-life situations.
Geometric Phase of a Transported Oscillator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dittirich, W.
2004-02-25
An oscillator constrained to a plane that is transported along some surface will rotate by an angle dependent only on the path and the surface, not on the speed at which it is transported. This is thus an example of a geometric phase. We analyze this phase using the methods of parallel transport. This concept plays a key role in General Relativity, but it can also be applied in classical mechanics. The Foucault pendulum can be seen as an application of this analysis, where the surface is a sphere and the curve is a line of constant latitude. In viewmore » of some considerable confusion and erroneous treatments in the recent literature, we here present a rather simple way for visualizing the motion of the Foucault pendulum using concepts that are based on Frenet's formulae and the methods of parallel displacement.« less
A single-stage flux-corrected transport algorithm for high-order finite-volume methods
Chaplin, Christopher; Colella, Phillip
2017-05-08
We present a new limiter method for solving the advection equation using a high-order, finite-volume discretization. The limiter is based on the flux-corrected transport algorithm. Here, we modify the classical algorithm by introducing a new computation for solution bounds at smooth extrema, as well as improving the preconstraint on the high-order fluxes. We compute the high-order fluxes via a method-of-lines approach with fourth-order Runge-Kutta as the time integrator. For computing low-order fluxes, we select the corner-transport upwind method due to its improved stability over donor-cell upwind. Several spatial differencing schemes are investigated for the high-order flux computation, including centered- differencemore » and upwind schemes. We show that the upwind schemes perform well on account of the dissipation of high-wavenumber components. The new limiter method retains high-order accuracy for smooth solutions and accurately captures fronts in discontinuous solutions. Further, we need only apply the limiter once per complete time step.« less
NASA Astrophysics Data System (ADS)
Di Ludovico, Donato; D'Ovidio, Gino
2017-10-01
This paper refers to an interdisciplinary planning research approach that aims to combine urban aspects related to a territorial spatial development with transport requirements connected to an efficiency and sustainable mobility. The proposed research method is based on “Territorial Frames” (TFs) model that derived from an original interpretation of the local context divided into a summation of territorial settlement fabrics characterized in terms of spatial tile, morphology and mobility axes. The TFs, with their own autonomous, different size and structure, are used as the main plot, able to assemble the settlement systems and their posturbane forms. With a view to polycentric and spatial development, the research method allows us to analyse the completeness of the TFs and their connective potential, in order to locate the missing/inefficient elements of the transportation network and planning other TFs essential to support economic and social development processes of the most isolated and disadvantaged inland areas. Finally, a case study of the Italian Median Macroregion configuration based on TFs model approach is proposed, analysed and discussed.
User-based representation of time-resolved multimodal public transportation networks.
Alessandretti, Laura; Karsai, Márton; Gauvin, Laetitia
2016-07-01
Multimodal transportation systems, with several coexisting services like bus, tram and metro, can be represented as time-resolved multilayer networks where the different transportation modes connecting the same set of nodes are associated with distinct network layers. Their quantitative description became possible recently due to openly accessible datasets describing the geo-localized transportation dynamics of large urban areas. Advancements call for novel analytics, which combines earlier established methods and exploits the inherent complexity of the data. Here, we provide a novel user-based representation of public transportation systems, which combines representations, accounting for the presence of multiple lines and reducing the effect of spatial embeddedness, while considering the total travel time, its variability across the schedule, and taking into account the number of transfers necessary. After the adjustment of earlier techniques to the novel representation framework, we analyse the public transportation systems of several French municipal areas and identify hidden patterns of privileged connections. Furthermore, we study their efficiency as compared to the commuting flow. The proposed representation could help to enhance resilience of local transportation systems to provide better design policies for future developments.
User-based representation of time-resolved multimodal public transportation networks
Alessandretti, Laura; Gauvin, Laetitia
2016-01-01
Multimodal transportation systems, with several coexisting services like bus, tram and metro, can be represented as time-resolved multilayer networks where the different transportation modes connecting the same set of nodes are associated with distinct network layers. Their quantitative description became possible recently due to openly accessible datasets describing the geo-localized transportation dynamics of large urban areas. Advancements call for novel analytics, which combines earlier established methods and exploits the inherent complexity of the data. Here, we provide a novel user-based representation of public transportation systems, which combines representations, accounting for the presence of multiple lines and reducing the effect of spatial embeddedness, while considering the total travel time, its variability across the schedule, and taking into account the number of transfers necessary. After the adjustment of earlier techniques to the novel representation framework, we analyse the public transportation systems of several French municipal areas and identify hidden patterns of privileged connections. Furthermore, we study their efficiency as compared to the commuting flow. The proposed representation could help to enhance resilience of local transportation systems to provide better design policies for future developments. PMID:27493773
FHWA infrastructure carbon estimator : final report and user’s guide.
DOT National Transportation Integrated Search
2014-09-01
This study developed a method of estimating energy and GHG emissions from construction and maintenance of transportation systems. Designed as a spreadsheet-based model for practitioners, FHWAs Infrastructure Carbon Estimator is based on data colle...
Bead-Based Microfluidic Sediment Analogues: Fabrication and Colloid Transport.
Guo, Yang; Huang, Jingwei; Xiao, Feng; Yin, Xiaolong; Chun, Jaehun; Um, Wooyong; Neeves, Keith B; Wu, Ning
2016-09-13
Mobile colloids can act as carriers for low-solubility contaminants in the environment. However, the dominant mechanism for this colloid-facilitated transport of chemicals is unclear. Therefore, we developed a bead-based microfluidic platform of sediment analogues and measured both single and population transport of model colloids. The porous medium is assembled through a bead-by-bead injection method. This approach has the versatility to build both electrostatically homogeneous and heterogeneous media at the pore scale. A T-junction at the exit also allowed for encapsulation and enumeration of colloids effluent at single particle resolution to give population dynamics. Tortuosity calculated from pore-scale trajectory analysis and its comparison with lattice Boltzmann simulations revealed that transport of colloids was influenced by the size exclusion effect. The porous media packed by positively and negatively charged beads into two layers showed distinctive colloidal particle retention and significant remobilization and re-adsorption of particles during water flushing. We demonstrated the potential of our method to fabricate porous media with surface heterogeneities at the pore scale. With both single and population dynamics measurement, our platform has the potential to connect pore-scale and macroscale colloid transport on a lab scale and to quantify the impact of grain surface heterogeneities that are natural in the subsurface environment.
Zagórska, Agnieszka; Czopek, Anna; Pawłowski, Maciej; Dybała, Małgorzata; Siwek, Agata; Nowak, Gabriel
2012-11-01
Affinities of arylpiperazinylalkyl derivatives of imidazo[2,1-f]purine-2,4-dione and imidazolidine-2,4-dione for serotonin transporter and their acid-base properties were evaluated. The dissociation constant (pK(a)) of compounds 1-22 were determinated by potentiometric titration and calculated using pKalc 3.1 module of the Pallas system. The data from experimental methods and computational calculations were compared and suitable conclusions were reached.
Davis, Jeffery T [College Park, MD; Sidorov, Vladimir [Richmond, VA; Kotch, Frank W [New Phila., PA
2008-04-08
A compound containing at least two aromatic rings covalently bonded together, with each aromatic ring containing at least one oxyacetamide-based side chain, the compound being capable of forming a chloride ion channel across a lipid bilayer, and transporting chloride ion across the lipid bilayer.
Teschome, Bezu; Facsko, Stefan; Schönherr, Tommy; Kerbusch, Jochen; Keller, Adrian; Erbe, Artur
2016-10-11
DNA origami nanostructures have been used extensively as scaffolds for numerous applications such as for organizing both organic and inorganic nanomaterials, studying single molecule reactions, and fabricating photonic devices. Yet, little has been done toward the integration of DNA origami nanostructures into nanoelectronic devices. Among other challenges, the technical difficulties in producing well-defined electrical contacts between macroscopic electrodes and individual DNA origami-based nanodevices represent a serious bottleneck that hinders the thorough characterization of such devices. Therefore, in this work, we have developed a method to electrically contact individual DNA origami-based metallic nanowires using electron beam lithography. We then characterize the charge transport of such nanowires in the temperature range from room temperature down to 4.2 K. The room temperature charge transport measurements exhibit ohmic behavior, whereas at lower temperatures, multiple charge transport mechanisms such as tunneling and thermally assisted transport start to dominate. Our results confirm that charge transport along metallized DNA origami nanostructures may deviate from pure metallic behavior due to several factors including partial metallization, seed inhomogeneities, impurities, and weak electronic coupling among AuNPs. Besides, this study further elucidates the importance of variable temperature measurements for determining the dominant charge transport mechanisms for conductive nanostructures made by self-assembly approaches.
Konur, Dinçer; Golias, Mihalis M; Darks, Brandon
2013-03-01
State Departments of Transportation (S-DOT's) periodically allocate budget for safety upgrades at railroad-highway crossings. Efficient resource allocation is crucial for reducing accidents at railroad-highway crossings and increasing railroad as well as highway transportation safety. While a specific method is not restricted to S-DOT's, sorting type of procedures are recommended by the Federal Railroad Administration (FRA), United States Department of Transportation for the resource allocation problem. In this study, a generic mathematical model is proposed for the resource allocation problem for railroad-highway crossing safety upgrades. The proposed approach is compared to sorting based methods for safety upgrades of public at-grade railroad-highway crossings in Tennessee. The comparison shows that the proposed mathematical modeling approach is more efficient than sorting methods in reducing accidents and severity. Copyright © 2012 Elsevier Ltd. All rights reserved.
Membrane transporter engineering in industrial biotechnology and whole cell biocatalysis.
Kell, Douglas B; Swainston, Neil; Pir, Pınar; Oliver, Stephen G
2015-04-01
Because they mainly do not involve chemical changes, membrane transporters have been a Cinderella subject in the biotechnology of small molecule production, but this is a serious oversight. Influx transporters contribute significantly to the flux towards product, and efflux transporters ensure the accumulation of product in the much greater extracellular space of fermentors. Programmes for improving biotechnological processes might therefore give greater consideration to transporters than may have been commonplace. Strategies for identifying important transporters include expression profiling, genome-wide knockout studies, stress-based selection, and the use of inhibitors. In addition, modern methods of directed evolution and synthetic biology, especially those effecting changes in energy coupling, offer huge opportunities for increasing the flux towards extracellular product formation by transporter engineering. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Spin-polarized electron transport in hybrid graphene-BN nanoribbons
NASA Astrophysics Data System (ADS)
Gao, Song; Lu, Wei; Zheng, Guo-Hui; Jia, Yalei; Ke, San-Huang
2017-05-01
The experimental realization of hybrid graphene and h-BN provides a new way to modify the electronic and transport properties of graphene-based materials. In this work, we investigate the spin-polarized electron transport in hybrid graphene-BN zigzag nanoribbons by performing first-principles nonequilibrium Green’s function method calculations. A 100% spin-polarized electron transport in a large energy window around the Fermi level is found and this behavior is independent of the ribbon width as long as there contain 3 zigzag carbon chains. This behavior may be useful in making perfect spin filters.
Zhang, Fan; Yeh, Gour-Tsyh; Parker, Jack C; Brooks, Scott C; Pace, Molly N; Kim, Young-Jin; Jardine, Philip M; Watson, David B
2007-06-16
This paper presents a reaction-based water quality transport model in subsurface flow systems. Transport of chemical species with a variety of chemical and physical processes is mathematically described by M partial differential equations (PDEs). Decomposition via Gauss-Jordan column reduction of the reaction network transforms M species reactive transport equations into two sets of equations: a set of thermodynamic equilibrium equations representing N(E) equilibrium reactions and a set of reactive transport equations of M-N(E) kinetic-variables involving no equilibrium reactions (a kinetic-variable is a linear combination of species). The elimination of equilibrium reactions from reactive transport equations allows robust and efficient numerical integration. The model solves the PDEs of kinetic-variables rather than individual chemical species, which reduces the number of reactive transport equations and simplifies the reaction terms in the equations. A variety of numerical methods are investigated for solving the coupled transport and reaction equations. Simulation comparisons with exact solutions were performed to verify numerical accuracy and assess the effectiveness of various numerical strategies to deal with different application circumstances. Two validation examples involving simulations of uranium transport in soil columns are presented to evaluate the ability of the model to simulate reactive transport with complex reaction networks involving both kinetic and equilibrium reactions.
Modeling, Monitoring and Fault Diagnosis of Spacecraft Air Contaminants
NASA Technical Reports Server (NTRS)
Ramirez, W. Fred; Skliar, Mikhail; Narayan, Anand; Morgenthaler, George W.; Smith, Gerald J.
1996-01-01
Progress and results in the development of an integrated air quality modeling, monitoring, fault detection, and isolation system are presented. The focus was on development of distributed models of the air contaminants transport, the study of air quality monitoring techniques based on the model of transport process and on-line contaminant concentration measurements, and sensor placement. Different approaches to the modeling of spacecraft air contamination are discussed, and a three-dimensional distributed parameter air contaminant dispersion model applicable to both laminar and turbulent transport is proposed. A two-dimensional approximation of a full scale transport model is also proposed based on the spatial averaging of the three dimensional model over the least important space coordinate. A computer implementation of the transport model is considered and a detailed development of two- and three-dimensional models illustrated by contaminant transport simulation results is presented. The use of a well established Kalman filtering approach is suggested as a method for generating on-line contaminant concentration estimates based on both real time measurements and the model of contaminant transport process. It is shown that high computational requirements of the traditional Kalman filter can render difficult its real-time implementation for high-dimensional transport model and a novel implicit Kalman filtering algorithm is proposed which is shown to lead to an order of magnitude faster computer implementation in the case of air quality monitoring.
A Monte Carlo method using octree structure in photon and electron transport
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogawa, K.; Maeda, S.
Most of the early Monte Carlo calculations in medical physics were used to calculate absorbed dose distributions, and detector responses and efficiencies. Recently, data acquisition in Single Photon Emission CT (SPECT) has been simulated by a Monte Carlo method to evaluate scatter photons generated in a human body and a collimator. Monte Carlo simulations in SPECT data acquisition are generally based on the transport of photons only because the photons being simulated are low energy, and therefore the bremsstrahlung productions by the electrons generated are negligible. Since the transport calculation of photons without electrons is much simpler than that withmore » electrons, it is possible to accomplish the high-speed simulation in a simple object with one medium. Here, object description is important in performing the photon and/or electron transport using a Monte Carlo method efficiently. The authors propose a new description method using an octree representation of an object. Thus even if the boundaries of each medium are represented accurately, high-speed calculation of photon transport can be accomplished because the number of voxels is much fewer than that of the voxel-based approach which represents an object by a union of the voxels of the same size. This Monte Carlo code using the octree representation of an object first establishes the simulation geometry by reading octree string, which is produced by forming an octree structure from a set of serial sections for the object before the simulation; then it transports photons in the geometry. Using the code, if the user just prepares a set of serial sections for the object in which he or she wants to simulate photon trajectories, he or she can perform the simulation automatically using the suboptimal geometry simplified by the octree representation without forming the optimal geometry by handwriting.« less
2013-08-06
of the problem studied Proton exchange membrane fuel cells ( PEMFCs ) are the most promising candidate systems for alternative electricity...characteristic. The limiting current can be used as a tool to study mass transport phenomena in PEMFC because it can provide experimental data for the...coefficient for PEMFCs under in situ conditions based on the galvanostatic discharge of a cell with an interrupted reactant supply. The results indicated
Simplified web-based decision support method for traffic management and work zone analysis.
DOT National Transportation Integrated Search
2017-01-01
Traffic congestion mitigation is one of the key challenges that transportation planners and operations engineers face when planning for construction and maintenance activities. There is a wide variety of approaches and methods that address work zone ...
Simplified web-based decision support method for traffic management and work zone analysis.
DOT National Transportation Integrated Search
2015-06-01
Traffic congestion mitigation is one of the key challenges that transportation planners and operations engineers face when : planning for construction and maintenance activities. There is a wide variety of approaches and methods that address work : z...
NASA Astrophysics Data System (ADS)
Kukushkin, A. B.; Sdvizhenskii, P. A.
2017-12-01
The results of accuracy analysis of automodel solutions for Lévy flight-based transport on a uniform background are presented. These approximate solutions have been obtained for Green’s function of the following equations: the non-stationary Biberman-Holstein equation for three-dimensional (3D) radiative transfer in plasma and gases, for various (Doppler, Lorentz, Voigt and Holtsmark) spectral line shapes, and the 1D transport equation with a simple longtailed step-length probability distribution function with various power-law exponents. The results suggest the possibility of substantial extension of the developed method of automodel solution to other fields far beyond physics.
NASA Astrophysics Data System (ADS)
Lu, Jian-Duo; Li, Yun-Bao; Liu, Hong-Yu; Peng, Shun-Jin; Zhao, Fei-Xiang
2016-09-01
Based on the transfer-matrix method, a systematic investigation of electron transport properties is done in a monolayer graphene modulated by the realistic magnetic field and the Schottky metal stripe. The strong dependence of the electron transmission and the conductance on the incident angle of carriers is clearly seen. The height, position as well as width of the barrier also play an important role on the electron transport properties. These interesting results are very useful for understanding the tunneling mechanism in the monolayer graphene and helpful for designing the graphene-based electrical device modulated by the realistic magnetic field and the electrical barrier.
NASA Astrophysics Data System (ADS)
Most, Sebastian; Nowak, Wolfgang; Bijeljic, Branko
2015-04-01
Fickian transport in groundwater flow is the exception rather than the rule. Transport in porous media is frequently simulated via particle methods (i.e. particle tracking random walk (PTRW) or continuous time random walk (CTRW)). These methods formulate transport as a stochastic process of particle position increments. At the pore scale, geometry and micro-heterogeneities prohibit the commonly made assumption of independent and normally distributed increments to represent dispersion. Many recent particle methods seek to loosen this assumption. Hence, it is important to get a better understanding of the processes at pore scale. For our analysis we track the positions of 10.000 particles migrating through the pore space over time. The data we use come from micro CT scans of a homogeneous sandstone and encompass about 10 grain sizes. Based on those images we discretize the pore structure and simulate flow at the pore scale based on the Navier-Stokes equation. This flow field realistically describes flow inside the pore space and we do not need to add artificial dispersion during the transport simulation. Next, we use particle tracking random walk and simulate pore-scale transport. Finally, we use the obtained particle trajectories to do a multivariate statistical analysis of the particle motion at the pore scale. Our analysis is based on copulas. Every multivariate joint distribution is a combination of its univariate marginal distributions. The copula represents the dependence structure of those univariate marginals and is therefore useful to observe correlation and non-Gaussian interactions (i.e. non-Fickian transport). The first goal of this analysis is to better understand the validity regions of commonly made assumptions. We are investigating three different transport distances: 1) The distance where the statistical dependence between particle increments can be modelled as an order-one Markov process. This would be the Markovian distance for the process, where the validity of yet-unexplored non-Gaussian-but-Markovian random walks start. 2) The distance where bivariate statistical dependence simplifies to a multi-Gaussian dependence based on simple linear correlation (validity of correlated PTRW/CTRW). 3) The distance of complete statistical independence (validity of classical PTRW/CTRW). The second objective is to reveal characteristic dependencies influencing transport the most. Those dependencies can be very complex. Copulas are highly capable of representing linear dependence as well as non-linear dependence. With that tool we are able to detect persistent characteristics dominating transport even across different scales. The results derived from our experimental data set suggest that there are many more non-Fickian aspects of pore-scale transport than the univariate statistics of longitudinal displacements. Non-Fickianity can also be found in transverse displacements, and in the relations between increments at different time steps. Also, the found dependence is non-linear (i.e. beyond simple correlation) and persists over long distances. Thus, our results strongly support the further refinement of techniques like correlated PTRW or correlated CTRW towards non-linear statistical relations.
NASA Astrophysics Data System (ADS)
Dement'eva, Marina
2017-10-01
The paper presents the results of a comparative analysis of two fundamentally different methods for planning capital repairs of objects of transport infrastructure and residential development. The first method was based on perspective long-term plans. Normative service life were the basis for planning the periodicity of repairs. The second method was based on the performance of repairs in fact of the onset of the malfunction. Problems of financing repair work, of the uneven aging of constructs and engineering systems, different wear mechanism in different conditions of exploitation, absence of methods of planning repairs of administrative and production buildings (depots, stations, etc.) justify the need to optimize methods of planning the repair and the relevance of this paper. The aim of the study was to develop the main provisions of an integrated technique for planning the capital repair of buildings of any functional purpose, which combines the advantages of each of the discussed planning methods. For this purpose, the consequences of technical and economic risk were analyzed of the buildings, including stations, depots, transport transfer hubs, administrative buildings, etc when choosing different planning methods. One of the significant results of the study is the possibility of justifying the optimal period of capital repairs on the basis of the proposed technical and economic criteria. The adjustment of the planned repair schedule is carried out taking into account the reliability and cost-effectiveness of the exploitation process.
Direct Discrete Method for Neutronic Calculations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vosoughi, Naser; Akbar Salehi, Ali; Shahriari, Majid
The objective of this paper is to introduce a new direct method for neutronic calculations. This method which is named Direct Discrete Method, is simpler than the neutron Transport equation and also more compatible with physical meaning of problems. This method is based on physic of problem and with meshing of the desired geometry, writing the balance equation for each mesh intervals and with notice to the conjunction between these mesh intervals, produce the final discrete equations series without production of neutron transport differential equation and mandatory passing from differential equation bridge. We have produced neutron discrete equations for amore » cylindrical shape with two boundary conditions in one group energy. The correction of the results from this method are tested with MCNP-4B code execution. (authors)« less
Strategic Technologies for Deep Space Transport
NASA Technical Reports Server (NTRS)
Litchford, Ronald J.
2016-01-01
Deep space transportation capability for science and exploration is fundamentally limited by available propulsion technologies. Traditional chemical systems are performance plateaued and require enormous Initial Mass in Low Earth Orbit (IMLEO) whereas solar electric propulsion systems are power limited and unable to execute rapid transits. Nuclear based propulsion and alternative energetic methods, on the other hand, represent potential avenues, perhaps the only viable avenues, to high specific power space transport evincing reduced trip time, reduced IMLEO, and expanded deep space reach. Here, key deep space transport mission capability objectives are reviewed in relation to STMD technology portfolio needs, and the advanced propulsion technology solution landscape is examined including open questions, technical challenges, and developmental prospects. Options for potential future investment across the full compliment of STMD programs are presented based on an informed awareness of complimentary activities in industry, academia, OGAs, and NASA mission directorates.
NASA Astrophysics Data System (ADS)
Singh, Deo Raj
Forster resonance energy transfer (FRET) has become an important tool to study proteins inside living cells. It has been used to explore membrane protein folding and dynamics, determine stoichiometry and geometry of protein complexes, and measure the distance between two molecules. In this dissertation, we use a method based on FRET and optical micro-spectroscopy (OptiMiS) technology, developed in our lab, to probe the structure of dynamic (as opposed to static) protein complexes in living cells. We use this method to determine the association stoichiometry and quaternary structure of an ABC transporter in living cells. Specifically, the transporter we investigate originates from the pathogen Pseudomonas aeruginosa, which is a Gram-negative bacterium with several virulence factors, lipopolysaccharides being one of them. This pathogen coexpresses two unique forms of lipopolysaccharides on its surface, the A- and B-bands. The A-band polysaccharides, synthesized in the cytoplasm, are translocated into the periplasm through an ATP-binding-cassette (ABC) transporter consisting of a transmembranar protein, Wzm, and a nucleotide-binding protein, Wzt. In P. aeruginosa, all of the biochemical studies of A-band LPS are concentrated on the stages of the synthesis and ligation of polysaccharides (PSs), leaving the export stage involving ABC transporter unexplored. The mode of PS export through ABC transporters is still unknown. This difficulty is due to the lack of information about sub-unit composition and structure of this bi-component ABC transporter. Using the FRET-OptiMiS combination method developed by our lab, we found that Wzt forms a rhombus-shaped homo-tetramer which becomes a square upon co-expression with Wzm, and that Wzm forms a square-shaped homo-tetramer both in the presence and absence of Wzt. Based on these results, we propose a structural model for the double-tetramer complex formed by the bi-component ABC transporter in living cells. An understanding of the structure and behavior of this ABC transporter will help develop antibiotics targeting the biosynthesis of the A-band LPS endotoxin.
Optimal Mass Transport for Shape Matching and Comparison
Su, Zhengyu; Wang, Yalin; Shi, Rui; Zeng, Wei; Sun, Jian; Luo, Feng; Gu, Xianfeng
2015-01-01
Surface based 3D shape analysis plays a fundamental role in computer vision and medical imaging. This work proposes to use optimal mass transport map for shape matching and comparison, focusing on two important applications including surface registration and shape space. The computation of the optimal mass transport map is based on Monge-Brenier theory, in comparison to the conventional method based on Monge-Kantorovich theory, this method significantly improves the efficiency by reducing computational complexity from O(n2) to O(n). For surface registration problem, one commonly used approach is to use conformal map to convert the shapes into some canonical space. Although conformal mappings have small angle distortions, they may introduce large area distortions which are likely to cause numerical instability thus resulting failures of shape analysis. This work proposes to compose the conformal map with the optimal mass transport map to get the unique area-preserving map, which is intrinsic to the Riemannian metric, unique, and diffeomorphic. For shape space study, this work introduces a novel Riemannian framework, Conformal Wasserstein Shape Space, by combing conformal geometry and optimal mass transport theory. In our work, all metric surfaces with the disk topology are mapped to the unit planar disk by a conformal mapping, which pushes the area element on the surface to a probability measure on the disk. The optimal mass transport provides a map from the shape space of all topological disks with metrics to the Wasserstein space of the disk and the pullback Wasserstein metric equips the shape space with a Riemannian metric. We validate our work by numerous experiments and comparisons with prior approaches and the experimental results demonstrate the efficiency and efficacy of our proposed approach. PMID:26440265
Gottschlich, Carsten; Schuhmacher, Dominic
2014-01-01
Finding solutions to the classical transportation problem is of great importance, since this optimization problem arises in many engineering and computer science applications. Especially the Earth Mover's Distance is used in a plethora of applications ranging from content-based image retrieval, shape matching, fingerprint recognition, object tracking and phishing web page detection to computing color differences in linguistics and biology. Our starting point is the well-known revised simplex algorithm, which iteratively improves a feasible solution to optimality. The Shortlist Method that we propose substantially reduces the number of candidates inspected for improving the solution, while at the same time balancing the number of pivots required. Tests on simulated benchmarks demonstrate a considerable reduction in computation time for the new method as compared to the usual revised simplex algorithm implemented with state-of-the-art initialization and pivot strategies. As a consequence, the Shortlist Method facilitates the computation of large scale transportation problems in viable time. In addition we describe a novel method for finding an initial feasible solution which we coin Modified Russell's Method.
Gottschlich, Carsten; Schuhmacher, Dominic
2014-01-01
Finding solutions to the classical transportation problem is of great importance, since this optimization problem arises in many engineering and computer science applications. Especially the Earth Mover's Distance is used in a plethora of applications ranging from content-based image retrieval, shape matching, fingerprint recognition, object tracking and phishing web page detection to computing color differences in linguistics and biology. Our starting point is the well-known revised simplex algorithm, which iteratively improves a feasible solution to optimality. The Shortlist Method that we propose substantially reduces the number of candidates inspected for improving the solution, while at the same time balancing the number of pivots required. Tests on simulated benchmarks demonstrate a considerable reduction in computation time for the new method as compared to the usual revised simplex algorithm implemented with state-of-the-art initialization and pivot strategies. As a consequence, the Shortlist Method facilitates the computation of large scale transportation problems in viable time. In addition we describe a novel method for finding an initial feasible solution which we coin Modified Russell's Method. PMID:25310106
Al Feteisi, Hajar; Achour, Brahim; Rostami-Hodjegan, Amin; Barber, Jill
2015-01-01
Drug-metabolizing enzymes and transporters play an important role in drug absorption, distribution, metabolism and excretion and, consequently, they influence drug efficacy and toxicity. Quantification of drug-metabolizing enzymes and transporters in various tissues is therefore essential for comprehensive elucidation of drug absorption, distribution, metabolism and excretion. Recent advances in liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) have improved the quantification of pharmacologically relevant proteins. This report presents an overview of mass spectrometry-based methods currently used for the quantification of drug-metabolizing enzymes and drug transporters, mainly focusing on applications and cost associated with various quantitative strategies based on stable isotope-labeled standards (absolute quantification peptide standards, quantification concatemers, protein standards for absolute quantification) and label-free analysis. In mass spectrometry, there is no simple relationship between signal intensity and analyte concentration. Proteomic strategies are therefore complex and several factors need to be considered when selecting the most appropriate method for an intended application, including the number of proteins and samples. Quantitative strategies require appropriate mass spectrometry platforms, yet choice is often limited by the availability of appropriate instrumentation. Quantitative proteomics research requires specialist practical skills and there is a pressing need to dedicate more effort and investment to training personnel in this area. Large-scale multicenter collaborations are also needed to standardize quantitative strategies in order to improve physiologically based pharmacokinetic models.
Shape Classification Using Wasserstein Distance for Brain Morphometry Analysis.
Su, Zhengyu; Zeng, Wei; Wang, Yalin; Lu, Zhong-Lin; Gu, Xianfeng
2015-01-01
Brain morphometry study plays a fundamental role in medical imaging analysis and diagnosis. This work proposes a novel framework for brain cortical surface classification using Wasserstein distance, based on uniformization theory and Riemannian optimal mass transport theory. By Poincare uniformization theorem, all shapes can be conformally deformed to one of the three canonical spaces: the unit sphere, the Euclidean plane or the hyperbolic plane. The uniformization map will distort the surface area elements. The area-distortion factor gives a probability measure on the canonical uniformization space. All the probability measures on a Riemannian manifold form the Wasserstein space. Given any 2 probability measures, there is a unique optimal mass transport map between them, the transportation cost defines the Wasserstein distance between them. Wasserstein distance gives a Riemannian metric for the Wasserstein space. It intrinsically measures the dissimilarities between shapes and thus has the potential for shape classification. To the best of our knowledge, this is the first. work to introduce the optimal mass transport map to general Riemannian manifolds. The method is based on geodesic power Voronoi diagram. Comparing to the conventional methods, our approach solely depends on Riemannian metrics and is invariant under rigid motions and scalings, thus it intrinsically measures shape distance. Experimental results on classifying brain cortical surfaces with different intelligence quotients demonstrated the efficiency and efficacy of our method.
Shape Classification Using Wasserstein Distance for Brain Morphometry Analysis
Su, Zhengyu; Zeng, Wei; Wang, Yalin; Lu, Zhong-Lin; Gu, Xianfeng
2015-01-01
Brain morphometry study plays a fundamental role in medical imaging analysis and diagnosis. This work proposes a novel framework for brain cortical surface classification using Wasserstein distance, based on uniformization theory and Riemannian optimal mass transport theory. By Poincare uniformization theorem, all shapes can be conformally deformed to one of the three canonical spaces: the unit sphere, the Euclidean plane or the hyperbolic plane. The uniformization map will distort the surface area elements. The area-distortion factor gives a probability measure on the canonical uniformization space. All the probability measures on a Riemannian manifold form the Wasserstein space. Given any 2 probability measures, there is a unique optimal mass transport map between them, the transportation cost defines the Wasserstein distance between them. Wasserstein distance gives a Riemannian metric for the Wasserstein space. It intrinsically measures the dissimilarities between shapes and thus has the potential for shape classification. To the best of our knowledge, this is the first work to introduce the optimal mass transport map to general Riemannian manifolds. The method is based on geodesic power Voronoi diagram. Comparing to the conventional methods, our approach solely depends on Riemannian metrics and is invariant under rigid motions and scalings, thus it intrinsically measures shape distance. Experimental results on classifying brain cortical surfaces with different intelligence quotients demonstrated the efficiency and efficacy of our method. PMID:26221691
NASA Astrophysics Data System (ADS)
Lu, Mujie; Shang, Wenjie; Ji, Xinkai; Hua, Mingzhuang; Cheng, Kuo
2015-12-01
Nowadays, intelligent transportation system (ITS) has already become the new direction of transportation development. Traffic data, as a fundamental part of intelligent transportation system, is having a more and more crucial status. In recent years, video observation technology has been widely used in the field of traffic information collecting. Traffic flow information contained in video data has many advantages which is comprehensive and can be stored for a long time, but there are still many problems, such as low precision and high cost in the process of collecting information. This paper aiming at these problems, proposes a kind of traffic target detection method with broad applicability. Based on three different ways of getting video data, such as aerial photography, fixed camera and handheld camera, we develop a kind of intelligent analysis software which can be used to extract the macroscopic, microscopic traffic flow information in the video, and the information can be used for traffic analysis and transportation planning. For road intersections, the system uses frame difference method to extract traffic information, for freeway sections, the system uses optical flow method to track the vehicles. The system was applied in Nanjing, Jiangsu province, and the application shows that the system for extracting different types of traffic flow information has a high accuracy, it can meet the needs of traffic engineering observations and has a good application prospect.
Synergism of the method of characteristics and CAD technology for neutron transport calculation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Z.; Wang, D.; He, T.
2013-07-01
The method of characteristics (MOC) is a very popular methodology in neutron transport calculation and numerical simulation in recent decades for its unique advantages. One of the key problems determining whether the MOC can be applied in complicated and highly heterogeneous geometry is how to combine an effective geometry processing method with MOC. Most of the existing MOC codes describe the geometry by lines and arcs with extensive input data, such as circles, ellipses, regular polygons and combination of them. Thus they have difficulty in geometry modeling, background meshing and ray tracing for complicated geometry domains. In this study, amore » new idea making use of a CAD solid modeler MCAM which is a CAD/Image-based Automatic Modeling Program for Neutronics and Radiation Transport developed by FDS Team in China was introduced for geometry modeling and ray tracing of particle transport to remove these geometrical limitations mentioned above. The diamond-difference scheme was applied to MOC to reduce the spatial discretization error of the flat flux approximation in theory. Based on MCAM and MOC, a new MOC code was developed and integrated into SuperMC system, which is a Super Multi-function Computational system for neutronics and radiation simulation. The numerical testing results demonstrated the feasibility and effectiveness of the new idea for geometry treatment in SuperMC. (authors)« less
Stochastic-field cavitation model
NASA Astrophysics Data System (ADS)
Dumond, J.; Magagnato, F.; Class, A.
2013-07-01
Nonlinear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally, the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian "particles" or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and, in particular, to cavitating flow. To validate the proposed stochastic-field cavitation model, two applications are considered. First, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.
Wang, Meng; Li, Sijin; Zhao, Huimin
2016-01-01
The development of high-throughput phenotyping tools is lagging far behind the rapid advances of genotype generation methods. To bridge this gap, we report a new strategy for design, construction, and fine-tuning of intracellular-metabolite-sensing/regulation gene circuits by repurposing bacterial transcription factors and eukaryotic promoters. As proof of concept, we systematically investigated the design and engineering of bacterial repressor-based xylose-sensing/regulation gene circuits in Saccharomyces cerevisiae. We demonstrated that numerous properties, such as induction ratio and dose-response curve, can be fine-tuned at three different nodes, including repressor expression level, operator position, and operator sequence. By applying these gene circuits, we developed a cell sorting based, rapid and robust high-throughput screening method for xylose transporter engineering and obtained a sugar transporter HXT14 mutant with 6.5-fold improvement in xylose transportation capacity. This strategy should be generally applicable and highly useful for evolutionary engineering of proteins, pathways, and genomes in S. cerevisiae. © 2015 Wiley Periodicals, Inc.
Stochastic-field cavitation model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dumond, J., E-mail: julien.dumond@areva.com; AREVA GmbH, Erlangen, Paul-Gossen-Strasse 100, D-91052 Erlangen; Magagnato, F.
2013-07-15
Nonlinear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally, the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian “particles” or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and, in particular, to cavitating flow. To validate the proposed stochastic-fieldmore » cavitation model, two applications are considered. First, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.« less
Electrical and fluid transport in consolidated sphere packs
NASA Astrophysics Data System (ADS)
Zhan, Xin; Schwartz, Lawrence M.; Toksöz, M. Nafi
2015-05-01
We calculate geometrical and transport properties (electrical conductivity, permeability, specific surface area, and surface conductivity) of a family of model granular porous media from an image based representation of its microstructure. The models are based on the packing described by Finney and cover a wide range of porosities. Finite difference methods are applied to solve for electrical conductivity and hydraulic permeability. Two image processing methods are used to identify the pore-grain interface and to test correlations linking permeability to electrical conductivity. A three phase conductivity model is developed to compute surface conductivity associated with the grain-pore interface. Our results compare well against empirical models over the entire porosity range studied. We conclude by examining the influence of image resolution on our calculations.
