Obtaining parsimonious hydraulic conductivity fields using head and transport observations: A Bayesian geostatistical parameter estimation approach

NASA Astrophysics Data System (ADS)

Fienen, M.; Hunt, R.; Krabbenhoft, D.; Clemo, T.

2009-08-01

Flow path delineation is a valuable tool for interpreting the subsurface hydrogeochemical environment. Different types of data, such as groundwater flow and transport, inform different aspects of hydrogeologic parameter values (hydraulic conductivity in this case) which, in turn, determine flow paths. This work combines flow and transport information to estimate a unified set of hydrogeologic parameters using the Bayesian geostatistical inverse approach. Parameter flexibility is allowed by using a highly parameterized approach with the level of complexity informed by the data. Despite the effort to adhere to the ideal of minimal a priori structure imposed on the problem, extreme contrasts in parameters can result in the need to censor correlation across hydrostratigraphic bounding surfaces. These partitions segregate parameters into facies associations. With an iterative approach in which partitions are based on inspection of initial estimates, flow path interpretation is progressively refined through the inclusion of more types of data. Head observations, stable oxygen isotopes (18O/16O ratios), and tritium are all used to progressively refine flow path delineation on an isthmus between two lakes in the Trout Lake watershed, northern Wisconsin, United States. Despite allowing significant parameter freedom by estimating many distributed parameter values, a smooth field is obtained.

Obtaining parsimonious hydraulic conductivity fields using head and transport observations: A Bayesian geostatistical parameter estimation approach

USGS Publications Warehouse

Fienen, M.; Hunt, R.; Krabbenhoft, D.; Clemo, T.

2009-01-01

Flow path delineation is a valuable tool for interpreting the subsurface hydrogeochemical environment. Different types of data, such as groundwater flow and transport, inform different aspects of hydrogeologic parameter values (hydraulic conductivity in this case) which, in turn, determine flow paths. This work combines flow and transport information to estimate a unified set of hydrogeologic parameters using the Bayesian geostatistical inverse approach. Parameter flexibility is allowed by using a highly parameterized approach with the level of complexity informed by the data. Despite the effort to adhere to the ideal of minimal a priori structure imposed on the problem, extreme contrasts in parameters can result in the need to censor correlation across hydrostratigraphic bounding surfaces. These partitions segregate parameters into facies associations. With an iterative approach in which partitions are based on inspection of initial estimates, flow path interpretation is progressively refined through the inclusion of more types of data. Head observations, stable oxygen isotopes (18O/16O ratios), and tritium are all used to progressively refine flow path delineation on an isthmus between two lakes in the Trout Lake watershed, northern Wisconsin, United States. Despite allowing significant parameter freedom by estimating many distributed parameter values, a smooth field is obtained.

Effect of UV light on different structural and transport parameters of cellophane membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benavente, J.; Vazquez, M.I.; De Abajo, J.

1996-01-01

A comparative study of UV light influence on structural and transport parameters of cellophane membranes was made. Changes in the chemical structure and electrical behavior of cellophane membranes were considered by determining the hydraulic permeability, salt diffusion coefficient, and resistance values, as well as some geometrical parameters, for an untreated membrane and two differently UV-treated cellophane membranes. Differences in the characteristic parameters for the three samples showed that radiation mainly affected the membrane structure, while only small changes in membrane electrical behavior were determined.

Using dual-domain advective-transport simulation to reconcile multiple-tracer ages and estimate dual-porosity transport parameters

NASA Astrophysics Data System (ADS)

Sanford, Ward E.; Niel Plummer, L.; Casile, Gerolamo; Busenberg, Ed; Nelms, David L.; Schlosser, Peter

2017-06-01

Dual-domain transport is an alternative conceptual and mathematical paradigm to advection-dispersion for describing the movement of dissolved constituents in groundwater. Here we test the use of a dual-domain algorithm combined with advective pathline tracking to help reconcile environmental tracer concentrations measured in springs within the Shenandoah Valley, USA. The approach also allows for the estimation of the three dual-domain parameters: mobile porosity, immobile porosity, and a domain exchange rate constant. Concentrations of CFC-113, SF6, 3H, and 3He were measured at 28 springs emanating from carbonate rocks. The different tracers give three different mean composite piston-flow ages for all the springs that vary from 5 to 18 years. Here we compare four algorithms that interpret the tracer concentrations in terms of groundwater age: piston flow, old-fraction mixing, advective-flow path modeling, and dual-domain modeling. Whereas the second two algorithms made slight improvements over piston flow at reconciling the disparate piston-flow age estimates, the dual-domain algorithm gave a very marked improvement. Optimal values for the three transport parameters were also obtained, although the immobile porosity value was not well constrained. Parameter correlation and sensitivities were calculated to help quantify the uncertainty. Although some correlation exists between the three parameters being estimated, a watershed simulation of a pollutant breakthrough to a local stream illustrates that the estimated transport parameters can still substantially help to constrain and predict the nature and timing of solute transport. The combined use of multiple environmental tracers with this dual-domain approach could be applicable in a wide variety of fractured-rock settings.

Optimal solution of full fuzzy transportation problems using total integral ranking

NASA Astrophysics Data System (ADS)

Sam’an, M.; Farikhin; Hariyanto, S.; Surarso, B.

2018-03-01

Full fuzzy transportation problem (FFTP) is a transportation problem where transport costs, demand, supply and decision variables are expressed in form of fuzzy numbers. To solve fuzzy transportation problem, fuzzy number parameter must be converted to a crisp number called defuzzyfication method. In this new total integral ranking method with fuzzy numbers from conversion of trapezoidal fuzzy numbers to hexagonal fuzzy numbers obtained result of consistency defuzzyfication on symmetrical fuzzy hexagonal and non symmetrical type 2 numbers with fuzzy triangular numbers. To calculate of optimum solution FTP used fuzzy transportation algorithm with least cost method. From this optimum solution, it is found that use of fuzzy number form total integral ranking with index of optimism gives different optimum value. In addition, total integral ranking value using hexagonal fuzzy numbers has an optimal value better than the total integral ranking value using trapezoidal fuzzy numbers.

Estimating the solute transport parameters of the spatial fractional advection-dispersion equation using Bees Algorithm

NASA Astrophysics Data System (ADS)

Mehdinejadiani, Behrouz

2017-08-01

This study represents the first attempt to estimate the solute transport parameters of the spatial fractional advection-dispersion equation using Bees Algorithm. The numerical studies as well as the experimental studies were performed to certify the integrity of Bees Algorithm. The experimental ones were conducted in a sandbox for homogeneous and heterogeneous soils. A detailed comparative study was carried out between the results obtained from Bees Algorithm and those from Genetic Algorithm and LSQNONLIN routines in FracFit toolbox. The results indicated that, in general, the Bees Algorithm much more accurately appraised the sFADE parameters in comparison with Genetic Algorithm and LSQNONLIN, especially in the heterogeneous soil and for α values near to 1 in the numerical study. Also, the results obtained from Bees Algorithm were more reliable than those from Genetic Algorithm. The Bees Algorithm showed the relative similar performances for all cases, while the Genetic Algorithm and the LSQNONLIN yielded different performances for various cases. The performance of LSQNONLIN strongly depends on the initial guess values so that, compared to the Genetic Algorithm, it can more accurately estimate the sFADE parameters by taking into consideration the suitable initial guess values. To sum up, the Bees Algorithm was found to be very simple, robust and accurate approach to estimate the transport parameters of the spatial fractional advection-dispersion equation.

Estimating the solute transport parameters of the spatial fractional advection-dispersion equation using Bees Algorithm.

PubMed

Mehdinejadiani, Behrouz

2017-08-01

This study represents the first attempt to estimate the solute transport parameters of the spatial fractional advection-dispersion equation using Bees Algorithm. The numerical studies as well as the experimental studies were performed to certify the integrity of Bees Algorithm. The experimental ones were conducted in a sandbox for homogeneous and heterogeneous soils. A detailed comparative study was carried out between the results obtained from Bees Algorithm and those from Genetic Algorithm and LSQNONLIN routines in FracFit toolbox. The results indicated that, in general, the Bees Algorithm much more accurately appraised the sFADE parameters in comparison with Genetic Algorithm and LSQNONLIN, especially in the heterogeneous soil and for α values near to 1 in the numerical study. Also, the results obtained from Bees Algorithm were more reliable than those from Genetic Algorithm. The Bees Algorithm showed the relative similar performances for all cases, while the Genetic Algorithm and the LSQNONLIN yielded different performances for various cases. The performance of LSQNONLIN strongly depends on the initial guess values so that, compared to the Genetic Algorithm, it can more accurately estimate the sFADE parameters by taking into consideration the suitable initial guess values. To sum up, the Bees Algorithm was found to be very simple, robust and accurate approach to estimate the transport parameters of the spatial fractional advection-dispersion equation. Copyright © 2017 Elsevier B.V. All rights reserved.

Phase I Contaminant Transport Parameters for the Groundwater Flow and Contaminant Transport Model of Corrective Action Unit 97: Yucca Flat/Climax Mine, Nevada Test Site, Nye County, Nevada, Revision 0

DOE Office of Scientific and Technical Information (OSTI.GOV)

John McCord

2007-09-01

This report documents transport data and data analyses for Yucca Flat/Climax Mine CAU 97. The purpose of the data compilation and related analyses is to provide the primary reference to support parameterization of the Yucca Flat/Climax Mine CAU transport model. Specific task objectives were as follows: • Identify and compile currently available transport parameter data and supporting information that may be relevant to the Yucca Flat/Climax Mine CAU. • Assess the level of quality of the data and associated documentation. • Analyze the data to derive expected values and estimates of the associated uncertainty and variability. The scope of thismore » document includes the compilation and assessment of data and information relevant to transport parameters for the Yucca Flat/Climax Mine CAU subsurface within the context of unclassified source-term contamination. Data types of interest include mineralogy, aqueous chemistry, matrix and effective porosity, dispersivity, matrix diffusion, matrix and fracture sorption, and colloid-facilitated transport parameters.« less

Parameter and observation importance in modelling virus transport in saturated porous media - Investigations in a homogenous system

USGS Publications Warehouse

Barth, Gilbert R.; Hill, M.C.

2005-01-01

This paper evaluates the importance of seven types of parameters to virus transport: hydraulic conductivity, porosity, dispersivity, sorption rate and distribution coefficient (representing physical-chemical filtration), and in-solution and adsorbed inactivation (representing virus inactivation). The first three parameters relate to subsurface transport in general while the last four, the sorption rate, distribution coefficient, and in-solution and adsorbed inactivation rates, represent the interaction of viruses with the porous medium and their ability to persist. The importance of four types of observations to estimate the virus-transport parameters are evaluated: hydraulic heads, flow, temporal moments of conservative-transport concentrations, and virus concentrations. The evaluations are conducted using one- and two-dimensional homogeneous simulations, designed from published field experiments, and recently developed sensitivity-analysis methods. Sensitivity to the transport-simulation time-step size is used to evaluate the importance of numerical solution difficulties. Results suggest that hydraulic conductivity, porosity, and sorption are most important to virus-transport predictions. Most observation types provide substantial information about hydraulic conductivity and porosity; only virus-concentration observations provide information about sorption and inactivation. The observations are not sufficient to estimate these important parameters uniquely. Even with all observation types, there is extreme parameter correlation between porosity and hydraulic conductivity and between the sorption rate and in-solution inactivation. Parameter estimation was accomplished by fixing values of porosity and in-solution inactivation.

Aspects of metallic low-temperature transport in Mott-insulator/band-insulator superlattices: Optical conductivity and thermoelectricity

NASA Astrophysics Data System (ADS)

Rüegg, Andreas; Pilgram, Sebastian; Sigrist, Manfred

2008-06-01

We investigate the low-temperature electrical and thermal transport properties in atomically precise metallic heterostructures involving strongly correlated electron systems. The model of the Mott-insulator/band-insulator superlattice was discussed in the framework of the slave-boson mean-field approximation and transport quantities were derived by use of the Boltzmann transport equation in the relaxation-time approximation. The results for the optical conductivity are in good agreement with recently published experimental data on (LaTiO3)N/(SrTiO3)M superlattices and allow us to estimate the values of key parameters of the model. Furthermore, predictions for the thermoelectric response were made and the dependence of the Seebeck coefficient on model parameters was studied in detail. The width of the Mott-insulating material was identified as the most relevant parameter, in particular, this parameter provides a way to optimize the thermoelectric power factor at low temperatures.

Assessment of key transport parameters in a karst system under different dynamic conditions based on tracer experiments: the Jeita karst system, Lebanon

NASA Astrophysics Data System (ADS)

Doummar, Joanna; Margane, Armin; Geyer, Tobias; Sauter, Martin

2018-03-01

Artificial tracer experiments were conducted in the mature karst system of Jeita (Lebanon) under various flow conditions using surface and subsurface tracer injection points, to determine the variation of transport parameters (attenuation of peak concentration, velocity, transit times, dispersivity, and proportion of immobile and mobile regions) along fast and slow flow pathways. Tracer breakthrough curves (TBCs) observed at the karst spring were interpreted using a two-region nonequilibrium approach (2RNEM) to account for the skewness in the TBCs' long tailings. The conduit test results revealed a discharge threshold in the system dynamics, beyond which the transport parameters vary significantly. The polynomial relationship between transport velocity and discharge can be related to the variation of the conduit's cross-sectional area. Longitudinal dispersivity in the conduit system is not a constant value (α = 7-10 m) and decreases linearly with increasing flow rate because of dilution effects. Additionally, the proportion of immobile regions (arising from conduit irregularities) increases with decreasing water level in the conduit system. From tracer tests with injection at the surface, longitudinal dispersivity values are found to be large (8-27 m). The tailing observed in some TBCs is generated in the unsaturated zone before the tracer actually arrives at the major subsurface conduit draining the system. This work allows the estimation and prediction of the key transport parameters in karst aquifers. It shows that these parameters vary with time and flow dynamics, and they reflect the geometry of the flow pathway and the origin of infiltrating (potentially contaminated) recharge.

Increased Uptake of Chelated Copper Ions by Lolium perenne Attributed to Amplified Membrane and Endodermal Damage

PubMed Central

Johnson, Anthea; Singhal, Naresh

2015-01-01

The contributions of mechanisms by which chelators influence metal translocation to plant shoot tissues are analyzed using a combination of numerical modelling and physical experiments. The model distinguishes between apoplastic and symplastic pathways of water and solute movement. It also includes the barrier effects of the endodermis and plasma membrane. Simulations are used to assess transport pathways for free and chelated metals, identifying mechanisms involved in chelate-enhanced phytoextraction. Hypothesized transport mechanisms and parameters specific to amendment treatments are estimated, with simulated results compared to experimental data. Parameter values for each amendment treatment are estimated based on literature and experimental values, and used for model calibration and simulation of amendment influences on solute transport pathways and mechanisms. Modeling indicates that chelation alters the pathways for Cu transport. For free ions, Cu transport to leaf tissue can be described using purely apoplastic or transcellular pathways. For strong chelators (ethylenediaminetetraacetic acid (EDTA) and diethylenetriaminepentaacetic acid (DTPA)), transport by the purely apoplastic pathway is insufficient to represent measured Cu transport to leaf tissue. Consistent with experimental observations, increased membrane permeability is required for simulating translocation in EDTA and DTPA treatments. Increasing the membrane permeability is key to enhancing phytoextraction efficiency. PMID:26512647

Rheological characterization of neutral and anionic polysaccharides with reduced mucociliary transport rates.

PubMed

Shah, Ankur J; Donovan, Maureen D

2007-04-20

The purpose of this research was to compare the viscoelastic properties of several neutral and anionic polysaccharide polymers with their mucociliary transport rates (MTR) across explants of ciliated bovine tracheal tissue to identify rheologic parameters capable of predicting the extent of reduction in mucociliary transport. The viscoelastic properties of the polymer gels and gels mixed with mucus were quantified using controlled stress rheometry. In general, the anionic polysaccharides were more efficient at decreasing the mucociliary transport rate than were the neutral polymers, and a concentration threshold, where no further decreases in mucociliary transport occurred with increasing polymer concentration, was observed for several of the neutral polysaccharides. No single rheologic parameter (eta, G', G'', tan delta, G*) was a good predictor of the extent of mucociliary transport reduction, but a combination of the apparent viscosity (eta), tangent to the phase angle (tan delta), and complex modulus (G*) was found to be useful in the identification of formulations capable of decreasing MTR. The relative values of each of the rheologic parameters were unique for each polymer, yet once the relationships between the rheologic parameters and mucociliary transport rate reduction were determined, formulations capable of resisting mucociliary clearance could be rapidly optimized.

Modelling Transcapillary Transport of Fluid and Proteins in Hemodialysis Patients

PubMed Central

Pietribiasi, Mauro; Waniewski, Jacek; Załuska, Alicja; Załuska, Wojciech; Lindholm, Bengt

2016-01-01

Background The kinetics of protein transport to and from the vascular compartment play a major role in the determination of fluid balance and plasma refilling during hemodialysis (HD) sessions. In this study we propose a whole-body mathematical model describing water and protein shifts across the capillary membrane during HD and compare its output to clinical data while evaluating the impact of choosing specific values for selected parameters. Methods The model follows a two-compartment structure (vascular and interstitial space) and is based on balance equations of protein mass and water volume in each compartment. The capillary membrane was described according to the three-pore theory. Two transport parameters, the fractional contribution of large pores (αLP) and the total hydraulic conductivity (LpS) of the capillary membrane, were estimated from patient data. Changes in the intensity and direction of individual fluid and solute flows through each part of the transport system were analyzed in relation to the choice of different values of small pores radius and fractional conductivity, lymphatic sensitivity to hydraulic pressure, and steady-state interstitial-to-plasma protein concentration ratio. Results The estimated values of LpS and αLP were respectively 10.0 ± 8.4 mL/min/mmHg (mean ± standard deviation) and 0.062 ± 0.041. The model was able to predict with good accuracy the profiles of plasma volume and serum total protein concentration in most of the patients (average root-mean-square deviation < 2% of the measured value). Conclusions The applied model provides a mechanistic interpretation of fluid transport processes induced by ultrafiltration during HD, using a minimum of tuned parameters and assumptions. The simulated values of individual flows through each kind of pore and lymphatic absorption rate yielded by the model may suggest answers to unsolved questions on the relative impact of these not-measurable quantities on total vascular refilling and fluid balance. PMID:27483369

Multiobjective sampling design for parameter estimation and model discrimination in groundwater solute transport

USGS Publications Warehouse

Knopman, Debra S.; Voss, Clifford I.

1989-01-01

Sampling design for site characterization studies of solute transport in porous media is formulated as a multiobjective problem. Optimal design of a sampling network is a sequential process in which the next phase of sampling is designed on the basis of all available physical knowledge of the system. Three objectives are considered: model discrimination, parameter estimation, and cost minimization. For the first two objectives, physically based measures of the value of information obtained from a set of observations are specified. In model discrimination, value of information of an observation point is measured in terms of the difference in solute concentration predicted by hypothesized models of transport. Points of greatest difference in predictions can contribute the most information to the discriminatory power of a sampling design. Sensitivity of solute concentration to a change in a parameter contributes information on the relative variance of a parameter estimate. Inclusion of points in a sampling design with high sensitivities to parameters tends to reduce variance in parameter estimates. Cost minimization accounts for both the capital cost of well installation and the operating costs of collection and analysis of field samples. Sensitivities, discrimination information, and well installation and sampling costs are used to form coefficients in the multiobjective problem in which the decision variables are binary (zero/one), each corresponding to the selection of an observation point in time and space. The solution to the multiobjective problem is a noninferior set of designs. To gain insight into effective design strategies, a one-dimensional solute transport problem is hypothesized. Then, an approximation of the noninferior set is found by enumerating 120 designs and evaluating objective functions for each of the designs. Trade-offs between pairs of objectives are demonstrated among the models. The value of an objective function for a given design is shown to correspond to the ability of a design to actually meet an objective.

Experimental design for estimating parameters of rate-limited mass transfer: Analysis of stream tracer studies

USGS Publications Warehouse

Wagner, Brian J.; Harvey, Judson W.

1997-01-01

Tracer experiments are valuable tools for analyzing the transport characteristics of streams and their interactions with shallow groundwater. The focus of this work is the design of tracer studies in high-gradient stream systems subject to advection, dispersion, groundwater inflow, and exchange between the active channel and zones in surface or subsurface water where flow is stagnant or slow moving. We present a methodology for (1) evaluating and comparing alternative stream tracer experiment designs and (2) identifying those combinations of stream transport properties that pose limitations to parameter estimation and therefore a challenge to tracer test design. The methodology uses the concept of global parameter uncertainty analysis, which couples solute transport simulation with parameter uncertainty analysis in a Monte Carlo framework. Two general conclusions resulted from this work. First, the solute injection and sampling strategy has an important effect on the reliability of transport parameter estimates. We found that constant injection with sampling through concentration rise, plateau, and fall provided considerably more reliable parameter estimates than a pulse injection across the spectrum of transport scenarios likely encountered in high-gradient streams. Second, for a given tracer test design, the uncertainties in mass transfer and storage-zone parameter estimates are strongly dependent on the experimental Damkohler number, DaI, which is a dimensionless combination of the rates of exchange between the stream and storage zones, the stream-water velocity, and the stream reach length of the experiment. Parameter uncertainties are lowest at DaI values on the order of 1.0. When DaI values are much less than 1.0 (owing to high velocity, long exchange timescale, and/or short reach length), parameter uncertainties are high because only a small amount of tracer interacts with storage zones in the reach. For the opposite conditions (DaI ≫ 1.0), solute exchange rates are fast relative to stream-water velocity and all solute is exchanged with the storage zone over the experimental reach. As DaI increases, tracer dispersion caused by hyporheic exchange eventually reaches an equilibrium condition and storage-zone exchange parameters become essentially nonidentifiable.

Optimal Cytoplasmic Transport in Viral Infections

PubMed Central

D'Orsogna, Maria R.; Chou, Tom

2009-01-01

For many viruses, the ability to infect eukaryotic cells depends on their transport through the cytoplasm and across the nuclear membrane of the host cell. During this journey, viral contents are biochemically processed into complexes capable of both nuclear penetration and genomic integration. We develop a stochastic model of viral entry that incorporates all relevant aspects of transport, including convection along microtubules, biochemical conversion, degradation, and nuclear entry. Analysis of the nuclear infection probabilities in terms of the transport velocity, degradation, and biochemical conversion rates shows how certain values of key parameters can maximize the nuclear entry probability of the viral material. The existence of such “optimal” infection scenarios depends on the details of the biochemical conversion process and implies potentially counterintuitive effects in viral infection, suggesting new avenues for antiviral treatment. Such optimal parameter values provide a plausible transport-based explanation of the action of restriction factors and of experimentally observed optimal capsid stability. Finally, we propose a new interpretation of how genetic mutations unrelated to the mechanism of drug action may nonetheless confer novel types of overall drug resistance. PMID:20046829

Electronic transport properties of 4f shell elements of liquid metal using hard sphere Yukawa system

NASA Astrophysics Data System (ADS)

Patel, H. P.; Sonvane, Y. A.; Thakor, P. B.

2018-04-01

The electronic transport properties are analyzed for 4f shell elements of liquid metals. To examine the electronic transport properties like electrical resistivity (ρ), thermal conductivity (σ) and thermo electrical power (Q), we used our own parameter free model potential with the Hard Sphere Yukawa (HSY) reference system. The screening effect on aforesaid properties has been examined by using different screening functions like Hartree (H), Taylor (T) and Sarkar (S). The correlations of our resultsand other data with available experimental values are intensely promising. Also, we conclude that our newly constructed parameter free model potential is capable of explaining the above mentioned electronic transport properties.

Monte Carlo sensitivity analysis of unknown parameters in hazardous materials transportation risk assessment.

PubMed

Pet-Armacost, J J; Sepulveda, J; Sakude, M

1999-12-01

The US Department of Transportation was interested in the risks associated with transporting Hydrazine in tanks with and without relief devices. Hydrazine is both highly toxic and flammable, as well as corrosive. Consequently, there was a conflict as to whether a relief device should be used or not. Data were not available on the impact of relief devices on release probabilities or the impact of Hydrazine on the likelihood of fires and explosions. In this paper, a Monte Carlo sensitivity analysis of the unknown parameters was used to assess the risks associated with highway transport of Hydrazine. To help determine whether or not relief devices should be used, fault trees and event trees were used to model the sequences of events that could lead to adverse consequences during transport of Hydrazine. The event probabilities in the event trees were derived as functions of the parameters whose effects were not known. The impacts of these parameters on the risk of toxic exposures, fires, and explosions were analyzed through a Monte Carlo sensitivity analysis and analyzed statistically through an analysis of variance. The analysis allowed the determination of which of the unknown parameters had a significant impact on the risks. It also provided the necessary support to a critical transportation decision even though the values of several key parameters were not known.

Effects of reaction-kinetic parameters on modeling reaction pathways in GaN MOVPE growth

NASA Astrophysics Data System (ADS)

Zhang, Hong; Zuo, Ran; Zhang, Guoyi

2017-11-01

In the modeling of the reaction-transport process in GaN MOVPE growth, the selections of kinetic parameters (activation energy Ea and pre-exponential factor A) for gas reactions are quite uncertain, which cause uncertainties in both gas reaction path and growth rate. In this study, numerical modeling of the reaction-transport process for GaN MOVPE growth in a vertical rotating disk reactor is conducted with varying kinetic parameters for main reaction paths. By comparisons of the molar concentrations of major Ga-containing species and the growth rates, the effects of kinetic parameters on gas reaction paths are determined. The results show that, depending on the values of the kinetic parameters, the gas reaction path may be dominated either by adduct/amide formation path, or by TMG pyrolysis path, or by both. Although the reaction path varies with different kinetic parameters, the predicted growth rates change only slightly because the total transport rate of Ga-containing species to the substrate changes slightly with reaction paths. This explains why previous authors using different chemical models predicted growth rates close to the experiment values. By varying the pre-exponential factor for the amide trimerization, it is found that the more trimers are formed, the lower the growth rates are than the experimental value, which indicates that trimers are poor growth precursors, because of thermal diffusion effect caused by high temperature gradient. The effective order for the contribution of major species to growth rate is found as: pyrolysis species > amides > trimers. The study also shows that radical reactions have little effect on gas reaction path because of the generation and depletion of H radicals in the chain reactions when NH2 is considered as the end species.

Mixing effects on apparent reaction rates and isotope fractionation during denitrification in a heterogeneous aquifer

USGS Publications Warehouse

Green, Christopher T.; Böhlke, John Karl; Bekins, Barbara A.; Phillips, Steven P.

2010-01-01

Gradients in contaminant concentrations and isotopic compositions commonly are used to derive reaction parameters for natural attenuation in aquifers. Differences between field‐scale (apparent) estimated reaction rates and isotopic fractionations and local‐scale (intrinsic) effects are poorly understood for complex natural systems. For a heterogeneous alluvial fan aquifer, numerical models and field observations were used to study the effects of physical heterogeneity on reaction parameter estimates. Field measurements included major ions, age tracers, stable isotopes, and dissolved gases. Parameters were estimated for the O2 reduction rate, denitrification rate, O2 threshold for denitrification, and stable N isotope fractionation during denitrification. For multiple geostatistical realizations of the aquifer, inverse modeling was used to establish reactive transport simulations that were consistent with field observations and served as a basis for numerical experiments to compare sample‐based estimates of “apparent” parameters with “true“ (intrinsic) values. For this aquifer, non‐Gaussian dispersion reduced the magnitudes of apparent reaction rates and isotope fractionations to a greater extent than Gaussian mixing alone. Apparent and true rate constants and fractionation parameters can differ by an order of magnitude or more, especially for samples subject to slow transport, long travel times, or rapid reactions. The effect of mixing on apparent N isotope fractionation potentially explains differences between previous laboratory and field estimates. Similarly, predicted effects on apparent O2threshold values for denitrification are consistent with previous reports of higher values in aquifers than in the laboratory. These results show that hydrogeological complexity substantially influences the interpretation and prediction of reactive transport.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makhnovskii, Yurii A.; Berezhkovskii, Alexander M.; Antipov, Anatoly E.

This paper is devoted to particle transport in a tube formed by alternating wide and narrow sections, in the presence of an external biasing force. The focus is on the effective transport coefficients—mobility and diffusivity, as functions of the biasing force and the geometric parameters of the tube. Dependences of the effective mobility and diffusivity on the tube geometric parameters are known in the limiting cases of no bias and strong bias. The approximations used to obtain these results are inapplicable at intermediate values of the biasing force. To bridge the two limits Brownian dynamics simulations were run to determinemore » the transport coefficients at intermediate values of the force. The simulations were performed for a representative set of tube geometries over a wide range of the biasing force. They revealed that there is a range of the narrow section length, where the force dependence of the mobility has a maximum. In contrast, the diffusivity is a monotonically increasing function of the force. A simple formula is proposed, which reduces to the known dependences of the diffusivity on the tube geometric parameters in both limits of zero and strong bias. At intermediate values of the biasing force, the formula catches the diffusivity dependence on the narrow section length, if the radius of these sections is not too small.« less

MODFLOW-2000 : the U.S. Geological Survey modular ground-water model--documentation of the Advective-Transport Observation (ADV2) Package

USGS Publications Warehouse

Anderman, Evan R.; Hill, Mary Catherine

2001-01-01

Observations of the advective component of contaminant transport in steady-state flow fields can provide important information for the calibration of ground-water flow models. This report documents the Advective-Transport Observation (ADV2) Package, version 2, which allows advective-transport observations to be used in the three-dimensional ground-water flow parameter-estimation model MODFLOW-2000. The ADV2 Package is compatible with some of the features in the Layer-Property Flow and Hydrogeologic-Unit Flow Packages, but is not compatible with the Block-Centered Flow or Generalized Finite-Difference Packages. The particle-tracking routine used in the ADV2 Package duplicates the semi-analytical method of MODPATH, as shown in a sample problem. Particles can be tracked in a forward or backward direction, and effects such as retardation can be simulated through manipulation of the effective-porosity value used to calculate velocity. Particles can be discharged at cells that are considered to be weak sinks, in which the sink applied does not capture all the water flowing into the cell, using one of two criteria: (1) if there is any outflow to a boundary condition such as a well or surface-water feature, or (2) if the outflow exceeds a user specified fraction of the cell budget. Although effective porosity could be included as a parameter in the regression, this capability is not included in this package. The weighted sum-of-squares objective function, which is minimized in the Parameter-Estimation Process, was augmented to include the square of the weighted x-, y-, and z-components of the differences between the simulated and observed advective-front locations at defined times, thereby including the direction of travel as well as the overall travel distance in the calibration process. The sensitivities of the particle movement to the parameters needed to minimize the objective function are calculated for any particle location using the exact sensitivity-equation approach; the equations are derived by taking the partial derivatives of the semi-analytical particle-tracking equation with respect to the parameters. The ADV2 Package is verified by showing that parameter estimation using advective-transport observations produces the true parameter values in a small but complicated test case when exact observations are used. To demonstrate how the ADV2 Package can be used in practice, a field application is presented. In this application, the ADV2 Package is used first in the Sensitivity-Analysis mode of MODFLOW-2000 to calculate measures of the importance of advective-transport observations relative to head-dependent flow observations when either or both are used in conjunction with hydraulic-head observations in a simulation of the sewage-discharge plume at Cape Cod, Massachusetts. The ADV2 Package is then used in the Parameter-Estimation mode of MODFLOW-2000 to determine best-fit parameter values. It is concluded that, for this problem, advective-transport observations improved the calibration of the model and the estimation of ground-water flow parameters, and the use of formal parameter-estimation methods and related techniques produced significant insight into the physical system.

Scaling of Transient Storage Parameter Estimates with Increasing Reach Length in a Mountain Headwater Stream

NASA Astrophysics Data System (ADS)

Briggs, M.; Gooseff, M. N.; McGlynn, B.

2006-12-01

. Numerous studies have used the methods of stream tracer experiments and subsequent solute transport modeling to determine transient storage characteristics of streams. Experimental reach length is often determined by site logistics, morphology, specific study goals, etc. Harvey et al. [1996] provided guidance for optimal study reach lengths, based on the Dahmkoler number, as a balance between timescales of advective transport and transient storage. In this study, we investigate the scaling of parameters in a solute transport model (OTIS) with increasing spatial scale of investigation. We conducted 2 6-hour constant rate injections of dissolved NaCl in Spring Park Creek, a headwater stream in the Tenderfoot Creek Experimental Forest, Montana. Below the first injection we sampled 4 reaches ~200m in length, we then moved upstream 640m for the second injection and sampled 3 more ~200 m reaches. Solute transport simulations were conducted for each of these sub-reaches and for combinations of these sub-reaches, from which we assessed estimates of solute velocity, dispersion, transient storage exchange, storage zone size, and Fmed (proportion of median transport time due to storage). Dahmkoler values calculated for each simulation (sub-reaches as well as longer combined reach) were within an order of magnitude of 1, suggesting that our study reach lengths were appropriate. Length-weighted average solute transport and transient storage parameters for the sub-reaches were found to be comparable to their counterparts in the longer reach simulation. In particular the average dispersion found for the sub-reaches (0.43 m2/s) compared very favorably with the value for dispersion calculated for the larger reach (0.40 m2/s). In contrast the weighted average of storage zone size for the sub-reaches was much greater (1.17 m2) than those calculated for the injection reach as a whole (0.09 m2) by a factor of ~13. Weighted average values for transient storage exchange and size for the sub-reaches were both found to be higher than that of the reach as a whole, but only by factors of ~2.5 and 3 respectively. This study indicates that some values of solute transport and transient storage for a particular reach can be reasonably extrapolated from its corresponding component reach values.

Control of optical transport parameters of 'porous medium – supercritical fluid' systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zimnyakov, D A; Ushakova, O V; Yuvchenko, S A

2015-11-30

The possibility of controlling optical transport parameters (in particular, transport scattering coefficient) of porous systems based on polymer fibres, saturated with carbon dioxide in different phase states (gaseous, liquid and supercritical) has been experimentally studied. An increase in the pressure of the saturating medium leads to a rise of its refractive index and, correspondingly, the diffuse-transmission coefficient of the system due to the decrease in the transport scattering coefficient. It is shown that, in the case of subcritical saturating carbon dioxide, the small-angle diffuse transmission of probed porous layers at pressures close to the saturated vapour pressure is determined bymore » the effect of capillary condensation in pores. The immersion effect in 'porous medium – supercritical fluid' systems, where the fluid pressure is used as a control parameter, is considered. The results of reconstructing the values of transport scattering coefficient of probed layers for different refractive indices of a saturating fluid are presented. (radiation scattering)« less

Effect of amiloride and bumetanide on transepithelial ion transport in isolated rabbit cecal and colonic wall.

PubMed

Kosik-Bogacka, Danuta; Młodzik-Danielewicz, Natalia; Banach, Bolesław; Tyrakowski, Tomasz

2005-06-03

The aim of the study was to compare the effects of amiloride and bumetanide on the baseline transepithelial electrical potential difference (PD) and changes in PD during mechanical stimulation (dPD) in isolated cecal and colonic wall of rabbits. The experiments were performed with a modified Ussing chamber system. Isolated tissue specimens were incubated in Ringer's solution, in amiloride and/or bumetanide, or in dimethyl sulfoxide (DMSO). Under control conditions, i.e. when all the experimental fluids were Ringer's solution, the PD and R values of the rabbit cecum and colon were similar, while during mechanical stimulation, dPD of the colon was twice as high as that of the cecum. Addition of amiloride and/or bumetanide to all experimental fluids diminished the electrophysiological parameters of both tissues. DMSO added to all experimental fluids significantly diminished the values of the electrophysiological parameters of the cecum. Addition of amiloride to the stimulation fluid only diminished the PD and dPD values in the colon, whereas addition of bumetanide to the stimulation fluid only diminished the PD and dPD values in the cecum. It was found that the PD and dPD values of the rabbit cecum depend primarily on chloride ion transport, while those of the colon depend on sodium ion transport.

The effect of dimethylsulfoxide on the water transport response of rat hepatocytes during freezing.

PubMed

Smith, D J; Schulte, M; Bischof, J C

1998-10-01

Successful improvement of cryopreservation protocols for cells in suspension requires knowledge of how such cells respond to the biophysical stresses of freezing (intracellular ice formation, water transport) while in the presence of a cryoprotective agent (CPA). This work investigates the biophysical water transport response in a clinically important cell type--isolated hepatocytes--during freezing in the presence of dimethylsulfoxide (DMSO). Sprague-Dawley rat liver hepatocytes were frozen in Williams E media supplemented with 0, 1, and 2 M DMSO, at rates of 5, 10, and 50 degrees C/min. The water transport was measured by cell volumetric changes as assessed by cryomicroscopy and image analysis. Assuming that water is the only species transported under these conditions, a water transport model of the form dV/dT = f(Lpg([CPA]), ELp([CPA]), T(t)) was curve-fit to the experimental data to obtain the biophysical parameters of water transport--the reference hydraulic permeability (Lpg) and activation energy of water transport (ELp)--for each DMSO concentration. These parameters were estimated two ways: (1) by curve-fitting the model to the average volume of the pooled cell data, and (2) by curve-fitting individual cell volume data and averaging the resulting parameters. The experimental data showed that less dehydration occurs during freezing at a given rate in the presence of DMSO at temperatures between 0 and -10 degrees C. However, dehydration was able to continue at lower temperatures (< -10 degrees C) in the presence of DMSO. The values of Lpg and ELp obtained using the individual cell volume data both decreased from their non-CPA values--4.33 x 10(-13) m3/N-s (2.69 microns/min-atm) and 317 kJ/mol (75.9 kcal/mol), respectively--to 0.873 x 10(-13) m3/N-s (0.542 micron/min-atm) and 137 kJ/mol (32.8 kcal/mol), respectively, in 1 M DMSO and 0.715 x 10(-13) m3/N-s (0.444 micron/min-atm) and 107 kJ/mol (25.7 kcal/mol), respectively, in 2 M DMSO. The trends in the pooled volume values for Lpg and ELp were very similar, but the overall fit was considered worse than for the individual volume parameters. A unique way of presenting the curve-fitting results supports a clear trend of reduction of both biophysical parameters in the presence of DMSO, and no clear trend in cooling rate dependence of the biophysical parameters. In addition, these results suggest that close proximity of the experimental cell volume data to the equilibrium volume curve may significantly reduce the efficiency of the curve-fitting process.

Improvement of economic security management system of municipalities with account of transportation system development: methods of assessment

NASA Astrophysics Data System (ADS)

Khe Sun, Pak; Vorona-Slivinskaya, Lubov; Voskresenskay, Elena

2017-10-01

The article highlights the necessity of a complex approach to assess economic security of municipalities, which would consider municipal management specifics. The approach allows comparing the economic security level of municipalities, but it does not describe parameter differences between compared municipalities. Therefore, there is a second method suggested: parameter rank order method. Applying these methods allowed to figure out the leaders and outsiders of the economic security among municipalities and rank all economic security parameters according to the significance level. Complex assessment of the economic security of municipalities, based on the combination of the two approaches, allowed to assess the security level more accurate. In order to assure economic security and equalize its threshold values, one should pay special attention to transportation system development in municipalities. Strategic aims of projects in the area of transportation infrastructure development in municipalities include the following issues: contribution into creating and elaborating transportation logistics and manufacture transport complexes, development of transportation infrastructure with account of internal and external functions of the region, public transport development, improvement of transport security and reducing its negative influence on the environment.

Spectral Induced Polarization approaches to characterize reactive transport parameters and processes

NASA Astrophysics Data System (ADS)

Schmutz, M.; Franceschi, M.; Revil, A.; Peruzzo, L.; Maury, T.; Vaudelet, P.; Ghorbani, A.; Hubbard, S. S.

2017-12-01

For almost a decade, geophysical methods have explored the potential for characterization of reactive transport parameters and processes relevant to hydrogeology, contaminant remediation, and oil and gas applications. Spectral Induced Polarization (SIP) methods show particular promise in this endeavour, given the sensitivity of the SIP signature to geological material electrical double layer properties and the critical role of the electrical double layer on reactive transport processes, such as adsorption. In this presentation, we discuss results from several recent studies that have been performed to quantify the value of SIP parameters for characterizing reactive transport parameters. The advances have been realized through performing experimental studies and interpreting their responses using theoretical and numerical approaches. We describe a series of controlled experimental studies that have been performed to quantify the SIP responses to variations in grain size and specific surface area, pore fluid geochemistry, and other factors. We also model chemical reactions at the interface fluid/matrix linked to part of our experimental data set. For some examples, both geochemical modelling and measurements are integrated into a SIP physico-chemical based model. Our studies indicate both the potential of and the opportunity for using SIP to estimate reactive transport parameters. In case of well sorted granulometry of the samples, we find that the grain size characterization (as well as the permeabililty for some specific examples) value can be estimated using SIP. We show that SIP is sensitive to physico-chemical conditions at the fluid/mineral interface, including the different pore fluid dissolved ions (Na+, Cu2+, Zn2+, Pb2+) due to their different adsorption behavior. We also showed the relevance of our approach to characterize the fluid/matrix interaction for various organic contents (wetting and non-wetting oils). We also discuss early efforts to jointly interpret SIP and other information for improved estimation, approaches to use SIP information to constrain mechanistic flow and transport models, and the potential to apply some of the approaches to field scale applications.

CALCULATING PHYSICAL PROPERTIES OF ORGANIC COMPOUNDS FOR ENVIRONMENTAL MODELING FROM MOLECULAR STRUCTURE

EPA Science Inventory

Mathematical models for predicting the transport and fate of pollutants in the environment require reactivity parameter values-- that is value of the physical and chemical constants that govern reactivity. Although empirical structure activity relationships have been developed t...

Exact solution of three-dimensional transport problems using one-dimensional models. [in semiconductor devices

NASA Technical Reports Server (NTRS)

Misiakos, K.; Lindholm, F. A.

1986-01-01

Several parameters of certain three-dimensional semiconductor devices including diodes, transistors, and solar cells can be determined without solving the actual boundary-value problem. The recombination current, transit time, and open-circuit voltage of planar diodes are emphasized here. The resulting analytical expressions enable determination of the surface recombination velocity of shallow planar diodes. The method involves introducing corresponding one-dimensional models having the same values of these parameters.

Memory effects in funnel ratchet of self-propelled particles

NASA Astrophysics Data System (ADS)

Hu, Cai-Tian; Wu, Jian-Chun; Ai, Bao-Quan

2017-05-01

The transport of self-propelled particles with memory effects is investigated in a two-dimensional periodic channel. Funnel-shaped barriers are regularly arrayed in the channel. Due to the asymmetry of the barriers, the self-propelled particles can be rectified. It is found that the memory effects of the rotational diffusion can strongly affect the rectified transport. The memory effects do not always break the rectified transport, and there exists an optimal finite value of correlation time at which the rectified efficiency takes its maximal value. We also find that the optimal values of parameters (the self-propulsion speed, the translocation diffusion coefficient, the rotational noise intensity, and the self-rotational diffusion coefficient) can facilitate the rectified transport. When introducing a finite load, particles with different self-propulsion speeds move to different directions and can be separated.

The Effect of Yaw Coupling in Turning Maneuvers of Large Transport Aircraft

NASA Technical Reports Server (NTRS)

McNeill, Walter E.; Innis, Robert C.

1965-01-01

A study has been made, using a piloted moving simulator, of the effects of the yaw-coupling parameters N(sub p) and N(sub delta(sub a) on the lateral-directional handling qualities of a large transport airplane at landing-approach airspeed. It is shown that the desirable combinations of these parameters tend to be more proverse when compared with values typical of current aircraft. Results of flight tests in a large variable-stability jet transport showed trends which were similar to those of the simulator data. Areas of minor disagreement, which were traced to differences in airplane geometry, indicate that pilot consciousness of side acceleration forces can be an important factor in handling qualities of future long-nosed transport aircraft.

Combining 3D Hydraulic Tomography with Tracer Tests for Improved Transport Characterization.

PubMed

Sanchez-León, E; Leven, C; Haslauer, C P; Cirpka, O A

2016-07-01

Hydraulic tomography (HT) is a method for resolving the spatial distribution of hydraulic parameters to some extent, but many details important for solute transport usually remain unresolved. We present a methodology to improve solute transport predictions by combining data from HT with the breakthrough curve (BTC) of a single forced-gradient tracer test. We estimated the three dimensional (3D) hydraulic-conductivity field in an alluvial aquifer by inverting tomographic pumping tests performed at the Hydrogeological Research Site Lauswiesen close to Tübingen, Germany, using a regularized pilot-point method. We compared the estimated parameter field to available profiles of hydraulic-conductivity variations from direct-push injection logging (DPIL), and validated the hydraulic-conductivity field with hydraulic-head measurements of tests not used in the inversion. After validation, spatially uniform parameters for dual-domain transport were estimated by fitting tracer data collected during a forced-gradient tracer test. The dual-domain assumption was used to parameterize effects of the unresolved heterogeneity of the aquifer and deemed necessary to fit the shape of the BTC using reasonable parameter values. The estimated hydraulic-conductivity field and transport parameters were subsequently used to successfully predict a second independent tracer test. Our work provides an efficient and practical approach to predict solute transport in heterogeneous aquifers without performing elaborate field tracer tests with a tomographic layout. © 2015, National Ground Water Association.

Estimating effective soil properties of heterogeneous areas for modeling infiltration and redistribution

USDA-ARS?s Scientific Manuscript database

Field scale water infiltration and soil-water and solute transport models require spatially-averaged “effective” soil hydraulic parameters to represent the average flux and storage. The values of these effective parameters vary for different conditions, processes, and component soils in a field. For...

Chamber transport for heavy ion fusion

NASA Astrophysics Data System (ADS)

Olson, Craig L.

2014-01-01

A brief review is given of research on chamber transport for HIF (heavy ion fusion) dating from the first HIF Workshop in 1976 to the present. Chamber transport modes are categorized into ballistic transport modes and channel-like modes. Four major HIF reactor studies are summarized (HIBALL-II, HYLIFE-II, Prometheus-H, OSIRIS), with emphasis on the chamber transport environment. In general, many beams are used to provide the required symmetry and to permit focusing to the required small spots. Target parameters are then discussed, with a summary of the individual heavy ion beam parameters required for HIF. The beam parameters are then classified as to their line charge density and perveance, with special emphasis on the perveance limits for radial space charge spreading, for the space charge limiting current, and for the magnetic (Alfven) limiting current. The major experiments on ballistic transport (SFFE, Sabre beamlets, GAMBLE II, NTX, NDCX) are summarized, with specific reference to the axial electron trapping limit for charge neutralization. The major experiments on channel-like transport (GAMBLE II channel, GAMBLE II self-pinch, LBNL channels, GSI channels) are discussed. The status of current research on HIF chamber transport is summarized, and the value of future NDCX-II transport experiments for the future of HIF is noted.

Studies on transport behaviour of a binary liquid mixture of ethanol and toluene at 298.15K in terms of viscosity models

NASA Astrophysics Data System (ADS)

Purohit, Suresh; Suthar, Shyam Sunder; Vyas, Mahendra; Beniwal, Ram Chandra

2018-05-01

The main transport properties of liquid or liquid mixtures are viscosity, diffusion, transference and electrical conductance. Viscosities of various liquid mixtures have been studied and their analyses have also been done by the help of some parameters. For each solution, the excess thermodynamic properties (YE) have been investigated. These excess thermodynamic properties are excess molar volume (VE), viscosity deviation (Δη) and excess Gibbs free energy of activation of viscous flow (ΔG*E). These parameters provide us the important information about interaction between molecules. For example, the negative value of VE and positive value of Δη shows the strong interaction between the solute and solvent molecules while positive value of VE and negative value of Δη shows the weak interaction between solute and solvent molecules. Above parameters and their discussion have been made in our earlier paper. In the present research paper, the viscosity data have been correlated with the equations of Grunberg and Nissan, Hind et al., Tamura and Kurata Katti. The excess values have been correlated using Redlich-Kister polynomial equation to obtain their coefficients and standard deviations. It has been found that in all cases, the data obtained fitted with the values correlated by the corresponding models very well. The results are interpreted in terms of molecular interactions occurring in the solution.

Measurement of carrier transport and recombination parameter in heavily doped silicon

NASA Technical Reports Server (NTRS)

Swanson, Richard M.

1986-01-01

The minority carrier transport and recombination parameters in heavily doped bulk silicon were measured. Both Si:P and Si:B with bulk dopings from 10 to the 17th and 10 to the 20th power/cu cm were studied. It is shown that three parameters characterize transport in bulk heavily doped Si: the minority carrier lifetime tau, the minority carrier mobility mu, and the equilibrium minority carrier density of n sub 0 and p sub 0 (in p-type and n-type Si respectively.) However, dc current-voltage measurements can never measure all three of these parameters, and some ac or time-transient experiment is required to obtain the values of these parameters as a function of dopant density. Using both dc electrical measurements on bipolar transitors with heavily doped base regions and transients optical measurements on heavily doped bulk and epitaxially grown samples, lifetime, mobility, and bandgap narrowing were measured as a function of both p and n type dopant densities. Best fits of minority carrier mobility, bandgap narrowing and lifetime as a function of doping density (in the heavily doped range) were constructed to allow accurate modeling of minority carrier transport in heavily doped Si.

Peritoneal fluid transport in CAPD patients with different transport rates of small solutes.

PubMed

Sobiecka, Danuta; Waniewski, Jacek; Weryński, Andrzej; Lindholm, Bengt

2004-01-01

Continuous ambulatory peritoneal dialysis (CAPD) patients with high peritoneal solute transport rate often have inadequate peritoneal fluid transport. It is not known whether this inadequate fluid transport is due solely to a too rapid fall of osmotic pressure, or if the decreased effectiveness of fluid transport is also a contributing factor. To analyze fluid transport parameters and the effectiveness of dialysis fluid osmotic pressure in the induction of fluid flow in CAPD patients with different small solute transport rates. 44 CAPD patients were placed in low (n = 6), low-average (n = 13), high-average (n = 19), and high (n = 6) transport groups according to a modified peritoneal equilibration test (PET). The study involved a 6-hour peritoneal dialysis dwell with 2 L 3.86% glucose dialysis fluid for each patient. Radioisotopically labeled serum albumin was added as a volume marker.The fluid transport parameters (osmotic conductance and fluid absorption rate) were estimated using three mathematical models of fluid transport: (1) Pyle model (model P), which describes ultrafiltration rate as an exponential function of time; (2) model OS, which is based on the linear relationship of ultrafiltration rate and overall osmolality gradient between dialysis fluid and blood; and (3) model G, which is based on the linear relationship between ultrafiltration rate and glucose concentration gradient between dialysis fluid and blood. Diffusive mass transport coefficients (K(BD)) for glucose, urea, creatinine, potassium, and sodium were estimated using the modified Babb-Randerson-Farrell model. The high transport group had significantly lower dialysate volume and glucose and osmolality gradients between dialysate and blood, but significantly higher K(BD) for small solutes compared with the other transport groups. Osmotic conductance, fluid absorption rate, and initial ultrafiltration rate did not differ among the transport groups for model OS and model P. Model G yielded unrealistic values of fluid transport parameters that differed from those estimated by models OS and P. The K(BD) values for small solutes were significantly different among the groups, and did not correlate with fluid transport parameters for model OS. The difference in fluid transport between the different transport groups was due only to the differences in the rate of disappearance of the overall osmotic pressure of the dialysate, which was a combined result of the transport rate of glucose and other small solutes. Although the glucose gradient is the major factor influencing ultrafiltration rate, other solutes, such as urea, are also of importance. The counteractive effect of plasma small solutes on transcapillary ultrafiltration was found to be especially notable in low transport patients. Thus, glucose gradient alone should not be considered the only force that shapes the ultrafiltration profile during peritoneal dialysis. We did not find any correlations between diffusive mass transport coefficients for small solutes and fluid transport parameters such as osmotic conductance or fluid and volume marker absorption. We may thus conclude that the pathway(s) for fluid transport appears to be partly independent from the pathway(s) for small solute transport, which supports the hypothesis of different pore types for fluid and solute transport.

Multidrug efflux transporter activity in sea urchin embryos:Does localization provide a diffusive advantage?

NASA Astrophysics Data System (ADS)

Song, Xianfeng; Setayeshgar, Sima; Cole, Bryan; Hamdoun, Amro; Epel, David

2008-03-01

Experiments have shown upregulation of multidrug efflux transporter activity approximately 30 min after fertilization in the sea urchin embryo [1]. These ATP-hydrolyzing transporter proteins pump moderately hydrophobic molecules out of the cell and represent the cell's first line of defense againstexogenous toxins. It has also been shown that transporters are moved in vesicles along microfilaments and localized to tips of microvilli prior to activation. We have constructed a geometrically realistic model of the embryo, including microvilli, to explore the functional role of this localization in the efficient elimination of toxins from the standpoint of diffusion. We compute diffusion of toxins in extracellular, membrane and intracellular spaces coupled with transporter activity, using experimentally derived values for physical parameters. For transporters uniformly distributed along microvilli and tip-localized transporters we compare regions in parameter space where each distribution provides diffusive advantage, and comment on the physically expected conditions. [1] A. M. Hamdoun, G. N. Cherr, T. A. Roepke and D. Epel, Developmental Biology 276 452 (2004).

[In vitro absorption mechanism of strychnine and the transport interaction with liquiritin in Caco-2 cell monolayer model].

PubMed

Wang, Jun-jun; Liao, Xiao-huan; Ye, Min; Chen, Yong

2010-09-01

To study the effect of liquiritin (Liq) on the transport of strychnine (Str) in Caco-2 cell monolayer model, the transport parameters of Str, such as apparent permeability coefficient (P app (B-->A) and P app (A-->B)) and cumulative transport amount (TRcum), were determined and comparatively analyzed when Str was used solely and co-used with Liq. The effect of drug concentrations, conveying times, P-glycoprotein (P-gp) inhibitor verapamil and conveying liquor pH values on the transport of Str were also investigated. The results indicated that the absorption of Str in Caco-2 cell monolayer model was well and the passive transference was the main intestinal absorption mechanism of Str in the Caco-2 monolayer model, along with the excretion action mediated by P-gp. Liq enhanced the absorption of Str. Meanwhile, conveying liquor pH value had significant influence on the excretion transport of Str.

Fractal continuum model for tracer transport in a porous medium.

PubMed

Herrera-Hernández, E C; Coronado, M; Hernández-Coronado, H

2013-12-01

A model based on the fractal continuum approach is proposed to describe tracer transport in fractal porous media. The original approach has been extended to treat tracer transport and to include systems with radial and uniform flow, which are cases of interest in geoscience. The models involve advection due to the fluid motion in the fractal continuum and dispersion whose mathematical expression is taken from percolation theory. The resulting advective-dispersive equations are numerically solved for continuous and for pulse tracer injection. The tracer profile and the tracer breakthrough curve are evaluated and analyzed in terms of the fractal parameters. It has been found in this work that anomalous transport frequently appears, and a condition on the fractal parameter values to predict when sub- or superdiffusion might be expected has been obtained. The fingerprints of fractality on the tracer breakthrough curve in the explored parameter window consist of an early tracer breakthrough and long tail curves for the spherical and uniform flow cases, and symmetric short tailed curves for the radial flow case.

Mathematical modeling of a thermovoltaic cell

NASA Technical Reports Server (NTRS)

White, Ralph E.; Kawanami, Makoto

1992-01-01

A new type of battery named 'Vaporvolt' cell is in the early stage of its development. A mathematical model of a CuO/Cu 'Vaporvolt' cell is presented that can be used to predict the potential and the transport behavior of the cell during discharge. A sensitivity analysis of the various transport and electrokinetic parameters indicates which parameters have the most influence on the predicted energy and power density of the 'Vaporvolt' cell. This information can be used to decide which parameters should be optimized or determined more accurately through further modeling or experimental studies. The optimal thicknesses of electrodes and separator, the concentration of the electrolyte, and the current density are determined by maximizing the power density. These parameter sensitivities and optimal design parameter values will help in the development of a better CuO/Cu 'Vaporvolt' cell.

Thermodynamic analysis of active sodium and potassium transport in the frog corneal epithelium.

PubMed

Candia, O A; Reinach, P S

1982-06-01

The formalism of linear nonequilibrium thermodynamics for a three-flow system was applied to the isolated frog corneal epithelium to study the coupling between metabolism and the Na-K transport system across this layer. There is little or no net ion transport across the isolated frog corneal epithelium bathed in Na2SO4 Ringer. Addition of amphotericin B to the tear side solution increases apical membrane permeability, which results in a net Na transport (from tear to stroma) and a net K transport in the opposite direction. Corneas were mounted in a modified Ussing chamber that permitted the simultaneous measurements of electrical parameters and O2 consumption by means of Clark-type oxygen electrodes. The overall degree of coupling, q, of the Na-K transport system to metabolism was calculated from measuring the suprabasal O2 consumption rate at "static head" and "level flow" conditions and by a second independent technique. Measurements of electrical conductance used in conjunction with other previously measured parameters allowed the calculation of the affinity, A, of the metabolic reaction driving transport, all phenomenological coefficients, and the electromotive forces of sodium (ENa) and potassium transport (EK). Values of q determined by the two techniques agreed (q = 0.80 and 0.84, respectively). This indicates incomplete coupling and a variable stoichiometric relationship among O2 consumption rate, net Na transport, and net K transport. The value calculated for A was 70.5 kcal.mol-1, for ENa 142.5 mV, and for EK -34.9 mV.

Fate and transport of uranium (VI) in weathered saprolite

DOE PAGES

Kim, Young-Jin; Brooks, Scott C.; Zhang, Fan; ...

2014-11-09

We conducted batch and column experiments to investigate sorption and transport of uranium (U) in the presence of saprolite derived from interbedded shale, limestone, and sandstone sequences. Sorption kinetics were measured at two initial concentrations (C0; 1, 10 mM) and three soil:solution ratios (Rs/w; 0.005, 0.25, 2 kg/L) at pH 4.5 (pH of the saprolite). The rate of U loss from solution (mmole/L/h) increased with increasing Rs/w. Uranium sorption exhibited a fast phase with 80% sorption in the first eight hours for all C0 and Rs/w values and a slow phase during which the reaction slowly approached (pseudo) equilibrium overmore » the next seven days. The pH-dependency of U sorption was apparent in pH sorption edges. U(VI) sorption increased over the pH range 4e6, then decreased sharply at pH > 7.5. U(VI) sorption edges were well described by a surface complexation model using calibrated parameters and the reaction network proposed by Waite et al. (1994). Sorption isotherms measured using the same Rs/w and pH values showed a solids concentration effect where U(VI) sorption capacity and affinity decreased with increasing solids concentration. Moreover, this effect may have been due to either particle aggregation or competition between U(VI) and exchangeable cations for sorption sites. The surface complexation model with calibrated parameters was able to predict the general sorption behavior relatively well, but failed to reproduce solid concentration effects, implying the importance of appropriate design if batch experiments are to be utilized for dynamic systems. Transport of U(VI) through the packed column was significantly retarded. We also conducted transport simulations using the reactive transport model HydroGeoChem (HGC) v5.0 that incorporated the surface complexation reaction network used to model the batch data. Model parameters reported by Waite et al. (1994) provided a better prediction of U transport than optimized parameters derived from our sorption edges. The results presented in this study highlight the challenges in defining appropriate conditions for batch-type experiments used to extrapolate parameters for transport models, and also underline a gap in our ability to transfer batch results to transport simulations.« less

The influence of hepatic transport on the distribution volumes and mean residence time of drug in the body and the accuracy of estimating these parameters by the traditional pharmacokinetic calculations.

PubMed

Berezhkovskiy, Leonid M

2011-11-01

The influence of hepatic uptake and efflux, which includes passive diffusion and transporter-mediated component, on drug distribution volumes [steady-state volume of distribution (V(ss)) and terminal volume of distribution (V(β))], mean residence time (MRT), clearance, and terminal half-life is considered using a simplified physiologically based pharmacokinetic model. To account for hepatic uptake, liver is treated as two-compartmental unit with drug transfer from extracellular water into hepatocytes. The exactly calculated distribution volumes and MRT are compared with that obtained by the traditional equations based on the assumption of central elimination. It was found that V(ss) may increase more than 10-fold and V(β) more than 100-fold due to the contribution of transporter-mediated uptake. The terminal half-life may be substantially shortened (more than 100-fold) due to transporters. It may also decrease significantly due to the increase of intrinsic hepatic clearance (CL(int)), whereas hepatic clearance has already reached saturation (and stays close to the possible maximum value). It is shown that in case of transporter-mediated uptake of compound into hepatocytes, in the absence of efflux and passive diffusion (unidirectional uptake), hepatic clearance is independent of CL(int) and is determined by hepatic blood flow and uptake rate constant. The effects of transporter-mediated uptake are mostly pronounced for hydrophilic acidic compounds and moderately lipophilic neutral compounds. For basic compounds and lipophilic neutral compounds the change of distribution volumes due to transporters is rather unlikely. It was found that the traditional equations provide very accurate values of V(ss), V(β), and MRT in the absence of transporter action even for very low rates of passive diffusion. On the other hand, the traditional equations fail to provide the correct values of these parameters when the increase of distribution volumes due to transporters takes place, and actually yield the values substantially smaller than the true ones (up to an order of magnitude for V(ss) and MRT, and three orders of magnitude for V(β)). Copyright © 2011 Wiley-Liss, Inc.

Parameters of Transportation of Tailings of Metals Lixiviating

NASA Astrophysics Data System (ADS)

Golik, Vladimir; Dmitrak, Yury

2017-11-01

The article shows that the change in the situation in the metals market with a steady increase in production volumes is intensified against the tendency of the transition of mining production from underground mining to underground mining for a certain group of ores. The possibility of a non-waste metals extraction from not only standard, but also from substandard raw materials, is currently provided only by technology with the lixiviating of metals from developing ores. The regular dependences of the magnitude of hydraulic resistances on the hydro-mixture velocity and its density are determined. The correct values of the experimental data convergence with the calculated values of these parameters are obtained. It is shown that the optimization of the transportation parameters of lixiviating tailings allows reducing the level of chemically dangerous pollution of the environment by leachate products. The direction of obtaining the ecological and technological effect from the use of simultaneously environmental and resource-saving technology for the extraction of the disclosed metals is indicated.

Mass Transport through Nanostructured Membranes: Towards a Predictive Tool

PubMed Central

Darvishmanesh, Siavash; Van der Bruggen, Bart

2016-01-01

This study proposes a new mechanism to understand the transport of solvents through nanostructured membranes from a fundamental point of view. The findings are used to develop readily applicable mathematical models to predict solvent fluxes and solute rejections through solvent resistant membranes used for nanofiltration. The new model was developed based on a pore-flow type of transport. New parameters found to be of fundamental importance were introduced to the equation, i.e., the affinity of the solute and the solvent for the membrane expressed as the hydrogen-bonding contribution of the solubility parameter for the solute, solvent and membrane. A graphical map was constructed to predict the solute rejection based on the hydrogen-bonding contribution of the solubility parameter. The model was evaluated with performance data from the literature. Both the solvent flux and the solute rejection calculated with the new approach were similar to values reported in the literature. PMID:27918434

Global sensitivity analysis of groundwater transport

NASA Astrophysics Data System (ADS)

Cvetkovic, V.; Soltani, S.; Vigouroux, G.

2015-12-01

In this work we address the model and parametric sensitivity of groundwater transport using the Lagrangian-Stochastic Advection-Reaction (LaSAR) methodology. The 'attenuation index' is used as a relevant and convenient measure of the coupled transport mechanisms. The coefficients of variation (CV) for seven uncertain parameters are assumed to be between 0.25 and 3.5, the highest value being for the lower bound of the mass transfer coefficient k0 . In almost all cases, the uncertainties in the macro-dispersion (CV = 0.35) and in the mass transfer rate k0 (CV = 3.5) are most significant. The global sensitivity analysis using Sobol and derivative-based indices yield consistent rankings on the significance of different models and/or parameter ranges. The results presented here are generic however the proposed methodology can be easily adapted to specific conditions where uncertainty ranges in models and/or parameters can be estimated from field and/or laboratory measurements.

Soil Parameters for Representing a Karst Geologic Terrain in the Noah Land-Surface Model over Tennessee and Kentucky

NASA Astrophysics Data System (ADS)

Sullivan, Z.; Fan, X.

2015-12-01

Currently, the Noah Land-Surface Model (Noah-LSM) coupled with the Weather Research and Forecasting (WRF) model does not have a representation of the physical behavior of a karst terrain found in a large area of Tennessee and Kentucky and 25% of land area worldwide. The soluble nature of the bedrock within a karst geologic terrains allows for the formation of caverns, joints, fissures, sinkholes, and underground streams which affect the hydrological behavior of the region. The Highland Rim of Tennessee and the Pennyroyal Plateau and Bluegrass region of Kentucky make up a larger karst area known as the Interior Low Plateau. The highly weathered upper portion of the karst terrain, known as the epikarst, allows for more rapid transport of water through the system. For this study, hydrological aspects, such as bedrock porosity and the hydraulic conductivity, were chosen within this region in order to determine the most representative subsurface parameters for the Noah-LSM. These values along with the use of similar proxy values were chosen to calculate and represent the remaining eight parameters within the SOILPARM.TBL for the WRF model. Hydraulic conductivity values show a variation ranging from around 10-7 and 10-5 ms-1 for the karst bedrock within this region. A sand and clay soil type was used along with bedrock parameters to determine an average soil parameter type for the epikarst bedrock located within this region. Results from this study show parameters for an epikarst bedrock type displaying higher water transport through the system, similar to that of a sandy soil type with a water retention similar to that of a loam type soil. The physical nature of epikarst may lead to a decrease in latent heat values over this region and increase sensible heat values. This, in turn, may effect boundary layer growth which could lead to convective development. Future modeling work can be conducted using these values by way of coupling the soil parameters with the karst regions of the Tennessee/Kentucky area.

Effects of historical and predictive information on ability of transport pilot to predict an alert

NASA Technical Reports Server (NTRS)

Trujillo, Anna C.

1994-01-01

In the aviation community, the early detection of the development of a possible subsystem problem during a flight is potentially useful for increasing the safety of the flight. Commercial airlines are currently using twin-engine aircraft for extended transport operations over water, and the early detection of a possible problem might increase the flight crew's options for safely landing the aircraft. One method for decreasing the severity of a developing problem is to predict the behavior of the problem so that appropriate corrective actions can be taken. To investigate the pilots' ability to predict long-term events, a computer workstation experiment was conducted in which 18 airline pilots predicted the alert time (the time to an alert) using 3 different dial displays and 3 different parameter behavior complexity levels. The three dial displays were as follows: standard (resembling current aircraft round dial presentations); history (indicating the current value plus the value of the parameter 5 sec in the past); and predictive (indicating the current value plus the value of the parameter 5 sec into the future). The time profiles describing the behavior of the parameter consisted of constant rate-of-change profiles, decelerating profiles, and accelerating-then-decelerating profiles. Although the pilots indicated that they preferred the near term predictive dial, the objective data did not support its use. The objective data did show that the time profiles had the most significant effect on performance in estimating the time to an alert.

[Modal failure analysis and effects in the detection of errors in the transport of samples to the clinical laboratory].

PubMed

Parés-Pollán, L; Gonzalez-Quintana, A; Docampo-Cordeiro, J; Vargas-Gallego, C; García-Álvarez, G; Ramos-Rodríguez, V; Diaz Rubio-García, M P

2014-01-01

Owing to the decrease in values of biochemical glucose parameter in some samples from external extraction centres, and the risk this implies to patient safety; it was decided to apply an adaptation of the «Health Services Failure Mode and Effects Analysis» (HFMEA) to manage risk during the pre-analytical phase of sample transportation from external centres to clinical laboratories. A retrospective study of glucose parameter was conducted during two consecutive months. The analysis was performed in its different phases: to define the HFMEA topic, assemble the team, graphically describe the process, conduct a hazard analysis, design the intervention and indicators, and identify a person to be responsible for ensuring completion of each action. The results of glucose parameter in one of the transport routes, were significantly lower (P=.006). The errors and potential causes of this problem were analysed, and criteria of criticality and detectability were applied (score≥8) in the decision tree. It was decided to: develop a document management system; reorganise extractions and transport routes in some centres; quality control of the sample container ice-packs, and the time and temperature during transportation. This work proposes quality indicators for controlling time and temperature of transported samples in the pre-analytical phase. Periodic review of certain laboratory parameters can help to detect problems in transporting samples. The HFMEA technique is useful for the clinical laboratory. Copyright © 2013 SECA. Published by Elsevier Espana. All rights reserved.