NASA Astrophysics Data System (ADS)
Cho, Joung-min; Mori, Takehiko
2016-06-01
Transistors based on single-crystal films of 2-decyl-7-phenyl-[1]benzothieno[3,2-b][1]benzothiophene (Ph-BTBT-10) fabricated using the blade-coating method are investigated by the four-probe method down to low temperatures. The four-probe mobility is as large as 18 cm2/V s at room temperature, and increases to 45 cm2/V s at 80 K. At 60 K the two-probe mobility drops abruptly by about 50%, but the mobility drop is mostly attributed to the increase of the source resistance. The carrier transport in the present single-crystal film is regarded as essentially bandlike down to 30 K.
Thermoelectric Measurements of Magnetic Nanostructures Using Thermal Isolation Platforms
NASA Astrophysics Data System (ADS)
Avery, A. D.; Sultan, R.; Bassett, D.; Pufall, M. R.; Zink, B. L.
2010-03-01
The effective design of next-generation memory storage and logic devices based on spin necessitates a thorough understanding of transport properties of their potential components. Although electrical transport in magnetic materials is well-understood, thermal transport is historically difficult to measure. Using micromachined thermal isolation structures, we make direct measurements of thermal and electrical transport in these systems. Our technique offers a method for accurately measuring films and other low-dimensional geometries from the microscale down to the nano regime. We will present in-plane thermal conductivity, resistivity, and thermopower results, as well as direct comparisons with the Wiedemann-Franz law for films of various thicknesses and preparation techniques. We will also present the extension of our technique to explore an evaporated multilayer film. Finally, we discuss the application of our method to examining the fundamental physics underlying thermoelectric effects, such as thermally driven spin currents, to further the emerging sub-field of spin caloritronics.
Design synthesis and optimization of joined-wing transports
NASA Technical Reports Server (NTRS)
Gallman, John W.; Smith, Stephen C.; Kroo, Ilan M.
1990-01-01
A computer program for aircraft synthesis using a numerical optimizer was developed to study the application of the joined-wing configuration to transport aircraft. The structural design algorithm included the effects of secondary bending moments to investigate the possibility of tail buckling and to design joined wings resistant to buckling. The structural weight computed using this method was combined with a statistically-based method to obtain realistic estimates of total lifting surface weight and aircraft empty weight. A variety of 'optimum' joined-wing and conventional aircraft designs were compared on the basis of direct operating cost, gross weight, and cruise drag. The most promising joined-wing designs were found to have a joint location at about 70 percent of the wing semispan. The optimum joined-wing transport is shown to save 1.7 percent in direct operating cost and 11 percent in drag for a 2000 nautical mile transport mission.
Consistent transport coefficients in astrophysics
NASA Technical Reports Server (NTRS)
Fontenla, Juan M.; Rovira, M.; Ferrofontan, C.
1986-01-01
A consistent theory for dealing with transport phenomena in stellar atmospheres starting with the kinetic equations and introducing three cases (LTE, partial LTE, and non-LTE) was developed. The consistent hydrodynamical equations were presented for partial-LTE, the transport coefficients defined, and a method shown to calculate them. The method is based on the numerical solution of kinetic equations considering Landau, Boltzmann, and Focker-Planck collision terms. Finally a set of results for the transport coefficients derived for a partially ionized hydrogen gas with radiation was shown, considering ionization and recombination as well as elastic collisions. The results obtained imply major changes is some types of theoretical model calculations and can resolve some important current problems concerning energy and mass balance in the solar atmosphere. It is shown that energy balance in the lower solar transition region can be fully explained by means of radiation losses and conductive flux.
Olbrant, Edgar; Frank, Martin
2010-12-01
In this paper, we study a deterministic method for particle transport in biological tissues. The method is specifically developed for dose calculations in cancer therapy and for radiological imaging. Generalized Fokker-Planck (GFP) theory [Leakeas and Larsen, Nucl. Sci. Eng. 137 (2001), pp. 236-250] has been developed to improve the Fokker-Planck (FP) equation in cases where scattering is forward-peaked and where there is a sufficient amount of large-angle scattering. We compare grid-based numerical solutions to FP and GFP in realistic medical applications. First, electron dose calculations in heterogeneous parts of the human body are performed. Therefore, accurate electron scattering cross sections are included and their incorporation into our model is extensively described. Second, we solve GFP approximations of the radiative transport equation to investigate reflectance and transmittance of light in biological tissues. All results are compared with either Monte Carlo or discrete-ordinates transport solutions.
A Theoretical Review on Interfacial Thermal Transport at the Nanoscale.
Zhang, Ping; Yuan, Peng; Jiang, Xiong; Zhai, Siping; Zeng, Jianhua; Xian, Yaoqi; Qin, Hongbo; Yang, Daoguo
2018-01-01
With the development of energy science and electronic technology, interfacial thermal transport has become a key issue for nanoelectronics, nanocomposites, energy transmission, and conservation, etc. The application of thermal interfacial materials and other physical methods can reliably improve the contact between joined surfaces and enhance interfacial thermal transport at the macroscale. With the growing importance of thermal management in micro/nanoscale devices, controlling and tuning the interfacial thermal resistance (ITR) at the nanoscale is an urgent task. This Review examines nanoscale interfacial thermal transport mainly from a theoretical perspective. Traditional theoretical models, multiscale models, and atomistic methodologies for predicting ITR are introduced. Based on the analysis and summary of the factors that influence ITR, new methods to control and reduce ITR at the nanoscale are described in detail. Furthermore, the challenges facing interfacial thermal management and the further progress required in this field are discussed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Nguyen, Thi-Thuy-My; Gandin, Charles-André; Combeau, Hervé; Založnik, Miha; Bellet, Michel
2018-02-01
The transport of solid crystals in the liquid pool during solidification of large ingots is known to have a significant effect on their final grain structure and macrosegregation. Numerical modeling of the associated physics is challenging since complex and strong interactions between heat and mass transfer at the microscopic and macroscopic scales must be taken into account. The paper presents a finite element multi-scale solidification model coupling nucleation, growth, and solute diffusion at the microscopic scale, represented by a single unique grain, while also including transport of the liquid and solid phases at the macroscopic scale of the ingots. The numerical resolution is based on a splitting method which sequentially describes the evolution and interaction of quantities into a transport and a growth stage. This splitting method reduces the non-linear complexity of the set of equations and is, for the first time, implemented using the finite element method. This is possible due to the introduction of an artificial diffusion in all conservation equations solved by the finite element method. Simulations with and without grain transport are compared to demonstrate the impact of solid phase transport on the solidification process as well as the formation of macrosegregation in a binary alloy (Sn-5 wt pct Pb). The model is also applied to the solidification of the binary alloy Fe-0.36 wt pct C in a domain representative of a 3.3-ton steel ingot.
Heberton, C.I.; Russell, T.F.; Konikow, Leonard F.; Hornberger, G.Z.
2000-01-01
This report documents the U.S. Geological Survey Eulerian-Lagrangian Localized Adjoint Method (ELLAM) algorithm that solves an integral form of the solute-transport equation, incorporating an implicit-in-time difference approximation for the dispersive and sink terms. Like the algorithm in the original version of the U.S. Geological Survey MOC3D transport model, ELLAM uses a method of characteristics approach to solve the transport equation on the basis of the velocity field. The ELLAM algorithm, however, is based on an integral formulation of conservation of mass and uses appropriate numerical techniques to obtain global conservation of mass. The implicit procedure eliminates several stability criteria required for an explicit formulation. Consequently, ELLAM allows large transport time increments to be used. ELLAM can produce qualitatively good results using a small number of transport time steps. A description of the ELLAM numerical method, the data-input requirements and output options, and the results of simulator testing and evaluation are presented. The ELLAM algorithm was evaluated for the same set of problems used to test and evaluate Version 1 and Version 2 of MOC3D. These test results indicate that ELLAM offers a viable alternative to the explicit and implicit solvers in MOC3D. Its use is desirable when mass balance is imperative or a fast, qualitative model result is needed. Although accurate solutions can be generated using ELLAM, its efficiency relative to the two previously documented solution algorithms is problem dependent.
Quantum transport modelling of silicon nanobeams using heterogeneous computing scheme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harb, M., E-mail: harbm@physics.mcgill.ca; Michaud-Rioux, V., E-mail: vincentm@physics.mcgill.ca; Guo, H., E-mail: guo@physics.mcgill.ca
We report the development of a powerful method for quantum transport calculations of nanowire/nanobeam structures with large cross sectional area. Our approach to quantum transport is based on Green's functions and tight-binding potentials. A linear algebraic formulation allows us to harness the massively parallel nature of Graphics Processing Units (GPUs) and our implementation is based on a heterogeneous parallel computing scheme with traditional processors and GPUs working together. Using our software tool, the electronic and quantum transport properties of silicon nanobeams with a realistic cross sectional area of ∼22.7 nm{sup 2} and a length of ∼81.5 nm—comprising 105 000 Si atoms and 24 000more » passivating H atoms in the scattering region—are investigated. The method also allows us to perform significant averaging over impurity configurations—all possible configurations were considered in the case of single impurities. Finally, the effect of the position and number of vacancy defects on the transport properties was considered. It is found that the configurations with the vacancies lying closer to the local density of states (LDOS) maxima have lower transmission functions than the configurations with the vacancies located at LDOS minima or far away from LDOS maxima, suggesting both a qualitative method to tune or estimate optimal impurity configurations as well as a physical picture that accounts for device variability. Finally, we provide performance benchmarks for structures as large as ∼42.5 nm{sup 2} cross section and ∼81.5 nm length.« less
Evaluation/modification of IDOT foundation piling design and construction policy.
DOT National Transportation Integrated Search
2009-03-01
The Illinois Department of Transportation (IDOT) estimates pile lengths based on a static analysis method; : however, the final length of the pile is determined with a dynamic formula based on the pile driving resistance : exhibited in the field. Bec...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carletta, Nicholas D.; Mullendore, Gretchen L.; Starzec, Mariusz
Convective mass transport is the transport of mass from near the surface up to the upper troposphere and lower stratosphere (UTLS) by a deep convective updraft. This transport can alter the chemical makeup and water vapor balance of the UTLS, which affects cloud formation and the radiative properties of the atmosphere. It is therefore important to understand the exact altitudes at which mass is detrained from convection. The purpose of this study was to improve upon previously published methodologies for estimating the level of maximum detrainment (LMD) within convection using data from a single ground-based radar. Four methods were usedmore » to identify the LMD and validated against dual-Doppler derived vertical mass divergence fields for six cases with a variety of storm types. The best method for locating the LMD was determined to be the method that used a reflectivity texture technique to determine convective cores and a multi-layer echo identification to determine anvil locations. Although an improvement over previously published methods, the new methodology still produced unreliable results in certain regimes. The methodology worked best when applied to mature updrafts, as the anvil needs time to grow to a detectable size. Thus, radar reflectivity is found to be valuable in estimating the LMD, but storm maturity must also be considered for best results.« less
Lagrangian based methods for coherent structure detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allshouse, Michael R., E-mail: mallshouse@chaos.utexas.edu; Peacock, Thomas, E-mail: tomp@mit.edu
There has been a proliferation in the development of Lagrangian analytical methods for detecting coherent structures in fluid flow transport, yielding a variety of qualitatively different approaches. We present a review of four approaches and demonstrate the utility of these methods via their application to the same sample analytic model, the canonical double-gyre flow, highlighting the pros and cons of each approach. Two of the methods, the geometric and probabilistic approaches, are well established and require velocity field data over the time interval of interest to identify particularly important material lines and surfaces, and influential regions, respectively. The other twomore » approaches, implementing tools from cluster and braid theory, seek coherent structures based on limited trajectory data, attempting to partition the flow transport into distinct regions. All four of these approaches share the common trait that they are objective methods, meaning that their results do not depend on the frame of reference used. For each method, we also present a number of example applications ranging from blood flow and chemical reactions to ocean and atmospheric flows.« less
NASA Astrophysics Data System (ADS)
Doisneau, François; Arienti, Marco; Oefelein, Joseph C.
2017-01-01
For sprays, as described by a kinetic disperse phase model strongly coupled to the Navier-Stokes equations, the resolution strategy is constrained by accuracy objectives, robustness needs, and the computing architecture. In order to leverage the good properties of the Eulerian formalism, we introduce a deterministic particle-based numerical method to solve transport in physical space, which is simple to adapt to the many types of closures and moment systems. The method is inspired by the semi-Lagrangian schemes, developed for Gas Dynamics. We show how semi-Lagrangian formulations are relevant for a disperse phase far from equilibrium and where the particle-particle coupling barely influences the transport; i.e., when particle pressure is negligible. The particle behavior is indeed close to free streaming. The new method uses the assumption of parcel transport and avoids to compute fluxes and their limiters, which makes it robust. It is a deterministic resolution method so that it does not require efforts on statistical convergence, noise control, or post-processing. All couplings are done among data under the form of Eulerian fields, which allows one to use efficient algorithms and to anticipate the computational load. This makes the method both accurate and efficient in the context of parallel computing. After a complete verification of the new transport method on various academic test cases, we demonstrate the overall strategy's ability to solve a strongly-coupled liquid jet with fine spatial resolution and we apply it to the case of high-fidelity Large Eddy Simulation of a dense spray flow. A fuel spray is simulated after atomization at Diesel engine combustion chamber conditions. The large, parallel, strongly coupled computation proves the efficiency of the method for dense, polydisperse, reacting spray flows.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doisneau, François, E-mail: fdoisne@sandia.gov; Arienti, Marco, E-mail: marient@sandia.gov; Oefelein, Joseph C., E-mail: oefelei@sandia.gov
For sprays, as described by a kinetic disperse phase model strongly coupled to the Navier–Stokes equations, the resolution strategy is constrained by accuracy objectives, robustness needs, and the computing architecture. In order to leverage the good properties of the Eulerian formalism, we introduce a deterministic particle-based numerical method to solve transport in physical space, which is simple to adapt to the many types of closures and moment systems. The method is inspired by the semi-Lagrangian schemes, developed for Gas Dynamics. We show how semi-Lagrangian formulations are relevant for a disperse phase far from equilibrium and where the particle–particle coupling barelymore » influences the transport; i.e., when particle pressure is negligible. The particle behavior is indeed close to free streaming. The new method uses the assumption of parcel transport and avoids to compute fluxes and their limiters, which makes it robust. It is a deterministic resolution method so that it does not require efforts on statistical convergence, noise control, or post-processing. All couplings are done among data under the form of Eulerian fields, which allows one to use efficient algorithms and to anticipate the computational load. This makes the method both accurate and efficient in the context of parallel computing. After a complete verification of the new transport method on various academic test cases, we demonstrate the overall strategy's ability to solve a strongly-coupled liquid jet with fine spatial resolution and we apply it to the case of high-fidelity Large Eddy Simulation of a dense spray flow. A fuel spray is simulated after atomization at Diesel engine combustion chamber conditions. The large, parallel, strongly coupled computation proves the efficiency of the method for dense, polydisperse, reacting spray flows.« less
Method to manage integration error in the Green-Kubo method.
Oliveira, Laura de Sousa; Greaney, P Alex
2017-02-01
The Green-Kubo method is a commonly used approach for predicting transport properties in a system from equilibrium molecular dynamics simulations. The approach is founded on the fluctuation dissipation theorem and relates the property of interest to the lifetime of fluctuations in its thermodynamic driving potential. For heat transport, the lattice thermal conductivity is related to the integral of the autocorrelation of the instantaneous heat flux. A principal source of error in these calculations is that the autocorrelation function requires a long averaging time to reduce remnant noise. Integrating the noise in the tail of the autocorrelation function becomes conflated with physically important slow relaxation processes. In this paper we present a method to quantify the uncertainty on transport properties computed using the Green-Kubo formulation based on recognizing that the integrated noise is a random walk, with a growing envelope of uncertainty. By characterizing the noise we can choose integration conditions to best trade off systematic truncation error with unbiased integration noise, to minimize uncertainty for a given allocation of computational resources.
Method to manage integration error in the Green-Kubo method
NASA Astrophysics Data System (ADS)
Oliveira, Laura de Sousa; Greaney, P. Alex
2017-02-01
The Green-Kubo method is a commonly used approach for predicting transport properties in a system from equilibrium molecular dynamics simulations. The approach is founded on the fluctuation dissipation theorem and relates the property of interest to the lifetime of fluctuations in its thermodynamic driving potential. For heat transport, the lattice thermal conductivity is related to the integral of the autocorrelation of the instantaneous heat flux. A principal source of error in these calculations is that the autocorrelation function requires a long averaging time to reduce remnant noise. Integrating the noise in the tail of the autocorrelation function becomes conflated with physically important slow relaxation processes. In this paper we present a method to quantify the uncertainty on transport properties computed using the Green-Kubo formulation based on recognizing that the integrated noise is a random walk, with a growing envelope of uncertainty. By characterizing the noise we can choose integration conditions to best trade off systematic truncation error with unbiased integration noise, to minimize uncertainty for a given allocation of computational resources.
Vertical Photon Transport in Cloud Remote Sensing Problems
NASA Technical Reports Server (NTRS)
Platnick, S.
1999-01-01
Photon transport in plane-parallel, vertically inhomogeneous clouds is investigated and applied to cloud remote sensing techniques that use solar reflectance or transmittance measurements for retrieving droplet effective radius. Transport is couched in terms of weighting functions which approximate the relative contribution of individual layers to the overall retrieval. Two vertical weightings are investigated, including one based on the average number of scatterings encountered by reflected and transmitted photons in any given layer. A simpler vertical weighting based on the maximum penetration of reflected photons proves useful for solar reflectance measurements. These weighting functions are highly dependent on droplet absorption and solar/viewing geometry. A superposition technique, using adding/doubling radiative transfer procedures, is derived to accurately determine both weightings, avoiding time consuming Monte Carlo methods. Superposition calculations are made for a variety of geometries and cloud models, and selected results are compared with Monte Carlo calculations. Effective radius retrievals from modeled vertically inhomogeneous liquid water clouds are then made using the standard near-infrared bands, and compared with size estimates based on the proposed weighting functions. Agreement between the two methods is generally within several tenths of a micrometer, much better than expected retrieval accuracy. Though the emphasis is on photon transport in clouds, the derived weightings can be applied to any multiple scattering plane-parallel radiative transfer problem, including arbitrary combinations of cloud, aerosol, and gas layers.
NASA Astrophysics Data System (ADS)
Hu, Junbao; Meng, Xin; Wei, Qi; Kong, Yan; Jiang, Zhilong; Xue, Liang; Liu, Fei; Liu, Cheng; Wang, Shouyu
2018-03-01
Wide-field microscopy is commonly used for sample observations in biological research and medical diagnosis. However, the tilting error induced by the oblique location of the image recorder or the sample, as well as the inclination of the optical path often deteriorates the imaging quality. In order to eliminate the tilting in microscopy, a numerical tilting compensation technique based on wavefront sensing using transport of intensity equation method is proposed in this paper. Both the provided numerical simulations and practical experiments prove that the proposed technique not only accurately determines the tilting angle with simple setup and procedures, but also compensates the tilting error for imaging quality improvement even in the large tilting cases. Considering its simple systems and operations, as well as image quality improvement capability, it is believed the proposed method can be applied for tilting compensation in the optical microscopy.
Chemical fabrication of heterometallic nanogaps for molecular transport junctions.
Chen, Xiaodong; Yeganeh, Sina; Qin, Lidong; Li, Shuzhou; Xue, Can; Braunschweig, Adam B; Schatz, George C; Ratner, Mark A; Mirkin, Chad A
2009-12-01
We report a simple and reproducible method for fabricating heterometallic nanogaps, which are made of two different metal nanorods separated by a nanometer-sized gap. The method is based upon on-wire lithography, which is a chemically enabled technique used to synthesize a wide variety of nanowire-based structures (e.g., nanogaps and disk arrays). This method can be used to fabricate pairs of metallic electrodes, which exhibit distinct work functions and are separated by gaps as small as 2 nm. Furthermore, we demonstrate that a symmetric thiol-terminated molecule can be assembled into such heterometallic nanogaps to form molecular transport junctions (MTJs) that exhibit molecular diode behavior. Theoretical calculations demonstrate that the coupling strength between gold and sulfur (Au-S) is 2.5 times stronger than that of Pt-S. In addition, the structures form Raman hot spots in the gap, allowing the spectroscopic characterization of the molecules that make up the MTJs.
Opto-mechanical design of vacuum laser resonator for the OSQAR experiment
NASA Astrophysics Data System (ADS)
Hošek, Jan; Macúchová, Karolina; Nemcová, Šárka; Kunc, Štěpán.; Šulc, Miroslav
2015-01-01
This paper gives short overview of laser-based experiment OSQAR at CERN which is focused on search of axions and axion-like particles. The OSQAR experiment uses two experimental methods for axion search - measurement of the ultra-fine vacuum magnetic birefringence and a method based on the "Light shining through the wall" experiment. Because both experimental methods have reached its attainable limits of sensitivity we have focused on designing a vacuum laser resonator. The resonator will increase the number of convertible photons and their endurance time within the magnetic field. This paper presents an opto-mechanical design of a two component transportable vacuum laser resonator. Developed optical resonator mechanical design allows to be used as a 0.8 meter long prototype laser resonator for laboratory testing and after transportation and replacement of the mirrors it can be mounted on the LHC magnet in CERN to form a 20 meter long vacuum laser resonator.
Zhao, Yu-Han; Zhang, Kai-Cheng; Wang, Zhao-Wei; Huang, Peng; Zhu, Kai; Li, Zhen-Dong; Li, Da-Hua; Yuan, Li-Gang; Zhou, Yi; Song, Bo
2017-08-09
Owing to the high charge mobility and low processing temperature, ZnO is regarded as an ideal candidate for electron transport layer (ETL) material in thin-film solar cells. For the film preparation, the presently dominated sol-gel (SG) and hydrolysis-condensation (HC) methods show great potential; however, the effect of these two methods on the performance of the resulting devices has not been investigated in the same frame. In this study, the ZnO films made through SG and HC methods were applied in perovskite solar cells (Pero-SCs), and the performances of corresponding devices were compared under parallel conditions. We found that the surface morphologies and the conductivities of the films prepared by SG and HC methods showed great differences. The HC-ZnO films with higher conductivity led to relatively higher device performance, and the best power conversion efficiencie (PCE) of 12.9% was obtained; meanwhile, for Pero-SCs based on SG-ZnO, the best PCE achieved was 10.9%. The better device performance of Pero-SCs based on HC-ZnO should be attributed to the better charge extraction and transportation ability of HC-ZnO film. Moreover, to further enhance the performance of Pero-SCs, a thin layer of pristine C 60 was introduced between HC-ZnO and perovskite layers. By doing so, the quality of perovskite films was improved, and the PCE was elevated to 14.1%. The preparation of HC-ZnO film involves relatively lower-temperature (maximum 100 °C) processing; the films showed better charge extraction and transportation properties and can be a more promising ETL material in Pero-SCs.
NASA Astrophysics Data System (ADS)
Cai, X. J.; Wang, X. X.; Zou, X. B.; Lu, Z. W.
2018-01-01
An understanding of electron kinetics is of importance in various applications of low temperature plasmas. We employ a series of model and real gases to investigate electron transport and relaxation properties based on improved multi-term approximation of the Boltzmann equation. First, a comparison of different methods to calculate the interaction integrals has been carried out; the effects of free parameters, such as vmax, lmax, and the arbitrary temperature Tb, on the convergence of electron transport coefficients are analyzed. Then, the modified attachment model of Ness et al. and SF6 are considered to investigate the effect of attachment on the electron transport properties. The deficiency of the pulsed Townsend technique to measure the electron transport and reaction coefficients in electronegative gases is highlighted when the reduced electric field is small. In order to investigate the effect of external magnetic field on the electron transport properties, Ar plasmas in high power impulse sputtering devices are considered. In the end, the electron relaxation properties of the Reid model under the influence of electric and magnetic fields are demonstrated.
Oxygen transport membrane reactor based method and system for generating electric power
Kelly, Sean M.; Chakravarti, Shrikar; Li, Juan
2017-02-07
A carbon capture enabled system and method for generating electric power and/or fuel from methane containing sources using oxygen transport membranes by first converting the methane containing feed gas into a high pressure synthesis gas. Then, in one configuration the synthesis gas is combusted in oxy-combustion mode in oxygen transport membranes based boiler reactor operating at a pressure at least twice that of ambient pressure and the heat generated heats steam in thermally coupled steam generation tubes within the boiler reactor; the steam is expanded in steam turbine to generate power; and the carbon dioxide rich effluent leaving the boiler reactor is processed to isolate carbon. In another configuration the synthesis gas is further treated in a gas conditioning system configured for carbon capture in a pre-combustion mode using water gas shift reactors and acid gas removal units to produce hydrogen or hydrogen-rich fuel gas that fuels an integrated gas turbine and steam turbine system to generate power. The disclosed method and system can also be adapted to integrate with coal gasification systems to produce power from both coal and methane containing sources with greater than 90% carbon isolation.
The Role of Scale and Model Bias in ADAPT's Photospheric Eatimation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Godinez Vazquez, Humberto C.; Hickmann, Kyle Scott; Arge, Charles Nicholas
2015-05-20
The Air Force Assimilative Photospheric flux Transport model (ADAPT), is a magnetic flux propagation based on Worden-Harvey (WH) model. ADAPT would be used to provide a global photospheric map of the Earth. A data assimilation method based on the Ensemble Kalman Filter (EnKF), a method of Monte Carlo approximation tied with Kalman filtering, is used in calculating the ADAPT models.
Isentropic Transport of Ozone Across the Tropopause on 345K
NASA Astrophysics Data System (ADS)
Jing, P.; Cunnold, D.
2002-05-01
Quantifying the transport of ozone from the stratosphere to the troposphere has been a challenge for many years. There are two types of cross-tropopause transport: the vertical diabatic transport and the quasi-horizontal isentropic transport. Because isentropic transport generally occurs more frequently than diabatic transport [Chen, 1995], it is a potentially important path for ozone to exchange between the stratosphere and the troposphere and to influence the chemistry in both regions. Based on the technique of contour advection, a method is developed to quantify the isentropic transport of ozone across the tropopause on the isentropic surface of 345K for the year 1990. This study employs the GSFC Data Assimilation Office assimilated products. It is shown that isentropic transport of ozone is a two-way process, but the annually integrated isentropic mass flux of ozone across the tropopause is directed from the stratosphere into the troposphere. The seasonality of the isentropic transport of ozone is also analyzed.
Forecasting the short-term passenger flow on high-speed railway with neural networks.
Xie, Mei-Quan; Li, Xia-Miao; Zhou, Wen-Liang; Fu, Yan-Bing
2014-01-01
Short-term passenger flow forecasting is an important component of transportation systems. The forecasting result can be applied to support transportation system operation and management such as operation planning and revenue management. In this paper, a divide-and-conquer method based on neural network and origin-destination (OD) matrix estimation is developed to forecast the short-term passenger flow in high-speed railway system. There are three steps in the forecasting method. Firstly, the numbers of passengers who arrive at each station or depart from each station are obtained from historical passenger flow data, which are OD matrices in this paper. Secondly, short-term passenger flow forecasting of the numbers of passengers who arrive at each station or depart from each station based on neural network is realized. At last, the OD matrices in short-term time are obtained with an OD matrix estimation method. The experimental results indicate that the proposed divide-and-conquer method performs well in forecasting the short-term passenger flow on high-speed railway.
NASA Astrophysics Data System (ADS)
Zhang, Hongbo; Ao, Tianqi; Gusyev, Maksym; Ishidaira, Hiroshi; Magome, Jun; Takeuchi, Kuniyoshi
2018-06-01
Nitrogen and phosphorus concentrations in Chinese river catchments are contributed by agricultural non-point and industrial point sources causing deterioration of river water quality and degradation of ecosystem functioning for a long distance downstream. To evaluate these impacts, a distributed pollutant transport module was developed on the basis of BTOPMC (Block-Wise Use of TOPMODEL with Muskingum-Cunge Method), a grid-based distributed hydrological model, using the water flow routing process of BTOPMC as the carrier of pollutant transport due a direct runoff. The pollutant flux at each grid is simulated based on mass balance of pollutants within the grid and surface water transport of these pollutants occurs between grids in the direction of the water flow on daily time steps. The model was tested in the study area of the Lu county area situated in the Laixi River basin in the Sichuan province of southwest China. The simulated concentrations of nitrogen and phosphorus are compared with the available monthly data at several water quality stations. These results demonstrate a greater pollutant concentration in the beginning of high flow period indicating the main mechanism of pollution transport. From these preliminary results, we suggest that the distributed pollutant transport model can reflect the characteristics of the pollutant transport and reach the expected target.
Large-scale transportation network congestion evolution prediction using deep learning theory.
Ma, Xiaolei; Yu, Haiyang; Wang, Yunpeng; Wang, Yinhai
2015-01-01
Understanding how congestion at one location can cause ripples throughout large-scale transportation network is vital for transportation researchers and practitioners to pinpoint traffic bottlenecks for congestion mitigation. Traditional studies rely on either mathematical equations or simulation techniques to model traffic congestion dynamics. However, most of the approaches have limitations, largely due to unrealistic assumptions and cumbersome parameter calibration process. With the development of Intelligent Transportation Systems (ITS) and Internet of Things (IoT), transportation data become more and more ubiquitous. This triggers a series of data-driven research to investigate transportation phenomena. Among them, deep learning theory is considered one of the most promising techniques to tackle tremendous high-dimensional data. This study attempts to extend deep learning theory into large-scale transportation network analysis. A deep Restricted Boltzmann Machine and Recurrent Neural Network architecture is utilized to model and predict traffic congestion evolution based on Global Positioning System (GPS) data from taxi. A numerical study in Ningbo, China is conducted to validate the effectiveness and efficiency of the proposed method. Results show that the prediction accuracy can achieve as high as 88% within less than 6 minutes when the model is implemented in a Graphic Processing Unit (GPU)-based parallel computing environment. The predicted congestion evolution patterns can be visualized temporally and spatially through a map-based platform to identify the vulnerable links for proactive congestion mitigation.
Large-Scale Transportation Network Congestion Evolution Prediction Using Deep Learning Theory
Ma, Xiaolei; Yu, Haiyang; Wang, Yunpeng; Wang, Yinhai
2015-01-01
Understanding how congestion at one location can cause ripples throughout large-scale transportation network is vital for transportation researchers and practitioners to pinpoint traffic bottlenecks for congestion mitigation. Traditional studies rely on either mathematical equations or simulation techniques to model traffic congestion dynamics. However, most of the approaches have limitations, largely due to unrealistic assumptions and cumbersome parameter calibration process. With the development of Intelligent Transportation Systems (ITS) and Internet of Things (IoT), transportation data become more and more ubiquitous. This triggers a series of data-driven research to investigate transportation phenomena. Among them, deep learning theory is considered one of the most promising techniques to tackle tremendous high-dimensional data. This study attempts to extend deep learning theory into large-scale transportation network analysis. A deep Restricted Boltzmann Machine and Recurrent Neural Network architecture is utilized to model and predict traffic congestion evolution based on Global Positioning System (GPS) data from taxi. A numerical study in Ningbo, China is conducted to validate the effectiveness and efficiency of the proposed method. Results show that the prediction accuracy can achieve as high as 88% within less than 6 minutes when the model is implemented in a Graphic Processing Unit (GPU)-based parallel computing environment. The predicted congestion evolution patterns can be visualized temporally and spatially through a map-based platform to identify the vulnerable links for proactive congestion mitigation. PMID:25780910
Intercomparison of Multiscale Modeling Approaches in Simulating Subsurface Flow and Transport
NASA Astrophysics Data System (ADS)
Yang, X.; Mehmani, Y.; Barajas-Solano, D. A.; Song, H. S.; Balhoff, M.; Tartakovsky, A. M.; Scheibe, T. D.
2016-12-01
Hybrid multiscale simulations that couple models across scales are critical to advance predictions of the larger system behavior using understanding of fundamental processes. In the current study, three hybrid multiscale methods are intercompared: multiscale loose-coupling method, multiscale finite volume (MsFV) method and multiscale mortar method. The loose-coupling method enables a parallel workflow structure based on the Swift scripting environment that manages the complex process of executing coupled micro- and macro-scale models without being intrusive to the at-scale simulators. The MsFV method applies microscale and macroscale models over overlapping subdomains of the modeling domain and enforces continuity of concentration and transport fluxes between models via restriction and prolongation operators. The mortar method is a non-overlapping domain decomposition approach capable of coupling all permutations of pore- and continuum-scale models with each other. In doing so, Lagrange multipliers are used at interfaces shared between the subdomains so as to establish continuity of species/fluid mass flux. Subdomain computations can be performed either concurrently or non-concurrently depending on the algorithm used. All the above methods have been proven to be accurate and efficient in studying flow and transport in porous media. However, there has not been any field-scale applications and benchmarking among various hybrid multiscale approaches. To address this challenge, we apply all three hybrid multiscale methods to simulate water flow and transport in a conceptualized 2D modeling domain of the hyporheic zone, where strong interactions between groundwater and surface water exist across multiple scales. In all three multiscale methods, fine-scale simulations are applied to a thin layer of riverbed alluvial sediments while the macroscopic simulations are used for the larger subsurface aquifer domain. Different numerical coupling methods are then applied between scales and inter-compared. Comparisons are drawn in terms of velocity distributions, solute transport behavior, algorithm-induced numerical error and computing cost. The intercomparison work provides support for confidence in a variety of hybrid multiscale methods and motivates further development and applications.
Microtubule defects influence kinesin-based transport in vitro.
NASA Astrophysics Data System (ADS)
Xu, Jing
Microtubules are protein polymers that form ``molecular highways'' for long-range transport within living cells. Molecular motors actively step along microtubules to shuttle cellular materials between the nucleus and the cell periphery; this transport is critical for the survival and health of all eukaryotic cells. Structural defects in microtubules exist, but whether these defects impact molecular motor-based transport remains unknown. Here, we report a new, to our knowledge, approach that allowed us to directly investigate the impact of such defects. Using a modified optical-trapping method, we examined the group function of a major molecular motor, conventional kinesin, when transporting cargos along individual microtubules. We found that microtubule defects influence kinesin-based transport in vitro. The effects depend on motor number: cargos driven by a few motors tended to unbind prematurely from the microtubule, whereas cargos driven by more motors tended to pause. To our knowledge, our study provides the first direct link between microtubule defects and kinesin function. The effects uncovered in our study may have physiological relevance in vivo. Supported by the UC Merced (to J.X.), NIH (NS048501 to S.J.K.), NSF (EF-1038697 to A.G.), and the James S. McDonnell Foundation (to A.G.). Work carried out at the Aspen Center for Physics was supported by NSF Grant PHY-1066293.
Nouri, Mohammad-Zaman; Komatsu, Setsuko
2010-05-01
To study the soybean plasma membrane proteome under osmotic stress, two methods were used: a gel-based and a LC MS/MS-based proteomics method. Two-day-old seedlings were subjected to 10% PEG for 2 days. Plasma membranes were purified from seedlings using a two-phase partitioning method and their purity was verified by measuring ATPase activity. Using the gel-based proteomics, four and eight protein spots were identified as up- and downregulated, respectively, whereas in the nanoLC MS/MS approach, 11 and 75 proteins were identified as up- and downregulated, respectively, under PEG treatment. Out of osmotic stress responsive proteins, most of the transporter proteins and all proteins with high number of transmembrane helices as well as low-abundance proteins could be identified by the LC MS/MS-based method. Three homologues of plasma membrane H(+)-ATPase, which are transporter proteins involved in ion efflux, were upregulated under osmotic stress. Gene expression of this protein was increased after 12 h of stress exposure. Among the identified proteins, seven proteins were mutual in two proteomics techniques, in which calnexin was the highly upregulated protein. Accumulation of calnexin in plasma membrane was confirmed by immunoblot analysis. These results suggest that under hyperosmotic conditions, calnexin accumulates in the plasma membrane and ion efflux accelerates by upregulation of plasma membrane H(+)-ATPase protein.
Modeling of soil erosion and sediment transport in the East River Basin in southern China
Wu, Yping; Chen, Ji
2012-01-01
Soil erosion is a major global environmental problem that has caused many issues involving land degradation, sedimentation of waterways, ecological degradation, and nonpoint source pollution. Therefore, it is significant to understand the processes of soil erosion and sediment transport along rivers, and this can help identify the erosion prone areas and find potential measures to alleviate the environmental effects. In this study, we investigated soil erosion and identified the most seriously eroded areas in the East River Basin in southern China using a physically-based model, Soil and Water Assessment Tool (SWAT). We also introduced a classical sediment transport method (Zhang) into SWAT and compared it with the built-in Bagnold method in simulating sediment transport process along the river. The derived spatial soil erosion map and land use based erosion levels can explicitly illustrate the identification and prioritization of the critical soil erosion areas in this basin. Our results also indicate that erosion is quite sensitive to soil properties and slope. Comparison of Bagnold and Zhang methods shows that the latter can give an overall better performance especially in tracking the peak and low sediment concentrations along the river. We also found that the East River is mainly characterized by sediment deposition in most of the segments and at most times of a year. Overall, the results presented in this paper can provide decision support for watershed managers about where the best management practices (conservation measures) can be implemented effectively and at low cost. The methods we used in this study can also be of interest in sediment modeling for other basins worldwide.
Computing eddy-driven effective diffusivity using Lagrangian particles
Wolfram, Phillip J.; Ringler, Todd D.
2017-08-14
A novel method to derive effective diffusivity from Lagrangian particle trajectory data sets is developed and then analyzed relative to particle-derived meridional diffusivity for eddy-driven mixing in an idealized circumpolar current. Quantitative standard dispersion- and transport-based mixing diagnostics are defined, compared and contrasted to motivate the computation and use of effective diffusivity derived from Lagrangian particles. We compute the effective diffusivity by first performing scalar transport on Lagrangian control areas using stored trajectories computed from online Lagrangian In-situ Global High-performance particle Tracking (LIGHT) using the Model for Prediction Across Scales Ocean (MPAS-O). Furthermore, the Lagrangian scalar transport scheme is comparedmore » against an Eulerian scalar transport scheme. Spatially-variable effective diffusivities are computed from resulting time-varying cumulative concentrations that vary as a function of cumulative area. The transport-based Eulerian and Lagrangian effective diffusivity diagnostics are found to be qualitatively consistent with the dispersion-based diffusivity. All diffusivity estimates show a region of increased subsurface diffusivity within the core of an idealized circumpolar current and results are within a factor of two of each other. The Eulerian and Lagrangian effective diffusivities are most similar; smaller and more spatially diffused values are obtained with the dispersion-based diffusivity computed with particle clusters.« less
Computing eddy-driven effective diffusivity using Lagrangian particles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wolfram, Phillip J.; Ringler, Todd D.
A novel method to derive effective diffusivity from Lagrangian particle trajectory data sets is developed and then analyzed relative to particle-derived meridional diffusivity for eddy-driven mixing in an idealized circumpolar current. Quantitative standard dispersion- and transport-based mixing diagnostics are defined, compared and contrasted to motivate the computation and use of effective diffusivity derived from Lagrangian particles. We compute the effective diffusivity by first performing scalar transport on Lagrangian control areas using stored trajectories computed from online Lagrangian In-situ Global High-performance particle Tracking (LIGHT) using the Model for Prediction Across Scales Ocean (MPAS-O). Furthermore, the Lagrangian scalar transport scheme is comparedmore » against an Eulerian scalar transport scheme. Spatially-variable effective diffusivities are computed from resulting time-varying cumulative concentrations that vary as a function of cumulative area. The transport-based Eulerian and Lagrangian effective diffusivity diagnostics are found to be qualitatively consistent with the dispersion-based diffusivity. All diffusivity estimates show a region of increased subsurface diffusivity within the core of an idealized circumpolar current and results are within a factor of two of each other. The Eulerian and Lagrangian effective diffusivities are most similar; smaller and more spatially diffused values are obtained with the dispersion-based diffusivity computed with particle clusters.« less
NASA Astrophysics Data System (ADS)
Subanti, S.; Hartatik; Hakim, A. R.; Daerobi, A.; Setiawan, R. R.
2018-03-01
The quality of life become a concern for individuals and communities seeking to find their sustainable life. Some people in industry, consumer groups, academics, and policy makers have sought to better understand how communication and transportation contributes on quality of life. Thus, this paper aimed to calculate quality of life based on transportation and communication. Indicator of transportation such as road surface condition and the availability of public of transportation; while indicator of communication such as the availability of television signal, post services, cable phone, and internet cafes. Cities involved in this study were Magelang, Surakarta, Salatiga, Semarang, Pekalongan, Tegal,and Yogyakarta. This paper used national socio-economic survey data and the potential of village data. Estimation techniques using multiple regression method. The findings of this paper, (1) transportation and communication were linked to Quality of Life; (2) the highest quality of life obtained by the city of Magelang, while the lowest was occupied by the City of Pekalongan. Suggestion from this paper, local government should have to prioritize infrastructure development such as transportation and communication because it can improve the quality of life whose lived in the city.
Optimisation of logistics processes of energy grass collection
NASA Astrophysics Data System (ADS)
Bányai, Tamás.
2010-05-01
The collection of energy grass is a logistics-intensive process [1]. The optimal design and control of transportation and collection subprocesses is a critical point of the supply chain. To avoid irresponsible decisions by right of experience and intuition, the optimisation and analysis of collection processes based on mathematical models and methods is the scientific suggestible way. Within the frame of this work, the author focuses on the optimisation possibilities of the collection processes, especially from the point of view transportation and related warehousing operations. However the developed optimisation methods in the literature [2] take into account the harvesting processes, county-specific yields, transportation distances, erosion constraints, machinery specifications, and other key variables, but the possibility of more collection points and the multi-level collection were not taken into consideration. The possible areas of using energy grass is very wide (energetically use, biogas and bio alcohol production, paper and textile industry, industrial fibre material, foddering purposes, biological soil protection [3], etc.), so not only a single level but also a multi-level collection system with more collection and production facilities has to be taken into consideration. The input parameters of the optimisation problem are the followings: total amount of energy grass to be harvested in each region; specific facility costs of collection, warehousing and production units; specific costs of transportation resources; pre-scheduling of harvesting process; specific transportation and warehousing costs; pre-scheduling of processing of energy grass at each facility (exclusive warehousing). The model take into consideration the following assumptions: (1) cooperative relation among processing and production facilties, (2) capacity constraints are not ignored, (3) the cost function of transportation is non-linear, (4) the drivers conditions are ignored. The objective function of the optimisation is the maximisation of the profit which means the maximization of the difference between revenue and cost. The objective function trades off the income of the assigned transportation demands against the logistic costs. The constraints are the followings: (1) the free capacity of the assigned transportation resource is more than the re-quested capacity of the transportation demand; the calculated arrival time of the transportation resource to the harvesting place is not later than the requested arrival time of them; (3) the calculated arrival time of the transportation demand to the processing and production facility is not later than the requested arrival time; (4) one transportation demand is assigned to one transportation resource and one resource is assigned to one transportation resource. The decision variable of the optimisation problem is the set of scheduling variables and the assignment of resources to transportation demands. The evaluation parameters of the optimised system are the followings: total costs of the collection process; utilisation of transportation resources and warehouses; efficiency of production and/or processing facilities. However the multidimensional heuristic optimisation method is based on genetic algorithm, but the routing sequence of the optimisation works on the base of an ant colony algorithm. The optimal routes are calculated by the aid of the ant colony algorithm as a subroutine of the global optimisation method and the optimal assignment is given by the genetic algorithm. One important part of the mathematical method is the sensibility analysis of the objective function, which shows the influence rate of the different input parameters. Acknowledgements This research was implemented within the frame of the project entitled "Development and operation of the Technology and Knowledge Transfer Centre of the University of Miskolc". with support by the European Union and co-funding of the European Social Fund. References [1] P. R. Daniel: The Economics of Harvesting and Transporting Corn Stover for Conversion to Fuel Ethanol: A Case Study for Minnesota. University of Minnesota, Department of Applied Economics. 2006. http://ideas.repec.org/p/ags/umaesp/14213.html [2] T. G. Douglas, J. Brendan, D. Erin & V.-D. Becca: Energy and Chemicals from Native Grasses: Production, Transportation and Processing Technologies Considered in the Northern Great Plains. University of Minnesota, Department of Applied Economics. 2006. http://ideas.repec.org/p/ags/umaesp/13838.html [3] Homepage of energygrass. www.energiafu.hu
Multi-species ion transport in ICF relevant conditions
NASA Astrophysics Data System (ADS)
Vold, Erik; Kagan, Grigory; Simakov, Andrei; Molvig, Kim; Yin, Lin; Albright, Brian
2017-10-01
Classical transport theory based on Chapman-Enskog methods provides self consistent approximations for kinetic fluxes of mass, heat and momentum for each ion species in a multi-ion plasma characterized with a small Knudsen number. A numerical method for solving the classic forms of multi-ion transport, self-consistently including heat and species mass fluxes relative to the center of mass, is given in [Kagan-Baalrud, arXiv '16] and similar transport coefficients result from recent derivations [Simakov-Molvig, PoP, '16]. We have implemented a combination of these methods in a standalone test code and in xRage, an adaptive-mesh radiation hydrodynamics code, at LANL. Transport mixing is examined between a DT fuel and a CH capsule shell in ICF conditions. The four ion species develop individual self-similar density profiles under the assumption of P-T equilibrium in 1D and show interesting early time transient pressure and center of mass velocity behavior when P-T equilibrium is not enforced. Some 2D results are explored to better understand the transport mix in combination with convective flow driven by macroscopic fluid instabilities at the fuel-capsule interface. Early transient and some 2D behaviors from the fluid transport are compared to kinetic code results. Work performed under the auspices of the U.S. DOE by the LANS, LLC, Los Alamos National Laboratory under Contract No. DE-AC52-06NA25396. Funding provided by the Advanced Simulation and Computing (ASC) Program.
Use of emergency transport by patients with cardiopathies: a focus group study.
Bolívar-Muñoz, Julia; Daponte-Codina, Antonio; Pascual-Martínez, Nuria; Barranco-Ruiz, Fernando; Sánchez-Cruz, José; Martín-Castro, Carmen; Gil-Piñero, Eladio
2007-12-01
The importance of emergency systems accessible by telephone for the early attention of patients with ischemic cardiopathy is well known. In Andalusia, this service is provided by calling 061. However, studies show an insufficient use of the existing emergency system in this type of patient. To identify explanations related to the decision regarding the method of transport to health-care systems, by private means of transport or 061 services, for people with ischemic cardiopathy from the onset of symptoms until their arrival at the Emergency Department. Eleven focal groups were held with subjects diagnosed with ischemic cardiopathy. The discussions were related to the method of transport (using 061 or their own means of transport to a major hospital or to a nearby health facility for onward transfer), depending on the existence of previous experience and distance to the hospital. The method of transport is related to the degree of ignorance about what is happening, perceptions regarding the fastest way to reach the hospital, people available around the patient when the event takes place, vehicle availability and possible stressful situations. This study provides information about the reasons for using or not using the emergency transport systems for these patients and understanding how decisions were made. The study's importance lies in the possibility of improving individuals' access to health care systems through education-based actions and a strategic information and training plan that targets patients, families and health professionals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilmore, Mark Allen
Turbulence, and turbulence-driven transport are ubiquitous in magnetically confined plasmas, where there is an intimate relationship between turbulence, transport, instability driving mechanisms (such as gradients), plasma flows, and flow shear. Though many of the detailed physics of the interrelationship between turbulence, transport, drive mechanisms, and flow remain unclear, there have been many demonstrations that transport and/or turbulence can be suppressed or reduced via manipulations of plasma flow profiles. This is well known in magnetic fusion plasmas [e.g., high confinement mode (H-mode) and internal transport barriers (ITB’s)], and has also been demonstrated in laboratory plasmas. However, it may be that themore » levels of particle transport obtained in such cases [e.g. H-mode, ITB’s] are actually lower than is desirable for a practical fusion device. Ideally, one would be able to actively feedback control the turbulent transport, via manipulation of the flow profiles. The purpose of this research was to investigate the feasibility of using both advanced model-based control algorithms, as well as non-model-based algorithms, to control cross-field turbulence-driven particle transport through appropriate manipulation of radial plasma flow profiles. The University of New Mexico was responsible for the experimental portion of the project, while our collaborators at the University of Montana provided plasma transport modeling, and collaborators at Lehigh University developed and explored control methods.« less
Altitude Effects on Thermal Ice Protection System Performance; a Study of an Alternative Approach
NASA Technical Reports Server (NTRS)
Addy, Harold E., Jr.; Orchard, David; Wright, William B.; Oleskiw, Myron
2016-01-01
Research has been conducted to better understand the phenomena involved during operation of an aircraft's thermal ice protection system under running wet icing conditions. In such situations, supercooled water striking a thermally ice-protected surface does not fully evaporate but runs aft to a location where it freezes. The effects of altitude, in terms of air pressure and density, on the processes involved were of particular interest. Initial study results showed that the altitude effects on heat energy transfer were accurately modeled using existing methods, but water mass transport was not. Based upon those results, a new method to account for altitude effects on thermal ice protection system operation was proposed. The method employs a two-step process where heat energy and mass transport are sequentially matched, linked by matched surface temperatures. While not providing exact matching of heat and mass transport to reference conditions, the method produces a better simulation than other methods. Moreover, it does not rely on the application of empirical correction factors, but instead relies on the straightforward application of the primary physics involved. This report describes the method, shows results of testing the method, and discusses its limitations.
NASA Astrophysics Data System (ADS)
Belyantseva, Oksana; Panenkov, Andrey; Safonova, Nataliya
2017-10-01
Current conditions of the cognitive economy formation demand to take into account the leading role of information, knowledge and human capital in the development of the transport industry management system. The article substantiates the conceptual approach to the self-organization of a management system on the basis of innovative changes. Human capital is the key aspect of self-organization, so the directions of improving the workforce quality are justified. Basing on the information-innovative genesis of the process of self-organization, the authors justified the necessity of preventing asymmetric information. For this pupose the actions against the resistance to innovations were proposed. The implementation of certain measures contributes to the effective development of the transport management system.
Rupp, K; Jungemann, C; Hong, S-M; Bina, M; Grasser, T; Jüngel, A
The Boltzmann transport equation is commonly considered to be the best semi-classical description of carrier transport in semiconductors, providing precise information about the distribution of carriers with respect to time (one dimension), location (three dimensions), and momentum (three dimensions). However, numerical solutions for the seven-dimensional carrier distribution functions are very demanding. The most common solution approach is the stochastic Monte Carlo method, because the gigabytes of memory requirements of deterministic direct solution approaches has not been available until recently. As a remedy, the higher accuracy provided by solutions of the Boltzmann transport equation is often exchanged for lower computational expense by using simpler models based on macroscopic quantities such as carrier density and mean carrier velocity. Recent developments for the deterministic spherical harmonics expansion method have reduced the computational cost for solving the Boltzmann transport equation, enabling the computation of carrier distribution functions even for spatially three-dimensional device simulations within minutes to hours. We summarize recent progress for the spherical harmonics expansion method and show that small currents, reasonable execution times, and rare events such as low-frequency noise, which are all hard or even impossible to simulate with the established Monte Carlo method, can be handled in a straight-forward manner. The applicability of the method for important practical applications is demonstrated for noise simulation, small-signal analysis, hot-carrier degradation, and avalanche breakdown.
NASA Astrophysics Data System (ADS)
Pei, C.; Bieber, J. W.; Burger, R. A.; Clem, J.
2010-12-01
We present a detailed description of our newly developed stochastic approach for solving Parker's transport equation, which we believe is the first attempt to solve it with time dependence in 3-D, evolving from our 3-D steady state stochastic approach. Our formulation of this method is general and is valid for any type of heliospheric magnetic field, although we choose the standard Parker field as an example to illustrate the steps to calculate the transport of galactic cosmic rays. Our 3-D stochastic method is different from other stochastic approaches in the literature in several ways. For example, we employ spherical coordinates to integrate directly, which makes the code much more efficient by reducing coordinate transformations. What is more, the equivalence between our stochastic differential equations and Parker's transport equation is guaranteed by Ito's theorem in contrast to some other approaches. We generalize the technique for calculating particle flux based on the pseudoparticle trajectories for steady state solutions and for time-dependent solutions in 3-D. To validate our code, first we show that good agreement exists between solutions obtained by our steady state stochastic method and a traditional finite difference method. Then we show that good agreement also exists for our time-dependent method for an idealized and simplified heliosphere which has a Parker magnetic field and a simple initial condition for two different inner boundary conditions.
Spatiotemporal Recurrent Convolutional Networks for Traffic Prediction in Transportation Networks
Yu, Haiyang; Wu, Zhihai; Wang, Shuqin; Wang, Yunpeng; Ma, Xiaolei
2017-01-01
Predicting large-scale transportation network traffic has become an important and challenging topic in recent decades. Inspired by the domain knowledge of motion prediction, in which the future motion of an object can be predicted based on previous scenes, we propose a network grid representation method that can retain the fine-scale structure of a transportation network. Network-wide traffic speeds are converted into a series of static images and input into a novel deep architecture, namely, spatiotemporal recurrent convolutional networks (SRCNs), for traffic forecasting. The proposed SRCNs inherit the advantages of deep convolutional neural networks (DCNNs) and long short-term memory (LSTM) neural networks. The spatial dependencies of network-wide traffic can be captured by DCNNs, and the temporal dynamics can be learned by LSTMs. An experiment on a Beijing transportation network with 278 links demonstrates that SRCNs outperform other deep learning-based algorithms in both short-term and long-term traffic prediction. PMID:28672867
Spatiotemporal Recurrent Convolutional Networks for Traffic Prediction in Transportation Networks.
Yu, Haiyang; Wu, Zhihai; Wang, Shuqin; Wang, Yunpeng; Ma, Xiaolei
2017-06-26
Predicting large-scale transportation network traffic has become an important and challenging topic in recent decades. Inspired by the domain knowledge of motion prediction, in which the future motion of an object can be predicted based on previous scenes, we propose a network grid representation method that can retain the fine-scale structure of a transportation network. Network-wide traffic speeds are converted into a series of static images and input into a novel deep architecture, namely, spatiotemporal recurrent convolutional networks (SRCNs), for traffic forecasting. The proposed SRCNs inherit the advantages of deep convolutional neural networks (DCNNs) and long short-term memory (LSTM) neural networks. The spatial dependencies of network-wide traffic can be captured by DCNNs, and the temporal dynamics can be learned by LSTMs. An experiment on a Beijing transportation network with 278 links demonstrates that SRCNs outperform other deep learning-based algorithms in both short-term and long-term traffic prediction.
Heat and Moisture transport of socks
NASA Astrophysics Data System (ADS)
Komárková, P.; Glombíková, V.; Havelka, A.
2017-10-01
Investigating the liquid moisture transport and thermal properties is essential for understanding physiological comfort of clothes. This study reports on an experimental investigation of moisture management transport and thermal transport on the physiological comfort of commercially available socks. There are subjective evaluation and objective measurements. Subjective evaluation of the physiological comfort of socks is based on individual sensory perception of probands during and after physical exertion. Objective measurements were performed according to standardized methods using Moisture Management tester for measuring the humidity parameters and C-term TCi analyzer for thermal conductivity and thermal effusivity. The obtained values of liquid moisture transport and thermal properties were related to the material composition and structure of the tested socks. In summary, these results show that objective measurement corresponds with probands feelings.
Space proton transport in one dimension
NASA Technical Reports Server (NTRS)
Lamkin, S. L.; Khandelwal, G. S.; Shinn, J. L.; Wilson, J. W.
1994-01-01
An approximate evaluation procedure is derived for a second-order theory of coupled nucleon transport in one dimension. An analytical solution with a simplified interaction model is used to determine quadrature parameters to minimize truncation error. Effects of the improved method on transport solutions with the BRYNTRN data base are evaluated. Comparisons with Monte Carlo benchmarks are given. Using different shield materials, the computational procedure is used to study the physics of space protons. A transition effect occurs in tissue near the shield interface and is most important in shields of high atomic number.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chapman, Bryan Scott; MacQuigg, Michael Robert; Wysong, Andrew Russell
In this document, the code MCNP is validated with ENDF/B-VII.1 cross section data under the purview of ANSI/ANS-8.24-2007, for use with uranium systems. MCNP is a computer code based on Monte Carlo transport methods. While MCNP has wide reading capability in nuclear transport simulation, this validation is limited to the functionality related to neutron transport and calculation of criticality parameters such as k eff.
NASA Astrophysics Data System (ADS)
Kong, Xiangzhen; He, Wei; Qin, Ning; He, Qishuang; Yang, Bin; Ouyang, Huiling; Wang, Qingmei; Xu, Fuliu
2013-03-01
Trajectory cluster analysis, including the two-stage cluster method based on Euclidean metrics and the one-stage clustering method based on Mahalanobis metrics and self-organizing maps (SOM), was applied and compared to identify the transport pathways of PM10 for the cities of Chaohu and Hefei, both located near Lake Chaohu in China. The two-stage cluster method was modified to further investigate the long trajectories in the second stage in order to eliminate the observed disaggregation among them. Twelve trajectory clusters were identified for both cities. The one-stage clustering method based on Mahalanobis metrics gives the best performance regarding the variances within clusters. The results showed that local PM10 emission was one of the most important sources in both cities and that the local emission in Hefei was higher than in Chaohu. In addition, Chaohu suffered greater effects from the eastern region (Yangtze River Delta, YRD) than Hefei. On the other hand, the long-range transportation from the northwestern pathway had a higher influence on the PM10 level in Hefei. Receptor models, including potential source contribution function (PSCF) and residence time weighted concentrations (RTWC), were utilized to identify the potential source locations of PM10 for both cities. However, the combined PSCF and RTWC results for the two cities provided PM10 source locations that were more consistent with the results of transport pathways and the total anthropogenic PM10 emission inventory. This indicates that the combined method's ability to identify the source regions is superior to that of the individual PSCF or RTWC methods. Henan and Shanxi Provinces and the YRD were important PM10 source regions for the two cities, but the Henan and Shanxi area was more important for Hefei than for Chaohu, while the YRD region was less important. In addition, the PSCF, RTWC and the combined results all had higher correlation coefficients with PM10 emission from traffic than from industry, electricity generation or residential sources, suggesting the relatively higher contribution of traffic emissions to the PM10 pollution in Lake Chaohu.
ERIC Educational Resources Information Center
Williams, Jessica H.; Green, Melanie C.; Kohler, Connie; Allison, Jeroan J.; Houston, Thomas K.
2011-01-01
Objective: To evaluate the construct and criterion validity of the Video Transportation Scale (VTS). Setting: Inpatient service of a safety net hospital in Birmingham, Alabama, USA. Method: We administered the VTS in the context of a randomized controlled trial of a DVD-delivered narrative-based intervention (stories) designed to encourage smoking…
Computational method for multi-modal microscopy based on transport of intensity equation
NASA Astrophysics Data System (ADS)
Li, Jiaji; Chen, Qian; Sun, Jiasong; Zhang, Jialin; Zuo, Chao
2017-02-01
In this paper, we develop the requisite theory to describe a hybrid virtual-physical multi-modal imaging system which yields quantitative phase, Zernike phase contrast, differential interference contrast (DIC), and light field moment imaging simultaneously based on transport of intensity equation(TIE). We then give the experimental demonstration of these ideas by time-lapse imaging of live HeLa cell mitosis. Experimental results verify that a tunable lens based TIE system, combined with the appropriate post-processing algorithm, can achieve a variety of promising imaging modalities in parallel with the quantitative phase images for the dynamic study of cellular processes.
Electronic properties of a molecular system with Platinum
NASA Astrophysics Data System (ADS)
Ojeda, J. H.; Medina, F. G.; Becerra-Alonso, David
2017-10-01
The electronic properties are studied using a finite homogeneous molecule called Trans-platinum-linked oligo(tetraethenylethenes). This system is composed of individual molecules such as benzene rings, platinum, Phosphore and Sulfur. The mechanism for the study of the electron transport through this system is based on placing the molecule between metal contacts to control the current through the molecular system. We study this molecule based on the tight-binding approach for the calculation of the transport properties using the Landauer-Büttiker formalism and the Fischer-Lee relationship, based on a semi-analytic Green's function method within a real-space renormalization approach. Our results show a significant agreement with experimental measurements.
Joh, Hyungmok; Lee, Seung-Wook; Seong, Mingi; Lee, Woo Seok; Oh, Soong Ju
2017-06-01
All-nanocrystal (NC)-based and all-solution-processed wearable resistance temperature detectors (RTDs) are introduced. The charge transport mechanisms of Ag NC thin films are engineered through various ligand treatments to design high performance RTDs. Highly conductive Ag NC thin films exhibiting metallic transport behavior with high positive temperature coefficients of resistance (TCRs) are achieved through tetrabutylammonium bromide treatment. Ag NC thin films showing hopping transport with high negative TCRs are created through organic ligand treatment. All-solution-based, one-step photolithography techniques that integrate two distinct opposite-sign TCR Ag NC thin films into an ultrathin single device are developed to decouple the mechanical effects such as human motion. The unconventional materials design and strategy enables highly accurate, sensitive, wearable and motion-free RTDs, demonstrated by experiments on moving or curved objects such as human skin, and simulation results based on charge transport analysis. This strategy provides a low cost and simple method to design wearable multifunctional sensors with high sensitivity which could be utilized in various fields such as biointegrated sensors or electronic skin. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schunert, Sebastian; Wang, Yaqi; Gleicher, Frederick
This paper presents a flexible nonlinear diffusion acceleration (NDA) method that discretizes both the S N transport equation and the diffusion equation using the discontinuous finite element method (DFEM). The method is flexible in that the diffusion equation can be discretized on a coarser mesh with the only restriction that it is nested within the transport mesh and the FEM shape function orders of the two equations can be different. The consistency of the transport and diffusion solutions at convergence is defined by using a projection operator mapping the transport into the diffusion FEM space. The diffusion weak form ismore » based on the modified incomplete interior penalty (MIP) diffusion DFEM discretization that is extended by volumetric drift, interior face, and boundary closure terms. In contrast to commonly used coarse mesh finite difference (CMFD) methods, the presented NDA method uses a full FEM discretized diffusion equation for acceleration. Suitable projection and prolongation operators arise naturally from the FEM framework. Via Fourier analysis and numerical experiments for a one-group, fixed source problem the following properties of the NDA method are established for structured quadrilateral meshes: (1) the presented method is unconditionally stable and effective in the presence of mild material heterogeneities if the same mesh and identical shape functions either of the bilinear or biquadratic type are used, (2) the NDA method remains unconditionally stable in the presence of strong heterogeneities, (3) the NDA method with bilinear elements extends the range of effectiveness and stability by a factor of two when compared to CMFD if a coarser diffusion mesh is selected. In addition, the method is tested for solving the C5G7 multigroup, eigenvalue problem using coarse and fine mesh acceleration. Finally, while NDA does not offer an advantage over CMFD for fine mesh acceleration, it reduces the iteration count required for convergence by almost a factor of two in the case of coarse mesh acceleration.« less
Schunert, Sebastian; Wang, Yaqi; Gleicher, Frederick; ...
2017-02-21
This paper presents a flexible nonlinear diffusion acceleration (NDA) method that discretizes both the S N transport equation and the diffusion equation using the discontinuous finite element method (DFEM). The method is flexible in that the diffusion equation can be discretized on a coarser mesh with the only restriction that it is nested within the transport mesh and the FEM shape function orders of the two equations can be different. The consistency of the transport and diffusion solutions at convergence is defined by using a projection operator mapping the transport into the diffusion FEM space. The diffusion weak form ismore » based on the modified incomplete interior penalty (MIP) diffusion DFEM discretization that is extended by volumetric drift, interior face, and boundary closure terms. In contrast to commonly used coarse mesh finite difference (CMFD) methods, the presented NDA method uses a full FEM discretized diffusion equation for acceleration. Suitable projection and prolongation operators arise naturally from the FEM framework. Via Fourier analysis and numerical experiments for a one-group, fixed source problem the following properties of the NDA method are established for structured quadrilateral meshes: (1) the presented method is unconditionally stable and effective in the presence of mild material heterogeneities if the same mesh and identical shape functions either of the bilinear or biquadratic type are used, (2) the NDA method remains unconditionally stable in the presence of strong heterogeneities, (3) the NDA method with bilinear elements extends the range of effectiveness and stability by a factor of two when compared to CMFD if a coarser diffusion mesh is selected. In addition, the method is tested for solving the C5G7 multigroup, eigenvalue problem using coarse and fine mesh acceleration. Finally, while NDA does not offer an advantage over CMFD for fine mesh acceleration, it reduces the iteration count required for convergence by almost a factor of two in the case of coarse mesh acceleration.« less
The Methodology of Selecting the Transport Mode for Companies on the Slovak Transport Market
NASA Astrophysics Data System (ADS)
Černá, Lenka; Zitrický, Vladislav; Daniš, Jozef
2017-03-01
Transport volume in the Slovak Republic is growing continuously every year. This rising trend is influenced by the development of car industry and its suppliers. Slovak republic has also a geographic strategy position in middle Europe from the side of transport corridors (east-west and north-south). The development of transport volume in freight transport depends on the transport and business processes between the European Union and China and it is an opportunity for Slovak republic to obtain transit transport flows. In the Slovak Republic, road transport has a dominant position in the transport market. The volume of road transport has gradually increased over the past years. The increase of road transport is reflected on the highways and speed roads in regions which have higher economic potential. The increase of rail transport as seen on the main rail corridors is not as significant as in road transport. Trade globalization also has an influence on the increase of transport volume in intermodal transport. Predicted increase in transport volume for this transport mode is from 2,3 mil ton per year at present to 8 mil ton in the year 2020. Selection of transport mode and carrier is an important aspect for logistic management, because companies (customers) want to reduce the number of carriers which they trade and they create the system of several key carriers. Bigger transport volume and more qualitative transport service give a possibility to reduce transport costs. This trend is positive for carriers too, because the carriers can focus only on the selected customers and provide more qualitative services. The paper is focused on the selection of transport mode based on the proposed methodology. The aims of the paper are, definition of criteria which directly influence the selection of transport modes, determination of criteria based on the subjectively methods, creation of process for the selection of transport modes and practical application of proposed methodology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Rabani, Eran; Reichman, David R.; Krilov, Goran; Berne, Bruce J.
2002-01-01
We present a method based on augmenting an exact relation between a frequency-dependent diffusion constant and the imaginary time velocity autocorrelation function, combined with the maximum entropy numerical analytic continuation approach to study transport properties in quantum liquids. The method is applied to the case of liquid para-hydrogen at two thermodynamic state points: a liquid near the triple point and a high-temperature liquid. Good agreement for the self-diffusion constant and for the real-time velocity autocorrelation function is obtained in comparison to experimental measurements and other theoretical predictions. Improvement of the methodology and future applications are discussed. PMID:11830656
Tamura, Shinichi; Okada, Yasunori; Morimoto, Shigeru; Ohta, Mitsuaki; Uchida, Naoyuki
2010-01-01
In order to obtain information regarding the correlation between an electroencephalogram (EEG) and the state of a dolphin, we developed a noninvasive recording method of EEG of a bottlenose dolphin (Tursiops truncatus) and an extraction method of true-EEG (EEG) from recorded-EEG (R-EEG) based on a human EEG recording method, and then carried out frequency analysis during transportation by truck. The frequency detected in the EEG of dolphin during apparent awakening was divided conveniently into three bands (5–15, 15–25, and 25–40 Hz) based on spectrum profiles. Analyses of the relationship between power ratio and movement of the dolphin revealed that the power ratio of dolphin in a situation when it was being quiet was evenly distributed among the three bands. These results suggested that the EEG of a dolphin could be detected accurately by this method, and that the frequency analysis of the detected EEG seemed to provide useful information for understanding the central nerve activity of these animals. PMID:20429047
Willis, Catherine; Rubin, Jacob
1987-01-01
A moving boundary problem which arises during transport with precipitation-dissolution reactions is solved by three different numerical methods. Two of these methods (one explicit and one implicit) are based on an integral formulation of mass balance and lead to an approximation of a weak solution. These methods are compared to a front-tracking scheme. Although the two approaches are conceptually different, the numerical solutions showed good agreement. As the ratio of dispersion to convection decreases, the methods based on the integral formulation become computationally more efficient. Specific reactions were modeled to examine the dependence of the system on the physical and chemical parameters. Although the water flow rate does not explicitly appear in the equation for the velocity of the moving boundary, the speed of the boundary depends more on the flux rate than on the dispersion coefficient. The discontinuity in the gradient of the solute concentration profile at the boundary increases with convection and with the initial concentration of the mineral. Our implicit method is extended to allow participation of the solutes in complexation reactions as well as the precipitation-dissolution reaction. This extension is easily made and does not change the basic method.
PhreeqcRM: A reaction module for transport simulators based on the geochemical model PHREEQC
Parkhurst, David L.; Wissmeier, Laurin
2015-01-01
PhreeqcRM is a geochemical reaction module designed specifically to perform equilibrium and kinetic reaction calculations for reactive transport simulators that use an operator-splitting approach. The basic function of the reaction module is to take component concentrations from the model cells of the transport simulator, run geochemical reactions, and return updated component concentrations to the transport simulator. If multicomponent diffusion is modeled (e.g., Nernst–Planck equation), then aqueous species concentrations can be used instead of component concentrations. The reaction capabilities are a complete implementation of the reaction capabilities of PHREEQC. In each cell, the reaction module maintains the composition of all of the reactants, which may include minerals, exchangers, surface complexers, gas phases, solid solutions, and user-defined kinetic reactants.PhreeqcRM assigns initial and boundary conditions for model cells based on standard PHREEQC input definitions (files or strings) of chemical compositions of solutions and reactants. Additional PhreeqcRM capabilities include methods to eliminate reaction calculations for inactive parts of a model domain, transfer concentrations and other model properties, and retrieve selected results. The module demonstrates good scalability for parallel processing by using multiprocessing with MPI (message passing interface) on distributed memory systems, and limited scalability using multithreading with OpenMP on shared memory systems. PhreeqcRM is written in C++, but interfaces allow methods to be called from C or Fortran. By using the PhreeqcRM reaction module, an existing multicomponent transport simulator can be extended to simulate a wide range of geochemical reactions. Results of the implementation of PhreeqcRM as the reaction engine for transport simulators PHAST and FEFLOW are shown by using an analytical solution and the reactive transport benchmark of MoMaS.
Flow assignment model for quantitative analysis of diverting bulk freight from road to railway
Liu, Chang; Wang, Jiaxi; Xiao, Jie; Liu, Siqi; Wu, Jianping; Li, Jian
2017-01-01
Since railway transport possesses the advantage of high volume and low carbon emissions, diverting some freight from road to railway will help reduce the negative environmental impacts associated with transport. This paper develops a flow assignment model for quantitative analysis of diverting truck freight to railway. First, a general network which considers road transportation, railway transportation, handling and transferring is established according to all the steps in the whole transportation process. Then general functions which embody the factors which the shippers will pay attention to when choosing mode and path are formulated. The general functions contain the congestion cost on road, the capacity constraints of railways and freight stations. Based on the general network and general cost function, a user equilibrium flow assignment model is developed to simulate the flow distribution on the general network under the condition that all shippers choose transportation mode and path independently. Since the model is nonlinear and challenging, we adopt a method that uses tangent lines to constitute envelope curve to linearize it. Finally, a numerical example is presented to test the model and show the method of making quantitative analysis of bulk freight modal shift between road and railway. PMID:28771536
James, Andrew I.; Jawitz, James W.; Munoz-Carpena, Rafael
2009-01-01
A model to simulate transport of materials in surface water and ground water has been developed to numerically approximate solutions to the advection-dispersion equation. This model, known as the Transport and Reaction Simulation Engine (TaRSE), uses an algorithm that incorporates a time-splitting technique where the advective part of the equation is solved separately from the dispersive part. An explicit finite-volume Godunov method is used to approximate the advective part, while a mixed-finite element technique is used to approximate the dispersive part. The dispersive part uses an implicit discretization, which allows it to run stably with a larger time step than the explicit advective step. The potential exists to develop algorithms that run several advective steps, and then one dispersive step that encompasses the time interval of the advective steps. Because the dispersive step is computationally most expensive, schemes can be implemented that are more computationally efficient than non-time-split algorithms. This technique enables scientists to solve problems with high grid Peclet numbers, such as transport problems with sharp solute fronts, without spurious oscillations in the numerical approximation to the solution and with virtually no artificial diffusion.
NASA Technical Reports Server (NTRS)
Coen, Peter G.
1991-01-01
A new computer technique for the analysis of transport aircraft sonic boom signature characteristics was developed. This new technique, based on linear theory methods, combines the previously separate equivalent area and F function development with a signature propagation method using a single geometry description. The new technique was implemented in a stand-alone computer program and was incorporated into an aircraft performance analysis program. Through these implementations, both configuration designers and performance analysts are given new capabilities to rapidly analyze an aircraft's sonic boom characteristics throughout the flight envelope.
Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.
Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua
2014-10-28
Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.
Rational design of capillary-driven flows for paper-based microfluidics.
Elizalde, Emanuel; Urteaga, Raúl; Berli, Claudio L A
2015-05-21
The design of paper-based assays that integrate passive pumping requires a precise programming of the fluid transport, which has to be encoded in the geometrical shape of the substrate. This requirement becomes critical in multiple-step processes, where fluid handling must be accurate and reproducible for each operation. The present work theoretically investigates the capillary imbibition in paper-like substrates to better understand fluid transport in terms of the macroscopic geometry of the flow domain. A fluid dynamic model was derived for homogeneous porous substrates with arbitrary cross-sectional shapes, which allows one to determine the cross-sectional profile required for a prescribed fluid velocity or mass transport rate. An extension of the model to slit microchannels is also demonstrated. Calculations were validated by experiments with prototypes fabricated in our lab. The proposed method constitutes a valuable tool for the rational design of paper-based assays.
Pricing of NASA Space Shuttle transportation system cargo
NASA Technical Reports Server (NTRS)
Hale, C. W.