Soil transport parameters of potassium under a tropical saline soil condition using STANMOD

NASA Astrophysics Data System (ADS)

Suzanye da Silva Santos, Rafaelly; Honorio de Miranda, Jarbas; Previatello da Silva, Livia

2015-04-01

Environmental responsibility and concerning about the final destination of solutes in soil, so more studies allow a better understanding about the solutes behaviour in soil. Potassium is a macronutrient that is required in high concentrations, been an extremely important nutrient for all agricultural crops. It plays essential roles in physiological processes vital for plant growth, from protein synthesis to maintenance of plant water balance, and is available to plants dissolved in soil water while exchangeable K is loosely held on the exchange sites on the surface of clay particles. K will tend to be adsorbed onto the surface of negatively charged soil particles. Potassium uptake is vital for plant growth but in saline soils sodium competes with potassium for uptake across the plasma membrane of plant cells. This can result in high Na+:K+ ratios that reduce plant growth and eventually become toxic. This study aimed to obtain soil transport parameters of potassium in saline soil, such as: pore water velocity in soil (v), retardation factor (R), dispersivity (λ) and dispersion coefficient (D), in a disturbed sandy soil with different concentrations of potassium chlorate solution (KCl), which is one of the most common form of potassium fertilizer. The experiment was carried out using soil samples collected in a depth of 0 to 20 cm, applying potassium chlorate solution containing 28.6, 100, 200 and 500 mg L-1 of K. To obtain transport parameters, the data were adjusted with the software STANMOD. At low concentrations, interaction between potassium and soil occur more efficiently. It was observed that only the breakthrough curve prepared with solution of 500 mg L-1 reached the applied concentration, and the solution of 28.6 mg L-1 overestimated the parameters values. The STANMOD proved to be efficient in obtaining potassium transport parameters; KCl solution to be applied should be greater than 500 mg L-1; solutions with low concentrations tend to overestimate parameters values.

Surface atmospheric extremes (Launch and transportation areas)

NASA Technical Reports Server (NTRS)

1972-01-01

The effects of extreme values of surface and low altitude atmospheric parameters on space vehicle design, tests, and operations are discussed. Atmospheric extremes from the surface to 150 meters for geographic locations of interest to NASA are given. Thermal parameters (temperature and solar radiation), humidity, pressure, and atmospheric electricity (lighting and static) are presented. Weather charts and tables are included.

Quantitative Microbial Risk Assessment Tutorial - SDMProjectBuilder: Import Local Data Files to Identify and Modify Contamination Sources and Input ParametersUpdated 2017

EPA Science Inventory

Twelve example local data support files are automatically downloaded when the SDMProjectBuilder is installed on a computer. They allow the user to modify values to parameters that impact the release, migration, fate, and transport of microbes within a watershed, and control delin...

Quantitative Microbial Risk Assessment Tutorial – SDMProjectBuilder: Import Local Data Files to Identify and Modify Contamination Sources and Input Parameters

EPA Science Inventory

Twelve example local data support files are automatically downloaded when the SDMProjectBuilder is installed on a computer. They allow the user to modify values to parameters that impact the release, migration, fate, and transport of microbes within a watershed, and control delin...

MOVES sensitivity study

DOT National Transportation Integrated Search

2012-01-01

Purpose: : To determine ranking of important parameters and the overall sensitivity to values of variables in MOVES : To allow a greater understanding of the MOVES modeling process for users : Continued support by FHWA to transportation modeling comm...

Curvature effects on the electronic and transport properties of semiconductor films

NASA Astrophysics Data System (ADS)

Batista, F. F.; Chaves, Andrey; da Costa, D. R.; Farias, G. A.

2018-05-01

Within the effective mass approximation, we study the curvature effects on the electronic and transport properties of semiconductor films. We investigate how the geometry-induced potential resulting exclusively from periodic ripples in the film induces electronic confinement and a superlattice band structure. For fixed curvature parameters, such a confinement can be easily tuned by an external electric field, hence features of the superlattice band structure such as its energy gaps and band curvature can be controlled by an external parameter. We also show that, for some values of curvature and electric field, it is possible to obtain massless Dirac bands for a smooth curved structure. Moreover, we use a wave packet propagation method to demonstrate that the ripples are responsible for a significant inter-sub-band transition, specially for moderate values of the ripple height.

Simultaneous measurement of glucose transport and utilization in the human brain

PubMed Central

Shestov, Alexander A.; Emir, Uzay E.; Kumar, Anjali; Henry, Pierre-Gilles; Seaquist, Elizabeth R.

2011-01-01

Glucose is the primary fuel for brain function, and determining the kinetics of cerebral glucose transport and utilization is critical for quantifying cerebral energy metabolism. The kinetic parameters of cerebral glucose transport, KMt and Vmaxt, in humans have so far been obtained by measuring steady-state brain glucose levels by proton (1H) NMR as a function of plasma glucose levels and fitting steady-state models to these data. Extraction of the kinetic parameters for cerebral glucose transport necessitated assuming a constant cerebral metabolic rate of glucose (CMRglc) obtained from other tracer studies, such as 13C NMR. Here we present new methodology to simultaneously obtain kinetic parameters for glucose transport and utilization in the human brain by fitting both dynamic and steady-state 1H NMR data with a reversible, non-steady-state Michaelis-Menten model. Dynamic data were obtained by measuring brain and plasma glucose time courses during glucose infusions to raise and maintain plasma concentration at ∼17 mmol/l for ∼2 h in five healthy volunteers. Steady-state brain vs. plasma glucose concentrations were taken from literature and the steady-state portions of data from the five volunteers. In addition to providing simultaneous measurements of glucose transport and utilization and obviating assumptions for constant CMRglc, this methodology does not necessitate infusions of expensive or radioactive tracers. Using this new methodology, we found that the maximum transport capacity for glucose through the blood-brain barrier was nearly twofold higher than maximum cerebral glucose utilization. The glucose transport and utilization parameters were consistent with previously published values for human brain. PMID:21791622

Accurate determination of electronic transport properties of silicon wafers by nonlinear photocarrier radiometry with multiple pump beam sizes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qian; University of the Chinese Academy of Sciences, Beijing 100039; Li, Bincheng, E-mail: bcli@uestc.ac.cn

2015-12-07

In this paper, photocarrier radiometry (PCR) technique with multiple pump beam sizes is employed to determine simultaneously the electronic transport parameters (the carrier lifetime, the carrier diffusion coefficient, and the front surface recombination velocity) of silicon wafers. By employing the multiple pump beam sizes, the influence of instrumental frequency response on the multi-parameter estimation is totally eliminated. A nonlinear PCR model is developed to interpret the PCR signal. Theoretical simulations are performed to investigate the uncertainties of the estimated parameter values by investigating the dependence of a mean square variance on the corresponding transport parameters and compared to that obtainedmore » by the conventional frequency-scan method, in which only the frequency dependences of the PCR amplitude and phase are recorded at single pump beam size. Simulation results show that the proposed multiple-pump-beam-size method can improve significantly the accuracy of the determination of the electronic transport parameters. Comparative experiments with a p-type silicon wafer with resistivity 0.1–0.2 Ω·cm are performed, and the electronic transport properties are determined simultaneously. The estimated uncertainties of the carrier lifetime, diffusion coefficient, and front surface recombination velocity are approximately ±10.7%, ±8.6%, and ±35.4% by the proposed multiple-pump-beam-size method, which is much improved than ±15.9%, ±29.1%, and >±50% by the conventional frequency-scan method. The transport parameters determined by the proposed multiple-pump-beam-size PCR method are in good agreement with that obtained by a steady-state PCR imaging technique.« less

Comparison of in situ uranium KD values with a laboratory determined surface complexation model

USGS Publications Warehouse

Curtis, G.P.; Fox, P.; Kohler, M.; Davis, J.A.

2004-01-01

Reactive solute transport simulations in groundwater require a large number of parameters to describe hydrologic and chemical reaction processes. Appropriate methods for determining chemical reaction parameters required for reactive solute transport simulations are still under investigation. This work compares U(VI) distribution coefficients (i.e. KD values) measured under field conditions with KD values calculated from a surface complexation model developed in the laboratory. Field studies were conducted in an alluvial aquifer at a former U mill tailings site near the town of Naturita, CO, USA, by suspending approximately 10 g samples of Naturita aquifer background sediments (NABS) in 17-5.1-cm diameter wells for periods of 3 to 15 months. Adsorbed U(VI) on these samples was determined by extraction with a pH 9.45 NaHCO3/Na2CO3 solution. In wells where the chemical conditions in groundwater were nearly constant, adsorbed U concentrations for samples taken after 3 months of exposure to groundwater were indistinguishable from samples taken after 15 months. Measured in situ K D values calculated from the measurements of adsorbed and dissolved U(VI) ranged from 0.50 to 10.6 mL/g and the KD values decreased with increasing groundwater alkalinity, consistent with increased formation of soluble U(VI)-carbonate complexes at higher alkalinities. The in situ K D values were compared with KD values predicted from a surface complexation model (SCM) developed under laboratory conditions in a separate study. A good agreement between the predicted and measured in situ KD values was observed. The demonstration that the laboratory derived SCM can predict U(VI) adsorption in the field provides a critical independent test of a submodel used in a reactive transport model. ?? 2004 Elsevier Ltd. All rights reserved.

Robustness Analysis and Reliable Flight Regime Estimation of an Integrated Resilent Control System for a Transport Aircraft

NASA Technical Reports Server (NTRS)

Shin, Jong-Yeob; Belcastro, Christine

2008-01-01

Formal robustness analysis of aircraft control upset prevention and recovery systems could play an important role in their validation and ultimate certification. As a part of the validation process, this paper describes an analysis method for determining a reliable flight regime in the flight envelope within which an integrated resilent control system can achieve the desired performance of tracking command signals and detecting additive faults in the presence of parameter uncertainty and unmodeled dynamics. To calculate a reliable flight regime, a structured singular value analysis method is applied to analyze the closed-loop system over the entire flight envelope. To use the structured singular value analysis method, a linear fractional transform (LFT) model of a transport aircraft longitudinal dynamics is developed over the flight envelope by using a preliminary LFT modeling software tool developed at the NASA Langley Research Center, which utilizes a matrix-based computational approach. The developed LFT model can capture original nonlinear dynamics over the flight envelope with the ! block which contains key varying parameters: angle of attack and velocity, and real parameter uncertainty: aerodynamic coefficient uncertainty and moment of inertia uncertainty. Using the developed LFT model and a formal robustness analysis method, a reliable flight regime is calculated for a transport aircraft closed-loop system.

Inhibition, by 2-oxo acids that accumulate in maple-syrup-urine disease, of lactate, pyruvate, and 3-hydroxybutyrate transport across the blood-brain barrier.

PubMed

Cremer, J E; Teal, H M; Cunningham, V J

1982-09-01

Data are presented in support of the transport of (-)-D-3-hydroxybutyrate across the blood-brain barrier (BBB) being a carrier-mediated process. The kinetic parameters in 21-day-old pentobarbital-anaesthetized rats were Vmax 2.0 mumol.g-1.min-1, Km 29 mM, and KD 0.024 ml.g-1.min-1. The value for Vmax was the same as that for L-lactate and pyruvate transport in animals of the same age. The transport of all three substrates was sensitive to inhibition by low concentrations of either 2-oxo-3-methylbutanoate or 2-oxo-4-methylpentanoate, the 2-oxo acids that can accumulate in patients with maple-syrup-urine disease. The Ki values for the 2-oxo acids were severalfold lower than the respective Km values. 2-Oxo-3-phenylpropionate was a poor inhibitor. The relative affinities of the various monocarboxylic acids for the transport system of the BBB distinguished it from similar systems described in brain, heart, and liver mitochondria; human erythrocytes; and Ehrlich ascites-tumour cells.

Advective transport in heterogeneous aquifers: Are proxy models predictive?

NASA Astrophysics Data System (ADS)

Fiori, A.; Zarlenga, A.; Gotovac, H.; Jankovic, I.; Volpi, E.; Cvetkovic, V.; Dagan, G.

2015-12-01

We examine the prediction capability of two approximate models (Multi-Rate Mass Transfer (MRMT) and Continuous Time Random Walk (CTRW)) of non-Fickian transport, by comparison with accurate 2-D and 3-D numerical simulations. Both nonlocal in time approaches circumvent the need to solve the flow and transport equations by using proxy models to advection, providing the breakthrough curves (BTC) at control planes at any x, depending on a vector of five unknown parameters. Although underlain by different mechanisms, the two models have an identical structure in the Laplace Transform domain and have the Markovian property of independent transitions. We show that also the numerical BTCs enjoy the Markovian property. Following the procedure recommended in the literature, along a practitioner perspective, we first calibrate the parameters values by a best fit with the numerical BTC at a control plane at x1, close to the injection plane, and subsequently use it for prediction at further control planes for a few values of σY2≤8. Due to a similar structure and Markovian property, the two methods perform equally well in matching the numerical BTC. The identified parameters are generally not unique, making their identification somewhat arbitrary. The inverse Gaussian model and the recently developed Multi-Indicator Model (MIM), which does not require any fitting as it relates the BTC to the permeability structure, are also discussed. The application of the proxy models for prediction requires carrying out transport field tests of large plumes for a long duration.

A statistical methodology for estimating transport parameters: Theory and applications to one-dimensional advectivec-dispersive systems

USGS Publications Warehouse

Wagner, Brian J.; Gorelick, Steven M.

1986-01-01

A simulation nonlinear multiple-regression methodology for estimating parameters that characterize the transport of contaminants is developed and demonstrated. Finite difference contaminant transport simulation is combined with a nonlinear weighted least squares multiple-regression procedure. The technique provides optimal parameter estimates and gives statistics for assessing the reliability of these estimates under certain general assumptions about the distributions of the random measurement errors. Monte Carlo analysis is used to estimate parameter reliability for a hypothetical homogeneous soil column for which concentration data contain large random measurement errors. The value of data collected spatially versus data collected temporally was investigated for estimation of velocity, dispersion coefficient, effective porosity, first-order decay rate, and zero-order production. The use of spatial data gave estimates that were 2–3 times more reliable than estimates based on temporal data for all parameters except velocity. Comparison of estimated linear and nonlinear confidence intervals based upon Monte Carlo analysis showed that the linear approximation is poor for dispersion coefficient and zero-order production coefficient when data are collected over time. In addition, examples demonstrate transport parameter estimation for two real one-dimensional systems. First, the longitudinal dispersivity and effective porosity of an unsaturated soil are estimated using laboratory column data. We compare the reliability of estimates based upon data from individual laboratory experiments versus estimates based upon pooled data from several experiments. Second, the simulation nonlinear regression procedure is extended to include an additional governing equation that describes delayed storage during contaminant transport. The model is applied to analyze the trends, variability, and interrelationship of parameters in a mourtain stream in northern California.

Parameter estimation for a cohesive sediment transport model by assimilating satellite observations in the Hangzhou Bay: Temporal variations and spatial distributions

NASA Astrophysics Data System (ADS)

Wang, Daosheng; Zhang, Jicai; He, Xianqiang; Chu, Dongdong; Lv, Xianqing; Wang, Ya Ping; Yang, Yang; Fan, Daidu; Gao, Shu

2018-01-01

Model parameters in the suspended cohesive sediment transport models are critical for the accurate simulation of suspended sediment concentrations (SSCs). Difficulties in estimating the model parameters still prevent numerical modeling of the sediment transport from achieving a high level of predictability. Based on a three-dimensional cohesive sediment transport model and its adjoint model, the satellite remote sensing data of SSCs during both spring tide and neap tide, retrieved from Geostationary Ocean Color Imager (GOCI), are assimilated to synchronously estimate four spatially and temporally varying parameters in the Hangzhou Bay in China, including settling velocity, resuspension rate, inflow open boundary conditions and initial conditions. After data assimilation, the model performance is significantly improved. Through several sensitivity experiments, the spatial and temporal variation tendencies of the estimated model parameters are verified to be robust and not affected by model settings. The pattern for the variations of the estimated parameters is analyzed and summarized. The temporal variations and spatial distributions of the estimated settling velocity are negatively correlated with current speed, which can be explained using the combination of flocculation process and Stokes' law. The temporal variations and spatial distributions of the estimated resuspension rate are also negatively correlated with current speed, which are related to the grain size of the seabed sediments under different current velocities. Besides, the estimated inflow open boundary conditions reach the local maximum values near the low water slack conditions and the estimated initial conditions are negatively correlated with water depth, which is consistent with the general understanding. The relationships between the estimated parameters and the hydrodynamic fields can be suggestive for improving the parameterization in cohesive sediment transport models.

Velocity and thermal slip effects on MHD third order blood flow in an irregular channel though a porous medium with homogeneous/ heterogeneous reactions

NASA Astrophysics Data System (ADS)

Gnaneswara Reddy, M.

2017-09-01

This communication presents the transportation of third order hydromagnetic fluid with thermal radiation by peristalsis through an irregular channel configuration filled a porous medium under the low Reynolds number and large wavelength approximations. Joule heating, Hall current and homogeneous-heterogeneous reactions effects are considered in the energy and species equations. The Second-order velocity and energy slip restrictions are invoked. Final dimensionless governing transport equations along the boundary restrictions are resolved numerically with the help of NDsolve in Mathematica package. Impact of involved sundry parameters on the non-dimensional axial velocity, fluid temperature and concentration characteristics have been analyzed via plots and tables. It is manifest that an increasing porosity parameter leads to maximum velocity in the core part of the channel. Fluid velocity boosts near the walls of the channel where as the reverse effect in the central part of the channel for higher values of first order slip. Larger values of thermal radiation parameter R reduce the fluid temperature field. Also, an increase in heterogeneous reaction parameter Ks magnifies the concentration profile. The present study has the crucial application of thermal therapy in biomedical engineering.

Economic agglomerations and spatio-temporal cycles in a spatial growth model with capital transport cost

NASA Astrophysics Data System (ADS)

Juchem Neto, J. P.; Claeyssen, J. C. R.; Pôrto Júnior, S. S.

2018-03-01

In this paper we introduce capital transport cost in a unidimensional spatial Solow-Swan model of economic growth with capital-induced labor migration, considered in an unbounded domain. Proceeding with a stability analysis, we show that there is a critical value for the capital transport cost where the dynamic behavior of the economy changes, provided that the intensity of capital-induced labor migration is strong enough. On the one hand, if the capital transport cost is higher than this critical value, the spatially homogeneous equilibrium of coexistence of the model is stable, and the economy converges to this spatially homogeneous state in the long run; on the other hand, if transport cost is lower than this critical value, the equilibrium is unstable, and the economy may develop different spatio-temporal dynamics, including the formation of stable economic agglomerations and spatio-temporal economic cycles, depending on the other parameters in the model. Finally, numerical simulations support the results of the stability analysis, and illustrate the spatio-temporal dynamics generated by the model, suggesting that the economy as a whole benefits from the formation of economic agglomerations and cycles, with a higher capital transport cost reducing this gain.

Uncertainty Quantification of Equilibrium Climate Sensitivity in CCSM4

NASA Astrophysics Data System (ADS)

Covey, C. C.; Lucas, D. D.; Tannahill, J.; Klein, R.

2013-12-01

Uncertainty in the global mean equilibrium surface warming due to doubled atmospheric CO2, as computed by a "slab ocean" configuration of the Community Climate System Model version 4 (CCSM4), is quantified using 1,039 perturbed-input-parameter simulations. The slab ocean configuration reduces the model's e-folding time when approaching an equilibrium state to ~5 years. This time is much less than for the full ocean configuration, consistent with the shallow depth of the upper well-mixed layer of the ocean represented by the "slab." Adoption of the slab ocean configuration requires the assumption of preset values for the convergence of ocean heat transport beneath the upper well-mixed layer. A standard procedure for choosing these values maximizes agreement with the full ocean version's simulation of the present-day climate when input parameters assume their default values. For each new set of input parameter values, we computed the change in ocean heat transport implied by a "Phase 1" model run in which sea surface temperatures and sea ice concentrations were set equal to present-day values. The resulting total ocean heat transport (= standard value + change implied by Phase 1 run) was then input into "Phase 2" slab ocean runs with varying values of atmospheric CO2. Our uncertainty estimate is based on Latin Hypercube sampling over expert-provided uncertainty ranges of N = 36 adjustable parameters in the atmosphere (CAM4) and sea ice (CICE4) components of CCSM4. Two-dimensional projections of our sampling distribution for the N(N-1)/2 possible pairs of input parameters indicate full coverage of the N-dimensional parameter space, including edges. We used a machine learning-based support vector regression (SVR) statistical model to estimate the probability density function (PDF) of equilibrium warming. This fitting procedure produces a PDF that is qualitatively consistent with the raw histogram of our CCSM4 results. Most of the values from the SVR statistical model are within ~0.1 K of the raw results, well below the inter-decile range inferred below. Independent validation of the fit indicates residual errors that are distributed about zero with a standard deviation of 0.17 K. Analysis of variance shows that the equilibrium warming in CCSM4 is mainly linear in parameter changes. Thus, in accord with the Central Limit Theorem of statistics, the PDF of the warming is approximately Gaussian, i.e. symmetric about its mean value (3.0 K). Since SVR allows for highly nonlinear fits, the symmetry is not an artifact of the fitting procedure. The 10-90 percentile range of the PDF is 2.6-3.4 K, consistent with earlier estimates from CCSM4 but narrower than estimates from other models, which sometimes produce a high-temperature asymmetric tail in the PDF. This work was performed under auspices of the US Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344, and was funded by LLNL's Uncertainty Quantification Strategic Initiative (Laboratory Directed Research and Development Project 10-SI-013).

Optical photon transport in powdered-phosphor scintillators. Part II. Calculation of single-scattering transport parameters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poludniowski, Gavin G.; Evans, Philip M.

2013-04-15

Purpose: Monte Carlo methods based on the Boltzmann transport equation (BTE) have previously been used to model light transport in powdered-phosphor scintillator screens. Physically motivated guesses or, alternatively, the complexities of Mie theory have been used by some authors to provide the necessary inputs of transport parameters. The purpose of Part II of this work is to: (i) validate predictions of modulation transform function (MTF) using the BTE and calculated values of transport parameters, against experimental data published for two Gd{sub 2}O{sub 2}S:Tb screens; (ii) investigate the impact of size-distribution and emission spectrum on Mie predictions of transport parameters; (iii)more » suggest simpler and novel geometrical optics-based models for these parameters and compare to the predictions of Mie theory. A computer code package called phsphr is made available that allows the MTF predictions for the screens modeled to be reproduced and novel screens to be simulated. Methods: The transport parameters of interest are the scattering efficiency (Q{sub sct}), absorption efficiency (Q{sub abs}), and the scatter anisotropy (g). Calculations of these parameters are made using the analytic method of Mie theory, for spherical grains of radii 0.1-5.0 {mu}m. The sensitivity of the transport parameters to emission wavelength is investigated using an emission spectrum representative of that of Gd{sub 2}O{sub 2}S:Tb. The impact of a grain-size distribution in the screen on the parameters is investigated using a Gaussian size-distribution ({sigma}= 1%, 5%, or 10% of mean radius). Two simple and novel alternative models to Mie theory are suggested: a geometrical optics and diffraction model (GODM) and an extension of this (GODM+). Comparisons to measured MTF are made for two commercial screens: Lanex Fast Back and Lanex Fast Front (Eastman Kodak Company, Inc.). Results: The Mie theory predictions of transport parameters were shown to be highly sensitive to both grain size and emission wavelength. For a phosphor screen structure with a distribution in grain sizes and a spectrum of emission, only the average trend of Mie theory is likely to be important. This average behavior is well predicted by the more sophisticated of the geometrical optics models (GODM+) and in approximate agreement for the simplest (GODM). The root-mean-square differences obtained between predicted MTF and experimental measurements, using all three models (GODM, GODM+, Mie), were within 0.03 for both Lanex screens in all cases. This is excellent agreement in view of the uncertainties in screen composition and optical properties. Conclusions: If Mie theory is used for calculating transport parameters for light scattering and absorption in powdered-phosphor screens, care should be taken to average out the fine-structure in the parameter predictions. However, for visible emission wavelengths ({lambda} < 1.0 {mu}m) and grain radii (a > 0.5 {mu}m), geometrical optics models for transport parameters are an alternative to Mie theory. These geometrical optics models are simpler and lead to no substantial loss in accuracy.« less

Theoretical Calculation of the Electron Transport Parameters and Energy Distribution Function for CF3I with noble gases mixtures using Monte Carlo simulation program

NASA Astrophysics Data System (ADS)

Jawad, Enas A.

2018-05-01

In this paper, The Monte Carlo simulation program has been used to calculation the electron energy distribution function (EEDF) and electric transport parameters for the gas mixtures of The trif leoroiodo methane (CF3I) ‘environment friendly’ with a noble gases (Argon, Helium, kryptos, Neon and Xenon). The electron transport parameters are assessed in the range of E/N (E is the electric field and N is the gas number density of background gas molecules) between 100 to 2000Td (1 Townsend = 10-17 V cm2) at room temperature. These parameters, namely are electron mean energy (ε), the density –normalized longitudinal diffusion coefficient (NDL) and the density –normalized mobility (μN). In contrast, the impact of CF3I in the noble gases mixture is strongly apparent in the values for the electron mean energy, the density –normalized longitudinal diffusion coefficient and the density –normalized mobility. Note in the results of the calculation agreed well with the experimental results.

VERIFICATION AND VALIDATION OF THE SPARC MODEL

EPA Science Inventory

Mathematical models for predicting the transport and fate of pollutants in the environment require reactivity parameter values--that is, the physical and chemical constants that govern reactivity. Although empirical structure-activity relationships that allow estimation of some ...

Constraining the symmetry energy with heavy-ion collisions and Bayesian analysis

NASA Astrophysics Data System (ADS)

Tsang, C. Y.; Jhang, G.; Morfouace, P.; Lynch, W. G.; Tsang, M. B.; HiRA Collaboration

2017-09-01

To extract constraints on symmetry energy terms in nuclear Equation of State (EoS), data from heavy ion reactions, are often compared to calculations from transport models. As multiple model input parameters are needed in the transport model, it is necessary to do multi-parameter analysis to understand the relationship especially if strong correlations exist among the parameters. In this talk, I will discuss how four symmetry energy parameters, So, (Symmetry energy) and L (slope) at saturation density as well as the nucleon scaler effective mass (ms*) and the nucleon effective mass splitting, (FI) are obtained by comparing transport mode results with experimental data such as isospin diffusions and n/p spectral ratios using MADAI Bayesian analysis software. Probability of each parameter having a certain value given experimental data can be calculated with Bayes theorem by Markov Chain Monte Carlo integration. Results using single and double ratios of neutron and proton spectra from 124Sn +124Sn, 112Sn +112Sn collisions at 120 MeV/u as well as isospin diffusion from Sn +Sn isotopes, at 50 and 35 MeV/u will be presented. This research is supported by the National Science Foundation under Grant No. PHY-1565546.

Behavior of sensitivities in the one-dimensional advection-dispersion equation: Implications for parameter estimation and sampling design

USGS Publications Warehouse

Knopman, Debra S.; Voss, Clifford I.

1987-01-01

The spatial and temporal variability of sensitivities has a significant impact on parameter estimation and sampling design for studies of solute transport in porous media. Physical insight into the behavior of sensitivities is offered through an analysis of analytically derived sensitivities for the one-dimensional form of the advection-dispersion equation. When parameters are estimated in regression models of one-dimensional transport, the spatial and temporal variability in sensitivities influences variance and covariance of parameter estimates. Several principles account for the observed influence of sensitivities on parameter uncertainty. (1) Information about a physical parameter may be most accurately gained at points in space and time with a high sensitivity to the parameter. (2) As the distance of observation points from the upstream boundary increases, maximum sensitivity to velocity during passage of the solute front increases and the consequent estimate of velocity tends to have lower variance. (3) The frequency of sampling must be “in phase” with the S shape of the dispersion sensitivity curve to yield the most information on dispersion. (4) The sensitivity to the dispersion coefficient is usually at least an order of magnitude less than the sensitivity to velocity. (5) The assumed probability distribution of random error in observations of solute concentration determines the form of the sensitivities. (6) If variance in random error in observations is large, trends in sensitivities of observation points may be obscured by noise and thus have limited value in predicting variance in parameter estimates among designs. (7) Designs that minimize the variance of one parameter may not necessarily minimize the variance of other parameters. (8) The time and space interval over which an observation point is sensitive to a given parameter depends on the actual values of the parameters in the underlying physical system.

Application of the compensated Arrhenius formalism to fluidity data of polar organic liquids.

PubMed

Petrowsky, Matt; Fleshman, Allison M; Frech, Roger

2013-03-14

The temperature dependence of viscosity (the reciprocal of fluidity) in polar liquids has been studied for over a century, but the available theoretical models have serious limitations. Consequently, the viscosity is often described with empirical equations using adjustable fitting parameters that offer no insight into the molecular mechanism of transport. We have previously reported a novel approach called the compensated Arrhenius formalism (CAF) to describe ionic conductivity, self-diffusion, and dielectric relaxation in terms of molecular and system properties. Here the CAF is applied to fluidity data of pure n-acetates, 2-ketones, n-nitriles, and n-alcohols over the temperature range 5-85 °C. The fluidity is represented as an Arrhenius-like expression that includes a static dielectric constant dependence in the exponential prefactor. The dielectric constant dependence results from the dependence of mass and charge transport on the molecular dipole moment and the solvent dipole density. The CAF is the only self-consistent description of fluid transport in polar liquids written solely in terms of molecular and system parameters. A scaling procedure is used to calculate the activation energy for transport. We find that the activation energies for fluidity of the aprotic liquids are comparable in value, whereas a higher average E(a) value is observed for the n-alcohol data. Finally, we contrast the molecular description of transport presented here with the conventional hydrodynamic model.

Simultaneous measurement of glucose transport and utilization in the human brain.

PubMed

Shestov, Alexander A; Emir, Uzay E; Kumar, Anjali; Henry, Pierre-Gilles; Seaquist, Elizabeth R; Öz, Gülin

2011-11-01

Glucose is the primary fuel for brain function, and determining the kinetics of cerebral glucose transport and utilization is critical for quantifying cerebral energy metabolism. The kinetic parameters of cerebral glucose transport, K(M)(t) and V(max)(t), in humans have so far been obtained by measuring steady-state brain glucose levels by proton ((1)H) NMR as a function of plasma glucose levels and fitting steady-state models to these data. Extraction of the kinetic parameters for cerebral glucose transport necessitated assuming a constant cerebral metabolic rate of glucose (CMR(glc)) obtained from other tracer studies, such as (13)C NMR. Here we present new methodology to simultaneously obtain kinetic parameters for glucose transport and utilization in the human brain by fitting both dynamic and steady-state (1)H NMR data with a reversible, non-steady-state Michaelis-Menten model. Dynamic data were obtained by measuring brain and plasma glucose time courses during glucose infusions to raise and maintain plasma concentration at ∼17 mmol/l for ∼2 h in five healthy volunteers. Steady-state brain vs. plasma glucose concentrations were taken from literature and the steady-state portions of data from the five volunteers. In addition to providing simultaneous measurements of glucose transport and utilization and obviating assumptions for constant CMR(glc), this methodology does not necessitate infusions of expensive or radioactive tracers. Using this new methodology, we found that the maximum transport capacity for glucose through the blood-brain barrier was nearly twofold higher than maximum cerebral glucose utilization. The glucose transport and utilization parameters were consistent with previously published values for human brain.

[Influence of transport parameters values on volume flows in the double-membrane system].

PubMed

Slezak, Andrzej; Bryll, Arkadiusz

2005-01-01

On the basis of Kedem-Katchalsky non-linear equations for the double-membrane system, research were carried out upon the influence of the transmembrane transport parameters, i.e. hydraulic permeability (Lp), reflection (sigma) and solute (omega) coefficients on the volume flows in the double-membrane system. The membrane system was composed of two membranes Ml and Mr characterized by coefficients, respectively Lpl, sigmal, omegal and Lp(r), sigmar, omegar, that separated the solutions at concentrations Cl, Cm, Cr. In order to show the influence of the membranes parameters values on the volume flow intensity, there were calculated the following dependencies: J(v sigma) = f omega(Lp)ii, Jv = f sigma(omega r)Lp,i), Jv = f sigma(sigma(omega r Lp,li), Jv = f sigma(sigma omega l Lp,ri) , (i = l, r), in conditions of set out mechanic pressure (Pl = Pr = Po = const.) and set concentrations (Cl = Cr = C = const.). The graphical pictures of the two first equations are hyperbolas and straight lines in particular cases, whereas the graphical pictures of further two dependencies are more complex.

Facilitated movement of inertial Brownian motors driven by a load under an asymmetric potential.

PubMed

Ai, Bao-quan; Liu, Liang-gang

2007-10-01

Based on recent work [L. Machura, M. Kostur, P. Talkner, J. Luczka, and P. Hanggi, Phys. Rev. Lett. 98, 040601 (2007)], we extend the study of inertial Brownian motors to the case of an asymmetric potential. It is found that some transport phenomena appear in the presence of an asymmetric potential. Within tailored parameter regimes, there exists two optimal values of the load at which the mean velocity takes its maximum, which means that a load can facilitate the transport in the two parameter regimes. In addition, the phenomenon of multiple current reversals can be observed when the load is increased.

Thermal conductivity and phonon transport properties of silicon using perturbation theory and the environment-dependent interatomic potential

NASA Astrophysics Data System (ADS)

Pascual-Gutiérrez, José A.; Murthy, Jayathi Y.; Viskanta, Raymond

2009-09-01

Silicon thermal conductivities are obtained from the solution of the linearized phonon Boltzmann transport equation without the use of any parameter-fitting. Perturbation theory is used to compute the strength of three-phonon and isotope scattering mechanisms. Matrix elements based on Fermi's golden rule are computed exactly without assuming either average or mode-dependent Grüeisen parameters, and with no underlying assumptions of crystal isotropy. The environment-dependent interatomic potential is employed to describe the interatomic force constants and the perturbing Hamiltonians. A detailed methodology to accurately find three-phonon processes satisfying energy- and momentum-conservation rules is also described. Bulk silicon thermal conductivity values are computed across a range of temperatures and shown to match experimental data very well. It is found that about two-thirds of the heat transport in bulk silicon may be attributed to transverse acoustic modes. Effective relaxation times and mean free paths are computed in order to provide a more complete picture of the detailed transport mechanisms and for use with carrier transport models based on the Boltzmann transport equation.

Profiling optimization for big data transfer over dedicated channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, D.; Wu, Qishi; Rao, Nageswara S

The transfer of big data is increasingly supported by dedicated channels in high-performance networks, where transport protocols play an important role in maximizing applicationlevel throughput and link utilization. The performance of transport protocols largely depend on their control parameter settings, but it is prohibitively time consuming to conduct an exhaustive search in a large parameter space to find the best set of parameter values. We propose FastProf, a stochastic approximation-based transport profiler, to quickly determine the optimal operational zone of a given data transfer protocol/method over dedicated channels. We implement and test the proposed method using both emulations based onmore » real-life performance measurements and experiments over physical connections with short (2 ms) and long (380 ms) delays. Both the emulation and experimental results show that FastProf significantly reduces the profiling overhead while achieving a comparable level of end-to-end throughput performance with the exhaustive search-based approach.« less

Guidance for Selecting Input Parameters in Modeling the Environmental Fate and Transport of Pesticides

EPA Pesticide Factsheets

Guidance to select and prepare input values for OPP's aquatic exposure models. Intended to improve the consistency in modeling the fate of pesticides in the environment and quality of OPP's aquatic risk assessments.

Heterogeneity in Hydraulic Conductivity and Its Role on the Macroscale Transport of a Solute Plume from a Landfill: From Measurements to a Practical Application of Stochastic Flow and Transport Theory

NASA Astrophysics Data System (ADS)

Sudicky, E. A.; Illman, W. A.; Goltz, I. K.; Adams, J. J.; McLaren, R. G.

2008-12-01

The spatial variability of hydraulic conductivity in a shallow unconfined aquifer located at North Bay, Ontario composed of glacial-lacustrine and glacial-fluvial sands is examined in exceptional detail and characterized geostatistically. A total of 1878 permeameter measurements were performed at 0.05 m vertical intervals along cores taken from 20 boreholes along two intersecting transect lines. Simultaneous three-dimensional fitting of ln K variogram data to an exponential model yielded geostatistical parameters for the estimation of bulk hydraulic conductivity and solute dispersion parameters. The analysis revealed a ln K variance equal to about 2.0 and three-dimensional anisotropy of the correlation structure of the heterogeneity (λ 1, λ 2 and λ 3 equal to 17.19 m, 7.39 m and 1.0 m, respectively). Effective values of the hydraulic conductivity tensor and the value of the longitudinal macrodispersivity were calculated using the theoretical expressions of Gelhar and Axness (1983). The magnitude of the longitudinal macrodispersivity is reasonably consistent with the observed degree of longitudinal dispersion of the landfill plume along the principal path of migration. The prediction of the transverse dispersion suggests that the transverse-mixing process at the field scale is essentially controlled by local dispersion and diffusion. Variably-saturated 3D flow modeling using the statistically-derived effective hydraulic conductivity tensor allowed a reasonably close calibration to the measured water table and the observed heads at various depths in an array of piezometers. Concomitant transport modeling using the calculated longitudinal macrodispersivity, as well as local-scale values of the transverse dispersion parameters, reasonably predicted the extent and migration rates of the observed contaminant plume that was monitored using a network of multi-level samplers over a period of about 5 years. This study demonstrates that the use of statistically-derived parameters based on stochastic theories results in reliable large-scale 3D flow and transport models for complex hydrogeological systems. This is in agreement with the conclusions reached by Sudicky (1986) at the site of an elaborate tracer test conducted in the aquifer at the Canadian Forces Base Borden. This study represents one of the few attempts at validating stochastic theories of groundwater flow and solute transport in three-dimensions at a site where extensive field data have been collected.

An inverse modeling approach to estimate groundwater flow and transport model parameters at a research site at Vandenberg AFB, CA

NASA Astrophysics Data System (ADS)

Rasa, E.; Foglia, L.; Mackay, D. M.; Ginn, T. R.; Scow, K. M.

2009-12-01

A numerical groundwater fate and transport model was developed for analyses of data from field experiments evaluating the impacts of ethanol on the natural attenuation of benzene, toluene, ethylbenzene, and xylenes (BTEX) and methyl tert-butyl ether (MTBE) at Vandenberg Air Force Base, Site 60. We used the U.S. Geological Survey (USGS) groundwater flow (MODFLOW2000) and transport (MT3DMS) models in conjunction with the USGS universal inverse modeling code (UCODE) to jointly determine flow and transport parameters using bromide tracer data from multiple experiments in the same location. The key flow and transport parameters include hydraulic conductivity of aquifer and aquitard layers, porosity, and transverse and longitudinal dispersivity. Aquifer and aquitard layers were assumed homogenous in this study. Therefore, the calibration parameters were not spatially variable within each layer. A total of 162 monitoring wells in seven transects perpendicular to the mean flow direction were monitored over the course of ten months, resulting in 1,766 bromide concentration data points and 149 head values used as observations for the inverse modeling. The results showed the significance of the concentration observation data in predicting the flow model parameters and indicated the sensitivity of the hydraulic conductivity of different zones in the aquifer including the excavated former contaminant zone. The model has already been used to evaluate alternative designs for further experiments on in situ bioremediation of the tert-butyl alcohol (TBA) plume remaining at the site. We describe the recent applications of the model and future work, including adding reaction submodels to the calibrated flow model.

SUTRA (Saturated-Unsaturated Transport). A Finite-Element Simulation Model for Saturated-Unsaturated, Fluid-Density-Dependent Ground-Water Flow with Energy Transport or Chemically-Reactive Single-Species Solute Transport.

DTIC Science & Technology

1984-12-30

as three dimensional, when the assumption is made that all SUTRA parameters and coefficients have a constant value in the third space direction. A...finite element. The type of element employed by SUTRA for two-dimensional simulation is a quadrilateral which has a finite thickness in the third ... space dimension. This type of a quad- rilateral element and a typical two-dimensional mesh is shown in Figure 3.1. - All twelve edges of the two

Evaluation of severe accident risks: Quantification of major input parameters: MAACS (MELCOR Accident Consequence Code System) input

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sprung, J.L.; Jow, H-N; Rollstin, J.A.

1990-12-01

Estimation of offsite accident consequences is the customary final step in a probabilistic assessment of the risks of severe nuclear reactor accidents. Recently, the Nuclear Regulatory Commission reassessed the risks of severe accidents at five US power reactors (NUREG-1150). Offsite accident consequences for NUREG-1150 source terms were estimated using the MELCOR Accident Consequence Code System (MACCS). Before these calculations were performed, most MACCS input parameters were reviewed, and for each parameter reviewed, a best-estimate value was recommended. This report presents the results of these reviews. Specifically, recommended values and the basis for their selection are presented for MACCS atmospheric andmore » biospheric transport, emergency response, food pathway, and economic input parameters. Dose conversion factors and health effect parameters are not reviewed in this report. 134 refs., 15 figs., 110 tabs.« less

Electro-kinetically driven peristaltic transport of viscoelastic physiological fluids through a finite length capillary: Mathematical modeling.

PubMed

Tripathi, Dharmendra; Yadav, Ashu; Bég, O Anwar

2017-01-01

Analytical solutions are developed for the electro-kinetic flow of a viscoelastic biological liquid in a finite length cylindrical capillary geometry under peristaltic waves. The Jefferys' non-Newtonian constitutive model is employed to characterize rheological properties of the fluid. The unsteady conservation equations for mass and momentum with electro-kinetic and Darcian porous medium drag force terms are reduced to a system of steady linearized conservation equations in an axisymmetric coordinate system. The long wavelength, creeping (low Reynolds number) and Debye-Hückel linearization approximations are utilized. The resulting boundary value problem is shown to be controlled by a number of parameters including the electro-osmotic parameter, Helmholtz-Smoluchowski velocity (maximum electro-osmotic velocity), and Jefferys' first parameter (ratio of relaxation and retardation time), wave amplitude. The influence of these parameters and also time on axial velocity, pressure difference, maximum volumetric flow rate and streamline distributions (for elucidating trapping phenomena) is visualized graphically and interpreted in detail. Pressure difference magnitudes are enhanced consistently with both increasing electro-osmotic parameter and Helmholtz-Smoluchowski velocity, whereas they are only elevated with increasing Jefferys' first parameter for positive volumetric flow rates. Maximum time averaged flow rate is enhanced with increasing electro-osmotic parameter, Helmholtz-Smoluchowski velocity and Jefferys' first parameter. Axial flow is accelerated in the core (plug) region of the conduit with greater values of electro-osmotic parameter and Helmholtz-Smoluchowski velocity whereas it is significantly decelerated with increasing Jefferys' first parameter. The simulations find applications in electro-osmotic (EO) transport processes in capillary physiology and also bio-inspired EO pump devices in chemical and aerospace engineering. Copyright © 2016 Elsevier Inc. All rights reserved.

Predicting environmental fate parameters with infrared spectroscopy.

EPA Science Inventory

One of the principal uncertainties associated with risk assessments of organic chemicals in the environment is the lack of chemical-specific values that quantify the many processes determining the chemical's transport and transformation. Because it is not feasible to measure the ...

Evaluation of the field-effect carrier mobility in single-grain (and polycrystalline) organic semconductors

NASA Astrophysics Data System (ADS)

Kwok, H. L.

2005-08-01

Mobility in single-grain and polycrystalline organic field-effect transistors (OFETs) is of interest because it affects the performance of these devices. While reasonable values of the hole mobility has been measured in pentacene OFETs, relatively speaking, our understanding of the detailed transport mechanisms is somewhat weak and there is a lack of precise knowledge on the effects of the materials parameters such as the site spacing, the localization length, the rms width of the density of states (DOS), the escape frequency, etc. This work attempts to analyze the materials parameters of pentacene OFETs extracted from data reported in the literature. In this work, we developed a model for the mobility parameter from first principle and extracted the relevant materials parameters. According to our analyses, the transport mechanisms in the OFETs are fairly complex and the electrical properties are dominated by the properties of the trap states. As observed, the single-grain OFETs having smaller values of the rms widths of the DOS (in comparison with the polycrystalline OFETs) also had higher hole mobilities. Our results showed that increasing the gate bias could have a similar but smaller effect. Potentially, increasing the escape frequency is a more effective way to raise the hole mobility and this parameter appears to be affected by changes in the molecular structure and in the degree of "disorder".

Effect of Solute Size on Transport in Structured Porous Media

NASA Astrophysics Data System (ADS)

Hu, Qinhong; Brusseau, Mark L.

1995-07-01

The purpose of this work was to investigate the effect of solute size on transport in structured porous media. Miscible displacement experiments were performed with tracers of different sizes (i.e., tritiated water (3H2O), pentafluorobenzoate (PFBA), 2,4-dichlorophenoxyacetic acid (2,4-D), and hydroxypropyl-β-cyclodextrin (HPCD)) in aggregated, stratified, and macroporous media. The breakthrough curves exhibited both early breakthrough and tailing, indicative of nonideal transport in these structured media. Comparison of breakthrough curves revealed that the extent of nonideality (e.g., tailing) was HPCD > PFBA, 2,4-D > 3H2O. This behavior is consistent with the impact of solute size on the relative degree of "nonequilibrium" experienced by solutes whose transport is constrained by diffusive mass transfer. The capability of the first-order, dual-porosity mobile-immobile model to represent solute transport in these structured systems was evaluated by comparing independently determined values of the input parameters to values obtained by curve fitting of the experimental measurements. The calculated and optimized values compared quite well for the aggregated and stratified media, but not for the macroporous media. xperiments performed with tracers of different size are useful for characterizing the nature of the porous medium through which transport is occurring.

A generalized interval fuzzy mixed integer programming model for a multimodal transportation problem under uncertainty

NASA Astrophysics Data System (ADS)

Tian, Wenli; Cao, Chengxuan

2017-03-01

A generalized interval fuzzy mixed integer programming model is proposed for the multimodal freight transportation problem under uncertainty, in which the optimal mode of transport and the optimal amount of each type of freight transported through each path need to be decided. For practical purposes, three mathematical methods, i.e. the interval ranking method, fuzzy linear programming method and linear weighted summation method, are applied to obtain equivalents of constraints and parameters, and then a fuzzy expected value model is presented. A heuristic algorithm based on a greedy criterion and the linear relaxation algorithm are designed to solve the model.

Effect of Ion-Parallel Viscosity on the Propagation of Alfven Surface Waves

DTIC Science & Technology

2003-07-20

mode arises from 0.6 whose phase speed decreases with the in- 0 0.2 0.4 0.6 0.8 I crease in the value of the parameter V0. It is also Figure 2...after the value of 0.9. [3] R. Balescu , Transport Proccsses in Plasmas, Thus the modes of surface waves become damped North Holland, Amsterdam, 1 (1988

Source Parameter Estimation using the Second-order Closure Integrated Puff Model

DTIC Science & Technology

The sensor measurements are categorized as triggered and non-triggered based on the recorded concentration measurements and a threshold...concentration value. Using each measured value, sources of adjoint material are created from the triggered and non-triggered sensors, and the adjoint transport...equations are solved to predict the adjoint concentration fields. The adjoint source strength is inversely proportional to the concentration measurement

Inference of reactive transport model parameters using a Bayesian multivariate approach

NASA Astrophysics Data System (ADS)

Carniato, Luca; Schoups, Gerrit; van de Giesen, Nick

2014-08-01

Parameter estimation of subsurface transport models from multispecies data requires the definition of an objective function that includes different types of measurements. Common approaches are weighted least squares (WLS), where weights are specified a priori for each measurement, and weighted least squares with weight estimation (WLS(we)) where weights are estimated from the data together with the parameters. In this study, we formulate the parameter estimation task as a multivariate Bayesian inference problem. The WLS and WLS(we) methods are special cases in this framework, corresponding to specific prior assumptions about the residual covariance matrix. The Bayesian perspective allows for generalizations to cases where residual correlation is important and for efficient inference by analytically integrating out the variances (weights) and selected covariances from the joint posterior. Specifically, the WLS and WLS(we) methods are compared to a multivariate (MV) approach that accounts for specific residual correlations without the need for explicit estimation of the error parameters. When applied to inference of reactive transport model parameters from column-scale data on dissolved species concentrations, the following results were obtained: (1) accounting for residual correlation between species provides more accurate parameter estimation for high residual correlation levels whereas its influence for predictive uncertainty is negligible, (2) integrating out the (co)variances leads to an efficient estimation of the full joint posterior with a reduced computational effort compared to the WLS(we) method, and (3) in the presence of model structural errors, none of the methods is able to identify the correct parameter values.

Geomorphically based predictive mapping of soil thickness in upland watersheds

NASA Astrophysics Data System (ADS)

Pelletier, Jon D.; Rasmussen, Craig

2009-09-01

The hydrologic response of upland watersheds is strongly controlled by soil (regolith) thickness. Despite the need to quantify soil thickness for input into hydrologic models, there is currently no widely used, geomorphically based method for doing so. In this paper we describe and illustrate a new method for predictive mapping of soil thicknesses using high-resolution topographic data, numerical modeling, and field-based calibration. The model framework works directly with input digital elevation model data to predict soil thicknesses assuming a long-term balance between soil production and erosion. Erosion rates in the model are quantified using one of three geomorphically based sediment transport models: nonlinear slope-dependent transport, nonlinear area- and slope-dependent transport, and nonlinear depth- and slope-dependent transport. The model balances soil production and erosion locally to predict a family of solutions corresponding to a range of values of two unconstrained model parameters. A small number of field-based soil thickness measurements can then be used to calibrate the local value of those unconstrained parameters, thereby constraining which solution is applicable at a particular study site. As an illustration, the model is used to predictively map soil thicknesses in two small, ˜0.1 km2, drainage basins in the Marshall Gulch watershed, a semiarid drainage basin in the Santa Catalina Mountains of Pima County, Arizona. Field observations and calibration data indicate that the nonlinear depth- and slope-dependent sediment transport model is the most appropriate transport model for this site. The resulting framework provides a generally applicable, geomorphically based tool for predictive mapping of soil thickness using high-resolution topographic data sets.

Finite element computation of multi-physical micropolar transport phenomena from an inclined moving plate in porous media

NASA Astrophysics Data System (ADS)

Shamshuddin, MD.; Anwar Bég, O.; Sunder Ram, M.; Kadir, A.

2018-02-01

Non-Newtonian flows arise in numerous industrial transport processes including materials fabrication systems. Micropolar theory offers an excellent mechanism for exploring the fluid dynamics of new non-Newtonian materials which possess internal microstructure. Magnetic fields may also be used for controlling electrically-conducting polymeric flows. To explore numerical simulation of transport in rheological materials processing, in the current paper, a finite element computational solution is presented for magnetohydrodynamic, incompressible, dissipative, radiative and chemically-reacting micropolar fluid flow, heat and mass transfer adjacent to an inclined porous plate embedded in a saturated homogenous porous medium. Heat generation/absorption effects are included. Rosseland's diffusion approximation is used to describe the radiative heat flux in the energy equation. A Darcy model is employed to simulate drag effects in the porous medium. The governing transport equations are rendered into non-dimensional form under the assumption of low Reynolds number and also low magnetic Reynolds number. Using a Galerkin formulation with a weighted residual scheme, finite element solutions are presented to the boundary value problem. The influence of plate inclination, Eringen coupling number, radiation-conduction number, heat absorption/generation parameter, chemical reaction parameter, plate moving velocity parameter, magnetic parameter, thermal Grashof number, species (solutal) Grashof number, permeability parameter, Eckert number on linear velocity, micro-rotation, temperature and concentration profiles. Furthermore, the influence of selected thermo-physical parameters on friction factor, surface heat transfer and mass transfer rate is also tabulated. The finite element solutions are verified with solutions from several limiting cases in the literature. Interesting features in the flow are identified and interpreted.

Investigation of Transport Parameters of Graphene-Based Nanostructures

NASA Astrophysics Data System (ADS)

Sergeyev, D. M.; Shunkeyev, K. Sh.

2018-03-01

The paper presents results of computer simulation of the main transport parameters of nanostructures obtained through the row-by-row removal of carbon atoms from graphene ribbon. Research into the electrical parameters is carried out within the density functional theory using the non-equilibrium Green functions in the local-density approximation. Virtual NanoLab based on Atomistix ToolKit is used to construct structures and analyze simulation results. Current-voltage characteristics, differential conductivity and transmittance spectra of nanostructures are calculated at different values of bias voltage. It is found that there is a large region of negative differential resistance in current-voltage characteristics of nanostructures caused by resonant tunneling of quasi-particles. Differential (dI/dV) characteristic also has similar changes. The obtained results can be useful for building novel electronic devices in the field of nanoelectronics.

An evaluation of the predictive capabilities of CTRW and MRMT

NASA Astrophysics Data System (ADS)

Fiori, Aldo; Zarlenga, Antonio; Gotovac, Hrvoje; Jankovic, Igor; Cvetkovic, Vladimir; Dagan, Gedeon

2016-04-01

The prediction capability of two approximate models of non-Fickian transport in highly heterogeneous aquifers is checked by comparison with accurate numerical simulations, for mean uniform flow of velocity U. The two models considered are the MRMT (Multi Rate Mass Transfer) and CTRW (Continuous Time Random Walk) models. Both circumvent the need to solve the flow and transport equations by using proxy models, which provide the BTC μ(x,t) depending on a vector a of unknown 5 parameters. Although underlain by different conceptualisations, the two models have a similar mathematical structure. The proponents of the models suggest using field transport experiments at a small scale to calibrate a, toward predicting transport at larger scale. The strategy was tested with the aid of accurate numerical simulations in two and three dimensions from the literature. First, the 5 parameter values were calibrated by using the simulated μ at a control plane close to the injection one and subsequently using these same parameters for predicting μ at further 10 control planes. It is found that the two methods perform equally well, though the parameters identification is nonunique, with a large set of parameters providing similar fitting. Also, errors in the determination of the mean eulerian velocity may lead to significant shifts of the predicted BTC. It is found that the simulated BTCs satisfy Markovianity: they can be found as n-fold convolutions of a "kernel", in line with the models' main assumption.

Perfect quantum excitation energy transport via single edge perturbation in a complete network

NASA Astrophysics Data System (ADS)

Bassereh, Hassan; Salari, Vahid; Shahbazi, Farhad; Ala-Nissila, Tapio

2017-06-01

We consider quantum excitation energy transport (EET) in a network of two-state nodes in the Markovian approximation by employing the Lindblad formulation. We find that EET from an initial site, where the excitation is inserted to the sink, is generally inefficient due to the inhibition of transport by localization of the excitation wave packet in a symmetric, fully-connected network. We demonstrate that the EET efficiency can be significantly increased up to ≈100% by perturbing hopping transport between the initial node and the one connected directly to the sink, while the rate of energy transport is highest at a finite value of the hopping parameter. We also show that prohibiting hopping between the other nodes which are not directly linked to the sink does not improve the efficiency. We show that external dephasing noise in the network plays a constructive role for EET in the presence of localization in the network, while in the absence of localization it reduces the efficiency of EET. We also consider the influence of off-diagonal disorder in the hopping parameters of the network.

Bayesian model for fate and transport of polychlorinated biphenyl in upper Hudson River

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steinberg, L.J.; Reckhow, K.H.; Wolpert, R.L.

1996-05-01

Modelers of contaminant fate and transport in surface waters typically rely on literature values when selecting parameter values for mechanistic models. While the expert judgment with which these selections are made is valuable, the information contained in contaminant concentration measurements should not be ignored. In this full-scale Bayesian analysis of polychlorinated biphenyl (PCB) contamination in the upper Hudson River, these two sources of information are combined using Bayes` theorem. A simulation model for the fate and transport of the PCBs in the upper Hudson River forms the basis of the likelihood function while the prior density is developed from literaturemore » values. The method provides estimates for the anaerobic biodegradation half-life, aerobic biodegradation plus volatilization half-life, contaminated sediment depth, and resuspension velocity of 4,400 d, 3.2 d, 0.32 m, and 0.02 m/yr, respectively. These are significantly different than values obtained with more traditional methods, and are shown to produce better predictions than those methods when used in a cross-validation study.« less

Zonal flow generation and its feedback on turbulence production in drift wave turbulence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pushkarev, Andrey V.; Bos, Wouter J. T.; Nazarenko, Sergey V.

2013-04-15

Plasma turbulence described by the Hasegawa-Wakatani equations is simulated numerically for different models and values of the adiabaticity parameter C. It is found that for low values of C turbulence remains isotropic, zonal flows are not generated and there is no suppression of the meridional drift waves and particle transport. For high values of C, turbulence evolves towards highly anisotropic states with a dominant contribution of the zonal sector to the kinetic energy. This anisotropic flow leads to a decrease of turbulence production in the meridional sector and limits the particle transport across the mean isopycnal surfaces. This behavior allowsmore » to consider the Hasegawa-Wakatani equations a minimal PDE model, which contains the drift-wave/zonal-flow feedback loop mechanism.« less

Analytical method for establishing indentation rolling resistance

NASA Astrophysics Data System (ADS)

Gładysiewicz, Lech; Konieczna, Martyna

2018-01-01

Belt conveyors are highly reliable machines able to work in special operating conditions. Harsh environment, long distance of transporting and great mass of transported martials are cause of high energy usage. That is why research in the field of belt conveyor transportation nowadays focuses on reducing the power consumption without lowering their efficiency. In this paper, previous methods for testing rolling resistance are described, and new method designed by authors was presented. New method of testing rolling resistance is quite simple and inexpensive. Moreover it allows to conduct the experimental tests of the impact of different parameters on the value of indentation rolling resistance such as core design, cover thickness, ambient temperature, idler travel frequency, or load value as well. Finally results of tests of relationship between rolling resistance and idler travel frequency and between rolling resistance and idler travel speed was presented.

Electron transport in gold colloidal nanoparticle-based strain gauges.

PubMed

Moreira, Helena; Grisolia, Jérémie; Sangeetha, Neralagatta M; Decorde, Nicolas; Farcau, Cosmin; Viallet, Benoit; Chen, Ke; Viau, Guillaume; Ressier, Laurence

2013-03-08

A systematic approach for understanding the electron transport mechanisms in resistive strain gauges based on assemblies of gold colloidal nanoparticles (NPs) protected by organic ligands is described. The strain gauges were fabricated from parallel micrometer wide wires made of 14 nm gold (Au) colloidal NPs on polyethylene terephthalate substrates, elaborated by convective self-assembly. Electron transport in such devices occurs by inter-particle electron tunneling through the tunnel barrier imposed by the organic ligands protecting the NPs. This tunnel barrier was varied by changing the nature of organic ligands coating the nanoparticles: citrate (CIT), phosphines (BSPP, TDSP) and thiols (MPA, MUDA). Electro-mechanical tests indicate that only the gold NPs protected by phosphine and thiol ligands yield high gauge sensitivity. Temperature-dependent resistance measurements are explained using the 'regular island array model' that extracts transport parameters, i.e., the tunneling decay constant β and the Coulomb charging energy E(C). This reveals that the Au@CIT nanoparticle assemblies exhibit a behavior characteristic of a strong-coupling regime, whereas those of Au@BSPP, Au@TDSP, Au@MPA and Au@MUDA nanoparticles manifest a weak-coupling regime. A comparison of the parameters extracted from the two methods indicates that the most sensitive gauges in the weak-coupling regime feature the highest β. Moreover, the E(C) values of these 14 nm NPs cannot be neglected in determining the β values.

Electron transport in gold colloidal nanoparticle-based strain gauges

NASA Astrophysics Data System (ADS)

Moreira, Helena; Grisolia, Jérémie; Sangeetha, Neralagatta M.; Decorde, Nicolas; Farcau, Cosmin; Viallet, Benoit; Chen, Ke; Viau, Guillaume; Ressier, Laurence

2013-03-01

A systematic approach for understanding the electron transport mechanisms in resistive strain gauges based on assemblies of gold colloidal nanoparticles (NPs) protected by organic ligands is described. The strain gauges were fabricated from parallel micrometer wide wires made of 14 nm gold (Au) colloidal NPs on polyethylene terephthalate substrates, elaborated by convective self-assembly. Electron transport in such devices occurs by inter-particle electron tunneling through the tunnel barrier imposed by the organic ligands protecting the NPs. This tunnel barrier was varied by changing the nature of organic ligands coating the nanoparticles: citrate (CIT), phosphines (BSPP, TDSP) and thiols (MPA, MUDA). Electro-mechanical tests indicate that only the gold NPs protected by phosphine and thiol ligands yield high gauge sensitivity. Temperature-dependent resistance measurements are explained using the ‘regular island array model’ that extracts transport parameters, i.e., the tunneling decay constant β and the Coulomb charging energy EC. This reveals that the Au@CIT nanoparticle assemblies exhibit a behavior characteristic of a strong-coupling regime, whereas those of Au@BSPP, Au@TDSP, Au@MPA and Au@MUDA nanoparticles manifest a weak-coupling regime. A comparison of the parameters extracted from the two methods indicates that the most sensitive gauges in the weak-coupling regime feature the highest β. Moreover, the EC values of these 14 nm NPs cannot be neglected in determining the β values.

Heat and Moisture transport of socks

NASA Astrophysics Data System (ADS)

Komárková, P.; Glombíková, V.; Havelka, A.

2017-10-01

Investigating the liquid moisture transport and thermal properties is essential for understanding physiological comfort of clothes. This study reports on an experimental investigation of moisture management transport and thermal transport on the physiological comfort of commercially available socks. There are subjective evaluation and objective measurements. Subjective evaluation of the physiological comfort of socks is based on individual sensory perception of probands during and after physical exertion. Objective measurements were performed according to standardized methods using Moisture Management tester for measuring the humidity parameters and C-term TCi analyzer for thermal conductivity and thermal effusivity. The obtained values of liquid moisture transport and thermal properties were related to the material composition and structure of the tested socks. In summary, these results show that objective measurement corresponds with probands feelings.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Sun Ung, E-mail: sunung@umich.edu; Monroe, Charles W., E-mail: cwmonroe@umich.edu

The inverse problem of parameterizing intermolecular potentials given macroscopic transport and thermodynamic data is addressed. Procedures are developed to create arbitrary-precision algorithms for transport collision integrals, using the Lennard-Jones (12–6) potential as an example. Interpolation formulas are produced that compute these collision integrals to four-digit accuracy over the reduced-temperature range 0.3≤T{sup ⁎}≤400, allowing very fast computation. Lennard-Jones parameters for neon, argon, and krypton are determined by simultaneously fitting the observed temperature dependences of their viscosities and second virial coefficients—one of the first times that a thermodynamic and a dynamic property have been used simultaneously for Lennard-Jones parameterization. In addition tomore » matching viscosities and second virial coefficients within the bounds of experimental error, the determined Lennard-Jones parameters are also found to predict the thermal conductivity and self-diffusion coefficient accurately, supporting the value of the Lennard-Jones (12–6) potential for noble-gas transport-property correlation.« less

Parameterizing sorption isotherms using a hybrid global-local fitting procedure.

PubMed

Matott, L Shawn; Singh, Anshuman; Rabideau, Alan J

2017-05-01

Predictive modeling of the transport and remediation of groundwater contaminants requires an accurate description of the sorption process, which is usually provided by fitting an isotherm model to site-specific laboratory data. Commonly used calibration procedures, listed in order of increasing sophistication, include: trial-and-error, linearization, non-linear regression, global search, and hybrid global-local search. Given the considerable variability in fitting procedures applied in published isotherm studies, we investigated the importance of algorithm selection through a series of numerical experiments involving 13 previously published sorption datasets. These datasets, considered representative of state-of-the-art for isotherm experiments, had been previously analyzed using trial-and-error, linearization, or non-linear regression methods. The isotherm expressions were re-fit using a 3-stage hybrid global-local search procedure (i.e. global search using particle swarm optimization followed by Powell's derivative free local search method and Gauss-Marquardt-Levenberg non-linear regression). The re-fitted expressions were then compared to previously published fits in terms of the optimized weighted sum of squared residuals (WSSR) fitness function, the final estimated parameters, and the influence on contaminant transport predictions - where easily computed concentration-dependent contaminant retardation factors served as a surrogate measure of likely transport behavior. Results suggest that many of the previously published calibrated isotherm parameter sets were local minima. In some cases, the updated hybrid global-local search yielded order-of-magnitude reductions in the fitness function. In particular, of the candidate isotherms, the Polanyi-type models were most likely to benefit from the use of the hybrid fitting procedure. In some cases, improvements in fitness function were associated with slight (<10%) changes in parameter values, but in other cases significant (>50%) changes in parameter values were noted. Despite these differences, the influence of isotherm misspecification on contaminant transport predictions was quite variable and difficult to predict from inspection of the isotherms. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of Escherichia coli challenge and transport stress on hematology and serum chemistry values of three genetic lines of turkeys.

PubMed

Huff, G R; Huff, W E; Rath, N C; Anthony, N B; Nestor, K E

2008-11-01

Three lines of turkeys were compared for response to an Escherichia coli challenge followed by transport stress (transport). The turkey lines were a slow-growing line selected for increased egg production (egg line), a fast-growing line selected for increased 16-wk BW (F line), and a commercial line (Comm line). Birds were challenged at 14 wk of age with an air sac injection of 5,000 to 10,000 cfu of E. coli. At 8 d postchallenge, birds were subjected to a transport stress procedure that included 12 h of holding time in a transport vehicle. The following morning all birds (n = 10 to 19 birds/line) were bled. Whole blood was analyzed using the Cell-Dyn 3500 blood analysis system (Abbott Diagnostics), and serum chemistry was measured using the Express Plus analyzer (Ciba-Corning Diagnostics Corp.). Transport significantly decreased the levels of hematocrit, hemoglobin, mean cell volume, mean corpuscular hemoglobin, glucose, triglycerides, cholesterol, phosphorus, iron, albumin, and alkaline phosphatase (AP) and increased the levels of uric acid, blood urea nitrogen, alanine aminotransferase, aspartate aminotransferase, and creatine kinase. Line differences were variable, but the levels of both iron and AP were least in the fastest-growing Comm line birds and greatest in the slowest-growing egg-line birds with intermediate values in the F line. Iron and AP were also the only parameters influenced by sex, with males having greater levels of both compared with females. The creatine kinase levels were more than 6-fold greater in transported Comm line birds, and iron levels of transported Comm males were 3-fold less than controls. Previously, the growth rate of these lines was positively correlated with increased heterophil to lymphocyte ratios and susceptibility to colibacillosis. The differences seen in the Comm line for these commonly measured blood parameters suggest that they may be useful for profiling flocks to determine their response to transport stress and feed withdrawal.

Effect of spatial variability on solute velocity and dispersion in two soils of the Argentinian Pampas

NASA Astrophysics Data System (ADS)

Aparicio, Virginia; Costa, José; Domenech, Marisa; Castro Franco, Mauricio

2013-04-01

Predicting how solutes move through the unsaturated zone is essential to determine the potential risk of groundwater contamination (Costa et al., 1994). The estimation of the spatial variability of solute transport parameters, such as velocity and dispersion, enables a more accurate understanding of transport processes. Apparent electrical conductivity (ECa) has been used to characterize the spatial behavior of soil properties. The objective of this study was to characterize the spatial variability of soil transport parameters at field scale using ECa measurements. ECa measurements of 42 ha (Tres Arroyos) and 50 ha (Balcarce) farms were collected for the top 0-30 cm (ECa(s)) soil using the Veris® 3100. ECa maps were generated using geostatistical interpolation techniques. From these maps, three general areas were delineated, named high, medium, and low ECa zones. At each zone, three sub samples were collected. Soil samples were taken at 0-30 cm. Clay content and organic matter (OM) was analyzed. The transport assay was performed in the laboratory using undisturbed soil columns, under controlled conditions of T ° (22 ° C).Br- determinations were performed with a specific Br- electrode. The breakthrough curves were fitted using the model CXTFIT 2.1 (Toride et al., 1999) to estimate the transport parameters Velocity (V) and Dispersion (D). In this study we found no statistical significant differences for V and D between treatments. Also, there were no differences in V and D between sites. The average V and D value was 9.3 cm h-1 and 357.5 cm2 h-2, respectively. Despite finding statistically significant differences between treatments for the other measured physical and chemical properties, in our work it was not possible to detect the spatial variability of solute transport parameters.