1979-01-01
A two-part pricing policy is investigated as the most feasible method of pricing the transportation services to be provided by NASA's SSTS. Engineering cost estimates and a deterministic operating cost model generate a data base and develop a procedure for pricing the services of the SSTS. It is expected that the SSTS will have a monopoly on space material processing in areas of crystal growth, glass processing, metallurgical space applications, and biomedical processes using electrophoresis which will require efficient pricing. Pricing problems, the SSTS operating costs based on orbit elevation, number of launch sites, and number of flights, capital costs of the SSTS, research and development costs, allocation of joint transportation costs of the SSTS to a particular space processing activity, and rates for the SSTS are discussed. It is concluded that joint costs for commercial cargoes carried in the SSTS can be most usefully handled by making cost allocations based on proportionate capacity utilization.
Non-contact transportation system of small objects using Ultrasonic Waveguides
NASA Astrophysics Data System (ADS)
Nakamura, K.; Koyama, D.
2012-12-01
A transportation system for small object or fluid without contact is investigated being based on ultrasonic levitation. Small objects are suspended against gravity at the nodal points in ultrasonic pressure field due to the sound radiation force generated as the gradient of the energy density of the field. In this study, the trapped object is transported in the horizontal plane by introducing the spatial shift of the standing waves by the switching the lateral modes or travelling waves. The goal of the study is to establish a technology which can provide a total system with the flexibility in composing various transportation paths. Methods for linear/rotary stepping motions and continuous linear transportation are explained in this report. All the transportation tracks are composed of a bending vibrator and a reflector. The design for these acoustic cavity/waveguide is discussed.
NASA Astrophysics Data System (ADS)
Foucart, Francois
2018-04-01
General relativistic radiation hydrodynamic simulations are necessary to accurately model a number of astrophysical systems involving black holes and neutron stars. Photon transport plays a crucial role in radiatively dominated accretion discs, while neutrino transport is critical to core-collapse supernovae and to the modelling of electromagnetic transients and nucleosynthesis in neutron star mergers. However, evolving the full Boltzmann equations of radiative transport is extremely expensive. Here, we describe the implementation in the general relativistic SPEC code of a cheaper radiation hydrodynamic method that theoretically converges to a solution of Boltzmann's equation in the limit of infinite numerical resources. The algorithm is based on a grey two-moment scheme, in which we evolve the energy density and momentum density of the radiation. Two-moment schemes require a closure that fills in missing information about the energy spectrum and higher order moments of the radiation. Instead of the approximate analytical closure currently used in core-collapse and merger simulations, we complement the two-moment scheme with a low-accuracy Monte Carlo evolution. The Monte Carlo results can provide any or all of the missing information in the evolution of the moments, as desired by the user. As a first test of our methods, we study a set of idealized problems demonstrating that our algorithm performs significantly better than existing analytical closures. We also discuss the current limitations of our method, in particular open questions regarding the stability of the fully coupled scheme.
DOT National Transportation Integrated Search
1978-04-01
Volume 2 defines a new algorithm for the network equilibrium model that works in the space of path flows and is based on the theory of fixed point method. The goals of the study were broadly defined as the identification of aggregation practices and ...
Electromechanical and Chemical Sensing at the Nanoscale: DFT and Transport Modeling
NASA Astrophysics Data System (ADS)
Maiti, Amitesh
Of the many nanoelectronic applications proposed for near to medium-term commercial deployment, sensors based on carbon nanotubes (CNT) and metal-oxide nanowires are receiving significant attention from researchers. Such devices typically operate on the basis of the changes of electrical response characteristics of the active component (CNT or nanowire) when subjected to an externally applied mechanical stress or the adsorption of a chemical or bio-molecule. Practical development of such technologies can greatly benefit from quantum chemical modeling based on density functional theory (DFT), and from electronic transport modeling based on non-equilibrium Green's function (NEGF). DFT can compute useful quantities like possible bond-rearrangements, binding energy, charge transfer, and changes to the electronic structure, while NEGF can predict changes in electronic transport behavior and contact resistance. Effects of surrounding medium and intrinsic structural defects can also be taken into account. In this work we review some recent DFT and transport investigations on (1) CNT-based nano-electromechanical sensors (NEMS) and (2) gas-sensing properties of CNTs and metal-oxide nanowires. We also briefly discuss our current understanding of CNT-metal contacts which, depending upon the metal, the deposition technique, and the masking method can have a significant effect on device performance.
DETERMINATION OF TRANSFORMATION RATES OF CHIRAL PESTICIDES AND PCBS IN SOIL AND SEDIMENT MICROCOSMS
Risk Based Corrective Action (RBCA) has gained widespread acceptance as a favorable approach to remediating contaminated sites. The use of RBCA methods often requires computer-based modeling to assess the fate and transport of hazardous contaminants in subsurface environments, a...
Alivisatos, A. Paul; Colvin, Vickie
1996-01-01
An electroluminescent device is described, as well as a method of making same, wherein the device is characterized by a semiconductor nanocrystal electron transport layer capable of emitting visible light in response to a voltage applied to the device. The wavelength of the light emitted by the device may be changed by changing either the size or the type of semiconductor nanocrystals used in forming the electron transport layer. In a preferred embodiment the device is further characterized by the capability of emitting visible light of varying wavelengths in response to changes in the voltage applied to the device. The device comprises a hole processing structure capable of injecting and transporting holes, and usually comprising a hole injecting layer and a hole transporting layer; an electron transport layer in contact with the hole processing structure and comprising one or more layers of semiconductor nanocrystals; and an electron injecting layer in contact with the electron transport layer for injecting electrons into the electron transport layer. The capability of emitting visible light of various wavelengths is principally based on the variations in voltage applied thereto, but the type of semiconductor nanocrystals used and the size of the semiconductor nanocrystals in the layers of semiconductor nanometer crystals may also play a role in color change, in combination with the change in voltage.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hep, J.; Konecna, A.; Krysl, V.
2011-07-01
This paper describes the application of effective source in forward calculations and the adjoint method to the solution of fast neutron fluence and activation detector activities in the reactor pressure vessel (RPV) and RPV cavity of a VVER-440 reactor. Its objective is the demonstration of both methods on a practical task. The effective source method applies the Boltzmann transport operator to time integrated source data in order to obtain neutron fluence and detector activities. By weighting the source data by time dependent decay of the detector activity, the result of the calculation is the detector activity. Alternatively, if the weightingmore » is uniform with respect to time, the result is the fluence. The approach works because of the inherent linearity of radiation transport in non-multiplying time-invariant media. Integrated in this way, the source data are referred to as the effective source. The effective source in the forward calculations method thereby enables the analyst to replace numerous intensive transport calculations with a single transport calculation in which the time dependence and magnitude of the source are correctly represented. In this work, the effective source method has been expanded slightly in the following way: neutron source data were performed with few group method calculation using the active core calculation code MOBY-DICK. The follow-up neutron transport calculation was performed using the neutron transport code TORT to perform multigroup calculations. For comparison, an alternative method of calculation has been used based upon adjoint functions of the Boltzmann transport equation. Calculation of the three-dimensional (3-D) adjoint function for each required computational outcome has been obtained using the deterministic code TORT and the cross section library BGL440. Adjoint functions appropriate to the required fast neutron flux density and neutron reaction rates have been calculated for several significant points within the RPV and RPV cavity of the VVER-440 reacto rand located axially at the position of maximum power and at the position of the weld. Both of these methods (the effective source and the adjoint function) are briefly described in the present paper. The paper also describes their application to the solution of fast neutron fluence and detectors activities for the VVER-440 reactor. (authors)« less
The peculiarities of process-based approach realization in transport sector company management
NASA Astrophysics Data System (ADS)
Khripko, Elena; Sidorov, Gennadiy
2017-10-01
In the present article we study the phenomena of multiple meaning in understanding process-based management method in construction of transport infrastructure facilities. The idea of multiple meaning is in distortions which appear during reception of the management process paradigm in organizational environment of transport sector. The cause of distortion in process management is organizational resistance. The distortions of management processes are discovered at the level of diffusion among spheres of responsibility, collision in forms of functional, project and process interaction between the owner of the process and its participants. The level of distortion is affected by the attitude towards the result of work which means that process understanding of the result is replaced by the functional one in practice of management. This transfiguration is the consequence of regressive defensive mechanisms of the organizational environment. On the base of experience of forming process management in construction of transport infrastructure facilities company of the issues of diagnostics of various forms of organizational resistance and ways of reducing the destructive influence on managing processes are reviewed.
Hunt, J G; Watchman, C J; Bolch, W E
2007-01-01
Absorbed fraction (AF) calculations to the human skeletal tissues due to alpha particles are of interest to the internal dosimetry of occupationally exposed workers and members of the public. The transport of alpha particles through the skeletal tissue is complicated by the detailed and complex microscopic histology of the skeleton. In this study, both Monte Carlo and chord-based techniques were applied to the transport of alpha particles through 3-D microCT images of the skeletal microstructure of trabecular spongiosa. The Monte Carlo program used was 'Visual Monte Carlo--VMC'. VMC simulates the emission of the alpha particles and their subsequent energy deposition track. The second method applied to alpha transport is the chord-based technique, which randomly generates chord lengths across bone trabeculae and the marrow cavities via alternate and uniform sampling of their cumulative density functions. This paper compares the AF of energy to two radiosensitive skeletal tissues, active marrow and shallow active marrow, obtained with these two techniques.
NASA Astrophysics Data System (ADS)
Anderson, R.; Dobrev, V.; Kolev, Tz.; Kuzmin, D.; Quezada de Luna, M.; Rieben, R.; Tomov, V.
2017-04-01
In this work we present a FCT-like Maximum-Principle Preserving (MPP) method to solve the transport equation. We use high-order polynomial spaces; in particular, we consider up to 5th order spaces in two and three dimensions and 23rd order spaces in one dimension. The method combines the concepts of positive basis functions for discontinuous Galerkin finite element spatial discretization, locally defined solution bounds, element-based flux correction, and non-linear local mass redistribution. We consider a simple 1D problem with non-smooth initial data to explain and understand the behavior of different parts of the method. Convergence tests in space indicate that high-order accuracy is achieved. Numerical results from several benchmarks in two and three dimensions are also reported.
Spatio-temporal scaling effects on longshore sediment transport pattern along the nearshore zone
NASA Astrophysics Data System (ADS)
Khorram, Saeed; Ergil, Mustafa
2018-03-01
A measure of uncertainties, entropy has been employed in such different applications as coastal engineering probability inferences. Entropy sediment transport integration theories present novel visions in coastal analyses/modeling the application and development of which are still far-reaching. Effort has been made in the present paper to propose a method that needs an entropy-power index for spatio-temporal patterns analyses. Results have shown that the index is suitable for marine/hydrological ecosystem components analyses based on a beach area case study. The method makes use of six Makran Coastal monthly data (1970-2015) and studies variables such as spatio-temporal patterns, LSTR (long-shore sediment transport rate), wind speed, and wave height all of which are time-dependent and play considerable roles in terrestrial coastal investigations; the mentioned variables show meaningful spatio-temporal variability most of the time, but explanation of their combined performance is not easy. Accordingly, the use of an entropy-power index can show considerable signals that facilitate the evaluation of water resources and will provide an insight regarding hydrological parameters' interactions at scales as large as beach areas. Results have revealed that an STDDPI (entropy based spatio-temporal disorder dynamics power index) can simulate wave, long-shore sediment transport rate, and wind when granulometry, concentration, and flow conditions vary.
Analytical and Numerical Solutions of Generalized Fokker-Planck Equations - Final Report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prinja, Anil K.
The overall goal of this project was to develop advanced theoretical and numerical techniques to quantitatively describe the spreading of a collimated beam of charged particles in space, in angle, and in energy, as a result of small deflection, small energy transfer Coulomb collisions with the target nuclei and electrons. Such beams arise in several applications of great interest in nuclear engineering, and include electron and ion radiotherapy, ion beam modification of materials, accelerator transmutation of waste, and accelerator production of tritium, to name some important candidates. These applications present unique and difficult modeling challenges, but from the outset aremore » amenable to the language of ''transport theory'', which is very familiar to nuclear engineers and considerably less-so to physicists and material scientists. Thus, our approach has been to adopt a fundamental description based on transport equations, but the forward peakedness associated with charged particle interactions precludes a direct application of solution methods developed for neutral particle transport. Unique problem formulations and solution techniques are necessary to describe the transport and interaction of charged particles. In particular, we have developed the Generalized Fokker-Planck (GFP) approach to describe the angular and radial spreading of a collimated beam and a renormalized transport model to describe the energy-loss straggling of an initially monoenergetic distribution. Both analytic and numerical solutions have been investigated and in particular novel finite element numerical methods have been developed. In the first phase of the project, asymptotic methods were used to develop closed form solutions to the GFP equation for different orders of expansion, and was described in a previous progress report. In this final report we present a detailed description of (i) a novel energy straggling model based on a Fokker-Planck approximation but which is adapted for a multigroup transport setting, and (ii) two unique families of discontinuous finite element schemes, one linear and the other nonlinear.« less
NASA Astrophysics Data System (ADS)
Schauer, F.; Nádaždy, V.; Gmucová, K.
2018-04-01
There is potential in applying conjugated polymers in novel organic optoelectronic devices, where a comprehensive understanding of the fundamental processes and energetics involved during transport and recombination is still lacking, limiting further device optimization. The electronic transport modeling and its optimization need the energy distribution of transport and defect states, expressed by the energy distribution of the Density of States (DOS) function, as input/comparative parameters. We present the Energy Resolved-Electrochemical Impedance Spectroscopy (ER-EIS) method for the study of transport and defect electronic states in organic materials. The method allows mapping over unprecedentedly wide energy and DOS ranges. The ER-EIS spectroscopic method is based on the small signal interaction between the surface of the organic film and the liquid electrolyte containing reduction-oxidation (redox) species, which is similar to the extraction of an electron by an acceptor and capture of an electron by a donor at a semiconductor surface. The desired DOS of electronic transport and defect states can be derived directly from the measured redox response signal to the small voltage perturbation at the instantaneous position of the Fermi energy, given by the externally applied voltage. The theory of the ER-EIS method and conditions for its validity for solid polymers are presented in detail. We choose four case studies on poly(3-hexylthiophene-2,5-diyl) and poly[methyl(phenyl)silane] to show the possibilities of the method to investigate the electronic structure expressed by DOS of polymers with a high resolution of about 6 orders of magnitude and in a wide energy range of 6 eV.
Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T
2018-03-03
MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.
Zhang, Wandi; Chen, Feng; Wang, Zijia; Huang, Jianling; Wang, Bo
2017-11-01
Public transportation automatic fare collection (AFC) systems are able to continuously record large amounts of passenger travel information, providing massive, low-cost data for research on regulations pertaining to public transport. These data can be used not only to analyze characteristics of passengers' trips but also to evaluate transport policies that promote a travel mode shift and emission reduction. In this study, models combining card, survey, and geographic information systems (GIS) data are established with a research focus on the private driving restriction policies being implemented in an ever-increasing number of cities. The study aims to evaluate the impact of these policies on the travel mode shift, as well as relevant carbon emission reductions. The private driving restriction policy implemented in Beijing is taken as an example. The impact of the restriction policy on the travel mode shift from cars to subways is analyzed through a model based on metro AFC data. The routing paths of these passengers are also analyzed based on the GIS method and on survey data, while associated carbon emission reductions are estimated. The analysis method used in this study can provide reference for the application of big data in evaluating transport policies. Motor vehicles have become the most prevalent source of emissions and subsequently air pollution within Chinese cities. The evaluation of the effects of driving restriction policies on the travel mode shift and vehicle emissions will be useful for other cities in the future. Transport big data, playing an important support role in estimating the travel mode shift and emission reduction considered, can help related departments to estimate the effects of traffic jam alleviation and environment improvement before the implementation of these restriction policies and provide a reference for relevant decisions.
Mixed Transportation Network Design under a Sustainable Development Perspective
Qin, Jin; Ni, Ling-lin; Shi, Feng
2013-01-01
A mixed transportation network design problem considering sustainable development was studied in this paper. Based on the discretization of continuous link-grade decision variables, a bilevel programming model was proposed to describe the problem, in which sustainability factors, including vehicle exhaust emissions, land-use scale, link load, and financial budget, are considered. The objective of the model is to minimize the total amount of resources exploited under the premise of meeting all the construction goals. A heuristic algorithm, which combined the simulated annealing and path-based gradient projection algorithm, was developed to solve the model. The numerical example shows that the transportation network optimized with the method above not only significantly alleviates the congestion on the link, but also reduces vehicle exhaust emissions within the network by up to 41.56%. PMID:23476142
Mixed transportation network design under a sustainable development perspective.
Qin, Jin; Ni, Ling-lin; Shi, Feng
2013-01-01
A mixed transportation network design problem considering sustainable development was studied in this paper. Based on the discretization of continuous link-grade decision variables, a bilevel programming model was proposed to describe the problem, in which sustainability factors, including vehicle exhaust emissions, land-use scale, link load, and financial budget, are considered. The objective of the model is to minimize the total amount of resources exploited under the premise of meeting all the construction goals. A heuristic algorithm, which combined the simulated annealing and path-based gradient projection algorithm, was developed to solve the model. The numerical example shows that the transportation network optimized with the method above not only significantly alleviates the congestion on the link, but also reduces vehicle exhaust emissions within the network by up to 41.56%.
NASA Astrophysics Data System (ADS)
Li, Dongde; Wu, Di; Zhang, Xiaojiao; Zeng, Bowen; Li, Mingjun; Duan, Haiming; Yang, Bingchu; Long, Mengqiu
2018-05-01
The spin-dependent electronic transport properties of M(dcdmp)2 (M = Cu, Au, Co, Ni; dcdmp = 2,3-dicyano-5,6-dimercaptopyrazyne) molecular devices based on zigzag graphene nanoribbon (ZGNR) electrodes were investigated by density functional theory combined nonequilibrium Green's function method (DFT-NEGF). Our results show that the spin-dependent transport properties of the M(dcdmp)2 molecular devices can be controlled by the spin configurations of the ZGNR electrodes, and the central 3d-transition metal atom can introduce a larger magnetism than that of the nonferrous metal one. Moreover, the perfect spin filtering effect, negative differential resistance, rectifying effect and magnetic resistance phenomena can be observed in our proposed M(dcdmp)2 molecular devices.
Design of an autonomous teleoperated cargo transporting vehicle for lunar base operations
NASA Technical Reports Server (NTRS)
Holt, James; Lao, Tom; Monali, Nkoy
1989-01-01
At the turn of the century NASA plans to begin construction of a lunar base. The base will likely consist of developed areas (i.e., habitation, laboratory, landing and launching sites, power plant) separated from each other due to safety considerations. The Self-Repositioning Track Vehicle (SRTV) was designed to transport cargo between these base facilities. The SRTV operates by using two robotic arms to raise and position segments of track upon which the vehicle travels. The SRTV utilizes the semiautonomous mobility (SAM) method of teleoperation; actuator-controlled interlocking track sections; two robotic arms each with five degrees of freedom; and these materials: titanium for structural members and aluminum for shell members, with the possible use of light-weight, high-strength composites.
Risk assessment for construction projects of transport infrastructure objects
NASA Astrophysics Data System (ADS)
Titarenko, Boris
2017-10-01
The paper analyzes and compares different methods of risk assessment for construction projects of transport objects. The management of such type of projects demands application of special probabilistic methods due to large level of uncertainty of their implementation. Risk management in the projects requires the use of probabilistic and statistical methods. The aim of the work is to develop a methodology for using traditional methods in combination with robust methods that allow obtaining reliable risk assessments in projects. The robust approach is based on the principle of maximum likelihood and in assessing the risk allows the researcher to obtain reliable results in situations of great uncertainty. The application of robust procedures allows to carry out a quantitative assessment of the main risk indicators of projects when solving the tasks of managing innovation-investment projects. Calculation of damage from the onset of a risky event is possible by any competent specialist. And an assessment of the probability of occurrence of a risky event requires the involvement of special probabilistic methods based on the proposed robust approaches. Practice shows the effectiveness and reliability of results. The methodology developed in the article can be used to create information technologies and their application in automated control systems for complex projects.
Tenzer, S; Peters, B; Bulik, S; Schoor, O; Lemmel, C; Schatz, M M; Kloetzel, P-M; Rammensee, H-G; Schild, H; Holzhütter, H-G
2005-05-01
Epitopes presented by major histocompatibility complex (MHC) class I molecules are selected by a multi-step process. Here we present the first computational prediction of this process based on in vitro experiments characterizing proteasomal cleavage, transport by the transporter associated with antigen processing (TAP) and MHC class I binding. Our novel prediction method for proteasomal cleavages outperforms existing methods when tested on in vitro cleavage data. The analysis of our predictions for a new dataset consisting of 390 endogenously processed MHC class I ligands from cells with known proteasome composition shows that the immunological advantage of switching from constitutive to immunoproteasomes is mainly to suppress the creation of peptides in the cytosol that TAP cannot transport. Furthermore, we show that proteasomes are unlikely to generate MHC class I ligands with a C-terminal lysine residue, suggesting processing of these ligands by a different protease that may be tripeptidyl-peptidase II (TPPII).
NASA Technical Reports Server (NTRS)
Hynes, Charles S.; Hardy, Gordon H.; Sherry, Lance
2007-01-01
Volume I of this report presents a new method for synthesizing hybrid systems directly from design requirements, and applies the method to design of a hybrid system for longitudinal control of transport aircraft. The resulting system satisfies general requirement for safety and effectiveness specified a priori, enabling formal validation to be achieved. Volume II contains seven appendices intended to make the report accessible to readers with backgrounds in human factors, fli ght dynamics and control. and formal logic. Major design goals are (1) system desi g n integrity based on proof of correctness at the design level, (2), significant simplification and cost reduction in system development and certification, and (3) improved operational efficiency, with significant alleviation of human-factors problems encountered by pilots in current transport aircraft. This report provides for the first time a firm technical basis for criteria governing design and certification of avionic systems for transport aircraft. It should be of primary interest to designers of next-generation avionic systems.
NASA Technical Reports Server (NTRS)
Hynes, Charles S.; Hardy, Gordon H.; Sherry, Lance
2007-01-01
Volume I of this report presents a new method for synthesizing hybrid systems directly from desi gn requirements, and applies the method to design of a hybrid system for longitudinal control of transport aircraft. The resulting system satisfies general requirement for safety and effectiveness specified a priori, enabling formal validation to be achieved. Volume II contains seven appendices intended to make the report accessible to readers with backgrounds in human factors, flight dynamics and control, and formal logic. Major design goals are (1) system design integrity based on proof of correctness at the design level, (2) significant simplification and cost reduction in system development and certification, and (3) improved operational efficiency, with significant alleviation of human-factors problems encountered by pilots in current transport aircraft. This report provides for the first time a firm technical basis for criteria governing design and certification of avionic systems for transport aircraft. It should be of primary interest to designers of next-generation avionic systems.
Xue, Xiuzhan; Yu, Cunming; Wang, Jingming; Jiang, Lei
2016-12-27
Microbubbles are tiny bubbles with diameters below 50 μm. Because of their minute buoyant force, the microbubbles stagnate in aqueous media for a long time, and they sometimes cause serious damage. Most traditional methods chosen for elimination of gas bubbles utilize buoyancy forces including chemical methods and physical methods, and they only have a minor effect on microbubbles. Several approaches have been developed to collect and transport microbubbles in aqueous media. However, the realization of innovative strategies to directly collect and transport microbubbles in aqueous media remains a big challenge. In nature, both spider silk and cactus spines take advantage of their conical-shaped surface to yield the gradient of Laplace pressure and surface free energy for collecting fog droplets from the environment. Inspired by this, we introduce here the gradient of Laplace pressure and surface free energy to the interface of superhydrophobic copper cones (SCCs), which can continuously collect and directionally transport CO 2 microbubbles (from tip side to base side) in CO 2 -supersaturated solution. A gas layer was formed when the microbubbles encounter the SCCs. This offers a channel for microbubble directional transportation. The efficiency of microbubble transport is significantly affected by the apex angle of SCCs and the carbon dioxide concentration. The former provides different gradients of Laplace pressure as the driving force. The latter represents the capacity, which offers the quantity of CO 2 microbubbles for collection and transportation. We believe that this approach provides a simple and valid way to remove microbubbles.
AN OPEN-SOURCE NEUTRINO RADIATION HYDRODYNAMICS CODE FOR CORE-COLLAPSE SUPERNOVAE
DOE Office of Scientific and Technical Information (OSTI.GOV)
O’Connor, Evan, E-mail: evanoconnor@ncsu.edu; CITA, Canadian Institute for Theoretical Astrophysics, Toronto, M5S 3H8
2015-08-15
We present an open-source update to the spherically symmetric, general-relativistic hydrodynamics, core-collapse supernova (CCSN) code GR1D. The source code is available at http://www.GR1Dcode.org. We extend its capabilities to include a general-relativistic treatment of neutrino transport based on the moment formalisms of Shibata et al. and Cardall et al. We pay special attention to implementing and testing numerical methods and approximations that lessen the computational demand of the transport scheme by removing the need to invert large matrices. This is especially important for the implementation and development of moment-like transport methods in two and three dimensions. A critical component of neutrinomore » transport calculations is the neutrino–matter interaction coefficients that describe the production, absorption, scattering, and annihilation of neutrinos. In this article we also describe our open-source neutrino interaction library NuLib (available at http://www.nulib.org). We believe that an open-source approach to describing these interactions is one of the major steps needed to progress toward robust models of CCSNe and robust predictions of the neutrino signal. We show, via comparisons to full Boltzmann neutrino-transport simulations of CCSNe, that our neutrino transport code performs remarkably well. Furthermore, we show that the methods and approximations we employ to increase efficiency do not decrease the fidelity of our results. We also test the ability of our general-relativistic transport code to model failed CCSNe by evolving a 40-solar-mass progenitor to the onset of collapse to a black hole.« less
Asymmetric nanopore membranes: Single molecule detection and unique transport properties
NASA Astrophysics Data System (ADS)
Bishop, Gregory William
Biological systems rely on the transport properties of transmembrane channels. Such pores can display selective transport by allowing the passage of certain ions or molecules while rejecting others. Recent advances in nanoscale fabrication have allowed the production of synthetic analogs of such channels. Synthetic nanopores (pores with a limiting dimension of 1--100 nm) can be produced in a variety of materials by several different methods. In the Martin group, we have been exploring the track-etch method to produce asymmetric nanopores in thin films of polymeric or crystalline materials. Asymmetric nanopores are of particular interest due to their ability to serve as ion-current rectifiers. This means that when a membrane that contains such a pore or collection of pores is used to separate identical portions of electrolyte solution, the magnitude of the ionic current will depend not only on the magnitude of the applied potential (as expected) but also the polarity. Ion-current rectification is characterized by an asymmetric current--potential response. Here, the interesting transport properties of asymmetric nanopores (ion-current rectification and the related phenomenon of electroosmotic flow rectification) are explored. The effects of pore shape and pore density on these phenomena are investigated. Membranes that contain a single nanopore can serve as platforms for the single-molecule sensing technique known as resistive pulse sensing. The resistive-pulse sensing method is based on the Coulter principle. Thus, the selectivity of the technique is based largely upon size, making the analysis of mixtures by this method difficult in many cases. Here, the surface of a single nanopore membrane is modified with a molecular recognition agent in an attempt to obtain a more selective resistive-pulse sensor for a specific analyte.
Modeling of soil erosion and sediment transport in the East River Basin in southern China.
Wu, Yiping; Chen, Ji
2012-12-15
Soil erosion is a major global environmental problem that has caused many issues involving land degradation, sedimentation of waterways, ecological degradation, and nonpoint source pollution. Therefore, it is significant to understand the processes of soil erosion and sediment transport along rivers, and this can help identify the erosion prone areas and find potential measures to alleviate the environmental effects. In this study, we investigated soil erosion and identified the most seriously eroded areas in the East River Basin in southern China using a physically-based model, Soil and Water Assessment Tool (SWAT). We also introduced a classical sediment transport method (Zhang) into SWAT and compared it with the built-in Bagnold method in simulating sediment transport process along the river. The derived spatial soil erosion map and land use based erosion levels can explicitly illustrate the identification and prioritization of the critical soil erosion areas in this basin. Our results also indicate that erosion is quite sensitive to soil properties and slope. Comparison of Bagnold and Zhang methods shows that the latter can give an overall better performance especially in tracking the peak and low sediment concentrations along the river. We also found that the East River is mainly characterized by sediment deposition in most of the segments and at most times of a year. Overall, the results presented in this paper can provide decision support for watershed managers about where the best management practices (conservation measures) can be implemented effectively and at low cost. The methods we used in this study can also be of interest in sediment modeling for other basins worldwide. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Sun, P.; Jokipii, J. R.; Giacalone, J.
2016-12-01
Anisotropies in astrophysical turbulence has been proposed and observed for a long time. And recent observations adopting the multi-scale analysis techniques provided a detailed description of the scale-dependent power spectrum of the magnetic field parallel and perpendicular to the scale-dependent magnetic field line at different scales in the solar wind. In the previous work, we proposed a multi-scale method to synthesize non-isotropic turbulent magnetic field with pre-determined power spectra of the fluctuating magnetic field as a function of scales. We present the effect of test particle transport in the resulting field with a two-scale algorithm. We find that the scale-dependent turbulence anisotropy has a significant difference in the effect on charged par- ticle transport from what the isotropy or the global anisotropy has. It is important to apply this field synthesis method to the solar wind magnetic field based on spacecraft data. However, this relies on how we extract the power spectra of the turbulent magnetic field across different scales. In this study, we propose here a power spectrum synthesis method based on Fourier analysis to extract the large and small scale power spectrum from a single spacecraft observation with a long enough period and a high sampling frequency. We apply the method to the solar wind measurement by the magnetometer onboard the ACE spacecraft and regenerate the large scale isotropic 2D spectrum and the small scale anisotropic 2D spectrum. We run test particle simulations in the magnetid field generated in this way to estimate the transport coefficients and to compare with the isotropic turbulence model.
Superpave binder implementation : final report.
DOT National Transportation Integrated Search
1999-01-01
Oregon Department of Transportation (ODOT) has specified performance-based asphalts (PBAs) since 1991. Developed by the Pacific Coast Conference on Asphalt Specifications (PCCAS) in 1990, the PBA concept uses conventional test methods for classificat...
Diluted magnetic semiconductor nanowires exhibiting magnetoresistance
Yang, Peidong [El Cerrito, CA; Choi, Heonjin [Seoul, KR; Lee, Sangkwon [Daejeon, KR; He, Rongrui [Albany, CA; Zhang, Yanfeng [El Cerrito, CA; Kuykendal, Tevye [Berkeley, CA; Pauzauskie, Peter [Berkeley, CA
2011-08-23
A method for is disclosed for fabricating diluted magnetic semiconductor (DMS) nanowires by providing a catalyst-coated substrate and subjecting at least a portion of the substrate to a semiconductor, and dopant via chloride-based vapor transport to synthesize the nanowires. Using this novel chloride-based chemical vapor transport process, single crystalline diluted magnetic semiconductor nanowires Ga.sub.1-xMn.sub.xN (x=0.07) were synthesized. The nanowires, which have diameters of .about.10 nm to 100 nm and lengths of up to tens of micrometers, show ferromagnetism with Curie temperature above room temperature, and magnetoresistance up to 250 Kelvin.
NASA Astrophysics Data System (ADS)
Pykhtin, Kirill; Simankina, Tatiana; Sharmanov, Vladimir; Kopytova, Anna
2017-10-01
The danger of injuries and accidents in various industries such as transportation and construction urges the government to control the occupational health and safety more strictly. However, in order to do so with the minimal costs modern risk management tools, have to be implemented. Risk-based approach is an essential tool for competent risk- assessment and used in a great variety of other countries, demonstrating great results in providing of safe working environment. The article describes the problems that the implementation of the method faces in Russia and suggests certain ways to resolve them.
NASA Technical Reports Server (NTRS)
Snyder, C. T.; Drinkwater, F. J., III; Fry, E. B.; Forrest, R. D.
1973-01-01
Data for use in development of takeoff airworthiness standards for new aircraft designs such as the supersonic transport (SST) and the large wide-body subsonic jet transport are provided. An advanced motion simulator was used to compare the performance and handling characteristics of three representative large jet transports during specific flight certification tasks. Existing regulatory constraints and methods for determining rotation speed were reviewed, and the effects on takeoff performance of variations in rotation speed, pitch attitude, and pitch attitude rate during the rotation maneuver were analyzed. A limited quantity of refused takeoff information was obtained. The aerodynamics, wing loading, and thrust-to-weight ratio of the subject SST resulted in takeoff speeds limited by climb (rather than lift-off) considerations. Take-off speeds based on U.S. subsonic transport requirements were found unacceptable because of the criticality of rotation-abuse effects on one-engine-inoperative climb performance. Adequate safety margin was provided by takeoff speeds based on proposed Anglo-French supersonic transport (TSS) criteria, with the limiting criterion being that takeoff safety speed be at least 1.15 times the one-engine-inoperative zero-rate-of-climb speed. Various observations related to SST certification are presented.
Monte Carlo Transport for Electron Thermal Transport
NASA Astrophysics Data System (ADS)
Chenhall, Jeffrey; Cao, Duc; Moses, Gregory
2015-11-01
The iSNB (implicit Schurtz Nicolai Busquet multigroup electron thermal transport method of Cao et al. is adapted into a Monte Carlo transport method in order to better model the effects of non-local behavior. The end goal is a hybrid transport-diffusion method that combines Monte Carlo Transport with a discrete diffusion Monte Carlo (DDMC). The hybrid method will combine the efficiency of a diffusion method in short mean free path regions with the accuracy of a transport method in long mean free path regions. The Monte Carlo nature of the approach allows the algorithm to be massively parallelized. Work to date on the method will be presented. This work was supported by Sandia National Laboratory - Albuquerque and the University of Rochester Laboratory for Laser Energetics.
A Computational Approach to Estimate Interorgan Metabolic Transport in a Mammal
Cui, Xiao; Geffers, Lars; Eichele, Gregor; Yan, Jun
2014-01-01
In multicellular organisms metabolism is distributed across different organs, each of which has specific requirements to perform its own specialized task. But different organs also have to support the metabolic homeostasis of the organism as a whole by interorgan metabolite transport. Recent studies have successfully reconstructed global metabolic networks in tissues and cell types and attempts have been made to connect organs with interorgan metabolite transport. Instead of these complicated approaches to reconstruct global metabolic networks, we proposed in this study a novel approach to study interorgan metabolite transport focusing on transport processes mediated by solute carrier (Slc) transporters and their couplings to cognate enzymatic reactions. We developed a computational approach to identify and score potential interorgan metabolite transports based on the integration of metabolism and transports in different organs in the adult mouse from quantitative gene expression data. This allowed us to computationally estimate the connectivity between 17 mouse organs via metabolite transport. Finally, by applying our method to circadian metabolism, we showed that our approach can shed new light on the current understanding of interorgan metabolite transport at a whole-body level in mammals. PMID:24971892
NASA Astrophysics Data System (ADS)
Matsumoto, Kensaku; Okada, Takashi; Takeuchi, Atsuo; Yazawa, Masato; Uchibori, Sumio; Shimizu, Yoshihiko
Field Measurement of Self Potential Method using Copper Sulfate Electrode was performed in base of riverbank in WATARASE River, where has leakage problem to examine leakage characteristics. Measurement results showed typical S-shape what indicates existence of flow groundwater. The results agreed with measurement results by Ministry of Land, Infrastructure and Transport with good accuracy. Results of 1m depth ground temperature detection and Chain-Array detection showed good agreement with results of the Self Potential Method. Correlation between Self Potential value and groundwater velocity was examined model experiment. The result showed apparent correlation. These results indicate that the Self Potential Method was effective method to examine the characteristics of ground water of base of riverbank in leakage problem.
Melchior, Donald L.; Sharom, Frances J.; Evers, Raymond; Wright, George E.; Chu, Joseph W.K.; Wright, Stephen E.; Chu, Xiaoyan; Yabut, Jocelyn
2012-01-01
Introduction P-Glycoprotein (ABCB1, MDR1) is a multidrug efflux pump that is a member of the ATP-binding cassette (ABC) superfamily. Many drugs in common clinical use are either substrates or inhibitors of this transporter. Quantitative details of P-glycoprotein inhibition by pharmaceutical agents are essential for assessment of their pharmacokinetic behavior and prevention of negative patient reactions. Cell-based systems have been widely used for determination of drug interactions with P-glycoprotein, but they suffer from several disadvantages, and results are often widely variable between laboratories. We aimed to demonstrate that a novel liposomal system employing contemporary biochemical methodologies could measure the ability of clinically used drugs to inhibit the P-glycoprotein pump. To accomplish this we compared results with those of cell-based approaches. Methods Purified transport-competent hamster Abcb1a P-glycoprotein was reconstituted into a unilamellar liposomal system, Fluorosome-trans-pgp, whose aqueous interior contains fluorescent drug sensors. This provides a well-defined system for measuring P-glycoprotein transport inhibition by test drugs in real time using rapid fluorescence-based technology. Results Inhibition of ATP-driven transport by Fluorosome-trans-pgp employed a panel of 46 representative drugs. Resulting IC50 values correlated well (r2 = 0.80) with Kd values for drug binding to purified P-glycoprotein. They also showed a similar trend to transport inhibition data obtained using LLC-MDR1 cell monolayers. Fluorosome-trans-pgp IC50 values were in agreement with published results of digoxin drug-drug interaction studies in humans. Discussion This novel approach using a liposomal system and fluorescence-based technology is shown to be suitable to study whether marketed drugs and drug candidates are P-glycoprotein inhibitors. The assay is rapid, allowing a 7-point IC50 determination in <6 minutes, and requires minimal quantities of test drug. The method is amenable to robotics and offers a cost advantage relative to conventional cell-based assays. The well-defined nature of this assay also obviates many of the inherent complications and ambiguities of cell-based systems. PMID:22394995
ERIC Educational Resources Information Center
Fienup, Daniel M.; Critchfield, Thomas S.
2011-01-01
College students in a psychology research-methods course learned concepts related to inferential statistics and hypothesis decision making. One group received equivalence-based instruction on conditional discriminations that were expected to promote the emergence of many untaught, academically useful abilities (i.e., stimulus equivalence group). A…
On the interplay of morphology and electronic conductivity of rotationally spun carbon fiber mats
NASA Astrophysics Data System (ADS)
Opitz, Martin; Go, Dennis; Lott, Philipp; Müller, Sandra; Stollenwerk, Jochen; Kuehne, Alexander J. C.; Roling, Bernhard
2017-09-01
Carbon-based materials are used as electrode materials in a wide range of electrochemical applications, e.g., in batteries, supercapacitors, and fuel cells. For these applications, the electronic conductivity of the materials plays an important role. Currently, porous carbon materials with complex morphologies and hierarchical pore structures are in the focus of research. The complex morphologies influence the electronic transport and may lead to an anisotropic electronic conductivity. In this paper, we unravel the influence of the morphology of rotationally spun carbon fiber mats on their electronic conductivity. By combining experiments with finite-element simulations, we compare and evaluate different electrode setups for conductivity measurements. While the "bar-type method" with two parallel electrodes on the same face of the sample yields information about the intrinsic conductivity of the carbon fibers, the "parallel-plate method" with two electrodes on opposite faces gives information about the electronic transport orthogonal to the faces. Results obtained for the van-der-Pauw method suggest that this method is not well suited for understanding morphology-transport relations in these materials.
An optimal transportation approach for nuclear structure-based pathology.
Wang, Wei; Ozolek, John A; Slepčev, Dejan; Lee, Ann B; Chen, Cheng; Rohde, Gustavo K
2011-03-01
Nuclear morphology and structure as visualized from histopathology microscopy images can yield important diagnostic clues in some benign and malignant tissue lesions. Precise quantitative information about nuclear structure and morphology, however, is currently not available for many diagnostic challenges. This is due, in part, to the lack of methods to quantify these differences from image data. We describe a method to characterize and contrast the distribution of nuclear structure in different tissue classes (normal, benign, cancer, etc.). The approach is based on quantifying chromatin morphology in different groups of cells using the optimal transportation (Kantorovich-Wasserstein) metric in combination with the Fisher discriminant analysis and multidimensional scaling techniques. We show that the optimal transportation metric is able to measure relevant biological information as it enables automatic determination of the class (e.g., normal versus cancer) of a set of nuclei. We show that the classification accuracies obtained using this metric are, on average, as good or better than those obtained utilizing a set of previously described numerical features. We apply our methods to two diagnostic challenges for surgical pathology: one in the liver and one in the thyroid. Results automatically computed using this technique show potentially biologically relevant differences in nuclear structure in liver and thyroid cancers.
An optimal transportation approach for nuclear structure-based pathology
Wang, Wei; Ozolek, John A.; Slepčev, Dejan; Lee, Ann B.; Chen, Cheng; Rohde, Gustavo K.
2012-01-01
Nuclear morphology and structure as visualized from histopathology microscopy images can yield important diagnostic clues in some benign and malignant tissue lesions. Precise quantitative information about nuclear structure and morphology, however, is currently not available for many diagnostic challenges. This is due, in part, to the lack of methods to quantify these differences from image data. We describe a method to characterize and contrast the distribution of nuclear structure in different tissue classes (normal, benign, cancer, etc.). The approach is based on quantifying chromatin morphology in different groups of cells using the optimal transportation (Kantorovich-Wasserstein) metric in combination with the Fisher discriminant analysis and multidimensional scaling techniques. We show that the optimal transportation metric is able to measure relevant biological information as it enables automatic determination of the class (e.g. normal vs. cancer) of a set of nuclei. We show that the classification accuracies obtained using this metric are, on average, as good or better than those obtained utilizing a set of previously described numerical features. We apply our methods to two diagnostic challenges for surgical pathology: one in the liver and one in the thyroid. Results automatically computed using this technique show potentially biologically relevant differences in nuclear structure in liver and thyroid cancers. PMID:20977984
Sun, Yan; Lang, Maoxiang; Wang, Danzhu
2016-01-01
The transportation of hazardous materials is always accompanied by considerable risk that will impact public and environment security. As an efficient and reliable transportation organization, a multimodal service should participate in the transportation of hazardous materials. In this study, we focus on transporting hazardous materials through the multimodal service network and explore the hazardous materials multimodal routing problem from the operational level of network planning. To formulate this problem more practicably, minimizing the total generalized costs of transporting the hazardous materials and the social risk along the planned routes are set as the optimization objectives. Meanwhile, the following formulation characteristics will be comprehensively modelled: (1) specific customer demands; (2) multiple hazardous material flows; (3) capacitated schedule-based rail service and uncapacitated time-flexible road service; and (4) environmental risk constraint. A bi-objective mixed integer nonlinear programming model is first built to formulate the routing problem that combines the formulation characteristics above. Then linear reformations are developed to linearize and improve the initial model so that it can be effectively solved by exact solution algorithms on standard mathematical programming software. By utilizing the normalized weighted sum method, we can generate the Pareto solutions to the bi-objective optimization problem for a specific case. Finally, a large-scale empirical case study from the Beijing–Tianjin–Hebei Region in China is presented to demonstrate the feasibility of the proposed methods in dealing with the practical problem. Various scenarios are also discussed in the case study. PMID:27483294
NASA Astrophysics Data System (ADS)
Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi
2005-10-01
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Generalized Kubo formulas for the transport properties of incommensurate 2D atomic heterostructures
NASA Astrophysics Data System (ADS)
Cancès, Eric; Cazeaux, Paul; Luskin, Mitchell
2017-06-01
We give an exact formulation for the transport coefficients of incommensurate two-dimensional atomic multilayer systems in the tight-binding approximation. This formulation is based upon the C* algebra framework introduced by Bellissard and collaborators [Coherent and Dissipative Transport in Aperiodic Solids, Lecture Notes in Physics (Springer, 2003), Vol. 597, pp. 413-486 and J. Math. Phys. 35(10), 5373-5451 (1994)] to study aperiodic solids (disordered crystals, quasicrystals, and amorphous materials), notably in the presence of magnetic fields (quantum Hall effect). We also present numerical approximations and test our methods on a one-dimensional incommensurate bilayer system.
[Global Atmospheric Chemistry/Transport Modeling and Data-Analysis
NASA Technical Reports Server (NTRS)
Prinn, Ronald G.
1999-01-01
This grant supported a global atmospheric chemistry/transport modeling and data- analysis project devoted to: (a) development, testing, and refining of inverse methods for determining regional and global transient source and sink strengths for trace gases; (b) utilization of these inverse methods which use either the Model for Atmospheric Chemistry and Transport (MATCH) which is based on analyzed observed winds or back- trajectories calculated from these same winds for determining regional and global source and sink strengths for long-lived trace gases important in ozone depletion and the greenhouse effect; (c) determination of global (and perhaps regional) average hydroxyl radical concentrations using inverse methods with multiple "titrating" gases; and (d) computation of the lifetimes and spatially resolved destruction rates of trace gases using 3D models. Important ultimate goals included determination of regional source strengths of important biogenic/anthropogenic trace gases and also of halocarbons restricted by the Montreal Protocol and its follow-on agreements, and hydrohalocarbons now used as alternatives to the above restricted halocarbons.
Low-stress mounting configuration design for large aperture laser transport mirror
NASA Astrophysics Data System (ADS)
Zhang, Zheng; Quan, Xusong; Yao, Chao; Wang, Hui
2016-10-01
TM1-6S1 large aperture laser transport mirror is a crucial optical unit of high power solid-state laser in the Inertial Confinement Fusion (ICF) facility. This article focuses on the low-stress and precise mounting method of large-aperture mirror. Based on the engineering practice of SG-III, the state-of-the-art and key problems of current mounting configuration are clarified firstly. Subsequently, a brand new low-stress mounting configuration with flexure supports is proposed. Opto-mechanical model of the mirror under mounting force is built up with elastic mechanics theory. Further, numerical methods and field tests are employed to verify the favorable load uniform capacity and load adjust capacity of flexure supports. With FEM, the relation between the mounting force from new configuration and the mirror surface distortion (wavefront error) is clarified. The novel mounting method of large aperture optics could be not only used on this laser transport mirror, but also on the other transmission optics and large crystals in ICF facilities.
Describing transport across complex biological interfaces
NASA Astrophysics Data System (ADS)
Lervik, A.; Kjelstrup, S.
2013-05-01
It has long been known that proteins are capable of transporting ions against a gradient in the chemical potential, using the energy available from a chemical reaction. This is called active transport. A well studied example is the Ca2+-transport by means of hydrolysis of adenosine triphoshpate (ATP) at the surface of the Ca2+-ATPase in sarcoplasmic reticulum. The cycle of events is known to be reversible, and has recently also been associated with a characteristic, and also reversible, heat production. We use the case of the Ca2+-ATPase to present and discuss various central theoretical approaches to describe active transport, with focus on two schools of development, namely the kinetic and the thermodynamic schools. Among the kinetic descriptions, Hill's diagram method gives the most sophisticated description, reducing to the common Post-Albers scheme with simple enzyme kinetic reactions. Among the thermodynamic approaches, we review the now classical approach of Katchalsky and Curran, and its extension to proper pathways by Caplan and Essig, before the most recent development based on mesoscopic theory is outlined. The mesoscopic approach gives a non-linear theory compatible with Hill's most general method when the active transport is isothermal. We show how the old question of scalar-vector coupling is resolved using rules for non-equilibrium thermodynamics for interfaces. Also thermal driving forces can then be accounted for. Essential physical concepts behind all methods are presented and advantages/deficiencies are pointed out. Emphasis is made on the connection to experiments.
Babst, Benjamin A; Karve, Abhijit A; Judt, Tatjana
2013-06-01
Metabolism and phloem transport of carbohydrates are interactive processes, yet each is often studied in isolation from the other. Carbon-11 ((11)C) has been successfully used to study transport and allocation processes dynamically over time. There is a need for techniques to determine metabolic partitioning of newly fixed carbon that are compatible with existing non-invasive (11)C-based methodologies for the study of phloem transport. In this report, we present methods using (11)C-labeled CO2 to trace carbon partitioning to the major non-structural carbohydrates in leaves-sucrose, glucose, fructose and starch. High-performance thin-layer chromatography (HPTLC) was adapted to provide multisample throughput, raising the possibility of measuring different tissues of the same individual plant, or for screening multiple plants. An additional advantage of HPTLC was that phosphor plate imaging of radioactivity had a much higher sensitivity and broader range of sensitivity than radio-HPLC detection, allowing measurement of (11)C partitioning to starch, which was previously not possible. Because of the high specific activity of (11)C and high sensitivity of detection, our method may have additional applications in the study of rapid metabolic responses to environmental changes that occur on a time scale of minutes. The use of this method in tandem with other (11)C assays for transport dynamics and whole-plant partitioning makes a powerful combination of tools to study carbohydrate metabolism and whole-plant transport as integrated processes.
Finite temperature dynamics of a Holstein polaron: The thermo-field dynamics approach
NASA Astrophysics Data System (ADS)
Chen, Lipeng; Zhao, Yang
2017-12-01
Combining the multiple Davydov D2 Ansatz with the method of thermo-field dynamics, we study finite temperature dynamics of a Holstein polaron on a lattice. It has been demonstrated, using the hierarchy equations of motion method as a benchmark, that our approach provides an efficient, robust description of finite temperature dynamics of the Holstein polaron in the simultaneous presence of diagonal and off-diagonal exciton-phonon coupling. The method of thermo-field dynamics handles temperature effects in the Hilbert space with key numerical advantages over other treatments of finite-temperature dynamics based on quantum master equations in the Liouville space or wave function propagation with Monte Carlo importance sampling. While for weak to moderate diagonal coupling temperature increases inhibit polaron mobility, it is found that off-diagonal coupling induces phonon-assisted transport that dominates at high temperatures. Results on the mean square displacements show that band-like transport features dominate the diagonal coupling cases, and there exists a crossover from band-like to hopping transport with increasing temperature when including off-diagonal coupling. As a proof of concept, our theory provides a unified treatment of coherent and incoherent transport in molecular crystals and is applicable to any temperature.
Evaluating base widening methods.
DOT National Transportation Integrated Search
2013-12-01
The surface transportation system forms the biggest infrastructure investment in the United States of which the : roadway pavement forms an integral part. Maintaining the roadways can involve rehabilitation in the form of : widening; which require a ...
Prevention of VOC releases from bridge painting operations.
DOT National Transportation Integrated Search
2007-06-01
Bridge maintenance painting employs solvent-based coatings that generate volatile organic compounds (VOCs) that contribute to air-quality problems. Methods for capturing VOCs during normal Kentucky Transportation Cabinet (KYTC) maintenance painting o...
United States - Japan evaluation tools and methods.
DOT National Transportation Integrated Search
2014-01-01
Cooperative systems based on intelligent transportation system (ITS) technologies can deliver significant benefits for all road users and the public, especially in terms of safer, more energy-efficient, and environmentally friendly surface transporta...
Modeling charge transport in organic photovoltaic materials.
Nelson, Jenny; Kwiatkowski, Joe J; Kirkpatrick, James; Frost, Jarvist M
2009-11-17
The performance of an organic photovoltaic cell depends critically on the mobility of charge carriers within the constituent molecular semiconductor materials. However, a complex combination of phenomena that span a range of length and time scales control charge transport in disordered organic semiconductors. As a result, it is difficult to rationalize charge transport properties in terms of material parameters. Until now, efforts to improve charge mobilities in molecular semiconductors have proceeded largely by trial and error rather than through systematic design. However, recent developments have enabled the first predictive simulation studies of charge transport in disordered organic semiconductors. This Account describes a set of computational methods, specifically molecular modeling methods, to simulate molecular packing, quantum chemical calculations of charge transfer rates, and Monte Carlo simulations of charge transport. Using case studies, we show how this combination of methods can reproduce experimental mobilities with few or no fitting parameters. Although currently applied to material systems of high symmetry or well-defined structure, further developments of this approach could address more complex systems such anisotropic or multicomponent solids and conjugated polymers. Even with an approximate treatment of packing disorder, these computational methods simulate experimental mobilities within an order of magnitude at high electric fields. We can both reproduce the relative values of electron and hole mobility in a conjugated small molecule and rationalize those values based on the symmetry of frontier orbitals. Using fully atomistic molecular dynamics simulations of molecular packing, we can quantitatively replicate vertical charge transport along stacks of discotic liquid crystals which vary only in the structure of their side chains. We can reproduce the trends in mobility with molecular weight for self-organizing polymers using a cheap, coarse-grained structural simulation method. Finally, we quantitatively reproduce the field-effect mobility in disordered C60 films. On the basis of these results, we conclude that all of the necessary building blocks are in place for the predictive simulation of charge transport in macromolecular electronic materials and that such methods can be used as a tool toward the future rational design of functional organic electronic materials.
Development of deterministic transport methods for low energy neutrons for shielding in space
NASA Technical Reports Server (NTRS)
Ganapol, Barry
1993-01-01
Transport of low energy neutrons associated with the galactic cosmic ray cascade is analyzed in this dissertation. A benchmark quality analytical algorithm is demonstrated for use with BRYNTRN, a computer program written by the High Energy Physics Division of NASA Langley Research Center, which is used to design and analyze shielding against the radiation created by the cascade. BRYNTRN uses numerical methods to solve the integral transport equations for baryons with the straight-ahead approximation, and numerical and empirical methods to generate the interaction probabilities. The straight-ahead approximation is adequate for charged particles, but not for neutrons. As NASA Langley improves BRYNTRN to include low energy neutrons, a benchmark quality solution is needed for comparison. The neutron transport algorithm demonstrated in this dissertation uses the closed-form Green's function solution to the galactic cosmic ray cascade transport equations to generate a source of neutrons. A basis function expansion for finite heterogeneous and semi-infinite homogeneous slabs with multiple energy groups and isotropic scattering is used to generate neutron fluxes resulting from the cascade. This method, called the FN method, is used to solve the neutral particle linear Boltzmann transport equation. As a demonstration of the algorithm coded in the programs MGSLAB and MGSEMI, neutron and ion fluxes are shown for a beam of fluorine ions at 1000 MeV per nucleon incident on semi-infinite and finite aluminum slabs. Also, to demonstrate that the shielding effectiveness against the radiation from the galactic cosmic ray cascade is not directly proportional to shield thickness, a graph of transmitted total neutron scalar flux versus slab thickness is shown. A simple model based on the nuclear liquid drop assumption is used to generate cross sections for the galactic cosmic ray cascade. The ENDF/B V database is used to generate the total and scattering cross sections for neutrons in aluminum. As an external verification, the results from MGSLAB and MGSEMI were compared to ANISN/PC, a routinely used neutron transport code, showing excellent agreement. In an application to an aluminum shield, the FN method seems to generate reasonable results.
Real-time hydraulic interval state estimation for water transport networks: a case study
NASA Astrophysics Data System (ADS)
Vrachimis, Stelios G.; Eliades, Demetrios G.; Polycarpou, Marios M.
2018-03-01
Hydraulic state estimation in water distribution networks is the task of estimating water flows and pressures in the pipes and nodes of the network based on some sensor measurements. This requires a model of the network as well as knowledge of demand outflow and tank water levels. Due to modeling and measurement uncertainty, standard state estimation may result in inaccurate hydraulic estimates without any measure of the estimation error. This paper describes a methodology for generating hydraulic state bounding estimates based on interval bounds on the parametric and measurement uncertainties. The estimation error bounds provided by this method can be applied to determine the existence of unaccounted-for water in water distribution networks. As a case study, the method is applied to a modified transport network in Cyprus, using actual data in real time.
Sediment transport simulation in an armoured stream
Milhous, Robert T.; Bradley, Jeffrey B.; Loeffler, Cindy L.
1986-01-01
Improved methods of calculating bed material stability and transport must be developed for a gravel bed stream having an armoured surface in order to use the HEC-6 model to examine channel change. Good possibilities exist for use of a two layer model based on the Schoklitsch and the Einstein-Brown transport equations. In Einstein-Brown the D35 of the armour is used for stabilities and the D50 of the bed (sub-surface) is used for transport. Data on the armour and sub-surface size distribution needs to be obtained as part of a bed material study in a gravel bed river; a "shovel" sample is not adequate. The Meyer-Peter, Muller equation should not be applied to a gravel bed stream with an armoured surface to estimate the initiation of transport or for calculation of transport at low effective bed shear stress.
Three-Dimensional Inverse Transport Solver Based on Compressive Sensing Technique
NASA Astrophysics Data System (ADS)
Cheng, Yuxiong; Wu, Hongchun; Cao, Liangzhi; Zheng, Youqi
2013-09-01
According to the direct exposure measurements from flash radiographic image, a compressive sensing-based method for three-dimensional inverse transport problem is presented. The linear absorption coefficients and interface locations of objects are reconstructed directly at the same time. It is always very expensive to obtain enough measurements. With limited measurements, compressive sensing sparse reconstruction technique orthogonal matching pursuit is applied to obtain the sparse coefficients by solving an optimization problem. A three-dimensional inverse transport solver is developed based on a compressive sensing-based technique. There are three features in this solver: (1) AutoCAD is employed as a geometry preprocessor due to its powerful capacity in graphic. (2) The forward projection matrix rather than Gauss matrix is constructed by the visualization tool generator. (3) Fourier transform and Daubechies wavelet transform are adopted to convert an underdetermined system to a well-posed system in the algorithm. Simulations are performed and numerical results in pseudo-sine absorption problem, two-cube problem and two-cylinder problem when using compressive sensing-based solver agree well with the reference value.
Crack image segmentation based on improved DBC method
NASA Astrophysics Data System (ADS)
Cao, Ting; Yang, Nan; Wang, Fengping; Gao, Ting; Wang, Weixing
2017-11-01
With the development of computer vision technology, crack detection based on digital image segmentation method arouses global attentions among researchers and transportation ministries. Since the crack always exhibits the random shape and complex texture, it is still a challenge to accomplish reliable crack detection results. Therefore, a novel crack image segmentation method based on fractal DBC (differential box counting) is introduced in this paper. The proposed method can estimate every pixel fractal feature based on neighborhood information which can consider the contribution from all possible direction in the related block. The block moves just one pixel every time so that it could cover all the pixels in the crack image. Unlike the classic DBC method which only describes fractal feature for the related region, this novel method can effectively achieve crack image segmentation according to the fractal feature of every pixel. The experiment proves the proposed method can achieve satisfactory results in crack detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chacon, Luis; del-Castillo-Negrete, Diego; Hauck, Cory D.
2014-09-01
We propose a Lagrangian numerical algorithm for a time-dependent, anisotropic temperature transport equation in magnetized plasmas in the large guide field regime. The approach is based on an analytical integral formal solution of the parallel (i.e., along the magnetic field) transport equation with sources, and it is able to accommodate both local and non-local parallel heat flux closures. The numerical implementation is based on an operator-split formulation, with two straightforward steps: a perpendicular transport step (including sources), and a Lagrangian (field-line integral) parallel transport step. Algorithmically, the first step is amenable to the use of modern iterative methods, while themore » second step has a fixed cost per degree of freedom (and is therefore scalable). Accuracy-wise, the approach is free from the numerical pollution introduced by the discrete parallel transport term when the perpendicular to parallel transport coefficient ratio X ⊥ /X ∥ becomes arbitrarily small, and is shown to capture the correct limiting solution when ε = X⊥L 2 ∥/X1L 2 ⊥ → 0 (with L∥∙ L⊥ , the parallel and perpendicular diffusion length scales, respectively). Therefore, the approach is asymptotic-preserving. We demonstrate the capabilities of the scheme with several numerical experiments with varying magnetic field complexity in two dimensions, including the case of transport across a magnetic island.« less
NASA Astrophysics Data System (ADS)
Maksyutov, Shamil; Takagi, Hiroshi; Belikov, Dmitry A.; Saeki, Tazu; Zhuravlev, Ruslan; Ganshin, Alexander; Lukyanov, Alexander; Yoshida, Yukio; Oshchepkov, Sergey; Bril, Andrey; Saito, Makoto; Oda, Tomohiro; Valsala, Vinu K.; Saito, Ryu; Andres, Robert J.; Conway, Thomas; Tans, Pieter; Yokota, Tatsuya
2012-11-01
Inverse estimation of surface C02 fluxes is performed with atmospheric transport model using ground-based and GOSAT observations. The NIES-retrieved C02 column mixing (Xc02) and column averaging kernel are provided by GOSAT Level 2 product v. 2.0 and PPDF-DOAS method. Monthly mean C02 fluxes for 64 regions are estimated together with a global mean offset between GOSAT data and ground-based data. We used the fixed-lag Kalman filter to infer monthly fluxes for 42 sub-continental terrestrial regions and 22 oceanic basins. We estimate fluxes and compare results obtained by two inverse modeling approaches. In basic approach adopted in GOSAT Level4 product v. 2.01, we use aggregation of the GOSAT observations into monthly mean over 5x5 degree grids, fluxes are estimated independently for each region, and NIES atmospheric transport model is used for forward simulation. In the alternative method, the model-observation misfit is estimated for each observation separately and fluxes are spatially correlated using EOF analysis of the simulated flux variability similar to geostatistical approach, while transport simulation is enhanced by coupling with a Lagrangian transport model Flexpart. Both methods use using the same set of prior fluxes and region maps. Daily net ecosystem exchange (NEE) is predicted by the Vegetation Integrative Simulator for Trace gases (VISIT) optimized to match seasonal cycle of the atmospheric C02 . Monthly ocean-atmosphere C02 fluxes are produced with an ocean pC02 data assimilation system. Biomass burning fluxes were provided by the Global Fire Emissions Database (GFED); and monthly fossil fuel C02 emissions are estimated with ODIAC inventory. The results of analyzing one year of the GOSAT data suggest that when both GOSAT and ground-based data are used together, fluxes in tropical and other remote regions with lower associated uncertainties are obtained than in the analysis using only ground-based data. With version 2.0 of L2 Xc02 the fluxes appear reasonable for many regions and seasons, however there is a need for improving the L2 bias correction, data filtering and the inverse modeling method to reduce estimated flux anomalies visible in some areas. We also observe that application of spatial flux correlations with EOF based approach reduces flux anomalies.
Forecasting the Short-Term Passenger Flow on High-Speed Railway with Neural Networks
Xie, Mei-Quan; Li, Xia-Miao; Zhou, Wen-Liang; Fu, Yan-Bing
2014-01-01
Short-term passenger flow forecasting is an important component of transportation systems. The forecasting result can be applied to support transportation system operation and management such as operation planning and revenue management. In this paper, a divide-and-conquer method based on neural network and origin-destination (OD) matrix estimation is developed to forecast the short-term passenger flow in high-speed railway system. There are three steps in the forecasting method. Firstly, the numbers of passengers who arrive at each station or depart from each station are obtained from historical passenger flow data, which are OD matrices in this paper. Secondly, short-term passenger flow forecasting of the numbers of passengers who arrive at each station or depart from each station based on neural network is realized. At last, the OD matrices in short-term time are obtained with an OD matrix estimation method. The experimental results indicate that the proposed divide-and-conquer method performs well in forecasting the short-term passenger flow on high-speed railway. PMID:25544838
NASA Astrophysics Data System (ADS)
Zhang, Wenyu; Yang, Yushu; Zhang, Shuai; Yu, Dejian; Chen, Yong
2018-05-01
With the growing complexity of customer requirements and the increasing scale of manufacturing services, how to select and combine the single services to meet the complex demand of the customer has become a growing concern. This paper presents a new manufacturing service composition method to solve the multi-objective optimization problem based on quality of service (QoS). The proposed model not only presents different methods for calculating the transportation time and transportation cost under various structures but also solves the three-dimensional composition optimization problem, including service aggregation, service selection, and service scheduling simultaneously. Further, an improved Flower Pollination Algorithm (IFPA) is proposed to solve the three-dimensional composition optimization problem using a matrix-based representation scheme. The mutation operator and crossover operator of the Differential Evolution (DE) algorithm are also used to extend the basic Flower Pollination Algorithm (FPA) to improve its performance. Compared to Genetic Algorithm, DE, and basic FPA, the experimental results confirm that the proposed method demonstrates superior performance than other meta heuristic algorithms and can obtain better manufacturing service composition solutions.
Multigrid optimal mass transport for image registration and morphing
NASA Astrophysics Data System (ADS)
Rehman, Tauseef ur; Tannenbaum, Allen
2007-02-01
In this paper we present a computationally efficient Optimal Mass Transport algorithm. This method is based on the Monge-Kantorovich theory and is used for computing elastic registration and warping maps in image registration and morphing applications. This is a parameter free method which utilizes all of the grayscale data in an image pair in a symmetric fashion. No landmarks need to be specified for correspondence. In our work, we demonstrate significant improvement in computation time when our algorithm is applied as compared to the originally proposed method by Haker et al [1]. The original algorithm was based on a gradient descent method for removing the curl from an initial mass preserving map regarded as 2D vector field. This involves inverting the Laplacian in each iteration which is now computed using full multigrid technique resulting in an improvement in computational time by a factor of two. Greater improvement is achieved by decimating the curl in a multi-resolutional framework. The algorithm was applied to 2D short axis cardiac MRI images and brain MRI images for testing and comparison.
Kokkonen, H T; Chin, H C; Töyräs, J; Jurvelin, J S; Quinn, T M
2017-04-01
Solute transport through the extracellular matrix (ECM) is crucial to chondrocyte metabolism. Cartilage injury affects solute transport in cartilage due to alterations in ECM structure and solute-matrix interactions. Therefore, cartilage injury may be detected by using contrast agent-based clinical imaging. In the present study, effects of mechanical injury on transport of negatively charged contrast agents in cartilage were characterized. Using cartilage plugs injured by mechanical compression protocol, effective partition coefficients and diffusion fluxes of iodine- and gadolinium-based contrast agents were measured using high resolution microCT imaging. For all contrast agents studied, effective diffusion fluxes increased significantly, particularly at early times during the diffusion process (38 and 33% increase after 4 min, P < 0.05 for iodine and Gd-DTPA; and 76% increase after 10 min for diatrizoate, P < 0.05). Effective partition coefficients were unaffected in mechanically injured cartilage. Mechanical injury reduced PG content and collagen integrity in cartilage superficial zone. This study suggests that alterations in contrast agent diffusion flux, a non-equilibrium transport parameter, provides a more sensitive indicator for assessment of cartilage matrix integrity than partition coefficient and the equilibrium distribution of solute. These findings may help in developing clinical methods of contrast agent-based imaging to detect cartilage injury.
NASA Astrophysics Data System (ADS)
Jardin, A.; Mazon, D.; Malard, P.; O'Mullane, M.; Chernyshova, M.; Czarski, T.; Malinowski, K.; Kasprowicz, G.; Wojenski, A.; Pozniak, K.
2017-08-01
The tokamak WEST aims at testing ITER divertor high heat flux component technology in long pulse operation. Unfortunately, heavy impurities like tungsten (W) sputtered from the plasma facing components can pollute the plasma core by radiation cooling in the soft x-ray (SXR) range, which is detrimental for the energy confinement and plasma stability. SXR diagnostics give valuable information to monitor impurities and study their transport. The WEST SXR diagnostic is composed of two new cameras based on the Gas Electron Multiplier (GEM) technology. The WEST GEM cameras will be used for impurity transport studies by performing 2D tomographic reconstructions with spectral resolution in tunable energy bands. In this paper, we characterize the GEM spectral response and investigate W density reconstruction thanks to a synthetic diagnostic recently developed and coupled with a tomography algorithm based on the minimum Fisher information (MFI) inversion method. The synthetic diagnostic includes the SXR source from a given plasma scenario, the photoionization, electron cloud transport and avalanche in the detection volume using Magboltz, and tomographic reconstruction of the radiation from the GEM signal. Preliminary studies of the effect of transport on the W ionization equilibrium and on the reconstruction capabilities are also presented.
NASA Astrophysics Data System (ADS)
Hoy, Erik P.; Mazziotti, David A.; Seideman, Tamar
2017-11-01
Can an electronic device be constructed using only a single molecule? Since this question was first asked by Aviram and Ratner in the 1970s [Chem. Phys. Lett. 29, 277 (1974)], the field of molecular electronics has exploded with significant experimental advancements in the understanding of the charge transport properties of single molecule devices. Efforts to explain the results of these experiments and identify promising new candidate molecules for molecular devices have led to the development of numerous new theoretical methods including the current standard theoretical approach for studying single molecule charge transport, i.e., the non-equilibrium Green's function formalism (NEGF). By pairing this formalism with density functional theory (DFT), a wide variety of transport problems in molecular junctions have been successfully treated. For some systems though, the conductance and current-voltage curves predicted by common DFT functionals can be several orders of magnitude above experimental results. In addition, since density functional theory relies on approximations to the exact exchange-correlation functional, the predicted transport properties can show significant variation depending on the functional chosen. As a first step to addressing this issue, the authors have replaced density functional theory in the NEGF formalism with a 2-electron reduced density matrix (2-RDM) method, creating a new approach known as the NEGF-RDM method. 2-RDM methods provide a more accurate description of electron correlation compared to density functional theory, and they have lower computational scaling compared to wavefunction based methods of similar accuracy. Additionally, 2-RDM methods are capable of capturing static electron correlation which is untreatable by existing NEGF-DFT methods. When studying dithiol alkane chains and dithiol benzene in model junctions, the authors found that the NEGF-RDM predicts conductances and currents that are 1-2 orders of magnitude below those of B3LYP and M06 DFT functionals. This suggests that the NEGF-RDM method could be a viable alternative to NEGF-DFT for molecular junction calculations.
Capillary photoelectrode structures for photoelectrochemical and photocatalytic cells
Wang, Xudong; Li, Zhaodong; Cai, Zhiyong; Yao, Chunhua
2017-05-02
Photocatalytic structures having a capillary-force based electrolyte delivery system are provided. Also provided are photoelectrochemical and photocatalytic cells incorporating the structures and methods for using the cells to generate hydrogen and/or oxygen from water. The photocatalytic structures use an electrolyte-transporting strip comprising a porous network of cellulose nanofibers to transport electrolyte from a body of the electrolyte to a porous photoelectrode or a porous photocatalytic substrate via capillary force.
Optimal control of thermally coupled Navier Stokes equations
NASA Technical Reports Server (NTRS)
Ito, Kazufumi; Scroggs, Jeffrey S.; Tran, Hien T.
1994-01-01
The optimal boundary temperature control of the stationary thermally coupled incompressible Navier-Stokes equation is considered. Well-posedness and existence of the optimal control and a necessary optimality condition are obtained. Optimization algorithms based on the augmented Lagrangian method with second order update are discussed. A test example motivated by control of transport process in the high pressure vapor transport (HVPT) reactor is presented to demonstrate the applicability of our theoretical results and proposed algorithm.
NASA Astrophysics Data System (ADS)
Brereton, Carol A.; Joynes, Ian M.; Campbell, Lucy J.; Johnson, Matthew R.
2018-05-01
Fugitive emissions are important sources of greenhouse gases and lost product in the energy sector that can be difficult to detect, but are often easily mitigated once they are known, located, and quantified. In this paper, a scalar transport adjoint-based optimization method is presented to locate and quantify unknown emission sources from downstream measurements. This emission characterization approach correctly predicted locations to within 5 m and magnitudes to within 13% of experimental release data from Project Prairie Grass. The method was further demonstrated on simulated simultaneous releases in a complex 3-D geometry based on an Alberta gas plant. Reconstructions were performed using both the complex 3-D transient wind field used to generate the simulated release data and using a sequential series of steady-state RANS wind simulations (SSWS) representing 30 s intervals of physical time. Both the detailed transient and the simplified wind field series could be used to correctly locate major sources and predict their emission rates within 10%, while predicting total emission rates from all sources within 24%. This SSWS case would be much easier to implement in a real-world application, and gives rise to the possibility of developing pre-computed databases of both wind and scalar transport adjoints to reduce computational time.
Bergstrom, Paul M.; Daly, Thomas P.; Moses, Edward I.; Patterson, Jr., Ralph W.; Schach von Wittenau, Alexis E.; Garrett, Dewey N.; House, Ronald K.; Hartmann-Siantar, Christine L.; Cox, Lawrence J.; Fujino, Donald H.
2000-01-01
A system and method is disclosed for radiation dose calculation within sub-volumes of a particle transport grid. In a first step of the method voxel volumes enclosing a first portion of the target mass are received. A second step in the method defines dosel volumes which enclose a second portion of the target mass and overlap the first portion. A third step in the method calculates common volumes between the dosel volumes and the voxel volumes. A fourth step in the method identifies locations in the target mass of energy deposits. And, a fifth step in the method calculates radiation doses received by the target mass within the dosel volumes. A common volume calculation module inputs voxel volumes enclosing a first portion of the target mass, inputs voxel mass densities corresponding to a density of the target mass within each of the voxel volumes, defines dosel volumes which enclose a second portion of the target mass and overlap the first portion, and calculates common volumes between the dosel volumes and the voxel volumes. A dosel mass module, multiplies the common volumes by corresponding voxel mass densities to obtain incremental dosel masses, and adds the incremental dosel masses corresponding to the dosel volumes to obtain dosel masses. A radiation transport module identifies locations in the target mass of energy deposits. And, a dose calculation module, coupled to the common volume calculation module and the radiation transport module, for calculating radiation doses received by the target mass within the dosel volumes.
Khruschev, S S; Abaturova, A M; Diakonova, A N; Fedorov, V A; Ustinin, D M; Kovalenko, I B; Riznichenko, G Yu; Rubin, A B
2015-01-01
The application of Brownian dynamics for simulation of transient protein-protein interactions is reviewed. The review focuses on theoretical basics of Brownian dynamics method, its particular implementations, advantages and drawbacks of the method. The outlook for future development of Brownian dynamics-based simulation techniques is discussed. Special attention is given to analysis of Brownian dynamics trajectories. The second part of the review is dedicated to the role of Brownian dynamics simulations in studying photosynthetic electron transport. Interactions of mobile electron carriers (plastocyanin, cytochrome c6, and ferredoxin) with their reaction partners (cytochrome b6f complex, photosystem I, ferredoxin:NADP-reductase, and hydrogenase) are considered.