Sorption testing and generalized composite surface complexation models for determining uranium sorption parameters at a proposed in-situ recovery site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Raymond H.; Truax, Ryan A.; Lankford, David A.

Solid-phase iron concentrations and generalized composite surface complexation models were used to evaluate procedures in determining uranium sorption on oxidized aquifer material at a proposed U in situ recovery (ISR) site. At the proposed Dewey Burdock ISR site in South Dakota, USA, oxidized aquifer material occurs downgradient of the U ore zones. Solid-phase Fe concentrations did not explain our batch sorption test results,though total extracted Fe appeared to be positively correlated with overall measured U sorption. Batch sorption test results were used to develop generalized composite surface complexation models that incorporated the full genericsorption potential of each sample, without detailedmore » mineralogiccharacterization. The resultant models provide U sorption parameters (site densities and equilibrium constants) for reactive transport modeling. The generalized composite surface complexation sorption models were calibrated to batch sorption data from three oxidized core samples using inverse modeling, and gave larger sorption parameters than just U sorption on the measured solidphase Fe. These larger sorption parameters can significantly influence reactive transport modeling, potentially increasing U attenuation. Because of the limited number of calibration points, inverse modeling required the reduction of estimated parameters by fixing two parameters. The best-fit models used fixed values for equilibrium constants, with the sorption site densities being estimated by the inversion process. While these inverse routines did provide best-fit sorption parameters, local minima and correlated parameters might require further evaluation. Despite our limited number of proxy samples, the procedures presented provide a valuable methodology to consider for sites where metal sorption parameters are required. Furthermore, these sorption parameters can be used in reactive transport modeling to assess downgradient metal attenuation, especially when no other calibration data are available, such as at proposed U ISR sites.« less

Sorption testing and generalized composite surface complexation models for determining uranium sorption parameters at a proposed in-situ recovery site

DOE PAGES

Johnson, Raymond H.; Truax, Ryan A.; Lankford, David A.; ...

2016-02-03

Solid-phase iron concentrations and generalized composite surface complexation models were used to evaluate procedures in determining uranium sorption on oxidized aquifer material at a proposed U in situ recovery (ISR) site. At the proposed Dewey Burdock ISR site in South Dakota, USA, oxidized aquifer material occurs downgradient of the U ore zones. Solid-phase Fe concentrations did not explain our batch sorption test results,though total extracted Fe appeared to be positively correlated with overall measured U sorption. Batch sorption test results were used to develop generalized composite surface complexation models that incorporated the full genericsorption potential of each sample, without detailedmore » mineralogiccharacterization. The resultant models provide U sorption parameters (site densities and equilibrium constants) for reactive transport modeling. The generalized composite surface complexation sorption models were calibrated to batch sorption data from three oxidized core samples using inverse modeling, and gave larger sorption parameters than just U sorption on the measured solidphase Fe. These larger sorption parameters can significantly influence reactive transport modeling, potentially increasing U attenuation. Because of the limited number of calibration points, inverse modeling required the reduction of estimated parameters by fixing two parameters. The best-fit models used fixed values for equilibrium constants, with the sorption site densities being estimated by the inversion process. While these inverse routines did provide best-fit sorption parameters, local minima and correlated parameters might require further evaluation. Despite our limited number of proxy samples, the procedures presented provide a valuable methodology to consider for sites where metal sorption parameters are required. Furthermore, these sorption parameters can be used in reactive transport modeling to assess downgradient metal attenuation, especially when no other calibration data are available, such as at proposed U ISR sites.« less

Fate and Transport of CL-20 and RDX in Unsaturated Laboratory Columns

NASA Astrophysics Data System (ADS)

Lemond, L. A.; Gamerdinger, A. P.; Szecsody, J. E.

2005-05-01

This research examines the fate and transport of two explosive compounds, Hexanitrohexaazaisowurtzitane (CL-20) and Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) in unsaturated laboratory columns. The transport and fate of these compounds were studied under saturated and unsaturated conditions in three natural soils: coarse sand, sandy loam, and a silt loam. Unsaturated column experiments were conducted using an ultra-centrifugation method. Sorption and degradation parameters were determined by moment analysis and hydrodynamic parameters were assessed with a two-region flow model. Differences in these parameters were evaluated as a function of water content. The fate and transport of CL-20 is highly dependent on 1) the soil type and 2) the compound's residence time in the soil and 3) water content of the media. Sorption of CL-20 was rate-limited. CL-20 degradation in saturated columns produced a half-life of as much as 22hr, but in unsaturated columns the degradation rate increased considerably, producing a half life of as little as 2hr. The fate and transport of RDX are also affected by the soil type, but sorption appeared to be instantaneous. Degradation of RDX was negligible. Our results suggest that at very low water content immobile water regions may become (at least in effect) isolated water regions and significantly alter the retardation of the tracer. In the sandy loam, there was as much as a 20-fold over-prediction of the retardation factor in the unsaturated saturated columns when predicted by Kd values derived from saturated columns. In the coarse sand, Kd values derived from saturated columns over-predicted retardation in the unsaturated columns by as much as 30%. In the silt loam, retardation factors were over-predicted by as much as 80%. At very low water contents, predictions of tracer behavior become very difficult because of changes in the flow regime that cannot be directly accounted for.

A new methodology for determination of macroscopic transport parameters in drying porous media

NASA Astrophysics Data System (ADS)

Attari Moghaddam, A.; Kharaghani, A.; Tsotsas, E.; Prat, M.

2015-12-01

Two main approaches have been used to model the drying process: The first approach considers the partially saturated porous medium as a continuum and partial differential equations are used to describe the mass, momentum and energy balances of the fluid phases. The continuum-scale models (CM) obtained by this approach involve constitutive laws which require effective material properties, such as the diffusivity, permeability, and thermal conductivity which are often determined by experiments. The second approach considers the material at the pore scale, where the void space is represented by a network of pores (PN). Micro- or nanofluidics models used in each pore give rise to a large system of ordinary differential equations with degrees of freedom at each node of the pore network. In this work, the moisture transport coefficient (D), the pseudo desorption isotherm inside the network and at the evaporative surface are estimated from the post-processing of the three-dimensional pore network drying simulations for fifteen realizations of the pore space geometry from a given probability distribution. A slice sampling method is used in order to extract these parameters from PN simulations. The moisture transport coefficient obtained in this way is shown in Fig. 1a. The minimum of average D values demonstrates the transition between liquid dominated moisture transport region and vapor dominated moisture transport region; a similar behavior has been observed in previous experimental findings. A function is fitted to the average D values and then is fed into the non-linear moisture diffusion equation. The saturation profiles obtained from PN and CM simulations are shown in Fig. 1b. Figure 1: (a) extracted moisture transport coefficient during drying for fifteen realizations of the pore network, (b) average moisture profiles during drying obtained from PN and CM simulations.

Air pollution potential: Regional study in Argentina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gassmann, M.I.; Mazzeo, N.A.

2000-04-01

Air pollution potential is a measure of the atmospheric conditions that are unable to transport and dilute pollutants into the air, independently of the existence of sources. This potential can be determined from two atmospheric parameters; mixing height and transport wind. In this paper a statistical analysis of the mixing height and transport wind, in order to determine the areas with high or poor atmospheric ventilation in Argentina, is presented. In order to achieve this, meteorological data registered during 1979--1982 at eight meteorological stations were used. Daily values of the maximum mixing height were calculated from observations of daily temperaturesmore » at different heights and maximum surface temperature. At the same time as the maximum mixing height, the values of the transport wind were determined from the surface windspeed and the characteristics of the ground in the surroundings of each meteorological station. The mean seasonal values for both parameters were obtained. Isopleths of the mean seasonal of the maximum mixing heights were drawn. The percentage of seasonal frequencies of poor ventilation conditions were calculated and the frequency isopleths were also drawn to determine areas with minor and major relative frequencies. It was found that the northeastern and central-eastern regions of Argentina had a high air pollution potential during the whole year. Unfavorable atmospheric ventilation conditions were also found in the central-western side of the country during the cold seasons (37.5% in autumn and 56.9% in winter). The region with the greatest atmospheric ventilation is located south of 40{degree}S, where the frequency of poor ventilation varies between 8.0% in summer and 10.8% in winter.« less

Interaction of 3H+ (as HTO) and 36Cl- (as Na36Cl) with crushed granite and corresponding fracture infill material investigated in column experiments.

PubMed

Štamberg, K; Palágyi, Š; Videnská, K; Havlová, V

The transport of 3 H + (as HTO) and 36 Cl - (as Na 36 Cl) was investigated in the dynamic system, i.e., in the columns filled with crushed pure granite and fracture infill of various grain sizes. The aim of column experiments was to determine important transport parameter, such as the retardation, respectively distribution coefficients, Peclet numbers and hydrodynamic dispersion coefficients. Furthermore, the research was focused to quantification of the effect of grain size on migration of studied radionuclides. The experimental breakthrough curves were fitted by a model based on the erfc-function, assuming a linear reversible equilibrium sorption/desorption isotherm, and the above mentioned transport parameters were determined. The results showed that influence of grain size on sorption of 3 H + and 36 Cl - was negligible. Retardation and distribution coefficients of both tracers converged to one and zero, respectively, in case of all fractions of crushed granite and infill material. Generally, the presumed ion exclusion of 36 Cl in anionic form was proved under given conditions, only very weak one seems to exist in a case of infill material. In principal, both radionuclides behaved as non-sorbing, conservative tracers. On the other hand, the influence of grain size on Peclet numbers value and on dispersion coefficient was observed for both crystalline materials, namely in agreement with theoretical suppositions that the values of Peclet numbers decrease with increasing grain size and values of dispersion coefficient increase.

Identification of diffusive transport properties of poly(vinyl alcohol) hydrogels from reservoir test.

PubMed

Kazimierska-Drobny, Katarzyna; Kaczmarek, Mariusz

2013-12-01

In this paper the identification of diffusion coefficient, retardation factor and surface distribution coefficient for selected salts in poly(vinyl alcohol) hydrogels is performed. The identification of the transport parameters is based on the previously developed inverse problem technique using experimental data from the reservoir test and the solution of the diffusive transport equation with linear equilibrium sorption. The estimated values of diffusion coefficient are: for physiological fluid (6.30±0.10)×10(-10) m(2)/s, for 1 M NaCl (6.42±0.39)×10(-10) m(2)/s, and for 1 M KCl (7.94±0.38)×10(-10) m(2)/s. The retardation factor for all tested materials and salts is equal or close to one. The average value of the effective surface distribution coefficient is equal to 0.5. © 2013 Elsevier B.V. All rights reserved.

Angular Momentum Transport in Convectively Unstable Shear Flows

NASA Astrophysics Data System (ADS)

Käpylä, Petri J.; Brandenburg, Axel; Korpi, Maarit J.; Snellman, Jan E.; Narayan, Ramesh

2010-08-01

Angular momentum transport due to hydrodynamic turbulent convection is studied using local three-dimensional numerical simulations employing the shearing box approximation. We determine the turbulent viscosity from non-rotating runs over a range of values of the shear parameter and use a simple analytical model in order to extract the non-diffusive contribution (Λ-effect) to the stress in runs where rotation is included. Our results suggest that the turbulent viscosity is on the order of the mixing length estimate and weakly affected by rotation. The Λ-effect is non-zero and a factor of 2-4 smaller than the turbulent viscosity in the slow rotation regime. We demonstrate that for Keplerian shear, the angular momentum transport can change sign and be outward when the rotation period is greater than the turnover time, i.e., when the Coriolis number is below unity. This result seems to be relatively independent of the value of the Rayleigh number.

New best estimates for radionuclide solid-liquid distribution coefficients in soils. Part 2: naturally occurring radionuclides.

PubMed

Vandenhove, H; Gil-García, C; Rigol, A; Vidal, M

2009-09-01

Predicting the transfer of radionuclides in the environment for normal release, accidental, disposal or remediation scenarios in order to assess exposure requires the availability of an important number of generic parameter values. One of the key parameters in environmental assessment is the solid liquid distribution coefficient, K(d), which is used to predict radionuclide-soil interaction and subsequent radionuclide transport in the soil column. This article presents a review of K(d) values for uranium, radium, lead, polonium and thorium based on an extensive literature survey, including recent publications. The K(d) estimates were presented per soil groups defined by their texture and organic matter content (Sand, Loam, Clay and Organic), although the texture class seemed not to significantly affect K(d). Where relevant, other K(d) classification systems are proposed and correlations with soil parameters are highlighted. The K(d) values obtained in this compilation are compared with earlier review data.

Particle tracking acceleration via signed distance fields in direct-accelerated geometry Monte Carlo

DOE PAGES

Shriwise, Patrick C.; Davis, Andrew; Jacobson, Lucas J.; ...

2017-08-26

Computer-aided design (CAD)-based Monte Carlo radiation transport is of value to the nuclear engineering community for its ability to conduct transport on high-fidelity models of nuclear systems, but it is more computationally expensive than native geometry representations. This work describes the adaptation of a rendering data structure, the signed distance field, as a geometric query tool for accelerating CAD-based transport in the direct-accelerated geometry Monte Carlo toolkit. Demonstrations of its effectiveness are shown for several problems. The beginnings of a predictive model for the data structure's utilization based on various problem parameters is also introduced.

Anisotropic mesoscale eddy transport in ocean general circulation models

NASA Astrophysics Data System (ADS)

Reckinger, Scott; Fox-Kemper, Baylor; Bachman, Scott; Bryan, Frank; Dennis, John; Danabasoglu, Gokhan

2014-11-01

In modern climate models, the effects of oceanic mesoscale eddies are introduced by relating subgrid eddy fluxes to the resolved gradients of buoyancy or other tracers, where the proportionality is, in general, governed by an eddy transport tensor. The symmetric part of the tensor, which represents the diffusive effects of mesoscale eddies, is universally treated isotropically. However, the diffusive processes that the parameterization approximates, such as shear dispersion and potential vorticity barriers, typically have strongly anisotropic characteristics. Generalizing the eddy diffusivity tensor for anisotropy extends the number of parameters from one to three: major diffusivity, minor diffusivity, and alignment. The Community Earth System Model (CESM) with the anisotropic eddy parameterization is used to test various choices for the parameters, which are motivated by observations and the eddy transport tensor diagnosed from high resolution simulations. Simply setting the ratio of major to minor diffusivities to a value of five globally, while aligning the major axis along the flow direction, improves biogeochemical tracer ventilation and reduces temperature and salinity biases. These effects can be improved by parameterizing the oceanic anisotropic transport mechanisms.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morales, George J.; Maggs, James E.

The project expanded and developed mathematical descriptions, and corresponding numerical modeling, of non-diffusive transport to incorporate new perspectives derived from basic transport experiments performed in the LAPD device at UCLA, and at fusion devices throughout the world. By non-diffusive it is meant that the transport of fundamental macroscopic parameters of a system, such as temperature and density, does not follow the standard diffusive behavior predicted by a classical Fokker-Planck equation. The appearance of non-diffusive behavior is often related to underlying microscopic processes that cause the value of a system parameter, at one spatial position, to be linked to distant events,more » i.e., non-locality. In the LAPD experiments the underlying process was traced to large amplitude, coherent drift-waves that give rise to chaotic trajectories. Significant advances were made in this project. The results have lead to a new perspective about the fundamentals of edge transport in magnetically confined plasmas; the insight has important consequences for worldwide studies in fusion devices. Progress was also made in advancing the mathematical techniques used to describe fractional diffusion.« less

Strong disk winds traced throughout outbursts in black-hole X-ray binaries

NASA Astrophysics Data System (ADS)

Tetarenko, B. E.; Lasota, J.-P.; Heinke, C. O.; Dubus, G.; Sivakoff, G. R.

2018-02-01

Recurring outbursts associated with matter flowing onto compact stellar remnants (such as black holes, neutron stars and white dwarfs) in close binary systems provide a way of constraining the poorly understood accretion process. The light curves of these outbursts are shaped by the efficiency of angular-momentum (and thus mass) transport in the accretion disks, which has traditionally been encoded in a viscosity parameter, α. Numerical simulations of the magneto-rotational instability that is believed to be the physical mechanism behind this transport yield values of α of roughly 0.1–0.2, consistent with values determined from observations of accreting white dwarfs. Equivalent viscosity parameters have hitherto not been estimated for disks around neutron stars or black holes. Here we report the results of an analysis of archival X-ray light curves of 21 outbursts in black-hole X-ray binaries. By applying a Bayesian approach to a model of accretion, we determine corresponding values of α of around 0.2–1.0. These high values may be interpreted as an indication either of a very high intrinsic rate of angular-momentum transport in the disk, which could be sustained by the magneto-rotational instability only if a large-scale magnetic field threads the disk, or that mass is being lost from the disk through substantial outflows, which strongly shape the outburst in the black-hole X-ray binary. The lack of correlation between our estimates of α and the accretion state of the binaries implies that such outflows can remove a substantial fraction of the disk mass in all accretion states and therefore suggests that the outflows correspond to magnetically driven disk winds rather than thermally driven ones, which require specific radiative conditions.

Strong disk winds traced throughout outbursts in black-hole X-ray binaries.

PubMed

Tetarenko, B E; Lasota, J-P; Heinke, C O; Dubus, G; Sivakoff, G R

2018-02-01

Recurring outbursts associated with matter flowing onto compact stellar remnants (such as black holes, neutron stars and white dwarfs) in close binary systems provide a way of constraining the poorly understood accretion process. The light curves of these outbursts are shaped by the efficiency of angular-momentum (and thus mass) transport in the accretion disks, which has traditionally been encoded in a viscosity parameter, α. Numerical simulations of the magneto-rotational instability that is believed to be the physical mechanism behind this transport yield values of α of roughly 0.1-0.2, consistent with values determined from observations of accreting white dwarfs. Equivalent viscosity parameters have hitherto not been estimated for disks around neutron stars or black holes. Here we report the results of an analysis of archival X-ray light curves of 21 outbursts in black-hole X-ray binaries. By applying a Bayesian approach to a model of accretion, we determine corresponding values of α of around 0.2-1.0. These high values may be interpreted as an indication either of a very high intrinsic rate of angular-momentum transport in the disk, which could be sustained by the magneto-rotational instability only if a large-scale magnetic field threads the disk, or that mass is being lost from the disk through substantial outflows, which strongly shape the outburst in the black-hole X-ray binary. The lack of correlation between our estimates of α and the accretion state of the binaries implies that such outflows can remove a substantial fraction of the disk mass in all accretion states and therefore suggests that the outflows correspond to magnetically driven disk winds rather than thermally driven ones, which require specific radiative conditions.

Investigation of flow and transport processes at the MADE site using ensemble Kalman filter

USGS Publications Warehouse

Liu, Gaisheng; Chen, Y.; Zhang, Dongxiao

2008-01-01

In this work the ensemble Kalman filter (EnKF) is applied to investigate the flow and transport processes at the macro-dispersion experiment (MADE) site in Columbus, MS. The EnKF is a sequential data assimilation approach that adjusts the unknown model parameter values based on the observed data with time. The classic advection-dispersion (AD) and the dual-domain mass transfer (DDMT) models are employed to analyze the tritium plume during the second MADE tracer experiment. The hydraulic conductivity (K), longitudinal dispersivity in the AD model, and mass transfer rate coefficient and mobile porosity ratio in the DDMT model, are estimated in this investigation. Because of its sequential feature, the EnKF allows for the temporal scaling of transport parameters during the tritium concentration analysis. Inverse simulation results indicate that for the AD model to reproduce the extensive spatial spreading of the tritium observed in the field, the K in the downgradient area needs to be increased significantly. The estimated K in the AD model becomes an order of magnitude higher than the in situ flowmeter measurements over a large portion of media. On the other hand, the DDMT model gives an estimation of K that is much more comparable with the flowmeter values. In addition, the simulated concentrations by the DDMT model show a better agreement with the observed values. The root mean square (RMS) between the observed and simulated tritium plumes is 0.77 for the AD model and 0.45 for the DDMT model at 328 days. Unlike the AD model, which gives inconsistent K estimates at different times, the DDMT model is able to invert the K values that consistently reproduce the observed tritium concentrations through all times. ?? 2008 Elsevier Ltd. All rights reserved.

Theoretical Study of Molecular Transport Through a Permeabilized Cell Membrane in a Microchannel.

PubMed

Mahboubi, Masoumeh; Movahed, Saeid; Hosseini Abardeh, Reza; Hoshyargar, Vahid

2017-06-01

A two-dimensional model is developed to study the molecular transport into an immersed cell in a microchannel and to investigate the effects of finite boundary (a cell is suspended in a microchannel), amplitude of electric pulse, and geometrical parameter (microchannel height and size of electrodes) on cell uptake. Embedded electrodes on the walls of the microchannel generate the required electric pulse to permeabilize the cell membrane, pass the ions through the membrane, and transport them into the cell. The shape of electric pulses is square with the time span of 6 ms; their intensities are in the range of 2.2, 2.4, 2.6, 3 V. Numerical simulations have been performed to comprehensively investigate the molecular uptake into the cell. The obtained results of the current study demonstrate that calcium ions enter the cell from the anodic side (the side near positive electrode); after a while, the cell faces depletion of the calcium ions on a positive electrode-facing side within the microchannel; the duration of depletion depends on the amplitude of electric pulse and geometry that lasts from microseconds to milliseconds. By keeping geometrical parameters and time span constant, increment of a pulse intensity enhances molecular uptake and rate of propagation inside the cell. If a ratio of electrode size to cell diameter is larger than 1, the transported amount of Ca 2+ into the cell, as well as the rate of propagation, will be significantly increased. By increasing the height of the microchannel, the rate of uptake is decreased. In an infinite domain, the peak concentration becomes constant after reaching the maximum value; this value depends on the intra-extracellular conductivity and diffusion coefficient of interior and exterior domains of the cell. In comparison, the maximum concentration is changed by geometrical parameters in the microchannel. After reaching the maximum value, the peak concentration reduces due to the depletion of Ca 2+ ions within the microchannel. Electrophoretic velocity has a significant effect on the cell uptake.

Heterogeneity in hydraulic conductivity and its role on the macroscale transport of a solute plume: From measurements to a practical application of stochastic flow and transport theory

NASA Astrophysics Data System (ADS)

Sudicky, E. A.; Illman, W. A.; Goltz, I. K.; Adams, J. J.; McLaren, R. G.

2010-01-01

The spatial variability of hydraulic conductivity in a shallow unconfined aquifer located at North Bay, Ontario, composed of glacial-lacustrine and glacial-fluvial sands, is examined in exceptional detail and characterized geostatistically. A total of 1878 permeameter measurements were performed at 0.05 m vertical intervals along cores taken from 20 boreholes along two intersecting transect lines. Simultaneous three-dimensional (3-D) fitting of Ln(K) variogram data to an exponential model yielded geostatistical parameters for the estimation of bulk hydraulic conductivity and solute dispersion parameters. The analysis revealed a Ln(K) variance equal to about 2.0 and 3-D anisotropy of the correlation structure of the heterogeneity (λ1, λ2, and λ3 equal to 17.19, 7.39, and 1.0 m, respectively). Effective values of the hydraulic conductivity tensor and the value of the longitudinal macrodispersivity were calculated using the theoretical expressions of Gelhar and Axness (1983). The magnitude of the longitudinal macrodispersivity is reasonably consistent with the observed degree of longitudinal dispersion of the landfill plume along the principal path of migration. Variably saturated 3-D flow modeling using the statistically derived effective hydraulic conductivity tensor allowed a reasonably close prediction of the measured water table and the observed heads at various depths in an array of piezometers. Concomitant transport modeling using the calculated longitudinal macrodispersivity reasonably predicted the extent and migration rates of the observed contaminant plume that was monitored using a network of multilevel samplers over a period of about 5 years. It was further demonstrated that the length of the plume is relatively insensitive to the value of the longitudinal macrodispersivity under the conditions of a steady flow in 3-D and constant source strength. This study demonstrates that the use of statistically derived parameters based on stochastic theories results in reliable large-scale 3-D flow and transport models for complex hydrogeological systems. This is in agreement with the conclusions reached by Sudicky (1986) at the site of an elaborate tracer test conducted in the aquifer at the Canadian Forces Base Borden.

Climate Change Impacts on Transportation; Groundwater Elevation, Road Performance, and Robust Adaptation

NASA Astrophysics Data System (ADS)

Kirshen, P. H.; Knott, J. F.; Ray, P.; Elshaer, M.; Daniel, J.; Jacobs, J. M.

2016-12-01

Transportation climate change vulnerability and adaptation studies have primarily focused on surface-water flooding from sea-level rise (SLR); little attention has been given to the effects of climate change and SLR on groundwater and subsequent impacts on the unbound foundation layers of coastal-road infrastructure. The magnitude of service-life reduction depends on the height of the groundwater in the unbound pavement materials, the pavement structure itself, and the loading. Using a steady-state groundwater model, and a multi-layer elastic pavement evaluation model, the strain changes in the layers can be determined as a function of parameter values and the strain changes translated into failure as measured by number of loading cycles to failure. For a section of a major coastal road in New Hampshire, future changes in sea-level, precipitation, temperature, land use, and groundwater pumping are characterized by deep uncertainty. Parameters that describe the groundwater system such as hydraulic conductivity can be probabilistically described while road characteristics are assumed to be deterministic. To understand the vulnerability of this road section, a bottom-up planning approach was employed over time where the combinations of parameter values that cause failure were determined and their plausibility of their occurring was analyzed. To design a robust adaptation strategy that will function reasonably well in the present and the future given the large number of uncertain parameter values, performance of adaptation options were investigated. Adaptation strategies that were considered include raising the road, load restrictions, increasing pavement layer thicknesses, replacing moisture-sensitive materials with materials that are not moisture sensitive, improving drainage systems, and treatment of the underlying materials.

Tokunaga river networks: New empirical evidence and applications to transport problems

NASA Astrophysics Data System (ADS)

Tejedor, A.; Zaliapin, I. V.

2013-12-01

The Tokunaga self-similarity has proven to be an important constraint for the observed river networks. Notably, various Horton laws are naturally satisfied by the Tokunaga networks, which makes this model of considerable interest for theoretical analysis and modeling of environmental transport. Recall that Horton self-similarity is a weaker property of a tree graph that addresses its principal branching; it is a counterpart of the power-law size distribution for system's elements. The stronger Tokunaga self-similarity addresses so-called side branching; it ensures that different levels of a hierarchy have the same probabilistic structure (in a sense that can be rigorously defined). We describe an improved statistical framework for testing self-similarity in a finite tree and estimating the related parameters. The developed inference is applied to the major river basins in continental United States and Iberian Peninsula. The results demonstrate the validity of the Tokunaga model for the majority of the examined networks with very narrow (universal) range of parameter values. Next, we explore possible relationships between the Tokunaga parameter anomalies (deviations from the universal values) and climatic and geomorphologic characteristics of a region. Finally, we apply the Tokunaga model to explore vulnerability of river networks, defined via reaction of the river discharge to a storm.

Theoretical study of the transfer integral and density of states in spiro-linked triphenylamine derivatives.

PubMed

Kirkpatrick, James; Nelson, Jenny

2005-08-22

We present a method for calculating the parameters that control hopping transport in disordered molecular solids, i.e., the transfer integrals and the distribution of transport site energies. Average values of these parameters are obtained by performing quantum-chemical calculations on a large ensemble of bimolecular complexes in random relative orientations. The method is applied to triphenylamine (TPA) and three differently substituted spiro-linked phenylamine compounds, 2,2',7,7'-tetrakis-(N,N-di-4-methoxyphenylamino)-9,9'-spirobifluorene (spiro-MeOTAD), 2,2'7,7'-tetrakis-(N,N-diphenylhenylamino)-9,9'-spirobifluorene (spiro-TAD), and 2,2',7,7'-tetrakis-(N,N-di-m-methylphenylamino)-9,9'-spirobifluorene (spiro-m-TTB). In the case of TPA, the dependence of the root-mean-square hole transfer integral J on intermolecular separation r for the ensemble of relative orientations is compared with that obtained by performing the same calculations for a fixed, approximately cofacial, orientation of the two TPA molecules. The calculation for the disordered geometry predicts a larger localization radius r0, where J approximately exp(-r/r0), than the calculation for the fixed orientation and is in better agreement with experiment. In the case of the spiro-linked compounds, results from our method are compared with parameters extracted from time-of-flight mobility measurements analyzed with the Gaussian disorder model (GDM). We find that the highest occupied molecular-orbital (HOMO) energies of the bimolecular complexes are distributed on an asymmetric peak, whose width varies in qualitative agreement with the value of the energetic disorder sigma obtained from experimental data using the GDM. The mean-square hole transfer integral varies in accordance with the experimentally determined value of the mobility prefactor micro0. The differences between the differently substituted compounds are interpreted in terms of differences in the spatial extent of the wave function. Spiro-MeOTAD was found to have a greater localization radius, which leads to both a larger transfer integral and a broader distribution of HOMO energies than either of the other compounds. For these compounds, differences in energetic disorder could not be explained in terms of differences in the permanent dipole moment. Our method is proposed as an approximate means of predicting the effect of chemical structure on the values of transport parameters in disordered molecular films.

[The blood glucose value not necessarily indicates correctly the cellular metabolic state].

PubMed

Simon, Kornél; Wittmann, István

2017-03-01

In clinical recommendations the normalized blood glucose level is declared as the main target in therapy of diabetes mellitus, i.e. the achievement of euglycemia is the main therapeutic goal. This approach suggests, that the normal blood glucose value is the marker of the normal carbohydrate metabolism (eumetabolism), and vice versa: hyperglycemia is associated with abnormal metabolism (dysmetabolism). However the question arises, whether identical blood glucose values do reflect the same intracellular biochemical mechanisms? On the basis of data published in the literature authors try to answer these questions by studying the relations between the short/longterm blood glucose level and the cellular metabolism in different clinical settings characterized by divergent pathophysiological parameters. The correlations between blood glucose level and cellular metabolism in development of micro-, and macroangiopathy, in the breakthrough phenomenon, as well as during administration of metabolic promoters, the discrepancies of relation between blood glucose values and cellular metabolism in type 1, and type 2 diabetes mellitus, furthermore association between blood glucose value and myocardial metabolism in acute and chronic stress were analyzed. Authors conclude, that the actual blood glucose values reveal the actual cellular metabolism in a very variable manner: neither euglycemia does mandatorily indicate eumetabolism (balance of cellular energy production), nor hyperglycemia is necessarily a marker of abnormal metabolic state (dept of cellular energy production). Moreover, at the same actual blood glucose level both the metabolic efficacy of the same organ may sharply vary, and the intracellular biochemical machinery could also be very different. In case of the very same longterm blood glucose level the metabolic state of the different organs could be very variable: some organs show an energetically balanced metabolism, while others produce a significant deficit. These inconsistencies between blood glucose level and cellular metabolism can be explained by the fact, that blood glucose value is a transport parameter, reflecting the actual steady state of glucose transport from the carbohydrate pools into the blood, and that from the blood into the tissues. Without knowing the speed of these transports of opposite direction, the blood glucose value per se can not reveal the quantitative and qualitative characteristics of cellular metabolism. Orv. Hetil., 2017, 158(11), 409-417.

Effect of dietary supplementation with carnosic acid or vitamin E on animal performance, haematological and immunological characteristics of artificially reared suckling lambs before and after road transport.

PubMed

Morán, Lara; Andrés, Sonia; Blanco, Carolina; Benavides, Julio; Martínez-Valladares, María; Moloney, Aidan P; Giráldez, F Javier

2017-08-01

To elucidate the influence of dietary carnosic acid (CA) and vitamin E on animal performance, immune response indicators and haematological parameters before and after transport stress, 24 lambs were individually fed ad libitum with milk replacer (MR) using an auto-feeder. Once daily the lambs received MR alone (Group CON, n = 8), MR + 0.096 g CA/kg live weight (LW) (Group CARN, n = 8) or MR + 0.024 g of α-tocopheryl acetate per kg LW (Group VitE, n = 8). After reaching the target slaughter weight (12 ± 0.5 kg), blood samples were collected to measure haematological and immunological parameters. Then, lambs were subjected to 4-h road transport and blood samples were collected again for haematological assessment. The animals were subsequently slaughtered. Before road transport, dietary CA supplementation promoted a descent of circulating white blood cells (WBC), red blood cells (RBC), haematocrit and haemoglobin concentration when compared with Groups CON and VitE (p < 0.05), but it did not affect production of cytokines by blood mononuclear cells. Road transport did not affect either RBC or haematocrit significantly. Nevertheless, transport affected leucocyte profile similarly in all the treatments, increasing granulocytes and monocytes proportions and decreasing lymphocytes. In contrast, after transport, WBC was increased in Group CARN, reaching similar values than Groups CON and VitE. However, under conditions of the present study, those modifications did not influence animal performance or immunity parameters of artificially reared suckling lambs.

Hydrodynamic dispersion in porous media with macroscopic disorder of parameters

NASA Astrophysics Data System (ADS)

Goldobin, D. S.; Maryshev, B. S.

2017-10-01

We present an analytical derivation of the macroscopic hydrodynamic dispersion for flows in porous media with frozen disorder of macroscopic parameters: porosity and permeability. The parameter inhomogeneities generate inhomogeneities of filtration flow which perform fluid mixing and, on the large spacial scale, act as an additional effective diffusion (eddy diffusivity or hydrodynamic dispersion). The derivation is performed for the general case, where the only restrictions are (i) the spatial autocorrelation functions of parameter inhomogeneities decay with the distance r not slower than 1/rn with n > 1, and (ii) the amplitudes of inhomogeneities are small compared to the mean value of parameters. Our analytical findings are confirmed with the results of direct numerical simulation for the transport of a passive scalar in inhomogeneous filtration flow.

Heat conduction in diatomic chains with correlated disorder

NASA Astrophysics Data System (ADS)

Savin, Alexander V.; Zolotarevskiy, Vadim; Gendelman, Oleg V.

2017-01-01

The paper considers heat transport in diatomic one-dimensional lattices, containing equal amounts of particles with different masses. Ordering of the particles in the chain is governed by single correlation parameter - the probability for two neighboring particles to have the same mass. As this parameter grows from zero to unity, the structure of the chain varies from regular staggering chain to completely random configuration, and then - to very long clusters of particles with equal masses. Therefore, this correlation parameter allows a control of typical cluster size in the chain. In order to explore different regimes of the heat transport, two interatomic potentials are considered. The first one is an infinite potential wall, corresponding to instantaneous elastic collisions between the neighboring particles. In homogeneous chains such interaction leads to an anomalous heat transport. The other one is classical Lennard-Jones interatomic potential, which leads to a normal heat transport. The simulations demonstrate that the correlated disorder of the particle arrangement does not change the convergence properties of the heat conduction coefficient, but essentially modifies its value. For the collision potential, one observes essential growth of the coefficient for fixed chain length as the limit of large homogeneous clusters is approached. The thermal transport in these models remains superdiffusive. In the Lennard-Jones chain the effect of correlation appears to be not monotonous in the limit of low temperatures. This behavior stems from the competition between formation of long clusters mentioned above, and Anderson localization close to the staggering ordered state.

Non-adaptive and adaptive hybrid approaches for enhancing water quality management

NASA Astrophysics Data System (ADS)

Kalwij, Ineke M.; Peralta, Richard C.

2008-09-01

SummaryUsing optimization to help solve groundwater management problems cost-effectively is becoming increasingly important. Hybrid optimization approaches, that combine two or more optimization algorithms, will become valuable and common tools for addressing complex nonlinear hydrologic problems. Hybrid heuristic optimizers have capabilities far beyond those of a simple genetic algorithm (SGA), and are continuously improving. SGAs having only parent selection, crossover, and mutation are inefficient and rarely used for optimizing contaminant transport management. Even an advanced genetic algorithm (AGA) that includes elitism (to emphasize using the best strategies as parents) and healing (to help assure optimal strategy feasibility) is undesirably inefficient. Much more efficient than an AGA is the presented hybrid (AGCT), which adds comprehensive tabu search (TS) features to an AGA. TS mechanisms (TS probability, tabu list size, search coarseness and solution space size, and a TS threshold value) force the optimizer to search portions of the solution space that yield superior pumping strategies, and to avoid reproducing similar or inferior strategies. An AGCT characteristic is that TS control parameters are unchanging during optimization. However, TS parameter values that are ideal for optimization commencement can be undesirable when nearing assumed global optimality. The second presented hybrid, termed global converger (GC), is significantly better than the AGCT. GC includes AGCT plus feedback-driven auto-adaptive control that dynamically changes TS parameters during run-time. Before comparing AGCT and GC, we empirically derived scaled dimensionless TS control parameter guidelines by evaluating 50 sets of parameter values for a hypothetical optimization problem. For the hypothetical area, AGCT optimized both well locations and pumping rates. The parameters are useful starting values because using trial-and-error to identify an ideal combination of control parameter values for a new optimization problem can be time consuming. For comparison, AGA, AGCT, and GC are applied to optimize pumping rates for assumed well locations of a complex large-scale contaminant transport and remediation optimization problem at Blaine Naval Ammunition Depot (NAD). Both hybrid approaches converged more closely to the optimal solution than the non-hybrid AGA. GC averaged 18.79% better convergence than AGCT, and 31.9% than AGA, within the same computation time (12.5 days). AGCT averaged 13.1% better convergence than AGA. The GC can significantly reduce the burden of employing computationally intensive hydrologic simulation models within a limited time period and for real-world optimization problems. Although demonstrated for a groundwater quality problem, it is also applicable to other arenas, such as managing salt water intrusion and surface water contaminant loading.

Reproducing tailing in breakthrough curves: Are statistical models equally representative and predictive?

NASA Astrophysics Data System (ADS)

Pedretti, Daniele; Bianchi, Marco

2018-03-01

Breakthrough curves (BTCs) observed during tracer tests in highly heterogeneous aquifers display strong tailing. Power laws are popular models for both the empirical fitting of these curves, and the prediction of transport using upscaling models based on best-fitted estimated parameters (e.g. the power law slope or exponent). The predictive capacity of power law based upscaling models can be however questioned due to the difficulties to link model parameters with the aquifers' physical properties. This work analyzes two aspects that can limit the use of power laws as effective predictive tools: (a) the implication of statistical subsampling, which often renders power laws undistinguishable from other heavily tailed distributions, such as the logarithmic (LOG); (b) the difficulties to reconcile fitting parameters obtained from models with different formulations, such as the presence of a late-time cutoff in the power law model. Two rigorous and systematic stochastic analyses, one based on benchmark distributions and the other on BTCs obtained from transport simulations, are considered. It is found that a power law model without cutoff (PL) results in best-fitted exponents (αPL) falling in the range of typical experimental values reported in the literature (1.5 < αPL < 4). The PL exponent tends to lower values as the tailing becomes heavier. Strong fluctuations occur when the number of samples is limited, due to the effects of subsampling. On the other hand, when the power law model embeds a cutoff (PLCO), the best-fitted exponent (αCO) is insensitive to the degree of tailing and to the effects of subsampling and tends to a constant αCO ≈ 1. In the PLCO model, the cutoff rate (λ) is the parameter that fully reproduces the persistence of the tailing and is shown to be inversely correlated to the LOG scale parameter (i.e. with the skewness of the distribution). The theoretical results are consistent with the fitting analysis of a tracer test performed during the MADE-5 experiment. It is shown that a simple mechanistic upscaling model based on the PLCO formulation is able to predict the ensemble of BTCs from the stochastic transport simulations without the need of any fitted parameters. The model embeds the constant αCO = 1 and relies on a stratified description of the transport mechanisms to estimate λ. The PL fails to reproduce the ensemble of BTCs at late time, while the LOG model provides consistent results as the PLCO model, however without a clear mechanistic link between physical properties and model parameters. It is concluded that, while all parametric models may work equally well (or equally wrong) for the empirical fitting of the experimental BTCs tails due to the effects of subsampling, for predictive purposes this is not true. A careful selection of the proper heavily tailed models and corresponding parameters is required to ensure physically-based transport predictions.

A Piloted Simulator Evaluation of Transport Aircraft Rudder Pedal Force/Feel Characteristics

NASA Technical Reports Server (NTRS)

Stewart, Eric C.

2008-01-01

A piloted simulation study has been conducted in a fixed-base research simulator to assess the directional handling qualities for various rudder pedal feel characteristics for commercial transport airplanes. That is, the effects of static pedal force at maximum pedal travel, breakout force, and maximum pedal travel on handling qualities were studied. An artificial maneuver with a severe lateral wind shear and requiring runway tracking at an altitude of 50 feet in a crosswind was used to fully exercise the rudder pedals. Twelve active airline pilots voluntarily participated in the study and flew approximately 500 maneuvers. The pilots rated the maneuver performance with various rudder pedal feel characteristics using the Cooper- Harper rating scale. The test matrix had 15 unique combinations of the 3 static pedal feel characteristics. A 10-term, second-order equation for the Cooper-Harper pilot rating as a function of the 3 independent pedal feel parameters was fit to the data. The test matrix utilized a Central Composite Design that is very efficient for fitting an equation of this form. The equation was used to produce contour plots of constant pilot ratings as a function of two of the parameters with the third parameter held constant. These contour plots showed regions of good handling qualities as well as regions of degraded handling qualities. In addition, a numerical equation solver was used to predict the optimum parameter values (those with the lowest pilot rating). Quantitative pilot performance data were also analyzed. This analysis found that the peak values of the cross power spectra of the pedal force and heading angle could be used to quantify the tendency toward directional pilot induced oscillations (PIO). Larger peak values of the cross power spectra were correlated with larger (degraded) Cooper-Harper pilot ratings. Thus, the subjective data (Cooper-Harper pilot ratings) were consistent with the objective data (peak values of the cross power spectra).

Peritoneal Fluid Transport rather than Peritoneal Solute Transport Associates with Dialysis Vintage and Age of Peritoneal Dialysis Patients.

PubMed

Waniewski, Jacek; Antosiewicz, Stefan; Baczynski, Daniel; Poleszczuk, Jan; Pietribiasi, Mauro; Lindholm, Bengt; Wankowicz, Zofia

2016-01-01

During peritoneal dialysis (PD), the peritoneal membrane undergoes ageing processes that affect its function. Here we analyzed associations of patient age and dialysis vintage with parameters of peritoneal transport of fluid and solutes, directly measured and estimated based on the pore model, for individual patients. Thirty-three patients (15 females; age 60 (21-87) years; median time on PD 19 (3-100) months) underwent sequential peritoneal equilibration test. Dialysis vintage and patient age did not correlate. Estimation of parameters of the two-pore model of peritoneal transport was performed. The estimated fluid transport parameters, including hydraulic permeability (LpS), fraction of ultrasmall pores (α u), osmotic conductance for glucose (OCG), and peritoneal absorption, were generally independent of solute transport parameters (diffusive mass transport parameters). Fluid transport parameters correlated whereas transport parameters for small solutes and proteins did not correlate with dialysis vintage and patient age. Although LpS and OCG were lower for older patients and those with long dialysis vintage, αu was higher. Thus, fluid transport parameters--rather than solute transport parameters--are linked to dialysis vintage and patient age and should therefore be included when monitoring processes linked to ageing of the peritoneal membrane.

Kinetic Analysis of Rhodamines Efflux Mediated by the Multidrug Resistance Protein (MRP1)

PubMed Central

Saengkhae, Chantarawan; Loetchutinat, Chatchanok; Garnier-Suillerot, Arlette

2003-01-01

Characterization of rhodamine 123 as functional assay for MDR has been primarily focused on P-glycoprotein-mediated MDR. Several studies have suggested that Rh123 is also a substrate for MRP1. However, no quantitative studies of the MRP1-mediated efflux of rhodamines have, up to now, been performed. Measurement of the kinetic characteristics of substrate transport is a powerful approach to enhancing our understanding of their function and mechanism. In the present study, we have used a continuous fluorescence assay with four rhodamine dyes (rhodamine 6G, tetramethylrosamine, tetramethylrhodamine ethyl ester, and tetramethylrhodamine methyl ester) to quantify drug transport by MRP1 in living GLC4/ADR cells. The formation of a substrate concentration gradient was observed. MRP1-mediated transport of rhodamine was glutathione-dependent. The kinetics parameter, ka = VM/km, was very similar for the four rhodamine analogs but ∼10-fold less than the values of the same parameter determined previously for the MRP1-mediated efflux of anthracycline. The findings presented here are the first to show quantitative information about the kinetics parameters for MRP1-mediated efflux of rhodamine dyes. PMID:12944313

Anomalous cross-B field transport and spokes in HiPIMS plasma

NASA Astrophysics Data System (ADS)

Hecimovic, Ante; Maszl, Christian; Schulz-von der Gathen, Volker; von Keudell, Achim

2016-09-01

The rotation of localised ionisation zones, i.e. spokes, in magnetron discharge is investigated as a function of discharge current, ranging from 10 mA (current density 0.5 mA cm-2) to 140 A (7 A cm-2) . The presence of spokes throughout the complete discharge current range indicates that the spokes are an intrinsic property of a magnetron sputtering plasma discharge. Up to discharge currents of several amperes, the spokes rotate in a retrograde ExB direction and beyond the spokes rotate in a ExB direction. In this contribution we present experimental evidence that anomalous diffusion is triggered by the appearance of spokes rotating in the ExB direction. The Hall parameter ωceτc , product of the electron cyclotron frequency and the classical collision time, reduces from Bohm diffusion values (16 and higher) down to the value of 3 as spokes appear, indicating anomalous cross-B field transport. The ion diffusion coefficients calculated from a sideways image of the spoke is six times higher than Bohm diffusion coefficients, which is consistent with the reduction of the Hall parameter.

Thickness-controlled electronic structure and thermoelectric performance of ultrathin SnS2 nanosheets.

PubMed

Li, Jun; Shen, Jinni; Ma, Zuju; Wu, Kechen

2017-08-21

The thermoelectric conversion efficiency of a material relies on a dimensionless parameter (ZT = S 2 σT/κ). It is a great challenge in enhancing the ZT value basically due to that the related transport factors of most of the bulk materials are inter-conditioned to each other, making it very difficult to simultaneously optimize these parameters. In this report, the negative correlation between power factor and thermal conductivity of nano-scaled SnS 2 multilayers is predicted by high-level first-principle computations combined with Boltzmann transport theory. By diminishing the thickness of SnS 2 nanosheet to about 3 L, the S and σ along a direction simultaneously increase whereas κ decreases, achieving a high ZT value of 1.87 at 800 K. The microscopic mechanisms for this unusual negative correlation in nano-scaled two dimensional (2D) material are elucidated and attributed to the quantum confinement effect. The results may open a way to explore the high ZT thermoelectric nano-devices for the practical thermoelectric applications.

Heat transport in Rayleigh-Bénard convection and angular momentum transport in Taylor-Couette flow: a comparative study

NASA Astrophysics Data System (ADS)

Brauckmann, Hannes J.; Eckhardt, Bruno; Schumacher, Jörg

2017-03-01

Rayleigh-Bénard convection and Taylor-Couette flow are two canonical flows that have many properties in common. We here compare the two flows in detail for parameter values where the Nusselt numbers, i.e. the thermal transport and the angular momentum transport normalized by the corresponding laminar values, coincide. We study turbulent Rayleigh-Bénard convection in air at Rayleigh number Ra=107 and Taylor-Couette flow at shear Reynolds number ReS=2×104 for two different mean rotation rates but the same Nusselt numbers. For individual pairwise related fields and convective currents, we compare the probability density functions normalized by the corresponding root mean square values and taken at different distances from the wall. We find one rotation number for which there is very good agreement between the mean profiles of the two corresponding quantities temperature and angular momentum. Similarly, there is good agreement between the fluctuations in temperature and velocity components. For the heat and angular momentum currents, there are differences in the fluctuations outside the boundary layers that increase with overall rotation and can be related to differences in the flow structures in the boundary layer and in the bulk. The study extends the similarities between the two flows from global quantities to local quantities and reveals the effects of rotation on the transport.

The influence of non-Gaussian distribution functions on the time-dependent perpendicular transport of energetic particles

NASA Astrophysics Data System (ADS)

Lasuik, J.; Shalchi, A.

2018-06-01

In the current paper we explore the influence of the assumed particle statistics on the transport of energetic particles across a mean magnetic field. In previous work the assumption of a Gaussian distribution function was standard, although there have been known cases for which the transport is non-Gaussian. In the present work we combine a kappa distribution with the ordinary differential equation provided by the so-called unified non-linear transport theory. We then compute running perpendicular diffusion coefficients for different values of κ and turbulence configurations. We show that changing the parameter κ slightly increases or decreases the perpendicular diffusion coefficient depending on the considered turbulence configuration. Since these changes are small, we conclude that the assumed statistics is less significant in particle transport theory. The results obtained in the current paper support to use a Gaussian distribution function as usually done in particle transport theory.

Influence of the Preparation Method on Planar Perovskite CH3NH3PbI3-xClx Solar Cell Performance and Hysteresis

NASA Astrophysics Data System (ADS)

Ivanova, A.; Tokmakov, A.; Lebedeva, K.; Roze, M.; Kaulachs, I.

2017-08-01

Organometal halide perovskites are promising materials for lowcost, high-efficiency solar cells. The method of perovskite layer deposition and the interfacial layers play an important role in determining the efficiency of perovskite solar cells (PSCs). In the paper, we demonstrate inverted planar perovskite solar cells where perovskite layers are deposited by two-step modified interdiffusion and one-step methods. We also demonstrate how PSC parameters change by doping of charge transport layers (CTL). We used dimethylsupoxide (DMSO) as dopant for the hole transport layer (PEDOT:PSS) but for the electron transport layer [6,6]-phenyl C61 butyric acid methyl ester (PCBM)) we used N,N-dimethyl-N-octadecyl(3-aminopropyl)trimethoxysilyl chloride (DMOAP). The highest main PSC parameters (PCE, EQE, VOC) were obtained for cells prepared by the one-step method with fast crystallization and doped CTLs but higher fill factor (FF) and shunt resistance (Rsh) values were obtained for cells prepared by the two-step method with undoped CTLs.

Combining experimental techniques with non-linear numerical models to assess the sorption of pesticides on soils

NASA Astrophysics Data System (ADS)

Magga, Zoi; Tzovolou, Dimitra N.; Theodoropoulou, Maria A.; Tsakiroglou, Christos D.

2012-03-01

The risk assessment of groundwater pollution by pesticides may be based on pesticide sorption and biodegradation kinetic parameters estimated with inverse modeling of datasets from either batch or continuous flow soil column experiments. In the present work, a chemical non-equilibrium and non-linear 2-site sorption model is incorporated into solute transport models to invert the datasets of batch and soil column experiments, and estimate the kinetic sorption parameters for two pesticides: N-phosphonomethyl glycine (glyphosate) and 2,4-dichlorophenoxy-acetic acid (2,4-D). When coupling the 2-site sorption model with the 2-region transport model, except of the kinetic sorption parameters, the soil column datasets enable us to estimate the mass-transfer coefficients associated with solute diffusion between mobile and immobile regions. In order to improve the reliability of models and kinetic parameter values, a stepwise strategy that combines batch and continuous flow tests with adequate true-to-the mechanism analytical of numerical models, and decouples the kinetics of purely reactive steps of sorption from physical mass-transfer processes is required.

Method for Calculating the Optical Diffuse Reflection Coefficient for the Ocular Fundus

NASA Astrophysics Data System (ADS)

Lisenko, S. A.; Kugeiko, M. M.

2016-07-01

We have developed a method for calculating the optical diffuse reflection coefficient for the ocular fundus, taking into account multiple scattering of light in its layers (retina, epithelium, choroid) and multiple refl ection of light between layers. The method is based on the formulas for optical "combination" of the layers of the medium, in which the optical parameters of the layers (absorption and scattering coefficients) are replaced by some effective values, different for cases of directional and diffuse illumination of the layer. Coefficients relating the effective optical parameters of the layers and the actual values were established based on the results of a Monte Carlo numerical simulation of radiation transport in the medium. We estimate the uncertainties in retrieval of the structural and morphological parameters for the fundus from its diffuse reflectance spectrum using our method. We show that the simulated spectra correspond to the experimental data and that the estimates of the fundus parameters obtained as a result of solving the inverse problem are reasonable.

Observations of pockmark flow structure in Belfast Bay, Maine, Part 3: implications for sediment transport

USGS Publications Warehouse

Fandel, Christina L.; Lippmann, Thomas C.; Foster, Diane L.; Brothers, Laura L.

2017-01-01

Current observations and sediment characteristics acquired within and along the rim of two pockmarks in Belfast Bay, Maine, were used to characterize periods of sediment transport and to investigate conditions favorable to the settling of suspended sediment. Hourly averaged Shields parameters determined from horizontal current velocity profiles within the center of each pockmark never exceed the critical value (approximated with the theoretical model of Dade et al. 1992). However, Shields parameters estimated at the pockmark rims periodically exceed the critical value, consistent with conditions that support the onset of sediment transport and suspension. Below the rim in the near-center of each pockmark, depth-averaged vertical velocities were less than zero (downward) 60% and 55% of the time in the northern and southern pockmarks, and were often comparable to depth-averaged horizontal velocities. Along the rim, depth-averaged vertical velocities over the lower 8 m of the water column were primarily downward but much less than depth-averaged horizontal velocities indicating that suspended sediment may be moved to distant locations. Maximum grain sizes capable of remaining in suspension under terminal settling flow conditions (ranging 10–170 μm) were typically much greater than the observed median grain diameter (about 7 μm) at the bed. During upwelling flow within the pockmarks, and in the absence of flocculation, suspended sediment would not settle. The greater frequency of predicted periods of sediment transport along the rim of the southern pockmark is consistent with pockmark morphology in Belfast Bay, which transitions from more spherical to more elongated toward the south, suggesting near-bed sediment transport may contribute to post-formation pockmark evolution during typical conditions in Belfast Bay.

In Silico and in Vitro Modeling of Hepatocyte Drug Transport Processes: Importance of ABCC2 Expression Levels in the Disposition of CarboxydichloroflurosceinS⃞

PubMed Central

Howe, Katharine; Gibson, G. Gordon; Coleman, Tanya; Plant, Nick

2009-01-01

The impact of transport proteins in the disposition of chemicals is becoming increasingly evident. Alteration in disposition can cause altered pharmacokinetic and pharmacodynamic parameters, potentially leading to reduced efficacy or overt toxicity. We have developed a quantitative in silico model, based upon literature and experimentally derived data, to model the disposition of carboxydichlorofluroscein (CDF), a substrate for the SLCO1A/B and ABCC subfamilies of transporters. Kinetic parameters generated by the in silico model closely match both literature and experimentally derived kinetic values, allowing this model to be used for the examination of transporter action in primary rat hepatocytes. In particular, we show that the in silico model is suited to the rapid, accurate determination of Ki values, using 3-[[3-[2-(7-chloroquinolin-2-yl)vinyl]phenyl]-(2-dimethylcarbamoylethylsulfanyl)methylsulfanyl] propionic acid (MK571) as a prototypical pan-ABCC inhibitor. In vitro-derived data are often used to predict in vivo response, and we have examined how differences in protein expression levels between these systems may affect chemical disposition. We show that ABCC2 and ABCC3 are overexpressed in sandwich culture hepatocytes by 3.5- and 2.3-fold, respectively, at the protein level. Correction for this in markedly different disposition of CDF, with the area under the concentration versus time curve and Cmax of intracellular CDF increasing by 365 and 160%, respectively. Finally, using kinetic simulations we show that ABCC2 represents a fragile node within this pathway, with alterations in ABCC2 having the most prominent effects on both the Km and Vmax through the pathway. This is the first demonstration of the utility of modeling approaches to estimate the impact of drug transport processes on chemical disposition. PMID:19022944

Ion temperature gradient driven transport in tokamaks with square shaping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joiner, N.; Dorland, W.

2010-06-15

Advanced tokamak schemes which may offer significant improvement to plasma confinement on the usual large aspect ratio Dee-shaped flux surface configuration are of great interest to the fusion community. One possibility is to introduce square shaping to the flux surfaces. The gyrokinetic code GS2[Kotschenreuther et al., Comput. Phys. Commun. 88, 128 (1996)] is used to study linear stability and the resulting nonlinear thermal transport of the ion temperature gradient driven (ITG) mode in tokamak equilibria with square shaping. The maximum linear growth rate of ITG modes is increased by negative squareness (diamond shaping) and reduced by positive values (square shaping).more » The dependence of thermal transport produced by saturated ITG instabilities on squareness is not as clear. The overall trend follows that of the linear instability, heat and particle fluxes increase with negative squareness and decrease with positive squareness. This is contradictory to recent experimental results [Holcomb et al., Phys. Plasmas 16, 056116 (2009)] which show a reduction in transport with negative squareness. This may be reconciled as a reduction in transport (consistent with the experiment) is observed at small negative values of the squareness parameter.« less

Purified reconstituted lac carrier protein from Escherichia coli is fully functional.

PubMed

Viitanen, P; Garcia, M L; Kaback, H R

1984-03-01

Proteoliposomes reconstituted with lac carrier protein purified from the plasma membrane of Escherichia coli catalyze each of the translocation reactions typical of the beta-galactoside transport system (i.e., active transport, counterflow, facilitated influx and efflux) with turnover numbers and apparent Km values comparable to those observed in right-side-out membrane vesicles. Furthermore, detailed kinetic studies show that the reconstituted system exhibits properties analogous to those observed in membrane vesicles. Imposition of a membrane potential (delta psi, interior negative) causes a marked decrease in apparent Km (by a factor of 7 to 10) with a smaller increase in Vmax (approximately equal to 3-fold). At submaximal values of delta psi, the reconstituted carrier exhibits biphasic kinetics, with one component manifesting the kinetic parameters of active transport and the other exhibiting the characteristics of facilitated diffusion. Finally, at low lactose concentrations, the initial velocity of influx varies linearly with the square of the proton electro-chemical gradient. The results provide quantitative support for the contention that a single polypeptide species, the product of the lac y gene, is responsible for each of the transport reactions typical of the beta-galactoside transport system.

Empirical flow parameters : a tool for hydraulic model validity

USGS Publications Warehouse

Asquith, William H.; Burley, Thomas E.; Cleveland, Theodore G.

2013-01-01

The objectives of this project were (1) To determine and present from existing data in Texas, relations between observed stream flow, topographic slope, mean section velocity, and other hydraulic factors, to produce charts such as Figure 1 and to produce empirical distributions of the various flow parameters to provide a methodology to "check if model results are way off!"; (2) To produce a statistical regional tool to estimate mean velocity or other selected parameters for storm flows or other conditional discharges at ungauged locations (most bridge crossings) in Texas to provide a secondary way to compare such values to a conventional hydraulic modeling approach. (3.) To present ancillary values such as Froude number, stream power, Rosgen channel classification, sinuosity, and other selected characteristics (readily determinable from existing data) to provide additional information to engineers concerned with the hydraulic-soil-foundation component of transportation infrastructure.

Parameterization and prediction of nanoparticle transport in porous media: A reanalysis using artificial neural network

NASA Astrophysics Data System (ADS)

Babakhani, Peyman; Bridge, Jonathan; Doong, Ruey-an; Phenrat, Tanapon

2017-06-01

The continuing rapid expansion of industrial and consumer processes based on nanoparticles (NP) necessitates a robust model for delineating their fate and transport in groundwater. An ability to reliably specify the full parameter set for prediction of NP transport using continuum models is crucial. In this paper we report the reanalysis of a data set of 493 published column experiment outcomes together with their continuum modeling results. Experimental properties were parameterized into 20 factors which are commonly available. They were then used to predict five key continuum model parameters as well as the effluent concentration via artificial neural network (ANN)-based correlations. The Partial Derivatives (PaD) technique and Monte Carlo method were used for the analysis of sensitivities and model-produced uncertainties, respectively. The outcomes shed light on several controversial relationships between the parameters, e.g., it was revealed that the trend of Katt with average pore water velocity was positive. The resulting correlations, despite being developed based on a "black-box" technique (ANN), were able to explain the effects of theoretical parameters such as critical deposition concentration (CDC), even though these parameters were not explicitly considered in the model. Porous media heterogeneity was considered as a parameter for the first time and showed sensitivities higher than those of dispersivity. The model performance was validated well against subsets of the experimental data and was compared with current models. The robustness of the correlation matrices was not completely satisfactory, since they failed to predict the experimental breakthrough curves (BTCs) at extreme values of ionic strengths.

Protoplanetary Disks as (Possibly) Viscous Disks

NASA Astrophysics Data System (ADS)

Rafikov, Roman R.

2017-03-01

Protoplanetary disks are believed to evolve on megayear timescales in a diffusive (viscous) manner as a result of angular momentum transport driven by internal stresses. Here we use a sample of 26 protoplanetary disks resolved by ALMA with measured (dust-based) masses and stellar accretion rates to derive the dimensionless α-viscosity values for individual objects, with the goal of constraining the angular momentum transport mechanism. We find that the inferred values of α do not cluster around a single value, but instead have a broad distribution extending from 10-4 to 0.04. Moreover, they correlate with neither the global disk parameters (mass, size, surface density) nor the stellar characteristics (mass, luminosity, radius). However, we do find a strong linear correlation between α and the central mass accretion rate \\dot{M}. This correlation is unlikely to result from the direct physical effect of \\dot{M} on internal stress on global scales. Instead, we suggest that it is caused by the decoupling of stellar \\dot{M} from the global disk characteristics in one of the following ways: (1) The behavior (and range) of α is controlled by a yet-unidentified parameter (e.g., ionization fraction, magnetic field strength, or geometry), ultimately driving the variation of \\dot{M}. (2) The central \\dot{M} is decoupled from the global accretion rate as a result of an instability, or mass accumulation (or loss in a wind or planetary accretion) in the inner disk. (3) Perhaps the most intriguing possibility is that angular momentum in protoplanetary disks is transported nonviscously, e.g., via magnetohydrodynamic winds or spiral density waves.

Stress in African catfish (Clarias gariepinus) following overland transportation.

PubMed

Manuel, Remy; Boerrigter, Jeroen; Roques, Jonathan; van der Heul, Jan; van den Bos, Ruud; Flik, Gert; van de Vis, Hans

2014-02-01

Of the many stressors in aquaculture, transportation of fish has remained poorly studied. The objective of this study was therefore to assess the effects of a (simulated) commercial transportation on stress physiology of market-size African catfish (Clarias gariepinus). Catfish weighing approximately 1.25 kg were returned to the farm after 3 h of truck-transportation, and stress-related parameters were measured for up to 72 h following return. Recovery from transportation was assessed through blood samples measuring plasma cortisol, glucose and non-esterified fatty acids (NEFA) and gill histology. Also, the number of skin lesions was compared before and after transport. Pre-transport handling and sorting elevated plasma cortisol levels compared to unhandled animals (before fasting). Plasma cortisol levels were further increased due to transportation. In control fish, plasma cortisol levels returned to baseline values within 6 h, whereas it took 48 h to reach baseline values in transported catfish. Plasma glucose and NEFA levels remained stable and were similar across all groups. Transported catfish did not, on average, have more skin lesions than the handling group, but the number of skin lesions had increased compared to unhandled animals. The macroscopic condition of the gills was similar in control, transported and unhandled catfish; however, light microscopy and immunohistochemistry revealed atypical morphology and chloride cell migration normally associated with adverse water conditions. From our data, we conclude that transportation may be considered a strong stressor to catfish that may add to other stressors and thus inflict upon the welfare of the fish.

Pre-slaughter stress and pork quality

NASA Astrophysics Data System (ADS)

Stajković, S.; Teodorović, V.; Baltić, M.; Karabasil, N.

2017-09-01

Stress is an inevitable consequence of handling of animals for slaughter. Stress conditions during transport, lairage and at slaughter induce undesirable effects on the end quality of meat such as pale, soft, exudative meat and dark firm dry meat. Hence, it is very important to define appropriate parameters for objective assessment of level of stress. Attempts to define measures of stress have been difficult and no physiological parameter has been successfully used to evaluate stress situations. One physiological change in swine associated with animal handling stress and with pork quality is an increase in blood lactate concentration. Plasma cortisol was thought to be an appropriate indicator of stress, but the concentration was not consistently changed by different stressors. Therefore, finding alternative parameters reacting to stressors, such as acute phase proteins, would be of great value for the objective evaluation of level of stress and meat quality. As the stress during pre-slaughter handling is unavoidable, the final goal is to improve transport and slaughter conditions for the animal and, as a consequence, meat quality and animal welfare.

Non-invasive technique to measure biogeochemical parameters (pH and O2) in a microenvironment: Design and applications

NASA Astrophysics Data System (ADS)

Li, Biting; Seliman, Ayman; Pales, Ashley; Liang, Weizhen; Sams, Allison; Darnault, Christophe; Devol, Timothy

2017-04-01

The primary objectives of this research are to do the pH and O2 sensor foils calibration and then to test them in applications. Potentially, this project can be utilized to monitor the fate and transport of radionuclides in porous media. The information for physical and chemical parameters (e.g. pH and O2) is crucial to know when determining contaminants' behavior and transport in the environment. As a non-invasive method, optical imaging technique using a DSLR camera could capture data on the foil when it fluoresces, and gives a high temporal and spatial resolution during the experimental period. The calibration procedures were done in cuvettes in a row. The preliminary experiments could measure pH value in the range from 4.5 to 7.5, and O2 concentration from 0 mg/L to 20.74 mg/L. Applications of sensor foils have involved nano zero valent and acid rain experiments in order to obtain a gradient of parameter changes.

Environmental Factors' Consideration at Industrial Transportation Organization in the «Seaport - Dry port» System

NASA Astrophysics Data System (ADS)

Muravev, Dmitri; Rakhmangulov, Aleksandr

2016-11-01

Currently, container shipping development is directly associated with an increase of warehouse areas for containers' storage. One of the most successful types of container terminal is an intermodal terminal called a dry port. Main pollution sources during the organization of intermodal transport are considered. A system of dry port parameters, which are recommended for the evaluation of different scenarios for a seaport infrastructure development at the stage of its strategic planning, is proposed in this paper. The authors have developed a method for determining the optimal values of the main dry port parameters by simulation modeling in the programming software Any- Logic. Dependencies thatwere obtained as a result of modeling experiments prove the adequacy of main selected dry port parameters for the effective scenarios' evaluation of throughput and handling capacity at existing seaports at the stage of strategic planning and a rational dry port location, allowed ensuring the improvement of the ecological situation in a port city.

Multi-process herbicide transport in structured soil columns: Experiments and model analysis

NASA Astrophysics Data System (ADS)

Köhne, J. Maximilian; Köhne, Sigrid; Šimůnek, Jirka

2006-05-01

Model predictions of pesticide transport in structured soils are complicated by multiple processes acting concurrently. In this study, the hydraulic, physical, and chemical nonequilibrium (HNE, PNE, and CNE, respectively) processes governing herbicide transport under variably saturated flow conditions were studied. Bromide (Br -), isoproturon (IPU, 3-(4-isoprpylphenyl)-1,1-dimethylurea) and terbuthylazine (TER, N2-tert-butyl-6-chloro- N4-ethyl-1,3,5-triazine-2,4-diamine) were applied to two soil columns. An aggregated Ap soil column and a macroporous, aggregated Ah soil column were irrigated at a rate of 1 cm h - 1 for 3 h. Two more irrigations at the same rate and duration followed in weekly intervals. Nonlinear (Freundlich) equilibrium and two-site kinetic sorption parameters were determined for IPU and TER using batch experiments. The observed water flow and Br - transport were inversely simulated using mobile-immobile (MIM), dual-permeability (DPM), and combined triple-porosity (DP-MIM) numerical models implemented in HYDRUS-1D, with improving correspondence between empirical data and model results. Using the estimated HNE and PNE parameters together with batch-test derived equilibrium sorption parameters, the preferential breakthrough of the weakly adsorbed IPU in the Ah soil could be reasonably well predicted with the DPM approach, whereas leaching of the strongly adsorbed TER was predicted less well. The transport of IPU and TER through the aggregated Ap soil could be described consistently only when HNE, PNE, and CNE were simultaneously accounted for using the DPM. Inverse parameter estimation suggested that two-site kinetic sorption in inter-aggregate flow paths was reduced as compared to within aggregates, and that large values for the first-order degradation rate were an artifact caused by irreversible sorption. Overall, our results should be helpful to enhance the understanding and modeling of multi-process pesticide transport through structured soils during variably saturated water flow.