NASA Astrophysics Data System (ADS)
Yin, Qiang; Chen, Tian-jin; Li, Wei-yang; Xiong, Ze-cheng; Ma, Rui
2017-09-01
In order to obtain the deformation map and equivalent stress distribution of rectifier cabinet for nuclear power generating stations, the quality distribution of structure and electrical are described, the tensile bond strengths of the rings are checked, and the finite element model of cabinet is set up by ANSYS. The transport conditions of the hoisting state and fork loading state are analyzed. The deformation map and equivalent stress distribution are obtained. The attentive problems are put forward. It is a reference for analysis method and the obtained results for the transport of rectifier cabinet for nuclear power generating stations.
Garcia, F; Arruda-Neto, J D; Manso, M V; Helene, O M; Vanin, V R; Rodriguez, O; Mesa, J; Likhachev, V P; Filho, J W; Deppman, A; Perez, G; Guzman, F; de Camargo, S P
1999-10-01
A new and simple statistical procedure (STATFLUX) for the calculation of transfer coefficients of radionuclide transport to animals and plants is proposed. The method is based on the general multiple-compartment model, which uses a system of linear equations involving geometrical volume considerations. By using experimentally available curves of radionuclide concentrations versus time, for each animal compartment (organs), flow parameters were estimated by employing a least-squares procedure, whose consistency is tested. Some numerical results are presented in order to compare the STATFLUX transfer coefficients with those from other works and experimental data.
Aungkulanon, Pasura; Luangpaiboon, Pongchanun
2016-01-01
Response surface methods via the first or second order models are important in manufacturing processes. This study, however, proposes different structured mechanisms of the vertical transportation systems or VTS embedded on a shuffled frog leaping-based approach. There are three VTS scenarios, a motion reaching a normal operating velocity, and both reaching and not reaching transitional motion. These variants were performed to simultaneously inspect multiple responses affected by machining parameters in multi-pass turning processes. The numerical results of two machining optimisation problems demonstrated the high performance measures of the proposed methods, when compared to other optimisation algorithms for an actual deep cut design.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Lei; Zuo, Chao; Idir, Mourad
A novel transport-of-intensity equation (TIE) based phase retrieval method is proposed with putting an arbitrarily-shaped aperture into the optical wavefield. In this arbitrarily-shaped aperture, the TIE can be solved under non-uniform illuminations and even non-homogeneous boundary conditions by iterative discrete cosine transforms with a phase compensation mechanism. Simulation with arbitrary phase, arbitrary aperture shape, and non-uniform intensity distribution verifies the effective compensation and high accuracy of the proposed method. Experiment is also carried out to check the feasibility of the proposed method in real measurement. Comparing to the existing methods, the proposed method is applicable for any types of phasemore » distribution under non-uniform illumination and non-homogeneous boundary conditions within an arbitrarily-shaped aperture, which enables the technique of TIE with hard aperture become a more flexible phase retrieval tool in practical measurements.« less
Huang, Lei; Zuo, Chao; Idir, Mourad; ...
2015-04-21
A novel transport-of-intensity equation (TIE) based phase retrieval method is proposed with putting an arbitrarily-shaped aperture into the optical wavefield. In this arbitrarily-shaped aperture, the TIE can be solved under non-uniform illuminations and even non-homogeneous boundary conditions by iterative discrete cosine transforms with a phase compensation mechanism. Simulation with arbitrary phase, arbitrary aperture shape, and non-uniform intensity distribution verifies the effective compensation and high accuracy of the proposed method. Experiment is also carried out to check the feasibility of the proposed method in real measurement. Comparing to the existing methods, the proposed method is applicable for any types of phasemore » distribution under non-uniform illumination and non-homogeneous boundary conditions within an arbitrarily-shaped aperture, which enables the technique of TIE with hard aperture become a more flexible phase retrieval tool in practical measurements.« less
Walter, Donald A.
2008-01-01
The unconsolidated glacial sediments underlying Cape Cod, Massachusetts compose a regional aquifer system that is used both as a source of drinking water and as a disposal site for wastewater; in addition, the discharge of clean ground water from the aquifer system is needed for the maintenance of freshwater and marine ecosystems throughout the region. Because these uses of the aquifer conflict with one another in many areas of the Cape, local and regional planners have begun to develop sustainable wastewater plans that will facilitate the disposal of wastewater while protecting water supplies and improving the health of aquatic ecosystems. To assist local and regional planners in these efforts, the U.S. Geological Survey conducted a 2-year investigation to (1) assist local and regional planners in the evaluation of potential wastewater scenarios, (2) use results and interpretation from these analyses to develop hydrologic concepts transferable throughout the region, and (3) establish and test methods that would be of use in future evaluations. Wastewater-disposal scenarios need to be evaluated in the context of the regional ground-water-flow system. For a given rate of disposal, wastewater from sites at or near a regional ground-water divide is transported in a wider arc of flow directions, flows deeper in the system, and contaminates a larger part of the aquifer than does wastewater discharged from sites farther from the divide. Also, traveltimes of wastewater from sites near a ground-water divide to receptors are longer (as much as several hundred years) than traveltimes from sites farther from the divide. Thus, wastewater disposal at or near a divide will affect a larger part of the aquifer and likely contribute wastewater to more receptors than wastewater disposal farther from a divide; however, longer traveltimes could allow for more attenuation of wastewater-derived nitrate from those sites. Ground-water-flow models and particle tracking can be used to identify advective-transport patterns downgradient from wastewater-disposal sites and estimate traveltimes; however, these tools cannot predict the distribution of mass or concentrations of wastewater constituents, such as nitrate, in the aquifer. Flow-based particle-tracking analyses can be used to estimate mass-loading rates and time-varying concentrations at wells and ecological receptors by the accounting of mass-weighted particles discharging into the receptor of interest. This method requires no additional development beyond the flow model; however, post-modeling analyses are required. In addition, the method is based on the assumption that no mass is lost during transport, an assumption that likely is not valid in many systems. Solute-transport models simulate the subsurface transport of nitrate through the aquifer and predict the distribution of the mass of a solute in the aquifer at different transport times. This method does require additional model development beyond the flow model, but can predict timevarying concentrations at receptors. Estimates of mass-loading rates require minimal post-modeling analyses. Time-varying concentrations and mass-loading rates calculated for wells in eastern Barnstable by the two methods generally were in reasonable agreement. Inherent in the flow-based particle-tracking method is the assumption that mass is conserved along a given flow line and that there is no spreading of mass in the aquifer. Although the solute-transport models also incorporate a system-wide conservation of mass, these models allow for a spreading of mass in the aquifer, and mass is not conserved along a given flow line. As a result, estimates of concentrations and mass loading rates generally were higher in particle-tracking analyses than in solute-transport simulations. Results from the two types of simulations agreed best for wells that receive large amounts of wastewater with short traveltimes (less than 10 years) because insufficient transport
Visualizing Mobility of Public Transportation System.
Zeng, Wei; Fu, Chi-Wing; Arisona, Stefan Müller; Erath, Alexander; Qu, Huamin
2014-12-01
Public transportation systems (PTSs) play an important role in modern cities, providing shared/massive transportation services that are essential for the general public. However, due to their increasing complexity, designing effective methods to visualize and explore PTS is highly challenging. Most existing techniques employ network visualization methods and focus on showing the network topology across stops while ignoring various mobility-related factors such as riding time, transfer time, waiting time, and round-the-clock patterns. This work aims to visualize and explore passenger mobility in a PTS with a family of analytical tasks based on inputs from transportation researchers. After exploring different design alternatives, we come up with an integrated solution with three visualization modules: isochrone map view for geographical information, isotime flow map view for effective temporal information comparison and manipulation, and OD-pair journey view for detailed visual analysis of mobility factors along routes between specific origin-destination pairs. The isotime flow map linearizes a flow map into a parallel isoline representation, maximizing the visualization of mobility information along the horizontal time axis while presenting clear and smooth pathways from origin to destinations. Moreover, we devise several interactive visual query methods for users to easily explore the dynamics of PTS mobility over space and time. Lastly, we also construct a PTS mobility model from millions of real passenger trajectories, and evaluate our visualization techniques with assorted case studies with the transportation researchers.
Parallel heat transport in integrable and chaotic magnetic fields
DOE Office of Scientific and Technical Information (OSTI.GOV)
Del-Castillo-Negrete, Diego B; Chacon, Luis
2012-01-01
The study of transport in magnetized plasmas is a problem of fundamental interest in controlled fusion, space plasmas, and astrophysics research. Three issues make this problem particularly chal- lenging: (i) The extreme anisotropy between the parallel (i.e., along the magnetic field), , and the perpendicular, , conductivities ( / may exceed 1010 in fusion plasmas); (ii) Magnetic field lines chaos which in general complicates (and may preclude) the construction of magnetic field line coordinates; and (iii) Nonlocal parallel transport in the limit of small collisionality. Motivated by these issues, we present a Lagrangian Green s function method to solve themore » local and non-local parallel transport equation applicable to integrable and chaotic magnetic fields in arbitrary geom- etry. The method avoids by construction the numerical pollution issues of grid-based algorithms. The potential of the approach is demonstrated with nontrivial applications to integrable (magnetic island chain), weakly chaotic (devil s staircase), and fully chaotic magnetic field configurations. For the latter, numerical solutions of the parallel heat transport equation show that the effective radial transport, with local and non-local closures, is non-diffusive, thus casting doubts on the appropriateness of the applicability of quasilinear diffusion descriptions. General conditions for the existence of non-diffusive, multivalued flux-gradient relations in the temperature evolution are derived.« less
Automatic background updating for video-based vehicle detection
NASA Astrophysics Data System (ADS)
Hu, Chunhai; Li, Dongmei; Liu, Jichuan
2008-03-01
Video-based vehicle detection is one of the most valuable techniques for the Intelligent Transportation System (ITS). The widely used video-based vehicle detection technique is the background subtraction method. The key problem of this method is how to subtract and update the background effectively. In this paper an efficient background updating scheme based on Zone-Distribution for vehicle detection is proposed to resolve the problems caused by sudden camera perturbation, sudden or gradual illumination change and the sleeping person problem. The proposed scheme is robust and fast enough to satisfy the real-time constraints of vehicle detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santi, A.; Piacentini, G.; Zanichelli, M.
2014-05-12
A method for reconstructing the spatial profile of the electric field along the thickness of a generic bulk solid-state photodetector is proposed. Furthermore, the mobility and lifetime of both electrons and holes can be evaluated contextually. The method is based on a procedure of minimization built up from current transient profiles induced by laser pulses in a planar detector at different applied voltages. The procedure was tested in CdTe planar detectors for X- and Gamma rays. The devices were measured in a single-carrier transport configuration by impinging laser light on the sample cathode. This method could be suitable for manymore » other devices provided that they are made of materials with sufficiently high resistivity, i.e., with a sufficiently low density of intrinsic carriers.« less
Meng, Xin; Huang, Huachuan; Yan, Keding; Tian, Xiaolin; Yu, Wei; Cui, Haoyang; Kong, Yan; Xue, Liang; Liu, Cheng; Wang, Shouyu
2016-12-20
In order to realize high contrast imaging with portable devices for potential mobile healthcare, we demonstrate a hand-held smartphone based quantitative phase microscope using the transport of intensity equation method. With a cost-effective illumination source and compact microscope system, multi-focal images of samples can be captured by the smartphone's camera via manual focusing. Phase retrieval is performed using a self-developed Android application, which calculates sample phases from multi-plane intensities via solving the Poisson equation. We test the portable microscope using a random phase plate with known phases, and to further demonstrate its performance, a red blood cell smear, a Pap smear and monocot root and broad bean epidermis sections are also successfully imaged. Considering its advantages as an accurate, high-contrast, cost-effective and field-portable device, the smartphone based hand-held quantitative phase microscope is a promising tool which can be adopted in the future in remote healthcare and medical diagnosis.
[Welding arc temperature field measurements based on Boltzmann spectrometry].
Si, Hong; Hua, Xue-Ming; Zhang, Wang; Li, Fang; Xiao, Xiao
2012-09-01
Arc plasma, as non-uniform plasma, has complicated energy and mass transport processes in its internal, so plasma temperature measurement is of great significance. Compared with absolute spectral line intensity method and standard temperature method, Boltzmann plot measuring is more accurate and convenient. Based on the Boltzmann theory, the present paper calculates the temperature distribution of the plasma and analyzes the principle of lines selection by real time scanning the space of the TIG are measurements.
Charge Redistribution from Anomalous Magnetovorticity Coupling
Hattori, Koichi; Yin, Yi
2016-10-05
Here, we investigate novel transport phenomena in a chiral fluid originated from an interplay between a vorticity and strong magnetic field, which induces a redistribution of vector charges in the system and an axial current along the magnetic field. The corresponding transport coefficients are obtained from an energy-shift argument for the chiral fermions in the lowest Landau level due to a spin-vorticity coupling and also from diagrammatic computations on the basis of the linear response theory. Based on consistent results from both methods, we also observe that the transport coefficients are proportional to the anomaly coefficient and are independent ofmore » temperature and chemical potential. Finally, we speculate that these transport phenomena are connected to quantum anomaly.« less
NASA Astrophysics Data System (ADS)
Jensen, Kaare H.; Beecher, Sierra; Holbrook, N. Michele; Knoblauch, Michael
2014-11-01
Many biological systems use complex networks of vascular conduits to distribute energy over great distances. Examples include sugar transport in the phloem tissue of vascular plants and cytoplasmic streaming in some slime molds. Detailed knowledge of transport patterns in these systems is important for our fundamental understanding of energy distribution during development and for engineering of more efficient crops. Current techniques for quantifying transport in these microfluidic systems, however, only allow for the determination of either the flow speed or the concentration of material. Here we demonstrate a new method, based on confocal microscopy, which allows us to simultaneously determine velocity and solute concentration by tracking the dispersion of a tracer dye. We attempt to rationalize the observed transport patterns through consideration of constrained optimization problems.
Fate of Volatile Organic Compounds in Constructed Wastewater Treatment Wetlands
Keefe, S.H.; Barber, L.B.; Runkel, R.L.; Ryan, J.N.
2004-01-01
The fate of volatile organic compounds was evaluated in a wastewater-dependent constructed wetland near Phoenix, AZ, using field measurements and solute transport modeling. Numerically based volatilization rates were determined using inverse modeling techniques and hydraulic parameters established by sodium bromide tracer experiments. Theoretical volatilization rates were calculated from the two-film method incorporating physicochemical properties and environmental conditions. Additional analyses were conducted using graphically determined volatilization rates based on field measurements. Transport (with first-order removal) simulations were performed using a range of volatilization rates and were evaluated with respect to field concentrations. The inverse and two-film reactive transport simulations demonstrated excellent agreement with measured concentrations for 1,4-dichlorobenzene, tetrachloroethene, dichloromethane, and trichloromethane and fair agreement for dibromochloromethane, bromo-dichloromethane, and toluene. Wetland removal efficiencies from inlet to outlet ranged from 63% to 87% for target compounds.
NASA Astrophysics Data System (ADS)
Bidwell, Colin S.
2015-05-01
A method for calculating particle transport through turbo-machinery using the mixing plane analogy was developed and used to analyze the energy efficient engine . This method allows the prediction of temperature and phase change of water based particles along their path and the impingement efficiency and particle impact property data on various components in the engine. This methodology was incorporated into the LEWICE3D V3.5 software. The method was used to predict particle transport in the low pressure compressor of the . The was developed by NASA and GE in the early 1980s as a technology demonstrator and is representative of a modern high bypass turbofan engine. The flow field was calculated using the NASA Glenn ADPAC turbo-machinery flow solver. Computations were performed for a Mach 0.8 cruise condition at 11,887 m assuming a standard warm day for ice particle sizes of 5, 20 and 100 microns and a free stream particle concentration of . The impingement efficiency results showed that as particle size increased average impingement efficiencies and scoop factors increased for the various components. The particle analysis also showed that the amount of mass entering the inner core decreased with increased particle size because the larger particles were less able to negotiate the turn into the inner core due to particle inertia. The particle phase change analysis results showed that the larger particles warmed less as they were transported through the low pressure compressor. Only the smallest 5 micron particles were warmed enough to produce melting with a maximum average melting fraction of 0.18. The results also showed an appreciable amount of particle sublimation and evaporation for the 5 micron particles entering the engine core (22.6 %).
Kishikawa, Naoya
2010-10-01
Quinones are compounds that have various characteristics such as a biological electron transporter, an industrial product and a harmful environmental pollutant. Therefore, an effective determination method for quinones is required in many fields. This review describes the development of sensitive and selective determination methods for quinones based on some detection principles and their application to analyses in environmental, pharmaceutical and biological samples. Firstly, a fluorescence method was developed based on fluorogenic derivatization of quinones and applied to environmental analysis. Secondly, a luminol chemiluminescence method was developed based on generation of reactive oxygen species through the redox cycle of quinone and applied to pharmaceutical analysis. Thirdly, a photo-induced chemiluminescence method was developed based on formation of reactive oxygen species and fluorophore or chemiluminescence enhancer by the photoreaction of quinones and applied to biological and environmental analyses.
Centler, Florian; Heße, Falk; Thullner, Martin
2013-09-01
At field sites with varying redox conditions, different redox-specific microbial degradation pathways contribute to total contaminant degradation. The identification of pathway-specific contributions to total contaminant removal is of high practical relevance, yet difficult to achieve with current methods. Current stable-isotope-fractionation-based techniques focus on the identification of dominant biodegradation pathways under constant environmental conditions. We present an approach based on dual stable isotope data to estimate the individual contributions of two redox-specific pathways. We apply this approach to carbon and hydrogen isotope data obtained from reactive transport simulations of an organic contaminant plume in a two-dimensional aquifer cross section to test the applicability of the method. To take aspects typically encountered at field sites into account, additional simulations addressed the effects of transverse mixing, diffusion-induced stable-isotope fractionation, heterogeneities in the flow field, and mixing in sampling wells on isotope-based estimates for aerobic and anaerobic pathway contributions to total contaminant biodegradation. Results confirm the general applicability of the presented estimation method which is most accurate along the plume core and less accurate towards the fringe where flow paths receive contaminant mass and associated isotope signatures from the core by transverse dispersion. The presented method complements the stable-isotope-fractionation-based analysis toolbox. At field sites with varying redox conditions, it provides a means to identify the relative importance of individual, redox-specific degradation pathways. © 2013.
NASA Technical Reports Server (NTRS)
1986-01-01
The findings of a study on the feasibility of several methods of providing electrical power for a permanently manned lunar base are provided. Two fundamentally different methods for lunar electrical power generation are considered. One is the use of a small nuclear reactor and the other is the conversion of solar energy to electricity. The baseline goal was to initially provide 300 kW of power with growth capability to one megawatt and eventually to 10 megawatts. A detailed, day by day scenario for the establishment, build-up, and operational activity of the lunar base is presented. Also presented is a conceptual approach to a supporting transportation system which identifies the number, type, and deployment of transportation vehicles required to support the base. An approach to the use of solar cells in the lunar environment was developed. There are a number of heat engines which are applicable to solar/electric conversions, and these are examined. Several approaches to energy storage which were used by the electric power utilities were examined and those which could be used at a lunar base were identified.
Carreón, Gustavo; Gershenson, Carlos; Pineda, Luis A
2017-01-01
The equal headway instability-the fact that a configuration with regular time intervals between vehicles tends to be volatile-is a common regulation problem in public transportation systems. An unsatisfactory regulation results in low efficiency and possible collapses of the service. Computational simulations have shown that self-organizing methods can regulate the headway adaptively beyond the theoretical optimum. In this work, we develop a computer simulation for metro systems fed with real data from the Mexico City Metro to test the current regulatory method with a novel self-organizing approach. The current model considers overall system's data such as minimum and maximum waiting times at stations, while the self-organizing method regulates the headway in a decentralized manner using local information such as the passenger's inflow and the positions of neighboring trains. The simulation shows that the self-organizing method improves the performance over the current one as it adapts to environmental changes at the timescale they occur. The correlation between the simulation of the current model and empirical observations carried out in the Mexico City Metro provides a base to calculate the expected performance of the self-organizing method in case it is implemented in the real system. We also performed a pilot study at the Balderas station to regulate the alighting and boarding of passengers through guide signs on platforms. The analysis of empirical data shows a delay reduction of the waiting time of trains at stations. Finally, we provide recommendations to improve public transportation systems.
Gershenson, Carlos; Pineda, Luis A.
2017-01-01
The equal headway instability—the fact that a configuration with regular time intervals between vehicles tends to be volatile—is a common regulation problem in public transportation systems. An unsatisfactory regulation results in low efficiency and possible collapses of the service. Computational simulations have shown that self-organizing methods can regulate the headway adaptively beyond the theoretical optimum. In this work, we develop a computer simulation for metro systems fed with real data from the Mexico City Metro to test the current regulatory method with a novel self-organizing approach. The current model considers overall system’s data such as minimum and maximum waiting times at stations, while the self-organizing method regulates the headway in a decentralized manner using local information such as the passenger’s inflow and the positions of neighboring trains. The simulation shows that the self-organizing method improves the performance over the current one as it adapts to environmental changes at the timescale they occur. The correlation between the simulation of the current model and empirical observations carried out in the Mexico City Metro provides a base to calculate the expected performance of the self-organizing method in case it is implemented in the real system. We also performed a pilot study at the Balderas station to regulate the alighting and boarding of passengers through guide signs on platforms. The analysis of empirical data shows a delay reduction of the waiting time of trains at stations. Finally, we provide recommendations to improve public transportation systems. PMID:29287120
Clémençon, Benjamin; Lüscher, Benjamin P.; Fine, Michael; Baumann, Marc U.; Surbek, Daniel V.; Bonny, Olivier; Hediger, Matthias A.
2014-01-01
The urate transporter, GLUT9, is responsible for the basolateral transport of urate in the proximal tubule of human kidneys and in the placenta, playing a central role in uric acid homeostasis. GLUT9 shares the least homology with other members of the glucose transporter family, especially with the glucose transporting members GLUT1-4 and is the only member of the GLUT family to transport urate. The recently published high-resolution structure of XylE, a bacterial D-xylose transporting homologue, yields new insights into the structural foundation of this GLUT family of proteins. While this represents a huge milestone, it is unclear if human GLUT9 can benefit from this advancement through subsequent structural based targeting and mutagenesis. Little progress has been made toward understanding the mechanism of GLUT9 since its discovery in 2000. Before work can begin on resolving the mechanisms of urate transport we must determine methods to express, purify and analyze hGLUT9 using a model system adept in expressing human membrane proteins. Here, we describe the surface expression, purification and isolation of monomeric protein, and functional analysis of recombinant hGLUT9 using the Xenopus laevis oocyte system. In addition, we generated a new homology-based high-resolution model of hGLUT9 from the XylE crystal structure and utilized our purified protein to generate a low-resolution single particle reconstruction. Interestingly, we demonstrate that the functional protein extracted from the Xenopus system fits well with the homology-based model allowing us to generate the predicted urate-binding pocket and pave a path for subsequent mutagenesis and structure-function studies. PMID:25286413
Charge transport in metal oxide nanocrystal-based materials
NASA Astrophysics Data System (ADS)
Runnerstrom, Evan Lars
There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochemical devices additionally rely on efficient transport of ionic charge in and around metal oxides. Colloidal synthesis has enabled metal oxide nanocrystals to emerge as a relatively new but highly tunable class of materials. Certain metal oxide nanocrystals, particularly highly doped metal oxides, have been enjoying rapid development in the last decade. As in myriad other materials systems, structure dictates the properties of metal oxide nanocrystals, but a full understanding of how nanocrystal synthesis, the processing of nanocrystal-based materials, and the structure of nanocrystals relate to the resulting properties of nanocrystal-based materials is still nascent. Gaining a fundamental understanding of and control over these structure-property relationships is crucial to developing a holistic understanding of metal oxide nanocrystals. The unique ability to tune metal oxide nanocrystals by changing composition through the introduction of dopants or by changing size and shape affords a way to study the interplay between structure, processing, and properties. This overall goal of this work is to chemically synthesize colloidal metal oxide nanocrystals, process them into useful materials, characterize charge transport in materials based on colloidal metal oxide nanocrystals, and develop ways to manipulate charge transport. In particular, this dissertation characterizes how the charge transport properties of metal oxide nanocrystal-based materials depend on their processing and structure. Charge transport can obviously be taken to mean the conduction of electrons, but it also refers to the motion of ions, such as lithium ions and protons. In many cases, the transport of ions is married to the motion of electrons as well, either through an external electrical circuit, or within the same material in the case of mixed ionic electronic conductors. The collective motion of electrons over short length scales, that is, within single nanocrystals, is also a subject of study as it pertains to plasmonic nanocrystals. Finally, charge transport can also be coupled to or result from the formation of defects in metal oxides. All of these modes of charge transport in metal oxides gain further complexity when considered in nanocrystalline systems, where the introduction of numerous surfaces can change the character of charge transport relative to bulk systems, providing opportunities to exploit new physical phenomena. Part I of this dissertation explores the combination of electronic and ionic transport in electrochromic devices based on nanocrystals. Colloidal chemistry and solution processing are used to fabricate nanocomposites based on electrochromic tin-doped indium oxide (ITO) nanocrystals. The nanocomposites, which are completely synthesized using solution processing, consist of ITO nanocrystals and lithium bis(trifluoromethylsulfonyl)amide (LiTFSI) salt dispersed in a lithium ion-conducting polymer matrix of either poly(ethylene oxide) (PEO) or poly(methyl methacrylate) (PMMA). ITO nanocrystals are prepared by colloidal synthetic methods and the nanocrystal surface chemistry is modified to achieve favorable nanocrystal-polymer interactions. Homogeneous solutions containing polymer, ITO nanocrystals, and lithium salt are thus prepared and deposited by spin casting. Characterization by DC electronic measurements, microscopy, and x-ray scattering techniques show that the ITO nanocrystals form a complete, connected electrode within a polymer electrolyte matrix, and that the morphology and properties of the nanocomposites can be manipulated by changing the chemical composition of the deposition solution. Careful application of AC impedance spectroscopy techniques and DC measurements are used to show that the nanocomposites exhibit mixed ionic and electronic conductivity, where electronic charge is transported through the ITO nanocrystal phase, and ionic charge is transported through the polymer matrix phase. The synthetic methods developed here and understanding of charge transport ultimately lead to the fabrication of a solid state nanocomposite electrochromic device based on nanocrystals of ITO and cerium oxide. Part II of this dissertation considers electron transport within individual metal oxide nanocrystals themselves. It primarily examines relationships between synthetic chemistry, doping mechanisms in metal oxides, and the accompanying physics of free carrier scattering within the interior of highly doped metal oxide nanocrystals, with particular mind paid to ITO nanocrystals. Additionally, synthetic methods as well as metal oxide defect chemistry influences the balance between activation and compensation of dopants, which limits the nanocrystals' free carrier concentration. Furthermore, because of ionized impurity scattering of the oscillating electrons by dopant ions, scattering must be treated in a fundamentally different way in semiconductor metal oxide materials when compared with conventional metals. (Abstract shortened by ProQuest.).
Hou, Jin; Wang, Wei; Quan, Xianyue; Liang, Wen; Li, Zhiming; Chen, Deji; Han, Hongbin
2017-09-03
BACKGROUND This study assessed an innovative tracer-based magnetic resonance imaging (MRI) system to visualize the dynamic transportation of tracers in regions of deep brain extracellular space (ECS) and to measure transportation ability and ECS structure. MATERIAL AND METHODS Gadolinium-diethylene triamine pentaacetic acid (Gd-DTPA) was the chosen tracer and was injected into the caudate nucleus and thalamus. Real-time dynamic transportation of Gd-DTPA in ECS was observed and the results were verified by laser scanning confocal microscopy. Using Transwell assay across the blood-brain barrier, a modified diffusion equation was further simplified. Effective diffusion coefficient D* and tortuosity λ were calculated. Immunohistochemical staining and Western blot analysis were used to investigate the extracellular matrix contributing to ECS structure. RESULTS Tracers injected into the caudate nucleus were transported to the ipsilateral frontal and temporal cortices away from the injection points, while both of them injected into the thalamus were only distributed on site. Although the caudate nucleus was closely adjacent to the thalamus, tracer transportation between partitions was not observed. In addition, D* and the λ showed statistically significant differences between partitions. ECS was shown to be a physiologically partitioned system, and its division is characterized by the unique distribution territory and transportation ability of substances located in it. Versican and Tenascin R are possible contributors to the tortuosity of ECS. CONCLUSIONS Tracer-based MRI will improve our understanding of the brain microenvironment, improve the techniques for local delivery of drugs, and highlight brain tissue engineering fields in the future.
Modeling contrast agent flow in cerebral aneurysms: comparison of CFD with medical imaging
NASA Astrophysics Data System (ADS)
Rayz, Vitaliy; Vali, Alireza; Sigovan, Monica; Lawton, Michael; Saloner, David; Boussel, Loic
2016-11-01
PURPOSE: The flow in cerebral aneurysms is routinely assessed with X-ray angiography, an imaging technique based on a contrast agent injection. In addition to requiring a patient's catheterization and radiation exposure, the X-ray angiography may inaccurately estimate the flow residence time, as the injection alters the native blood flow patterns. Numerical modeling of the contrast transport based on MRI imaging, provides a non-invasive alternative for the flow diagnostics. METHODS: The flow in 3 cerebral aneurysms was measured in vivo with 4D PC-MRI, which provides time-resolved, 3D velocity field. The measured velocities were used to simulate a contrast agent transport by solving the advection-diffusion equation. In addition, the flow in the same patient-specific geometries was simulated with CFD and the velocities obtained from the Navier-Stokes solution were used to model the transport of a virtual contrast. RESULTS: Contrast filling and washout patterns obtained in simulations based on MRI-measured velocities were in agreement with those obtained using the Navier-Stokes solution. Some discrepancies were observed in comparison to the X-ray angiography data, as numerical modeling of the contrast transport is based on the native blood flow unaffected by the contrast injection. NIH HL115267.
Minimum requirements for predictive pore-network modeling of solute transport in micromodels
NASA Astrophysics Data System (ADS)
Mehmani, Yashar; Tchelepi, Hamdi A.
2017-10-01
Pore-scale models are now an integral part of analyzing fluid dynamics in porous materials (e.g., rocks, soils, fuel cells). Pore network models (PNM) are particularly attractive due to their computational efficiency. However, quantitative predictions with PNM have not always been successful. We focus on single-phase transport of a passive tracer under advection-dominated regimes and compare PNM with high-fidelity direct numerical simulations (DNS) for a range of micromodel heterogeneities. We identify the minimum requirements for predictive PNM of transport. They are: (a) flow-based network extraction, i.e., discretizing the pore space based on the underlying velocity field, (b) a Lagrangian (particle tracking) simulation framework, and (c) accurate transfer of particles from one pore throat to the next. We develop novel network extraction and particle tracking PNM methods that meet these requirements. Moreover, we show that certain established PNM practices in the literature can result in first-order errors in modeling advection-dominated transport. They include: all Eulerian PNMs, networks extracted based on geometric metrics only, and flux-based nodal transfer probabilities. Preliminary results for a 3D sphere pack are also presented. The simulation inputs for this work are made public to serve as a benchmark for the research community.
Oxytocin Levels in Community-Collected Saliva Samples Transported by Dry Versus Wet Ice.
Howland, Lois C; Pickler, Rita H; Sullenbarger, Brent A; Connelly, Cynthia D
2018-01-01
Oxytocin (OT), a neuropeptide produced primarily in the hypothalamus, is associated with both critical physiological and psychological processes, particularly stress and feelings of affiliation. Increasingly, researchers are seeking ways to reliably incorporate OT as an outcome biomarker in clinical research. Previously, OT levels were measured in plasma or urine. Recently, researchers have measured this biomarker in saliva, particularly when conducting research in clinical and community settings. In spite of increased interest in the use of salivary OT in clinical research, procedures for handling, transport, and analysis of specimens vary. It is not known if significant OT protein degradation occurs if samples are initially transported on wet ice before being frozen. The aim of this study is to evaluate the effect of transport media (wet vs. dry ice) on OT levels derived from saliva collected from 12 postpartum women residing in the community. Saliva collected from each participant was divided between two microcentrifuge tubes (MIDSCI, Valley Park, MO), one placed on wet ice and one on dry ice for transport from the participant's home to the laboratory freezer. Time from collection to storage freezer was recorded. Laboratory personnel, blinded to method of transport, batch processed the samples. No significant differences in OT levels were found by transport method. Despite large interperson variations in OT levels, there were negligible intraperson variations. Although further research is required to identify factors (including transport time) related to interperson variation, this study supports the use of wet ice as a means of transporting salivary OT specimens in community-based research.
Liu, Xing; Barkawi, Lana; Gardner, Gary; Cohen, Jerry D.
2012-01-01
The polar transport of the natural auxins indole-3-butyric acid (IBA) and indole-3-acetic acid (IAA) has been described in Arabidopsis (Arabidopsis thaliana) hypocotyls using radioactive tracers. Because radioactive assays alone cannot distinguish IBA from its metabolites, the detected transport from applied [3H]IBA may have resulted from the transport of IBA metabolites, including IAA. To test this hypothesis, we used a mass spectrometry-based method to quantify the transport of IBA in Arabidopsis hypocotyls by following the movement of [13C1]IBA and the [13C1]IAA derived from [13C1]IBA. We also assayed [13C6]IAA transport in a parallel control experiment. We found that the amount of transported [13C1]IBA was dramatically lower than [13C6]IAA, and the IBA transport was not reduced by the auxin transport inhibitor N-1-naphthylphthalamic acid. Significant amounts of the applied [13C1]IBA were converted to [13C1]IAA during transport, but [13C1]IBA transport was independent of IBA-to-IAA conversion. We also found that most of the [13C1]IBA was converted to ester-linked [13C1]IBA at the apical end of hypocotyls, and ester-linked [13C1]IBA was also found in the basal end at a level higher than free [13C1]IBA. In contrast, most of the [13C6]IAA was converted to amide-linked [13C6]IAA at the apical end of hypocotyls, but very little conjugated [13C6]IAA was found in the basal end. Our results demonstrate that the polar transport of IBA is much lower than IAA in Arabidopsis hypocotyls, and the transport mechanism is distinct from IAA transport. These experiments also establish a method for quantifying the movement of small molecules in plants using stable isotope labeling. PMID:22323783
NASA Astrophysics Data System (ADS)
Afan, Haitham Abdulmohsin; El-shafie, Ahmed; Mohtar, Wan Hanna Melini Wan; Yaseen, Zaher Mundher
2016-10-01
An accurate model for sediment prediction is a priority for all hydrological researchers. Many conventional methods have shown an inability to achieve an accurate prediction of suspended sediment. These methods are unable to understand the behaviour of sediment transport in rivers due to the complexity, noise, non-stationarity, and dynamism of the sediment pattern. In the past two decades, Artificial Intelligence (AI) and computational approaches have become a remarkable tool for developing an accurate model. These approaches are considered a powerful tool for solving any non-linear model, as they can deal easily with a large number of data and sophisticated models. This paper is a review of all AI approaches that have been applied in sediment modelling. The current research focuses on the development of AI application in sediment transport. In addition, the review identifies major challenges and opportunities for prospective research. Throughout the literature, complementary models superior to classical modelling.
Molecular Dynamical Simulation of Thermal Conductivity in Amorphous Structures
NASA Astrophysics Data System (ADS)
Deangelis, Freddy; Henry, Asegun
While current descriptions of thermal transport exists for well-ordered materials such as crystal latices, new methods are needed to describe thermal transport in disordered materials, including amorphous solids. Because such structures lack periodic, long-range order, a group velocity cannot be defined for thermal modes of vibration; thus, the phonon gas model cannot be applied to these structures. Instead, a new framework must be applied to analyze such materials. Using a combination of density functional theory and molecular dynamics, we have analyzed thermal transport in amorphous structures, chiefly amorphous germanium. The analysis allows us to categorize vibrational modes as propagons, diffusons, or locons, and to determine how they contribute to thermal conductivity within amorphous structures. This method is also being extended to other disordered structures such as amorphous polymers. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship Program under Grant No. DGE-1148903.
NASA Astrophysics Data System (ADS)
Papior, Nick; Lorente, Nicolás; Frederiksen, Thomas; García, Alberto; Brandbyge, Mads
2017-03-01
We present novel methods implemented within the non-equilibrium Green function code (NEGF) TRANSIESTA based on density functional theory (DFT). Our flexible, next-generation DFT-NEGF code handles devices with one or multiple electrodes (Ne ≥ 1) with individual chemical potentials and electronic temperatures. We describe its novel methods for electrostatic gating, contour optimizations, and assertion of charge conservation, as well as the newly implemented algorithms for optimized and scalable matrix inversion, performance-critical pivoting, and hybrid parallelization. Additionally, a generic NEGF "post-processing" code (TBTRANS/PHTRANS) for electron and phonon transport is presented with several novelties such as Hamiltonian interpolations, Ne ≥ 1 electrode capability, bond-currents, generalized interface for user-defined tight-binding transport, transmission projection using eigenstates of a projected Hamiltonian, and fast inversion algorithms for large-scale simulations easily exceeding 106 atoms on workstation computers. The new features of both codes are demonstrated and bench-marked for relevant test systems.