A Taguchi approach on optimal process control parameters for HDPE pipe extrusion process

NASA Astrophysics Data System (ADS)

Sharma, G. V. S. S.; Rao, R. Umamaheswara; Rao, P. Srinivasa

2017-06-01

High-density polyethylene (HDPE) pipes find versatile applicability for transportation of water, sewage and slurry from one place to another. Hence, these pipes undergo tremendous pressure by the fluid carried. The present work entails the optimization of the withstanding pressure of the HDPE pipes using Taguchi technique. The traditional heuristic methodology stresses on a trial and error approach and relies heavily upon the accumulated experience of the process engineers for determining the optimal process control parameters. This results in setting up of less-than-optimal values. Hence, there arouse a necessity to determine optimal process control parameters for the pipe extrusion process, which can ensure robust pipe quality and process reliability. In the proposed optimization strategy, the design of experiments (DoE) are conducted wherein different control parameter combinations are analyzed by considering multiple setting levels of each control parameter. The concept of signal-to-noise ratio ( S/ N ratio) is applied and ultimately optimum values of process control parameters are obtained as: pushing zone temperature of 166 °C, Dimmer speed at 08 rpm, and Die head temperature to be 192 °C. Confirmation experimental run is also conducted to verify the analysis and research result and values proved to be in synchronization with the main experimental findings and the withstanding pressure showed a significant improvement from 0.60 to 1.004 Mpa.

Continued development of a detailed model of arc discharge dynamics

NASA Technical Reports Server (NTRS)

Beers, B. L.; Pine, V. W.; Ives, S. T.

1982-01-01

Using a previously developed set of codes (SEMC, CASCAD, ACORN), a parametric study was performed to quantify the parameters which describe the development of a single electron indicated avalanche into a negative tip streamer. The electron distribution function in Teflon is presented for values of the electric field in the range of four-hundred million volts/meter to four billon volts/meter. A formulation of the scattering parameters is developed which shows that the transport can be represented by three independent variables. The distribution of ionization sites is used to indicate an avalanche. The self consistent evolution of the avalanche is computed over the parameter range of scattering set.

Chandrasekhar-type algorithms for fast recursive estimation in linear systems with constant parameters

NASA Technical Reports Server (NTRS)

Choudhury, A. K.; Djalali, M.

1975-01-01

In this recursive method proposed, the gain matrix for the Kalman filter and the convariance of the state vector are computed not via the Riccati equation, but from certain other equations. These differential equations are of Chandrasekhar-type. The 'invariant imbedding' idea resulted in the reduction of the basic boundary value problem of transport theory to an equivalent initial value system, a significant computational advance. Initial value experience showed that there is some computational savings in the method and the loss of positive definiteness of the covariance matrix is less vulnerable.

Tracer SWIW tests in propped and un-propped fractures: parameter sensitivity issues, revisited

NASA Astrophysics Data System (ADS)

Ghergut, Julia; Behrens, Horst; Sauter, Martin

2017-04-01

Single-well injection-withdrawal (SWIW) or 'push-then-pull' tracer methods appear attractive for a number of reasons: less uncertainty on design and dimensioning, and lower tracer quantities required than for inter-well tests; stronger tracer signals, enabling easier and cheaper metering, and shorter metering duration required, reaching higher tracer mass recovery than in inter-well tests; last not least: no need for a second well. However, SWIW tracer signal inversion faces a major issue: the 'push-then-pull' design weakens the correlation between tracer residence times and georeservoir transport parameters, inducing insensitivity or ambiguity of tracer signal inversion w. r. to some of those georeservoir parameters that are supposed to be the target of tracer tests par excellence: pore velocity, transport-effective porosity, fracture or fissure aperture and spacing or density (where applicable), fluid/solid or fluid/fluid phase interface density. Hydraulic methods cannot measure the transport-effective values of such parameters, because pressure signals correlate neither with fluid motion, nor with material fluxes through (fluid-rock, or fluid-fluid) phase interfaces. The notorious ambiguity impeding parameter inversion from SWIW test signals has nourished several 'modeling attitudes': (i) regard dispersion as the key process encompassing whatever superposition of underlying transport phenomena, and seek a statistical description of flow-path collectives enabling to characterize dispersion independently of any other transport parameter, as proposed by Gouze et al. (2008), with Hansen et al. (2016) offering a comprehensive analysis of the various ways dispersion model assumptions interfere with parameter inversion from SWIW tests; (ii) regard diffusion as the key process, and seek for a large-time, asymptotically advection-independent regime in the measured tracer signals (Haggerty et al. 2001), enabling a dispersion-independent characterization of multiple-scale diffusion; (iii) attempt to determine both advective and non-advective transport parameters from one and the same conservative-tracer signal (relying on 'third-party' knowledge), or from twin signals of a so-called 'dual' tracer pair, e. g.: using tracers with contrasting reactivity and partitioning behavior to determine residual saturation in depleted oilfields (Tomich et al. 1973), or to determine advective parameters (Ghergut et al. 2014); using early-time signals of conservative and sorptive tracers for propped-fracture characterization (Karmakar et al. 2015); using mid-time signals of conservative tracers for a reservoir-borne inflow profiling in multi-frac systems (Ghergut et al. 2016), etc. The poster describes new uses of type-(iii) techniques for the specific purposes of shale-gas reservoir characterization, productivity monitoring, diagnostics and engineering of 're-frac' treatments, based on parameter sensitivity findings from German BMWi research project "TRENDS" (Federal Ministry for Economic Affairs and Energy, FKZ 0325515) and from the EU-H2020 project "FracRisk" (grant no. 640979).

Wide-range measurement of thermal effusivity using molybdenum thin film with low thermal conductivity for thermal microscopes

NASA Astrophysics Data System (ADS)

Miyake, Shugo; Matsui, Genzou; Ohta, Hiromichi; Hatori, Kimihito; Taguchi, Kohei; Yamamoto, Suguru

2017-07-01

Thermal microscopes are a useful technology to investigate the spatial distribution of the thermal transport properties of various materials. However, for high thermal effusivity materials, the estimated values of thermophysical parameters based on the conventional 1D heat flow model are known to be higher than the values of materials in the literature. Here, we present a new procedure to solve the problem which calculates the theoretical temperature response with the 3D heat flow and measures reference materials which involve known values of thermal effusivity and heat capacity. In general, a complicated numerical iterative method and many thermophysical parameters are required for the calculation in the 3D heat flow model. Here, we devised a simple procedure by using a molybdenum (Mo) thin film with low thermal conductivity on the sample surface, enabling us to measure over a wide thermal effusivity range for various materials.

Alterations in rotation thromboelastometry (ROTEM®) parameters: point-of-care testing vs analysis after pneumatic tube system transport.

PubMed

Martin, J; Schuster, T; Moessmer, G; Kochs, E F; Wagner, K J

2012-10-01

Thromboelastometry as point-of-care (POC) testing enables the analysis of the clotting process at the bedside, providing rapid results to guide haemostatic therapy. However, POC testing utilizes medical staff who are managing critically ill patients, as non-laboratory personnel may not be sufficiently trained to run the devices. To resolve these problems, thromboelastometry can be performed in the central laboratory and rapid transport of samples can be accomplished via a pneumatic tube system (PTS). This study compares thromboelastometry parameters of blood samples analysed immediately with those analysed after PTS transport. In patients with normal haemostasis, two arterial blood samples were collected from each patient (n=92) in citrated plastic tubes to investigate the assays INTEM (n=35), EXTEM (n=27), and FIBTEM (n=30). One blood sample was analysed immediately, the other sample after PTS transport. Thromboelastometry was performed using a single ROTEM(®) device. The mean clot firmness values were significantly lower for PTS samples in both the INTEM (-0.7 mm cf. -1.1 mm) and EXTEM (-1.4 cf. -1.7 mm) assays. INTEM coagulation time (CT) was significantly lower in PTS samples with a mean difference of -13 s. EXTEM CT was significantly higher in PTS samples with a mean difference of +3.9 s. Thromboelastometry parameters of blood samples analysed after PTS transport are significantly altered compared with those analysed immediately. However, in patients with normal haemostasis, the alterations were small and without clinical consequence, implying that analysis after PTS transport is an acceptable alternative to prompt analysis at the bedside. Further studies should focus on patients with impaired haemostasis.

Synthesis of NH4-Substituted Muscovite at 6.3 GPa and 1000°C: Implications for Nitrogen Transport to the Earth's Mantle

NASA Astrophysics Data System (ADS)

Sokol, A. G.; Sokol, E. V.; Kupriyanov, I. N.; Sobolev, N. V.

2018-03-01

The synthesis of NH4-bearing muscovite at P = 6.3 GPa and T = 1000°C in equilibrium with NH3-H2O fluid is performed. It is determined that the newly formed muscovite is enriched in celadonite minal and contains 370 ppm of NH4. The obtained data make it possible to conclude that ammonium-bearing micas have sufficient thermal stability and can transport crustal nitrogen to the mantle in the presence of a reduced water-ammonia fluid at fO2 less than the values of IW + 2 log units even in the regime of "hot" subduction. The key parameter that determines the efficiency of this mechanism for the deep nitrogen cycle is redox stability of NH4-bearing muscovite at the mantle PT-parameters.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sen, Amiya K.

The goal of this grant has been to study the basic physics of various sources of anomalous transport in tokamaks. Anomalous transport in tokamaks continues to be one of the major problems in magnetic fusion research. As a tokamak is not a physics device by design, direct experimental observation and identification of the instabilities responsible for transport, as well as physics studies of the transport in tokamaks, have been difficult and of limited value. It is noted that direct experimental observation, identification and physics study of microinstabilities including ITG, ETG, and trapped electron/ion modes in tokamaks has been very difficultmore » and nearly impossible. The primary reasons are co-existence of many instabilities, their broadband fluctuation spectra, lack of flexibility for parameter scans and absence of good local diagnostics. This has motivated us to study the suspected tokamak instabilities and their transport consequences in a simpler, steady state Columbia Linear Machine (CLM) with collisionless plasma and the flexibility of wide parameter variations. Earlier work as part of this grant was focused on both ITG turbulence, widely believed to be a primary source of ion thermal transport in tokamaks, and the effects of isotope scaling on transport levels. Prior work from our research team has produced and definitively identified both the slab and toroidal branches of this instability and determined the physics criteria for their existence. All the experimentally observed linear physics corroborate well with theoretical predictions. However, one of the large areas of research dealt with turbulent transport results that indicate some significant differences between our experimental results and most theoretical predictions. Latter years of this proposal were focused on anomalous electron transport with a special focus on ETG. There are several advanced tokamak scenarios with internal transport barriers (ITB), when the ion transport is reduced to neoclassical values by combined mechanisms of ExB and diamagnetic flow shear suppression of the ion temperature gradient (ITG) instabilities. However, even when the ion transport is strongly suppressed, the electron transport remains highly anomalous. The most plausible physics scenario for the anomalous electron transport is based on electron temperature gradient (ETG) instabilities. This instability is an electron analog of and nearly isomorphic to the ITG instability, which we had studied before extensively. However, this isomorphism is broken nonlinearily. It is noted that as the typical ETG mode growth rates are larger (in contrast to ITG modes) than ExB shearing rates in usual tokamaks, the flow shear suppression of ETG modes is highly unlikely. This motivated a broader range of investigations of other physics scenarios of nonlinear saturation and transport scaling of ETG modes.« less

Estimating Age Distributions of Base Flow in Watersheds Underlain by Single and Dual Porosity Formations Using Groundwater Transport Simulation and Weighted Weibull Functions

NASA Astrophysics Data System (ADS)

Sanford, W. E.

2015-12-01

Age distributions of base flow to streams are important to estimate for predicting the timing of water-quality responses to changes in distributed inputs of nutrients or pollutants at the land surface. Simple models of shallow aquifers will predict exponential age distributions, but more realistic 3-D stream-aquifer geometries will cause deviations from an exponential curve. In addition, in fractured rock terrains the dual nature of the effective and total porosity of the system complicates the age distribution further. In this study shallow groundwater flow and advective transport were simulated in two regions in the Eastern United States—the Delmarva Peninsula and the upper Potomac River basin. The former is underlain by layers of unconsolidated sediment, while the latter consists of folded and fractured sedimentary rocks. Transport of groundwater to streams was simulated using the USGS code MODPATH within 175 and 275 watersheds, respectively. For the fractured rock terrain, calculations were also performed along flow pathlines to account for exchange between mobile and immobile flow zones. Porosities at both sites were calibrated using environmental tracer data (3H, 3He, CFCs and SF6) in wells and springs, and with a 30-year tritium record from the Potomac River. Carbonate and siliciclastic rocks were calibrated to have mobile porosity values of one and six percent, and immobile porosity values of 18 and 12 percent, respectively. The age distributions were fitted to Weibull functions. Whereas an exponential function has one parameter that controls the median age of the distribution, a Weibull function has an extra parameter that controls the slope of the curve. A weighted Weibull function was also developed that potentially allows for four parameters, two that control the median age and two that control the slope, one of each weighted toward early or late arrival times. For both systems the two-parameter Weibull function nearly always produced a substantially better fit to the data than the one-parameter exponential function. For the single porosity system it was found that the use of three parameters was often optimal for accurately describing the base-flow age distribution, whereas for the dual porosity system the fourth parameter was often required to fit the more complicated response curves.

Transport of cardiovascular microbubbles in gas embolotherapy

NASA Astrophysics Data System (ADS)

Bull, Joseph L.; Calderon, Andres J.; Eshpuniyani, Brijesh; Valassis, Doug; Fowlkes, J. Brian

2006-11-01

This work is motivated by our ongoing development of a novel gas embolotherapy technique to occlude blood flow to tumors using gas bubbles that are selectively formed by the in vivo acoustic vaporization of liquid perfluorocarbon droplets. The droplets are small enough to pass through the microcirculation, but the subsequent bubbles are large enough to lodge in vessels. The uniformity of tumor infarction depends on the transport the blood-borne bubbles before they stick. We theoretically and experimentally investigate the transport of gas bubbles through bifurcating blood vessels. More homogenous bubble splitting is observed for higher values of capillary numbers and lower values of Bond numbers. The dependence of bubble lodging on flow parameters is also investigated, and several modes of bubble lodging and sticking are identified. These findings indicate the ability of gas bubbles to occlude flow and suggest the potential for development of treatment strategies that uniformly occlude the tumor circulation while minimizing collateral infarction. This work is supported by NSF grant BES-0301278 and NIH grant EB003541.

Estimates of atmospheric O2 in the Paleoproterozoic from paleosols

NASA Astrophysics Data System (ADS)

Kanzaki, Yoshiki; Murakami, Takashi

2016-02-01

A weathering model was developed to constrain the partial pressure of atmospheric O2 (PO2) in the Paleoproterozoic from the Fe records in paleosols. The model describes the Fe behavior in a weathering profile by dissolution/precipitation of Fe-bearing minerals, oxidation of dissolved Fe(II) to Fe(III) by oxygen and transport of dissolved Fe by water flow, in steady state. The model calculates the ratio of the precipitated Fe(III)-(oxyhydr)oxides from the dissolved Fe(II) to the dissolved Fe(II) during weathering (ϕ), as a function of PO2 . An advanced kinetic expression for Fe(II) oxidation by O2 was introduced into the model from the literature to calculate accurate ϕ-PO2 relationships. The model's validity is supported by the consistency of the calculated ϕ-PO2 relationships with those in the literature. The model can calculate PO2 for a given paleosol, once a ϕ value and values of the other parameters relevant to weathering, namely, pH of porewater, partial pressure of carbon dioxide (PCO2), water flow, temperature and O2 diffusion into soil, are obtained for the paleosol. The above weathering-relevant parameters were scrutinized for individual Paleoproterozoic paleosols. The values of ϕ, temperature, pH and PCO2 were obtained from the literature on the Paleoproterozoic paleosols. The parameter value of water flow was constrained for each paleosol from the mass balance of Si between water and rock phases and the relationships between water saturation ratio and hydraulic conductivity. The parameter value of O2 diffusion into soil was calculated for each paleosol based on the equation for soil O2 concentration with the O2 transport parameters in the literature. Then, we conducted comprehensive PO2 calculations for individual Paleoproterozoic paleosols which reflect all uncertainties in the weathering-relevant parameters. Consequently, robust estimates of PO2 in the Paleoproterozoic were obtained: 10-7.1-10-5.4 atm at ∼2.46 Ga, 10-5.0-10-2.5 atm at ∼2.15 Ga, 10-5.2-10-1.7 atm at ∼2.08 Ga and more than 10-4.6-10-2.0 atm at ∼1.85 Ga. Comparison of the present PO2 estimates to those in the literature suggests that a drastic rise of oxygen would not have occurred at ∼2.4 Ga, supporting a slightly rapid rise of oxygen at ∼2.4 Ga and a gradual rise of oxygen in the Paleoproterozoic in long term.

A simple reactive-transport model of calcite precipitation in soils and other porous media

NASA Astrophysics Data System (ADS)

Kirk, G. J. D.; Versteegen, A.; Ritz, K.; Milodowski, A. E.

2015-09-01

Calcite formation in soils and other porous media generally occurs around a localised source of reactants, such as a plant root or soil macro-pore, and the rate depends on the transport of reactants to and from the precipitation zone as well as the kinetics of the precipitation reaction itself. However most studies are made in well mixed systems, in which such transport limitations are largely removed. We developed a mathematical model of calcite precipitation near a source of base in soil, allowing for transport limitations and precipitation kinetics. We tested the model against experimentally-determined rates of calcite precipitation and reactant concentration-distance profiles in columns of soil in contact with a layer of HCO3--saturated exchange resin. The model parameter values were determined independently. The agreement between observed and predicted results was satisfactory given experimental limitations, indicating that the model correctly describes the important processes. A sensitivity analysis showed that all model parameters are important, indicating a simpler treatment would be inadequate. The sensitivity analysis showed that the amount of calcite precipitated and the spread of the precipitation zone were sensitive to parameters controlling rates of reactant transport (soil moisture content, salt content, pH, pH buffer power and CO2 pressure), as well as to the precipitation rate constant. We illustrate practical applications of the model with two examples: pH changes and CaCO3 precipitation in the soil around a plant root, and around a soil macro-pore containing a source of base such as urea.

Transport of the moving barrier driven by chiral active particles

NASA Astrophysics Data System (ADS)

Liao, Jing-jing; Huang, Xiao-qun; Ai, Bao-quan

2018-03-01

Transport of a moving V-shaped barrier exposed to a bath of chiral active particles is investigated in a two-dimensional channel. Due to the chirality of active particles and the transversal asymmetry of the barrier position, active particles can power and steer the directed transport of the barrier in the longitudinal direction. The transport of the barrier is determined by the chirality of active particles. The moving barrier and active particles move in the opposite directions. The average velocity of the barrier is much larger than that of active particles. There exist optimal parameters (the chirality, the self-propulsion speed, the packing fraction, and the channel width) at which the average velocity of the barrier takes its maximal value. In particular, tailoring the geometry of the barrier and the active concentration provides novel strategies to control the transport properties of micro-objects or cargoes in an active medium.

Simulating Pre-Asymptotic, Non-Fickian Transport Although Doing Simple Random Walks - Supported By Empirical Pore-Scale Velocity Distributions and Memory Effects

NASA Astrophysics Data System (ADS)

Most, S.; Jia, N.; Bijeljic, B.; Nowak, W.

2016-12-01

Pre-asymptotic characteristics are almost ubiquitous when analyzing solute transport processes in porous media. These pre-asymptotic aspects are caused by spatial coherence in the velocity field and by its heterogeneity. For the Lagrangian perspective of particle displacements, the causes of pre-asymptotic, non-Fickian transport are skewed velocity distribution, statistical dependencies between subsequent increments of particle positions (memory) and dependence between the x, y and z-components of particle increments. Valid simulation frameworks should account for these factors. We propose a particle tracking random walk (PTRW) simulation technique that can use empirical pore-space velocity distributions as input, enforces memory between subsequent random walk steps, and considers cross dependence. Thus, it is able to simulate pre-asymptotic non-Fickian transport phenomena. Our PTRW framework contains an advection/dispersion term plus a diffusion term. The advection/dispersion term produces time-series of particle increments from the velocity CDFs. These time series are equipped with memory by enforcing that the CDF values of subsequent velocities change only slightly. The latter is achieved through a random walk on the axis of CDF values between 0 and 1. The virtual diffusion coefficient for that random walk is our only fitting parameter. Cross-dependence can be enforced by constraining the random walk to certain combinations of CDF values between the three velocity components in x, y and z. We will show that this modelling framework is capable of simulating non-Fickian transport by comparison with a pore-scale transport simulation and we analyze the approach to asymptotic behavior.

Cardiac biomarker changes in camels (Camelus dromedarius) secondary to road transportation.

PubMed

Tharwat, Mohamed; Al-Sobayil, Fahd; Buczinski, Sébastien

2013-03-01

Little is known about cardiac biomarkers in camels despite their extensive use as draft animals. This study was designed to establish reference ranges for the cardiac biomarkers cardiac troponin I (cTnI) and creatine kinase myocardial b fraction (CK-MB) in healthy camels and to investigate their changes in response to road transportation. Twenty-five healthy camels transported for a 5 h round-trip journey. None of the camels had evidence of cardiac abnormalities on cardiac auscultation, echocardiography or electrocardiography. Three blood samples were obtained from each camel: 24 h before transportation (T0), within 2 h after unloading (T1) and 24 h after transportation (T2). The mean cTnI concentration in the camels was 0.032 ± 0.023 ng/mL. All the camels had resting cTnI concentrations of <0.08 ng/mL. At T1, the cTnI concentration was significantly higher (P < 0.001) in all 25 camels compared to values at T0. The CK-MB concentration in the camels was 0.19 ± 0.05 ng/mL. All the camels had resting CK-MB concentrations of <0.33 ng/mL. At T1, the CK-MB concentration was higher in 3/25 camels compared to values at both T0 and T2. Concerning the hematobiochemical variables, significant increases were detected at T1 in total white blood cells, total protein, globulin, magnesium and phosphorus. Cardiac troponin I, CK-MB and all the hematobiochemical parameters had returned to their pre-transport values at T2. 5 h road transportation might have transient adverse effects on the cardiac muscle of healthy camels. Copyright © 2013 Elsevier B.V. All rights reserved.

Efficient Bayesian experimental design for contaminant source identification

NASA Astrophysics Data System (ADS)

Zhang, J.; Zeng, L.

2013-12-01

In this study, an efficient full Bayesian approach is developed for the optimal sampling well location design and source parameter identification of groundwater contaminants. An information measure, i.e., the relative entropy, is employed to quantify the information gain from indirect concentration measurements in identifying unknown source parameters such as the release time, strength and location. In this approach, the sampling location that gives the maximum relative entropy is selected as the optimal one. Once the sampling location is determined, a Bayesian approach based on Markov Chain Monte Carlo (MCMC) is used to estimate unknown source parameters. In both the design and estimation, the contaminant transport equation is required to be solved many times to evaluate the likelihood. To reduce the computational burden, an interpolation method based on the adaptive sparse grid is utilized to construct a surrogate for the contaminant transport. The approximated likelihood can be evaluated directly from the surrogate, which greatly accelerates the design and estimation process. The accuracy and efficiency of our approach are demonstrated through numerical case studies. Compared with the traditional optimal design, which is based on the Gaussian linear assumption, the method developed in this study can cope with arbitrary nonlinearity. It can be used to assist in groundwater monitor network design and identification of unknown contaminant sources. Contours of the expected information gain. The optimal observing location corresponds to the maximum value. Posterior marginal probability densities of unknown parameters, the thick solid black lines are for the designed location. For comparison, other 7 lines are for randomly chosen locations. The true values are denoted by vertical lines. It is obvious that the unknown parameters are estimated better with the desinged location.

On extracting sediment transport information from measurements of luminescence in river sediment

USGS Publications Warehouse

Gray, Harrison J.; Tucker, Gregory E.; Mahan, Shannon; McGuire, Chris; Rhodes, Edward J.

2017-01-01

Accurately quantifying sediment transport rates in rivers remains an important goal for geomorphologists, hydraulic engineers, and environmental scientists. However, current techniques for measuring long-time scale (102–106 years) transport rates are laborious, and formulae to predict transport are notoriously inaccurate. Here we attempt to estimate sediment transport rates by using luminescence, a property of common sedimentary minerals that is used by the geoscience community for geochronology. This method is advantageous because of the ease of measurement on ubiquitous quartz and feldspar sand. We develop a model from first principles by using conservation of energy and sediment mass to explain the downstream pattern of luminescence in river channel sediment. We show that the model can accurately reproduce the luminescence observed in previously published field measurements from two rivers with very different sediment transport styles. The model demonstrates that the downstream pattern of river sand luminescence should show exponential-like decay in the headwaters which asymptotes to a constant value with further downstream distance. The parameters from the model can then be used to estimate the time-averaged virtual velocity, characteristic transport lengthscale, storage time scale, and floodplain exchange rate of fine sand-sized sediment in a fluvial system. The sediment transport values predicted from the luminescence method show a broader range than those reported in the literature, but the results are nonetheless encouraging and suggest that luminescence demonstrates potential as a sediment transport indicator. However, caution is warranted when applying the model as the complex nature of sediment transport can sometimes invalidate underlying simplifications.

Heat transport in Rayleigh–Bénard convection and angular momentum transport in Taylor–Couette flow: a comparative study

PubMed Central

Brauckmann, Hannes J.

2017-01-01

Rayleigh–Bénard convection and Taylor–Couette flow are two canonical flows that have many properties in common. We here compare the two flows in detail for parameter values where the Nusselt numbers, i.e. the thermal transport and the angular momentum transport normalized by the corresponding laminar values, coincide. We study turbulent Rayleigh–Bénard convection in air at Rayleigh number Ra=107 and Taylor–Couette flow at shear Reynolds number ReS=2×104 for two different mean rotation rates but the same Nusselt numbers. For individual pairwise related fields and convective currents, we compare the probability density functions normalized by the corresponding root mean square values and taken at different distances from the wall. We find one rotation number for which there is very good agreement between the mean profiles of the two corresponding quantities temperature and angular momentum. Similarly, there is good agreement between the fluctuations in temperature and velocity components. For the heat and angular momentum currents, there are differences in the fluctuations outside the boundary layers that increase with overall rotation and can be related to differences in the flow structures in the boundary layer and in the bulk. The study extends the similarities between the two flows from global quantities to local quantities and reveals the effects of rotation on the transport. This article is part of the themed issue ‘Toward the development of high-fidelity models of wall turbulence at large Reynolds number’. PMID:28167575

Genetic variability and heritability of chlorophyll a fluorescence parameters in Scots pine (Pinus sylvestris L.).

PubMed

Čepl, Jaroslav; Holá, Dana; Stejskal, Jan; Korecký, Jiří; Kočová, Marie; Lhotáková, Zuzana; Tomášková, Ivana; Palovská, Markéta; Rothová, Olga; Whetten, Ross W; Kaňák, Jan; Albrechtová, Jana; Lstibůrek, Milan

2016-07-01

Current knowledge of the genetic mechanisms underlying the inheritance of photosynthetic activity in forest trees is generally limited, yet it is essential both for various practical forestry purposes and for better understanding of broader evolutionary mechanisms. In this study, we investigated genetic variation underlying selected chlorophyll a fluorescence (ChlF) parameters in structured populations of Scots pine (Pinus sylvestris L.) grown on two sites under non-stress conditions. These parameters were derived from the OJIP part of the ChlF kinetics curve and characterize individual parts of primary photosynthetic processes associated, for example, with the exciton trapping by light-harvesting antennae, energy utilization in photosystem II (PSII) reaction centers (RCs) and its transfer further down the photosynthetic electron-transport chain. An additive relationship matrix was estimated based on pedigree reconstruction, utilizing a set of highly polymorphic single sequence repeat markers. Variance decomposition was conducted using the animal genetic evaluation mixed-linear model. The majority of ChlF parameters in the analyzed pine populations showed significant additive genetic variation. Statistically significant heritability estimates were obtained for most ChlF indices, with the exception of DI0/RC, φD0 and φP0 (Fv/Fm) parameters. Estimated heritabilities varied around the value of 0.15 with the maximal value of 0.23 in the ET0/RC parameter, which indicates electron-transport flux from QA to QB per PSII RC. No significant correlation was found between these indices and selected growth traits. Moreover, no genotype × environment interaction (G × E) was detected, i.e., no differences in genotypes' performance between sites. The absence of significant G × E in our study is interesting, given the relatively low heritability found for the majority of parameters analyzed. Therefore, we infer that polygenic variability of these indices is selectively neutral. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Stoichiometry and pH dependence of the rabbit proton-dependent oligopeptide transporter PepT1.

PubMed

Steel, A; Nussberger, S; Romero, M F; Boron, W F; Boyd, C A; Hediger, M A

1997-02-01

1. The intestinal H(+)-coupled peptide transporter PepT1, displays a broad substrate specificity and accepts most charged and neutral di- and tripeptides. To study the proton-to-peptide stoichiometry and the dependence of the kinetic parameters on extracellular pH (pHo), rabbit PepT1 was expressed in Xenopus laevis oocytes and used for uptake studies of radiolabelled neutral and charged dipeptides, voltage-clamp analysis and intracellular pH measurements. 2. PepT1 did not display the substrate-gated anion conductances that have been found to be characteristic of members of the Na(+)- and H(+)-coupled high-affinity glutamate transporter family. In conjunction with previous data on the ion dependence of PepT1, it can therefore be concluded that peptide-evoked charge fluxes of PepT1 are entirely due to H+ movement. 3. Neutral, acidic and basic dipeptides induced intracellular acidification. The rate of acidification, the initial rates of the uptake of radiolabelled peptides and the associated charge fluxes gave proton-substrate coupling ratios of 1:1, 2:1 and 1:1 for neutral, acidic and basic dipeptides, respectively. 4. Maximal transport of the neutral and charged dipeptides Gly-Leu, Gly-Glu, Gly-Lys and Ala-Lys occurred at pHo 5.5, 5.2, 6.2 and 5.8, respectively. The Imax values were relatively pHo independent but the apparent affinity (Km(app) values for these peptides were shown to be highly pHo dependent. 5. Our data show that at physiological pH (pHo 5.5-6.0) PepT1 prefers neutral and acidic peptides. The shift in transport maximum for the acidic peptide Gly-Glu to a lower pH value suggests that acidic dipeptides are transported in the protonated form. The shift in the transport maxima of the basic dipeptides to higher pH values may involve titration of a side-chain on the transporter molecule (e.g. protonation of a histidine group). These considerations have led us to propose a model for coupled transport of neutral, acidic and basic dipeptides.

In vivo amino acid transport of subacute and chronic cerebral infarction evaluated by 12-18F-phenylalanine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimosegawa, E.; Miura, S.; Murakami, M.

1994-05-01

On the basis of previous validation of kinetic two-compartment model and the determination of normal values of three parameters (k{sub 1}:influx rate constant, k{sub 2}:outflux rate constant, Vd:distribution volume), PET measurements of in vivo amino acid transport from blood to brain using L-(2-18F)-fluorophenylalanine ({sup 18}F-Phe) were undergone in the patients with cerebral infarction. The purposes of this study are to evaluate the alteration of amino acid transport in subacute and chronic stage of cerebral infarction and to compare with cerebral blood flow (CBF) and oxygen metabolism. Dynamic {sup 18}F-Phe PET studies for 50 minutes were performed in 7 patients withmore » cerebral infarction. The input function was obtained by 27 points of arterial sampling. In all patients, measurements of CBF, cerebral blood volume (CBV), cerebral metabolic rate of oxygen (CMRO{sub 2}), and oxygen extraction fraction (OEF) were made on the same day of {sup 18}F-Phe PET measurement. Each patient was studied twice, within 2 weeks of the onset and 3 months later. Weighted integration technique with table look-up method was applied for the reconstruction of parametric images of {sup 18}F-Phe and ROI analysis of k{sub 1}, k{sub 2}, and Vd. In subacute stage, significant reduction of k{sub 2} value in infarct area was observed when compared to that in periinfarct area (p<0.05) and in normal cortices (p<0.001). k{sub 1} value in this stage showed only slightly decrease in infarct area, therefore, Vd value in infarct area increased significantly compared to normal cortices (p<0.001). In chronic stage, both k{sub 1} and k{sub 2} values in infarct area were significantly lower than that in normal cortices (p<0.001), and corresponding Vd value reduced to normal level. Correlativity between kinetic parameters of {sup 18}F-Phe and CBF or oxygen metabolism was not observed both in subacute and chronic stage of infarction.« less

Distributed modeling of diffusive solute transport in peritoneal dialysis.

PubMed

Waniewski, Jacek

2002-01-01

The diffusive transport between blood and an ex-tissue medium (dialysis fluid) is evaluated using a mathematical model that takes into account the (quasicontinuous) distribution of capillaries within the tissue at various distances from the tissue surface, and includes diffusive-convective transport through the capillary wall and lymphatic absorption from the tissue. General formulas for solute penetration depth, lambda, and for the diffusive mass transport coefficient for the transport between blood and dialysis fluid, K(BD), are provided in terms of local transport coefficients for capillary wall, tissue, and lymphatic absorption. For pure diffusive transport between blood and dialysis fluid and thick tissue layers (i.e., if the solute penetration depth is much lower than the tissue thickness) these formulas yield previously known expressions. It is shown that apparent tissue layers, with widths lambdaTBL and lambdaT, respectively, may be defined according to the values of local transport parameters in such a way that K(BD) is equal to the solute clearance K(TBL) from the tissue by blood and lymph for a layer with width lambdaTBL or to the solute clearance K(T) from blood to dialysate by diffusion through the tissue layer with width lambdaT. For tissue layers with width much higher than the penetration depth: lambdaT approximately = lambdaTBL approximately = lambda. These characteristic width lengths depend on the transport parameters (and thus on the size) of solutes. Effective blood flow, which may be related to the exchange of the solute between blood and dialysate, is defined using an analogy to the extraction/absorption coefficients for blood-tissue exchange. Various approximations for the distributed model formula for diffusive mass transport coefficient (K(BD)) are possible. The appropriate range for their application is obtained from the general formula.

Transport models for desorption from natural soils packed in flushed columns

NASA Astrophysics Data System (ADS)

Brouwers, H. J. H.

1999-06-01

This paper addresses an experimental and theoretical study of sorbed contaminant removal from a column (or reactor) by flushing. This removal may take place by either volatilization or rinsing, and nonlinear sorption is accounted for by employing a Freundlich relationship. A one-dimensional nonequilibrium transport model is proposed which describes the unsteady mass transfer between flushing medium and soil phases in the column, using a linear chemical transfer model. The moving boundary problem is transferred, and a perturbation method is employed to obtain an approximate solution of the governing equations for a small Merkel number Me (this dimensionless number comprises the product of fluid residence time and the mass transfer coefficient). The solution reveals the effect of the various parameters, such as the Freundlich parameter n, on the contaminant transport in fluid phase and decay in solid phase. Applying the model to various experimental data results in values for the overall mass transfer coefficients, which are useful for engineering computations. Furthermore, the model enables the prediction of the initial soil contamination level as well as the parameter n solely from the measured exit contaminant concentrations in the flushing fluid. A thorough comparison of this prediction with the measured soil concentration (prior to the experiments) yields good agreement.

How Sensitive Are Transdermal Transport Predictions by Microscopic Stratum Corneum Models to Geometric and Transport Parameter Input?

PubMed

Wen, Jessica; Koo, Soh Myoung; Lape, Nancy

2018-02-01

While predictive models of transdermal transport have the potential to reduce human and animal testing, microscopic stratum corneum (SC) model output is highly dependent on idealized SC geometry, transport pathway (transcellular vs. intercellular), and penetrant transport parameters (e.g., compound diffusivity in lipids). Most microscopic models are limited to a simple rectangular brick-and-mortar SC geometry and do not account for variability across delivery sites, hydration levels, and populations. In addition, these models rely on transport parameters obtained from pure theory, parameter fitting to match in vivo experiments, and time-intensive diffusion experiments for each compound. In this work, we develop a microscopic finite element model that allows us to probe model sensitivity to variations in geometry, transport pathway, and hydration level. Given the dearth of experimentally-validated transport data and the wide range in theoretically-predicted transport parameters, we examine the model's response to a variety of transport parameters reported in the literature. Results show that model predictions are strongly dependent on all aforementioned variations, resulting in order-of-magnitude differences in lag times and permeabilities for distinct structure, hydration, and parameter combinations. This work demonstrates that universally predictive models cannot fully succeed without employing experimentally verified transport parameters and individualized SC structures. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Nonlinear waves in reaction-diffusion systems: The effect of transport memory

NASA Astrophysics Data System (ADS)

Manne, K. K.; Hurd, A. J.; Kenkre, V. M.

2000-04-01

Motivated by the problem of determining stress distributions in granular materials, we study the effect of finite transport correlation times on the propagation of nonlinear wave fronts in reaction-diffusion systems. We obtain results such as the possibility of spatial oscillations in the wave-front shape for certain values of the system parameters and high enough wave-front speeds. We also generalize earlier known results concerning the minimum wave-front speed and shape-speed relationships stemming from the finiteness of the correlation times. Analytic investigations are made possible by a piecewise linear representation of the nonlinearity.

Phase 1: Definition of intercity transportation comparison framework. Volume 1: Summary. [operations research of passenger and freight transporatation systems

NASA Technical Reports Server (NTRS)

1978-01-01

A unified framework for comparing intercity passenger and freight transportation systems is presented. Composite measures for cost, service/demand, energy, and environmental impact were determined. A set of 14 basic measures were articulated to form the foundation for computing the composite measures. A parameter dependency diagram, constructed to explicitly interrelate the composite and basic measures is discussed. Ground rules and methodology for developing the values of the basic measures are provided and the use of the framework with existing cost and service data is illustrated for various freight systems.

Experimental research on the behavior of the pneumatic transport of fine-grained iron

NASA Astrophysics Data System (ADS)

Andrei, V.; Hritac, M.; Constantin, N.; Dobrescu, C.

2017-01-01

Mixed injection of fine-grained iron ore and pulverized coal in the furnace, involves determining the behavior of these materials during pneumatic transport in a dense state through the pipe and setting possibilities for adjusting the flow rate of material transported with the corresponding values of the process. Parameters of the pneumatic transport were determined for the main types of iron ore and chalk used in Arcelor Mittal Galati. Outside the intended purpose of injecting iron ore and flux, it was considered also the experimental check of the possibility for injecting ilmenite in the furnace for crucible protection purpose. The possibility of injecting cinder mill into the furnace was also considered. Injecting cinder could be taken into account for the recycling of ferrous waste in the furnace, also as additive for intensifying the combustion process around the tuyeres.

Peritoneal Fluid Transport rather than Peritoneal Solute Transport Associates with Dialysis Vintage and Age of Peritoneal Dialysis Patients

PubMed Central

Waniewski, Jacek; Antosiewicz, Stefan; Baczynski, Daniel; Poleszczuk, Jan; Pietribiasi, Mauro; Lindholm, Bengt; Wankowicz, Zofia

2016-01-01

During peritoneal dialysis (PD), the peritoneal membrane undergoes ageing processes that affect its function. Here we analyzed associations of patient age and dialysis vintage with parameters of peritoneal transport of fluid and solutes, directly measured and estimated based on the pore model, for individual patients. Thirty-three patients (15 females; age 60 (21–87) years; median time on PD 19 (3–100) months) underwent sequential peritoneal equilibration test. Dialysis vintage and patient age did not correlate. Estimation of parameters of the two-pore model of peritoneal transport was performed. The estimated fluid transport parameters, including hydraulic permeability (LpS), fraction of ultrasmall pores (α u), osmotic conductance for glucose (OCG), and peritoneal absorption, were generally independent of solute transport parameters (diffusive mass transport parameters). Fluid transport parameters correlated whereas transport parameters for small solutes and proteins did not correlate with dialysis vintage and patient age. Although LpS and OCG were lower for older patients and those with long dialysis vintage, αu was higher. Thus, fluid transport parameters—rather than solute transport parameters—are linked to dialysis vintage and patient age and should therefore be included when monitoring processes linked to ageing of the peritoneal membrane. PMID:26989432

Effect of hyperthyroidism on the transport of pyruvate in rat-heart mitochondria.

PubMed

Paradies, G; Ruggiero, F M

1988-08-17

A comparative study of the transport of pyruvate in heart mitochondria from normal and triiodothyronine-treated rats has been carried out. It has been found that the rate of carrier-mediated (alpha-cyanocinnamate-sensitive) pyruvate uptake is significantly enhanced in mitochondria from triiodothyronine-treated rats as compared with mitochondria from control rats. The kinetic parameters of the pyruvate uptake indicate that only the Vmax of this process is enhanced whilst there is no change in the Km value. The enhanced rate of pyruvate uptake is not dependent on the increase of the transmembrane delta pH value (both mitochondria from normal and triiodothyronine-treated rats exhibit the same delta pH value) neither does it depend on the increase of the pyruvate carrier molecules (titration of these last with alpha-cyanocinnamate gives the same total number of binding sites). the pyruvate-dependent oxygen uptake is stimulated by 35-40% in mitochondria from hyperthyroid rats when compared with mitochondria from control rats. There is, however, no difference in either the respiratory control ratios or in the ADP/O ratios between these two types of mitochondria. The heart mitochondrial phospholipid composition is altered significantly in hyperthyroid rats; in particular, negatively charged phospholipid such as cardiolipin and phosphatidylserine were found to increase by more than 50%. Minor alterations were found in the pattern of fatty acids with an increase of 20:4/18:2 ratio. It is suggested that the changes in the kinetic parameters of pyruvate transport in mitochondria from hyperthyroid rats involve hormone-mediated changes in the lipid composition of the mitochondrial membranes which in turn modulate the activity of the pyruvate carrier.

Validating predictions of evolving porosity and permeability in carbonate reservoir rocks exposed to CO2-brine

NASA Astrophysics Data System (ADS)

Smith, M. M.; Hao, Y.; Carroll, S.

2017-12-01

Improving our ability to better forecast the extent and impact of changes in porosity and permeability due to CO2-brine-carbonate reservoir interactions should lower uncertainty in long-term geologic CO2 storage capacity estimates. We have developed a continuum-scale reactive transport model that simulates spatial and temporal changes to porosity, permeability, mineralogy, and fluid composition within carbonate rocks exposed to CO2 and brine at storage reservoir conditions. The model relies on two primary parameters to simulate brine-CO2-carbonate mineral reaction: kinetic rate constant(s), kmineral, for carbonate dissolution; and an exponential parameter, n, relating porosity change to resulting permeability. Experimental data collected from fifteen core-flooding experiments conducted on samples from the Weyburn (Saskatchewan, Canada) and Arbuckle (Kansas, USA) carbonate reservoirs were used to calibrate the reactive-transport model and constrain the useful range of k and n values. Here we present the results of our current efforts to validate this model and the use of these parameter values, by comparing predictions of extent and location of dissolution and the evolution of fluid permeability against our results from new core-flood experiments conducted on samples from the Duperow Formation (Montana, USA). Agreement between model predictions and experimental data increase our confidence that these parameter ranges need not be considered site-specific but may be applied (within reason) at various locations and reservoirs. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Anisotropic Mesoscale Eddy Transport in Ocean General Circulation Models

NASA Astrophysics Data System (ADS)

Reckinger, S. J.; Fox-Kemper, B.; Bachman, S.; Bryan, F.; Dennis, J.; Danabasoglu, G.

2014-12-01

Modern climate models are limited to coarse-resolution representations of large-scale ocean circulation that rely on parameterizations for mesoscale eddies. The effects of eddies are typically introduced by relating subgrid eddy fluxes to the resolved gradients of buoyancy or other tracers, where the proportionality is, in general, governed by an eddy transport tensor. The symmetric part of the tensor, which represents the diffusive effects of mesoscale eddies, is universally treated isotropically in general circulation models. Thus, only a single parameter, namely the eddy diffusivity, is used at each spatial and temporal location to impart the influence of mesoscale eddies on the resolved flow. However, the diffusive processes that the parameterization approximates, such as shear dispersion, potential vorticity barriers, oceanic turbulence, and instabilities, typically have strongly anisotropic characteristics. Generalizing the eddy diffusivity tensor for anisotropy extends the number of parameters to three: a major diffusivity, a minor diffusivity, and the principal axis of alignment. The Community Earth System Model (CESM) with the anisotropic eddy parameterization is used to test various choices for the newly introduced parameters, which are motivated by observations and the eddy transport tensor diagnosed from high resolution simulations. Simply setting the ratio of major to minor diffusivities to a value of five globally, while aligning the major axis along the flow direction, improves biogeochemical tracer ventilation and reduces global temperature and salinity biases. These effects can be improved even further by parameterizing the anisotropic transport mechanisms in the ocean.

Frequency and concentration windows for the electric activation of a membrane active transport system.

PubMed Central

Markin, V. S.; Tsong, T. Y.

1991-01-01

Previous work has shown that a simple four-state membrane transport system can interact with an oscillating electric field to become an active transport system if there is charge translocation associated with conformational changes of the transporter and if affinities of the transporter for the ligand on the two sides of membrane are different. The relationship between the transport flux and both the frequency of the applied field and the concentration of ligand have been examined based on the following assumptions: the rate of the electroconformational change of the transporter is much greater than that of the ligand association/dissociation reaction, and the oscillating electric field has a large amplitude. It was found that the transport flux depends strongly on the frequency of the field and on the concentration of the ligand and it displays a window of broad bandwidth both on the frequency and the concentration axes. The maximum concentration gradient, or the static head, which can be supported by this mechanism is shown to be constant for field frequencies smaller than the rate of the electroconformational change. The static head value diminishes completely when the field frequency exceeds the rate of the conformational change. The presence of an optimal field frequency has been shown experimentally in several membrane enzyme systems. The theory was applied to the description of Rb and Na pumping in human erythrocytes stimulated by an AC field. The prediction of a window for a ligand concentration and the static head value may be tested experimentally. In addition, the rate constants and the equilibrium constants of the four state model can be determined by measuring positions of windows, fluxes, and static head values under different experimental conditions. These results are equally applicable to the oscillation of pressure, membrane tension, substrate concentration, or temperature if these external parameters can induce functionally relevant conformational changes of the transporter. Images FIGURE 8 PMID:1873467

Sorption kinetics of diuron on volcanic ash derived soils.

PubMed

Cáceres-Jensen, Lizethly; Rodríguez-Becerra, Jorge; Parra-Rivero, Joselyn; Escudey, Mauricio; Barrientos, Lorena; Castro-Castillo, Vicente

2013-10-15

Diuron sorption kinetic was studied in Andisols, Inceptisol and Ultisols soils in view of their distinctive physical and chemical properties: acidic pH and variable surface charge. Two types of kinetic models were used to fit the experimental dates: those that allow to establish principal kinetic parameters and modeling of sorption process (pseudo-first-order, pseudo-second-order), and some ones frequently used to describe solute transport mechanisms of organic compounds on different sorbents intended for remediation purposes (Elovich equation, intraparticle diffusion, Boyd, and two-site nonequilibrium models). The best fit was obtained with the pseudo-second-order model. The rate constant and the initial rate constant values obtained through this model demonstrated the behavior of Diuron in each soil, in Andisols were observed the highest values for both parameters. The application of the models to describe solute transport mechanisms allowed establishing that in all soils the mass transfer controls the sorption kinetic across the boundary layer and intraparticle diffusion into macropores and micropores. The slowest sorption rate was observed on Ultisols, behavior which must be taken into account when the leaching potential of Diuron is considered. Copyright © 2013 Elsevier B.V. All rights reserved.

Compartmental analysis of [11C]flumazenil kinetics for the estimation of ligand transport rate and receptor distribution using positron emission tomography.

PubMed

Koeppe, R A; Holthoff, V A; Frey, K A; Kilbourn, M R; Kuhl, D E

1991-09-01

The in vivo kinetic behavior of [11C]flumazenil ([11C]FMZ), a non-subtype-specific central benzodiazepine antagonist, is characterized using compartmental analysis with the aim of producing an optimized data acquisition protocol and tracer kinetic model configuration for the assessment of [11C]FMZ binding to benzodiazepine receptors (BZRs) in human brain. The approach presented is simple, requiring only a single radioligand injection. Dynamic positron emission tomography data were acquired on 18 normal volunteers using a 60- to 90-min sequence of scans and were analyzed with model configurations that included a three-compartment, four-parameter model, a three-compartment, three-parameter model, with a fixed value for free plus nonspecific binding; and a two-compartment, two-parameter model. Statistical analysis indicated that a four-parameter model did not yield significantly better fits than a three-parameter model. Goodness of fit was improved for three- versus two-parameter configurations in regions with low receptor density, but not in regions with moderate to high receptor density. Thus, a two-compartment, two-parameter configuration was found to adequately describe the kinetic behavior of [11C]FMZ in human brain, with stable estimates of the model parameters obtainable from as little as 20-30 min of data. Pixel-by-pixel analysis yields functional images of transport rate (K1) and ligand distribution volume (DV"), and thus provides independent estimates of ligand delivery and BZR binding.

Determination of Groundwater Velocity and Dispersion Parameters by Borehole Wall Multielectrode Geoelectrics

NASA Astrophysics Data System (ADS)

Kessels, W.; Wuttke, M. W.

2007-05-01

A single well technique to determine groundwater flow values and transport parameters is presented. Multielectrode arrays are placed at the filtered casing depth by an inflatable packer or are installed on the borehole wall behind the casing.Tracer water with a higher or lower specific electrical conductivity (salinity) which is injected between the electrodes. This tracer plume then moves into the natural groundwater flow field. The observation of this movement by geoelectric logging enables the determination of the groundwater velocity and salinity. The transport parameters "effective porosity" and "dispersion length" can also be derived. The geoelectric logging uses n borehole electrodes and two grounding electrodes. Thus, either n independent two point measurements or n*(n-1)/2 pole-to-pole measurements can be conducted to obtain a full set of geoelectric measurements. This set is used to derive all electrode combinations by applying the law of superposition and reciprocity. The tracer distribution around the borehole during and after injection depends on the hydraulic and transport parameters of the aquifer and the filter sand. The transport parameter "porosity" plus the total injected tracer volume determines the tracer distribution around the borehole. The transport parameter "dispersivity" determines the abruptness of the tracer front. The method was tested by undertaking measurements in a lab aquifer filled with sand. The results are discussed and the limitations of the method are shown. Multielectrode installations behind casing were tested in situ in the two scientific boreholes CAT-LUD-1 and CAT- LUD-1A drilled in the northern part of Germany. A multielectrode packer system was designed, built and tested in these boreholes. The results are compared with colloid observations in the borehole and hydraulic triangulation in surrounded observation wells. Here, the interpretation of these in situ measurements is mainly restricted to two point geoelectric measurements and vertical four point electrode interpretations. The transport equation for NaCl-tracered water is the basic rule to determine the groundwater transport velocity. Numerical calculations to simulate the measurement are carried out with the program FEFLOW. Due to the density contrast, the tracer undergoes vertical movement. Kessels, W., Zoth, G.(1998): Doppelmantel - Packer mit geoelektrischer Meßtechnik zur Bestimmung der Abstandsgeschwindigkeit des Grundwassers, Patent Az:19855048.0, GGA-Institut, Germany, Hannover. KESSELS, W., RIFAI, H., THORENZ, C., ZOTH, G.(2002): Multi Electrode Geoelectric on the Borehole Wall- Determination of groundwater velocity and dispersion parameters, AGU spring meeting, Washington KESSELS, W., ZOTH, G., WONIK, T., FULDA, C. (1999): THE USE OF SALT CARTRIDGES FOR FLUID LOGGING. XXIV GENERAL ASSEMBLY OF E.G.S. THE HAGUE, THE NETHERLANDS PANTELEIT,B., KESSELS, W., BINOT, F (2006): MUD TRACER TEST DURING SOFT ROCK DRILLING; W.R.R., VOL. 42, W11415, DOI:10.1029/2005WR004487

One dimensional heavy ion beam transport: Energy independent model. M.S. Thesis

NASA Technical Reports Server (NTRS)

Farhat, Hamidullah

1990-01-01

Attempts are made to model the transport problem for heavy ion beams in various targets, employing the current level of understanding of the physics of high-charge and energy (HZE) particle interaction with matter are made. An energy independent transport model, with the most simplified assumptions and proper parameters is presented. The first and essential assumption in this case (energy independent transport) is the high energy characterization of the incident beam. The energy independent equation is solved and application is made to high energy neon (NE-20) and iron (FE-56) beams in water. The numerical solutions is given and compared to a numerical solution to determine the accuracy of the model. The lower limit energy for neon and iron to be high energy beams is calculated due to Barkas and Burger theory by LBLFRG computer program. The calculated values in the density range of interest (50 g/sq cm) of water are: 833.43 MeV/nuc for neon and 1597.68 MeV/nuc for iron. The analytical solutions of the energy independent transport equation gives the flux of different collision terms. The fluxes of individual collision terms are given and the total fluxes are shown in graphs relative to different thicknesses of water. The values for fluxes are calculated by the ANASTP computer code.

Towards the minimization of thermodynamic irreversibility in an electrically actuated microflow of a viscoelastic fluid under electrical double layer phenomenon

NASA Astrophysics Data System (ADS)

Sarma, Rajkumar; Jain, Manish; Mondal, Pranab Kumar

2017-10-01

We discuss the entropy generation minimization for electro-osmotic flow of a viscoelastic fluid through a parallel plate microchannel under the combined influences of interfacial slip and conjugate transport of heat. We use in this study the simplified Phan-Thien-Tanner model to describe the rheological behavior of the viscoelastic fluid. Using Navier's slip law and thermal boundary conditions of the third kind, we solve the transport equations analytically and evaluate the global entropy generation rate of the system. We examine the influential role of the following parameters on the entropy generation rate of the system, viz., the viscoelastic parameter (ɛDe2), Debye-Hückel parameter ( κ ¯ ) , channel wall thickness (δ), thermal conductivity of the wall (γ), Biot number (Bi), Peclet number (Pe), and axial temperature gradient (B). This investigation finally establishes the optimum values of the abovementioned parameters, leading to the minimum entropy generation of the system. We believe that results of this analysis could be helpful in optimizing the second-law performance of microscale thermal management devices, including the micro-heat exchangers, micro-reactors, and micro-heat pipes.

Determining fundamental properties of matter created in ultrarelativistic heavy-ion collisions

NASA Astrophysics Data System (ADS)

Novak, J.; Novak, K.; Pratt, S.; Vredevoogd, J.; Coleman-Smith, C. E.; Wolpert, R. L.

2014-03-01

Posterior distributions for physical parameters describing relativistic heavy-ion collisions, such as the viscosity of the quark-gluon plasma, are extracted through a comparison of hydrodynamic-based transport models to experimental results from 100AGeV+100AGeV Au +Au collisions at the Relativistic Heavy Ion Collider. By simultaneously varying six parameters and by evaluating several classes of observables, we are able to explore the complex intertwined dependencies of observables on model parameters. The methods provide a full multidimensional posterior distribution for the model output, including a range of acceptable values for each parameter, and reveal correlations between them. The breadth of observables and the number of parameters considered here go beyond previous studies in this field. The statistical tools, which are based upon Gaussian process emulators, are tested in detail and should be extendable to larger data sets and a higher number of parameters.

Fitting Transporter Activities to Cellular Drug Concentrations and Fluxes: Why the Bumblebee Can Fly

PubMed Central

Mendes, Pedro; Oliver, Stephen G.; Kell, Douglas B.

2015-01-01

A recent paper in this journal argued that reported expression levels, kcat and Km for drug transporters could be used to estimate the likelihood that drug fluxes through Caco-2 cells could be accounted for solely by protein transporters. It was in fact concluded that if five such transporters contributed ‘randomly’ they could account for the flux of the most permeable drug tested (verapamil) 35% of the time. However, the values of permeability cited for verapamil were unusually high; this and other drugs have much lower permeabilities. Even for the claimed permeabilities, we found that a single ‘random’ transporter could account for the flux 42% of the time, and that two transporters can achieve 10 · 10−6 cm·s−1 90% of the time. Parameter optimisation methods show that even a single transporter can account for Caco-2 drug uptake of the most permeable drug. Overall, the proposal that ‘phospholipid bilayer diffusion (of drugs) is negligible’ is not disproved by the calculations of ‘likely’ transporter-based fluxes. PMID:26538313

Model calibration and issues related to validation, sensitivity analysis, post-audit, uncertainty evaluation and assessment of prediction data needs

USGS Publications Warehouse

Tiedeman, Claire; Hill, Mary C.

2007-01-01

When simulating natural and engineered groundwater flow and transport systems, one objective is to produce a model that accurately represents important aspects of the true system. However, using direct measurements of system characteristics, such as hydraulic conductivity, to construct a model often produces simulated values that poorly match observations of the system state, such as hydraulic heads, flows and concentrations (for example, Barth et al., 2001). This occurs because of inaccuracies in the direct measurements and because the measurements commonly characterize system properties at different scales from that of the model aspect to which they are applied. In these circumstances, the conservation of mass equations represented by flow and transport models can be used to test the applicability of the direct measurements, such as by comparing model simulated values to the system state observations. This comparison leads to calibrating the model, by adjusting the model construction and the system properties as represented by model parameter values, so that the model produces simulated values that reasonably match the observations.

Study of atmospheric diffusion using LANDSAT

NASA Technical Reports Server (NTRS)

Torsani, J. A.; Viswanadham, Y.

1982-01-01

The parameters of diffusion patterns of atmospheric pollutants under different conditions were investigated for use in the Gaussian model for calculation of pollution concentration. Value for the divergence pattern of concentration distribution along the Y axis were determined using LANDSAT images. Multispectral scanner images of a point source plume having known characteristics, wind and temperature data, and cloud cover and solar elevation data provided by LANDSAT, were analyzed using the 1-100 system for image analysis. These measured values are compared with pollution transport as predicted by the Pasquill-Gifford, Juelich, and Hoegstroem atmospheric models.

Modeling leaching of viruses by the Monte Carlo method.

PubMed

Faulkner, Barton R; Lyon, William G; Khan, Faruque A; Chattopadhyay, Sandip

2003-11-01

A predictive screening model was developed for fate and transport of viruses in the unsaturated zone by applying the final value theorem of Laplace transformation to previously developed governing equations. A database of input parameters allowed Monte Carlo analysis with the model. The resulting kernel densities of predicted attenuation during percolation indicated very small, but finite probabilities of failure for all homogeneous USDA classified soils to attenuate reovirus 3 by 99.99% in one-half meter of gravity drainage. The logarithm of saturated hydraulic conductivity and water to air-water interface mass transfer coefficient affected virus fate and transport about 3 times more than any other parameter, including the logarithm of inactivation rate of suspended viruses. Model results suggest extreme infiltration events may play a predominant role in leaching of viruses in soils, since such events could impact hydraulic conductivity. The air-water interface also appears to play a predominating role in virus transport and fate. Although predictive modeling may provide insight into actual attenuation of viruses, hydrogeologic sensitivity assessments for the unsaturated zone should include a sampling program.

Transport channel of secondary ion beam of experimental setup for selective laser ionization with gas cell GALS

NASA Astrophysics Data System (ADS)

Gulbekyan, G. G.; Zemlyanoy, S. G.; Bashevoy, V. V.; Ivanenko, I. A.; Kazarinov, N. Yu; Kazacha, V. I.; Osipov, N. F.

2017-07-01

GALS is the experimental setup intended for production and research of isobaric and isotopically pure heavy neutron-rich nuclei. The beam line consists of two parts. The initial part is used for transport of the primary 136Xe ion beam with the energy of 4.5-9.0 MeV/amu from the FLNR cyclotron U-400M to the Pb target for production of the studying ion beams. These beams have the following design parameters: the charge Z = +1, the mass A = 180-270 and the kinetic energy W = 40 keV. The second part placed after the target consists of the SPIG (QPIG) system, the accelerating gap, the electrostatic Einzel lens, 90-degree spectrometric magnet (calculated value of the mass-resolution is equal to 1400) and the beam line for the transportation of the ions from the magnet focal plane to a particle detector. The results of simulation of the particle dynamics and the basic parameters of all elements of the beam line are presented.

Predicting the long-term (137)Cs distribution in Fukushima after the Fukushima Dai-ichi nuclear power plant accident: a parameter sensitivity analysis.

PubMed

Yamaguchi, Masaaki; Kitamura, Akihiro; Oda, Yoshihiro; Onishi, Yasuo

2014-09-01

Radioactive materials deposited on the land surface of Fukushima Prefecture from the Fukushima Dai-ichi Nuclear Power Plant explosion is a crucial issue for a number of reasons, including external and internal radiation exposure and impacts on agricultural environments and aquatic biota. Predicting the future distribution of radioactive materials and their fates is therefore indispensable for evaluation and comparison of the effectiveness of remediation options regarding human health and the environment. Cesium-137, the main radionuclide to be focused on, is well known to adsorb to clay-rich soils; therefore its primary transportation mechanism is in the form of soil erosion on the land surface and transport of sediment-sorbed contaminants in the water system. In this study, we applied the Soil and Cesium Transport model, which we have developed, to predict a long-term cesium distribution in the Fukushima area, based on the Universal Soil Loss Equation and simple sediment discharge formulas. The model consists of calculation schemes of soil erosion, transportation and deposition, as well as cesium transport and its future distribution. Since not all the actual data on parameters is available, a number of sensitivity analyses were conducted here to find the range of the output results due to the uncertainties of parameters. The preliminary calculation indicated that a large amount of total soil loss remained in slope, and the residual sediment was transported to rivers, deposited in rivers and lakes, or transported farther downstream to the river mouths. Most of the sediment deposited in rivers and lakes consists of sand. On the other hand, most of the silt and clay portions transported to river were transported downstream to the river mouths. The rate of sediment deposition in the Abukuma River basin was three times as high as those of the other 13 river basins. This may be due to the larger catchment area and more moderate channel slope of the Abukuma River basin than those of the other rivers. Annual sediment outflows from the Abukuma River and the total from the other 13 river basins were calculated as 3.2 × 10(4)-3.1 × 10(5) and 3.4 × 10(4)-2.1 × 10(5)ty(-1), respectively. The values vary between calculation cases because of the critical shear stress, the rainfall factor, and other differences. On the other hand, contributions of those parameters were relatively small for (137)Cs concentration within transported soil. This indicates that the total amount of (137)Cs outflow into the ocean would mainly be controlled by the amount of soil erosion and transport and the total amount of (137)Cs concentration remaining within the basin. Outflows of (137)Cs from the Abukuma River and the total from the other 13 river basins during the first year after the accident were calculated to be 2.3 × 10(11)-3.7 × 10(12) and 4.6 × 10(11)-6.5 × 10(12)Bqy(-1), respectively. The former results were compared with the field investigation results, and the order of magnitude was matched between the two, but the value of the investigation result was beyond the upper limit of model prediction. Copyright © 2014 Elsevier Ltd. All rights reserved.

Volume Diffusion Growth Kinetics and Step Geometry in Crystal Growth

NASA Technical Reports Server (NTRS)

Mazuruk, Konstantin; Ramachandran, Narayanan

1998-01-01

The role of step geometry in two-dimensional stationary volume diff4sion process used in crystal growth kinetics models is investigated. Three different interface shapes: a) a planar interface, b) an equidistant hemispherical bumps train tAx interface, and c) a train of right angled steps, are used in this comparative study. The ratio of the super-saturation to the diffusive flux at the step position is used as a control parameter. The value of this parameter can vary as much as 50% for different geometries. An approximate analytical formula is derived for the right angled steps geometry. In addition to the kinetic models, this formula can be utilized in macrostep growth models. Finally, numerical modeling of the diffusive and convective transport for equidistant steps is conducted. In particular, the role of fluid flow resulting from the advancement of steps and its contribution to the transport of species to the steps is investigated.

In-situ analysis of microwave conductivity and impedance spectroscopy for evaluation of charge carrier dynamics at interfaces

NASA Astrophysics Data System (ADS)

Choi, Wookjin; Inoue, Junichi; Tsutsui, Yusuke; Sakurai, Tsuneaki; Seki, Shu

2017-11-01

A unique concerted analysis comprising non-contact microwave conductivity measurements and impedance spectroscopy was developed to simultaneously assess the charge carrier mobility and injection barriers. The frequency dependence of the microwave conductivity as well as the electrical current was analyzed by applying sinusoidal voltage to determine the equivalent circuit parameters. Based on the temperature dependence of the circuit parameters, the energy of the injection barrier was estimated to be 0.4 eV with the Richardson-Schottky model, and the band-like transport was confirmed with the negative temperature coefficient with the β value of 1.4 in the intra-layer conduction of C8-BTBT. In contrast, the increase in the resistance of the C8-BTBT layer with decreasing temperature implied the occurrence of hopping-like transport in the inter-layer conduction of C8-BTBT.

Slip Effects on Mixed Convective Peristaltic Transport of Copper-Water Nanofluid in an Inclined Channel

PubMed Central

Abbasi, Fahad Munir; Hayat, Tasawar; Ahmad, Bashir; Chen, Guo-Qian

2014-01-01

Peristaltic transport of copper-water nanofluid in an inclined channel is reported in the presence of mixed convection. Both velocity and thermal slip conditions are considered. Mathematical modelling has been carried out using the long wavelength and low Reynolds number approximations. Resulting coupled system of equations is solved numerically. Quantities of interest are analyzed through graphs. Numerical values of heat transfer rate at the wall for different parameters are obtained and examined. Results showed that addition of copper nanoparticles reduces the pressure gradient, axial velocity at the center of channel, trapping and temperature. Velocity slip parameter has a decreasing effect on the velocity near the center of channel. Temperature of nanofluid increases with increase in the Grashoff number and channel inclination angle. It is further concluded that the heat transfer rate at the wall increases considerably in the presence of copper nanoparticles. PMID:25170908

Comparison of Approaches for Measuring the Mass Accommodation Coefficient for the Condensation of Water and Sensitivities to Uncertainties in Thermophysical Properties

PubMed Central

2012-01-01

We compare and contrast measurements of the mass accommodation coefficient of water on a water surface made using ensemble and single particle techniques under conditions of supersaturation and subsaturation, respectively. In particular, we consider measurements made using an expansion chamber, a continuous flow streamwise thermal gradient cloud condensation nuclei chamber, the Leipzig Aerosol Cloud Interaction Simulator, aerosol optical tweezers, and electrodynamic balances. Although this assessment is not intended to be comprehensive, these five techniques are complementary in their approach and give values that span the range from near 0.1 to 1.0 for the mass accommodation coefficient. We use the same semianalytical treatment to assess the sensitivities of the measurements made by the various techniques to thermophysical quantities (diffusion constants, thermal conductivities, saturation pressure of water, latent heat, and solution density) and experimental parameters (saturation value and temperature). This represents the first effort to assess and compare measurements made by different techniques to attempt to reduce the uncertainty in the value of the mass accommodation coefficient. Broadly, we show that the measurements are consistent within the uncertainties inherent to the thermophysical and experimental parameters and that the value of the mass accommodation coefficient should be considered to be larger than 0.5. Accurate control and measurement of the saturation ratio is shown to be critical for a successful investigation of the surface transport kinetics during condensation/evaporation. This invariably requires accurate knowledge of the partial pressure of water, the system temperature, the droplet curvature and the saturation pressure of water. Further, the importance of including and quantifying the transport of heat in interpreting droplet measurements is highlighted; the particular issues associated with interpreting measurements of condensation/evaporation rates with varying pressure are discussed, measurements that are important for resolving the relative importance of gas diffusional transport and surface kinetics. PMID:23057492

Calculation of effective transport properties of partially saturated gas diffusion layers

NASA Astrophysics Data System (ADS)

Bednarek, Tomasz; Tsotridis, Georgios

2017-02-01

A large number of currently available Computational Fluid Dynamics numerical models of Polymer Electrolyte Membrane Fuel Cells (PEMFC) are based on the assumption that porous structures are mainly considered as thin and homogenous layers, hence the mass transport equations in structures such as Gas Diffusion Layers (GDL) are usually modelled according to the Darcy assumptions. Application of homogenous models implies that the effects of porous structures are taken into consideration via the effective transport properties of porosity, tortuosity, permeability (or flow resistance), diffusivity, electric and thermal conductivity. Therefore, reliable values of those effective properties of GDL play a significant role for PEMFC modelling when employing Computational Fluid Dynamics, since these parameters are required as input values for performing the numerical calculations. The objective of the current study is to calculate the effective transport properties of GDL, namely gas permeability, diffusivity and thermal conductivity, as a function of liquid water saturation by using the Lattice-Boltzmann approach. The study proposes a method of uniform water impregnation of the GDL based on the "Fine-Mist" assumption by taking into account the surface tension of water droplets and the actual shape of GDL pores.

Physical characteristics and resistance parameters of typical urban cyclists.

PubMed

Tengattini, Simone; Bigazzi, Alexander York

2018-03-30

This study investigates the rolling and drag resistance parameters and bicycle and cargo masses of typical urban cyclists. These factors are important for modelling of cyclist speed, power and energy expenditure, with applications including exercise performance, health and safety assessments and transportation network analysis. However, representative values for diverse urban travellers have not been established. Resistance parameters were measured utilizing a field coast-down test for 557 intercepted cyclists in Vancouver, Canada. Masses were also measured, along with other bicycle attributes such as tire pressure and size. The average (standard deviation) of coefficient of rolling resistance, effective frontal area, bicycle plus cargo mass, and bicycle-only mass were 0.0077 (0.0036), 0.559 (0.170) m 2 , 18.3 (4.1) kg, and 13.7 (3.3) kg, respectively. The range of measured values is wider and higher than suggested in existing literature, which focusses on sport cyclists. Significant correlations are identified between resistance parameters and rider and bicycle attributes, indicating higher resistance parameters for less sport-oriented cyclists. The findings of this study are important for appropriately characterising the full range of urban cyclists, including commuters and casual riders.

Determination of hyporheic travel time distributions and other parameters from concurrent conservative and reactive tracer tests by local-in-global optimization

NASA Astrophysics Data System (ADS)

Knapp, Julia L. A.; Cirpka, Olaf A.

2017-06-01

The complexity of hyporheic flow paths requires reach-scale models of solute transport in streams that are flexible in their representation of the hyporheic passage. We use a model that couples advective-dispersive in-stream transport to hyporheic exchange with a shape-free distribution of hyporheic travel times. The model also accounts for two-site sorption and transformation of reactive solutes. The coefficients of the model are determined by fitting concurrent stream-tracer tests of conservative (fluorescein) and reactive (resazurin/resorufin) compounds. The flexibility of the shape-free models give rise to multiple local minima of the objective function in parameter estimation, thus requiring global-search algorithms, which is hindered by the large number of parameter values to be estimated. We present a local-in-global optimization approach, in which we use a Markov-Chain Monte Carlo method as global-search method to estimate a set of in-stream and hyporheic parameters. Nested therein, we infer the shape-free distribution of hyporheic travel times by a local Gauss-Newton method. The overall approach is independent of the initial guess and provides the joint posterior distribution of all parameters. We apply the described local-in-global optimization method to recorded tracer breakthrough curves of three consecutive stream sections, and infer section-wise hydraulic parameter distributions to analyze how hyporheic exchange processes differ between the stream sections.

Modeling charge transport in organic photovoltaic materials.

PubMed

Nelson, Jenny; Kwiatkowski, Joe J; Kirkpatrick, James; Frost, Jarvist M

2009-11-17

The performance of an organic photovoltaic cell depends critically on the mobility of charge carriers within the constituent molecular semiconductor materials. However, a complex combination of phenomena that span a range of length and time scales control charge transport in disordered organic semiconductors. As a result, it is difficult to rationalize charge transport properties in terms of material parameters. Until now, efforts to improve charge mobilities in molecular semiconductors have proceeded largely by trial and error rather than through systematic design. However, recent developments have enabled the first predictive simulation studies of charge transport in disordered organic semiconductors. This Account describes a set of computational methods, specifically molecular modeling methods, to simulate molecular packing, quantum chemical calculations of charge transfer rates, and Monte Carlo simulations of charge transport. Using case studies, we show how this combination of methods can reproduce experimental mobilities with few or no fitting parameters. Although currently applied to material systems of high symmetry or well-defined structure, further developments of this approach could address more complex systems such anisotropic or multicomponent solids and conjugated polymers. Even with an approximate treatment of packing disorder, these computational methods simulate experimental mobilities within an order of magnitude at high electric fields. We can both reproduce the relative values of electron and hole mobility in a conjugated small molecule and rationalize those values based on the symmetry of frontier orbitals. Using fully atomistic molecular dynamics simulations of molecular packing, we can quantitatively replicate vertical charge transport along stacks of discotic liquid crystals which vary only in the structure of their side chains. We can reproduce the trends in mobility with molecular weight for self-organizing polymers using a cheap, coarse-grained structural simulation method. Finally, we quantitatively reproduce the field-effect mobility in disordered C60 films. On the basis of these results, we conclude that all of the necessary building blocks are in place for the predictive simulation of charge transport in macromolecular electronic materials and that such methods can be used as a tool toward the future rational design of functional organic electronic materials.

Methods for using groundwater model predictions to guide hydrogeologic data collection, with application to the Death Valley regional groundwater flow system

USGS Publications Warehouse

Tiedeman, C.R.; Hill, M.C.; D'Agnese, F. A.; Faunt, C.C.

2003-01-01

Calibrated models of groundwater systems can provide substantial information for guiding data collection. This work considers using such models to guide hydrogeologic data collection for improving model predictions by identifying model parameters that are most important to the predictions. Identification of these important parameters can help guide collection of field data about parameter values and associated flow system features and can lead to improved predictions. Methods for identifying parameters important to predictions include prediction scaled sensitivities (PSS), which account for uncertainty on individual parameters as well as prediction sensitivity to parameters, and a new "value of improved information" (VOII) method presented here, which includes the effects of parameter correlation in addition to individual parameter uncertainty and prediction sensitivity. In this work, the PSS and VOII methods are demonstrated and evaluated using a model of the Death Valley regional groundwater flow system. The predictions of interest are advective transport paths originating at sites of past underground nuclear testing. Results show that for two paths evaluated the most important parameters include a subset of five or six of the 23 defined model parameters. Some of the parameters identified as most important are associated with flow system attributes that do not lie in the immediate vicinity of the paths. Results also indicate that the PSS and VOII methods can identify different important parameters. Because the methods emphasize somewhat different criteria for parameter importance, it is suggested that parameters identified by both methods be carefully considered in subsequent data collection efforts aimed at improving model predictions.

Transport coefficients for the shear dynamo problem at small Reynolds numbers.

PubMed

Singh, Nishant K; Sridhar, S

2011-05-01

We build on the formulation developed in S. Sridhar and N. K. Singh [J. Fluid Mech. 664, 265 (2010)] and present a theory of the shear dynamo problem for small magnetic and fluid Reynolds numbers, but for arbitrary values of the shear parameter. Specializing to the case of a mean magnetic field that is slowly varying in time, explicit expressions for the transport coefficients α(il) and η(il) are derived. We prove that when the velocity field is nonhelical, the transport coefficient α(il) vanishes. We then consider forced, stochastic dynamics for the incompressible velocity field at low Reynolds number. An exact, explicit solution for the velocity field is derived, and the velocity spectrum tensor is calculated in terms of the Galilean-invariant forcing statistics. We consider forcing statistics that are nonhelical, isotropic, and delta correlated in time, and specialize to the case when the mean field is a function only of the spatial coordinate X(3) and time τ; this reduction is necessary for comparison with the numerical experiments of A. Brandenburg, K. H. Rädler, M. Rheinhardt, and P. J. Käpylä [Astrophys. J. 676, 740 (2008)]. Explicit expressions are derived for all four components of the magnetic diffusivity tensor η(il)(τ). These are used to prove that the shear-current effect cannot be responsible for dynamo action at small Re and Rm, but for all values of the shear parameter. © 2011 American Physical Society

Transport coefficients for the shear dynamo problem at small Reynolds numbers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Nishant K.; Joint Astronomy Programme, Indian Institute of Science, Bangalore 560 012; Sridhar, S.

2011-05-15

We build on the formulation developed in S. Sridhar and N. K. Singh [J. Fluid Mech. 664, 265 (2010)] and present a theory of the shear dynamo problem for small magnetic and fluid Reynolds numbers, but for arbitrary values of the shear parameter. Specializing to the case of a mean magnetic field that is slowly varying in time, explicit expressions for the transport coefficients {alpha}{sub il} and {eta}{sub iml} are derived. We prove that when the velocity field is nonhelical, the transport coefficient {alpha}{sub il} vanishes. We then consider forced, stochastic dynamics for the incompressible velocity field at low Reynoldsmore » number. An exact, explicit solution for the velocity field is derived, and the velocity spectrum tensor is calculated in terms of the Galilean-invariant forcing statistics. We consider forcing statistics that are nonhelical, isotropic, and delta correlated in time, and specialize to the case when the mean field is a function only of the spatial coordinate X{sub 3} and time {tau}; this reduction is necessary for comparison with the numerical experiments of A. Brandenburg, K. H. Raedler, M. Rheinhardt, and P. J. Kaepylae [Astrophys. J. 676, 740 (2008)]. Explicit expressions are derived for all four components of the magnetic diffusivity tensor {eta}{sub ij}({tau}). These are used to prove that the shear-current effect cannot be responsible for dynamo action at small Re and Rm, but for all values of the shear parameter.« less

Quantitative analysis of transverse bacterial migration induced by chemotaxis in a packed column with structured physical heterogeneity.

PubMed

Wang, Meng; Ford, Roseanne M

2010-01-15

A two-dimensional mathematical model was developed to simulate transport phenomena of chemotactic bacteria in a sand-packed column designed with structured physical heterogeneity in the presence of a localized chemical source. In contrast to mathematical models in previous research work, in which bacteria were typically treated as immobile colloids, this model incorporated a convective-like chemotaxis term to represent chemotactic migration. Consistency between experimental observation and model prediction supported the assertions that (1) dispersion-induced microbial transfer between adjacent conductive zones occurred at the interface and had little influence on bacterial transport in the bulk flow of the permeable layers and (2) the enhanced transverse bacterial migration in chemotactic experiments relative to nonchemotactic controls was mainly due to directed migration toward the chemical source zone. On the basis of parameter sensitivity analysis, chemotactic parameters determined in bulk aqueous fluid were adequate to predict the microbial transport in our intermediate-scale porous media system. Additionally, the analysis of adsorption coefficient values supported the observation of a previous study that microbial deposition to the surface of porous media might be decreased under the effect of chemoattractant gradients. By quantitatively describing bacterial transport and distribution in a heterogeneous system, this mathematical model serves to advance our understanding of chemotaxis and motility effects in granular media systems and provides insights for modeling microbial transport in in situ microbial processes.

An initial investigation of multidimensional flow and transverse mixing characteristics of the Ohio River near Cincinnati, Ohio

USGS Publications Warehouse

Holtschlag, David J.

2009-01-01

Two-dimensional hydrodynamic and transport models were applied to a 34-mile reach of the Ohio River from Cincinnati, Ohio, upstream to Meldahl Dam near Neville, Ohio. The hydrodynamic model was based on the generalized finite-element hydrodynamic code RMA2 to simulate depth-averaged velocities and flow depths. The generalized water-quality transport code RMA4 was applied to simulate the transport of vertically mixed, water-soluble constituents that have a density similar to that of water. Boundary conditions for hydrodynamic simulations included water levels at the U.S. Geological Survey water-level gaging station near Cincinnati, Ohio, and flow estimates based on a gate rating at Meldahl Dam. Flows estimated on the basis of the gate rating were adjusted with limited flow-measurement data to more nearly reflect current conditions. An initial calibration of the hydrodynamic model was based on data from acoustic Doppler current profiler surveys and water-level information. These data provided flows, horizontal water velocities, water levels, and flow depths needed to estimate hydrodynamic parameters related to channel resistance to flow and eddy viscosity. Similarly, dye concentration measurements from two dye-injection sites on each side of the river were used to develop initial estimates of transport parameters describing mixing and dye-decay characteristics needed for the transport model. A nonlinear regression-based approach was used to estimate parameters in the hydrodynamic and transport models. Parameters describing channel resistance to flow (Manning’s “n”) were estimated in areas of deep and shallow flows as 0.0234, and 0.0275, respectively. The estimated RMA2 Peclet number, which is used to dynamically compute eddy-viscosity coefficients, was 38.3, which is in the range of 15 to 40 that is typically considered appropriate. Resulting hydrodynamic simulations explained 98.8 percent of the variability in depth-averaged flows, 90.0 percent of the variability in water levels, 93.5 percent of the variability in flow depths, and 92.5 percent of the variability in velocities. Estimates of the water-quality-transport-model parameters describing turbulent mixing characteristics converged to different values for the two dye-injection reaches. For the Big Indian Creek dye-injection study, an RMA4 Peclet number of 37.2 was estimated, which was within the recommended range of 15 to 40, and similar to the RMA2 Peclet number. The estimated dye-decay coefficient was 0.323. Simulated dye concentrations explained 90.2 percent of the variations in measured dye concentrations for the Big Indian Creek injection study. For the dye-injection reach starting downstream from Twelvemile Creek, however, an RMA4 Peclet number of 173 was estimated, which is far outside the recommended range. Simulated dye concentrations were similar to measured concentration distributions at the first four transects downstream from the dye-injection site that were considered vertically mixed. Farther downstream, however, simulated concentrations did not match the attenuation of maximum concentrations or cross-channel transport of dye that were measured. The difficulty of determining a consistent RMA4 Peclet was related to the two-dimension model assumption that velocity distributions are closely approximated by their depth-averaged values. Analysis of velocity data showed significant variations in velocity direction with depth in channel reaches with curvature. Channel irregularities (including curvatures, depth irregularities, and shoreline variations) apparently produce transverse currents that affect the distribution of constituents, but are not fully accounted for in a two-dimensional model. The two-dimensional flow model, using channel resistance to flow parameters of 0.0234 and 0.0275 for deep and shallow areas, respectively, and an RMA2 Peclet number of 38.3, and the RMA4 transport model with a Peclet number of 37.2, may have utility for emergency-planning purposes. Emergency-response efforts would be enhanced by continuous streamgaging records downstream from Meldahl Dam, real-time water-quality monitoring, and three-dimensional modeling. Decay coefficients are constituent specific.

Estimation of π-π Electronic Couplings from Current Measurements.

PubMed

Trasobares, J; Rech, J; Jonckheere, T; Martin, T; Aleveque, O; Levillain, E; Diez-Cabanes, V; Olivier, Y; Cornil, J; Nys, J P; Sivakumarasamy, R; Smaali, K; Leclere, P; Fujiwara, A; Théron, D; Vuillaume, D; Clément, N

2017-05-10

The π-π interactions between organic molecules are among the most important parameters for optimizing the transport and optical properties of organic transistors, light-emitting diodes, and (bio-) molecular devices. Despite substantial theoretical progress, direct experimental measurement of the π-π electronic coupling energy parameter t has remained an old challenge due to molecular structural variability and the large number of parameters that affect the charge transport. Here, we propose a study of π-π interactions from electrochemical and current measurements on a large array of ferrocene-thiolated gold nanocrystals. We confirm the theoretical prediction that t can be assessed from a statistical analysis of current histograms. The extracted value of t ≈35 meV is in the expected range based on our density functional theory analysis. Furthermore, the t distribution is not necessarily Gaussian and could be used as an ultrasensitive technique to assess intermolecular distance fluctuation at the subangström level. The present work establishes a direct bridge between quantum chemistry, electrochemistry, organic electronics, and mesoscopic physics, all of which were used to discuss results and perspectives in a quantitative manner.

Distribution Development for STORM Ingestion Input Parameters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fulton, John

The Sandia-developed Transport of Radioactive Materials (STORM) code suite is used as part of the Radioisotope Power System Launch Safety (RPSLS) program to perform statistical modeling of the consequences due to release of radioactive material given a launch accident. As part of this modeling, STORM samples input parameters from probability distributions with some parameters treated as constants. This report described the work done to convert four of these constant inputs (Consumption Rate, Average Crop Yield, Cropland to Landuse Database Ratio, and Crop Uptake Factor) to sampled values. Consumption rate changed from a constant value of 557.68 kg / yr tomore » a normal distribution with a mean of 102.96 kg / yr and a standard deviation of 2.65 kg / yr. Meanwhile, Average Crop Yield changed from a constant value of 3.783 kg edible / m 2 to a normal distribution with a mean of 3.23 kg edible / m 2 and a standard deviation of 0.442 kg edible / m 2 . The Cropland to Landuse Database ratio changed from a constant value of 0.0996 (9.96%) to a normal distribution with a mean value of 0.0312 (3.12%) and a standard deviation of 0.00292 (0.29%). Finally the crop uptake factor changed from a constant value of 6.37e -4 (Bq crop /kg)/(Bq soil /kg) to a lognormal distribution with a geometric mean value of 3.38e -4 (Bq crop /kg)/(Bq soil /kg) and a standard deviation value of 3.33 (Bq crop /kg)/(Bq soil /kg)« less

EVALUATING THE SENSITIVITY OF A SUBSURFACE MULTICOMPONENT REACTIVE TRANSPORT MODEL WITH RESPECT TO TRANSPORT AND REACTION PARAMETERS

EPA Science Inventory

The input variables for a numerical model of reactive solute transport in groundwater include both transport parameters, such as hydraulic conductivity and infiltration, and reaction parameters that describe the important chemical and biological processes in the system. These pa...

Optimization of GATE and PHITS Monte Carlo code parameters for uniform scanning proton beam based on simulation with FLUKA general-purpose code

NASA Astrophysics Data System (ADS)

Kurosu, Keita; Takashina, Masaaki; Koizumi, Masahiko; Das, Indra J.; Moskvin, Vadim P.

2014-10-01

Although three general-purpose Monte Carlo (MC) simulation tools: Geant4, FLUKA and PHITS have been used extensively, differences in calculation results have been reported. The major causes are the implementation of the physical model, preset value of the ionization potential or definition of the maximum step size. In order to achieve artifact free MC simulation, an optimized parameters list for each simulation system is required. Several authors have already proposed the optimized lists, but those studies were performed with a simple system such as only a water phantom. Since particle beams have a transport, interaction and electromagnetic processes during beam delivery, establishment of an optimized parameters-list for whole beam delivery system is therefore of major importance. The purpose of this study was to determine the optimized parameters list for GATE and PHITS using proton treatment nozzle computational model. The simulation was performed with the broad scanning proton beam. The influences of the customizing parameters on the percentage depth dose (PDD) profile and the proton range were investigated by comparison with the result of FLUKA, and then the optimal parameters were determined. The PDD profile and the proton range obtained from our optimized parameters list showed different characteristics from the results obtained with simple system. This led to the conclusion that the physical model, particle transport mechanics and different geometry-based descriptions need accurate customization in planning computational experiments for artifact-free MC simulation.

Heat transport in Rayleigh-Bénard convection and angular momentum transport in Taylor-Couette flow: a comparative study.

PubMed

Brauckmann, Hannes J; Eckhardt, Bruno; Schumacher, Jörg

2017-03-13

Rayleigh-Bénard convection and Taylor-Couette flow are two canonical flows that have many properties in common. We here compare the two flows in detail for parameter values where the Nusselt numbers, i.e. the thermal transport and the angular momentum transport normalized by the corresponding laminar values, coincide. We study turbulent Rayleigh-Bénard convection in air at Rayleigh number Ra=10 7 and Taylor-Couette flow at shear Reynolds number Re S =2×10 4 for two different mean rotation rates but the same Nusselt numbers. For individual pairwise related fields and convective currents, we compare the probability density functions normalized by the corresponding root mean square values and taken at different distances from the wall. We find one rotation number for which there is very good agreement between the mean profiles of the two corresponding quantities temperature and angular momentum. Similarly, there is good agreement between the fluctuations in temperature and velocity components. For the heat and angular momentum currents, there are differences in the fluctuations outside the boundary layers that increase with overall rotation and can be related to differences in the flow structures in the boundary layer and in the bulk. The study extends the similarities between the two flows from global quantities to local quantities and reveals the effects of rotation on the transport.This article is part of the themed issue 'Toward the development of high-fidelity models of wall turbulence at large Reynolds number'. © 2017 The Author(s).

Sorption, degradation and transport phenomena of alcohol ethoxysulfates in agricultural soils. Laboratory studies.

PubMed

Fernández-Ramos, C; Rodríguez-Gómez, R; Reis, M S; Zafra-Gómez, A; Verge, C; de Ferrer, J A; Pérez-Pascual, M; Vílchez, J L

2017-03-01

In the present work, laboratory studies were conducted in order to determine and model the sorption, degradation and transport processes of alcohol ethoxysulfates (AES), one of the most important groups of anionic surfactants. Adsorption/desorption isotherms were obtained for several structurally related AES ethoxymers (homologue AES-C 12 E n with n = 0-10 ethoxymer units and homologue AES-C 14 E n with n = 0-7 ethoxymer units) using a batch equilibrium method. Data were fitted to a linear and a Freundlich isotherm models. Additionally, experiments in continuous-flow soil columns were also carried out and the breakthrough curves observed for each compound were studied. Breakthrough curves were used to determine the fundamental parameters of the transport model (hydrodynamic dispersion coefficient, degradation rate constant and adsorption/desorption isotherm slope), that is the main phenomena that take place simultaneously when AES move through agricultural soil. When the results obtained for the AES ethoxymers are combined, they reveal a clear and consistent trend towards a sorption increase with the number of ethoxylated units and with the length of the alkyl chain that opens the possibility to estimate the values of the transport parameters for other structurally related ethoxymers. Copyright © 2016 Elsevier Ltd. All rights reserved.

Using a derivative-free optimization method for multiple solutions of inverse transport problems

DOE PAGES

Armstrong, Jerawan C.; Favorite, Jeffrey A.

2016-01-14

Identifying unknown components of an object that emits radiation is an important problem for national and global security. Radiation signatures measured from an object of interest can be used to infer object parameter values that are not known. This problem is called an inverse transport problem. An inverse transport problem may have multiple solutions and the most widely used approach for its solution is an iterative optimization method. This paper proposes a stochastic derivative-free global optimization algorithm to find multiple solutions of inverse transport problems. The algorithm is an extension of a multilevel single linkage (MLSL) method where a meshmore » adaptive direct search (MADS) algorithm is incorporated into the local phase. Furthermore, numerical test cases using uncollided fluxes of discrete gamma-ray lines are presented to show the performance of this new algorithm.« less

Buses of Cuernavaca—an agent-based model for universal random matrix behavior minimizing mutual information

NASA Astrophysics Data System (ADS)

Warchoł, Piotr

2018-06-01

The public transportation system of Cuernavaca, Mexico, exhibits random matrix theory statistics. In particular, the fluctuation of times between the arrival of buses on a given bus stop, follows the Wigner surmise for the Gaussian unitary ensemble. To model this, we propose an agent-based approach in which each bus driver tries to optimize his arrival time to the next stop with respect to an estimated arrival time of his predecessor. We choose a particular form of the associated utility function and recover the appropriate distribution in numerical experiments for a certain value of the only parameter of the model. We then investigate whether this value of the parameter is otherwise distinguished within an information theoretic approach and give numerical evidence that indeed it is associated with a minimum of averaged pairwise mutual information.

Modeling motor vehicle crashes using Poisson-gamma models: examining the effects of low sample mean values and small sample size on the estimation of the fixed dispersion parameter.

PubMed

Lord, Dominique

2006-07-01

There has been considerable research conducted on the development of statistical models for predicting crashes on highway facilities. Despite numerous advancements made for improving the estimation tools of statistical models, the most common probabilistic structure used for modeling motor vehicle crashes remains the traditional Poisson and Poisson-gamma (or Negative Binomial) distribution; when crash data exhibit over-dispersion, the Poisson-gamma model is usually the model of choice most favored by transportation safety modelers. Crash data collected for safety studies often have the unusual attributes of being characterized by low sample mean values. Studies have shown that the goodness-of-fit of statistical models produced from such datasets can be significantly affected. This issue has been defined as the "low mean problem" (LMP). Despite recent developments on methods to circumvent the LMP and test the goodness-of-fit of models developed using such datasets, no work has so far examined how the LMP affects the fixed dispersion parameter of Poisson-gamma models used for modeling motor vehicle crashes. The dispersion parameter plays an important role in many types of safety studies and should, therefore, be reliably estimated. The primary objective of this research project was to verify whether the LMP affects the estimation of the dispersion parameter and, if it is, to determine the magnitude of the problem. The secondary objective consisted of determining the effects of an unreliably estimated dispersion parameter on common analyses performed in highway safety studies. To accomplish the objectives of the study, a series of Poisson-gamma distributions were simulated using different values describing the mean, the dispersion parameter, and the sample size. Three estimators commonly used by transportation safety modelers for estimating the dispersion parameter of Poisson-gamma models were evaluated: the method of moments, the weighted regression, and the maximum likelihood method. In an attempt to complement the outcome of the simulation study, Poisson-gamma models were fitted to crash data collected in Toronto, Ont. characterized by a low sample mean and small sample size. The study shows that a low sample mean combined with a small sample size can seriously affect the estimation of the dispersion parameter, no matter which estimator is used within the estimation process. The probability the dispersion parameter becomes unreliably estimated increases significantly as the sample mean and sample size decrease. Consequently, the results show that an unreliably estimated dispersion parameter can significantly undermine empirical Bayes (EB) estimates as well as the estimation of confidence intervals for the gamma mean and predicted response. The paper ends with recommendations about minimizing the likelihood of producing Poisson-gamma models with an unreliable dispersion parameter for modeling motor vehicle crashes.

Attempt to model laboratory-scale diffusion and retardation data.

PubMed

Hölttä, P; Siitari-Kauppi, M; Hakanen, M; Tukiainen, V

2001-02-01

Different approaches for measuring the interaction between radionuclides and rock matrix are needed to test the compatibility of experimental retardation parameters and transport models used in assessing the safety of the underground repositories for the spent nuclear fuel. In this work, the retardation of sodium, calcium and strontium was studied on mica gneiss, unaltered, moderately altered and strongly altered tonalite using dynamic fracture column method. In-diffusion of calcium into rock cubes was determined to predict retardation in columns. In-diffusion of calcium into moderately and strongly altered tonalite was interpreted using a numerical code FTRANS. The code was able to interprete in-diffusion of weakly sorbing calcium into the saturated porous matrix. Elution curves of calcium for the moderately and strongly altered tonalite fracture columns were explained adequately using FTRANS code and parameters obtained from in-diffusion calculations. In this paper, mass distribution ratio values of sodium, calcium and strontium for intact rock are compared to values, previously obtained for crushed rock from batch and crushed rock column experiments. Kd values obtained from fracture column experiments were one order of magnitude lower than Kd values from batch experiments.

Computational Study of Anomalous Transport in High Beta DIII-D Discharges with ITBs

NASA Astrophysics Data System (ADS)

Pankin, Alexei; Garofalo, Andrea; Grierson, Brian; Kritz, Arnold; Rafiq, Tariq

2015-11-01

The advanced tokamak scenarios require a large bootstrap current fraction and high β. These large values are often outside the range that occurs in ``conventional'' tokamak discharges. The GLF23, TGLF, and MMM transport models have been previously validated for discharges with parameters associated with ``conventional'' tokamak discharges. It has been demonstrated that the TGLF model under-predicts anomalous transport in high β DIII-D discharges [A.M. Garofalo et al. 2015 TTF Workshop]. In this research, the validity of MMM7.1 model [T. Rafiq et al. Phys. Plasmas 20 032506 (2013)] is tested for high β DIII-D discharges with low and high torque. In addition, the sensitivity of the anomalous transport to β is examined. It is shown that the MMM7.1 model over-predicts the anomalous transport in the DIII-D discharge 154406. In particular, a significant level of anomalous transport is found just outside the internal transport barrier. Differences in the anomalous transport predicted using TGLF and MMM7.1 are reviewed. Mechanisms for quenching of anomalous transport in the ITB regions of high-beta discharges are investigated. This research is supported by US Department of Energy.

Effective pollutant emission heights for atmospheric transport modelling based on real-world information.

PubMed

Pregger, Thomas; Friedrich, Rainer

2009-02-01

Emission data needed as input for the operation of atmospheric models should not only be spatially and temporally resolved. Another important feature is the effective emission height which significantly influences modelled concentration values. Unfortunately this information, which is especially relevant for large point sources, is usually not available and simple assumptions are often used in atmospheric models. As a contribution to improve knowledge on emission heights this paper provides typical default values for the driving parameters stack height and flue gas temperature, velocity and flow rate for different industrial sources. The results were derived from an analysis of the probably most comprehensive database of real-world stack information existing in Europe based on German industrial data. A bottom-up calculation of effective emission heights applying equations used for Gaussian dispersion models shows significant differences depending on source and air pollutant and compared to approaches currently used for atmospheric transport modelling.

A Computational Framework for Identifiability and Ill-Conditioning Analysis of Lithium-Ion Battery Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

López C, Diana C.; Wozny, Günter; Flores-Tlacuahuac, Antonio

2016-03-23

The lack of informative experimental data and the complexity of first-principles battery models make the recovery of kinetic, transport, and thermodynamic parameters complicated. We present a computational framework that combines sensitivity, singular value, and Monte Carlo analysis to explore how different sources of experimental data affect parameter structural ill conditioning and identifiability. Our study is conducted on a modified version of the Doyle-Fuller-Newman model. We demonstrate that the use of voltage discharge curves only enables the identification of a small parameter subset, regardless of the number of experiments considered. Furthermore, we show that the inclusion of a single electrolyte concentrationmore » measurement significantly aids identifiability and mitigates ill-conditioning.« less

Effect of X-ray Line Spectra Profile Fitting with Pearson VII, Pseudo-Voigt and Generalized Fermi Functions on Asphalt Binder Aromaticity and Crystallite Parameters

NASA Astrophysics Data System (ADS)

Gebresellasie, K.; Shirokoff, J.; Lewis, J. C.

2012-12-01

X-ray line spectra profile fitting using Pearson VII, pseudo-Voigt and generalized Fermi functions was performed on asphalt binders prior to the calculation of aromaticity and crystallite size parameters. The effects of these functions on the results are presented and discussed in terms of the peak profile fit parameters, the uncertainties in calculated values that can arise owing to peak shape, peak features in the pattern and crystallite size according to the asphalt models (Yen, modified Yen or Yen-Mullins) and theories. Interpretation of these results is important in terms of evaluating the performance of asphalt binders widely used in the application of transportation systems (roads, highways, airports).

Kinetic modeling of ion conduction in KcsA potassium channel.

PubMed

Mafé, Salvador; Pellicer, Julio; Cervera, Javier

2005-05-22

KcsA constitutes a potassium channel of known structure that shows both high conduction rates and selectivity among monovalent cations. A kinetic model for ion conduction through this channel that assumes rapid ion transport within the filter has recently been presented by Nelson. In a recent, brief communication, we used the model to provide preliminary explanations to the experimental current-voltage J-V and conductance-concentration g-S curves obtained for a series of monovalent ions (K(+),Tl(+), and Rb(+)). We did not assume rapid ion transport in the calculations, since ion transport within the selectivity filter could be rate limiting for ions other than native K(+). This previous work is now significantly extended to the following experimental problems. First, the outward rectification of the J-V curves in K(+) symmetrical solutions is analyzed using a generalized kinetic model. Second, the J-V and g-S curves for NH(4) (+) are obtained and compared with those of other ions (the NH(4) (+) J-V curve is qualitatively different from those of Rb(+) and Tl(+)). Third, the effects of Na(+) block on K(+) and Rb(+) currents through single KcsA channels are studied and the different blocking behavior is related to the values of the translocation rate constants characteristic of ion transport within the filter. Finally, the significantly decreased K(+) conductance caused by mutation of the wild-type channel is also explained in terms of this rate constant. In order to keep the number of model parameters to a minimum, we do not allow the electrical distance (an empirical parameter of kinetic models that controls the exponential voltage dependence of the dissociation rate) to vary with the ionic species. Without introducing the relatively high number of adjustable parameters of more comprehensive site-based models, we show that ion association to the filter is rate controlling at low concentrations, but ion dissociation from the filter and ion transport within the filter could limit conduction at high concentration. Although some experimental data from other authors were included to allow qualitative comparison with model calculations, the absolute values of the effective rate constants obtained are only tentative. However, the relative changes in these constants needed to explain qualitatively the experiments should be of significance.

Sensitivity Analysis of Genetic Algorithm Parameters for Optimal Groundwater Monitoring Network Design

NASA Astrophysics Data System (ADS)

Abdeh-Kolahchi, A.; Satish, M.; Datta, B.

2004-05-01

A state art groundwater monitoring network design is introduced. The method combines groundwater flow and transport results with optimization Genetic Algorithm (GA) to identify optimal monitoring well locations. Optimization theory uses different techniques to find a set of parameter values that minimize or maximize objective functions. The suggested groundwater optimal monitoring network design is based on the objective of maximizing the probability of tracking a transient contamination plume by determining sequential monitoring locations. The MODFLOW and MT3DMS models included as separate modules within the Groundwater Modeling System (GMS) are used to develop three dimensional groundwater flow and contamination transport simulation. The groundwater flow and contamination simulation results are introduced as input to the optimization model, using Genetic Algorithm (GA) to identify the groundwater optimal monitoring network design, based on several candidate monitoring locations. The groundwater monitoring network design model is used Genetic Algorithms with binary variables representing potential monitoring location. As the number of decision variables and constraints increase, the non-linearity of the objective function also increases which make difficulty to obtain optimal solutions. The genetic algorithm is an evolutionary global optimization technique, which is capable of finding the optimal solution for many complex problems. In this study, the GA approach capable of finding the global optimal solution to a groundwater monitoring network design problem involving 18.4X 1018 feasible solutions will be discussed. However, to ensure the efficiency of the solution process and global optimality of the solution obtained using GA, it is necessary that appropriate GA parameter values be specified. The sensitivity analysis of genetic algorithms parameters such as random number, crossover probability, mutation probability, and elitism are discussed for solution of monitoring network design.

Airline Transport Pilot Preferences for Predictive Information

NASA Technical Reports Server (NTRS)

Trujillo, Anna C.

1996-01-01

This experiment assessed certain issues about the usefulness of predictive information: (1) the relative time criticality of failures, (2) the subjective utility of predictive information for different parameters or sensors, and (3) the preferred form and prediction time for displaying predictive information. To address these issues, three separate tasks were administered to 22 airline pilots. As shown by the data, these pilots preferred predictive information on parameters they considered vital to the safety of the flight. These parameters were related to the checklists performed first for alert messages. These pilots also preferred to know whether a parameter was changing abnormally and the time to a certain value being reached. Furthermore, they considered this information most useful during the cruise, the climb, and the descent phases of flight. Lastly, these pilots preferred the information to predict as far ahead as possible.

Modeling the movement of a pH perturbation and its impact on adsorbed zinc and phosphate in a wastewater‐contaminated aquifer

USGS Publications Warehouse

Kent, D.B.; Wilkie, J.A.; Davis, J.A.

2007-01-01

Chemical conditions were perturbed in an aquifer with an ambient pH of 5.9 and wastewater‐derived adsorbed zinc (Zn) and phosphate (P) contamination by injecting a pulse of amended groundwater. The injected groundwater had low concentrations of dissolved Zn and P, a pH value of 4.5 resulting from equilibration with carbon dioxide gas, and added potassium bromide (KBr). Downgradient of the injection, breakthrough of nonreactive Br and total dissolved carbonate concentrations in excess of ambient values (excess TCO2) were accompanied by a decrease in pH values and over twentyfold increases in dissolved Zn concentrations above preinjection values. Peak concentrations of Br and excess TCO2 were followed by slow increases in pH values accompanied by significant increases in dissolved P above preinjection concentrations. The injected tracers mobilized a significant mass of wastewater‐derived Zn. Reactive transport simulations incorporating surface complexation models for adsorption of Zn, P, hydrogen ions, and major cations onto the aquifer sediments, calibrated using laboratory experimental data, captured most of the important trends observed during the experiment. These include increases in Zn concentrations in response to the pH perturbation, perturbations in major cation concentrations, attenuation of the pH perturbation with transport distance, and increases in alkalinity with transport distance. Observed desorption of P in response to chemical perturbations was not predicted, possibly because of a disparity between the range of chemical conditions in the calibration data set and those encountered during the field experiment. Zinc and P desorbed rapidly in response to changing chemical conditions despite decades of contact with the sediments. Surface complexation models with relatively few parameters in the form of logK values and site concentrations show considerable promise for describing the influence of variable chemistry on the transport of adsorbing contaminants.

Resonant tunneling with high peak to valley current ratio in SiO{sub 2}/nc-Si/SiO{sub 2} multi-layers at room temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, D. Y., E-mail: cdy7659@126.com; Nanjing University of posts and Telecommunications, Nanjing 210046; Sun, Y.

We have investigated carrier transport in SiO{sub 2}/nc-Si/SiO{sub 2} multi-layers by room temperature current-voltage measurements. Resonant tunneling signatures accompanied by current peaks are observed. Carrier transport in the multi-layers were analyzed by plots of ln(I/V{sup 2}) as a function of 1/V and ln(I) as a function of V{sup 1/2}. Results suggest that besides films quality, nc-Si and barrier sub-layer thicknesses are important parameters that restrict carrier transport. When thicknesses are both small, direct tunneling dominates carrier transport, resonant tunneling occurs only at certain voltages and multi-resonant tunneling related current peaks can be observed but with peak to valley current ratiomore » (PVCR) values smaller than 1.5. When barrier thickness is increased, trap-related and even high field related tunneling is excited, causing that multi-current peaks cannot be observed clearly, only one current peak with higher PVCR value of 7.7 can be observed. While if the thickness of nc-Si is large enough, quantum confinement is not so strong, a broad current peak with PVCR value as high as 60 can be measured, which may be due to small energy difference between the splitting energy levels in the quantum dots of nc-Si. Size distribution in a wide range may cause un-controllability of the peak voltages.« less

Silicon quantum dots embedded in a SiO2 matrix: From structural study to carrier transport properties

NASA Astrophysics Data System (ADS)

Garcia-Castello, Nuria; Illera, Sergio; Guerra, Roberto; Prades, Joan Daniel; Ossicini, Stefano; Cirera, Albert

2013-08-01

We study the details of electronic transport related to the atomistic structure of silicon quantum dots embedded in a silicon dioxide matrix using ab initio calculations of the density of states. Several structural and composition features of quantum dots (QDs), such as diameter and amorphization level, are studied and correlated with transport under transfer Hamiltonian formalism. The current is strongly dependent on the QD density of states and on the conduction gap, both dependent on the dot diameter. In particular, as size increases, the available states inside the QD increase, while the QD band gap decreases due to relaxation of quantum confinement. Both effects contribute to increasing the current with the dot size. Besides, valence band offset between the band edges of the QD and the silica, and conduction band offset in a minor grade, increases with the QD diameter up to the theoretical value corresponding to planar heterostructures, thus decreasing the tunneling transmission probability and hence the total current. We discuss the influence of these parameters on electron and hole transport, evidencing a correlation between the electron (hole) barrier value and the electron (hole) current, and obtaining a general enhancement of the electron (hole) transport for larger (smaller) QD. Finally, we show that crystalline and amorphous structures exhibit enhanced probability of hole and electron current, respectively.

Trans-Pacific transport and evolution of aerosols and trace gases from Asia during the INTEX-B field campaign

NASA Astrophysics Data System (ADS)

Adhikary, B.; Carmichael, G. R.; Kulkarni, S.; Wei, C.; Tang, Y.; Dallura, A.; Mena-Carrasco, M.; Streets, D. G.; Zhang, Q.; Pierce, R. B.; Al-Saadi, J. A.; Emmons, L. K.; Pfister, G. G.; Avery, M. A.; Barrick, J. D.; Blake, D. R.; Brune, W. H.; Cohen, R. C.; Dibb, J. E.; Fried, A.; Heikes, B. G.; Huey, L. G.; O'Sullivan, D. W.; Sachse, G. W.; Shetter, R. E.; Singh, H. B.; Campos, T. L.; Cantrell, C. A.; Flocke, F. M.; Dunlea, E. J.; Jimenez, J. L.; Weinheimer, A. J.; Crounse, J. D.; Wennberg, P. O.; Schauer, J. J.; Stone, E. A.; Jaffe, D. A.; Reidmiller, D. R.

2009-08-01

The Sulfur Transport and dEposition Model (STEM) developed at the University of Iowa is applied to the analysis of observations obtained during the Intercontinental Chemical Transport Experiment-Phase B (INTEX-B), conducted over the Pacific Ocean during the 2006 North American spring season. This paper reports on the model performance of meteorological parameters, trace gases, aerosols and photolysis rate (J-values) predictions with the NASA DC-8 and NSF/NCAR C-130 airborne measurements along with observations from three surface sites Mt. Bachelor, Trinidad Head and Kathmandu, Nepal. In general the model shows appreciable skill in predicting many of the important aspects of the observed distributions. The major meteorological parameters driving long range transport are accurately predicted by the WRF simulations used in this study. Furthermore, the STEM model predicts aerosols and trace gases concentrations within a standard deviation of most of the observed mean values. The results also point towards areas where model improvements are needed; e.g., the STEM model underestimates CO (15% for the DC8 and 6% for the C-130), whereas it overpredicts PAN (by a factor of two for both aircraft). The errors in the model calculations are attributed to uncertainty in emissions estimates and uncertainty in the top and lateral boundary conditions. Results from a series of sensitivity simulations examining the impact of the growth of emissions in Asia from 2000 to 2006, the importance of biomass burning, the effect of using boundary conditions from different global models, and the role of heterogeneous chemistry on the predictions are also presented. The impacts of heterogeneous reactions at specific times during dust transport episodes can be significant, and in the presence of dust both sulfate and nitrate aerosol production is increased and gas phase nitric acid levels are reduced appreciably (~50%). The aging of the air masses during the long range transport over the Pacific and the impact of various sources (source regions as well as energy and biomass burning) on targeted observations are analyzed using back-trajectories and tagged CO-tracer analysis.

Full-scale demonstration of in situ cometabolic biodegradation of trichloroethylene in groundwater 2. Comprehensive analysis of field data using reactive transport modeling

NASA Astrophysics Data System (ADS)

Gandhi, Rahul K.; Hopkins, Gary D.; Goltz, Mark N.; Gorelick, Steven M.; McCarty, Perry L.

2002-04-01

We present an analysis of an extensively monitored full-scale field demonstration of in situ treatment of trichloroethylene (TCE) contamination by aerobic cometabolic biodegradation. The demonstration was conducted at Edwards Air Force Base in southern California. There are two TCE-contaminated aquifers at the site, separated from one another by a clay aquitard. The treatment system consisted of two recirculating wells located 10 m apart. Each well was screened in both of the contaminated aquifers. Toluene, oxygen, and hydrogen peroxide were added to the water in both wells. At one well, water was pumped from the upper aquifer to the lower aquifer. In the other well, pumping was from the lower to the upper aquifer. This resulted in a ``conveyor belt'' flow system with recirculation between the two aquifers. The treatment system was successfully operated for a 410 day period. We explore how well a finite element reactive transport model can describe the key processes in an engineered field system. Our model simulates TCE, toluene, oxygen, hydrogen peroxide, and microbial growth/death. Simulated processes include advective-dispersive transport, biodegradation, the inhibitory effect of hydrogen peroxide on biomass growth, and oxygen degassing. Several parameter values were fixed to laboratory values or values from previous modeling studies. The remaining six parameter values were obtained by calibrating the model to 7213 TCE concentration data and 6997 dissolved oxygen concentration data collected during the demonstration using a simulation-regression procedure. In this complex flow field involving reactive transport, TCE and dissolved oxygen concentration histories are matched very well by the calibrated model. Both simulated and observed toluene concentrations display similar high-frequency oscillations due to pulsed toluene injection approximately one half hour during each 8 hour period. Simulation results indicate that over the course of the demonstration, 6.9 kg of TCE was degraded and that in the upper aquifer a region 40 m wide extending 25 m down gradient of the treatment system was cleaned up to less than 100 μg L-1 from initial concentrations of approximately 700 μg L-1. A smaller region was cleaned up to less than 30 μg L-1. Simulations indicate that the cleaned up area in the upper aquifer would continue to expand for as long as treatment was continued.

The S factor--a new derived hemodynamic oxygenation parameter--a useful tool for simplified mathematical modeling of global problems of oxygen transport.

PubMed

Farrell, K; Wasser, T

1997-01-01

We describe a new derived hemodynamic oxygenation parameter, the S factor (S). The factor is based on oxygen delivery and oxygen consumption and can range from -3 to 1. It allows simplified mathematical modeling of clinical problems of oxygen transport and can be applied to many clinical situations. A new hemodynamic oxygenation parameter, the S factor (S), is introduced as an aid to mathematical modeling. It is defined as follows: [formula: see text] (DO2 = oxygen delivery, VO2 = oxygen consumption) S can theoretically vary from -3 (DO2 = VO2) to +1 (VO2 = 0). When DO2/VO2 = 4 (ie. OER = 0.25), S = 0. An S < 0 implies utilization of reserve oxygen transport capacity. An S > 0 implies increased oxygen delivery in relation to oxygen consumption (ie. "shunted oxygen delivery"). By algebraic manipulation and substitution of the components of DO2 into Equation 1: DO2 = Q x Ca x 10 DO2 = Q [(Hb)(Sat)(1.36) + PaO2(.0031)] 10 (2) the following equations can be derived: [formula: see text] [formula: see text] Ca - Cv (Ca = arterial content, Cv = venous content) can be determined by substituting components of oxygen consumption: VO2 = Q (Ca - Cv) x 10 (5) into equation 1 and solving for Ca - Cv. [formula: see text] Equation 6 can be simplified to: [formula: see text] A previously defined relationship between mixed venous PO2 (PvO2) and DO2/VO2 (where calculated P50 is 26.6 +/- 1.0) can be used to modify S in a clinically relevant manner. PvO2 = 5.44D O2/VO2 + 18.16 (8) The relationship between S and PvO2 can be defined by substituting Equation 4 into Equation 1 and solving for PvO2 PvO2 = [21.76/(1-S)] + 18.16 (9) As an example, at a PvO2 of 28 torr (anaerobic threshold), S = -1.2. The relationship between PvO2 and S is shown in Figure 1. S, which can also be defined as 1-4(VO2/DO2) or 1-4(OER), is a useful tool for mathematical modeling of global problems of oxygen transport because the previously derived equations with the S value allow the components of oxygen transport to be interrelated in a clinically relevant manner. Additional advantages of using S in mathematical modeling are: 1. Conceptually it 'fits' in that in regards to the sign (+ or -), as a -S implies utilization of reserve oxygen transport capacity and a +S implies wasted or excess oxygen delivery (shunted). 2. These concepts are easily quantified using the S factor. 3. It 'spreads out' the difference between values for parameters (OER or S) integrating components of oxygen transport, ie. in the 'normal state' regarding oxygen transport, OER = 0.25 and S = 0. At the anaerobic threshold (PvO2 = 28 torr), OER = 0.55 and S = -1.2. Thus, the change in OER from 'normal state' to anaerobic threshold is 0.3 (0.55-0.25) and the change in S is 1.2. This represents a four-fold increase. Four examples of mathematical modeling of global problems of oxygen transport using the S factor are described below.

Analytical Solution for Reactive Solute Transport Considering Incomplete Mixing

NASA Astrophysics Data System (ADS)

Bellin, A.; Chiogna, G.

2013-12-01

The laboratory experiments of Gramling et al. (2002) showed that incomplete mixing at the pore scale exerts a significant impact on transport of reactive solutes and that assuming complete mixing leads to overestimation of product concentration in bimolecular reactions. We consider here the family of equilibrium reactions for which the concentration of the reactants and the product can be expressed as a function of the mixing ratio, the concentration of a fictitious non reactive solute. For this type of reactions we propose, in agreement with previous studies, to model the effect of incomplete mixing at scales smaller than the Darcy scale assuming that the mixing ratio is distributed within an REV according to a Beta distribution. We compute the parameters of the Beta model by imposing that the mean concentration is equal to the value that the concentration assumes at the continuum Darcy scale, while the variance decays with time as a power law. We show that our model reproduces the concentration profiles of the reaction product measured in the Gramling et al. (2002) experiments using the transport parameters obtained from conservative experiments and an instantaneous reaction kinetic. The results are obtained applying analytical solutions both for conservative and for reactive solute transport, thereby providing a method to handle the effect of incomplete mixing on multispecies reactive solute transport, which is simpler than other previously developed methods. Gramling, C. M., C. F. Harvey, and L. C. Meigs (2002), Reactive transport in porous media: A comparison of model prediction with laboratory visualization, Environ. Sci. Technol., 36(11), 2508-2514.

TURTLE with MAD input (Trace Unlimited Rays Through Lumped Elements) -- A computer program for simulating charged particle beam transport systems and DECAY TURTLE including decay calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carey, D.C.

1999-12-09

TURTLE is a computer program useful for determining many characteristics of a particle beam once an initial design has been achieved, Charged particle beams are usually designed by adjusting various beam line parameters to obtain desired values of certain elements of a transfer or beam matrix. Such beam line parameters may describe certain magnetic fields and their gradients, lengths and shapes of magnets, spacings between magnetic elements, or the initial beam accepted into the system. For such purposes one typically employs a matrix multiplication and fitting program such as TRANSPORT. TURTLE is designed to be used after TRANSPORT. For conveniencemore » of the user, the input formats of the two programs have been made compatible. The use of TURTLE should be restricted to beams with small phase space. The lumped element approximation, described below, precludes the inclusion of the effect of conventional local geometric aberrations (due to large phase space) or fourth and higher order. A reading of the discussion below will indicate clearly the exact uses and limitations of the approach taken in TURTLE.« less

Investigation of self-organized criticality behavior of edge plasma transport in Torus experiment of technology oriented research

NASA Astrophysics Data System (ADS)

Xu, Y. H.; Jachmich, S.; Weynants, R. R.; Huber, A.; Unterberg, B.; Samm, U.

2004-12-01

The self-organized criticality (SOC) behavior of the edge plasma transport has been studied using fluctuation data measured in the plasma edge and the scrape-off layer of Torus experiment of technology oriented research tokamak [H. Soltwisch et al., Plasma Phys. Controlled Fusion 26, 23 (1984)] before and during the edge biasing experiments. In the "nonshear" discharge phase before biasing, the fluctuation data clearly show some of the characteristics associated with SOC, including similar frequency spectra to those obtained in "sandpile" transport and other SOC systems, slowly decaying long tails in the autocorrelation function, values of Hurst parameters larger than 0.5 at all the detected radial locations, and a radial propagation of avalanchelike events in the edge plasma area. During the edge biasing phase, with the generation of an edge radial electric field Er and thus of Er×B flow shear, contrary to theoretical expectation, the Hurst parameters are substantially enhanced in the negative flow shear region and in the scrape-off layer as well. Concomitantly, it is found that the local turbulence is well decorrelated by the Er×B velocity shear, consistent with theoretical predictions.

Oxygen consumption by bovine granulosa cells with prediction of oxygen transport in preantral follicles.

PubMed

Li, Dongxing; Redding, Gabe P; Bronlund, John E

2013-01-01

The rate of oxygen consumption by granulosa cells is a key parameter in mathematical models that describe oxygen transport across ovarian follicles. This work measured the oxygen consumption rate of bovine granulosa cells in vitro to be in the range 2.1-3.3×10⁻¹⁶ mol cell⁻¹ s⁻¹ (0.16-0.25 mol m⁻³ s⁻¹). The implications of the rates for oxygen transport in large bovine preantral follicles were examined using a mathematical model. The results indicate that oocyte oxygenation becomes increasingly constrained as preantral follicles grow, reaching hypoxic levels near the point of antrum formation. Beyond a preantral follicle radius of 134 µm, oxygen cannot reach the oocyte surface at typical values of model parameters. Since reported sizes of large bovine preantral follicles range from 58 to 145 µm in radius, this suggests that oocyte oxygenation is possible in all but the largest preantral follicles, which are on the verge of antrum formation. In preantral bovine follicles, the oxygen consumption rate of granulosa cells and fluid voidage will be the key determinants of oxygen levels across the follicle.

Inverse problem to constrain the controlling parameters of large-scale heat transport processes: The Tiberias Basin example

NASA Astrophysics Data System (ADS)

Goretzki, Nora; Inbar, Nimrod; Siebert, Christian; Möller, Peter; Rosenthal, Eliyahu; Schneider, Michael; Magri, Fabien

2015-04-01

Salty and thermal springs exist along the lakeshore of the Sea of Galilee, which covers most of the Tiberias Basin (TB) in the northern Jordan- Dead Sea Transform, Israel/Jordan. As it is the only freshwater reservoir of the entire area, it is important to study the salinisation processes that pollute the lake. Simulations of thermohaline flow along a 35 km NW-SE profile show that meteoric and relic brines are flushed by the regional flow from the surrounding heights and thermally induced groundwater flow within the faults (Magri et al., 2015). Several model runs with trial and error were necessary to calibrate the hydraulic conductivity of both faults and major aquifers in order to fit temperature logs and spring salinity. It turned out that the hydraulic conductivity of the faults ranges between 30 and 140 m/yr whereas the hydraulic conductivity of the Upper Cenomanian aquifer is as high as 200 m/yr. However, large-scale transport processes are also dependent on other physical parameters such as thermal conductivity, porosity and fluid thermal expansion coefficient, which are hardly known. Here, inverse problems (IP) are solved along the NW-SE profile to better constrain the physical parameters (a) hydraulic conductivity, (b) thermal conductivity and (c) thermal expansion coefficient. The PEST code (Doherty, 2010) is applied via the graphical interface FePEST in FEFLOW (Diersch, 2014). The results show that both thermal and hydraulic conductivity are consistent with the values determined with the trial and error calibrations. Besides being an automatic approach that speeds up the calibration process, the IP allows to cover a wide range of parameter values, providing additional solutions not found with the trial and error method. Our study shows that geothermal systems like TB are more comprehensively understood when inverse models are applied to constrain coupled fluid flow processes over large spatial scales. References Diersch, H.-J.G., 2014. FEFLOW Finite Element Modeling of Flow, Mass and Heat Transport in Porous and Fractured Media. Springer- Verlag Berlin Heidelberg ,996p. Doherty J., 2010, PEST: Model-Independent Parameter Estimation. user manual 5th Edition. Watermark, Brisbane, Australia Magri, F., Inbar, N., Siebert C., Rosenthal, E., Guttman, J., Möller, P., 2015. Transient simulations of large-scale hydrogeological processes causing temperature and salinity anomalies in the Tiberias Basin. Journal of Hydrology, 520(0), 342-355.

Skyshine line-beam response functions for 20- to 100-MeV photons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brockhoff, R.C.; Shultis, J.K.; Faw, R.E.

1996-06-01

The line-beam response function, needed for skyshine analyses based on the integral line-beam method, was evaluated with the MCNP Monte Carlo code for photon energies from 20 to 100 MeV and for source-to-detector distances out to 1,000 m. These results are compared with point-kernel results, and the effects of bremsstrahlung and positron transport in the air are found to be important in this energy range. The three-parameter empirical formula used in the integral line-beam skyshine method was fit to the MCNP results, and values of these parameters are reported for various source energies and angles.

Inverse modelling-based reconstruction of the Chernobyl source term available for long-range transport

NASA Astrophysics Data System (ADS)

Davoine, X.; Bocquet, M.

2007-03-01

The reconstruction of the Chernobyl accident source term has been previously carried out using core inventories, but also back and forth confrontations between model simulations and activity concentration or deposited activity measurements. The approach presented in this paper is based on inverse modelling techniques. It relies both on the activity concentration measurements and on the adjoint of a chemistry-transport model. The location of the release is assumed to be known, and one is looking for a source term available for long-range transport that depends both on time and altitude. The method relies on the maximum entropy on the mean principle and exploits source positivity. The inversion results are mainly sensitive to two tuning parameters, a mass scale and the scale of the prior errors in the inversion. To overcome this hardship, we resort to the statistical L-curve method to estimate balanced values for these two parameters. Once this is done, many of the retrieved features of the source are robust within a reasonable range of parameter values. Our results favour the acknowledged three-step scenario, with a strong initial release (26 to 27 April), followed by a weak emission period of four days (28 April-1 May) and again a release, longer but less intense than the initial one (2 May-6 May). The retrieved quantities of iodine-131, caesium-134 and caesium-137 that have been released are in good agreement with the latest reported estimations. Yet, a stronger apportionment of the total released activity is ascribed to the first period and less to the third one. Finer chronological details are obtained, such as a sequence of eruptive episodes in the first two days, likely related to the modulation of the boundary layer diurnal cycle. In addition, the first two-day release surges are found to have effectively reached an altitude up to the top of the domain (5000 m).

A review of lung-to-blood absorption rates for radon progeny.

PubMed

Marsh, J W; Bailey, M R

2013-12-01

The International Commission on Radiological Protection (ICRP) Publication 66 Human Respiratory Tract Model (HRTM) treats clearance of materials from the respiratory tract as a competitive process between absorption into blood and particle transport to the alimentary tract and lymphatics. The ICRP recommended default absorption rates for lead and polonium (Type M) in ICRP Publication 71 but stated that the values were not appropriate for short-lived radon progeny. This paper reviews and evaluates published data from volunteer and laboratory animal experiments to estimate the HRTM absorption parameter values for short-lived radon progeny. Animal studies showed that lead ions have two phases of absorption: ∼10 % absorbed with a half-time of ∼15 min, the rest with a half-time of ∼10 h. The studies also indicated that some of the lead ions were bound to respiratory tract components. Bound fractions, f(b), for lead were estimated from volunteer and animal studies and ranged from 0.2 to 0.8. Based on the evaluations of published data, the following HRTM absorption parameter values were derived for lead as a decay product of radon: f(r) = 0.1, s(r) = 100 d(-1), s(s) = 1.7 d(-1), f(b) = 0.5 and s(b) = 1.7 d(-1). Effective doses calculated assuming these absorption parameter values instead of a single absorption half-time of 10 h with no binding (as has generally been assumed) are only a few per cent higher. However, as there is some conflicting evidence on the absorption kinetics for radon progeny, dose calculations have been carried out for different sets of absorption parameter values derived from different studies. The results of these calculations are discussed.

Estimation of αL, velocity, Kd and confidence limits from tracer injection test data

USGS Publications Warehouse

Broermann, James; Bassett, R.L.; Weeks, Edwin P.; Borgstrom, Mark

1997-01-01

Bromide and boron were used as tracers during an injection experiment conducted at an artificial recharge facility near Stanton, Texas. The Ogallala aquifer at the Stanton site represents a heterogeneous alluvial environment and provides the opportunity to report scale dependent dispersivities at observation distances of 2 to 15 m in this setting. Values of longitudinal dispersivities are compared with other published values. Water samples were collected at selected depths both from piezometers and from fully screened observation wells at radii of 2, 5, 10 and 15 m. An exact analytical solution is used to simulate the concentration breakthrough curves and estimate longitudinal dispersivities and velocity parameters. Greater confidence can be placed on these data because the estimated parameters are error bounded using the bootstrap method. The non-conservative behavior of boron transport in clay rich sections of the aquifer were quantified with distribution coefficients by using bromide as a conservative reference tracer.

Estimation of αL, velocity, Kd, and confidence limits from tracer injection data

USGS Publications Warehouse

Broermann, James; Bassett, R.L.; Weeks, Edwin P.; Borgstrom, Mark

1997-01-01

Bromide and boron were used as tracers during an injection experiment conducted at an artificial recharge facility near Stanton, Texas. The Ogallala aquifer at the Stanton site represents a heterogeneous alluvial environment and provides the opportunity to report scale dependent dispersivities at observation distances of 2 to 15 m in this setting. Values of longitudinal dispersivities are compared with other published values. Water samples were collected at selected depths both from piezometers and from fully screened observation wells at radii of 2, 5, 10 and 15 m. An exact analytical solution is used to simulate the concentration breakthrough curves and estimate longitudinal dispersivities and velocity parameters. Greater confidence can be placed on these data because the estimated parameters are error bounded using the bootstrap method. The non-conservative behavior of boron transport in clay rich sections of the aquifer were quantified with distribution coefficients by using bromide as a conservative reference tracer.

The analysis of energy consumption of the transport and manipulation process of Fanuc AM100iB robot

NASA Astrophysics Data System (ADS)

Cholewa, A.; Świder, J.; Zbilski, A.

2017-08-01

This article describes test results of energy consumption of Fanuc ArcMate 100iB robot during realization of the transport and manipulation process. The energy consumption test involved the acquisition of values of angular positions of the robot’s encoder shafts and values of tensions and expansions of the electrical currents in three phases of each engine. Based on the simulation results, the analysis of energy consumption was carried out, which specified the tested palletizing process using the set of complete and partial decompositions of the energy consumption of all these factors, which in significant degree impacted the amount of energy taken during the process. Quality of the data provided by the analysis of energy consumption was assessed through validation of results, which involved direct comparison of corresponding parameters, which values were measured and calculated. With regards to the developed analysis of energy consumption, computerized techniques were used to determine the impact of all material factors on the total energy consumption of the machine. The work presents the most significant results of the obtained outcomes.

Transport, Structural and Mechanical Properties of Quaternary FeVTiAl Alloy

NASA Astrophysics Data System (ADS)

Bhat, Tahir Mohiuddin; Gupta, Dinesh C.

2016-11-01

The electronic, structural, magnetic and transport properties of FeVTiAl quaternary alloy have been investigated within the framework of density functional theory. The material is a completely spin-polarized half-metallic ferromagnet in its ground state with F-43m structure. The structural stability was further confirmed by elastic constants in the cubic phase with high Young's modulus and brittle nature. The present study predicts an energy band gap of 0.72 eV in a localized minority spin channel at equilibrium lattice parameter of 6.00 Å. The transport properties of the material are discussed based on the Seebeck coefficient, and electrical and thermal conductivity coefficients. The alloy presents large values of Seebeck coefficients, ~39 μV K-1 at room temperature (300 K), and has an excellent thermoelectric performance with ZT = ~0.8.

Fitting the Elementary Rate Constants of the P-gp Transporter Network in the hMDR1-MDCK Confluent Cell Monolayer Using a Particle Swarm Algorithm

PubMed Central

Agnani, Deep; Acharya, Poulomi; Martinez, Esteban; Tran, Thuy Thanh; Abraham, Feby; Tobin, Frank; Ellens, Harma; Bentz, Joe

2011-01-01

P-glycoprotein, a human multidrug resistance transporter, has been extensively studied due to its importance to human health and disease. In order to understand transport kinetics via P-gp, confluent cell monolayers overexpressing P-gp are widely used. The purpose of this study is to obtain the mass action elementary rate constants for P-gp's transport and to functionally characterize members of P-gp's network, i.e., other transporters that transport P-gp substrates in hMDR1-MDCKII confluent cell monolayers and are essential to the net substrate flux. Transport of a range of concentrations of amprenavir, loperamide, quinidine and digoxin across the confluent monolayer of cells was measured in both directions, apical to basolateral and basolateral to apical. We developed a global optimization algorithm using the Particle Swarm method that can simultaneously fit all datasets to yield accurate and exhaustive fits of these elementary rate constants. The statistical sensitivity of the fitted values was determined by using 24 identical replicate fits, yielding simple averages and standard deviations for all of the kinetic parameters, including the efflux active P-gp surface density. Digoxin required additional basolateral and apical transporters, while loperamide required just a basolateral tranporter. The data were better fit by assuming bidirectional transporters, rather than active importers, suggesting that they are not MRP or active OATP transporters. The P-gp efflux rate constants for quinidine and digoxin were about 3-fold smaller than reported ATP hydrolysis rate constants from P-gp proteoliposomes. This suggests a roughly 3∶1 stoichiometry between ATP hydrolysis and P-gp transport for these two drugs. The fitted values of the elementary rate constants for these P-gp substrates support the hypotheses that the selective pressures on P-gp are to maintain a broad substrate range and to keep xenobiotics out of the cytosol, but not out of the apical membrane. PMID:22028772

RNA quality in fresh-frozen gastrointestinal tumor specimens-experiences from the tumor and healthy tissue bank TU Dresden.

PubMed

Zeugner, Silke; Mayr, Thomas; Zietz, Christian; Aust, Daniela E; Baretton, Gustavo B

2015-01-01

The term "pre-analytics" summarizes all procedures concerned with specimen collection or processing as well as logistical aspects like transport or storage of tissue specimens. All or these variables as well as tissue-specific characteristics affect sample quality. While certain parameters like warm ischemia or tissue-specific characteristics cannot be changed, other parameters can be assessed and optimized. The aim of this study was to determine RNA quality by assessing the RIN values of specimens from different organs and to assess the influence of vacuum preservation. Samples from the GI tract, in general, appear to have lower RNA quality when compared to samples from other organ sites. This may be due to the digestive enzymes or bacterial colonization. Processing time in pathology does not significantly influence RNA quality. Tissue preservation with a vacuum sealer leads to preserved RNA quality over an extended period of time and offers a feasible alternative to minimize the influence of transport time into pathology.

Electron transport parameters in NF3

NASA Astrophysics Data System (ADS)

Lisovskiy, V.; Yegorenkov, V.; Ogloblina, P.; Booth, J.-P.; Martins, S.; Landry, K.; Douai, D.; Cassagne, V.

2014-03-01

We present electron transport parameters (the first Townsend coefficient, the dissociative attachment coefficient, the fraction of electron energy lost by collisions with NF3 molecules, the average and characteristic electron energy, the electron mobility and the drift velocity) in NF3 gas calculated from published elastic and inelastic electron-NF3 collision cross-sections using the BOLSIG+ code. Calculations were performed for the combined RB (Rescigno 1995 Phys. Rev. E 52 329, Boesten et al 1996 J. Phys. B: At. Mol. Opt. Phys. 29 5475) momentum-transfer cross-section, as well as for the JB (Joucoski and Bettega 2002 J. Phys. B: At. Mol. Opt. Phys. 35 783) momentum-transfer cross-section. In addition, we have measured the radio frequency (rf) breakdown curves for various inter-electrode gaps and rfs, and from these we have determined the electron drift velocity in NF3 from the location of the turning point in these curves. These drift velocity values are in satisfactory agreement with those calculated by the BOLSIG+ code employing the JB momentum-transfer cross-section.

Estimation of Handling Qualities Parameters of the Tu-144 Supersonic Transport Aircraft from Flight Test Data

NASA Technical Reports Server (NTRS)

Curry, Timothy J.; Batterson, James G. (Technical Monitor)

2000-01-01

Low order equivalent system (LOES) models for the Tu-144 supersonic transport aircraft were identified from flight test data. The mathematical models were given in terms of transfer functions with a time delay by the military standard MIL-STD-1797A, "Flying Qualities of Piloted Aircraft," and the handling qualities were predicted from the estimated transfer function coefficients. The coefficients and the time delay in the transfer functions were estimated using a nonlinear equation error formulation in the frequency domain. Flight test data from pitch, roll, and yaw frequency sweeps at various flight conditions were used for parameter estimation. Flight test results are presented in terms of the estimated parameter values, their standard errors, and output fits in the time domain. Data from doublet maneuvers at the same flight conditions were used to assess the predictive capabilities of the identified models. The identified transfer function models fit the measured data well and demonstrated good prediction capabilities. The Tu-144 was predicted to be between level 2 and 3 for all longitudinal maneuvers and level I for all lateral maneuvers. High estimates of the equivalent time delay in the transfer function model caused the poor longitudinal rating.

Stability of haematological parameters and its relevance on the athlete's biological passport model.

PubMed

Lombardi, Giovanni; Lanteri, Patrizia; Colombini, Alessandra; Lippi, Giuseppe; Banfi, Giuseppe

2011-12-01

The stability of haematological parameters is crucial to guarantee accurate and reliable data for implementing and interpreting the athlete's biological passport (ABP). In this model, the values of haemoglobin, reticulocytes and out-of-doping period (OFF)-score (Hb-60√Ret) are used to monitor the possible variations of those parameters, and also to compare the thresholds developed by the statistical model for the single athlete on the basis of its personal values and the variance of parameters in the modal group. Nevertheless, a critical review of the current scientific literature dealing with the stability of the haematological parameters included in the ABP programme, and which are used for evaluating the probability of anomalies in the athlete's profile, is currently lacking. In addition, we collected information from published studies, in order to supply a useful, practical and updated review to sports physicians and haematologists. There are some parameters that are highly stable, such as haemoglobin and erythrocytes (red blood cells [RBCs]), whereas others, (e.g. reticulocytes, mean RBC volume and haematocrit) appear less stable. Regardless of the methodology, the stability of haematological parameters is improved by sample refrigeration. The stability of all parameters is highly affected from high storage temperatures, whereas the stability of RBCs and haematocrit is affected by initial freezing followed by refrigeration. Transport and rotation of tubes do not substantially influence any haematological parameter except for reticulocytes. In all the studies we reviewed that used Sysmex instrumentation, which is recommended for ABP measurements, stability was shown for 72 hours at 4 ° C for haemoglobin, RBCs and mean curpuscular haemoglobin concentration (MCHC); up to 48 hours for reticulocytes; and up to 24 hours for haematocrit. In one study, Sysmex instrumentation shows stability extended up to 72 hours at 4 ° C for all the parameters. There are significant differences among methods and instruments: Siemens Advia shows lower stability than Sysmex as regards to reticulocytes. However, the limit of 36 hours from blood collection to analysis as recommended by ABP scientists is reasonable to guarantee analytical quality, when samples are transported at 4 ° C and are accompanied by a certified steadiness of this temperature. There are some parameters that are highly stable, such as haemoglobin and RBCs; whereas others, such as reticulocytes, mean cell volume and haematocrit are more unstable. The stability of haematological parameters might be improved independently from the analytical methodology, by refrigeration of the specimens.