NASA Astrophysics Data System (ADS)
Dai, H.; Chen, X.; Ye, M.; Song, X.; Zachara, J. M.
2016-12-01
Sensitivity analysis has been an important tool in groundwater modeling to identify the influential parameters. Among various sensitivity analysis methods, the variance-based global sensitivity analysis has gained popularity for its model independence characteristic and capability of providing accurate sensitivity measurements. However, the conventional variance-based method only considers uncertainty contribution of single model parameters. In this research, we extended the variance-based method to consider more uncertainty sources and developed a new framework to allow flexible combinations of different uncertainty components. We decompose the uncertainty sources into a hierarchical three-layer structure: scenario, model and parametric. Furthermore, each layer of uncertainty source is capable of containing multiple components. An uncertainty and sensitivity analysis framework was then constructed following this three-layer structure using Bayesian network. Different uncertainty components are represented as uncertain nodes in this network. Through the framework, variance-based sensitivity analysis can be implemented with great flexibility of using different grouping strategies for uncertainty components. The variance-based sensitivity analysis thus is improved to be able to investigate the importance of an extended range of uncertainty sources: scenario, model, and other different combinations of uncertainty components which can represent certain key model system processes (e.g., groundwater recharge process, flow reactive transport process). For test and demonstration purposes, the developed methodology was implemented into a test case of real-world groundwater reactive transport modeling with various uncertainty sources. The results demonstrate that the new sensitivity analysis method is able to estimate accurate importance measurements for any uncertainty sources which were formed by different combinations of uncertainty components. The new methodology can provide useful information for environmental management and decision-makers to formulate policies and strategies.
Transport Theory for Propagation and Reverberation
2016-07-20
mentioned that our transport theory method is essentially 2-D (range and depth), so that out-of- plane forward scattering (a 3-D effect) is not treated...roughness spectrum, it is useful to consider scattering based on perturbation theory in some detail with a plane wave incident on the rough surface. The...the wave vector for the water wave. Let an incident acoustic plane wave have wave vector ki = kiH + kiz, where kiH denotes the horizontal component
Parameterizing the Transport Pathways for Cell Invasion in Complex Scaffold Architectures
Ashworth, Jennifer C.; Mehr, Marco; Buxton, Paul G.; Best, Serena M.
2016-01-01
Interconnecting pathways through porous tissue engineering scaffolds play a vital role in determining nutrient supply, cell invasion, and tissue ingrowth. However, the global use of the term “interconnectivity” often fails to describe the transport characteristics of these pathways, giving no clear indication of their potential to support tissue synthesis. This article uses new experimental data to provide a critical analysis of reported methods for the description of scaffold transport pathways, ranging from qualitative image analysis to thorough structural parameterization using X-ray Micro-Computed Tomography. In the collagen scaffolds tested in this study, it was found that the proportion of pore space perceived to be accessible dramatically changed depending on the chosen method of analysis. Measurements of % interconnectivity as defined in this manner varied as a function of direction and connection size, and also showed a dependence on measurement length scale. As an alternative, a method for transport pathway parameterization was investigated, using percolation theory to calculate the diameter of the largest sphere that can travel to infinite distance through a scaffold in a specified direction. As proof of principle, this approach was used to investigate the invasion behavior of primary fibroblasts in response to independent changes in pore wall alignment and pore space accessibility, parameterized using the percolation diameter. The result was that both properties played a distinct role in determining fibroblast invasion efficiency. This example therefore demonstrates the potential of the percolation diameter as a method of transport pathway parameterization, to provide key structural criteria for application-based scaffold design. PMID:26888449
Ion-Transport Design for High-Performance Na+-Based Electrochromics.
Li, Ran; Li, Kerui; Wang, Gang; Li, Lei; Zhang, Qiangqiang; Yan, Jinhui; Chen, Yao; Zhang, Qinghong; Hou, Chengyi; Li, Yaogang; Wang, Hongzhi
2018-04-24
Sodium ion (Na + )-based electrochemical systems have been extensively investigated in batteries and supercapacitors and also can be quality candidates for electrochromic (EC) devices. However, poor diffusion kinetics and severe EC performance degradation occur during the intercalation/deintercalation processes because the ionic radii of Na + are larger than those of conventional intercalation ions. Here, through intentional design of ion-transport channels in metal-organic frameworks (MOFs), Na + serves as an efficient intercalation ion for incorporation into a nanostructured electrode with a high diffusion coefficient of approximately 10 -8 cm 2 s -1 . As a result, the well-designed MOF-based EC device demonstrates desirable Na + EC performance, including fast switching speed, multicolor switching, and high stability. A smart "quick response code" display is fabricated using a mask-free laser writing method for application in the "Internet of Things". In addition, the concept of ion transport pathway design can be widely adopted for fabricating high-performance ion intercalation materials and devices for consumer electronics.
Fracture mechanics based design for radioactive material transport packagings -- Historical review
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, J.A.; Salzbrenner, D.; Sorenson, K.
1998-04-01
The use of a fracture mechanics based design for the radioactive material transport (RAM) packagings has been the subject of extensive research for more than a decade. Sandia National Laboratories (SNL) has played an important role in the research and development of the application of this technology. Ductile iron has been internationally accepted as an exemplary material for the demonstration of a fracture mechanics based method of RAM packaging design and therefore is the subject of a large portion of the research discussed in this report. SNL`s extensive research and development program, funded primarily by the U. S. Department ofmore » Energy`s Office of Transportation, Energy Management and Analytical Services (EM-76) and in an auxiliary capacity, the office of Civilian Radioactive Waste Management, is summarized in this document along with a summary of the research conducted at other institutions throughout the world. In addition to the research and development work, code and standards development and regulatory positions are also discussed.« less
On the Kubo-Greenwood model for electron conductivity
NASA Astrophysics Data System (ADS)
Dufty, James; Wrighton, Jeffrey; Luo, Kai; Trickey, S. B.
2018-02-01
Currently, the most common method to calculate transport properties for materials under extreme conditions is based on the phenomenological Kubo-Greenwood method. The results of an inquiry into the justification and context of that model are summarized here. Specifically, the basis for its connection to equilibrium DFT and the assumption of static ions are discussed briefly.
The exact solution of the monoenergetic transport equation for critical cylinders
NASA Technical Reports Server (NTRS)
Westfall, R. M.; Metcalf, D. R.
1972-01-01
An analytic solution for the critical, monoenergetic, bare, infinite cylinder is presented. The solution is obtained by modifying a previous development based on a neutron density transform and Case's singular eigenfunction method. Numerical results for critical radii and the neutron density as a function of position are included and compared with the results of other methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akande, Akinlolu, E-mail: akandea@tcd.ie; Bhattacharya, Sandip; Cathcart, Thomas
2014-02-21
We investigate with state of the art density functional theory the structural, electronic, and transport properties of a class of recently synthesized nanostructures based on triarylamine derivatives. First, we consider the single molecule precursors in the gas phase and calculate their static properties, namely (i) the geometrical structure of the neutral and cationic ions, (ii) the electronic structure of the frontier molecular orbitals, and (iii) the ionization potential, hole extraction potential, and internal reorganization energy. This initial study does not evidence any direct correlation between the properties of the individual molecules and their tendency to self-assembly. Subsequently, we investigate themore » charge transport characteristics of the triarylamine derivatives nanowires, by using Marcus theory. For one derivative we further construct an effective Hamiltonian including intermolecular vibrations and evaluate the mobility from the Kubo formula implemented with Monte Carlo sampling. These two methods, valid respectively in the sequential hopping and polaronic band limit, give us values for the room-temperature mobility in the range 0.1–12 cm{sup 2}/Vs. Such estimate confirms the superior transport properties of triarylamine-based nanowires, and make them an attracting materials platform for organic electronics.« less
Dynamics of long ring Raman fiber laser
NASA Astrophysics Data System (ADS)
Sukhanov, Sergey V.; Melnikov, Leonid A.; Mazhirina, Yulia A.
2016-04-01
The numerical model for dynamics of long fiber ring Raman laser is proposed. The model is based on the transport equations and Courant-Isaacson-Rees numerical method. Different regimes of a long ring fiber Raman laser are investigated.
Optimization-based methods for road image registration
DOT National Transportation Integrated Search
2008-02-01
A number of transportation agencies are now relying on direct imaging for monitoring and cataloguing the state of their roadway systems. Images provide objective information to characterize the pavement as well as roadside hardware. The tasks of proc...
Ex-ante assessment of the safety effects of intelligent transport systems.
Kulmala, Risto
2010-07-01
There is a need to develop a comprehensive framework for the safety assessment of Intelligent Transport Systems (ITS). This framework should: (1) cover all three dimensions of road safety-exposure, crash risk and consequence, (2) cover, in addition to the engineering effect, also the effects due to behavioural adaptation and (3) be compatible with the other aspects of state of the art road safety theories. A framework based on nine ITS safety mechanisms is proposed and discussed with regard to the requirements set to the framework. In order to illustrate the application of the framework in practice, the paper presents a method based on the framework and the results from applying that method for twelve intelligent vehicle systems in Europe. The framework is also compared to two recent frameworks applied in the safety assessment of intelligent vehicle safety systems. Copyright 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Guo, Heng; Yang, Jian; Pu, Bingxue; Zhang, Haiyan; Niu, Xiaobin
2018-01-01
Organo-lead perovskites as light harvesters have represented a hot field of research on high-efficiency perovskite solar cells. Previous approaches to increasing the solar cell efficiency have focused on optimization of the morphology of perovskite film. In fact, the electron transporting layer (ETL) also has a significant impact on solar cell performance. Herein, we introduce a facile and low temperature solution-processing method to deposit Nb2O5 film as ETL for PSCs. Based on Nb2O5 ETL, we investigate the effect of the annealing time for the perovskite films via different solution processing, relating it to the perovskite film morphology and its influence on the device working mechanisms. These results shed light on the origin of photovoltaic performance voltage in perovskite solar cells, and provide a path to further increase their efficiency.
Data Transfer Advisor with Transport Profiling Optimization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rao, Nageswara S.; Liu, Qiang; Yun, Daqing
The network infrastructures have been rapidly upgraded in many high-performance networks (HPNs). However, such infrastructure investment has not led to corresponding performance improvement in big data transfer, especially at the application layer, largely due to the complexity of optimizing transport control on end hosts. We design and implement ProbData, a PRofiling Optimization Based DAta Transfer Advisor, to help users determine the most effective data transfer method with the most appropriate control parameter values to achieve the best data transfer performance. ProbData employs a profiling optimization based approach to exploit the optimal operational zone of various data transfer methods in supportmore » of big data transfer in extreme scale scientific applications. We present a theoretical framework of the optimized profiling approach employed in ProbData as wellas its detailed design and implementation. The advising procedure and performance benefits of ProbData are illustrated and evaluated by proof-of-concept experiments in real-life networks.« less
Solar cells with perovskite-based light sensitization layers
Kanatzidis, Mercouri G.; Chang, Robert P.H.; Stoumpos, Konstantinos; Lee, Byunghong
2018-05-08
Solar cells are provided which comprise an electron transporting layer and a light sensitizing layer of perovskite disposed over the surface of the electron transporting layer. The perovskite may have a formula selected from the group consisting of A2MX6, Z2MX6 or YMX6, wherein A is an alkali metal, M is a metal or a metalloid, X is a halide, Z is selected from the group consisting of a primary ammonium, an iminium, a secondary ammonium, a tertiary ammonium, and a quaternary ammonium, and Y has formula Mb(L)3, wherein Mb is a transition metal in the 2+ oxidation state L is an N--N neutral chelating ligand. Methods of making the solar cells are also provided, including methods based on electrospray deposition.
OpenMC In Situ Source Convergence Detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aldrich, Garrett Allen; Dutta, Soumya; Woodring, Jonathan Lee
2016-05-07
We designed and implemented an in situ version of particle source convergence for the OpenMC particle transport simulator. OpenMC is a Monte Carlo based-particle simulator for neutron criticality calculations. For the transport simulation to be accurate, source particles must converge on a spatial distribution. Typically, convergence is obtained by iterating the simulation by a user-settable, fixed number of steps, and it is assumed that convergence is achieved. We instead implement a method to detect convergence, using the stochastic oscillator for identifying convergence of source particles based on their accumulated Shannon Entropy. Using our in situ convergence detection, we are ablemore » to detect and begin tallying results for the full simulation once the proper source distribution has been confirmed. Our method ensures that the simulation is not started too early, by a user setting too optimistic parameters, or too late, by setting too conservative a parameter.« less
NASA Astrophysics Data System (ADS)
Béranger, Sandra C.; Sleep, Brent E.; Lollar, Barbara Sherwood; Monteagudo, Fernando Perez
2005-01-01
An analytical, one-dimensional, multi-species, reactive transport model for simulating the concentrations and isotopic signatures of tetrachloroethylene (PCE) and its daughter products was developed. The simulation model was coupled to a genetic algorithm (GA) combined with a gradient-based (GB) method to estimate the first order decay coefficients and enrichment factors. In testing with synthetic data, the hybrid GA-GB method reduced the computational requirements for parameter estimation by a factor as great as 300. The isotopic signature profiles were observed to be more sensitive than the concentration profiles to estimates of both the first order decay constants and enrichment factors. Including isotopic data for parameter estimation significantly increased the GA convergence rate and slightly improved the accuracy of estimation of first order decay constants.
NASA Technical Reports Server (NTRS)
Chen, H. C.; Neback, H. E.; Kao, T. J.; Yu, N. Y.; Kusunose, K.
1991-01-01
This manual explains how to use an Euler based computational method for predicting the airframe/propulsion integration effects for an aft-mounted turboprop transport. The propeller power effects are simulated by the actuator disk concept. This method consists of global flow field analysis and the embedded flow solution for predicting the detailed flow characteristics in the local vicinity of an aft-mounted propfan engine. The computational procedure includes the use of several computer programs performing four main functions: grid generation, Euler solution, grid embedding, and streamline tracing. This user's guide provides information for these programs, including input data preparations with sample input decks, output descriptions, and sample Unix scripts for program execution in the UNICOS environment.
Smithwick, R W; Stratigos, C B; David, H L
1975-01-01
A method is presented for the decontamination, liquefaction, and concentration of sputum specimens that are in transport more than 24 h. The method is inexpensive, and culture results compare well with those obtained with the accepted N-acetyl-L-cysteine and sodium hydroxide method for the isolation of tubercle bacilli. The working solution, 1% cetylpyridinium chloride and 2% sodium chloride, is mixed in equal volumes with sputum before the specimens are shipped. Tubercle bacilli remained viable after 8 days of exposure to this solution. Only Lowenstein-Jensen medium was used because the cetylpyridinium chloride in the inoculum remains active on 7H10 or other agar base media and partially inhibits the growth of tubercle bacilli. PMID:809478
Self-organization and feedback effects in the shock compressed media
NASA Astrophysics Data System (ADS)
Khantuleva, Tatyana
2005-07-01
New theoretical approach to the transport in condensed matter far from equilibrium combines methods of statistical mechanics and cybernetic physics in order to construct closed mathematical model of a system with self-organization and self-regulation. Mesoscopic effects are considered as a result of the structure formation and the feedback effects in an open system under dynamic loading. Nonequilibrium state equations had been involved to incorporate the velocity dispersion. Integrodifferential balance equations describe both wave and dissipative transport properties. Boundary conditions determine the internal scale spectra. The model is completed by the feedback that introduces the structure evolution basing the methods of cybernetic physics. The obtained results open a wide prospective for the control methods in applications to new technologies, intellectual systems and prediction of catastrophic phenomena.
Klasmeier, Jörg; Matthies, Michael; Macleod, Matthew; Fenner, Kathrin; Scheringer, Martin; Stroebe, Maximilian; Le Gall, Anne Christine; Mckone, Thomas; Van De Meent, Dik; Wania, Frank
2006-01-01
We propose a multimedia model-based methodology to evaluate whether a chemical substance qualifies as POP-like based on overall persistence (Pov) and potential for long-range transport (LRTP). It relies upon screening chemicals against the Pov and LRTP characteristics of selected reference chemicals with well-established environmental fates. Results indicate that chemicals of high and low concern in terms of persistence and long-range transport can be consistently identified by eight contemporary multimedia models using the proposed methodology. Model results for three hypothetical chemicals illustrate that the model-based classification of chemicals according to Pov and LRTP is not always consistent with the single-media half-life approach proposed by the UNEP Stockholm Convention and thatthe models provide additional insight into the likely long-term hazards associated with chemicals in the environment. We suggest this model-based classification method be adopted as a complement to screening against defined half-life criteria at the initial stages of tiered assessments designed to identify POP-like chemicals and to prioritize further environmental fate studies for new and existing chemicals.
Fitting Transporter Activities to Cellular Drug Concentrations and Fluxes: Why the Bumblebee Can Fly
Mendes, Pedro; Oliver, Stephen G.; Kell, Douglas B.
2015-01-01
A recent paper in this journal argued that reported expression levels, kcat and Km for drug transporters could be used to estimate the likelihood that drug fluxes through Caco-2 cells could be accounted for solely by protein transporters. It was in fact concluded that if five such transporters contributed ‘randomly’ they could account for the flux of the most permeable drug tested (verapamil) 35% of the time. However, the values of permeability cited for verapamil were unusually high; this and other drugs have much lower permeabilities. Even for the claimed permeabilities, we found that a single ‘random’ transporter could account for the flux 42% of the time, and that two transporters can achieve 10 · 10−6 cm·s−1 90% of the time. Parameter optimisation methods show that even a single transporter can account for Caco-2 drug uptake of the most permeable drug. Overall, the proposal that ‘phospholipid bilayer diffusion (of drugs) is negligible’ is not disproved by the calculations of ‘likely’ transporter-based fluxes. PMID:26538313
Ma, Shuwei; Liu, Xingyan; Xu, Qingrun; Zhang, Xiantao
2014-10-02
In this report, the transport of ginkgolides with different lipophilicities was investigated using an hCMEC/D3 cell monolayer as a blood-brain barrier (BBB) cell model in vitro in an attempt to explain ginkgolide transport path mediated by lipophilicity. The log P values of ginkgolides were determined by measuring the distribution of the molecule between oil and water. Additionally, the cytotoxicity of ginkgolides on hCMEC/D3 cells was assayed with the MTT method. Ginkgolide contents were determined with an ultra performance liquid chromatograph equipped with an evaporative light scattering detector (ULPC-ELSD) method. Apparent permeability coefficients (Papp) and efflux ratios (PappBL→AP/PappAP→BL) were then calculated to describe the transport characteristics of ginkgolide. The transport of ginkgolide A, ginkgolide B, ginkgolide C, and ginkgolide J across the hCMEC/D3 cell monolayer was non-directional. Additionally, ginkgolide C transport on the cell monolayer was time- and concentration-dependent in the paracellular pathway controlled by cytochalasin D (a tight junction modulator). The transport of ginkgolide N, ginkgolide L, and ginkgolide K across the cell monolayer displayed clear directionality at low ginkgolide concentrations. This behavior indicated that the transport of ginkgolide N, ginkgolide L, and ginkgolide K was influenced by the transcellular pathway containing an efflux protein accompanied by the paracellular pathway for passive diffusion. Additionally, the transport of ginkgolide K was increased significantly by co-culturing with a P-gp inhibitor. These findings provide important information for elucidating ginkgolide transport pathways and may be beneficial for the design of ginkgolide molecules with high neuroprotective effects. Copyright © 2014 Elsevier Inc. All rights reserved.
Solute transport across the articular surface of injured cartilage.
Chin, Hooi Chuan; Moeini, Mohammad; Quinn, Thomas M
2013-07-15
Solute transport through extracellular matrix (ECM) is important to physiology and contrast agent-based clinical imaging of articular cartilage. Mechanical injury is likely to have important effects on solute transport since it involves alteration of ECM structure. Therefore it is of interest to characterize effects of mechanical injury on solute transport in cartilage. Using cartilage explants injured by an established mechanical compression protocol, effective partition coefficients and diffusivities of solutes for transport across the articular surface were measured. A range of fluorescent solutes (fluorescein isothiocyanate, 4 and 40kDa dextrans, insulin, and chondroitin sulfate) and an X-ray contrast agent (sodium iodide) were used. Mechanical injury was associated with a significant increase in effective diffusivity versus uninjured explants for all solutes studied. On the other hand, mechanical injury had no effects on effective partition coefficients for most solutes tested, except for 40kDa dextran and chondroitin sulfate where small but significant changes in effective partition coefficient were observed in injured explants. Findings highlight enhanced diffusive transport across the articular surface of injured cartilage, which may have important implications for injury and repair situations. Results also support development of non-equilibrium methods for identification of focal cartilage lesions by contrast agent-based clinical imaging. Copyright © 2013 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Ploeger, F.; Gottschling, C.; Griessbach, S.; Grooß, J.-U.; Guenther, G.; Konopka, P.; Müller, R.; Riese, M.; Stroh, F.; Tao, M.; Ungermann, J.; Vogel, B.; von Hobe, M.
2015-11-01
The Asian summer monsoon provides an important pathway of tropospheric source gases and pollution into the lower stratosphere. This transport is characterized by deep convection and steady upwelling, combined with confinement inside a large-scale anticyclonic circulation in the upper troposphere and lower stratosphere (UTLS). In this paper, we show that a barrier to horizontal transport along the 380 K isentrope in the monsoon anticyclone can be determined from a local maximum in the gradient of potential vorticity (PV), following methods developed for the polar vortex (e.g., Nash et al., 1996). The monsoon anticyclone is dynamically highly variable and the maximum in the PV gradient is weak, such that additional constraints are needed (e.g., time averaging). Nevertheless, PV contours in the monsoon anticyclone agree well with contours of trace gas mixing ratios (CO, O3) and mean age from model simulations with a Lagrangian chemistry transport model (CLaMS) and satellite observations from the Microwave Limb Sounder (MLS) instrument. Hence, the PV-based transport barrier reflects the separation between air inside the core of the anticyclone and the background atmosphere well. For the summer season 2011 we find an average PV value of 3.6 PVU for the transport barrier in the anticyclone on the 380 K isentrope.
Langeveld, J G; Veldkamp, R G; Clemens, F
2005-01-01
Modelling suspended solids transport is a key issue for predicting the pollution load discharged by CSOs. Nonetheless, there is still much debate on the main drivers for suspended solids transport and on the modelling approach to be adopted. Current sewer models provide suspended solids transport models. These models, however, rely upon erosion-deposition criteria developed in fluvial environments, therewith oversimplifying the sewer sediment characteristics. Consequently, the performance of these models is poor from a theoretical point of view. To get an improved understanding of the temporal and spatial variations in suspended solids transport, a measuring network was installed in the sewer system of Loenen in conjunction with a hydraulic measuring network from June through December 2001. During the measuring period, 15 storm events rendered high-quality data on both the hydraulics and the turbidity. For each storm event, a hydrodynamic model was calibrated using the Clemens' method. The conclusion of the paper is that modelling of suspended solids transport has been and will be one of the challenges in the field of urban drainage modelling. A direct relation of either shear stress or flow velocity with turbidity could not be found, likely because of the time varying characteristics of the suspended solids.
In vitro and in vivo evaluations of the P-glycoprotein-mediated efflux of dibenzoylhydrazines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyata, Ken-ichi, E-mail: Miyata.Kenichi@otsuka.jp; Otsuka Pharmaceutical Co., Ltd., Tokushima 771-0182; Nakagawa, Yoshiaki
2016-05-01
P-glycoprotein (P-gp) is a member of the ATP-binding cassette transporter family. It actively transports a wide variety of compounds out of cells to protect humans from xenobiotics. Thus, determining whether chemicals are substrates and/or inhibitors of P-gp is important in risk assessments of pharmacokinetic interactions among chemicals because P-gp-mediated transport processes play a significant role in their absorption and disposition. We previously reported that dibenzoylhydrazines (DBHs) such as tebufenozide and methoxyfenozide (agrochemicals) stimulated P-gp ATPase activity. However, it currently remains unclear whether these derivatives are transport substrates of P-gp and inhibit transport of other chemicals by P-gp. In the presentmore » study, in order to evaluate the interactions of DBHs with other chemicals in humans, we determined whether DBHs are P-gp transport substrates using both the in vitro bidirectional transport assay and the in vivo study of rats. In the in vivo study, we investigated the influence of P-gp inhibitors on the brain to plasma ratio of methoxyfenozide in rats. We also examined the inhibitory effects of DBHs on quinidine (a P-gp substrate) transport by P-gp in order to ascertain whether these derivatives are inhibitors of P-gp. Based on the results, DBHs were concluded to be weak P-gp transport substrates and moderate P-gp inhibitors. However, the risk of DBHs caused by interaction with other chemicals including drugs was considered to be low by considering the DBHs' potential as the substrates and inhibitors of P-gp as well as their plasma concentrations as long as DBHs are properly used. - Highlights: • Transport of DBHs by P-gp was not detected in in vitro bidirectional transport assay. • DBHs were weak P-gp transport substrates based on in vivo studies in rats. • The in vivo studies are useful methods for evaluating P-gp transport substrates. • DBHs inhibit quinidine transport by P-gp in in vitro bidirectional transport assay.« less
Using operations research to plan improvement of the transport of critically ill patients.
Chen, Jing; Awasthi, Anjali; Shechter, Steven; Atkins, Derek; Lemke, Linda; Fisher, Les; Dodek, Peter
2013-01-01
Operations research is the application of mathematical modeling, statistical analysis, and mathematical optimization to understand and improve processes in organizations. The objective of this study was to illustrate how the methods of operations research can be used to identify opportunities to reduce the absolute value and variability of interfacility transport intervals for critically ill patients. After linking data from two patient transport organizations in British Columbia, Canada, for all critical care transports during the calendar year 2006, the steps for transfer of critically ill patients were tabulated into a series of time intervals. Statistical modeling, root-cause analysis, Monte Carlo simulation, and sensitivity analysis were used to test the effect of changes in component intervals on overall duration and variation of transport times. Based on quality improvement principles, we focused on reducing the 75th percentile and standard deviation of these intervals. We analyzed a total of 3808 ground and air transports. Constraining time spent by transport personnel at sending and receiving hospitals was projected to reduce the total time taken by 33 minutes with as much as a 20% reduction in standard deviation of these transport intervals in 75% of ground transfers. Enforcing a policy of requiring acceptance of patients who have life- or limb-threatening conditions or organ failure was projected to reduce the standard deviation of air transport time by 63 minutes and the standard deviation of ground transport time by 68 minutes. Based on findings from our analyses, we developed recommendations for technology renovation, personnel training, system improvement, and policy enforcement. Use of the tools of operations research identifies opportunities for improvement in a complex system of critical care transport.
NASA Astrophysics Data System (ADS)
Gotovac, Hrvoje; Srzic, Veljko
2014-05-01
Contaminant transport in natural aquifers is a complex, multiscale process that is frequently studied using different Eulerian, Lagrangian and hybrid numerical methods. Conservative solute transport is typically modeled using the advection-dispersion equation (ADE). Despite the large number of available numerical methods that have been developed to solve it, the accurate numerical solution of the ADE still presents formidable challenges. In particular, current numerical solutions of multidimensional advection-dominated transport in non-uniform velocity fields are affected by one or all of the following problems: numerical dispersion that introduces artificial mixing and dilution, grid orientation effects, unresolved spatial and temporal scales and unphysical numerical oscillations (e.g., Herrera et al, 2009; Bosso et al., 2012). In this work we will present Eulerian Lagrangian Adaptive Fup Collocation Method (ELAFCM) based on Fup basis functions and collocation approach for spatial approximation and explicit stabilized Runge-Kutta-Chebyshev temporal integration (public domain routine SERK2) which is especially well suited for stiff parabolic problems. Spatial adaptive strategy is based on Fup basis functions which are closely related to the wavelets and splines so that they are also compactly supported basis functions; they exactly describe algebraic polynomials and enable a multiresolution adaptive analysis (MRA). MRA is here performed via Fup Collocation Transform (FCT) so that at each time step concentration solution is decomposed using only a few significant Fup basis functions on adaptive collocation grid with appropriate scales (frequencies) and locations, a desired level of accuracy and a near minimum computational cost. FCT adds more collocations points and higher resolution levels only in sensitive zones with sharp concentration gradients, fronts and/or narrow transition zones. According to the our recent achievements there is no need for solving the large linear system on adaptive grid because each Fup coefficient is obtained by predefined formulas equalizing Fup expansion around corresponding collocation point and particular collocation operator based on few surrounding solution values. Furthermore, each Fup coefficient can be obtained independently which is perfectly suited for parallel processing. Adaptive grid in each time step is obtained from solution of the last time step or initial conditions and advective Lagrangian step in the current time step according to the velocity field and continuous streamlines. On the other side, we implement explicit stabilized routine SERK2 for dispersive Eulerian part of solution in the current time step on obtained spatial adaptive grid. Overall adaptive concept does not require the solving of large linear systems for the spatial and temporal approximation of conservative transport. Also, this new Eulerian-Lagrangian-Collocation scheme resolves all mentioned numerical problems due to its adaptive nature and ability to control numerical errors in space and time. Proposed method solves advection in Lagrangian way eliminating problems in Eulerian methods, while optimal collocation grid efficiently describes solution and boundary conditions eliminating usage of large number of particles and other problems in Lagrangian methods. Finally, numerical tests show that this approach enables not only accurate velocity field, but also conservative transport even in highly heterogeneous porous media resolving all spatial and temporal scales of concentration field.
NASA Astrophysics Data System (ADS)
Dai, Heng; Chen, Xingyuan; Ye, Ming; Song, Xuehang; Zachara, John M.
2017-05-01
Sensitivity analysis is an important tool for development and improvement of mathematical models, especially for complex systems with a high dimension of spatially correlated parameters. Variance-based global sensitivity analysis has gained popularity because it can quantify the relative contribution of uncertainty from different sources. However, its computational cost increases dramatically with the complexity of the considered model and the dimension of model parameters. In this study, we developed a new sensitivity analysis method that integrates the concept of variance-based method with a hierarchical uncertainty quantification framework. Different uncertain inputs are grouped and organized into a multilayer framework based on their characteristics and dependency relationships to reduce the dimensionality of the sensitivity analysis. A set of new sensitivity indices are defined for the grouped inputs using the variance decomposition method. Using this methodology, we identified the most important uncertainty source for a dynamic groundwater flow and solute transport model at the Department of Energy (DOE) Hanford site. The results indicate that boundary conditions and permeability field contribute the most uncertainty to the simulated head field and tracer plume, respectively. The relative contribution from each source varied spatially and temporally. By using a geostatistical approach to reduce the number of realizations needed for the sensitivity analysis, the computational cost of implementing the developed method was reduced to a practically manageable level. The developed sensitivity analysis method is generally applicable to a wide range of hydrologic and environmental problems that deal with high-dimensional spatially distributed input variables.
NASA Astrophysics Data System (ADS)
Dai, H.; Chen, X.; Ye, M.; Song, X.; Zachara, J. M.
2017-12-01
Sensitivity analysis is an important tool for development and improvement of mathematical models, especially for complex systems with a high dimension of spatially correlated parameters. Variance-based global sensitivity analysis has gained popularity because it can quantify the relative contribution of uncertainty from different sources. However, its computational cost increases dramatically with the complexity of the considered model and the dimension of model parameters. In this study we developed a new sensitivity analysis method that integrates the concept of variance-based method with a hierarchical uncertainty quantification framework. Different uncertain inputs are grouped and organized into a multi-layer framework based on their characteristics and dependency relationships to reduce the dimensionality of the sensitivity analysis. A set of new sensitivity indices are defined for the grouped inputs using the variance decomposition method. Using this methodology, we identified the most important uncertainty source for a dynamic groundwater flow and solute transport model at the Department of Energy (DOE) Hanford site. The results indicate that boundary conditions and permeability field contribute the most uncertainty to the simulated head field and tracer plume, respectively. The relative contribution from each source varied spatially and temporally. By using a geostatistical approach to reduce the number of realizations needed for the sensitivity analysis, the computational cost of implementing the developed method was reduced to a practically manageable level. The developed sensitivity analysis method is generally applicable to a wide range of hydrologic and environmental problems that deal with high-dimensional spatially-distributed input variables.
Promising Thermoelectric Bulk Materials with 2D Structures.
Zhou, Yiming; Zhao, Li-Dong
2017-12-01
Given that more than two thirds of all energy is lost, mostly as waste heat, in utilization processes worldwide, thermoelectric materials, which can directly convert waste heat to electricity, provide an alternative option for optimizing energy utilization processes. After the prediction that superlattices may show high thermoelectric performance, various methods based on quantum effects and superlattice theory have been adopted to analyze bulk materials, leading to the rapid development of thermoelectric materials. Bulk materials with two-dimensional (2D) structures show outstanding properties, and their high performance originates from both their low thermal conductivity and high Seebeck coefficient due to their strong anisotropic features. Here, the advantages of superlattices for enhancing the thermoelectric performance, the transport mechanism in bulk materials with 2D structures, and optimization methods are discussed. The phenomenological transport mechanism in these materials indicates that thermal conductivities are reduced in 2D materials with intrinsically short mean free paths. Recent progress in the transport mechanisms of Bi 2 Te 3 -, SnSe-, and BiCuSeO-based systems is summarized. Finally, possible research directions to enhance the thermoelectric performance of bulk materials with 2D structures are briefly considered. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Burden of disease caused by local transport in Warsaw, Poland
Tainio, Marko
2015-01-01
Transport is a major source of air pollution, noise, injuries and physical activity in the urban environment. The quantification of the health risks and benefits arising from these factors would provide useful information for the planning of cost-effective mitigation actions. In this study we quantified the burden of disease caused by local transport in the city of Warsaw, Poland. The disability-adjusted life-years (DALYs) were estimated for transport related air pollution (particulate matter (PM), nitrogen oxides (NOx), sulfur dioxide (SO2), benzo[a]pyrene (BaP), cadmium, lead and nickel), noise, injuries and physical activity. Exposure to these factors was based on local and international data, and the exposure-response functions (ERFs) were based on published reviews and recommendations. The uncertainties were quantified and propagated with the Monte Carlo method. Local transport generated air pollution, noise and injuries were estimated to cause approximately 58,000 DALYs in the study area. From this burden 44% was due to air pollution and 46% due to noise. Transport related physical activity was estimated to cause a health benefit of 17,000 DALYs. Main quantified uncertainties were related to disability weight for the annoyance (due to noise) and to the ERFs for fine particulate matter (PM2.5) air pollution and walking. The results indicate that the health burden of transport could be mitigated by reducing motorized transport, which causes air pollution and noise, and by encouraging walking and cycling in the study area. PMID:26516622
The intelligence of dual simplex method to solve linear fractional fuzzy transportation problem.
Narayanamoorthy, S; Kalyani, S
2015-01-01
An approach is presented to solve a fuzzy transportation problem with linear fractional fuzzy objective function. In this proposed approach the fractional fuzzy transportation problem is decomposed into two linear fuzzy transportation problems. The optimal solution of the two linear fuzzy transportations is solved by dual simplex method and the optimal solution of the fractional fuzzy transportation problem is obtained. The proposed method is explained in detail with an example.
External intermittency prediction using AMR solutions of RANS turbulence and transported PDF models
NASA Astrophysics Data System (ADS)
Olivieri, D. A.; Fairweather, M.; Falle, S. A. E. G.
2011-12-01
External intermittency in turbulent round jets is predicted using a Reynolds-averaged Navier-Stokes modelling approach coupled to solutions of the transported probability density function (pdf) equation for scalar variables. Solutions to the descriptive equations are obtained using a finite-volume method, combined with an adaptive mesh refinement algorithm, applied in both physical and compositional space. This method contrasts with conventional approaches to solving the transported pdf equation which generally employ Monte Carlo techniques. Intermittency-modified eddy viscosity and second-moment turbulence closures are used to accommodate the effects of intermittency on the flow field, with the influence of intermittency also included, through modifications to the mixing model, in the transported pdf equation. Predictions of the overall model are compared with experimental data on the velocity and scalar fields in a round jet, as well as against measurements of intermittency profiles and scalar pdfs in a number of flows, with good agreement obtained. For the cases considered, predictions based on the second-moment turbulence closure are clearly superior, although both turbulence models give realistic predictions of the bimodal scalar pdfs observed experimentally.
NASA Astrophysics Data System (ADS)
Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco
2018-03-01
Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Y. M., E-mail: ymingy@gmail.com; Bednarz, B.; Svatos, M.