A Stokes drift approximation based on the Phillips spectrum

NASA Astrophysics Data System (ADS)

Breivik, Øyvind; Bidlot, Jean-Raymond; Janssen, Peter A. E. M.

2016-04-01

A new approximation to the Stokes drift velocity profile based on the exact solution for the Phillips spectrum is explored. The profile is compared with the monochromatic profile and the recently proposed exponential integral profile. ERA-Interim spectra and spectra from a wave buoy in the central North Sea are used to investigate the behavior of the profile. It is found that the new profile has a much stronger gradient near the surface and lower normalized deviation from the profile computed from the spectra. Based on estimates from two open-ocean locations, an average value has been estimated for a key parameter of the profile. Given this parameter, the profile can be computed from the same two parameters as the monochromatic profile, namely the transport and the surface Stokes drift velocity.

Numerical analysis of the diffusive mass transport in brain tissues with applications to optical sensors

NASA Astrophysics Data System (ADS)

Neculae, Adrian P.; Otte, Andreas; Curticapean, Dan

2013-03-01

In the brain-cell microenvironment, diffusion plays an important role: apart from delivering glucose and oxygen from the vascular system to brain cells, it also moves informational substances between cells. The brain is an extremely complex structure of interwoven, intercommunicating cells, but recent theoretical and experimental works showed that the classical laws of diffusion, cast in the framework of porous media theory, can deliver an accurate quantitative description of the way molecules are transported through this tissue. The mathematical modeling and the numerical simulations are successfully applied in the investigation of diffusion processes in tissues, replacing the costly laboratory investigations. Nevertheless, modeling must rely on highly accurate information regarding the main parameters (tortuosity, volume fraction) which characterize the tissue, obtained by structural and functional imaging. The usual techniques to measure the diffusion mechanism in brain tissue are the radiotracer method, the real time iontophoretic method and integrative optical imaging using fluorescence microscopy. A promising technique for obtaining the values for characteristic parameters of the transport equation is the direct optical investigation using optical fibers. The analysis of these parameters also reveals how the local geometry of the brain changes with time or under pathological conditions. This paper presents a set of computations concerning the mass transport inside the brain tissue, for different types of cells. By measuring the time evolution of the concentration profile of an injected substance and using suitable fitting procedures, the main parameters characterizing the tissue can be determined. This type of analysis could be an important tool in understanding the functional mechanisms of effective drug delivery in complex structures such as the brain tissue. It also offers possibilities to realize optical imaging methods for in vitro and in vivo measurements using optical fibers. The model also may help in radiotracer biomarker models for the understanding of the mechanism of action of new chemical entities.

Production of biodiesel from coastal macroalgae (Chara vulgaris) and optimization of process parameters using Box-Behnken design.

PubMed

Siddiqua, Shaila; Mamun, Abdullah Al; Enayetul Babar, Sheikh Md

2015-01-01

Renewable biodiesels are needed as an alternative to petroleum-derived transport fuels, which contribute to global warming and are of limited availability. Algae biomass, are a potential source of renewable energy, and they can be converted into energy such as biofuels. This study introduces an integrated method for the production of biodiesel from Chara vulgaris algae collected from the coastal region of Bangladesh. The Box-Behnken design based on response surface methods (RSM) used as the statistical tool to optimize three variables for predicting the best performing conditions (calorific value and yield) of algae biodiesel. The three parameters for production condition were chloroform (X1), sodium chloride concentration (X2) and temperature (X3). Optimal conditions were estimated by the aid of statistical regression analysis and surface plot chart. The optimal condition of biodiesel production parameter for 12 g of dry algae biomass was observed to be 198 ml chloroform with 0.75 % sodium chloride at 65 °C temperature, where the calorific value of biodiesel is 9255.106 kcal/kg and yield 3.6 ml.

Role of carrier density and disorder on anisotropic charge transport in polypyrrole

NASA Astrophysics Data System (ADS)

Varade, Vaibhav; Anjaneyulu, P.; Suchand Sangeeth, C. S.; Ramesh, K. P.; Menon, Reghu

2013-01-01

Polypyrrole (PPy) has been synthesized electrochemically on platinum substrate by varying synthesis temperature and dopant concentration. The charge transport in PPy has been investigated as a function of temperature for both in-plane and out-of-plane geometry in a wide temperature range of 5 K-300 K. The charge transport showed strong anisotropy and various mechanisms were used to explain the transport. The conductivity ratio, σr = σ(300 K)/σ(5 K) is calculated for each sample to quantify the relative disorder. At all the temperatures, the conductivity values for in-plane transport are found to be more for PPy synthesized at lower temperature, while the behavior is found to be different for out-of-plane transport. The carrier density is found to play a crucial role in case of in-plane transport. An effort has been made to correlate charge transport to morphology by analyzing temperature and frequency dependence of conductivity. Charge transport in lateral direction is found to be dominated by hopping whereas tunneling mechanisms are dominated in vertical direction. Parameters such as density of states at the Fermi level [N(EF)], average hopping distance (R), and average hopping energy (W) have been estimated for each samples in both geometry.

Model-Based Design of Long-Distance Tracer Transport Experiments in Plants.

PubMed

Bühler, Jonas; von Lieres, Eric; Huber, Gregor J

2018-01-01

Studies of long-distance transport of tracer isotopes in plants offer a high potential for functional phenotyping, but so far measurement time is a bottleneck because continuous time series of at least 1 h are required to obtain reliable estimates of transport properties. Hence, usual throughput values are between 0.5 and 1 samples h -1 . Here, we propose to increase sample throughput by introducing temporal gaps in the data acquisition of each plant sample and measuring multiple plants one after each other in a rotating scheme. In contrast to common time series analysis methods, mechanistic tracer transport models allow the analysis of interrupted time series. The uncertainties of the model parameter estimates are used as a measure of how much information was lost compared to complete time series. A case study was set up to systematically investigate different experimental schedules for different throughput scenarios ranging from 1 to 12 samples h -1 . Selected designs with only a small amount of data points were found to be sufficient for an adequate parameter estimation, implying that the presented approach enables a substantial increase of sample throughput. The presented general framework for automated generation and evaluation of experimental schedules allows the determination of a maximal sample throughput and the respective optimal measurement schedule depending on the required statistical reliability of data acquired by future experiments.

Relaxation Dynamics of a Granular Pile on a Vertically Vibrating Plate

NASA Astrophysics Data System (ADS)

Tsuji, Daisuke; Otsuki, Michio; Katsuragi, Hiroaki

2018-03-01

Nonlinear relaxation dynamics of a vertically vibrated granular pile is experimentally studied. In the experiment, the flux and slope on the relaxing pile are measured by using a high-speed laser profiler. The relation of these quantities can be modeled by the nonlinear transport law assuming the uniform vibrofluidization of an entire pile. The fitting parameter in this model is only the relaxation efficiency, which characterizes the energy conversion rate from vertical vibration into horizontal transport. We demonstrate that this value is a constant independent of experimental conditions. The actual relaxation is successfully reproduced by the continuity equation with the proposed model. Finally, its specific applicability toward an astrophysical phenomenon is shown.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Model Construction and Analysis of Respiration in Halobacterium salinarum.

PubMed

Talaue, Cherryl O; del Rosario, Ricardo C H; Pfeiffer, Friedhelm; Mendoza, Eduardo R; Oesterhelt, Dieter

2016-01-01

The archaeon Halobacterium salinarum can produce energy using three different processes, namely photosynthesis, oxidative phosphorylation and fermentation of arginine, and is thus a model organism in bioenergetics. Compared to its bacteriorhodopsin-driven photosynthesis, less attention has been devoted to modeling its respiratory pathway. We created a system of ordinary differential equations that models its oxidative phosphorylation. The model consists of the electron transport chain, the ATP synthase, the potassium uniport and the sodium-proton antiport. By fitting the model parameters to experimental data, we show that the model can explain data on proton motive force generation, ATP production, and the charge balancing of ions between the sodium-proton antiporter and the potassium uniport. We performed sensitivity analysis of the model parameters to determine how the model will respond to perturbations in parameter values. The model and the parameters we derived provide a resource that can be used for analytical studies of the bioenergetics of H. salinarum.

Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carter, Austin Lewis; Talou, Patrick; Stetcu, Ionel

CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivitymore » of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.« less

Classical and quantum dynamics of a kicked relativistic particle in a box

NASA Astrophysics Data System (ADS)

Yusupov, J. R.; Otajanov, D. M.; Eshniyazov, V. E.; Matrasulov, D. U.

2018-03-01

We study classical and quantum dynamics of a kicked relativistic particle confined in a one dimensional box. It is found that in classical case for chaotic motion the average kinetic energy grows in time, while for mixed regime the growth is suppressed. However, in case of regular motion energy fluctuates around certain value. Quantum dynamics is treated by solving the time-dependent Dirac equation with delta-kicking potential, whose exact solution is obtained for single kicking period. In quantum case, depending on the values of the kicking parameters, the average kinetic energy can be quasi periodic, or fluctuating around some value. Particle transport is studied by considering spatio-temporal evolution of the Gaussian wave packet and by analyzing the trembling motion.

Bivariate extreme value distributions

NASA Technical Reports Server (NTRS)

Elshamy, M.

1992-01-01

In certain engineering applications, such as those occurring in the analyses of ascent structural loads for the Space Transportation System (STS), some of the load variables have a lower bound of zero. Thus, the need for practical models of bivariate extreme value probability distribution functions with lower limits was identified. We discuss the Gumbel models and present practical forms of bivariate extreme probability distributions of Weibull and Frechet types with two parameters. Bivariate extreme value probability distribution functions can be expressed in terms of the marginal extremel distributions and a 'dependence' function subject to certain analytical conditions. Properties of such bivariate extreme distributions, sums and differences of paired extremals, as well as the corresponding forms of conditional distributions, are discussed. Practical estimation techniques are also given.

Comparisons of Solar Wind Coupling Parameters with Auroral Energy Deposition Rates

NASA Technical Reports Server (NTRS)

Elsen, R.; Brittnacher, M. J.; Fillingim, M. O.; Parks, G. K.; Germany G. A.; Spann, J. F., Jr.

1997-01-01

Measurement of the global rate of energy deposition in the ionosphere via auroral particle precipitation is one of the primary goals of the Polar UVI program and is an important component of the ISTP program. The instantaneous rate of energy deposition for the entire month of January 1997 has been calculated by applying models to the UVI images and is presented by Fillingim et al. In this session. A number of parameters that predict the rate of coupling of solar wind energy into the magnetosphere have been proposed in the last few decades. Some of these parameters, such as the epsilon parameter of Perrault and Akasofu, depend on the instantaneous values in the solar wind. Other parameters depend on the integrated values of solar wind parameters, especially IMF Bz, e.g. applied flux which predicts the net transfer of magnetic flux to the tail. While these parameters have often been used successfully with substorm studies, their validity in terms of global energy input has not yet been ascertained, largely because data such as that supplied by the ISTP program was lacking. We have calculated these and other energy coupling parameters for January 1997 using solar wind data provided by WIND and other solar wind monitors. The rates of energy input predicted by these parameters are compared to those measured through UVI data and correlations are sought. Whether these parameters are better at providing an instantaneous rate of energy input or an average input over some time period is addressed. We also study if either type of parameter may provide better correlations if a time delay is introduced; if so, this time delay may provide a characteristic time for energy transport in the coupled solar wind-magnetosphere-ionosphere system.

Computational modeling of unsteady third-grade fluid flow over a vertical cylinder: A study of heat transfer visualization

NASA Astrophysics Data System (ADS)

Reddy, G. Janardhana; Hiremath, Ashwini; Kumar, Mahesh

2018-03-01

The present paper aims to investigate the effect of Prandtl number for unsteady third-grade fluid flow over a uniformly heated vertical cylinder using Bejan's heat function concept. The mathematical model of this problem is given by highly time-dependent non-linear coupled equations and are resolved by an efficient unconditionally stable implicit scheme. The time histories of average values of momentum and heat transport coefficients as well as the steady-state flow variables are displayed graphically for distinct values of non-dimensional control parameters arising in the system. As the non-dimensional parameter value gets amplified, the time taken for the fluid flow variables to attain the time-independent state is decreasing. The dimensionless heat function values are closely associated with an overall rate of heat transfer. Thermal energy transfer visualization implies that the heat function contours are compact in the neighborhood of the leading edge of the hot cylindrical wall. It is noticed that the deviations of flow-field variables from the hot wall for a non-Newtonian third-grade fluid flow are significant compared to the usual Newtonian fluid flow.

Determining the Impact of Personal Mobility Carbon Allowance Schemes in Transportation Networks

DOE PAGES

Aziz, H. M. Abdul; Ukkusuri, Satish V.; Zhan, Xianyuan

2016-10-17

We know that personal mobility carbon allowance (PMCA) schemes are designed to reduce carbon consumption from transportation networks. PMCA schemes influence the travel decision process of users and accordingly impact the system metrics including travel time and greenhouse gas (GHG) emissions. Here, we develop a multi-user class dynamic user equilibrium model to evaluate the transportation system performance when PMCA scheme is implemented. The results using Sioux-Falls test network indicate that PMCA schemes can achieve the emissions reduction goals for transportation networks. Further, users characterized by high value of travel time are found to be less sensitive to carbon budget inmore » the context of work trips. Results also show that PMCA scheme can lead to higher emissions for a path compared with the case without PMCA because of flow redistribution. The developed network equilibrium model allows us to examine the change in system states at different carbon allocation levels and to design parameters of PMCA schemes accounting for population heterogeneity.« less

Determining the Impact of Personal Mobility Carbon Allowance Schemes in Transportation Networks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aziz, H. M. Abdul; Ukkusuri, Satish V.; Zhan, Xianyuan

We know that personal mobility carbon allowance (PMCA) schemes are designed to reduce carbon consumption from transportation networks. PMCA schemes influence the travel decision process of users and accordingly impact the system metrics including travel time and greenhouse gas (GHG) emissions. Here, we develop a multi-user class dynamic user equilibrium model to evaluate the transportation system performance when PMCA scheme is implemented. The results using Sioux-Falls test network indicate that PMCA schemes can achieve the emissions reduction goals for transportation networks. Further, users characterized by high value of travel time are found to be less sensitive to carbon budget inmore » the context of work trips. Results also show that PMCA scheme can lead to higher emissions for a path compared with the case without PMCA because of flow redistribution. The developed network equilibrium model allows us to examine the change in system states at different carbon allocation levels and to design parameters of PMCA schemes accounting for population heterogeneity.« less

Ionization balance of impurities in turbulent scrape-off layer plasmas I: local ionization-recombination equilibrium

NASA Astrophysics Data System (ADS)

Guzman, F.; Marandet, Y.; Tamain, P.; Bufferand, H.; Ciraolo, G.; Ghendrih, Ph; Guirlet, R.; Rosato, J.; Valentinuzzi, M.

2015-12-01

In magnetized fusion devices, cross field impurity transport is often dominated by turbulence, in particular in the scrape-off layer. In these outer regions of the plasma, fluctuations of plasma parameters can be comparable to mean values, and the way ionization and recombination sources are treated in transport codes becomes questionnable. In fact, sources are calculated using the mean density and temperature values, with no account of fluctuations. In this work we investigate the modeling uncertainties introduced by this approximation, both qualitatively and quantitatively for the local ionization equilibrium. As a first step transport effects are neglected, and their role will be discussed in a companion paper. We show that temperature fluctuations shift the ionization balance towards lower temperatures, essentially because of the very steep temperature dependence of the ionization rate coefficients near the threshold. To reach this conclusion, a thorough analysis of the time scales involved is carried out, in order to devise a proper way of averaging over fluctuations. The effects are found to be substantial only for fairly large relative fluctuation levels for temperature, that is of the order of a few tens of percents.

Effect of hemodialysis on factors influencing oxygen transport.

PubMed

Hirszel, P; Maher, J F; Tempel, G E; Mengel, C E

1975-06-01

Ten patients underwent 4 study hemodialyses, one with standard dialysis conditions, one with an isophosphate dialysate, one with simultaneous ammonium chloride loading, and other, after pretreatment, with sodium bicarbonate. Measurement of hemoglobin oxygen affinity (P-50), erythrocyte 2,3-DPG, blood-gasses, and serum chemistries revealed biochemically effective hemodialyses and slight changes in oxygen transport parameters. The P-50 (in vivo) values decreased slightly but significantly (p greater than 0.05) with dialysis. When corrected to pH 7.4, eliminating the Bohr effect, P-50 increased (p greater than 0.05). With unmodified dialysis elevated values of 2,3-DPG (in comparison to normal) decreased, a change that did not correlate with delta-p-50, delta-serum phosphate, or delta-serum creatinine. With standard and isophosphate dialyses Po-2 decreased significantly. The decrease correlated with delta-hydrogen ion concentration and did not occur with dialyses designed to maintain pH constant. Thus, hemodialysis influences many factors that affect oxygen transport in different and counterbalancing directions. These changes are not totally explained by alterations in 2,3-DPG, pH or serum phosphate. Maintenance of acidosis or hyperphosphatemia during dialysis is not recommended.

Impact of Anemia in Critically Ill Burned Casualties Evacuated From Combat Theater via US Military Critical Care Air Transport Teams.

PubMed

Hamilton, Joshua A; Mora, Alejandra G; Chung, Kevin K; Bebarta, Vikhyat S

2015-08-01

US military Critical Care Air Transport Teams (CCATT) transport critically ill burn patients out of theater. Blood transfusion may incur adverse effects, and studies report lower hemoglobin (Hgb) value may be safe for critically ill patients. There are no studies evaluating the optimal Hgb value for critically ill burn patients prior to CCATT evacuation. The aim of the study was to determine if critically ill burn casualties with an Hgb of 10 g/dL or less, transported via CCATT, have similar clinical outcomes at 30 days as compared with patients with an Hgb of greater than 10 g/dL. We conducted an institutional review board-approved retrospective cohort study involving patients transported via CCATT. We separated our study population into two cohorts based on Hgb levels at the time of theater evacuation: Hgb ≤10 g/dL or Hgb ≥10 g/dL. We compared demographics, injury description, physiologic parameters, and clinical outcomes. Of the 140 subjects enrolled, 29 were Hgb ≤10, and 111 were Hgb ≥10. Both groups were similar in age and percent total body surface area burned. Those Hgb ≤10 had a higher injury severity score (34 ± 19.8 vs. 25 ± 16.9, P = 0.02) and were more likely to have additional trauma (50% vs. 25%, P = 0.04). Modeling revealed no persistent differences in mortality, and other clinical outcomes measured. Critical Care Air Transport Teams transport of critically ill burn patients with an Hgb of 10 g/dL or less had no significant differences in complications or mortality as compared with patients with an Hgb of greater than 10 g/dL. In this study, lower hemoglobin levels did not confer greater risk for worse outcomes.

Gyrofluid theory and simulation of electromagnetic turbulence and transport in tokamak plasmas

NASA Astrophysics Data System (ADS)

Snyder, Philip Benjamin

1999-11-01

Turbulence and transport in toroidal plasmas is studied via the development of an electromagnetic gyrofluid model, and its implementation in realistic nonlinear simulations. This work extends earlier electrostatic gyrofluid models to include magnetic fluctuations and non-adiabatic passing electron dynamics. A new set of electron fluid equations is derived from the drift kinetic equation, via an expansion in the electron-ion mass ratio. These electron equations include descriptions of linear and nonlinear drift motion, Landau damping, and electron-ion collisions. Ion moment equations are derived from the electromagnetic gyrokinetic equation, and the gyrokinetic Poisson's Equation and Ampere's Law close the system. The model is benchmarked with linear gyrokinetic calculations, and good agreement is found for both the finite-β ion temperature gradient (ITG) and kinetic Alfvén ballooning (KBM) instabilities. Nonlinear simulations of ITG and KBM-driven turbulence are performed in toroidal flux tube geometry at a range of values of plasma β, and electromagnetic effects are found to significantly impact turbulent heat and particle transport. At low values of β, transport is reduced, as expected due to the finite-β stabilization of the ITG mode. However, as β approaches the Ideal-MHD stability threshold, transport can increase. In the presence of dissipation provided by a model of electron Landau damping and electron-ion collisions, this transport increase can be quite dramatic. Finally, the results of the simulations are compared to tokamak experiments, and encouraging agreement is found with measured density and temperature fluctuation spectra. Direct comparisons of transport fluxes reveal that electromagnetic effects are important at characteristic edge parameters, bringing predicted fluxes more closely in line with observations.

Acclimation of photosynthetic parameters is not the icing on the cake. It is the cake.

NASA Astrophysics Data System (ADS)

Prentice, Iain Colin; Wang, Han; Togashi, Henrique; Keenan, Trevor; Davis, Tyler; Wright, Ian

2015-04-01

Photosynthesis and transpiration are tightly coupled through stomatal behaviour and therefore it is impossible to understand and parsimoniously model one without also considering the other. The ratio of leaf-internal to ambient carbon dioxide concentration (ci:ca ratio) is a measure of the "exchange rate" between water and carbon. We have shown that it is possible to predict the observed dependencies of ci:ca on environmental factors (temperature, vapour pressure deficit and atmospheric pressure) based on the "least-cost hypothesis", which states that plants minimize the sum of the unit costs (respiration per unit assimilation) of maintaining the capacities for carbon fixation (Vcmax) and water transport. Moreover, with the help of the "co-ordination hypothesis" (the long-accepted idea that Rubisco capacity and electron transport tend to co-limit photosynthesis) it is possible to predict not only how ci:ca should vary, but also how Vcmax and electron transport capacity (Jmax) should vary, in space and time. We will present empirical support for this idea based on both ecophysiological measurements at the leaf scale, and analysis of carbon dioxide flux measurements at the ecosystem scale. We conclude that acclimation of photosynthetic parameters is pervasive. This is fundamental because it predicts a quite different set of environmental responses than those that are usually applied in models that incorrectly assume constancy of parameter values with time and within plant functional types (PFTs). In addition, acclimation actually simplifies modelling because it describes universal relationships that apply across all PFTs with the C3 photosynthetic pathway, and it removes the need to specify parameters such as Vcmax and Jmax as if they were properties of PFTs.

Estimating parameters and uncertainty for three-dimensional flow and transport in a highly heterogeneous sand box experiment

NASA Astrophysics Data System (ADS)

Yoon, H.; McKenna, S. A.; Hart, D. B.

2010-12-01

Heterogeneity plays an important role in groundwater flow and contaminant transport in natural systems. Since it is impossible to directly measure spatial variability of hydraulic conductivity, predictions of solute transport based on mathematical models are always uncertain. While in most cases groundwater flow and tracer transport problems are investigated in two-dimensional (2D) systems, it is important to study more realistic and well-controlled 3D systems to fully evaluate inverse parameter estimation techniques and evaluate uncertainty in the resulting estimates. We used tracer concentration breakthrough curves (BTCs) obtained from a magnetic resonance imaging (MRI) technique in a small flow cell (14 x 8 x 8 cm) that was packed with a known pattern of five different sands (i.e., zones) having cm-scale variability. In contrast to typical inversion systems with head, conductivity and concentration measurements at limited points, the MRI data included BTCs measured at a voxel scale (~0.2 cm in each dimension) over 13 x 8 x 8 cm with a well controlled boundary condition, but did not have direct measurements of head and conductivity. Hydraulic conductivity and porosity were conceptualized as spatial random fields and estimated using pilot points along layers of the 3D medium. The steady state water flow and solute transport were solved using MODFLOW and MODPATH. The inversion problem was solved with a nonlinear parameter estimation package - PEST. Two approaches to parameterization of the spatial fields are evaluated: 1) The detailed zone information was used as prior information to constrain the spatial impact of the pilot points and reduce the number of parameters; and 2) highly parameterized inversion at cm scale (e.g., 1664 parameters) using singular value decomposition (SVD) methodology to significantly reduce the run-time demands. Both results will be compared to measured BTCs. With MRI, it is easy to change the averaging scale of the observed concentration from point to cross-section. This comparison allows us to evaluate which method best matches experimental results at different scales. To evaluate the uncertainty in parameter estimation, the null space Monte Carlo method will be used to reduce computational burden of the development of calibration-constrained Monte Carlo based parameter fields. This study will illustrate how accurately a well-calibrated model can predict contaminant transport. This material is based upon work supported as part of the Center for Frontiers of Subsurface Energy Security (CFSES), an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences under Award Number DE-SC0001114. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

A model of axonal transport drug delivery

NASA Astrophysics Data System (ADS)

Kuznetsov, Andrey V.

2012-04-01

In this paper a model of targeted drug delivery by means of active (motor-driven) axonal transport is developed. The model is motivated by recent experimental research by Filler et al. (A.G. Filler, G.T. Whiteside, M. Bacon, M. Frederickson, F.A. Howe, M.D. Rabinowitz, A.J. Sokoloff, T.W. Deacon, C. Abell, R. Munglani, J.R. Griffiths, B.A. Bell, A.M.L. Lever, Tri-partite complex for axonal transport drug delivery achieves pharmacological effect, Bmc Neuroscience 11 (2010) 8) that reported synthesis and pharmacological efficiency tests of a tri-partite complex designed for axonal transport drug delivery. The developed model accounts for two populations of pharmaceutical agent complexes (PACs): PACs that are transported retrogradely by dynein motors and PACs that are accumulated in the axon at the Nodes of Ranvier. The transitions between these two populations of PACs are described by first-order reactions. An analytical solution of the coupled system of transient equations describing conservations of these two populations of PACs is obtained by using Laplace transform. Numerical results for various combinations of parameter values are presented and their physical significance is discussed.

Identification of TCE and PCE sorption and biodegradation parameters in a sandy aquifer for fate and transport modelling: batch and column studies.

PubMed

Kret, E; Kiecak, A; Malina, G; Nijenhuis, I; Postawa, A

2015-07-01

The main aim of this study was to determine the sorption and biodegradation parameters of trichloroethene (TCE) and tetrachloroethene (PCE) as input data required for their fate and transport modelling in a Quaternary sandy aquifer. Sorption was determined based on batch and column experiments, while biodegradation was investigated using the compound-specific isotope analysis (CSIA). The aquifer materials medium (soil 1) to fine (soil 2) sands and groundwater samples came from the representative profile of the contaminated site (south-east Poland). The sorption isotherms were approximately linear (TCE, soil 1, K d = 0.0016; PCE, soil 1, K d = 0.0051; PCE, soil 2, K d = 0.0069) except for one case in which the best fitting was for the Langmuir isotherm (TCE, soil 2, K f = 0.6493 and S max = 0.0145). The results indicate low retardation coefficients (R) of TCE and PCE; however, somewhat lower values were obtained in batch compared to column experiments. In the column experiments with the presence of both contaminants, TCE influenced sorption of PCE, so that the R values for both compounds were almost two times higher. Non-significant differences in isotope compositions of TCE and PCE measured in the observation points (δ(13)C values within the range of -23.6 ÷ -24.3‰ and -26.3 ÷-27.7‰, respectively) indicate that biodegradation apparently is not an important process contributing to the natural attenuation of these contaminants in the studied sandy aquifer.

Ecophysiology of nickel phytoaccumulation: a simplified biophysical approach.

PubMed

Coinchelin, David; Bartoli, François; Robin, Christophe; Echevarria, Guillaume

2012-10-01

Solute active transport or exclusion by plants can be identified by the values of the Transpiration Stream Concentration Factor (TSCF=xylem:solution solute concentration ratio). The aim of this study was to estimate this parameter for Ni uptake by the Ni-hyperaccumulator Leptoplax emarginata or the Ni-excluder Triticum aestivum cultivar 'Fidel'. The Intact Plant TSCF for nickel (IPTSCF(Ni)) was calculated as the ratio between the nickel mass accumulation in the leaves and the nickel concentration in solution per volume of water transpired. Predominantly, Ni active transport occurred for L. emarginata, with IPTSCF(Ni) values of 4.7-7.2 and convective component proportions of the root Ni uptake flow of only 15-20% for a range of Ni concentrations in solutions of 2-16 µmol Ni l(-1), regardless of the growth period and the time of Ni uptake. Hyperaccumulator roots were permeable to both water and nickel (mean reflection coefficient for Ni, σ(Ni), of 0.06), which was mainly attributed to an absence of exodermis. Results provide a new view of the mechanisms of Ni hyperaccumulation. By contrast, the wheat excluder was characterized by an extremely low mean IPTSCF(Ni) value of 0.006, characterizing a predominantly Ni sequestration in roots. From a methodological viewpoint, the 'microscopic' TSCF(Ni), measured directly on excised plants was 2.4 times larger than its recommended 'macroscopic' IPTSCF(Ni) counterpart. Overall, IPTSCF and σ determined on intact transpiring plants appeared to be very useful biophysical parameters in the study of the mechanisms involved in metal uptake and accumulation by plants, and in their modelling.

MAGNETOROTATIONAL TURBULENCE TRANSPORTS ANGULAR MOMENTUM IN STRATIFIED DISKS WITH LOW MAGNETIC PRANDTL NUMBER BUT MAGNETIC REYNOLDS NUMBER ABOVE A CRITICAL VALUE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oishi, Jeffrey S.; Mac Low, Mordecai-Mark, E-mail: jsoishi@stanford.edu, E-mail: mordecai@amnh.org

2011-10-10

The magnetorotational instability (MRI) may dominate outward transport of angular momentum in accretion disks, allowing material to fall onto the central object. Previous work has established that the MRI can drive a mean-field dynamo, possibly leading to a self-sustaining accretion system. Recently, however, simulations of the scaling of the angular momentum transport parameter {alpha}{sub SS} with the magnetic Prandtl number Pm have cast doubt on the ability of the MRI to transport astrophysically relevant amounts of angular momentum in real disk systems. Here, we use simulations including explicit physical viscosity and resistivity to show that when vertical stratification is included,more » mean-field dynamo action operates, driving the system to a configuration in which the magnetic field is not fully helical. This relaxes the constraints on the generated field provided by magnetic helicity conservation, allowing the generation of a mean field on timescales independent of the resistivity. Our models demonstrate the existence of a critical magnetic Reynolds number Rm{sub crit}, below which transport becomes strongly Pm-dependent and chaotic, but above which the transport is steady and Pm-independent. Prior simulations showing Pm dependence had Rm < Rm{sub crit}. We conjecture that this steady regime is possible because the mean-field dynamo is not helicity-limited and thus does not depend on the details of the helicity ejection process. Scaling to realistic astrophysical parameters suggests that disks around both protostars and stellar mass black holes have Rm >> Rm{sub crit}. Thus, we suggest that the strong Pm dependence seen in recent simulations does not occur in real systems.« less

Magnetorotational Turbulence Transports Angular Momentum in Stratified Disks with Low Magnetic Prandtl Number but Magnetic Reynolds Number above a Critical Value

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oishi, Jeffrey S.; /KIPAC, Menlo Park; Low, Mordecai-Mark Mac

2012-02-14

The magnetorotational instability (MRI) may dominate outward transport of angular momentum in accretion disks, allowing material to fall onto the central object. Previous work has established that the MRI can drive a mean-field dynamo, possibly leading to a self-sustaining accretion system. Recently, however, simulations of the scaling of the angular momentum transport parameter {alpha}{sub SS} with the magnetic Prandtl number Pm have cast doubt on the ability of the MRI to transport astrophysically relevant amounts of angular momentum in real disk systems. Here, we use simulations including explicit physical viscosity and resistivity to show that when vertical stratification is included,more » mean field dynamo action operates, driving the system to a configuration in which the magnetic field is not fully helical. This relaxes the constraints on the generated field provided by magnetic helicity conservation, allowing the generation of a mean field on timescales independent of the resistivity. Our models demonstrate the existence of a critical magnetic Reynolds number Rm{sub crit}, below which transport becomes strongly Pm-dependent and chaotic, but above which the transport is steady and Pm-independent. Prior simulations showing Pm-dependence had Rm < Rm{sub crit}. We conjecture that this steady regime is possible because the mean field dynamo is not helicity-limited and thus does not depend on the details of the helicity ejection process. Scaling to realistic astrophysical parameters suggests that disks around both protostars and stellar mass black holes have Rm >> Rm{sub crit}. Thus, we suggest that the strong Pm dependence seen in recent simulations does not occur in real systems.« less

Initial sediment transport model of the mining-affected Aries River Basin, Romania

USGS Publications Warehouse

Friedel, Michael J.; Linard, Joshua I.

2008-01-01

The Romanian government is interested in understanding the effects of existing and future mining activities on long-term dispersal, storage, and remobilization of sediment-associated metals. An initial Soil and Water Assessment Tool (SWAT) model was prepared using available data to evaluate hypothetical failure of the Valea Sesei tailings dam at the Rosia Poieni mine in the Aries River basin. Using the available data, the initial Aries River Basin SWAT model could not be manually calibrated to accurately reproduce monthly streamflow values observed at the Turda gage station. The poor simulation of the monthly streamflow is attributed to spatially limited soil and precipitation data, limited constraint information due to spatially and temporally limited streamflow measurements, and in ability to obtain optimal parameter values when using a manual calibration process. Suggestions to improve the Aries River basin sediment transport model include accounting for heterogeneity in model input, a two-tier nonlinear calibration strategy, and analysis of uncertainty in predictions.

Giant current fluctuations in an overheated single-electron transistor

NASA Astrophysics Data System (ADS)

Laakso, M. A.; Heikkilä, T. T.; Nazarov, Yuli V.

2010-11-01

Interplay of cotunneling and single-electron tunneling in a thermally isolated single-electron transistor leads to peculiar overheating effects. In particular, there is an interesting crossover interval where the competition between cotunneling and single-electron tunneling changes to the dominance of the latter. In this interval, the current exhibits anomalous sensitivity to the effective electron temperature of the transistor island and its fluctuations. We present a detailed study of the current and temperature fluctuations at this interesting point. The methods implemented allow for a complete characterization of the distribution of the fluctuating quantities, well beyond the Gaussian approximation. We reveal and explore the parameter range where, for sufficiently small transistor islands, the current fluctuations become gigantic. In this regime, the optimal value of the current, its expectation value, and its standard deviation differ from each other by parametrically large factors. This situation is unique for transport in nanostructures and for electron transport in general. The origin of this spectacular effect is the exponential sensitivity of the current to the fluctuating effective temperature.

Distribution and stable isotope composition of leaf wax n-alkanes as tracers for organic matter transport along hydrological transects in the NW Argentine Andes

NASA Astrophysics Data System (ADS)

Tofelde, Stefanie; Sachse, Dirk; Schildgen, Taylor; Strecker, Manfred R.

2015-04-01

The burial of organic matter in marine sediments represents the main long-term sink for reduced carbon in the global carbon cycle, with the fluvial system being the predominant transport mechanism. Organic matter deposited in marine and continental sediments contains valuable information on ecological and climatic conditions, and organic proxy data is thus often used in paleoclimate research. To use sedimentary records to investigate past environmental conditions in the terrestrial realm, processes dictating the transport of organic matter, including spatial and temporal resolution as well as the influence of climatic and tectonic processes, have to be understood. In this study, we test if a lipid biomarker based approach can be used to trace present-day organic matter sources in a fluvial watershed draining two intermontane basins in the southern-central Andes of NW Argentina, a tectonically active region with pronounced topographic, rainfall, and vegetation gradients. We investigated the distribution of long-chain leaf-wax n-alkanes, a terrestrial plant biomarker (and as such representative of terrestrially sourced carbon), in river sediments and coarse particulate organic matter (CPOM) along two altitudinal and hydrological gradients. We used n-alkane abundances and their stable carbon and hydrogen isotopic values as three independent parameters for source discrimination. Additionally, we analyzed the control of environmental parameters on the isotopic signatures in leaf-wax n-alkanes. The general pattern of n-alkane distribution in river sediments and CPOM samples in our study area suggest that vascular plants are the major source of riverine organic matter. The stable carbon isotopic composition of nC29 alkanes suggests a nearly exclusive input of C3 vegetation. Although C4 plants are present in the lower catchment areas, the total percentage is too low to have a detectable influence on the carbon isotopic composition in river sediment and CPOM samples. Considering environmental parameters, nC29 alkane δ13C values are significantly correlated with mean annual rainfall in the respective catchment area, with less negative δ13C values in drier areas (r = - 0.63, p < 0.01). The variability in stable hydrogen isotopic composition (δD) of nC29 alkanes is determined mostly by the δD value of the source water and aridity. We find that the apparent fractionation (?app), defined as the difference in hydrogen isotopic composition of plant source waters and synthesized leaf-wax n-alkanes, is significantly correlated with aridity (r = -0.65, p < 0.005), with a smaller apparent fractionation in drier areas, as well as with mean annual rainfall (r = -0.59, p < 0.01), relative humidity (r = -0.56, p < 0.02), and actual evapotranspiration (r = -0.53, p < 0.05). Our data indicate that vascular plants are the major source of riverine organic matter, with their stable carbon and hydrogen isotopic compositions influenced by climatic parameters. Thus, on spatial scales covering large gradients in environmental parameters, the analysis of leaf-wax n-alkanes can be used for organic matter source assessment in orogenic settings.

GASPLOT - A computer graphics program that draws a variety of thermophysical property charts

NASA Technical Reports Server (NTRS)

Trivisonno, R. J.; Hendricks, R. C.

1977-01-01

A FORTRAN V computer program, written for the UNIVAC 1100 series, is used to draw a variety of precision thermophysical property charts on the Calcomp plotter. In addition to the program (GASPLOT), which requires (15 160) sub 10 storages, a thermophysical properties routine needed to produce plots. The program is designed so that any two of the state variables, the derived variables, or the transport variables may be plotted as the ordinate - abscissa pair with as many as five parametric variables. The parameters may be temperature, pressure, density, enthalpy, and entropy. Each parameter may have as many a 49 values, and the range of the variables is limited only by the thermophysical properties routine.

The viscosity to entropy ratio: From string theory motivated bounds to warm dense matter

DOE PAGES

Faussurier, G.; Libby, S. B.; Silvestrelli, P. L.

2014-07-04

Here, we study the ratio of viscosity to entropy density in Yukawa one-component plasmas as a function of coupling parameter at fixed screening, and in realistic warm dense matter models as a function of temperature at fixed density. In these two situations, the ratio is minimized for values of the coupling parameters that depend on screening, and for temperatures that in turn depend on density and material. In this context, we also examine Rosenfeld arguments relating transport coefficients to excess reduced entropy for Yukawa one-component plasmas. For these cases we show that this ratio is always above the lower-bound conjecturemore » derived from string theory ideas.« less

CXTFIT/Excel A modular adaptable code for parameter estimation, sensitivity analysis and uncertainty analysis for laboratory or field tracer experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Guoping; Mayes, Melanie; Parker, Jack C

2010-01-01

We implemented the widely used CXTFIT code in Excel to provide flexibility and added sensitivity and uncertainty analysis functions to improve transport parameter estimation and to facilitate model discrimination for multi-tracer experiments on structured soils. Analytical solutions for one-dimensional equilibrium and nonequilibrium convection dispersion equations were coded as VBA functions so that they could be used as ordinary math functions in Excel for forward predictions. Macros with user-friendly interfaces were developed for optimization, sensitivity analysis, uncertainty analysis, error propagation, response surface calculation, and Monte Carlo analysis. As a result, any parameter with transformations (e.g., dimensionless, log-transformed, species-dependent reactions, etc.) couldmore » be estimated with uncertainty and sensitivity quantification for multiple tracer data at multiple locations and times. Prior information and observation errors could be incorporated into the weighted nonlinear least squares method with a penalty function. Users are able to change selected parameter values and view the results via embedded graphics, resulting in a flexible tool applicable to modeling transport processes and to teaching students about parameter estimation. The code was verified by comparing to a number of benchmarks with CXTFIT 2.0. It was applied to improve parameter estimation for four typical tracer experiment data sets in the literature using multi-model evaluation and comparison. Additional examples were included to illustrate the flexibilities and advantages of CXTFIT/Excel. The VBA macros were designed for general purpose and could be used for any parameter estimation/model calibration when the forward solution is implemented in Excel. A step-by-step tutorial, example Excel files and the code are provided as supplemental material.« less

Heat transport in the high-pressure ice mantle of large icy moons

NASA Astrophysics Data System (ADS)

Choblet, Gael; Tobie, Gabriel; Sotin, Christophe; Kalousova, Klara; Grasset, Olivier

2017-04-01

While the existence of a buried ocean sandwiched between surface ice and high-pressure (HP) polymorphs of ice emerges as the most plausible structure for the hundreds-of-kilometers thick hydrospheres within large icy moons of the Solar System (Ganymede, Callisto, Titan), little is known about the thermal structure of the deep HP ice mantle and its dynamics, possibly involving melt production and extraction. This has major implications for the thermal history of these objects as well as on the habitability of their ocean as the HP ice mantle is presumed to limit chemical transport from the rock component to the ocean. Here, we describe 3D spherical simulations of subsolidus thermal convection tailored to the specific structure of the HP ice mantle of large icy moons. Melt production is monitored and melt transport is simplified by assuming instantaneous extraction to the ocean above. The two controlling parameters for these models are the rheology of ice VI and the heat flux from the rock core. Reasonable end-members are considered for both parameters as disagreement remains on the former (especially the pressure effect on viscosity) and as the latter is expected to vary significantly during the moon's history. We show that the heat power produced by radioactive decay within the rock core is mainly transported through the HP ice mantle by melt extraction to the ocean, with most of the melt produced directly above the rock/water interface. While the average temperature in the bulk of the HP ice mantle is always relatively cool when compared to the value at the interface with the rock core (˜ 5 K above the value at the surface of the HP ice mantle), maximum temperatures at all depths are close to the melting point, often leading to the interconnection of a melt path via hot convective plume conduits throughout the HP ice mantle. Overall, we predict long periods of time during these moons' history where water generated in contact with the rock core is transported to the above ocean.

Heat transport in the high-pressure ice mantle of large icy moons

NASA Astrophysics Data System (ADS)

Choblet, G.; Tobie, G.; Sotin, C.; Kalousová, K.; Grasset, O.

2017-03-01

While the existence of a buried ocean sandwiched between surface ice and high-pressure (HP) polymorphs of ice emerges as the most plausible structure for the hundreds-of-kilometers thick hydrospheres within large icy moons of the Solar System (Ganymede, Callisto, Titan), little is known about the thermal structure of the deep HP ice mantle and its dynamics, possibly involving melt production and extraction. This has major implications for the thermal history of these objects as well as on the habitability of their ocean as the HP ice mantle is presumed to limit chemical transport from the rock component to the ocean. Here, we describe 3D spherical simulations of subsolidus thermal convection tailored to the specific structure of the HP ice mantle of large icy moons. Melt production is monitored and melt transport is simplified by assuming instantaneous extraction to the ocean above. The two controlling parameters for these models are the rheology of ice VI and the heat flux from the rock core. Reasonable end-members are considered for both parameters as disagreement remains on the former (especially the pressure effect on viscosity) and as the latter is expected to vary significantly during the moon's history. We show that the heat power produced by radioactive decay within the rock core is mainly transported through the HP ice mantle by melt extraction to the ocean, with most of the melt produced directly above the rock/water interface. While the average temperature in the bulk of the HP ice mantle is always relatively cool when compared to the value at the interface with the rock core (∼ 5 K above the value at the surface of the HP ice mantle), maximum temperatures at all depths are close to the melting point, often leading to the interconnection of a melt path via hot convective plume conduits throughout the HP ice mantle. Overall, we predict long periods of time during these moons' history where water generated in contact with the rock core is transported to the above ocean.

Geological entropy and solute transport in heterogeneous porous media

NASA Astrophysics Data System (ADS)

Bianchi, Marco; Pedretti, Daniele

2017-06-01

We propose a novel approach to link solute transport behavior to the physical heterogeneity of the aquifer, which we fully characterize with two measurable parameters: the variance of the log K values (σY2), and a new indicator (HR) that integrates multiple properties of the K field into a global measure of spatial disorder or geological entropy. From the results of a detailed numerical experiment considering solute transport in K fields representing realistic distributions of hydrofacies in alluvial aquifers, we identify empirical relationship between the two parameters and the first three central moments of the distributions of arrival times of solute particles at a selected control plane. The analysis of experimental data indicates that the mean and the variance of the solutes arrival times tend to increase with spatial disorder (i.e., HR increasing), while highly skewed distributions are observed in more orderly structures (i.e., HR decreasing) or at higher σY2. We found that simple closed-form empirical expressions of the bivariate dependency of skewness on HR and σY2 can be used to predict the emergence of non-Fickian transport in K fields considering a range of structures and heterogeneity levels, some of which based on documented real aquifers. The accuracy of these predictions and in general the results from this study indicate that a description of the global variability and structure of the K field in terms of variance and geological entropy offers a valid and broadly applicable approach for the interpretation and prediction of transport in heterogeneous porous media.

Analytical solution for reactive solute transport considering incomplete mixing within a reference elementary volume

NASA Astrophysics Data System (ADS)

Chiogna, Gabriele; Bellin, Alberto

2013-05-01

The laboratory experiments of Gramling et al. (2002) showed that incomplete mixing at the pore scale exerts a significant impact on transport of reactive solutes and that assuming complete mixing leads to overestimation of product concentration in bimolecular reactions. Successively, several attempts have been made to model this experiment, either considering spatial segregation of the reactants, non-Fickian transport applying a Continuous Time Random Walk (CTRW) or an effective upscaled time-dependent kinetic reaction term. Previous analyses of these experimental results showed that, at the Darcy scale, conservative solute transport is well described by a standard advection dispersion equation, which assumes complete mixing at the pore scale. However, reactive transport is significantly affected by incomplete mixing at smaller scales, i.e., within a reference elementary volume (REV). We consider here the family of equilibrium reactions for which the concentration of the reactants and the product can be expressed as a function of the mixing ratio, the concentration of a fictitious non reactive solute. For this type of reactions we propose, in agreement with previous studies, to model the effect of incomplete mixing at scales smaller than the Darcy scale assuming that the mixing ratio is distributed within an REV according to a Beta distribution. We compute the parameters of the Beta model by imposing that the mean concentration is equal to the value that the concentration assumes at the continuum Darcy scale, while the variance decays with time as a power law. We show that our model reproduces the concentration profiles of the reaction product measured in the Gramling et al. (2002) experiments using the transport parameters obtained from conservative experiments and an instantaneous reaction kinetic. The results are obtained applying analytical solutions both for conservative and for reactive solute transport, thereby providing a method to handle the effect of incomplete mixing on multispecies reactive solute transport, which is simpler than other previously developed methods.

Characteristics of melting heat transfer during flow of Carreau fluid induced by a stretching cylinder.

PubMed

Hashim; Khan, Masood; Saleh Alshomrani, Ali

2017-01-01

This article provides a comprehensive analysis of the energy transportation by virtue of the melting process of high-temperature phase change materials. We have developed a two-dimensional model for the boundary layer flow of non-Newtonian Carreau fluid. It is assumed that flow is caused by stretching of a cylinder in the axial direction by means of a linear velocity. Adequate local similarity transformations are employed to determine a set of non-linear ordinary differential equations which govern the flow problem. Numerical solutions to the resultant non-dimensional boundary value problem are computed via the fifth-order Runge-Kutta Fehlberg integration scheme. The solutions are captured for both zero and non-zero curvature parameters, i.e., for flow over a flat plate or flow over a cylinder. The flow and heat transfer attributes are witnessed to be prompted in an intricate manner by the melting parameter, the curvature parameter, the Weissenberg number, the power law index and the Prandtl number. We determined that one of the possible ways to boost the fluid velocity is to increase the melting parameter. Additionally, both the velocity of the fluid and the momentum boundary layer thickness are higher in the case of flow over a stretching cylinder. As expected, the magnitude of the skin friction and the rate of heat transfer decrease by raising the values of the melting parameter and the Weissenberg number.

Analysis of the repaglinide concentration increase produced by gemfibrozil and itraconazole based on the inhibition of the hepatic uptake transporter and metabolic enzymes.

PubMed

Kudo, Toshiyuki; Hisaka, Akihiro; Sugiyama, Yuichi; Ito, Kiyomi

2013-02-01

The plasma concentration of repaglinide is reported to increase greatly when given after repeated oral administration of itraconazole and gemfibrozil. The present study analyzed this interaction based on a physiologically based pharmacokinetic (PBPK) model incorporating inhibition of the hepatic uptake transporter and metabolic enzymes involved in repaglinide disposition. Firstly, the plasma concentration profiles of inhibitors (itraconazole, gemfibrozil, and gemfibrozil glucuronide) were reproduced by a PBPK model to obtain their pharmacokinetic parameters. The plasma concentration profiles of repaglinide were then analyzed by a PBPK model, together with those of the inhibitors, assuming a competitive inhibition of CYP3A4 by itraconazole, mechanism-based inhibition of CYP2C8 by gemfibrozil glucuronide, and inhibition of organic anion transporting polypeptide (OATP) 1B1 by gemfibrozil and its glucuronide. The plasma concentration profiles of repaglinide were well reproduced by the PBPK model based on the above assumptions, and the optimized values for the inhibition constants (0.0676 nM for itraconazole against CYP3A4; 14.2 μM for gemfibrozil against OATP1B1; and 5.48 μM for gemfibrozil glucuronide against OATP1B1) and the fraction of repaglinide metabolized by CYP2C8 (0.801) were consistent with the reported values. The validity of the obtained parameters was further confirmed by sensitivity analyses and by reproducing the repaglinide concentration increase produced by concomitant gemfibrozil administration at various timings/doses. The present findings suggested that the reported concentration increase of repaglinide, suggestive of synergistic effects of the coadministered inhibitors, can be quantitatively explained by the simultaneous inhibition of the multiple clearance pathways of repaglinide.

Geochemical Data Package for Performance Assessment Calculations Related to the Savannah River Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaplan, Daniel I.

The Savannah River Site (SRS) disposes of low-level radioactive waste (LLW) and stabilizes high-level radioactive waste (HLW) tanks in the subsurface environment. Calculations used to establish the radiological limits of these facilities are referred to as Performance Assessments (PA), Special Analyses (SA), and Composite Analyses (CA). The objective of this document is to revise existing geochemical input values used for these calculations. This work builds on earlier compilations of geochemical data (2007, 2010), referred to a geochemical data packages. This work is being conducted as part of the on-going maintenance program of the SRS PA programs that periodically updates calculationsmore » and data packages when new information becomes available. Because application of values without full understanding of their original purpose may lead to misuse, this document also provides the geochemical conceptual model, the approach used for selecting the values, the justification for selecting data, and the assumptions made to assure that the conceptual and numerical geochemical models are reasonably conservative (i.e., bias the recommended input values to reflect conditions that will tend to predict the maximum risk to the hypothetical recipient). This document provides 1088 input parameters for geochemical parameters describing transport processes for 64 elements (>740 radioisotopes) potentially occurring within eight subsurface disposal or tank closure areas: Slit Trenches (ST), Engineered Trenches (ET), Low Activity Waste Vault (LAWV), Intermediate Level (ILV) Vaults, Naval Reactor Component Disposal Areas (NRCDA), Components-in-Grout (CIG) Trenches, Saltstone Facility, and Closed Liquid Waste Tanks. The geochemical parameters described here are the distribution coefficient, Kd value, apparent solubility concentration, k s value, and the cementitious leachate impact factor.« less

Shaping ability of single-file reciprocating and heat-treated multifile rotary systems: a micro-CT study.

PubMed

Marceliano-Alves, M F V; Sousa-Neto, M D; Fidel, S R; Steier, L; Robinson, J P; Pécora, J D; Versiani, M A

2015-12-01

To investigate changes in three-dimensional geometry, in various cross-sectional morphological parameters and in the centring ability of root canals prepared with different preparation systems using microcomputed tomographic imaging technology. Sixty-four mesial canals of mandibular molars were matched based on similar morphological dimensions using micro-CT evaluation and assigned to four experimental groups (n = 16), according to the canal preparation technique: Reciproc, WaveOne, Twisted File and HyFlex CM systems. Changes in several 2D (area, perimeter, form factor, roundness, minor and major diameter) and 3D [volume, surface area, structure model index (SMI)] morphological parameters, as well as canal transportation, were compared with preoperative values using Kruskal-Wallis and anovapost hoc Tukey's tests with the significance level set at 5%. Preparation significantly increased all tested parameters in the experimental groups. No significant differences were observed between groups regarding changes in volume, surface area, SMI, form factor and roundness of the root canal after preparation (P > 0.05). In the apical third, the Reciproc group had significantly greater changes in canal area, perimeter, major and minor diameters than the other groups (P < 0.05). Overall, the Twisted File and HyFlex CM systems were associated with significantly less transportation than the reciprocating instruments, Reciproc and WaveOne (P < 0.05). Shaping procedures led to the enlargement of the root canal space with no evidence of significant preparation errors. Changes in 3D parameters were not different between groups whilst, in the apical third, Reciproc was associated with significantly greater changes in several 2D parameters compared to the other groups. Twisted File and HyFlex CM systems were able to maintain the original canal anatomy with less canal transportation than Reciproc and WaveOne; however, these differences are unlikely to be of clinical significance. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Acclimatization of rats after ground transportation to a new animal facility.

PubMed

Capdevila, S; Giral, M; Ruiz de la Torre, J L; Russell, R J; Kramer, K

2007-04-01

This study aimed to assess the time needed by rats, which had not been previously transported, to acclimate to a new environment after 5 h of van transport, using physiological parameters as measures of acclimatization. Animal shipping boxes and transport van conditions were standardized to minimize stress factors that could be associated with transport. Heart rate (HR), body temperature and activity levels were measured in the rats before and after transport using previously implanted radio-telemetry transmitters. Body weight was also recorded. All parameters were changed significantly except for body temperature. Results suggest that rats take three days to acclimate to a new environment, as measured by the physiological parameters of body weight, HR and activity.

Use of a reactive gas transport model to determine rates of hydrocarbon biodegradation in unsaturated porous media

USGS Publications Warehouse

Baehr, Arthur L.; Baker, Ronald J.

1995-01-01

A mathematical model is presented that simulates the transport and reaction of any number of gaseous phase constituents (e.g. CO2, O2, N2, and hydrocarbons) in unsaturated porous media. The model was developed as part of a method to determine rates of hydrocarbon biodegradation associated with natural cleansing at petroleum product spill sites. The one-dimensional model can be applied to analyze data from column experiments or from field sites where gas transport in the unsaturated zone is approximately vertical. A coupled, non-Fickian constitutive relation between fluxes and concentration gradients, together with the capability of incorporating heterogeneity with respect to model parameters, results in model applicability over a wide range of experimental and field conditions. When applied in a calibration mode, the model allows for the determination of constituent production/consumption rates as a function of the spatial coordinate. Alternatively, the model can be applied in a predictive mode to obtain the distribution of constituent concentrations and fluxes on the basis of assumed values of model parameters and a biodegradation hypothesis. Data requirements for the model are illustrated by analyzing data from a column experiment designed to determine the aerobic degradation rate of toluene in sediments collected from a gasoline spill site in Galloway Township, New Jersey.

Can high fields save the tokamak? The challenge of steady-state operation for low cost compact reactors

NASA Astrophysics Data System (ADS)

Freidberg, Jeffrey; Dogra, Akshunna; Redman, William; Cerfon, Antoine

2016-10-01

The development of high field, high temperature superconductors is thought to be a game changer for the development of fusion power based on the tokamak concept. We test the validity of this assertion for pilot plant scale reactors (Q 10) for two different but related missions: pulsed operation and steady-state operation. Specifically, we derive a set of analytic criteria that determines the basic design parameters of a given fusion reactor mission. As expected there are far more constraints than degrees of freedom in any given design application. However, by defining the mission of the reactor under consideration, we have been able to determine the subset of constraints that drive the design, and calculate the values for the key parameters characterizing the tokamak. Our conclusions are as follows: 1) for pulsed reactors, high field leads to more compact designs and thus cheaper reactors - high B is the way to go; 2) steady-state reactors with H-mode like transport are large, even with high fields. The steady-state constraint is hard to satisfy in compact designs - high B helps but is not enough; 3) I-mode like transport, when combined with high fields, yields relatively compact steady-state reactors - why is there not more research on this favorable transport regime?

Roles of cyclic AMP and Ca in epithelial ion transport across corneal epithelium: a review.

PubMed

Reinach, P S

1985-04-01

The messenger roles of cyclic AMP and the calcium ion in stimulus-secretion coupling are considered in the frog and bovine corneal epithelium, respectively. In the frog cornea, epinephrine stimulates net C1 transport by increasing cyclic AMP content. This stimulation is associated with a larger apical membrane C1 conductance and basolateral membrane ionic conductance. The response of the apical membrane conductance is thought to result from an increase in cyclic AMP content whereas the basolateral membrane ionic conductance increase is unrelated based on measurements of the effects of the calcium channel antagonist, diltiazem, and the beta agonist, isoproterenol, on the electrical parameters and cyclic AMP content. The basolateral membrane is essentially K permselective since the K channel blocker, Ba, depolarized the intracellular potential difference and increased the basolateral membrane resistance. Diltiazem had even larger effects on these parameters suggesting that this compound is a more effective inhibitor of K channel activity than barium. In broken cell preparations of bovine corneal epithelium, a high affinity form of Ca + Mg activated ATPase is present (Km = .06 microM for Ca) and is essentially of plasma membrane origin. This ATPase activation is at a Ca activity similar to the expected intracellular value and suggests that this activity is the enzymatic basis for net Ca transport.

Computer programs for thermodynamic and transport properties of hydrogen (tabcode-II)

NASA Technical Reports Server (NTRS)

Roder, H. M.; Mccarty, R. D.; Hall, W. J.

1972-01-01

The thermodynamic and transport properties of para and equilibrium hydrogen have been programmed into a series of computer routines. Input variables are the pair's pressure-temperature and pressure-enthalpy. The programs cover the range from 1 to 5000 psia with temperatures from the triple point to 6000 R or enthalpies from minus 130 BTU/lb to 25,000 BTU/lb. Output variables are enthalpy or temperature, density, entropy, thermal conductivity, viscosity, at constant volume, the heat capacity ratio, and a heat transfer parameter. Property values on the liquid and vapor boundaries are conveniently obtained through two small routines. The programs achieve high speed by using linear interpolation in a grid of precomputed points which define the surface of the property returned.

A simulation study of the impact of the public-private partnership strategy on the performance of transport infrastructure.

PubMed

Huang, Zhengfeng; Zheng, Pengjun; Ma, Yanqiang; Li, Xuan; Xu, Wenjun; Zhu, Wanlu

2016-01-01

The choice of investment strategy has a great impact on the performance of transport infrastructure. Positive projects such as the "Subway plus Property" model in Hong Kong have created sustainable financial profits for the public transport projects. Owing to a series of public debt and other constraints, public-private partnership (PPP) was introduced as an innovative investment model to address this issue and help develop transport infrastructure. Yet, few studies provide a deeper understanding of relationships between PPP strategy and the performance of such transport projects (particularly the whole transport system). This paper defines the research scope as a regional network of freeway. With a popular PPP model, travel demand prediction method, and relevant parameters as input, agents in a simulation framework can simulate the choice of PPP freeway over time. The simulation framework can be used to analyze the relationship between the PPP strategy and performance of the regional freeway network. This study uses the Freeway Network of Yangtze River Delta (FN-YRD) in China as the context. The results demonstrate the value of using simulation models of complex transportation systems to help decision makers choose the right PPP projects. Such a tool is viewed as particularly important given the ongoing transformation of functions of the Chinese transportation sector, including franchise rights of transport projects, and freeway charging mechanism.

MODFLOW-2000, the U.S. Geological Survey modular ground-water model; user guide to the observation, sensitivity, and parameter-estimation processes and three post-processing programs

USGS Publications Warehouse

Hill, Mary C.; Banta, E.R.; Harbaugh, A.W.; Anderman, E.R.

2000-01-01

This report documents the Observation, Sensitivity, and Parameter-Estimation Processes of the ground-water modeling computer program MODFLOW-2000. The Observation Process generates model-calculated values for comparison with measured, or observed, quantities. A variety of statistics is calculated to quantify this comparison, including a weighted least-squares objective function. In addition, a number of files are produced that can be used to compare the values graphically. The Sensitivity Process calculates the sensitivity of hydraulic heads throughout the model with respect to specified parameters using the accurate sensitivity-equation method. These are called grid sensitivities. If the Observation Process is active, it uses the grid sensitivities to calculate sensitivities for the simulated values associated with the observations. These are called observation sensitivities. Observation sensitivities are used to calculate a number of statistics that can be used (1) to diagnose inadequate data, (2) to identify parameters that probably cannot be estimated by regression using the available observations, and (3) to evaluate the utility of proposed new data. The Parameter-Estimation Process uses a modified Gauss-Newton method to adjust values of user-selected input parameters in an iterative procedure to minimize the value of the weighted least-squares objective function. Statistics produced by the Parameter-Estimation Process can be used to evaluate estimated parameter values; statistics produced by the Observation Process and post-processing program RESAN-2000 can be used to evaluate how accurately the model represents the actual processes; statistics produced by post-processing program YCINT-2000 can be used to quantify the uncertainty of model simulated values. Parameters are defined in the Ground-Water Flow Process input files and can be used to calculate most model inputs, such as: for explicitly defined model layers, horizontal hydraulic conductivity, horizontal anisotropy, vertical hydraulic conductivity or vertical anisotropy, specific storage, and specific yield; and, for implicitly represented layers, vertical hydraulic conductivity. In addition, parameters can be defined to calculate the hydraulic conductance of the River, General-Head Boundary, and Drain Packages; areal recharge rates of the Recharge Package; maximum evapotranspiration of the Evapotranspiration Package; pumpage or the rate of flow at defined-flux boundaries of the Well Package; and the hydraulic head at constant-head boundaries. The spatial variation of model inputs produced using defined parameters is very flexible, including interpolated distributions that require the summation of contributions from different parameters. Observations can include measured hydraulic heads or temporal changes in hydraulic heads, measured gains and losses along head-dependent boundaries (such as streams), flows through constant-head boundaries, and advective transport through the system, which generally would be inferred from measured concentrations. MODFLOW-2000 is intended for use on any computer operating system. The program consists of algorithms programmed in Fortran 90, which efficiently performs numerical calculations and is fully compatible with the newer Fortran 95. The code is easily modified to be compatible with FORTRAN 77. Coordination for multiple processors is accommodated using Message Passing Interface (MPI) commands. The program is designed in a modular fashion that is intended to support inclusion of new capabilities.

Convective flows of generalized time-nonlocal nanofluids through a vertical rectangular channel

NASA Astrophysics Data System (ADS)

Ahmed, Najma; Vieru, Dumitru; Fetecau, Constantin; Shah, Nehad Ali

2018-05-01

Time-nonlocal generalized model of the natural convection heat transfer and nanofluid flows through a rectangular vertical channel with wall conditions of the Robin type are studied. The generalized mathematical model with time-nonlocality is developed by considering the fractional constitutive equations for the shear stress and thermal flux defined with the time-fractional Caputo derivative. The Caputo power-law non-local kernel provides the damping to the velocity and temperature gradient; therefore, transport processes are influenced by the histories at all past and present times. Analytical solutions for dimensionless velocity and temperature fields are obtained by using the Laplace transform coupled with the finite sine-cosine Fourier transform which is suitable to problems with boundary conditions of the Robin type. Particularizing the fractional thermal and velocity parameters, solutions for three simplified models are obtained (classical linear momentum equation with damped thermal flux; fractional shear stress constitutive equation with classical Fourier's law for thermal flux; classical shear stress and thermal flux constitutive equations). It is found that the thermal histories strongly influence the thermal transport for small values of time t. Also, the thermal transport can be enhanced if the thermal fractional parameter decreases or by increasing the nanoparticles' volume fraction. The velocity field is influenced on the one hand by the temperature of the fluid and on the other by the damping of the velocity gradient introduced by the fractional derivative. Also, the transport motions of the channel walls influence the motion of the fluid layers located near them.

Using periodic orbits to compute chaotic transport rates between resonance zones.

PubMed

Sattari, Sulimon; Mitchell, Kevin A

2017-11-01

Transport properties of chaotic systems are computable from data extracted from periodic orbits. Given a sufficient number of periodic orbits, the escape rate can be computed using the spectral determinant, a function that incorporates the eigenvalues and periods of periodic orbits. The escape rate computed from periodic orbits converges to the true value as more and more periodic orbits are included. Escape from a given region of phase space can be computed by considering only periodic orbits that lie within the region. An accurate symbolic dynamics along with a corresponding partitioning of phase space is useful for systematically obtaining all periodic orbits up to a given period, to ensure that no important periodic orbits are missing in the computation. Homotopic lobe dynamics (HLD) is an automated technique for computing accurate partitions and symbolic dynamics for maps using the topological forcing of intersections of stable and unstable manifolds of a few periodic anchor orbits. In this study, we apply the HLD technique to compute symbolic dynamics and periodic orbits, which are then used to find escape rates from different regions of phase space for the Hénon map. We focus on computing escape rates in parameter ranges spanning hyperbolic plateaus, which are parameter intervals where the dynamics is hyperbolic and the symbolic dynamics does not change. After the periodic orbits are computed for a single parameter value within a hyperbolic plateau, periodic orbit continuation is used to compute periodic orbits over an interval that spans the hyperbolic plateau. The escape rates computed from a few thousand periodic orbits agree with escape rates computed from Monte Carlo simulations requiring hundreds of billions of orbits.

Impact of Submarine Groundwater Discharge on Marine Water Quality and Reef Biota of Maui

PubMed Central

Bishop, James M.

2016-01-01

Generally unseen and infrequently measured, submarine groundwater discharge (SGD) can transport potentially large loads of nutrients and other land-based contaminants to coastal ecosystems. To examine this linkage we employed algal bioassays, benthic community analysis, and geochemical methods to examine water quality and community parameters of nearshore reefs adjacent to a variety of potential, land-based nutrient sources on Maui. Three common reef algae, Acanthophora spicifera, Hypnea musciformis, and Ulva spp. were collected and/or deployed at six locations with SGD. Algal tissue nitrogen (N) parameters (δ15N, N %, and C:N) were compared with nutrient and δ15N-nitrate values of coastal groundwater and nearshore surface water at all locations. Benthic community composition was estimated for ten 10-m transects per location. Reefs adjacent to sugarcane farms had the greatest abundance of macroalgae, low species diversity, and the highest concentrations of N in algal tissues, coastal groundwater, and marine surface waters compared to locations with low anthropogenic impact. Based on δ15N values of algal tissues, we estimate ca. 0.31 km2 of Kahului Bay is impacted by effluent injected underground at the Kahului Wastewater Reclamation Facility (WRF); this region is barren of corals and almost entirely dominated by colonial zoanthids. Significant correlations among parameters of algal tissue N with adjacent surface and coastal groundwater N indicate that these bioassays provided a useful measure of nutrient source and loading. A conceptual model that uses Ulva spp. tissue δ15N and N % to identify potential N source(s) and relative N loading is proposed for Hawaiʻi. These results indicate that SGD can be a significant transport pathway for land-based nutrients with important biogeochemical and ecological implications in tropical, oceanic islands. PMID:27812171

Impact of Submarine Groundwater Discharge on Marine Water Quality and Reef Biota of Maui.

PubMed

Amato, Daniel W; Bishop, James M; Glenn, Craig R; Dulai, Henrietta; Smith, Celia M

2016-01-01

Generally unseen and infrequently measured, submarine groundwater discharge (SGD) can transport potentially large loads of nutrients and other land-based contaminants to coastal ecosystems. To examine this linkage we employed algal bioassays, benthic community analysis, and geochemical methods to examine water quality and community parameters of nearshore reefs adjacent to a variety of potential, land-based nutrient sources on Maui. Three common reef algae, Acanthophora spicifera, Hypnea musciformis, and Ulva spp. were collected and/or deployed at six locations with SGD. Algal tissue nitrogen (N) parameters (δ15N, N %, and C:N) were compared with nutrient and δ15N-nitrate values of coastal groundwater and nearshore surface water at all locations. Benthic community composition was estimated for ten 10-m transects per location. Reefs adjacent to sugarcane farms had the greatest abundance of macroalgae, low species diversity, and the highest concentrations of N in algal tissues, coastal groundwater, and marine surface waters compared to locations with low anthropogenic impact. Based on δ15N values of algal tissues, we estimate ca. 0.31 km2 of Kahului Bay is impacted by effluent injected underground at the Kahului Wastewater Reclamation Facility (WRF); this region is barren of corals and almost entirely dominated by colonial zoanthids. Significant correlations among parameters of algal tissue N with adjacent surface and coastal groundwater N indicate that these bioassays provided a useful measure of nutrient source and loading. A conceptual model that uses Ulva spp. tissue δ15N and N % to identify potential N source(s) and relative N loading is proposed for Hawai'i. These results indicate that SGD can be a significant transport pathway for land-based nutrients with important biogeochemical and ecological implications in tropical, oceanic islands.

A new multistage groundwater transport inverse method: presentation, evaluation, and implications

USGS Publications Warehouse

Anderman, Evan R.; Hill, Mary C.

1999-01-01

More computationally efficient methods of using concentration data are needed to estimate groundwater flow and transport parameters. This work introduces and evaluates a three‐stage nonlinear‐regression‐based iterative procedure in which trial advective‐front locations link decoupled flow and transport models. Method accuracy and efficiency are evaluated by comparing results to those obtained when flow‐ and transport‐model parameters are estimated simultaneously. The new method is evaluated as conclusively as possible by using a simple test case that includes distinct flow and transport parameters, but does not include any approximations that are problem dependent. The test case is analytical; the only flow parameter is a constant velocity, and the transport parameters are longitudinal and transverse dispersivity. Any difficulties detected using the new method in this ideal situation are likely to be exacerbated in practical problems. Monte‐Carlo analysis of observation error ensures that no specific error realization obscures the results. Results indicate that, while this, and probably other, multistage methods do not always produce optimal parameter estimates, the computational advantage may make them useful in some circumstances, perhaps as a precursor to using a simultaneous method.

Sensitivity analyses of a colloid-facilitated contaminant transport model for unsaturated heterogeneous soil conditions.

NASA Astrophysics Data System (ADS)

Périard, Yann; José Gumiere, Silvio; Rousseau, Alain N.; Caron, Jean

2013-04-01

Certain contaminants may travel faster through soils when they are sorbed to subsurface colloidal particles. Indeed, subsurface colloids may act as carriers of some contaminants accelerating their translocation through the soil into the water table. This phenomenon is known as colloid-facilitated contaminant transport. It plays a significant role in contaminant transport in soils and has been recognized as a source of groundwater contamination. From a mechanistic point of view, the attachment/detachment of the colloidal particles from the soil matrix or from the air-water interface and the straining process may modify the hydraulic properties of the porous media. Šimůnek et al. (2006) developed a model that can simulate the colloid-facilitated contaminant transport in variably saturated porous media. The model is based on the solution of a modified advection-dispersion equation that accounts for several processes, namely: straining, exclusion and attachement/detachement kinetics of colloids through the soil matrix. The solutions of these governing, partial differential equations are obtained using a standard Galerkin-type, linear finite element scheme, implemented in the HYDRUS-2D/3D software (Šimůnek et al., 2012). Modeling colloid transport through the soil and the interaction of colloids with the soil matrix and other contaminants is complex and requires the characterization of many model parameters. In practice, it is very difficult to assess actual transport parameter values, so they are often calibrated. However, before calibration, one needs to know which parameters have the greatest impact on output variables. This kind of information can be obtained through a sensitivity analysis of the model. The main objective of this work is to perform local and global sensitivity analyses of the colloid-facilitated contaminant transport module of HYDRUS. Sensitivity analysis was performed in two steps: (i) we applied a screening method based on Morris' elementary effects and the one-at-a-time approach (O.A.T); and (ii), we applied Sobol's global sensitivity analysis method which is based on variance decompositions. Results illustrate that ψm (maximum sorption rate of mobile colloids), kdmc (solute desorption rate from mobile colloids), and Ks (saturated hydraulic conductivity) are the most sensitive parameters with respect to the contaminant travel time. The analyses indicate that this new module is able to simulate the colloid-facilitated contaminant transport. However, validations under laboratory conditions are needed to confirm the occurrence of the colloid transport phenomenon and to understand model prediction under non-saturated soil conditions. Future work will involve monitoring of the colloidal transport phenomenon through soil column experiments. The anticipated outcome will provide valuable information on the understanding of the dominant mechanisms responsible for colloidal transports, colloid-facilitated contaminant transport and, also, the colloid detachment/deposition processes impacts on soil hydraulic properties. References: Šimůnek, J., C. He, L. Pang, & S. A. Bradford, Colloid-Facilitated Solute Transport in Variably Saturated Porous Media: Numerical Model and Experimental Verification, Vadose Zone Journal, 2006, 5, 1035-1047 Šimůnek, J., M. Šejna, & M. Th. van Genuchten, The C-Ride Module for HYDRUS (2D/3D) Simulating Two-Dimensional Colloid-Facilitated Solute Transport in Variably-Saturated Porous Media, Version 1.0, PC Progress, Prague, Czech Republic, 45 pp., 2012.

Application of a data assimilation method via an ensemble Kalman filter to reactive urea hydrolysis transport modeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Juxiu Tong; Bill X. Hu; Hai Huang

2014-03-01

With growing importance of water resources in the world, remediations of anthropogenic contaminations due to reactive solute transport become even more important. A good understanding of reactive rate parameters such as kinetic parameters is the key to accurately predicting reactive solute transport processes and designing corresponding remediation schemes. For modeling reactive solute transport, it is very difficult to estimate chemical reaction rate parameters due to complex processes of chemical reactions and limited available data. To find a method to get the reactive rate parameters for the reactive urea hydrolysis transport modeling and obtain more accurate prediction for the chemical concentrations,more » we developed a data assimilation method based on an ensemble Kalman filter (EnKF) method to calibrate reactive rate parameters for modeling urea hydrolysis transport in a synthetic one-dimensional column at laboratory scale and to update modeling prediction. We applied a constrained EnKF method to pose constraints to the updated reactive rate parameters and the predicted solute concentrations based on their physical meanings after the data assimilation calibration. From the study results we concluded that we could efficiently improve the chemical reactive rate parameters with the data assimilation method via the EnKF, and at the same time we could improve solute concentration prediction. The more data we assimilated, the more accurate the reactive rate parameters and concentration prediction. The filter divergence problem was also solved in this study.« less

Overview of transport, fast particle and heating and current drive physics using tritium in JET plasmas

NASA Astrophysics Data System (ADS)

Stork, D.; Baranov, Yu.; Belo, P.; Bertalot, L.; Borba, D.; Brzozowski, J. H.; Challis, C. D.; Ciric, D.; Conroy, S.; de Baar, M.; de Vries, P.; Dumortier, P.; Garzotti, L.; Hawkes, N. C.; Hender, T. C.; Joffrin, E.; Jones, T. T. C.; Kiptily, V.; Lamalle, P.; Mailloux, J.; Mantsinen, M.; McDonald, D. C.; Nave, M. F. F.; Neu, R.; O'Mullane, M.; Ongena, J.; Pearce, R. J.; Popovichev, S.; Sharapov, S. E.; Stamp, M.; Stober, J.; Surrey, E.; Valovic, M.; Voitsekhovitch, I.; Weisen, H.; Whiteford, A. D.; Worth, L.; Yavorskij, V.; Zastrow, K.-D.; EFDA contributors, JET

2005-10-01

Results are presented from the JET Trace Tritium Experimental (TTE) campaign using minority tritium (T) plasmas (nT/nD < 3%). Thermal tritium particle transport coefficients (DT, vT) are found to exceed neo-classical values in all regimes, except in ELMy H-modes at high densities and in the region of internal transport barriers (ITBs) in reversed shear plasmas. In ELMy H-mode dimensionless parameter scans, at q95 ~ 2.8 and triangularity δ = 0.2, the T particle transport scales in a gyro-Bohm manner in the inner plasma (r/a < 0.4), whilst the outer plasma particle transport scaling is more Bohm-like. Dimensionless parameter scans show contrasting behaviour for the trace particle confinement (increases with collisionality, ν* and β) and bulk energy confinement (decreases with ν* and is independent of β). In an extended ELMy H-mode data set, with ρ*, ν*, β and q varied but with neo-classical tearing modes (NTMs) either absent or limited to weak, benign core modes (4/3 or above), the multiparameter fit to the normalized diffusion coefficient in the outer plasma (0.65 < r/a < 0.8) gives DT/Bphi ~ ρ*2.46ν*-0.23β-1.01q2.03. In hybrid scenarios (qmin ~ 1, low positive shear, no sawteeth), the T particle confinement is found to scale with increasing triangularity and plasma current. Comparing regimes (ELMy H-mode, ITB plasma and hybrid scenarios) in the outer plasma region, a correlation of high values of DT with high values of vT is seen. The normalized diffusion coefficients for the hybrid and ITB scenarios do not fit the scaling derived for ELMy H-modes. The normalized tritium diffusion scales with normalized poloidal Larmor radius (\\rho_{\\theta}^\\ast=q\\rho^{\\ast}) in a manner close to gyro-Bohm ({\\sim}\\rho_{\\theta}^{\\ast 3}) , with an added inverse β dependence. The effects of ELMs, sawteeth and NTMs on the T particle transport are described. Fast-ion confinement in current-hole (CH) plasmas was tested in TTE by tritium neutral beam injection into JET CH plasmas. γ-rays from the reactions of fusion alpha and beryllium impurities (9Be(α, nγ)12C) characterized the fast fusion-alpha population evolution. The γ-decay times are consistent with classical alpha plus parent fast triton slowing down times (τTs + ταs) for high plasma currents (Ip > 2 MA) and monotonic q-profiles. In CH discharges the γ-ray emission decay times are much lower than classical (τTs+ταs), indicating alpha confinement degradation, due to the orbit losses and particle orbit drift predicted by a 3-D Fokker-Planck numerical code and modelled using TRANSP.

Optimal Equilibria and Plasma Parameter Evolutions for the Ignitor Experiment*

NASA Astrophysics Data System (ADS)

Airoldi, A.; Cenacchi, G.; Coppi, B.

2011-10-01

In view of the operation of the Ignitor machine in both the H and the I-regime, optimal equilibrium configurations that can sustain plasma currents Ip up to 10 MA with a double X-point have been identified. In fact, the emergence of the I-regime in double X-point configurations has not been observed experimentally yet. The characteristics of the magnetic equilibrium configurations that can be produced play a crucial role in the performance of the machine. Therefore, particular care has been devoted to the study of plasma equilibria relevant to the main phases of the discharge evolution. A series of simulations to be utilized for the control of the relevant (sub-ignited) plasma parameters has been carried out using the JETTO transport code considering different values of the plasma current and, correspondingly, of the magnetic field. Special attention has been devoted to non-igniting experiments with Ip = 5 MA and BT = 8 T, where BT is the toroidal magnetic field, as they can be performed with much better duty cycles and longer duration than experiments aimed at reaching the most extreme plasma parameters and ignition in particular. The results of the relevant analyses with a discussion of the adopted transport coefficients is presented. * Sponsored in part by ENEA and the U.S. DOE.

Impact of capillary flow hydrodynamics on carrier-mediated transport of opioid derivatives at the blood-brain barrier, based on pH-dependent Michaelis-Menten and Crone-Renkin analyses.

PubMed

Yusof, Siti R; Abbott, N Joan; Avdeef, Alex

2017-08-30

Most studies of blood-brain barrier (BBB) permeability and transport are conducted at a single pH, but more detailed information can be revealed by using multiple pH values. A pH-dependent biophysical model was applied to the mechanistic analysis of published pH-dependent BBB luminal uptake data from three opioid derivatives in rat: pentazocine (Suzuki et al., 2002a, 2002b), naloxone (Suzuki et al., 2010a), and oxycodone (Okura et al., 2008). Two types of data were processed: in situ brain perfusion (ISBP) and brain uptake index (BUI). The published perfusion data were converted to apparent luminal permeability values, P app , and analyzed by the pCEL-X program (Yusof et al., 2014), using the pH-dependent Crone-Renkin equation (pH-CRE) to determine the impact of cerebrovascular flow on the Michaelis-Menten transport parameters (Avdeef and Sun, 2011). For oxycodone, the ISBP data had been measured at pH7.4 and 8.4. The present analysis indicates a 7-fold lower value of the cerebrovascular flow velocity, F pf , than that expected in the original study. From the pyrilamine-inhibited data, the flow-corrected passive intrinsic permeability value was determined to be P 0 =398×10 -6 cm·s -1 . The uptake data indicate that the neutral form of oxycodone is affected by a transporter at pH8.4. The extent of the cation uptake was less certain from the available data. For pentazocine, the brain uptake by the BUI method had been measured at pH5.5, 6.5, and 7.4, in a concentration range 0.1-40mM. Under similar conditions, ISBP data were also available. The pH-CRE determined values of F pf from both methods were nearly the same, and were smaller than the expected value in the original publication. The transport of the cationic pentazocine was not fully saturated at pH5.5 at 40mM. The transport of the neutral species at pH7.4 appeared to reach saturation at 40mM pentazocine concentration, but not at 12mM. In the case of naloxone, a pH-dependent Michaelis-Menten equation (pH-MME) analysis of the data indicated a smooth sigmoidal transition from a higher capacity uptake process affecting cationic naloxone (pH5.0-7.0) to a lower capacity uptake process affecting the neutral drug (pH8.0-8.5), with cross-over point near pH7.4. Evidently, measurements at multiple pH values can reveal important information about both cerebrovascular flow and BBB transport kinetics. Copyright © 2017 Elsevier B.V. All rights reserved.

The impact of transportation on physiological and behavioral parameters in Wistar rats: implications for acclimatization periods.

PubMed

Arts, Johanna W M; Kramer, Klaas; Arndt, Saskia S; Ohl, Frauke

2012-01-01

Transportation of laboratory rodents unavoidably causes stress. Nevertheless, very little is known about the effects of transportation and how long it takes for the animal to recuperate. In the present study, we investigated physiological and behavioral parameters before and after transportation in both transported and nontransported animals. We took blood samples to analyze plasma corticosterone and creatine kinase, and performed physiological measurements by means of telemetry, measuring heart rate, blood pressure, and activity. Behavior was measured by means of home cage observations. This study revealed that plasma corticosterone levels increased at least up to 16 days after transportation, blood pressure and heart rate showed a lasting decrease after transportation, grooming increased, and social interactions and locomotor activity decreased after transportation. With these data we demonstrate that there is a long-lasting effect of transportation on physiological and behavioral parameters. Our results show that the stressful impact of transportation embraces all parts of the procedure, including for example the packing of the animals. Researchers must be aware of this impact and provide a sufficient acclimatization period to allow for the (re-)stabilization of parameters. Insufficient acclimatization periods endanger not only the reliability of research results but also the welfare of the animal used.

Effects of microscale inertia on heat or mass transfer from a drop

NASA Astrophysics Data System (ADS)

Krishnamurthy, Deepak; Subramanian, Ganesh

2012-11-01

Heat or mass transport from suspensions of solid particles or drops is ubiquitous in many industrial processes. In the zero inertia limit the transport is diffusion limited owing to the presence of closed streamlines around each particle. A small but finite amount of inertia though, results in a vastly different picture, greatly enhancing transport by destroying the closed streamline configuration. We develop a theoretical formulation to study the effects of weak inertia on transport from a density-matched drop in a 2D linear flow. It is shown that, unlike a solid particle, the near-surface streamlines are closed only when the viscosity ratio (λ) exceeds a critical value λc = 2 α / (1- α) , where α is the linear flow parameter measuring relative magnitudes of extension and vorticity. The velocity field on the drop surface can be characterized using a complex-valued analogue of the (C, τ) coordinate system used to describe Jeffrey orbits of an axisymmetric particle. In the open-streamline case (λ < λ c) , convective transport occurs even with zero inertia, and for large Peclet number (Pe) (the relative magnitude of convective to diffusive transport), the Nusselt number (dimensionless rate of heat transfer) is expected to scale as F(α, λ) Pe1/2 and is determined via a boundary layer analysis in the (C, τ) coordinate system. In the closed streamline case (λ > λ c) , similar to the solid particle, inertia plays a crucial role, and the Nusselt number must scale as G(α, λ)Re1/2Pe1/2. A methodology is developed to analyze the convection along spiraling streamlines using a physically motivated choice of coordinate system on the drop surface.

A full-Bayesian approach to parameter inference from tracer travel time moments and investigation of scale effects at the Cape Cod experimental site

USGS Publications Warehouse

Woodbury, Allan D.; Rubin, Yoram

2000-01-01

A method for inverting the travel time moments of solutes in heterogeneous aquifers is presented and is based on peak concentration arrival times as measured at various samplers in an aquifer. The approach combines a Lagrangian [Rubin and Dagan, 1992] solute transport framework with full‐Bayesian hydrogeological parameter inference. In the full‐Bayesian approach the noise values in the observed data are treated as hyperparameters, and their effects are removed by marginalization. The prior probability density functions (pdfs) for the model parameters (horizontal integral scale, velocity, and log K variance) and noise values are represented by prior pdfs developed from minimum relative entropy considerations. Analysis of the Cape Cod (Massachusetts) field experiment is presented. Inverse results for the hydraulic parameters indicate an expected value for the velocity, variance of log hydraulic conductivity, and horizontal integral scale of 0.42 m/d, 0.26, and 3.0 m, respectively. While these results are consistent with various direct‐field determinations, the importance of the findings is in the reduction of confidence range about the various expected values. On selected control planes we compare observed travel time frequency histograms with the theoretical pdf, conditioned on the observed travel time moments. We observe a positive skew in the travel time pdf which tends to decrease as the travel time distance grows. We also test the hypothesis that there is no scale dependence of the integral scale λ with the scale of the experiment at Cape Cod. We adopt two strategies. The first strategy is to use subsets of the full data set and then to see if the resulting parameter fits are different as we use different data from control planes at expanding distances from the source. The second approach is from the viewpoint of entropy concentration. No increase in integral scale with distance is inferred from either approach over the range of the Cape Cod tracer experiment.

Effects of finite coverage on global polarization observables in heavy ion collisions

NASA Astrophysics Data System (ADS)

Lan, Shaowei; Lin, Zi-Wei; Shi, Shusu; Sun, Xu

2018-05-01

In non-central relativistic heavy ion collisions, the created matter possesses a large initial orbital angular momentum. Particles produced in the collisions could be polarized globally in the direction of the orbital angular momentum due to spin-orbit coupling. Recently, the STAR experiment has presented polarization signals for Λ hyperons and possible spin alignment signals for ϕ mesons. Here we discuss the effects of finite coverage on these observables. The results from a multi-phase transport and a toy model both indicate that a pseudorapidity coverage narrower than | η | < ∼ 1 will generate a larger value for the extracted ϕ-meson ρ00 parameter; thus a finite coverage can lead to an artificial deviation of ρ00 from 1/3. We also show that a finite η and pT coverage affect the extracted pH parameter for Λ hyperons when the real pH value is non-zero. Therefore proper corrections are necessary to reliably quantify the global polarization with experimental observables.

On the density scaling of pVT data and transport properties for molecular and ionic liquids.

PubMed

López, Enriqueta R; Pensado, Alfonso S; Fernández, Josefa; Harris, Kenneth R

2012-06-07

In this work, a general equation of state (EOS) recently derived by Grzybowski et al. [Phys. Rev. E 83, 041505 (2011)] is applied to 51 molecular and ionic liquids in order to perform density scaling of pVT data employing the scaling exponent γ(EOS). It is found that the scaling is excellent in most cases examined. γ(EOS) values range from 6.1 for ammonia to 13.3 for the ionic liquid [C(4)C(1)im][BF(4)]. These γ(EOS) values are compared with results recently reported by us [E. R. López, A. S. Pensado, M. J. P. Comuñas, A. A. H. Pádua, J. Fernández, and K. R. Harris, J. Chem. Phys. 134, 144507 (2011)] for the scaling exponent γ obtained for several different transport properties, namely, the viscosity, self-diffusion coefficient, and electrical conductivity. For the majority of the compounds examined, γ(EOS) > γ, but for hexane, heptane, octane, cyclopentane, cyclohexane, CCl(4), dimethyl carbonate, m-xylene, and decalin, γ(EOS) < γ. In addition, we find that the γ(EOS) values are very much higher than those of γ for alcohols, pentaerythritol esters, and ionic liquids. For viscosities and the self-diffusion coefficient-temperature ratio, we have tested the relation linking EOS and dynamic scaling parameters, proposed by Paluch et al. [J. Phys. Chem. Lett. 1, 987-992 (2010)] and Grzybowski et al. [J. Chem. Phys. 133, 161101 (2010); Phys. Rev. E 82, 013501 (2010)], that is, γ = (γ(EOS)/φ) + γ(G), where φ is the stretching parameter of the modified Avramov relation for the density scaling of a transport property, and γ(G) is the Grüneisen constant. This relationship is based on data for structural relaxation times near the glass transition temperature for seven molecular liquids, including glass formers, and a single ionic liquid. For all the compounds examined in our much larger database the ratio (γ(EOS)/φ) is actually higher than γ, with the only exceptions of propylene carbonate and 1-methylnaphthalene. Therefore, it seems the relation proposed by Paluch et al. applies only in certain cases, and is really not generally applicable to liquid transport properties such as viscosities, self-diffusion coefficients or electrical conductivities when examined over broad ranges of temperature and pressure.

Ascent trajectory dispersion analysis for WTR heads-up space shuttle trajectory

NASA Technical Reports Server (NTRS)

1986-01-01

The results of a Space Transportation System ascent trajectory dispersion analysis are discussed. The purpose is to provide critical trajectory parameter values for assessing the Space Shuttle in a heads-up configuration launched from the Western Test Range (STR). This analysis was conducted using a trajectory profile based on a launch from the WTR in December. The analysis consisted of the following steps: (1) nominal trajectories were simulated under the conditions as specified by baseline reference mission guidelines; (2) dispersion trajectories were simulated using predetermined parametric variations; (3) requirements for a system-related composite trajectory were determined by a root-sum-square (RSS) analysis of the positive deviations between values of the aerodynamic heating indicator (AHI) generated by the dispersion and nominal trajectories; (4) using the RSS assessment as a guideline, the system related composite trajectory was simulated by combinations of dispersion parameters which represented major contributors; (5) an assessment of environmental perturbations via a RSS analysis was made by the combination of plus or minus 2 sigma atmospheric density variation and 95% directional design wind dispersions; (6) maximum aerodynamic heating trajectories were simulated by variation of dispersion parameters which would emulate the summation of the system-related RSS and environmental RSS values of AHI. The maximum aerodynamic heating trajectories were simulated consistent with the directional winds used in the environmental analysis.

Numerical Modeling System for Shoreline Change.

DTIC Science & Technology

1986-10-01

waves and currents remains essentially unchanged, the behavior of a beach fill can be estimated (James 1975; Shore Protection Manual (SPM) 1984... Htp K( 0 ) KR(cxtp, Dip, D) Ks(D) / Ks(Dtp) (15) S.. .G Io Go -ZVI / 4-9 where KD is the diffraction coefficient, 8 is the geometric angle for a line...angle to the x-axis. For the value of the longshore sand transport parameter, K1 in Eq. (5a), Komar and Inman (1979) and the Shore Protection Manual

General solution of a fractional Parker diffusion-convection equation describing the superdiffusive transport of energetic particles

NASA Astrophysics Data System (ADS)

Tawfik, Ashraf M.; Fichtner, Horst; Elhanbaly, A.; Schlickeiser, Reinhard

2018-06-01

Anomalous diffusion models of energetic particles in space plasmas are developed by introducing the fractional Parker diffusion-convection equation. Analytical solution of the space-time fractional equation is obtained by use of the Caputo and Riesz-Feller fractional derivatives with the Laplace-Fourier transforms. The solution is given in terms of the Fox H-function. Profiles of particle densities are illustrated for different values of the space fractional order and the so-called skewness parameter.

Lateral stability and control derivatives extracted from five early flights of the space shuttle Columbia

NASA Technical Reports Server (NTRS)

Schiess, J. R.

1986-01-01

Flight data taken from the first five flights (STS-2, 3, 4, 5 and 9) of the Space Transportation System Shuttle Columbia during entry are analyzed to determine the Shuttle lateral aerodynamic characteristics. Maximum likelihood estimation is applied to data derived from accelerometer and rate gyro measurements and trajectory, meteorological and control surface data to estimate lateral-directional stability and control derivatives. The estimated parameters are compared across the five flights and to preflight predicted values.

Upscaling of nanoparticle transport in porous media under unfavorable conditions: Pore scale to Darcy scale

NASA Astrophysics Data System (ADS)

Seetha, N.; Raoof, Amir; Mohan Kumar, M. S.; Majid Hassanizadeh, S.

2017-05-01

Transport and deposition of nanoparticles in porous media is a multi-scale problem governed by several pore-scale processes, and hence, it is critical to link the processes at pore scale to the Darcy-scale behavior. In this study, using pore network modeling, we develop correlation equations for deposition rate coefficients for nanoparticle transport under unfavorable conditions at the Darcy scale based on pore-scale mechanisms. The upscaling tool is a multi-directional pore-network model consisting of an interconnected network of pores with variable connectivities. Correlation equations describing the pore-averaged deposition rate coefficients under unfavorable conditions in a cylindrical pore, developed in our earlier studies, are employed for each pore element. Pore-network simulations are performed for a wide range of parameter values to obtain the breakthrough curves of nanoparticle concentration. The latter is fitted with macroscopic 1-D advection-dispersion equation with a two-site linear reversible deposition accounting for both equilibrium and kinetic sorption. This leads to the estimation of three Darcy-scale deposition coefficients: distribution coefficient, kinetic rate constant, and the fraction of equilibrium sites. The correlation equations for the Darcy-scale deposition coefficients, under unfavorable conditions, are provided as a function of measurable Darcy-scale parameters, including: porosity, mean pore throat radius, mean pore water velocity, nanoparticle radius, ionic strength, dielectric constant, viscosity, temperature, and surface potentials of the particle and grain surfaces. The correlation equations are found to be consistent with the available experimental results, and in qualitative agreement with Colloid Filtration Theory for all parameters, except for the mean pore water velocity and nanoparticle radius.

Dynamic characteristics of organic bulk-heterojunction solar cells

NASA Astrophysics Data System (ADS)

Babenko, S. D.; Balakai, A. A.; Moskvin, Yu. L.; Simbirtseva, G. V.; Troshin, P. A.

2010-12-01

Transient characteristics of organic bulk-heterojunction solar cells have been studied using pulsed laser probing. An analysis of the photoresponse waveforms of a typical solar cell measured by varying load resistance within broad range at different values of the bias voltage provided detailed information on the photocell parameters that characterize electron-transport properties of active layers. It is established that the charge carrier mobility is sufficient to ensure high values of the fill factor (˜0.6) in the obtained photocells. On approaching the no-load voltage, the differential capacitance of the photocell exhibits a sixfold increase as compared to the geometric capacitance. A possible mechanism of recombination losses in the active medium is proposed.

Evaluation of five dry particle deposition parameterizations for incorporation into atmospheric transport models

NASA Astrophysics Data System (ADS)

Khan, Tanvir R.; Perlinger, Judith A.

2017-10-01

Despite considerable effort to develop mechanistic dry particle deposition parameterizations for atmospheric transport models, current knowledge has been inadequate to propose quantitative measures of the relative performance of available parameterizations. In this study, we evaluated the performance of five dry particle deposition parameterizations developed by Zhang et al. (2001) (Z01), Petroff and Zhang (2010) (PZ10), Kouznetsov and Sofiev (2012) (KS12), Zhang and He (2014) (ZH14), and Zhang and Shao (2014) (ZS14), respectively. The evaluation was performed in three dimensions: model ability to reproduce observed deposition velocities, Vd (accuracy); the influence of imprecision in input parameter values on the modeled Vd (uncertainty); and identification of the most influential parameter(s) (sensitivity). The accuracy of the modeled Vd was evaluated using observations obtained from five land use categories (LUCs): grass, coniferous and deciduous forests, natural water, and ice/snow. To ascertain the uncertainty in modeled Vd, and quantify the influence of imprecision in key model input parameters, a Monte Carlo uncertainty analysis was performed. The Sobol' sensitivity analysis was conducted with the objective to determine the parameter ranking from the most to the least influential. Comparing the normalized mean bias factors (indicators of accuracy), we find that the ZH14 parameterization is the most accurate for all LUCs except for coniferous forest, for which it is second most accurate. From Monte Carlo simulations, the estimated mean normalized uncertainties in the modeled Vd obtained for seven particle sizes (ranging from 0.005 to 2.5 µm) for the five LUCs are 17, 12, 13, 16, and 27 % for the Z01, PZ10, KS12, ZH14, and ZS14 parameterizations, respectively. From the Sobol' sensitivity results, we suggest that the parameter rankings vary by particle size and LUC for a given parameterization. Overall, for dp = 0.001 to 1.0 µm, friction velocity was one of the three most influential parameters in all parameterizations. For giant particles (dp = 10 µm), relative humidity was the most influential parameter. Because it is the least complex of the five parameterizations, and it has the greatest accuracy and least uncertainty, we propose that the ZH14 parameterization is currently superior for incorporation into atmospheric transport models.

Are grain packing and flow turbulence the keys to predicting bedload transport in steep streams? (Invited)

NASA Astrophysics Data System (ADS)

Yager, E.; Monsalve Sepulveda, A.; Smith, H. J.; Badoux, A.

2013-12-01

Bedload transport rates in steep mountain channels are often over-predicted by orders of magnitude, which has been attributed to a range of processes from grain jamming, roughness drag, changes in fluid turbulence and a limited upstream sediment supply. We hypothesize that such poor predictions occur in part because the grain-scale mechanics (turbulence, particle arrangements) of sediment transport are not well understood or incorporated into simplified reach-averaged calculations. To better quantify how turbulence impacts sediment movement, we measured detailed flow velocities and forces at the onset of motion of a single test grain with a fixed pocket geometry in laboratory flume experiments. Of all measured parameters (e.g. flow velocity, shear stress), the local fluid drag force had the highest statistical correlation with grain motion. Use of flow velocity or shear stress to estimate sediment transport may therefore result in erroneous predictions given their relatively low correlation to the onset of sediment motion. To further understand the role of grain arrangement on bedload transport, we measured in situ grain resisting forces to motion (using a force sensor) for a range of grain sizes and patch classes in the Erlenbach torrent, Switzerland (10% gradient). Such forces varied by over two orders of magnitude for a given grain weight and were statistically greater than those calculated using empirical equations for the friction angle. In addition, when normalized by the grain weight, the resisting forces declined with higher grain protrusion above the surrounding bed sediment. Therefore, resisting forces from grain packing and interlocking are substantial and depend on the amount of grain burial. The onset of motion may be considerably under-estimated when calculated solely from measured grain sizes and friction angles. These packing forces may partly explain why critical Shields stresses are higher in steep channels. Such flow and grain parameters also spatially vary in steep streams because of boulder steps and patches of different grain size distributions. To determine if this spatial variation is important for bedload transport, we incorporated probability density functions of flow turbulence and patch grain size distributions into a simple bedload transport equation. Predicted bedload fluxes were significantly improved when distributions of these parameters, rather than single reach-averaged values, were used.

A strategy to determine operating parameters in tissue engineering hollow fiber bioreactors

PubMed Central

Shipley, RJ; Davidson, AJ; Chan, K; Chaudhuri, JB; Waters, SL; Ellis, MJ

2011-01-01

The development of tissue engineering hollow fiber bioreactors (HFB) requires the optimal design of the geometry and operation parameters of the system. This article provides a strategy for specifying operating conditions for the system based on mathematical models of oxygen delivery to the cell population. Analytical and numerical solutions of these models are developed based on Michaelis–Menten kinetics. Depending on the minimum oxygen concentration required to culture a functional cell population, together with the oxygen uptake kinetics, the strategy dictates the model needed to describe mass transport so that the operating conditions can be defined. If cmin ≫ Km we capture oxygen uptake using zero-order kinetics and proceed analytically. This enables operating equations to be developed that allow the user to choose the medium flow rate, lumen length, and ECS depth to provide a prescribed value of cmin. When , we use numerical techniques to solve full Michaelis–Menten kinetics and present operating data for the bioreactor. The strategy presented utilizes both analytical and numerical approaches and can be applied to any cell type with known oxygen transport properties and uptake kinetics. PMID:21370228

Evaluating Conceptual Site Models with Multicomponent Reactive Transport Modeling

NASA Astrophysics Data System (ADS)

Dai, Z.; Heffner, D.; Price, V.; Temples, T. J.; Nicholson, T. J.

2005-05-01

Modeling ground-water flow and multicomponent reactive chemical transport is a useful approach for testing conceptual site models and assessing the design of monitoring networks. A graded approach with three conceptual site models is presented here with a field case of tetrachloroethene (PCE) transport and biodegradation near Charleston, SC. The first model assumed a one-layer homogeneous aquifer structure with semi-infinite boundary conditions, in which an analytical solution of the reactive solute transport can be obtained with BIOCHLOR (Aziz et al., 1999). Due to the over-simplification of the aquifer structure, this simulation cannot reproduce the monitoring data. In the second approach we used GMS to develop the conceptual site model, a layer-cake multi-aquifer system, and applied a numerical module (MODFLOW and RT3D within GMS) to solve the flow and reactive transport problem. The results were better than the first approach but still did not fit the plume well because the geological structures were still inadequately defined. In the third approach we developed a complex conceptual site model by interpreting log and seismic survey data with Petra and PetraSeis. We detected a major channel and a younger channel, through the PCE source area. These channels control the local ground-water flow direction and provide a preferential chemical transport pathway. Results using the third conceptual site model agree well with the monitoring concentration data. This study confirms that the bias and uncertainty from inadequate conceptual models are much larger than those introduced from an inadequate choice of model parameter values (Neuman and Wierenga, 2003; Meyer et al., 2004). Numerical modeling in this case provides key insight into the hydrogeology and geochemistry of the field site for predicting contaminant transport in the future. Finally, critical monitoring points and performance indicator parameters are selected for future monitoring to confirm system performance.

Concept Design of Trailor Ferry Service to Carry 150 Trailers Between Jacksonville, FL and Bridgeport, CT of USA

NASA Astrophysics Data System (ADS)

Sindagi, S. C.; Sandhu, B. S.

2015-04-01

With the increased load on highways, today there is a need to develop alternate ways to transport goods within the sovereignty. The use of ships to transport goods has always been the primary method of transporting goods across the seas but it can also be used to transport goods within the country. This way we can reduce the load on highways which at this point of time serve as the primary method of transportation. Worldwide very few ferries are in operation which transports 100-150 Trailers between two ports. Catching on this opportunity for design, construction and operation of vessels, a survey for possible routes in United States of America which will transport 150 Trailers has been conducted by various authorities and organizations. The challenge here is to determine the parameters of the vessel and design a fleet of vessels that could carry trailers along with their tractors within the least possible time and in with least possible freight between Jacksonville, FL and Bridgeport, CT of United States of America. The primary aim of the work presented here is to propose a design with fleet in such a way that each day 150 trailers could be loaded and unloaded at each of the two mentioned ports. An analysis of the route between the ports brought out various primary parameters like the distance, weather, different load lines to be encountered and also several size constraints that the vessel needs to adhere to, in order to ply smoothly on this route. The vessel is designed as per the Guidelines for ships operating in international waters. The economic analysis of the project was performed spanning over 20 years and the best freight was found out which would be most profitable for the company as well as be a good value for money for the customers.

Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices

NASA Astrophysics Data System (ADS)

K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.

2017-10-01

The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

Modeling the influence of variable pH on the transport of zinc in a contaminated aquifer using semiempirical surface complexation models

USGS Publications Warehouse

Kent, D.B.; Abrams, R.H.; Davis, J.A.; Coston, J.A.; LeBlanc, D.R.

2000-01-01

Land disposal of sewage effluent resulted in contamination of a sand and gravel aquifer (Cape Cod, Massachusetts) with zinc (Zn). The distribution of Zn was controlled by pH‐dependent adsorption; the Zn extended 15 m into the 30‐m‐thick sewage plume within approximately 100 m of the source but only 2–4 m into the plume between 100 and 400 m downgradient. A two‐dimensional vertical cross section model coupling groundwater flow with solute transport and equilibrium adsorption is used to simulate the influence of pH on Zn transport. Adsorption is described using semiempirical surface complexation models (SCM) by writing chemical reactions between dissolved Zn and mineral surface sites. SCM parameters were determined in independent laboratory experiments. A 59‐year simulation with a one‐site SCM describes the influence of pH on Zn transport well, with greater mobility at the low pH values near the upper sewage plume boundary than at the higher pH values deeper in the sewage‐contaminated zone. Simulation with a two‐site SCM describes both the sharpness and approximate location of the leading edge of the Zn‐contaminated region. Temporal variations in pH of incoming groundwater can result in large increases in Zn concentration and mobility. The influence of spatial and temporal variability in pH on adsorption and transport of Zn was accomplished much more easily with the semiempirical SCM approach than could be achieved with distribution coefficients or adsorption isotherms.

Wake Vortex Inverse Model User's Guide

NASA Technical Reports Server (NTRS)

Lai, David; Delisi, Donald

2008-01-01

NorthWest Research Associates (NWRA) has developed an inverse model for inverting landing aircraft vortex data. The data used for the inversion are the time evolution of the lateral transport position and vertical position of both the port and starboard vortices. The inverse model performs iterative forward model runs using various estimates of vortex parameters, vertical crosswind profiles, and vortex circulation as a function of wake age. Forward model predictions of lateral transport and altitude are then compared with the observed data. Differences between the data and model predictions guide the choice of vortex parameter values, crosswind profile and circulation evolution in the next iteration. Iterations are performed until a user-defined criterion is satisfied. Currently, the inverse model is set to stop when the improvement in the rms deviation between the data and model predictions is less than 1 percent for two consecutive iterations. The forward model used in this inverse model is a modified version of the Shear-APA model. A detailed description of this forward model, the inverse model, and its validation are presented in a different report (Lai, Mellman, Robins, and Delisi, 2007). This document is a User's Guide for the Wake Vortex Inverse Model. Section 2 presents an overview of the inverse model program. Execution of the inverse model is described in Section 3. When executing the inverse model, a user is requested to provide the name of an input file which contains the inverse model parameters, the various datasets, and directories needed for the inversion. A detailed description of the list of parameters in the inversion input file is presented in Section 4. A user has an option to save the inversion results of each lidar track in a mat-file (a condensed data file in Matlab format). These saved mat-files can be used for post-inversion analysis. A description of the contents of the saved files is given in Section 5. An example of an inversion input file, with preferred parameters values, is given in Appendix A. An example of the plot generated at a normal completion of the inversion is shown in Appendix B.

Anomalous solute transport in saturated porous media: Relating transport model parameters to electrical and nuclear magnetic resonance properties

USGS Publications Warehouse

Swanson, Ryan D; Binley, Andrew; Keating, Kristina; France, Samantha; Osterman, Gordon; Day-Lewis, Frederick D.; Singha, Kamini

2015-01-01

The advection-dispersion equation (ADE) fails to describe commonly observed non-Fickian solute transport in saturated porous media, necessitating the use of other models such as the dual-domain mass-transfer (DDMT) model. DDMT model parameters are commonly calibrated via curve fitting, providing little insight into the relation between effective parameters and physical properties of the medium. There is a clear need for material characterization techniques that can provide insight into the geometry and connectedness of pore spaces related to transport model parameters. Here, we consider proton nuclear magnetic resonance (NMR), direct-current (DC) resistivity, and complex conductivity (CC) measurements for this purpose, and assess these methods using glass beads as a control and two different samples of the zeolite clinoptilolite, a material that demonstrates non-Fickian transport due to intragranular porosity. We estimate DDMT parameters via calibration of a transport model to column-scale solute tracer tests, and compare NMR, DC resistivity, CC results, which reveal that grain size alone does not control transport properties and measured geophysical parameters; rather, volume and arrangement of the pore space play important roles. NMR cannot provide estimates of more-mobile and less-mobile pore volumes in the absence of tracer tests because these estimates depend critically on the selection of a material-dependent and flow-dependent cutoff time. Increased electrical connectedness from DC resistivity measurements are associated with greater mobile pore space determined from transport model calibration. CC was hypothesized to be related to length scales of mass transfer, but the CC response is unrelated to DDMT.

Method and apparatus for optical phase error correction

DOEpatents

DeRose, Christopher; Bender, Daniel A.

2014-09-02

The phase value of a phase-sensitive optical device, which includes an optical transport region, is modified by laser processing. At least a portion of the optical transport region is exposed to a laser beam such that the phase value is changed from a first phase value to a second phase value, where the second phase value is different from the first phase value. The portion of the optical transport region that is exposed to the laser beam can be a surface of the optical transport region or a portion of the volume of the optical transport region. In an embodiment of the invention, the phase value of the optical device is corrected by laser processing. At least a portion of the optical transport region is exposed to a laser beam until the phase value of the optical device is within a specified tolerance of a target phase value.

Light extinction by fine atmospheric particles in the White Mountains region of New Hampshire and its relationship to air mass transport.

PubMed

Slater, John F; Dibb, Jack E; Keim, Barry D; Talbot, Robert W

2002-03-27

Chemical, optical, and physical measurements of fine aerosols (aerodynamic diameter < or = 2.5 microm) have been performed at a mountaintop location adjacent to the White Mountain National Forest in northern NH, USA. A 1-month long sampling campaign was conducted at Cranmore Mountain during spring 2000. We report on the apportionment of light extinction by fine aerosols into its major chemical components, and relationships between variations in aerosol parameters and changes in air mass origin. Filter-based, 24-h integrated samples were collected and analyzed for major inorganic ions, as well as organic (OC), elemental (EC), and total carbon. Light scattering and light absorption coefficients were measured at 5-min intervals using an integrating nephelometer and a light absorption photometer. Fine particle number density was measured with a condensation particle counter. Air mass origins and transport patterns were investigated through the use of 3-day backward trajectories and a synoptic climate classification system. Two distinct transport regimes were observed: (1) flow from the north/northeast (N/NE) occurred during 9 out of 18 sample-days; and (2) flow from the west/southwest (W/SW) occurred 8 out of 18 sample-days. All measured and derived aerosol and meteorological parameters were separated into two categories based on these different flow scenarios. During W/SW flow, higher values of aerosol chemical concentration, absorption and scattering coefficients, number density, and haziness were observed compared to N/NE flow. The highest level of haziness was associated with the climate classification Frontal Atlantic Return, which brought polluted air into the region from the mid-Atlantic corridor. Fine particle mass scattering efficiencies of (NH4)2SO4 and OC were 5.35 +/- 0.42 m2 g(-1) and 1.56 +/- 0.40 m2 g(-1), respectively, when transport was out of the N/NE. When transport was from the W/SW the values were 4.94 +/- 0.68 m2 g(-1) for (NH4)2SO4 and 2.18 +/- 0.91 m2 g(-1) for OC. EC mass absorption efficiency when transport was from the N/NE was 9.66 +/- 1.06 m2 g(-1) and 10.80 +/- 1.76 m2 g(-1) when transport was from the W/SW. Results from this work can be used to predict visual air quality in the White Mountain National Forest based on a forecasted synoptic climate classification and its associated visibility.

Analysis of time series of Cs-137 concentration in sewage sludge at Fukushima City

NASA Astrophysics Data System (ADS)

Fischer, Helmut W.; Mack, Majvor; Shikano, Yudai; Yokoo, Yoshiyuki

2015-04-01

Daily routine radioisotope measurements of sewage sludge at the sewage plant of Fukushima City starting in 2011 have provided a detailed data set for the isotopes Cs-137, Cs-134 and I-131. The long-term trend for the Cs isotopes is comparable to data sets from Central Europe caused by the Chernobyl emissions in 1986 - the average Cs-137 concentration decreases faster in the first year (T1/2 < 1 yr) and slower in later years (T1/2 > 1 yr). Absolute values at Fukushima City are comparably low (mostly below 1 kBq/kg dry mass), due to the existence of separate wastewater and rainwater sewer systems, with only a small portion of rainwater and erosion products reaching the purification plant. Cs-134 data decay faster due to the shorter radioactive half-life. I-131 appears even years after the NPP releases and is assumed to originate from the common medical usage of the isotope for thyroid treatment. Short-term Cs data show a clear dependence on rainfall: each significant rainfall event causes a concentration increase in sludge of up to a factor of ten. Therefore the time series exhibits high short-term variability. Here we attempt to numerically analyse the detailed Cs-137 data set, using two separate approaches: The first method tries to connect parameters like the local surface deposition density, surface types (sealed/unsealed), rainfall statistics, rainfall-induced erosion rate, leakage rate from rainwater to wastewater sewer, transport time in the sewer and residence time in the purification plant for a basically physical approach. As not all parameters are known, values have to be assumed or can be extracted in the course of the fitting process. The second approach is purely heuristic, based on a water surface runoff and transport model. Whilst there is no ad-hoc physical meaning in the extracted parameters, they can possibly be interpreted as such when compared with physical modeling results. The combination of both methods is expected to give a deeper insight into the transport dynamics of radioisotopes in contaminated areas, helping to identify important sources and sinks and to predict long-term behaviour.

Screening tool to evaluate the vulnerability of down-gradient receptors to groundwater contaminants from uncapped landfills

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baker, Ronald J.; Reilly, Timothy J.; Lopez, Anthony

2015-09-15

Highlights: • A spreadsheet-based risk screening tool for groundwater affected by landfills is presented. • Domenico solute transport equations are used to estimate downgradient contaminant concentrations. • Landfills are categorized as presenting high, moderate or low risks. • Analysis of parameter sensitivity and examples of the method’s application are given. • The method has value to regulators and those considering redeveloping closed landfills. - Abstract: A screening tool for quantifying levels of concern for contaminants detected in monitoring wells on or near landfills to down-gradient receptors (streams, wetlands and residential lots) was developed and evaluated. The tool uses Quick Domenicomore » Multi-scenario (QDM), a spreadsheet implementation of Domenico-based solute transport, to estimate concentrations of contaminants reaching receptors under steady-state conditions from a constant-strength source. Unlike most other available Domenico-based model applications, QDM calculates the time for down-gradient contaminant concentrations to approach steady state and appropriate dispersivity values, and allows for up to fifty simulations on a single spreadsheet. Sensitivity of QDM solutions to critical model parameters was quantified. The screening tool uses QDM results to categorize landfills as having high, moderate and low levels of concern, based on contaminant concentrations reaching receptors relative to regulatory concentrations. The application of this tool was demonstrated by assessing levels of concern (as defined by the New Jersey Pinelands Commission) for thirty closed, uncapped landfills in the New Jersey Pinelands National Reserve, using historic water-quality data from monitoring wells on and near landfills and hydraulic parameters from regional flow models. Twelve of these landfills are categorized as having high levels of concern, indicating a need for further assessment. This tool is not a replacement for conventional numerically-based transport model or other available Domenico-based applications, but is suitable for quickly assessing the level of concern posed by a landfill or other contaminant point source before expensive and lengthy monitoring or remediation measures are taken. In addition to quantifying the level of concern using historic groundwater-monitoring data, the tool allows for archiving model scenarios and adding refinements as new data become available.« less

Electrically facilitated molecular transport. Analysis of the relative contributions of diffusion, migration, and electroosmosis to solute transport in an ion-exchange membrane.

PubMed

Bath, B D; White, H S; Scott, E R

2000-02-01

Electrically facilitated molecular transport in an ion-exchange membrane (Nafion, 1100 equiv wt) has been studied using a scanning electrochemical microscope. The transport rates of ferrocenylmethyltrimethylammonium (a cation), acetaminophen (a neutral molecule), and ascorbate (an anion) through approximately 120-micron-thick membranes were measured as a function of the iontophoretic current passed across the membrane (-1.0 to +1.0 A/cm2). Transport rates were analyzed by employing the Nernst-Planck equation, modified to account for electric field-driven convective transport. Excellent agreement between experimental and theoretical values of the molecular flux was obtained using a single fitting parameter for each molecule (electroosmotic drag coefficient). The electroosmotic velocity of the neutral molecule, acetaminophen, was shown to be a factor of approximately 500 larger than that of the cation ferrocenylmethyltrimethylammonium, a consequence of the electrostatic interaction of the cation with the negatively charged pore walls of the ion-exchange membrane. Electroosmotic transport of ascorbate occurred at a negligible rate due to repulsion of the anion by the cation-selective membrane. These results suggest that electroosmotic velocities of solute molecules are determined by specific chemical interactions of the permeant and membrane and may be very different from the average solution velocity. The efficiency of electroosmotic transport was also shown to be a function of the membrane thickness, in addition to membrane/solute interactions.

Modifying Bagnold's Sediment Transport Equation for Use in Watershed-Scale Channel Incision Models

NASA Astrophysics Data System (ADS)

Lammers, R. W.; Bledsoe, B. P.

2016-12-01

Destabilized stream channels may evolve through a sequence of stages, initiated by bed incision and followed by bank erosion and widening. Channel incision can be modeled using Exner-type mass balance equations, but model accuracy is limited by the accuracy and applicability of the selected sediment transport equation. Additionally, many sediment transport relationships require significant data inputs, limiting their usefulness in data-poor environments. Bagnold's empirical relationship for bedload transport is attractive because it is based on stream power, a relatively straightforward parameter to estimate using remote sensing data. However, the equation is also dependent on flow depth, which is more difficult to measure or estimate for entire drainage networks. We recast Bagnold's original sediment transport equation using specific discharge in place of flow depth. Using a large dataset of sediment transport rates from the literature, we show that this approach yields similar predictive accuracy as other stream power based relationships. We also explore the applicability of various critical stream power equations, including Bagnold's original, and support previous conclusions that these critical values can be predicted well based solely on sediment grain size. In addition, we propagate error in these sediment transport equations through channel incision modeling to compare the errors associated with our equation to alternative formulations. This new version of Bagnold's bedload transport equation has utility for channel incision modeling at larger spatial scales using widely available and remote sensing data.

Utility usage forecasting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hosking, Jonathan R. M.; Natarajan, Ramesh

The computer creates a utility demand forecast model for weather parameters by receiving a plurality of utility parameter values, wherein each received utility parameter value corresponds to a weather parameter value. Determining that a range of weather parameter values lacks a sufficient amount of corresponding received utility parameter values. Determining one or more utility parameter values that corresponds to the range of weather parameter values. Creating a model which correlates the received and the determined utility parameter values with the corresponding weather parameters values.

Towards elucidation of the drug release mechanism from compressed hydrophilic matrices made of cellulose ethers. III. Critical use of thermodynamic parameters of activation for modeling the water penetration and drug release processes.

PubMed

Ferrero, Carmen; Massuelle, Danielle; Jeannerat, Damien; Doelker, Eric

2013-09-10

The two main purposes of this work were: (i) to critically consider the use of thermodynamic parameters of activation for elucidating the drug release mechanism from hydroxypropyl methylcellulose (HPMC) matrices, and (ii) to examine the effect of neutral (pH 6) and acidic (pH 2) media on the release mechanism. For this, caffeine was chosen as model drug and various processes were investigated for the effect of temperature and pH: caffeine diffusion in solution and HPMC gels, and drug release from and water penetration into the HPMC tablets. Generally, the kinetics of the processes was not significantly affected by pH. As for the temperature dependence, the activation energy (E(a)) values calculated from caffeine diffusivities were in the range of Fickian transport (20-40 kJ mol⁻¹). Regarding caffeine release from HPMC matrices, fitting the profiles using the Korsmeyer-Peppas model would indicate anomalous transport. However, the low apparent E(a) values obtained were not compatible with a swelling-controlled mechanism and can be assigned to the dimensional change of the system during drug release. Unexpectedly, negative apparent E(a) values were calculated for the water uptake process, which can be ascribed to the exothermic dissolution of water into the initially dry HPMC, the expansion of the matrix and the polymer dissolution. Taking these contributions into account, the true E(a) would fall into the range valid for Fickian diffusion. Consequently, a relaxation-controlled release mechanism can be dismissed. The apparent anomalous drug release from HPMC matrices results from a coupled Fickian diffusion-erosion mechanism, both at pH 6 and 2. Copyright © 2013 Elsevier B.V. All rights reserved.

Phase space analysis for anisotropic universe with nonlinear bulk viscosity

NASA Astrophysics Data System (ADS)

Sharif, M.; Mumtaz, Saadia

2018-06-01

In this paper, we discuss phase space analysis of locally rotationally symmetric Bianchi type I universe model by taking a noninteracting mixture of dust like and viscous radiation like fluid whose viscous pressure satisfies a nonlinear version of the Israel-Stewart transport equation. An autonomous system of equations is established by defining normalized dimensionless variables. In order to investigate stability of the system, we evaluate corresponding critical points for different values of the parameters. We also compute power-law scale factor whose behavior indicates different phases of the universe model. It is found that our analysis does not provide a complete immune from fine-tuning because the exponentially expanding solution occurs only for a particular range of parameters. We conclude that stable solutions exist in the presence of nonlinear model for bulk viscosity with different choices of the constant parameter m for anisotropic universe.

Red Cell Properties after Different Modes of Blood Transportation

PubMed Central

Makhro, Asya; Huisjes, Rick; Verhagen, Liesbeth P.; Mañú-Pereira, María del Mar; Llaudet-Planas, Esther; Petkova-Kirova, Polina; Wang, Jue; Eichler, Hermann; Bogdanova, Anna; van Wijk, Richard; Vives-Corrons, Joan-Lluís; Kaestner, Lars

2016-01-01

Transportation of blood samples is unavoidable for assessment of specific parameters in blood of patients with rare anemias, blood doping testing, or for research purposes. Despite the awareness that shipment may substantially alter multiple parameters, no study of that extent has been performed to assess these changes and optimize shipment conditions to reduce transportation-related artifacts. Here we investigate the changes in multiple parameters in blood of healthy donors over 72 h of simulated shipment conditions. Three different anticoagulants (K3EDTA, Sodium Heparin, and citrate-based CPDA) for two temperatures (4°C and room temperature) were tested to define the optimal transportation conditions. Parameters measured cover common cytology and biochemistry parameters (complete blood count, hematocrit, morphological examination), red blood cell (RBC) volume, ion content and density, membrane properties and stability (hemolysis, osmotic fragility, membrane heat stability, patch-clamp investigations, and formation of micro vesicles), Ca2+ handling, RBC metabolism, activity of numerous enzymes, and O2 transport capacity. Our findings indicate that individual sets of parameters may require different shipment settings (anticoagulants, temperature). Most of the parameters except for ion (Na+, K+, Ca2+) handling and, possibly, reticulocytes counts, tend to favor transportation at 4°C. Whereas plasma and intraerythrocytic Ca2+ cannot be accurately measured in the presence of chelators such as citrate and EDTA, the majority of Ca2+-dependent parameters are stabilized in CPDA samples. Even in blood samples from healthy donors transported using an optimized shipment protocol, the majority of parameters were stable within 24 h, a condition that may not hold for the samples of patients with rare anemias. This implies for as short as possible shipping using fast courier services to the closest expert laboratory at reach. Mobile laboratories or the travel of the patients to the specialized laboratories may be the only option for some groups of patients with highly unstable RBCs. PMID:27471472

One- and Two-Equation Models to Simulate Ion Transport in Charged Porous Electrodes

DOE PAGES

Gabitto, Jorge; Tsouris, Costas

2018-01-19

Energy storage in porous capacitor materials, capacitive deionization (CDI) for water desalination, capacitive energy generation, geophysical applications, and removal of heavy ions from wastewater streams are some examples of processes where understanding of ionic transport processes in charged porous media is very important. In this work, one- and two-equation models are derived to simulate ionic transport processes in heterogeneous porous media comprising two different pore sizes. It is based on a theory for capacitive charging by ideally polarizable porous electrodes without Faradaic reactions or specific adsorption of ions. A two-step volume averaging technique is used to derive the averaged transportmore » equations for multi-ionic systems without any further assumptions, such as thin electrical double layers or Donnan equilibrium. A comparison between both models is presented. The effective transport parameters for isotropic porous media are calculated by solving the corresponding closure problems. An approximate analytical procedure is proposed to solve the closure problems. Numerical and theoretical calculations show that the approximate analytical procedure yields adequate solutions. Lastly, a theoretical analysis shows that the value of interphase pseudo-transport coefficients determines which model to use.« less

One- and Two-Equation Models to Simulate Ion Transport in Charged Porous Electrodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabitto, Jorge; Tsouris, Costas

Energy storage in porous capacitor materials, capacitive deionization (CDI) for water desalination, capacitive energy generation, geophysical applications, and removal of heavy ions from wastewater streams are some examples of processes where understanding of ionic transport processes in charged porous media is very important. In this work, one- and two-equation models are derived to simulate ionic transport processes in heterogeneous porous media comprising two different pore sizes. It is based on a theory for capacitive charging by ideally polarizable porous electrodes without Faradaic reactions or specific adsorption of ions. A two-step volume averaging technique is used to derive the averaged transportmore » equations for multi-ionic systems without any further assumptions, such as thin electrical double layers or Donnan equilibrium. A comparison between both models is presented. The effective transport parameters for isotropic porous media are calculated by solving the corresponding closure problems. An approximate analytical procedure is proposed to solve the closure problems. Numerical and theoretical calculations show that the approximate analytical procedure yields adequate solutions. Lastly, a theoretical analysis shows that the value of interphase pseudo-transport coefficients determines which model to use.« less

Monte Carlo simulation based on dynamic disorder model in organic semiconductors: From coherent to incoherent transport

NASA Astrophysics Data System (ADS)

Yao, Yao; Si, Wei; Hou, Xiaoyuan; Wu, Chang-Qin

2012-06-01

The dynamic disorder model for charge carrier transport in organic semiconductors has been extensively studied in recent years. Although it is successful on determining the value of bandlike mobility in the organic crystalline materials, the incoherent hopping, the typical transport characteristic in amorphous molecular semiconductors, cannot be described. In this work, the decoherence process is taken into account via a phenomenological parameter, say, decoherence time, and the projective and Monte Carlo method are applied for this model to determine the waiting time and thus the diffusion coefficient. It is obtained that the type of transport is changed from coherent to incoherent with a sufficiently short decoherence time, which indicates the essential role of decoherence time in determining the type of transport in organics. We have also discussed the spatial extent of carriers for different decoherence time, and the transition from delocalization (carrier resides in about 10 molecules) to localization is observed. Based on the experimental results of spatial extent, we estimate that the decoherence time in pentacene has the order of 1 ps. Furthermore, the dependence of diffusion coefficient on decoherence time is also investigated, and corresponding experiments are discussed.

Monte Carlo simulation based on dynamic disorder model in organic semiconductors: from coherent to incoherent transport.

PubMed

Yao, Yao; Si, Wei; Hou, Xiaoyuan; Wu, Chang-Qin

2012-06-21

The dynamic disorder model for charge carrier transport in organic semiconductors has been extensively studied in recent years. Although it is successful on determining the value of bandlike mobility in the organic crystalline materials, the incoherent hopping, the typical transport characteristic in amorphous molecular semiconductors, cannot be described. In this work, the decoherence process is taken into account via a phenomenological parameter, say, decoherence time, and the projective and Monte Carlo method are applied for this model to determine the waiting time and thus the diffusion coefficient. It is obtained that the type of transport is changed from coherent to incoherent with a sufficiently short decoherence time, which indicates the essential role of decoherence time in determining the type of transport in organics. We have also discussed the spatial extent of carriers for different decoherence time, and the transition from delocalization (carrier resides in about 10 molecules) to localization is observed. Based on the experimental results of spatial extent, we estimate that the decoherence time in pentacene has the order of 1 ps. Furthermore, the dependence of diffusion coefficient on decoherence time is also investigated, and corresponding experiments are discussed.

Analysis of Conservative Tracer Tests in the Bullfrog, Tram, and Prow Pass Tuffs, 1996 to 1998, Yucca Mountain, Nye County, Nevada

USGS Publications Warehouse

Umari, Amjad; Fahy, Michael F.; Earle, John D.; Tucci, Patrick

2008-01-01

To evaluate the potential for transport of radionuclides in ground water from the proposed high-level nuclear-waste repository at Yucca Mountain, Nevada, conservative (nonsorbing) tracer tests were conducted among three boreholes, known as the C-hole Complex, and values for transport (or flow) porosity, storage (or matrix) porosity, longitudinal dispersivity, and the extent of matrix diffusion were obtained. The C-holes are completed in a sequence of Miocene tuffaceous rock, consisting of nonwelded to densely welded ash-flow tuff with intervals of ash-fall tuff and volcaniclastic rocks, covered by Quaternary alluvium. The lower part of the tuffaceous-rock sequence includes the Prow Pass, Bullfrog, and Tram Tuffs of the Crater Flat Group. The rocks are pervaded by tectonic and cooling fractures. Paleozoic limestone and dolomite underlie the tuffaceous rocks. Four radially convergent and one partially recirculating conservative (nonsorbing) tracer tests were conducted at the C-hole Complex from 1996 to 1998 to establish values for flow porosity, storage porosity, longitudinal dispersivity, and extent of matrix diffusion in the Bullfrog and Tram Tuffs and the Prow Pass Tuff. Tracer tests included (1) injection of iodide into the combined Bullfrog-Tram interval; (2) injection of 2,6 difluorobenzoic acid into the Lower Bullfrog interval; (3) injection of 3-carbamoyl-2-pyridone into the Lower Bullfrog interval; and (4) injection of iodide and 2,4,5 trifluorobenzoic acid, followed by 2,3,4,5 tetrafluorobenzoic acid, into the Prow Pass Tuff. All tracer tests were analyzed by the Moench single- and dual-porosity analytical solutions to the advection-dispersion equation or by superposition of these solutions. Nonlinear regression techniques were used to corroborate tracer solution results, to obtain optimal parameter values from the solutions, and to quantify parameter uncertainty resulting from analyzing two of the three radially convergent conservative tracer tests conducted in the Bullfrog and Tram intervals. Longitudinal dispersivity values in the Bullfrog and Tram Tuffs ranged from 1.83 to 2.6 meters, flow-porosity values from 0.072 to 0.099, and matrix-porosity values from 0.088 to 0.19. The flow-porosity values indicate that the pathways between boreholes UE-25 c#2 and UE-25 c#3 in the Bullfrog and Tram intervals are not connected well. Tracer testing in the Prow Pass interval indicates different transport characteristics than those obtained in the Bullfrog and Tram intervals. In the Prow Pass Tuff, longitudinal dispersivity was 0.27 meter, flow porosity was 4.5 ? 10?4, and matrix porosity was 0.01. This indicates that the flow network in the Prow Pass is dominated by interconnected fractures, whereas in the Bullfrog and Tram, the flow network is dominated by discontinuous fractures with connecting segments of matrix.

Toroidal ripple transport of beam ions in the mega-ampere spherical tokamak

DOE Office of Scientific and Technical Information (OSTI.GOV)

McClements, K. G.; Hole, M. J.

The transport of injected beam ions due to toroidal magnetic field ripple in the mega-ampere spherical tokamak (MAST) is quantified using a full orbit particle tracking code, with collisional slowing-down and pitch-angle scattering by electrons and bulk ions taken into account. It is shown that the level of ripple losses is generally rather low, although it depends sensitively on the major radius of the outer midplane plasma edge; for typical values of this parameter in MAST plasmas, the reduction in beam heating power due specifically to ripple transport is less than 1%, and the ripple contribution to beam ion diffusivitymore » is of the order of 0.1 m{sup 2} s{sup -1} or less. It is concluded that ripple effects make only a small contribution to anomalous transport rates that have been invoked to account for measured neutron rates and plasma stored energies in some MAST discharges. Delayed (non-prompt) losses are shown to occur close to the outer midplane, suggesting that banana-drift diffusion is the most likely cause of the ripple-induced losses.« less

Evaluation of stream water quality in Atlanta, Georgia, and the surrounding region (USA)

USGS Publications Warehouse

Peters, N.E.; Kandell, S.J.

1999-01-01

A water-quality index (WQI) was developed from historical data (1986-1995) for streams in the Atlanta Region and augmented with 'new' and generally more comprehensive biweekly data on four small urban streams, representing an industrial area, a developed medium-density residential area and developing and developed low-density residential areas. Parameter WQIs were derived from percentile ranks of individual water-quality parameter values for each site by normalizing the constituent ranks for values from all sites in the area for a base period, i.e. 1990-1995. WQIs were developed primarily for nutrient-related parameters due to data availability. Site WQIs, which were computed by averaging the parameter WQIs, range from 0.2 (good quality) to 0.8 (poor quality), and increased downstream of known nutrient sources. Also, annual site WQI decreases from 1986 to 1995 at most long-term monitoring sites. Annual site WQI for individual parameters correlated with annual hydrological characteristics, particularly runoff, precipitation quantity, and water yield, reflecting the effect of dilution on parameter values. The WQIs of the four small urban streams were evaluated for the core-nutrient-related parameters, parameters for specific dissolved trace metal concentrations and sediment characteristics, and a species diversity index for the macro-invertebrate taxa. The site WQI for the core-nutrient-related parameters used in the retrospective analysis was, as expected, the worst for the industrial area and the best for the low-density residential areas. However, macro-invertebrate data indicate that although the species at the medium-density residential site were diverse, the taxa at the site were for species tolerant of degraded water quality. Furthermore, although a species-diversity index indicates no substantial difference between the two low-density residential areas, the number for macro-invertebrates for the developing area was much less than that for the developed area, consistent with observations of recent sediment problems probably associated with construction in the basin. However, sediment parameters were similar for the two sites suggesting that the routine biweekly measurements may not capture the short-term increases in sediment transport associated with rainstorms. The WQI technique is limited by the number and types of parameters included in it, the general conditions of those parameters for the range of conditions in area streams, and by the effects of external factors, such as hydrology, and therefore, should be used with caution.

Evaluation of advanced displays for engine monitoring and control

NASA Technical Reports Server (NTRS)

Summers, L. G.

1993-01-01

The relative effectiveness of two advanced display concepts for monitoring engine performance for commercial transport aircraft was studied. The concepts were the Engine Monitoring and Control System (EMACS) display developed by NASA Langley and a display by exception design. Both of these concepts were based on the philosophy of providing information that is directly related to the pilot's task. Both concepts used a normalized thrust display. In addition, EMACS used column deviation indicators; i.e., the difference between the actual parameter value and the value predicted by an engine model, for engine health monitoring; while the Display by Exception displayed the engine parameters if the automated system detected a difference between the actual and the predicted values. The results showed that the advanced display concepts had shorter detection and response times. There were no differences in any of the results between manual and auto throttles. There were no effects upon perceived workload or performance on the primary flight task. The majority of pilots preferred the advanced displays and thought they were operationally acceptable. Certification of these concepts depends on the validation of the engine model. Recommendations are made to improve both the EMACS and the display by exception display formats.

PYFLOW_2.0: a computer program for calculating flow properties and impact parameters of past dilute pyroclastic density currents based on field data

NASA Astrophysics Data System (ADS)

Dioguardi, Fabio; Mele, Daniela

2018-03-01

This paper presents PYFLOW_2.0, a hazard tool for the calculation of the impact parameters of dilute pyroclastic density currents (DPDCs). DPDCs represent the dilute turbulent type of gravity flows that occur during explosive volcanic eruptions; their hazard is the result of their mobility and the capability to laterally impact buildings and infrastructures and to transport variable amounts of volcanic ash along the path. Starting from data coming from the analysis of deposits formed by DPDCs, PYFLOW_2.0 calculates the flow properties (e.g., velocity, bulk density, thickness) and impact parameters (dynamic pressure, deposition time) at the location of the sampled outcrop. Given the inherent uncertainties related to sampling, laboratory analyses, and modeling assumptions, the program provides ranges of variations and probability density functions of the impact parameters rather than single specific values; from these functions, the user can interrogate the program to obtain the value of the computed impact parameter at any specified exceedance probability. In this paper, the sedimentological models implemented in PYFLOW_2.0 are presented, program functionalities are briefly introduced, and two application examples are discussed so as to show the capabilities of the software in quantifying the impact of the analyzed DPDCs in terms of dynamic pressure, volcanic ash concentration, and residence time in the atmosphere. The software and user's manual are made available as a downloadable electronic supplement.