Purpose: The future of radiation therapy will require advanced inverse planning solutions to support single-arc, multiple-arc, and “4π” delivery modes, which present unique challenges in finding an optimal treatment plan over a vast search space, while still preserving dosimetric accuracy. The successful clinical implementation of such methods would benefit from Monte Carlo (MC) based dose calculation methods, which can offer improvements in dosimetric accuracy when compared to deterministic methods. The standard method for MC based treatment planning optimization leverages the accuracy of the MC dose calculation and efficiency of well-developed optimization methods, by precalculating the fluence to dose relationship withinmore » a patient with MC methods and subsequently optimizing the fluence weights. However, the sequential nature of this implementation is computationally time consuming and memory intensive. Methods to reduce the overhead of the MC precalculation have been explored in the past, demonstrating promising reductions of computational time overhead, but with limited impact on the memory overhead due to the sequential nature of the dose calculation and fluence optimization. The authors propose an entirely new form of “concurrent” Monte Carlo treat plan optimization: a platform which optimizes the fluence during the dose calculation, reduces wasted computation time being spent on beamlets that weakly contribute to the final dose distribution, and requires only a low memory footprint to function. In this initial investigation, the authors explore the key theoretical and practical considerations of optimizing fluence in such a manner. Methods: The authors present a novel derivation and implementation of a gradient descent algorithm that allows for optimization during MC particle transport, based on highly stochastic information generated through particle transport of very few histories. A gradient rescaling and renormalization algorithm, and the concept of momentum from stochastic gradient descent were used to address obstacles unique to performing gradient descent fluence optimization during MC particle transport. The authors have applied their method to two simple geometrical phantoms, and one clinical patient geometry to examine the capability of this platform to generate conformal plans as well as assess its computational scaling and efficiency, respectively. Results: The authors obtain a reduction of at least 50% in total histories transported in their investigation compared to a theoretical unweighted beamlet calculation and subsequent fluence optimization method, and observe a roughly fixed optimization time overhead consisting of ∼10% of the total computation time in all cases. Finally, the authors demonstrate a negligible increase in memory overhead of ∼7–8 MB to allow for optimization of a clinical patient geometry surrounded by 36 beams using their platform. Conclusions: This study demonstrates a fluence optimization approach, which could significantly improve the development of next generation radiation therapy solutions while incurring minimal additional computational overhead.« less
Cost-effective strategy to mitigate transportation disruptions in supply chain
NASA Astrophysics Data System (ADS)
Albertzeth, G.; Pujawan, I. N.
2018-04-01
Supply chain disruptions have gained significant attention by scholars. But, even though transportation plays a central role in supply chain, only few studies address transportation disruptions. This research demonstrates a real case of an order delivery process from a focal company (FC) to a single distributor, where transportation disruptions stochastically occurs. Considering the possibility of sales loss during the disruption duration, we proposed a redundant stock, flexible route, and combined flexibility-redundancy (ReFlex) as mitigation strategies and a base case as a risk acceptance strategy. The objective is to find out the best strategy that promotes cost-effectiveness against transportation disruptions. To fulfill this objective, we use simulation modeling and cost-effectiveness analysis (CEA) as our research method. We simulate the delivery process of 5 brands using each strategy to produce two different responses: loss of sales percentage and the incurred costs. Next, using these responses, we evaluate and compare the cost-effectiveness ratio of each strategy using CEA. We found that redundant stock gave the best effectiveness on all brands, ReFlex as the second best, while flexible route gave the least effectiveness. Finally, we recommend which strategy should be applied based on the decision maker willingness to pay.
NASA Astrophysics Data System (ADS)
Yao, Yao; Si, Wei; Hou, Xiaoyuan; Wu, Chang-Qin
2012-06-01
The dynamic disorder model for charge carrier transport in organic semiconductors has been extensively studied in recent years. Although it is successful on determining the value of bandlike mobility in the organic crystalline materials, the incoherent hopping, the typical transport characteristic in amorphous molecular semiconductors, cannot be described. In this work, the decoherence process is taken into account via a phenomenological parameter, say, decoherence time, and the projective and Monte Carlo method are applied for this model to determine the waiting time and thus the diffusion coefficient. It is obtained that the type of transport is changed from coherent to incoherent with a sufficiently short decoherence time, which indicates the essential role of decoherence time in determining the type of transport in organics. We have also discussed the spatial extent of carriers for different decoherence time, and the transition from delocalization (carrier resides in about 10 molecules) to localization is observed. Based on the experimental results of spatial extent, we estimate that the decoherence time in pentacene has the order of 1 ps. Furthermore, the dependence of diffusion coefficient on decoherence time is also investigated, and corresponding experiments are discussed.
Yao, Yao; Si, Wei; Hou, Xiaoyuan; Wu, Chang-Qin
2012-06-21
The dynamic disorder model for charge carrier transport in organic semiconductors has been extensively studied in recent years. Although it is successful on determining the value of bandlike mobility in the organic crystalline materials, the incoherent hopping, the typical transport characteristic in amorphous molecular semiconductors, cannot be described. In this work, the decoherence process is taken into account via a phenomenological parameter, say, decoherence time, and the projective and Monte Carlo method are applied for this model to determine the waiting time and thus the diffusion coefficient. It is obtained that the type of transport is changed from coherent to incoherent with a sufficiently short decoherence time, which indicates the essential role of decoherence time in determining the type of transport in organics. We have also discussed the spatial extent of carriers for different decoherence time, and the transition from delocalization (carrier resides in about 10 molecules) to localization is observed. Based on the experimental results of spatial extent, we estimate that the decoherence time in pentacene has the order of 1 ps. Furthermore, the dependence of diffusion coefficient on decoherence time is also investigated, and corresponding experiments are discussed.
Locally adaptive methods for KDE-based random walk models of reactive transport in porous media
NASA Astrophysics Data System (ADS)
Sole-Mari, G.; Fernandez-Garcia, D.
2017-12-01
Random Walk Particle Tracking (RWPT) coupled with Kernel Density Estimation (KDE) has been recently proposed to simulate reactive transport in porous media. KDE provides an optimal estimation of the area of influence of particles which is a key element to simulate nonlinear chemical reactions. However, several important drawbacks can be identified: (1) the optimal KDE method is computationally intensive and thereby cannot be used at each time step of the simulation; (2) it does not take advantage of the prior information about the physical system and the previous history of the solute plume; (3) even if the kernel is optimal, the relative error in RWPT simulations typically increases over time as the particle density diminishes by dilution. To overcome these problems, we propose an adaptive branching random walk methodology that incorporates the physics, the particle history and maintains accuracy with time. The method allows particles to efficiently split and merge when necessary as well as to optimally adapt their local kernel shape without having to recalculate the kernel size. We illustrate the advantage of the method by simulating complex reactive transport problems in randomly heterogeneous porous media.
Methods for stable recording of short-circuit current in a Na+-transporting epithelium.
Gondzik, Veronika; Awayda, Mouhamed S
2011-07-01
Epithelial Na(+) transport as measured by a variety of techniques, including the short-circuit current technique, has been described to exhibit a "rundown" phenomenon. This phenomenon manifests as time-dependent decrease of current and resistance and precludes the ability to carry out prolonged experiments aimed at examining the regulation of this transport. We developed methods for prolonged stable recordings of epithelial Na(+) transport using modifications of the short-circuit current technique and commercial Ussing-type chambers. We utilize the polarized MDCK cell line expressing the epithelial Na(+) channel (ENaC) to describe these methods. Briefly, existing commercial chambers were modified to allow continuous flow of Ringer solution and precise control of such flow. Chamber manifolds and associated plumbing were modified to allow precise temperature clamp preventing temperature oscillations. Recording electrodes were modified to eliminate the use of KCl and prevent membrane depolarization from KCl leakage. Solutions utilized standard bicarbonate-based buffers, but all gasses were prehydrated to clamp buffer osmolarity. We demonstrate that these modifications result in measurements of current and resistance that are stable for at least 2 h. We further demonstrate that drifts in osmolarity similar to those obtained before prior to our modifications can lead to a decrease of current and resistance similar to those attributed to rundown.
A new experimental method to determine the sorption isotherm of a liquid in a porous medium.
Ouoba, Samuel; Cherblanc, Fabien; Cousin, Bruno; Bénet, Jean-Claude
2010-08-01
Sorption from the vapor phase is an important factor controlling the transport of volatile organic compounds (VOCs) in the vadose zone. Therefore, an accurate description of sorption behavior is essential to predict the ultimate fate of contaminants. Several measurement techniques are available in the case of water, however, when dealing with VOCs, the determination of sorption characteristics generally relies on gas chromatography. To avoid some drawbacks associated with this technology, we propose a new method to determine the sorption isotherm of any liquid compounds adsorbed in a soil. This method is based on standard and costless transducers (gas pressure, temperature) leading to a simple and transportable experimental device. A numerical estimation underlines the good accuracy and this technique is validated on two examples. Finally, this method is applied to determine the sorption isotherm of three liquid compounds (water, heptane, and trichloroethylene) in a clayey soil.
Spatial resolution of the electrical conductance of ionic fluids using a Green-Kubo method.
Jones, R E; Ward, D K; Templeton, J A
2014-11-14
We present a Green-Kubo method to spatially resolve transport coefficients in compositionally heterogeneous mixtures. We develop the underlying theory based on well-known results from mixture theory, Irving-Kirkwood field estimation, and linear response theory. Then, using standard molecular dynamics techniques, we apply the methodology to representative systems. With a homogeneous salt water system, where the expectation of the distribution of conductivity is clear, we demonstrate the sensitivities of the method to system size, and other physical and algorithmic parameters. Then we present a simple model of an electrochemical double layer where we explore the resolution limit of the method. In this system, we observe significant anisotropy in the wall-normal vs. transverse ionic conductances, as well as near wall effects. Finally, we discuss extensions and applications to more realistic systems such as batteries where detailed understanding of the transport properties in the vicinity of the electrodes is of technological importance.
Study on transport packages used for food freshness preservation based on thermal analysis
NASA Astrophysics Data System (ADS)
Yu, Ying
2016-12-01
In recent time, as the Chinese consumption level increases, the consumption quantity of high-value fruits, vegetables and seafood products have been increasing year by year. As a consequence, the traffic volume of refrigerated products also increases yearly and the popularization degree of the cold-chain transportation enhances. A low-temperature environment should be guaranteed during transportation, thus there is about 40% of diesel oil should be consumed by the refrigerating system and the cold-chain transportation becomes very costly. This study aimed to explore methods that could reduce the cost of transport packages of refrigerated products. On the basis of the heat transfer theory and the fluid mechanics theory, the heat exchanging process of corrugated cases during the operation of refrigerating system was analyzed, the heat transfer process of corrugated cases and refrigerator van was theoretically analyzed and the heat balance equation of corrugated cases was constructed.
Carrier mobility in organic field-effect transistors
NASA Astrophysics Data System (ADS)
Xu, Yong; Benwadih, Mohamed; Gwoziecki, Romain; Coppard, Romain; Minari, Takeo; Liu, Chuan; Tsukagoshi, Kazuhito; Chroboczek, Jan; Balestra, Francis; Ghibaudo, Gerard
2011-11-01
A study of carrier transport in top-gate and bottom-contact TIPS-pentacene organic field-effect transistors (OFETs) based on mobility is presented. Among three mobilities extracted by different methods, the low-field mobility obtained by the Y function exhibits the best reliability and ease for use, whereas the widely applied field-effect mobility is not reliable, particularly in short-channel transistors and at low temperatures. A detailed study of contact transport reveals its strong impact on short-channel transistors, suggesting that a more intrinsic transport analysis is better implemented in relatively longer-channel devices. The observed temperature dependences of mobility are well explained by a transport model with Gaussian-like diffusivity band tails, different from diffusion in localized states band tails. This model explicitly interprets the non-zero constant mobility at low temperatures and clearly demonstrates the effects of disorder and hopping transport on temperature and carrier density dependences of mobility in organic transistors.
Bioinspired one-dimensional materials for directional liquid transport.
Ju, Jie; Zheng, Yongmei; Jiang, Lei
2014-08-19
One-dimensional materials (1D) capable of transporting liquid droplets directionally, such as spider silks and cactus spines, have recently been gathering scientists' attention due to their potential applications in microfluidics, textile dyeing, filtration, and smog removal. This remarkable property comes from the arrangement of the micro- and nanostructures on these organisms' surfaces, which have inspired chemists to develop methods to prepare surfaces with similar directional liquid transport ability. In this Account, we report our recent progress in understanding how this directional transport works, as well our advances in the design and fabrication of bioinspired 1D materials capable of transporting liquid droplets directionally. To begin, we first discuss some basic theories on droplet directional movement. Then, we discuss the mechanism of directional transport of water droplets on natural spider silks. Upon contact with water droplets, the spider silk undergoes what is known as a wet-rebuilt, which forms periodic spindle-knots and joints. We found that the resulting gradient of Laplace pressure and surface free energy between the spindle-knots and joints account for the cooperative driving forces to transport water droplets directionally. Next, we discuss the directional transport of water droplets on desert cactus. The integration of multilevel structures of the cactus and the resulting integration of multiple functions together allow the cactus spine to transport water droplets continuously from tip to base. Based on our studies of natural spider silks and cactus spines, we have prepared a series of artificial spider silks (A-SSs) and artificial cactus spines (A-CSs) with various methods. By changing the surface roughness and chemical compositions of the artificial spider silks' spindle-knots, or by introducing stimulus-responsive molecules, such as thermal-responsive and photoresponsive molecules, onto the spindle-knots, we can reversibly manipulate the direction of water droplet's movement on the prepared A-SSs. In addition, the A-SSs with nonuniform spindle-knots, such as multilevel sized spindle-knots and gradient spindle-knots, further demonstrate integrated directional transport ability for water droplets. Through mimicking the main principle of cactus spines in transporting water droplets, we were able to fabricate both single and array A-CSs, which are able to transport liquid droplets directionally both in air and under water. Lastly, we demonstrated some applications of this directional liquid transport, from aspects of efficient fog collection to oil/water separation. In addition, we showed some potential applications in smart catalysis, tracer substance enrichment, smog removal, and drug delivery.
Mesoscopic modeling of multi-physicochemical transport phenomena in porous media
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kang, Qinjin; Wang, Moran; Mukherjee, Partha P
2009-01-01
We present our recent progress on mesoscopic modeling of multi-physicochemical transport phenomena in porous media based on the lattice Boltzmann method. Simulation examples include injection of CO{sub 2} saturated brine into a limestone rock, two-phase behavior and flooding phenomena in polymer electrolyte fuel cells, and electroosmosis in homogeneously charged porous media. It is shown that the lattice Boltzmann method can account for multiple, coupled physicochemical processes in these systems and can shed some light on the underlying physics occuning at the fundamental scale. Therefore, it can be a potential powerful numerical tool to analyze multi-physicochemical processes in various energy, earth,more » and environmental systems.« less
Development of Scanning Ultrafast Electron Microscope Capability.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collins, Kimberlee Chiyoko; Talin, Albert Alec; Chandler, David W.
Modern semiconductor devices rely on the transport of minority charge carriers. Direct examination of minority carrier lifetimes in real devices with nanometer-scale features requires a measurement method with simultaneously high spatial and temporal resolutions. Achieving nanometer spatial resolutions at sub-nanosecond temporal resolution is possible with pump-probe methods that utilize electrons as probes. Recently, a stroboscopic scanning electron microscope was developed at Caltech, and used to study carrier transport across a Si p-n junction [ 1 , 2 , 3 ] . In this report, we detail our development of a prototype scanning ultrafast electron microscope system at Sandia National Laboratoriesmore » based on the original Caltech design. This effort represents Sandia's first exploration into ultrafast electron microscopy.« less
Inventory-transportation integrated optimization for maintenance spare parts of high-speed trains
Wang, Jiaxi; Wang, Huasheng; Wang, Zhongkai; Li, Jian; Lin, Ruixi; Xiao, Jie; Wu, Jianping
2017-01-01
This paper presents a 0–1 programming model aimed at obtaining the optimal inventory policy and transportation mode for maintenance spare parts of high-speed trains. To obtain the model parameters for occasionally-replaced spare parts, a demand estimation method based on the maintenance strategies of China’s high-speed railway system is proposed. In addition, we analyse the shortage time using PERT, and then calculate the unit time shortage cost from the viewpoint of train operation revenue. Finally, a real-world case study from Shanghai Depot is conducted to demonstrate our method. Computational results offer an effective and efficient decision support for inventory managers. PMID:28472097
EPA Biofuels Research: Biofuel Vapor Generation and Monitoring Methods
The interest in renewable fuels and alternative energy sources has stimulated development of alternatives to traditional petroleum-based fuels. The EPA's Office of Transportation Air Quality (OTAQ) requires information regarding the potential health hazards ofthese fuels regardin...
NASA Astrophysics Data System (ADS)
Zhang, Xiaoxian; Crawford, John W.; Flavel, Richard J.; Young, Iain M.
2016-10-01
The Lattice Boltzmann (LB) model and X-ray computed tomography (CT) have been increasingly used in combination over the past decade to simulate water flow and chemical transport at pore scale in porous materials. Because of its limitation in resolution and the hierarchical structure of most natural soils, the X-ray CT tomography can only identify pores that are greater than its resolution and treats other pores as solid. As a result, the so-called solid phase in X-ray images may in reality be a grey phase, containing substantial connected pores capable of conducing fluids and solute. Although modified LB models have been developed to simulate fluid flow in such media, models for solute transport are relatively limited. In this paper, we propose a LB model for simulating solute transport in binary soil images containing permeable solid phase. The model is based on the single-relaxation time approach and uses a modified partial bounce-back method to describe the resistance caused by the permeable solid phase to chemical transport. We derive the relationship between the diffusion coefficient and the parameter introduced in the partial bounce-back method, and test the model against analytical solution for movement of a pulse of tracer. We also validate it against classical finite volume method for solute diffusion in a simple 2D image, and then apply the model to a soil image acquired using X-ray tomography at resolution of 30 μm in attempts to analyse how the ability of the solid phase to diffuse solute at micron-scale affects the behaviour of the solute at macro-scale after a volumetric average. Based on the simulated results, we discuss briefly the danger in interpreting experimental results using the continuum model without fully understanding the pore-scale processes, as well as the potential of using pore-scale modelling and tomography to help improve the continuum models.
NASA Astrophysics Data System (ADS)
Pazderin, A. V.; Sof'in, V. V.; Samoylenko, V. O.
2015-11-01
Efforts aimed at improving energy efficiency in all branches of the fuel and energy complex shall be commenced with setting up a high-tech automated system for monitoring and accounting energy resources. Malfunctions and failures in the measurement and information parts of this system may distort commercial measurements of energy resources and lead to financial risks for power supplying organizations. In addition, measurement errors may be connected with intentional distortion of measurements for reducing payment for using energy resources on the consumer's side, which leads to commercial loss of energy resource. The article presents a universal mathematical method for verifying the validity of measurement information in networks for transporting energy resources, such as electricity and heat, petroleum, gas, etc., based on the state estimation theory. The energy resource transportation network is represented by a graph the nodes of which correspond to producers and consumers, and its branches stand for transportation mains (power lines, pipelines, and heat network elements). The main idea of state estimation is connected with obtaining the calculated analogs of energy resources for all available measurements. Unlike "raw" measurements, which contain inaccuracies, the calculated flows of energy resources, called estimates, will fully satisfy the suitability condition for all state equations describing the energy resource transportation network. The state equations written in terms of calculated estimates will be already free from residuals. The difference between a measurement and its calculated analog (estimate) is called in the estimation theory an estimation remainder. The obtained large values of estimation remainders are an indicator of high errors of particular energy resource measurements. By using the presented method it is possible to improve the validity of energy resource measurements, to estimate the transportation network observability, to eliminate the energy resource flows measurement imbalances, and to filter invalid measurements at the data acquisition and processing stage in performing monitoring of an automated energy resource monitoring and accounting system.
NASA Astrophysics Data System (ADS)
Aksenov, A. G.; Chechetkin, V. M.
2018-04-01
Most of the energy released in the gravitational collapse of the cores of massive stars is carried away by neutrinos. Neutrinos play a pivotal role in explaining core-collape supernovae. Currently, mathematical models of the gravitational collapse are based on multi-dimensional gas dynamics and thermonuclear reactions, while neutrino transport is considered in a simplified way. Multidimensional gas dynamics is used with neutrino transport in the flux-limited diffusion approximation to study the role of multi-dimensional effects. The possibility of large-scale convection is discussed, which is interesting both for explaining SN II and for setting up observations to register possible high-energy (≳10MeV) neutrinos from the supernova. A new multi-dimensional, multi-temperature gas dynamics method with neutrino transport is presented.
Interface-facilitated energy transport in coupled Frenkel-Kontorova chains
NASA Astrophysics Data System (ADS)
Su, Rui-Xia; Yuan, Zong-Qiang; Wang, Jun; Zheng, Zhi-Gang
2016-04-01
The role of interface couplings on the energy transport of two coupled Frenkel-Kontorova (FK) chains is explored through numerical simulations. In general, it is expected that the interface couplings result in the suppression of heat conduction through the coupled system due to the additional interface phonon-phonon scattering. In the present paper, it is found that the thermal conductivity increases with increasing intensity of interface interactions for weak inter-chain couplings, whereas the heat conduction is suppressed by the interface interaction in the case of strong inter-chain couplings. Based on the phonon spectral energy density method, we demonstrate that the enhancement of energy transport results from the excited phonon modes (in addition to the intrinsic phonon modes), while the strong interface phonon-phonon scattering results in the suppressed energy transport.
NASA Astrophysics Data System (ADS)
Fujiwara, K.; Shibahara, M.
2018-02-01
Molecular evaporation processes from a vapor-liquid interface formed in a slit-like pore were examined based on the classical molecular dynamics method, in order to elucidate a molecular mechanism of local mass and energy transports in a slit. The calculation system consisted of monatomic molecules and atoms which interact through the 12-6 Lennard-Jones potential. At first, a liquid was situated in a slit with a vapor-liquid interface, and instantaneous amounts of the mass and energy fluxes defined locally in the slit were obtained in two dimensions to reveal local fluctuation properties of the fluid in equilibrium states. Then, imposing a temperature gradient in the calculation system, non-equilibrium evaporation processes in the slit were investigated in details based on the local mass and energy fluxes. In this study, we focused on the fluid which is in the vicinity of the solid surface and in contact with the vapor phase. In the non-equilibrium evaporation processes, the results revealed that the local energy transport mechanism in the vicinity of the solid surface is different from that of the vapor phase, especially in the case of the relatively strong fluid-solid interaction. The results also revealed that the local mass transport in the vicinity of the solid surface can be interpreted based on the mechanism of the local energy transport, and the mechanism provides valuable information about pictures of the evaporation phenomena especially in the vicinity of the hydrophilic surfaces. It suggests that evaluating and changing this mechanism of the local energy transport are necessary to control the local mass flux more precisely in the vicinity of the solid surface.
NASA Astrophysics Data System (ADS)
Korol, Roman; Kilgour, Michael; Segal, Dvira
2018-03-01
We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.
Computational analysis of species transport and electrochemical characteristics of a MOLB-type SOFC
NASA Astrophysics Data System (ADS)
Hwang, J. J.; Chen, C. K.; Lai, D. Y.
A multi-physics model coupling electrochemical kinetics with fluid dynamics has been developed to simulate the transport phenomena in mono-block-layer built (MOLB) solid oxide fuel cells (SOFC). A typical MOLB module is composed of trapezoidal flow channels, corrugated positive electrode-electrolyte-negative electrode (PEN) plates, and planar inter-connecters. The control volume-based finite difference method is employed for calculation, which is based on the conservation of mass, momentum, energy, species, and electric charge. In the porous electrodes, the flow momentum is governed by a Darcy model with constant porosity and permeability. The diffusion of reactants follows the Bruggman model. The chemistry within the plates is described via surface reactions with a fixed surface-to-volume ratio, tortuosity and average pore size. Species transports as well as the local variations of electrochemical characteristics, such as overpotential and current density distributions in the electrodes of an MOLB SOFC, are discussed in detail.
The Intelligence of Dual Simplex Method to Solve Linear Fractional Fuzzy Transportation Problem
Narayanamoorthy, S.; Kalyani, S.
2015-01-01
An approach is presented to solve a fuzzy transportation problem with linear fractional fuzzy objective function. In this proposed approach the fractional fuzzy transportation problem is decomposed into two linear fuzzy transportation problems. The optimal solution of the two linear fuzzy transportations is solved by dual simplex method and the optimal solution of the fractional fuzzy transportation problem is obtained. The proposed method is explained in detail with an example. PMID:25810713
Huang, W.; Zheng, Lingyun; Zhan, X.
2002-01-01
Accurate modelling of groundwater flow and transport with sharp moving fronts often involves high computational cost, when a fixed/uniform mesh is used. In this paper, we investigate the modelling of groundwater problems using a particular adaptive mesh method called the moving mesh partial differential equation approach. With this approach, the mesh is dynamically relocated through a partial differential equation to capture the evolving sharp fronts with a relatively small number of grid points. The mesh movement and physical system modelling are realized by solving the mesh movement and physical partial differential equations alternately. The method is applied to the modelling of a range of groundwater problems, including advection dominated chemical transport and reaction, non-linear infiltration in soil, and the coupling of density dependent flow and transport. Numerical results demonstrate that sharp moving fronts can be accurately and efficiently captured by the moving mesh approach. Also addressed are important implementation strategies, e.g. the construction of the monitor function based on the interpolation error, control of mesh concentration, and two-layer mesh movement. Copyright ?? 2002 John Wiley and Sons, Ltd.
Precision Manipulation with Cooperative Robots
NASA Technical Reports Server (NTRS)
Stroupe, Ashley; Huntsberger, Terry; Okon, Avi; Aghzarian, Hrand
2005-01-01
This work addresses several challenges of cooperative transportThis work addresses several challenges of cooperative transport and precision manipulation. Precision manipulation requires a rigid grasp, which places a hard constraint on the relative rover formation that must be accommodated, even though the rovers cannot directly observe their relative poses. Additionally, rovers must jointly select appropriate actions based on all available sensor information. Lastly, rovers cannot act on independent sensor information, but must fuse information to move jointly; the methods for fusing information must be determined.
Technology Development Risk Assessment for Space Transportation Systems
NASA Technical Reports Server (NTRS)
Mathias, Donovan L.; Godsell, Aga M.; Go, Susie
2006-01-01
A new approach for assessing development risk associated with technology development projects is presented. The method represents technology evolution in terms of sector-specific discrete development stages. A Monte Carlo simulation is used to generate development probability distributions based on statistical models of the discrete transitions. Development risk is derived from the resulting probability distributions and specific program requirements. Two sample cases are discussed to illustrate the approach, a single rocket engine development and a three-technology space transportation portfolio.
Multi Dimensional Honey Bee Foraging Algorithm Based on Optimal Energy Consumption
NASA Astrophysics Data System (ADS)
Saritha, R.; Vinod Chandra, S. S.
2017-10-01
In this paper a new nature inspired algorithm is proposed based on natural foraging behavior of multi-dimensional honey bee colonies. This method handles issues that arise when food is shared from multiple sources by multiple swarms at multiple destinations. The self organizing nature of natural honey bee swarms in multiple colonies is based on the principle of energy consumption. Swarms of multiple colonies select a food source to optimally fulfill the requirements of its colonies. This is based on the energy requirement for transporting food between a source and destination. Minimum use of energy leads to maximizing profit in each colony. The mathematical model proposed here is based on this principle. This has been successfully evaluated by applying it on multi-objective transportation problem for optimizing cost and time. The algorithm optimizes the needs at each destination in linear time.
Xianwei, Tan; Diannan, Lu; Boxiong, Wang
2016-07-19
The EmrD transporter, which is a classical major facilitator superfamily (MFS) protein, can extrude a range of drug molecules out of E. coil. The drug molecules transport through the channel of MFS in an outward open state, an important issue in research about bacterial drug resistance, which however, is still unknown. In this paper, we construct a starting outward-open model of the EmrD transporter using a state transition method. The starting model is refined by a conventional molecular dynamics simulation. Locally enhanced sampling simulation (LES) is used to validate the outward-open model of EmrD. In the locally enhanced sampling simulation, ten substrates are placed along the channel of the outward-open EmrD, and these substrates are sampled in the outward-open center cavity. It is found that the translocation pathway of these substrates from the inside to the outside of the cell through the EmrD transporter is composed of two sub-pathways, one sub-pathway, including H2, H4, and H5, and another sub-pathway, including H8, H10, and H11. The results give us have a further insight to the ways of substrate translocation of an MFS protein. The model method is based on common features of an MFS protein, so this modeling method can be used to construct various MFS protein models which have a desired state with other conformations not known in the alternating-access mechanism.
NASA Technical Reports Server (NTRS)
1986-01-01
Due to large amounts of oxygen required for space travel, a method of mining, transporting, and storing this oxygen in space would facilitate further space exploration. The following project deals specifically with the methods for transporting liquid oxygen from the lunar surface to the Lunar Orbit (LO) space station, and then to the Lower Earth Orbit (LEO) space station. Two vehicles were designed for operation between the LEO and LO space stations. The first of these vehicles is an aerobraked design vehicle. The Aerobrake Orbital Transfer Vehicle (OTV) is capable of transporting 5000 lbm of payload to LO while returning to LEO with 60,000 lbm of liquid oxygen, and thus meet mission requirements. The second vehicle can deliver 18,000 lbm of payload to LO and is capable of bringing 60,000 lbm of liquid oxygen back to LEO. A lunar landing vehicle was also designed for operation between LO and the established moon base. The use of an electromagnetic railgun as a method for launching the lunar lander was also investigated. The feasibility of the railgun is doubtful at this time. A system of spheres was also designed for proper storing and transporting of the liquid oxygen. The system assumes a safe means for transferring the liquid oxygen from tank to tank is operational. A sophisticated life support system was developed for both the OTV and the lunar lander. This system focuses on such factors as the vehicle environment, waste management, water requirements, food requirements, and oxygen requirements.
Alam, Nazmul; Chowdhury, Mahbub Elahi; Kouanda, Seni; Seppey, Mathieu; Alam, Anadil; Savadogo, Justin Ragnessi; Sia, Drissa; Fournier, Pierre
2016-11-01
To understand the role of transportation in accessing health care during pregnancy, delivery, and the postpartum period among women in rural Bangladesh and Burkina Faso. An exploratory mixed methods study was conducted in Mymensingh district in Bangladesh and Kaya district in Burkina Faso. We recruited 300 women from Bangladesh and 340 from Burkina Faso with a delivery outcome within one year of interview. Key informant interviews were conducted with 19 participants and 12 focus group discussions took place with attendees in selected community clinics. Of the interviewees, 45.7% in Bangladesh and 73.2% in Burkina Faso reported having had health complications during their last pregnancy, delivery, or postpartum period. Of all women, 42.7% in Bangladesh and 67.4% in Burkina Faso sought facility care for their complications. Facility-based delivery was much higher in Burkina Faso (87.7%) than Bangladesh (38.2%). Literacy, transport availability, transportation costs, and travel time were associated with care seeking behavior. Lack of reliable transportation was reported as a significant barrier to accessing care during pregnancy, delivery, and postpartum by women in Bangladesh and Burkina Faso. Effort should be made to improve access to emergency obstetric care, and transport intervention should be strengthened. Copyright © 2016 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Heleno, Sandra; Matias, Magda; Pina, Pedro
2015-04-01
Visual interpretation of satellite imagery remains extremely demanding in terms of resources and time, especially when dealing with numerous multi-scale landslides affecting wide areas, such as is the case of rainfall-induced shallow landslides. Applying automated methods can contribute to more efficient landslide mapping and updating of existing inventories, and in recent years the number and variety of approaches is rapidly increasing. Very High Resolution (VHR) images, acquired by space-borne sensors with sub-metric precision, such as Ikonos, Quickbird, Geoeye and Worldview, are increasingly being considered as the best option for landslide mapping, but these new levels of spatial detail also present new challenges to state of the art image analysis tools, asking for automated methods specifically suited to map landslide events on VHR optical images. In this work we develop and test a methodology for semi-automatic landslide recognition and mapping of landslide source and transport areas. The method combines object-based image analysis and a Support Vector Machine supervised learning algorithm, and was tested using a GeoEye-1 multispectral image, sensed 3 days after a damaging landslide event in Madeira Island, together with a pre-event LiDAR DEM. Our approach has proved successful in the recognition of landslides on a 15 Km2-wide study area, with 81 out of 85 landslides detected in its validation regions. The classifier also showed reasonable performance (false positive rate 60% and false positive rate below 36% in both validation regions) in the internal mapping of landslide source and transport areas, in particular in the sunnier east-facing slopes. In the less illuminated areas the classifier is still able to accurately map the source areas, but performs poorly in the mapping of landslide transport areas.
Dynamic Integration of Mobile JXTA with Cloud Computing for Emergency Rural Public Health Care
Rajkumar, Rajasekaran; Sriman Narayana Iyengar, Nallani Chackravatula
2013-01-01
Objectives The existing processes of health care systems where data collection requires a great deal of labor with high-end tasks to retrieve and analyze information, are usually slow, tedious, and error prone, which restrains their clinical diagnostic and monitoring capabilities. Research is now focused on integrating cloud services with P2P JXTA to identify systematic dynamic process for emergency health care systems. The proposal is based on the concepts of a community cloud for preventative medicine, to help promote a healthy rural community. We investigate the approaches of patient health monitoring, emergency care, and an ambulance alert alarm (AAA) under mobile cloud-based telecare or community cloud controller systems. Methods Considering permanent mobile users, an efficient health promotion method is proposed. Experiments were conducted to verify the effectiveness of the method. The performance was evaluated from September 2011 to July 2012. A total of 1,856,454 cases were transported and referred to hospital, identified with health problems, and were monitored. We selected all the peer groups and the control server N0 which controls N1, N2, and N3 proxied peer groups. The hospital cloud controller maintains the database of the patients through a JXTA network. Results Among 1,856,454 transported cases with beneficiaries of 1,712,877 cases there were 1,662,834 lives saved and 8,500 cases transported per day with 104,530 transported cases found to be registered in a JXTA network. Conclusion The registered case histories were referred from the Hospital community cloud (HCC). SMS messages were sent from node N0 to the relay peers which connected to the N1, N2, and N3 nodes, controlled by the cloud controller through a JXTA network. PMID:24298441
Quantitative phase measurement for wafer-level optics
NASA Astrophysics Data System (ADS)
Qu, Weijuan; Wen, Yongfu; Wang, Zhaomin; Yang, Fang; Huang, Lei; Zuo, Chao
2015-07-01
Wafer-level-optics now is widely used in smart phone camera, mobile video conferencing or in medical equipment that require tiny cameras. Extracting quantitative phase information has received increased interest in order to quantify the quality of manufactured wafer-level-optics, detect defective devices before packaging, and provide feedback for manufacturing process control, all at the wafer-level for high-throughput microfabrication. We demonstrate two phase imaging methods, digital holographic microscopy (DHM) and Transport-of-Intensity Equation (TIE) to measure the phase of the wafer-level lenses. DHM is a laser-based interferometric method based on interference of two wavefronts. It can perform a phase measurement in a single shot. While a minimum of two measurements of the spatial intensity of the optical wave in closely spaced planes perpendicular to the direction of propagation are needed to do the direct phase retrieval by solving a second-order differential equation, i.e., with a non-iterative deterministic algorithm from intensity measurements using the Transport-of-Intensity Equation (TIE). But TIE is a non-interferometric method, thus can be applied to partial-coherence light. We demonstrated the capability and disability for the two phase measurement methods for wafer-level optics inspection.
Bejaei, M; Cheng, K M
2014-02-01
Appropriate management of an ostrich's exposure to stressors during preslaughter handling and transport practices can improve its well-being and product quality. Because of the lack of information about ostrich farming and transportation in North America and lack of developed Codes of Practice for ratite transport in Canada and the United States, the first objective of our research was to identify current preslaughter handling and transport practices of the ostrich industry in Canada and the United States, and to identify potential welfare issues based on the current practices. The second objective of this research was to review ostrich transport welfare standards and guidelines from Australia, European Union, New Zealand, and South Africa to investigate if those guidelines are applicable to Canadian and American ostrich production systems. Preliminary producer interviews, on-farm visits, and literature review information sources were used to design a producer questionnaire that was used to survey producers by Internet and mail surveying methods to identify existing ostrich transport norms in Canada and the United States. Based on the results of our producer survey and review of the transport standards and guidelines, we conclude that following factors are potential ostrich handling and transport welfare issues in Canada and the United States: lack of scientific information about welfare of ostriches during handling and transport; unfamiliarity of handlers and birds with handling and transport practices; not considering birds' social bounds, sex, behavior, and physical state in mixing them during handling and transport process; lack of an established specific maximum water and feed withdrawal duration for ostrich transport in Canada and the United States; lack of a specific vehicle designed for ratite transportation in Canada and the United States considering different physical body characteristics of ostriches compared with other species; exposure of birds to natural light during transport inside the trailer; overcrowding; and long transportation in Canada and the United States. Results of this research will contribute toward developing Codes of Practice for preslaughter handling, transportation, and slaughter of ostriches in Canada and the United States.