Equilibrium structure of solar magnetic flux tubes: Energy transport with multistream radiative transfer

NASA Technical Reports Server (NTRS)

Hasan, S. S.; Kalkofen, W.

1994-01-01

We examine the equilibrium structure of vertical intense magnetic flux tubes on the Sun. Assuming cylindrical geometry, we solve the magnetohydrostatic equations in the thin flux-tube approximation, allowing for energy transport by radiation and convection. The radiative transfer equation is solved in the six-stream approximation, assuming gray opacity and local thermodynamic equilibrium. This constitutes a significant improvement over a previous study, in which the transfer was solved using the multidimensional generalization of the Eddington approximation. Convection in the flux tube is treated using mixing-length theory, with an additional parameter alpha, characterizing the suppression of convective energy transport in the tube by the strong magnetic field. The equations are solved using the method of partial linearization. We present results for tubes with different values of the magnetic field strength and radius at a fixed depth in the atmosphere. In general, we find that, at equal geometric heights, the temperature on the tube axis, compared to the ambient medium, is higher in the photosphere and lower in the convection zone, with the difference becoming larger for thicker tubes. At equal optical depths the tubes are generally hotter than their surroundings. The results are comparatively insensitive to alpha but depend upon whether radiative and convective energy transport operate simultaneously or in separate layers. A comparison of our results with semiempirical models shows that the temperature and intensity contrast are in broad agreement. However, the field strengths of the flux-tube models are somewhat lower than the values inferred from observations.

Treatment of cyanide wastewater by bulk liquid membrane using tricaprylamine as a carrier.

PubMed

Li, Guoping; Xue, Juanqin; Liu, Nina; Yu, Lihua

2016-01-01

The transport of cyanide from wastewater through a bulk liquid membrane (BLM) containing tricaprylamine (TOA) as a carrier was studied. The effect of cyanide concentration in the feed solution, TOA concentration in the organic phase, the stirring speed, NaOH concentration in the stripping solution and temperature on cyanide transport was determined through BLM. Mass transfer of cyanide through BLM was analyzed by following the kinetic laws of two consecutive irreversible first-order reactions, and the kinetic parameters (k(1), k(2), R(m)(max), t(max), J(a)(max), J(d)(max)) were also calculated. Apparently, increase in membrane entrance (k(1)) and exit rate (k(2)) constants was accompanied by a rise in temperature. The values of activation energies were obtained as 35.6 kJ/mol and 18.2 kJ/mol for removal and recovery, respectively. These values showed that both removal and recovery steps in cyanide transport is controlled by the rate of the chemical complexation reaction. The optimal reaction conditions were determined by BLM using trioctylamine as the carrier: feed phase: pH 4, carrier TOA possession ratio in organic phase: 2% (V/V), stripping phase concentration of NaOH: 1% (W/V), reaction time: 60 min, stirring speed: 250 r/min. Under the above conditions, the removal rate was up to 92.96%. The experiments demonstrated that TOA was a good carrier for cyanide transport through BLM in this study.

Scaling and pedotransfer in numerical simulations of flow and transport in soils

USDA-ARS?s Scientific Manuscript database

Flow and transport parameters of soils in numerical simulations need to be defined at the support scale of computational grid cells. Such support scale can substantially differ from the support scale in laboratory or field measurements of flow and transport parameters. The scale-dependence of flow a...

Roles of nonlocal conductivity on spin Hall angle measurement

NASA Astrophysics Data System (ADS)

Chen, Kai; Zhang, Shufeng

2017-10-01

Spin Hall angle characterizes the rate of spin-charge current conversion and it has become one of the most important material parameters for spintronics physics and device application. A long-standing controversy is that the spin Hall angles for a given material measured by spin pumping and by spin Hall torque experiments are inconsistent and they could differ by as much as an order of magnitude. By using the linear response spin transport theory, we explicitly formulate the relation between the spin Hall angle and measured variables in different experiments. We find that the nonlocal conductivity inherited in the layered structure plays a key role to resolve conflicting values of the spin Hall angle. We provide a generalized scheme for extracting spin transport coefficients from experimental data.

Modeling and Ab initio Calculations of Thermal Transport in Si-Based Clathrates and Solar Perovskites

NASA Astrophysics Data System (ADS)

He, Yuping

2015-03-01

We present calculations of the thermal transport coefficients of Si-based clathrates and solar perovskites, as obtained from ab initio calculations and models, where all input parameters derived from first principles. We elucidated the physical mechanisms responsible for the measured low thermal conductivity in Si-based clatherates and predicted their electronic properties and mobilities, which were later confirmed experimentally. We also predicted that by appropriately tuning the carrier concentration, the thermoelectric figure of merit of Sn and Pb based perovskites may reach values ranging between 1 and 2, which could possibly be further increased by optimizing the lattice thermal conductivity through engineering perovskite superlattices. Work done in collaboration with Prof. G. Galli, and supported by DOE/BES Grant No. DE-FG0206ER46262.

ITC Recommendations for Transporter Kinetic Parameter Estimation and Translational Modeling of Transport-Mediated PK and DDIs in Humans

PubMed Central

Zamek-Gliszczynski, MJ; Lee, CA; Poirier, A; Bentz, J; Chu, X; Ellens, H; Ishikawa, T; Jamei, M; Kalvass, JC; Nagar, S; Pang, KS; Korzekwa, K; Swaan, PW; Taub, ME; Zhao, P; Galetin, A

2013-01-01

This white paper provides a critical analysis of methods for estimating transporter kinetics and recommendations on proper parameter calculation in various experimental systems. Rational interpretation of transporter-knockout animal findings and application of static and dynamic physiologically based modeling approaches for prediction of human transporter-mediated pharmacokinetics and drug–drug interactions (DDIs) are presented. The objective is to provide appropriate guidance for the use of in vitro, in vivo, and modeling tools in translational transporter science. PMID:23588311

Relationship between bioimpedance-determined body composition and peritoneal transport in peritoneal dialysis.

PubMed

da Costa, Bernardo M; Del Peso, Gloria; Bajo, Maria Auxiliadora; Carreño, Gilda; Ferreira, Marta; Ferreira, Carina; Selgas, Rafael

2017-05-29

In peritoneal dialysis (PD) patients, body fluid homeostasis is dependent on peritoneal elimination of water and solutes. Patients with less favorable peritoneal transport parameters should be more overhydrated. Despite this, the association between faster transport and overhydration (OH) is weak, and the factors that influence hydration status are still poorly characterized. Modified peritoneal equilibration tests (PET) offer us new parameters that might correlate better with hydration status, like free water transport (FWT). The aim of this study was thus to establish the relationships between new peritoneal transport parameters and body composition parameters estimated by bioimpedance spectroscopy (BIS). Prospective observational study on incident PD patients with a baseline and 1-year follow-up evaluation. 61 patients were included in the baseline evaluation, 19 of whom had a 1-year follow-up evaluation; 67.2% were fluid overloaded. There was a negative correlation between D/P creatinine and FWT (r = -0.598, p = 0.000). The fraction of FWT was negatively correlated with OH (r = -0.302, p = 0.018). Peritoneal protein losses (PPL) were also correlated with OH (r = 0.287, p = 0.028). There were no significant differences in OH according to small-solute transport status or fluid output parameters. After 1 year, we observed a significant worsening of renal function and an improvement in 24-hour ultrafiltration (UF) and hydration status, but we detected no differences in peritoneal transport of water or solutes that could explain these changes. There is a poor relationship between kidney/peritoneal function parameters and body composition parameters. The fraction of FWT and PPL may be underestimated markers of peritoneal health and of its contribution to the hydration status.

Effects of farm management practices and transport duration on stress response and meat quality traits of suckling goat kids.

PubMed

Alcalde, M J; Suárez, M D; Rodero, E; Álvarez, R; Sáez, M I; Martínez, T F

2017-09-01

Studies aimed to assess up to what extent farming and transport previous to slaughtering might affect physiology and meat quality in young goat kids are needed, with the ultimate purpose of promoting practices that minimize stress in these animals. In this regard the effects of on-farm management and transport duration on some physiological responses and meat quality parameters in goat kids were assessed. Two farms representing 'high' and 'low' welfare-friendly management practices were selected. In total, 32 suckling kids were withdrawn from each farm, transported by road for 2 or 6 h, and then slaughtered. Blood samples were collected both on-farm and in the slaughterhouse, and biochemistry, cell counts and haematocrit were determined. After slaughtering, carcass quality parameters were measured. Longissimus dorsi muscle was dissected and pH, colour parameters, water holding capacity and shear force were measured throughout 8-day ageing period. Results indicate that, regardless its duration, transport caused significant effects on some blood parameters suggesting stress in live animals, like glucose, cortisol or creatine kinase. Despite the marked stress status in animals, this condition was not decisively reflected on L. dorsi quality parameters, but some effects were observed regarding fat cover in carcasses and colour parameters. The results suggest that postmortem changes throughout ageing were more decisive in terms of meat quality than stressful management either on-farm or during transport.

Transport impacts on atmosphere and climate: Metrics

NASA Astrophysics Data System (ADS)

Fuglestvedt, J. S.; Shine, K. P.; Berntsen, T.; Cook, J.; Lee, D. S.; Stenke, A.; Skeie, R. B.; Velders, G. J. M.; Waitz, I. A.

2010-12-01

The transport sector emits a wide variety of gases and aerosols, with distinctly different characteristics which influence climate directly and indirectly via chemical and physical processes. Tools that allow these emissions to be placed on some kind of common scale in terms of their impact on climate have a number of possible uses such as: in agreements and emission trading schemes; when considering potential trade-offs between changes in emissions resulting from technological or operational developments; and/or for comparing the impact of different environmental impacts of transport activities. Many of the non-CO 2 emissions from the transport sector are short-lived substances, not currently covered by the Kyoto Protocol. There are formidable difficulties in developing metrics and these are particularly acute for such short-lived species. One difficulty concerns the choice of an appropriate structure for the metric (which may depend on, for example, the design of any climate policy it is intended to serve) and the associated value judgements on the appropriate time periods to consider; these choices affect the perception of the relative importance of short- and long-lived species. A second difficulty is the quantification of input parameters (due to underlying uncertainty in atmospheric processes). In addition, for some transport-related emissions, the values of metrics (unlike the gases included in the Kyoto Protocol) depend on where and when the emissions are introduced into the atmosphere - both the regional distribution and, for aircraft, the distribution as a function of altitude, are important. In this assessment of such metrics, we present Global Warming Potentials (GWPs) as these have traditionally been used in the implementation of climate policy. We also present Global Temperature Change Potentials (GTPs) as an alternative metric, as this, or a similar metric may be more appropriate for use in some circumstances. We use radiative forcings and lifetimes from the literature to derive GWPs and GTPs for the main transport-related emissions, and discuss the uncertainties in these estimates. We find large variations in metric (GWP and GTP) values for NO x, mainly due to the dependence on location of emissions but also because of inter-model differences and differences in experimental design. For aerosols we give only global-mean values due to an inconsistent picture amongst available studies regarding regional dependence. The uncertainty in the presented metric values reflects the current state of understanding; the ranking of the various components with respect to our confidence in the given metric values is also given. While the focus is mostly on metrics for comparing the climate impact of emissions, many of the issues are equally relevant for stratospheric ozone depletion metrics, which are also discussed.

A three-dimensional cohesive sediment transport model with data assimilation: Model development, sensitivity analysis and parameter estimation

NASA Astrophysics Data System (ADS)

Wang, Daosheng; Cao, Anzhou; Zhang, Jicai; Fan, Daidu; Liu, Yongzhi; Zhang, Yue

2018-06-01

Based on the theory of inverse problems, a three-dimensional sigma-coordinate cohesive sediment transport model with the adjoint data assimilation is developed. In this model, the physical processes of cohesive sediment transport, including deposition, erosion and advection-diffusion, are parameterized by corresponding model parameters. These parameters are usually poorly known and have traditionally been assigned empirically. By assimilating observations into the model, the model parameters can be estimated using the adjoint method; meanwhile, the data misfit between model results and observations can be decreased. The model developed in this work contains numerous parameters; therefore, it is necessary to investigate the parameter sensitivity of the model, which is assessed by calculating a relative sensitivity function and the gradient of the cost function with respect to each parameter. The results of parameter sensitivity analysis indicate that the model is sensitive to the initial conditions, inflow open boundary conditions, suspended sediment settling velocity and resuspension rate, while the model is insensitive to horizontal and vertical diffusivity coefficients. A detailed explanation of the pattern of sensitivity analysis is also given. In ideal twin experiments, constant parameters are estimated by assimilating 'pseudo' observations. The results show that the sensitive parameters are estimated more easily than the insensitive parameters. The conclusions of this work can provide guidance for the practical applications of this model to simulate sediment transport in the study area.

Analysis of Advanced Thermoelectric Materials and Their Functional Limits

NASA Technical Reports Server (NTRS)

Kim, Hyun Jung

2015-01-01

The world's demand for energy is increasing dramatically, but the best energy conversion systems operate at approximately 30% efficiency. One way to decrease energy loss is in the recovery of waste heat using thermoelectric (TE) generators. A TE generator is device that generates electricity by exploiting heat flow across a thermal gradient. The efficiency of a TE material for power generation and cooling is determined by the dimensionless Figure of Merit (ZT): ZT = S(exp. 2)sigmaT/?: where S is the Seebeck coefficient, sigma is the electrical conductivity, T is the absolute temperature, and ? is the thermal conductivity. The parameters are not physically independent, but intrinsically coupled since they are a function of the transport properties of electrons. Traditional research on TE materials has focused on synthesizing bulk semiconductor-type materials that have low thermal conductivity and high electrical conductivity affording ZT values of 1. The optimization of the s/? ratio is difficult to achieve using current material formats, as these material constants are complementary. Recent areas of research are focusing on using nanostructural artifacts that introduce specific dislocations and boundary conditions that scatter the phonons. This disrupts the physical link between thermal (phonon) and electrical (electron) transport. The result is that ? is decreased without decreasing s. These material formats give ZT values of up to 2 which represent approximately 18% energy gain from waste heat recovery. The next challenge in developing the next generation of TE materials with superior performance is to tailor the interconnected thermoelectric physical parameters of the material system. In order to approach this problem, the fundamental physics of each parameter S, sigma, and ? need to be physically understood in their context of electron/phonon interaction for the construction of new high ZT thermoelectric devices. Is it possible to overcome the physical limit imposed by of the effect of phonon lattice oscillation and energetic electrons towards thermal conductivity? Is the Seebeck coefficient, based on the difference in voltage over temperature gradient ( deltaV/deltaT), an intrinsic parameter of each material? All these parameters were manipulated using nano-bridge and twin-lattice structural concepts at the NASA Langley Research Center. This talk will review the current trend of TE research to optimize the ZT and discuss about new approaches on increasing ZT within functional limits of each parameter.

Transport, diffusion, and energy studies in the Arnold-Beltrami-Childress map

NASA Astrophysics Data System (ADS)

Das, Swetamber; Gupte, Neelima

2017-09-01

We study the transport and diffusion properties of passive inertial particles described by a six-dimensional dissipative bailout embedding map. The base map chosen for the study is the three-dimensional incompressible Arnold-Beltrami-Childress (ABC) map chosen as a representation of volume preserving flows. There are two distinct cases: the two-action and the one-action cases, depending on whether two or one of the parameters (A ,B ,C ) exceed 1. The embedded map dynamics is governed by two parameters (α ,γ ), which quantify the mass density ratio and dissipation, respectively. There are important differences between the aerosol (α <1 ) and the bubble (α >1 ) regimes. We have studied the diffusive behavior of the system and constructed the phase diagram in the parameter space by computing the diffusion exponents η . Three classes have been broadly classified—subdiffusive transport (η <1 ), normal diffusion (η ≈1 ), and superdiffusion (η >1 ) with η ≈2 referred to as the ballistic regime. Correlating the diffusive phase diagram with the phase diagram for dynamical regimes seen earlier, we find that the hyperchaotic bubble regime is largely correlated with normal and superdiffusive behavior. In contrast, in the aerosol regime, ballistic superdiffusion is seen in regions that largely show periodic dynamical behaviors, whereas subdiffusive behavior is seen in both periodic and chaotic regimes. The probability distributions of the diffusion exponents show power-law scaling for both aerosol and bubbles in the superdiffusive regimes. We further study the Poincáre recurrence times statistics of the system. Here, we find that recurrence time distributions show power law regimes due to the existence of partial barriers to transport in the phase space. Moreover, the plot of average particle kinetic energies versus the mass density ratio for the two-action case exhibits a devil's staircase-like structure for higher dissipation values. We explain these results and discuss their implications for realistic systems.

Electronic transport characterization of silicon wafers by spatially resolved steady-state photocarrier radiometric imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qian; University of the Chinese Academy of Sciences, Beijing 100039; Li, Bincheng, E-mail: bcli@ioe.ac.cn

2015-09-28

Spatially resolved steady-state photocarrier radiometric (PCR) imaging technique is developed to characterize the electronic transport properties of silicon wafers. Based on a nonlinear PCR theory, simulations are performed to investigate the effects of electronic transport parameters (the carrier lifetime, the carrier diffusion coefficient, and the front surface recombination velocity) on the steady-state PCR intensity profiles. The electronic transport parameters of an n-type silicon wafer are simultaneously determined by fitting the measured steady-state PCR intensity profiles to the three-dimensional nonlinear PCR model. The determined transport parameters are in good agreement with the results obtained by the conventional modulated PCR technique withmore » multiple pump beam radii.« less

Parameters estimation for reactive transport: A way to test the validity of a reactive model

NASA Astrophysics Data System (ADS)

Aggarwal, Mohit; Cheikh Anta Ndiaye, Mame; Carrayrou, Jérôme

The chemical parameters used in reactive transport models are not known accurately due to the complexity and the heterogeneous conditions of a real domain. We will present an efficient algorithm in order to estimate the chemical parameters using Monte-Carlo method. Monte-Carlo methods are very robust for the optimisation of the highly non-linear mathematical model describing reactive transport. Reactive transport of tributyltin (TBT) through natural quartz sand at seven different pHs is taken as the test case. Our algorithm will be used to estimate the chemical parameters of the sorption of TBT onto the natural quartz sand. By testing and comparing three models of surface complexation, we show that the proposed adsorption model cannot explain the experimental data.

[Effects of different water potentials on leaf gas exchange and chlorophyll fluorescence parameters of cucumber during post-flowering growth stage].

PubMed

Lin, Lu; Tang, Yun; Zhang, Ji-tao; Yan, Wan-li; Xiao, Jian-hong; Ding, Chao; Dong, Chuan; Ji, Zeng-shun

2015-07-01

Impacts of different substrate water potentials (SWP) on leaf gas exchange and chlorophyll fluorescence parameters of greenhouse cucumber during its post-flowering growth stage were analyzed in this study. The results demonstrated that -10 and -30 kPa were the critical values for initiating stomatal and non-stomatal limitation of drought stress, respectively. During the stage of no drought stress (-10 kPa < SWP ≤ 0 kPa), gas exchange parameters and chlorophyll fluorescence parameters were not different significantly among treatments. During the stage of stomatal limitation of drought stress (-30 kPa

A computational model of oxygen delivery by hemoglobin-based oxygen carriers in three-dimensional microvascular networks.

PubMed

Tsoukias, Nikolaos M; Goldman, Daniel; Vadapalli, Arjun; Pittman, Roland N; Popel, Aleksander S

2007-10-21

A detailed computational model is developed to simulate oxygen transport from a three-dimensional (3D) microvascular network to the surrounding tissue in the presence of hemoglobin-based oxygen carriers. The model accounts for nonlinear O(2) consumption, myoglobin-facilitated diffusion and nonlinear oxyhemoglobin dissociation in the RBCs and plasma. It also includes a detailed description of intravascular resistance to O(2) transport and is capable of incorporating realistic 3D microvascular network geometries. Simulations in this study were performed using a computer-generated microvascular architecture that mimics morphometric parameters for the hamster cheek pouch retractor muscle. Theoretical results are presented next to corresponding experimental data. Phosphorescence quenching microscopy provided PO(2) measurements at the arteriolar and venular ends of capillaries in the hamster retractor muscle before and after isovolemic hemodilution with three different hemodilutents: a non-oxygen-carrying plasma expander and two hemoglobin solutions with different oxygen affinities. Sample results in a microvascular network show an enhancement of diffusive shunting between arterioles, venules and capillaries and a decrease in hemoglobin's effectiveness for tissue oxygenation when its affinity for O(2) is decreased. Model simulations suggest that microvascular network anatomy can affect the optimal hemoglobin affinity for reducing tissue hypoxia. O(2) transport simulations in realistic representations of microvascular networks should provide a theoretical framework for choosing optimal parameter values in the development of hemoglobin-based blood substitutes.

Computational Study of Ternary Devices: Stable, Low-Cost, and Efficient Planar Perovskite Solar Cells

NASA Astrophysics Data System (ADS)

Sajid, Sajid; Elseman, Ahmed Mourtada; Ji, Jun; Dou, Shangyi; Wei, Dong; Huang, Hao; Cui, Peng; Xi, Wenkang; Chu, Lihua; Li, Yingfeng; Jiang, Bing; Li, Meicheng

2018-07-01

Although perovskite solar cells with power conversion efficiencies (PCEs) more than 22% have been realized with expensive organic charge-transporting materials, their stability and high cost remain to be addressed. In this work, the perovskite configuration of MAPbX (MA = CH3NH3, X = I3, Br3, or I2Br) integrated with stable and low-cost Cu:NiO x hole-transporting material, ZnO electron-transporting material, and Al counter electrode was modeled as a planar PSC and studied theoretically. A solar cell simulation program (wxAMPS), which served as an update of the popular solar cell simulation tool (AMPS: Analysis of Microelectronic and Photonic Structures), was used. The study yielded a detailed understanding of the role of each component in the solar cell and its effect on the photovoltaic parameters as a whole. The bandgap of active materials and operating temperature of the modeled solar cell were shown to influence the solar cell performance in a significant way. Further, the simulation results reveal a strong dependence of photovoltaic parameters on the thickness and defect density of the light-absorbing layers. Under moderate simulation conditions, the MAPbBr3 and MAPbI2Br cells recorded the highest PCEs of 20.58 and 19.08%, respectively, while MAPbI3 cell gave a value of 16.14%. [Figure not available: see fulltext.

Imidacloprid transport and sorption nonequilibrium in single and multilayered columns of Immokalee fine sand

PubMed Central

Nkedi-Kizza, Peter; Morgan, Kelly T.; Kadyampakeni, Davie M.

2017-01-01

Imidacloprid (IMD) is a neonicotinoid pesticide soil-drenched to many crops to control piercing-sucking insects such as the Asian citrus psyllid (ACP). Neonicotinoids are persistent in the environment and transport analyses are helpful estimate leaching potential from soils that could result in groundwater pollution. The objective of this study was to analyze IMD breakthrough under saturated water flow in soil columns packed with three horizons (A, E, Bh) of Immokalee Fine Sand (IFS). Also, we used the dimensionless form of the convective-dispersive model (CD-Model) to compare the optimized transport parameters from each column experiment (retardation factor, R; fraction of instantaneous-to-total retardation, β; and mass transfer coefficient, ω) with the parameters obtained from sorption batch equilibria and sorption kinetics. The tracer (Cl-) breakthrough curves (BTCs) were symmetrical and properly described by the CD-Model. IMD BTCs from A, Bh, and multilayered [A+E+Bh] soil columns showed steep fronts and tailing that were well described by the one-site nonequilibrium (OSNE) model, which was an evidence of non-ideal transport due to IMD mass transfer into the soil organic matter. In general, IMD was weakly-sorbed in the A and Bh horizons (R values of 3.72 ± 0.04 and 3.08 ± 0.07, respectively), and almost no retardation was observed in the E horizon (R = 1.20 ± 0.02) due to its low organic matter content (0.3%). Using the HYDRUS-1D package, optimized parameters (R, β, ω) from the individual columns successfully simulated IMD transport in a multilayered column mimicking an IFS soil profile. These column studies and corresponding simulations agreed with previous findings from batch sorption equilibria and kinetics experiments, where IMD showed one-site kinetic mass transfer between soil surfaces and soil solution. Ideally, sandy soils should be maintained unsaturated by crop irrigation systems and rainfall monitoring during and after soil-drench application. The unsaturated soil will increase IMD retardation factors and residence time for plant uptake, lowering leaching potential from soil layers with low sorption capacity, such as the E horizon. PMID:28837702

Unified Scaling Law for flux pinning in practical superconductors: II. Parameter testing, scaling constants, and the Extrapolative Scaling Expression

NASA Astrophysics Data System (ADS)

Ekin, Jack W.; Cheggour, Najib; Goodrich, Loren; Splett, Jolene; Bordini, Bernardo; Richter, David

2016-12-01

A scaling study of several thousand Nb3Sn critical-current (I c) measurements is used to derive the Extrapolative Scaling Expression (ESE), a relation that can quickly and accurately extrapolate limited datasets to obtain full three-dimensional dependences of I c on magnetic field (B), temperature (T), and mechanical strain (ɛ). The relation has the advantage of being easy to implement, and offers significant savings in sample characterization time and a useful tool for magnet design. Thorough data-based analysis of the general parameterization of the Unified Scaling Law (USL) shows the existence of three universal scaling constants for practical Nb3Sn conductors. The study also identifies the scaling parameters that are conductor specific and need to be fitted to each conductor. This investigation includes two new, rare, and very large I c(B,T,ɛ) datasets (each with nearly a thousand I c measurements spanning magnetic fields from 1 to 16 T, temperatures from ˜2.26 to 14 K, and intrinsic strains from -1.1% to +0.3%). The results are summarized in terms of the general USL parameters given in table 3 of Part 1 (Ekin J W 2010 Supercond. Sci. Technol. 23 083001) of this series of articles. The scaling constants determined for practical Nb3Sn conductors are: the upper-critical-field temperature parameter v = 1.50 ± 0.04 the cross-link parameter w = 3.0 ± 0.3 and the strain curvature parameter u = 1.7 ± 0.1 (from equation (29) for b c2(ɛ) in Part 1). These constants and required fitting parameters result in the ESE relation, given by I c ( B , T , ɛ ) B = C [ b c 2 ( ɛ ) ] s ( 1 - t 1.5 ) η - μ ( 1 - t 2 ) μ b p ( 1 - b ) q with reduced magnetic field b ≡ B/B c2*(T,ɛ) and reduced temperature t ≡ T/T c*(ɛ), where: B c 2 * ( T , ɛ ) = B c 2 * ( 0 , 0 ) ( 1 - t 1.5 ) b c 2 ( ɛ ) T c * ( ɛ ) = T c * ( 0 ) [ b c 2 ( ɛ ) ] 1/3 and fitting parameters: C, B c2*(0,0), T c*(0), s, either η or μ (but not both), plus the parameters in the strain function b c2(ɛ). The pinning-force shape parameters p and q are also preferably fitted (simultaneously with the other parameters), but default values p = 0.5 and q = 2.0 also give high fitting accuracy when the range of relative magnetic fields is not extensive. Default values are also essential when the magnetic field data range is insufficient to determine p and q. The scaling constants are remarkably stable (changes less than ˜1%) with respect to different values of p and q, Nb3Sn conductor configurations, magnetic self-field corrections, and pinning-force trim values. The results demonstrate that the scaling of transport critical current holds down to the lowest temperatures measured ˜2.2 K, for both magnetic self-field corrected and uncorrected data. An initial comparison is also made between transport and magnetization scaling data in matched Nb3Sn samples and significant differences are found, especially for the upper critical field B c2*(T,ɛ), which may be a result of inhomogeneous shielding currents. In Part 3 of this topical review series (Ekin J W 2017 Supercond. Sci. Technol. at press), the smallest practical minimum dataset for extrapolating full I c(B,T,ɛ) datasets is derived. Application of the ESE relation is illustrated in several new areas, including full characterization of Nb3Sn conductors from as little as a single I c(B) curve when a few core parameters have been determined for similar conductors.

Slower phloem transport in gymnosperm trees can be attributed to higher sieve element resistance.

PubMed

Liesche, Johannes; Windt, Carel; Bohr, Tomas; Schulz, Alexander; Jensen, Kaare H

2015-04-01

In trees, carbohydrates produced in photosynthesizing leaves are transported to roots and other sink organs over distances of up to 100 m inside a specialized transport tissue, the phloem. Angiosperm and gymnosperm trees have a fundamentally different phloem anatomy with respect to cell size, shape and connectivity. Whether these differences have an effect on the physiology of carbohydrate transport, however, is not clear. A meta-analysis of the experimental data on phloem transport speed in trees yielded average speeds of 56 cm h(-1) for angiosperm trees and 22 cm h(-1) for gymnosperm trees. Similar values resulted from theoretical modeling using a simple transport resistance model. Analysis of the model parameters clearly identified sieve element (SE) anatomy as the main factor for the significantly slower carbohydrate transport speed inside the phloem in gymnosperm compared with angiosperm trees. In order to investigate the influence of SE anatomy on the hydraulic resistance, anatomical data on SEs and sieve pores were collected by transmission electron microscopy analysis and from the literature for 18 tree species. Calculations showed that the hydraulic resistance is significantly higher in the gymnosperm than in angiosperm trees. The higher resistance is only partially offset by the considerably longer SEs of gymnosperms. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Kinetic modeling and exploratory numerical simulation of chloroplastic starch degradation

PubMed Central

2011-01-01

Background Higher plants and algae are able to fix atmospheric carbon dioxide through photosynthesis and store this fixed carbon in large quantities as starch, which can be hydrolyzed into sugars serving as feedstock for fermentation to biofuels and precursors. Rational engineering of carbon flow in plant cells requires a greater understanding of how starch breakdown fluxes respond to variations in enzyme concentrations, kinetic parameters, and metabolite concentrations. We have therefore developed and simulated a detailed kinetic ordinary differential equation model of the degradation pathways for starch synthesized in plants and green algae, which to our knowledge is the most complete such model reported to date. Results Simulation with 9 internal metabolites and 8 external metabolites, the concentrations of the latter fixed at reasonable biochemical values, leads to a single reference solution showing β-amylase activity to be the rate-limiting step in carbon flow from starch degradation. Additionally, the response coefficients for stromal glucose to the glucose transporter kcat and KM are substantial, whereas those for cytosolic glucose are not, consistent with a kinetic bottleneck due to transport. Response coefficient norms show stromal maltopentaose and cytosolic glucosylated arabinogalactan to be the most and least globally sensitive metabolites, respectively, and β-amylase kcat and KM for starch to be the kinetic parameters with the largest aggregate effect on metabolite concentrations as a whole. The latter kinetic parameters, together with those for glucose transport, have the greatest effect on stromal glucose, which is a precursor for biofuel synthetic pathways. Exploration of the steady-state solution space with respect to concentrations of 6 external metabolites and 8 dynamic metabolite concentrations show that stromal metabolism is strongly coupled to starch levels, and that transport between compartments serves to lower coupling between metabolic subsystems in different compartments. Conclusions We find that in the reference steady state, starch cleavage is the most significant determinant of carbon flux, with turnover of oligosaccharides playing a secondary role. Independence of stationary point with respect to initial dynamic variable values confirms a unique stationary point in the phase space of dynamically varying concentrations of the model network. Stromal maltooligosaccharide metabolism was highly coupled to the available starch concentration. From the most highly converged trajectories, distances between unique fixed points of phase spaces show that cytosolic maltose levels depend on the total concentrations of arabinogalactan and glucose present in the cytosol. In addition, cellular compartmentalization serves to dampen much, but not all, of the effects of one subnetwork on another, such that kinetic modeling of single compartments would likely capture most dynamics that are fast on the timescale of the transport reactions. PMID:21682905

Modelling of an Orthovoltage X-ray Therapy Unit with the EGSnrc Monte Carlo Package

NASA Astrophysics Data System (ADS)

Knöös, Tommy; Rosenschöld, Per Munck Af; Wieslander, Elinore

2007-06-01

Simulations with the EGSnrc code package of an orthovoltage x-ray machine have been performed. The BEAMnrc code was used to transport electrons, produce x-ray photons in the target and transport of these through the treatment machine down to the exit level of the applicator. Further transport in water or CT based phantoms was facilitated by the DOSXYZnrc code. Phase space files were scored with BEAMnrc and analysed regarding the energy spectra at the end of the applicator. Tuning of simulation parameters was based on the half-value layer quantity for the beams in either Al or Cu. Calculated depth dose and profile curves have been compared against measurements and show good agreement except at shallow depths. The MC model tested in this study can be used for various dosimetric studies as well as generating a library of typical treatment cases that can serve as both educational material and guidance in the clinical practice

Different electronic and charge-transport properties of four organic semiconductors Tetraazaperopyrenes derivatives

NASA Astrophysics Data System (ADS)

Shi, Yarui; Wei, Huiling; Liu, Yufang

2015-03-01

Tetraazaperopyrenes (TAPPs) derivatives are high-performance n-type organic semiconductor material families with the remarkable long-term stabilities. The charge carrier mobilities in TAPPs derivatives crystals were calculated by the density functional theory (DFT) method combined with the Marcus-Hush electron-transfer theory. The existence of considerable C-H…F-C bonding defines the conformation of the molecular structure and contributes to its stability. We illustrated how it is possible to control the electronic and charge-transport parameters of TAPPs derivatives as a function of the positions, a type of the substituents. It is found that the core substitution of TAPPs has a drastic influence on the charge-transport mobilities. The maximum electron mobility value of the core-brominated 2,9-bis (perfluoroalkyl)-substituted TAPPs is 0.521 cm2 V-1 s-1, which appear in the orientation angle 95° and 275°. The results demonstrate that the TAPPs with bromine substituents in ortho positions exhibit the best charge-transfer efficiency among the four different TAPP derivatives.

Nonequilibrium transport of charge carriers and transient electroluminescence in organic light-emitting diodes

NASA Astrophysics Data System (ADS)

Nikitenko, V. R.; von Seggern, H.

2007-11-01

An analytic theory of nonequilibrium hopping charge transport in disordered organic materials includes quasiequilibrium (normal) and extremely nonequilibrium (dispersive) regimes as limiting cases at long and short times, respectively. In the intermediate interval of time quasiequilibrium value of mobility is nearly established while the coefficient of field-assisted diffusion continues to increase (quasidispersive regime). Therefore, normalized time dependencies of transient current in time-of-flight (TOF) conditions are practically independent of field strength and sample thickness, in good agreement both with data of TOF experiments for molecularly doped polymers and results of numerical simulations of Gaussian disorder model. An analytic model of transient electroluminescence (TEL) is developed on the base of the mentioned theory. Strong asymmetry of mobilities is presumed. In analogy with TOF transients, dispersion parameter of normalized TEL intensity is anomalously large and almost field independent in the quasidispersive regime of transport. The method for determination of mobility from TEL data is proposed.

An Analytical Study for Subsonic Oblique Wing Transport Concept

NASA Technical Reports Server (NTRS)

Bradley, E. S.; Honrath, J.; Tomlin, K. H.; Swift, G.; Shumpert, P.; Warnock, W.

1976-01-01

The oblique wing concept has been investigated for subsonic transport application for a cruise Mach number of 0.95. Three different mission applications were considered and the concept analyzed against the selected mission requirements. Configuration studies determined the best area of applicability to be a commercial passenger transport mission. The critical parameter for the oblique wing concept was found to be aspect ratio which was limited to a value of 6.0 due to aeroelastic divergence. Comparison of the concept final configuration was made with fixed winged configurations designed to cruise at Mach 0.85 and 0.95. The crossover Mach number for the oblique wing concept was found to be Mach 0.91 for takeoff gross weight and direct operating cost. Benefits include reduced takeoff distance, installed thrust and mission block fuel and improved community noise characteristics. The variable geometry feature enables the final configuration to increase range by 10% at Mach 0.712 and to increase endurance by as much as 44%.

Axial plasma detachment in helicon plasmas during a global transition due to spontaneous self organization: instabilities, bifurcation and the helicon core formation

NASA Astrophysics Data System (ADS)

Chakraborty Thakur, Saikat; Hong, Rongjie; Tynan, George

2017-10-01

We observe axial plasma detachment in a helicon plasma device that occurs simultaneously along with a spontaneous, self-organized global transition in the plasma dynamics via a transport bifurcation with strong hysteresis, at a certain B_crit. For B B_crit, the plasma exhibits steepened density and ion temperature gradients, strong shearing in the azimuthal and parallel velocities, and multiple, simultaneously present, radially separated plasma instabilities. The axial detachment also follows the same hysteresis curves associated with the transport bifurcation that led to the transition. The value of B_crit depends on the source parameters (pressure, gas flow rate, rf power etc.). This study allows access to new regimes to study plasma turbulence and transport as well as plasma detachment and helicon core formation. We find that the plasma can exist in more than one type of helicon modes.

Application of RANS Simulations for Contact Time Predictions in Turbulent Reactor Tanks for Water Purification Process

NASA Astrophysics Data System (ADS)

Nickles, Cassandra; Goodman, Matthew; Saez, Jose; Issakhanian, Emin

2016-11-01

California's current drought has renewed public interest in recycled water from Water Reclamation Plants (WRPs). It is critical that the recycled water meets public health standards. This project consists of simulating the transport of an instantaneous conservative tracer through the WRP chlorine contact tanks. Local recycled water regulations stipulate a minimum 90-minute modal contact time during disinfection at peak dry weather design flow. In-situ testing is extremely difficult given flowrate dependence on real world sewage line supply and recycled water demand. Given as-built drawings and operation parameters, the chlorine contact tanks are modeled to simulate extreme situations, which may not meet regulatory standards. The turbulent flow solutions are used as the basis to model the transport of a turbulently diffusing conservative tracer added instantaneously to the inlet of the reactors. This tracer simulates the transport through advection and dispersion of chlorine in the WRPs. Previous work validated the models against experimental data. The current work shows the predictive value of the simulations.

A theory for water and macromolecular transport in the pulmonary artery wall with a detailed comparison to the aorta

PubMed Central

Zeng, Zhongqing; Jan, Kung-Ming

2012-01-01

The pulmonary artery (PA) wall, which has much higher hydraulic conductivity and albumin void space and approximately one-sixth the normal transmural pressure of systemic arteries (e.g, aorta, carotid arteries), is rarely atherosclerotic, except under pulmonary hypertension. This study constructs a detailed, two-dimensional, wall-structure-based filtration and macromolecular transport model for the PA to investigate differences in prelesion transport processes between the disease-susceptible aorta and the relatively resistant PA. The PA and aorta models are similar in wall structure, but very different in parameter values, many of which have been measured (and therefore modified) since the original aorta model of Huang et al. (23). Both PA and aortic model simulations fit experimental data on transwall LDL concentration profiles and on the growth of isolated endothelial (horseradish peroxidase) tracer spots with circulation time very well. They reveal that lipid entering the aorta attains a much higher intima than media concentration but distributes better between these regions in the PA than aorta and that tracer in both regions contributes to observed tracer spots. Solutions show why both the overall transmural water flow and spot growth rates are similar in these vessels despite very different material transport parameters. Since early lipid accumulation occurs in the subendothelial intima and since (matrix binding) reaction kinetics depend on reactant concentrations, the lower intima lipid concentrations in the PA vs. aorta likely lead to slower accumulation of bound lipid in the PA. These findings may be relevant to understanding the different atherosusceptibilities of these vessels. PMID:22198178

Predicting long-range transport: a systematic evaluation of two multimedia transport models.

PubMed

Bennett, D H; Scheringer, M; McKone, T E; Hungerbühler, K

2001-03-15

The United Nations Environment Program has recently developed criteria to identify and restrict chemicals with a potential for persistence and long-range transport (persistent organic pollutants or POPs). There are many stakeholders involved, and the issues are not only scientific but also include social, economic, and political factors. This work focuses on one aspect of the POPs debate, the criteria for determining the potential for long-range transport (LRT). Our goal is to determine if current models are reliable enough to support decisions that classify a chemical based on the LRT potential. We examine the robustness of two multimedia fate models for determining the relative ranking and absolute spatial range of various chemicals in the environment. We also consider the effect of parameter uncertainties and the model uncertainty associated with the selection of an algorithm for gas-particle partitioning on the model results. Given the same chemical properties, both models give virtually the same ranking. However, when chemical parameter uncertainties and model uncertainties such as particle partitioning are considered, the spatial range distributions obtained for the individual chemicals overlap, preventing a distinct rank order. The absolute values obtained for the predicted spatial range or travel distance differ significantly between the two models for the uncertainties evaluated. We find that to evaluate a chemical when large and unresolved uncertainties exist, it is more informative to use two or more models and include multiple types of uncertainty. Model differences and uncertainties must be explicitly confronted to determine how the limitations of scientific knowledge impact predictions in the decision-making process.

Measurement of Instantaneous Velocity Vectors of Organelle Transport: Mitochondrial Transport and Bioenergetics in Hippocampal Neurons

PubMed Central

Gerencser, Akos A.; Nicholls, David G.

2008-01-01

Impaired transport of mitochondria, in dendrites and axons of neurons, and bioenergetic deficit are increasingly recognized to be of pathological importance in neurodegenerative diseases. To study the relationship between transport and bioenergetics, we have developed what to our knowledge is a novel technique to quantify organelle velocity in cultured cells. The aim was to combine measurement of motion and bioenergetic parameters while minimizing photodynamic oxidative artifacts evoked by fluorescence excitation. Velocity determination from sequential fluorescence images is not trivial, and here we describe an application of “optical flow”, the flow of gray values in grayscale images, to this problem. Based on the principles of photon shot noise occurring in low light level fluorescence microscopy, we describe and validate here an optical flow-based, robust method to measure velocity vectors for organelles expressing fluorescent proteins. This method features instantaneous velocity determination from a pair of images by detecting motion of edges, with no assumptions about the separation or shapes of the objects in the image. Optical flow was used in combination with single mitochondrion assay of mitochondrial thiol redox status by mitochondrially targeted redox-sensitive green fluorescent protein and measurement of mitochondrial membrane potential by tetramethylrhodamine methyl ester. Mitochondrial populations of resting cultured hippocampal neurons were analyzed. It was found that mitochondria with more oxidized thiol redox status have lower membrane potentials and are smaller in size. These mitochondria are more motile than the average; however, mitochondrial motility is only slightly dependent on the observed bioenergetic parameters and is correlated the best to the size of the mitochondria. PMID:18757564

49 CFR 236.791 - Release, value.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Release, value. 236.791 Section 236.791 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Release, value. The electrical value at which the movable member of an electromagnetic device will move to...

Local sensitivity analysis for inverse problems solved by singular value decomposition

USGS Publications Warehouse

Hill, M.C.; Nolan, B.T.

2010-01-01

Local sensitivity analysis provides computationally frugal ways to evaluate models commonly used for resource management, risk assessment, and so on. This includes diagnosing inverse model convergence problems caused by parameter insensitivity and(or) parameter interdependence (correlation), understanding what aspects of the model and data contribute to measures of uncertainty, and identifying new data likely to reduce model uncertainty. Here, we consider sensitivity statistics relevant to models in which the process model parameters are transformed using singular value decomposition (SVD) to create SVD parameters for model calibration. The statistics considered include the PEST identifiability statistic, and combined use of the process-model parameter statistics composite scaled sensitivities and parameter correlation coefficients (CSS and PCC). The statistics are complimentary in that the identifiability statistic integrates the effects of parameter sensitivity and interdependence, while CSS and PCC provide individual measures of sensitivity and interdependence. PCC quantifies correlations between pairs or larger sets of parameters; when a set of parameters is intercorrelated, the absolute value of PCC is close to 1.00 for all pairs in the set. The number of singular vectors to include in the calculation of the identifiability statistic is somewhat subjective and influences the statistic. To demonstrate the statistics, we use the USDA’s Root Zone Water Quality Model to simulate nitrogen fate and transport in the unsaturated zone of the Merced River Basin, CA. There are 16 log-transformed process-model parameters, including water content at field capacity (WFC) and bulk density (BD) for each of five soil layers. Calibration data consisted of 1,670 observations comprising soil moisture, soil water tension, aqueous nitrate and bromide concentrations, soil nitrate concentration, and organic matter content. All 16 of the SVD parameters could be estimated by regression based on the range of singular values. Identifiability statistic results varied based on the number of SVD parameters included. Identifiability statistics calculated for four SVD parameters indicate the same three most important process-model parameters as CSS/PCC (WFC1, WFC2, and BD2), but the order differed. Additionally, the identifiability statistic showed that BD1 was almost as dominant as WFC1. The CSS/PCC analysis showed that this results from its high correlation with WCF1 (-0.94), and not its individual sensitivity. Such distinctions, combined with analysis of how high correlations and(or) sensitivities result from the constructed model, can produce important insights into, for example, the use of sensitivity analysis to design monitoring networks. In conclusion, the statistics considered identified similar important parameters. They differ because (1) with CSS/PCC can be more awkward because sensitivity and interdependence are considered separately and (2) identifiability requires consideration of how many SVD parameters to include. A continuing challenge is to understand how these computationally efficient methods compare with computationally demanding global methods like Markov-Chain Monte Carlo given common nonlinear processes and the often even more nonlinear models.

Effect of different transport observations on inverse modeling results: case study of a long-term groundwater tracer test monitored at high resolution

NASA Astrophysics Data System (ADS)

Rasa, Ehsan; Foglia, Laura; Mackay, Douglas M.; Scow, Kate M.

2013-11-01

Conservative tracer experiments can provide information useful for characterizing various subsurface transport properties. This study examines the effectiveness of three different types of transport observations for sensitivity analysis and parameter estimation of a three-dimensional site-specific groundwater flow and transport model: conservative tracer breakthrough curves (BTCs), first temporal moments of BTCs ( m 1), and tracer cumulative mass discharge ( M d) through control planes combined with hydraulic head observations ( h). High-resolution data obtained from a 410-day controlled field experiment at Vandenberg Air Force Base, California (USA), have been used. In this experiment, bromide was injected to create two adjacent plumes monitored at six different transects (perpendicular to groundwater flow) with a total of 162 monitoring wells. A total of 133 different observations of transient hydraulic head, 1,158 of BTC concentration, 23 of first moment, and 36 of mass discharge were used for sensitivity analysis and parameter estimation of nine flow and transport parameters. The importance of each group of transport observations in estimating these parameters was evaluated using sensitivity analysis, and five out of nine parameters were calibrated against these data. Results showed the advantages of using temporal moment of conservative tracer BTCs and mass discharge as observations for inverse modeling.

Transportation optimization with fuzzy trapezoidal numbers based on possibility theory.

PubMed

He, Dayi; Li, Ran; Huang, Qi; Lei, Ping

2014-01-01

In this paper, a parametric method is introduced to solve fuzzy transportation problem. Considering that parameters of transportation problem have uncertainties, this paper develops a generalized fuzzy transportation problem with fuzzy supply, demand and cost. For simplicity, these parameters are assumed to be fuzzy trapezoidal numbers. Based on possibility theory and consistent with decision-makers' subjectiveness and practical requirements, the fuzzy transportation problem is transformed to a crisp linear transportation problem by defuzzifying fuzzy constraints and objectives with application of fractile and modality approach. Finally, a numerical example is provided to exemplify the application of fuzzy transportation programming and to verify the validity of the proposed methods.

Investigating the collision energy dependence of η /s in the beam energy scan at the BNL Relativistic Heavy Ion Collider using Bayesian statistics

NASA Astrophysics Data System (ADS)

Auvinen, Jussi; Bernhard, Jonah E.; Bass, Steffen A.; Karpenko, Iurii

2018-04-01

We determine the probability distributions of the shear viscosity over the entropy density ratio η /s in the quark-gluon plasma formed in Au + Au collisions at √{sN N}=19.6 ,39 , and 62.4 GeV , using Bayesian inference and Gaussian process emulators for a model-to-data statistical analysis that probes the full input parameter space of a transport + viscous hydrodynamics hybrid model. We find the most likely value of η /s to be larger at smaller √{sN N}, although the uncertainties still allow for a constant value between 0.10 and 0.15 for the investigated collision energy range.

Towards a more sustainable transport infrastructure: how spatial geological data can be utilized to improve early stage Life cycle assessment of road infrastructure

NASA Astrophysics Data System (ADS)

Karlsson, Caroline; Miliutenko, Sofiia; Björklund, Anna; Mörtberg, Ulla; Olofsson, Bo; Toller, Susanna

2017-04-01

Environmental impacts during the life cycle stages of transport infrastructure are substantial, including among other greenhouse gas (GHG) emissions, as well as resource and energy use. For transport infrastructure to be sustainable, such issues need to be integrated in the planning process. Environmental Impact Assessment (EIA) is required by the European Union (EU) in order to ensure that all environmental aspects are considered during planning of road infrastructure projects. As a part of this process, the European Commission has suggested the use of the tool life cycle assessment (LCA) for assessing life cycle energy use and GHG emissions. When analyzing life cycle impacts of the road infrastructure itself, it was shown that earthworks and materials used for the road construction have a big share in the total energy use and GHG emissions. Those aspects are largely determined by the geological conditions at the site of construction: parameters such as soil thickness, slope, bedrock quality and soil type. The geological parameters determine the amounts of earthworks (i.e. volumes of soil and rock that will be excavated and blasted), transportation need for excavated materials as well as the availability of building materials. The study presents a new geographic information system (GIS)-based approach for utilizing spatial geological data in three dimensions (i.e. length, width and depth) in order to improve estimates on earthworks during the early stages of road infrastructure planning. Three main methodological steps were undertaken: mass balance calculation, life cycle inventory analysis and spatial mapping of greenhouse gas (GHG) emissions and energy use. The proposed GIS-based approach was later evaluated by comparing with the actual values of extracted material of a real road construction project. The results showed that the estimate of filling material was the most accurate, while the estimate for excavated soil and blasted rock had a wide variation from the actual values. It was also found that the total volume of excavated and ripped soils did not change when accounting for geological stratigraphy. The proposed GIS-based approach shows promising results for usage in LCA at an early stage of road infrastructure planning, and by providing better data quality, GIS in combination with LCA can enable planning for a more sustainable transport infrastructure.

Simulation of the hybrid and steady state advanced operating modes in ITER

NASA Astrophysics Data System (ADS)

Kessel, C. E.; Giruzzi, G.; Sips, A. C. C.; Budny, R. V.; Artaud, J. F.; Basiuk, V.; Imbeaux, F.; Joffrin, E.; Schneider, M.; Murakami, M.; Luce, T.; St. John, Holger; Oikawa, T.; Hayashi, N.; Takizuka, T.; Ozeki, T.; Na, Y.-S.; Park, J. M.; Garcia, J.; Tucillo, A. A.

2007-09-01

Integrated simulations are performed to establish a physics basis, in conjunction with present tokamak experiments, for the operating modes in the International Thermonuclear Experimental Reactor (ITER). Simulations of the hybrid mode are done using both fixed and free-boundary 1.5D transport evolution codes including CRONOS, ONETWO, TSC/TRANSP, TOPICS and ASTRA. The hybrid operating mode is simulated using the GLF23 and CDBM05 energy transport models. The injected powers are limited to the negative ion neutral beam, ion cyclotron and electron cyclotron heating systems. Several plasma parameters and source parameters are specified for the hybrid cases to provide a comparison of 1.5D core transport modelling assumptions, source physics modelling assumptions, as well as numerous peripheral physics modelling. Initial results indicate that very strict guidelines will need to be imposed on the application of GLF23, for example, to make useful comparisons. Some of the variations among the simulations are due to source models which vary widely among the codes used. In addition, there are a number of peripheral physics models that should be examined, some of which include fusion power production, bootstrap current, treatment of fast particles and treatment of impurities. The hybrid simulations project to fusion gains of 5.6-8.3, βN values of 2.1-2.6 and fusion powers ranging from 350 to 500 MW, under the assumptions outlined in section 3. Simulations of the steady state operating mode are done with the same 1.5D transport evolution codes cited above, except the ASTRA code. In these cases the energy transport model is more difficult to prescribe, so that energy confinement models will range from theory based to empirically based. The injected powers include the same sources as used for the hybrid with the possible addition of lower hybrid. The simulations of the steady state mode project to fusion gains of 3.5-7, βN values of 2.3-3.0 and fusion powers of 290 to 415 MW, under the assumptions described in section 4. These simulations will be presented and compared with particular focus on the resulting temperature profiles, source profiles and peripheral physics profiles. The steady state simulations are at an early stage and are focused on developing a range of safety factor profiles with 100% non-inductive current.

Evaluation of Single File Systems Reciproc, Oneshape, and WaveOne using Cone Beam Computed Tomography -An In Vitro Study.

PubMed

Dhingra, Annil; Ruhal, Nidhi; Miglani, Anjali

2015-04-01

Successful endodontic therapy depends on many factor, one of the most important step in any root canal treatment is root canal preparation. In addition, respecting the original shape of the canal is of the same importance; otherwise, canal aberrations such as transportation will be created. The purpose of this study is to compare and evaluate Reciprocating WaveOne ,Reciproc and Rotary Oneshape Single File Instrumentation System On Cervical Dentin Thickness, Cross Sectional Area and Canal Transportation on First Mandibular Molar Using Cone Beam Computed Tomography. Sixty Mandibular First Molars extracted due to periodontal reason was collected from the Department of Oral and Maxillofacial. Teeth were prepared using one rotary and two reciprocating single file system. Teeth were divided into 3 groups 20 teeth in each group. Pre instrumentation and Post instrumentation scans was done and evaluated for three parameters Canal Transportation, Cervical Dentinal Thickness, Cross-sectional Area. Results were analysed statistically using ANOVA, Post-Hoc Tukey analysis. The change in cross-sectional area after filing showed significant difference at 0mm, 1mm, 2mm and 7mm (p<0.001, p =0.006, 0.004 & <0.001 respectively). There was significant difference between wave one and oneshape; oneshape and reciproc at 0mm, 1mm, 2mm & 7mm (p-values for waveone and Oneshape <0.001, 0.022, 0.011 & <0.001 resp. and for oneshape and reciproc < 0.001, p= 0.011, p=0.008 & <0.001). On assessing the transportation of the three file system over a distance of 7 mm (starting from 0mm and then evaluation at 1mm, 2mm, 3mm, 5mm and 7mm), the results showed a significant difference among the file systems at various lengths (p= 0.014, 0.046, 0.004, 0.028, 0.005 & 0.029 respectively). Mean value of cervical dentinal removal is maximum at all the levels for oneshape and minimum for waveone showing the better quality of waveone and reciproc over oneshape file system. Significant difference was found at 9mm, 11mm and 12mm between all the three file systems (p<0.001,< 0.001, <0.001). It was concluded that reciprocating motion is better than rotary motion in all the three parameters Canal Transportation, Cross-sectional Area, Cervical Dentinal Thickness.

Relevance of anisotropy and spatial variability of gas diffusivity for soil-gas transport

NASA Astrophysics Data System (ADS)

Schack-Kirchner, Helmer; Kühne, Anke; Lang, Friederike

2017-04-01

Models of soil gas transport generally do not consider neither direction dependence of gas diffusivity, nor its small-scale variability. However, in a recent study, we could provide evidence for anisotropy favouring vertical gas diffusion in natural soils. We hypothesize that gas transport models based on gas diffusion data measured with soil rings are strongly influenced by both, anisotropy and spatial variability and the use of averaged diffusivities could be misleading. To test this we used a 2-dimensional model of soil gas transport to under compacted wheel tracks to model the soil-air oxygen distribution in the soil. The model was parametrized with data obtained from soil-ring measurements with its central tendency and variability. The model includes vertical parameter variability as well as variation perpendicular to the elongated wheel track. Different parametrization types have been tested: [i)]Averaged values for wheel track and undisturbed. em [ii)]Random distribution of soil cells with normally distributed variability within the strata. em [iii)]Random distributed soil cells with uniformly distributed variability within the strata. All three types of small-scale variability has been tested for [j)] isotropic gas diffusivity and em [jj)]reduced horizontal gas diffusivity (constant factor), yielding in total six models. As expected the different parametrizations had an important influence to the aeration state under wheel tracks with the strongest oxygen depletion in case of uniformly distributed variability and anisotropy towards higher vertical diffusivity. The simple simulation approach clearly showed the relevance of anisotropy and spatial variability in case of identical central tendency measures of gas diffusivity. However, until now it did not consider spatial dependency of variability, that could even aggravate effects. To consider anisotropy and spatial variability in gas transport models we recommend a) to measure soil-gas transport parameters spatially explicit including different directions and b) to use random-field stochastic models to assess the possible effects for gas-exchange models.

Modeling Input Errors to Improve Uncertainty Estimates for Sediment Transport Model Predictions

NASA Astrophysics Data System (ADS)

Jung, J. Y.; Niemann, J. D.; Greimann, B. P.

2016-12-01

Bayesian methods using Markov chain Monte Carlo algorithms have recently been applied to sediment transport models to assess the uncertainty in the model predictions due to the parameter values. Unfortunately, the existing approaches can only attribute overall uncertainty to the parameters. This limitation is critical because no model can produce accurate forecasts if forced with inaccurate input data, even if the model is well founded in physical theory. In this research, an existing Bayesian method is modified to consider the potential errors in input data during the uncertainty evaluation process. The input error is modeled using Gaussian distributions, and the means and standard deviations are treated as uncertain parameters. The proposed approach is tested by coupling it to the Sedimentation and River Hydraulics - One Dimension (SRH-1D) model and simulating a 23-km reach of the Tachia River in Taiwan. The Wu equation in SRH-1D is used for computing the transport capacity for a bed material load of non-cohesive material. Three types of input data are considered uncertain: (1) the input flowrate at the upstream boundary, (2) the water surface elevation at the downstream boundary, and (3) the water surface elevation at a hydraulic structure in the middle of the reach. The benefits of modeling the input errors in the uncertainty analysis are evaluated by comparing the accuracy of the most likely forecast and the coverage of the observed data by the credible intervals to those of the existing method. The results indicate that the internal boundary condition has the largest uncertainty among those considered. Overall, the uncertainty estimates from the new method are notably different from those of the existing method for both the calibration and forecast periods.

A FOUR-FLUID MHD MODEL OF THE SOLAR WIND/INTERSTELLAR MEDIUM INTERACTION WITH TURBULENCE TRANSPORT AND PICKUP PROTONS AS SEPARATE FLUID

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usmanov, Arcadi V.; Matthaeus, William H.; Goldstein, Melvyn L., E-mail: arcadi.usmanov@nasa.gov

2016-03-20

We have developed a four-fluid, three-dimensional magnetohydrodynamic model of the solar wind interaction with the local interstellar medium. The unique features of the model are: (a) a three-fluid description for the charged components of the solar wind and interstellar plasmas (thermal protons, electrons, and pickup protons), (b) the built-in turbulence transport equations based on Reynolds decomposition and coupled with the mean-flow Reynolds-averaged equations, and (c) a solar corona/solar wind model that supplies inner boundary conditions at 40 au by computing solar wind and magnetic field parameters outward from the coronal base. The three charged species are described by separate energy equationsmore » and are assumed to move with the same velocity. The fourth fluid in the model is the interstellar hydrogen which is treated by separate continuity, momentum, and energy equations and is coupled with the charged components through photoionization and charge exchange. We evaluate the effects of turbulence transport and pickup protons on the global heliospheric structure and compute the distribution of plasma, magnetic field, and turbulence parameters throughout the heliosphere for representative solar minimum and maximum conditions. We compare our results with Voyager 1 observations in the outer heliosheath and show that the relative amplitude of magnetic fluctuations just outside the heliopause is in close agreement with the value inferred from Voyager 1 measurements by Burlaga et al. The simulated profiles of magnetic field parameters in the outer heliosheath are in qualitative agreement with the Voyager 1 observations and with the analytical model of magnetic field draping around the heliopause of Isenberg et al.« less

A mathematical model of liver metabolism: from steady state to dynamic

NASA Astrophysics Data System (ADS)

Calvetti, D.; Kuceyeski, A.; Somersalo, E.

2008-07-01

The increase in Type 2 diabetes and other metabolic disorders has led to an intense focus on the areas of research related to metabolism. Because the liver is essential in regulating metabolite concentrations that maintain life, it is especially important to have good knowledge of the functions within this organ. In silico mathematical models that can adequately describe metabolite concentrations, flux and transport rates in the liver in vivo can be a useful predictive tool. Fully dynamic models, which contain expressions for Michaelis-Menten reaction kinetics can be utilized to investigate different metabolic states, for example exercise, fed or starved state. In this paper we describe a two compartment (blood and tissue) spatially lumped liver metabolism model. First, we use Bayesian Flux Balance Analysis (BFBA) to estimate the values of flux and transport rates at steady state, which agree closely with values from the literature. These values are then used to find a set of Michaelis-Menten parameters and initial concentrations which identify a dynamic model that can be used for exploring different metabolic states. In particular, we investigate the effect of doubling the concentration of lactate entering the system via the hepatic artery and portal vein. This change in lactate concentration forces the system to a new steady state, where glucose production is increased.

Structural, transport and thermoelectric properties of Nb-doped CaLaMnO perovskite

NASA Astrophysics Data System (ADS)

Villa, J. I.; Rodríguez, J. E.

2014-12-01

Poly-crystalline perovskite-type (CaLaMnO) Ca0.95La0.05Mn1-xNbxO3 (0.0 ≤ x ≤ 0.10) was synthesized using the conventional solid-state reaction method. Structural and morphological properties were studied by X-ray diffraction analysis (XRD) and scanning electron microscopy (SEM), respectively. Their transport and thermoelectric properties were studied from electrical resistivity ρ(T) and Seebeck coefficient S(T) measurements as a function of temperature and niobium content. The Rietveld analysis revealed a compound with orthorhombic structure, where their lattice parameters increase with the niobium content which is given by a distortion in octahedra MnO6. Electrical resistivity exhibits a semiconducting-like behavior, for low niobium contents (Nb ≤ 0.03) the magnitude of the electrical resistivity decreases, reaching minimum values close to 0.1 Ω - cm. Seebeck coefficient is negative in all studied temperature range. The temperature behavior of S(T) is interpreted in terms of variable range hopping (VRH) and Heikes model. From ρ(T) and S(T) measurements it was possible to calculate the thermoelectric power factor (PF), which reaches maximum values around 0.4 μW /K2 -cm. These values make these ceramics promising electronic thermoelectric materials.

A novel application of t-statistics to objectively assess the quality of IC50 fits for P-glycoprotein and other transporters.

PubMed

O'Connor, Michael; Lee, Caroline; Ellens, Harma; Bentz, Joe

2015-02-01

Current USFDA and EMA guidance for drug transporter interactions is dependent on IC50 measurements as these are utilized in determining whether a clinical interaction study is warranted. It is therefore important not only to standardize transport inhibition assay systems but also to develop uniform statistical criteria with associated probability statements for generation of robust IC50 values, which can be easily adopted across the industry. The current work provides a quantitative examination of critical factors affecting the quality of IC50 fits for P-gp inhibition through simulations of perfect data with randomly added error as commonly observed in the large data set collected by the P-gp IC50 initiative. The types of errors simulated were (1) variability in replicate measures of transport activity; (2) transformations of error-contaminated transport activity data prior to IC50 fitting (such as performed when determining an IC50 for inhibition of P-gp based on efflux ratio); and (3) the lack of well defined "no inhibition" and "complete inhibition" plateaus. The effect of the algorithm used in fitting the inhibition curve (e.g., two or three parameter fits) was also investigated. These simulations provide strong quantitative support for the recommendations provided in Bentz et al. (2013) for the determination of IC50 values for P-gp and demonstrate the adverse effect of data transformation prior to fitting. Furthermore, the simulations validate uniform statistical criteria for robust IC50 fits in general, which can be easily implemented across the industry. A calibration of the t-statistic is provided through calculation of confidence intervals associated with the t-statistic.

Permeability, transport, and metabolism of solutes in Caco-2 cell monolayers: a theoretical study.

PubMed

Sun, Huadong; Pang, K Sandy

2008-01-01

We explored the properties of a catenary model that includes the basolateral (B), apical (A), and cellular compartments via simulations under linear and nonlinear conditions to understand the asymmetric observations arising from transporters, enzymes, and permeability in Caco-2 cells. The efflux ratio (EfR; P(app,B-->A)/P(app,A-->B)), obtained from the effective permeability from the A-->B and B-->A direction under linear conditions, was unity for passively permeable drugs whose transport does not involve transporters; the value was unaffected by cellular binding or metabolism, but increased with apical efflux. Metabolism was asymmetric, showing lesser metabolite accrual for the B-->A than A-->B direction because of inherent differences in the volumes for A and B. Moreover, the net flux (total - passive permeation) due to saturable apical efflux, absorption, or metabolism showed nonconformity to simple Michaelis-Menten kinetics against C(D,0), the loading donor concentration. EfR values differed with saturable apical efflux and metabolism (>1), as well as apical absorption (EfRs <1), but approached unity with high passive diffusive clearance (CL(d)) and increasing C(D,0) at a higher degree of saturation of the process. The J(max) (apparent V(max) estimated for the carrier system) and K(m)(') [or the K(m)('') based on a modified equation with the Hill coefficient (beta)] estimates from the Eadie-Hofstee plot revealed spurious correlations with the assigned V(max) and K(m). The sampling time, CL(d), and parameter space of K(m) and V(max) strongly influenced both the correlation and accuracy of estimates. Improved correlation was found for compounds with high CL(d). These observations showed that the catenary model is appropriate in the description of transport and metabolic data in Caco-2 cells.

Breast cancer resistance protein (BCRP)-mediated glyburide transport: effect of the C421A/Q141K BCRP single-nucleotide polymorphism.

PubMed

Pollex, Erika K; Anger, Gregory; Hutson, Janine; Koren, Gideon; Piquette-Miller, Micheline

2010-05-01

The antidiabetic agent glyburide (glibenclamide) is frequently used for the treatment of type II diabetes and is increasingly being used for the treatment of gestational diabetes. Evidence suggests that breast cancer resistance protein/ATP-binding cassette, subfamily G, member 2 (ABCG2) expressed in the placenta protects the fetus against the accumulation of glyburide. A number of studies have investigated the significance of several single-nucleotide polymorphisms (SNPs) in the ABCG2 gene. Associations between the Q141K (C421A) SNP and ABCG2 protein expression, membrane surface translocation, efflux activity, or ATPase activity have been shown. Therefore, alterations in glyburide transport across the placenta, resulting in increased fetal glyburide exposure, may be seen in individuals carrying the C421A allele. The purpose of this study is to investigate whether the Q141K SNP causes alterations in ABCG2-mediated glyburide transport. Glyburide accumulation assays were carried out with stably transfected human embryonic kidney (HEK)-293 cells expressing wild-type ABCG2 (Arg482) and polymorphic ABCG2 (Q141K). Glyburide kinetic parameters were determined for comparison of wild-type and SNP ABCG2 activity by simultaneously fitting data for ABCG2-expressing cells (saturable transport) and empty vector-expressing cells (nonsaturable transport) by nonlinear regression analysis. The apparent K(t) and V(max) values for the transfected HEK-293 cells expressing the polymorphic variant (Q141K) of ABCG2 were significantly higher than those values determined for the wild-type ABCG2-expressing cells (p < 0.05). Our results indicate that the Q141K variant of ABCG2 may have the potential to alter the placental pharmacokinetics of glyburide used in pregnancy.

A novel application of t-statistics to objectively assess the quality of IC50 fits for P-glycoprotein and other transporters

PubMed Central

O'Connor, Michael; Lee, Caroline; Ellens, Harma; Bentz, Joe

2015-01-01

Current USFDA and EMA guidance for drug transporter interactions is dependent on IC50 measurements as these are utilized in determining whether a clinical interaction study is warranted. It is therefore important not only to standardize transport inhibition assay systems but also to develop uniform statistical criteria with associated probability statements for generation of robust IC50 values, which can be easily adopted across the industry. The current work provides a quantitative examination of critical factors affecting the quality of IC50 fits for P-gp inhibition through simulations of perfect data with randomly added error as commonly observed in the large data set collected by the P-gp IC50 initiative. The types of errors simulated were (1) variability in replicate measures of transport activity; (2) transformations of error-contaminated transport activity data prior to IC50 fitting (such as performed when determining an IC50 for inhibition of P-gp based on efflux ratio); and (3) the lack of well defined “no inhibition” and “complete inhibition” plateaus. The effect of the algorithm used in fitting the inhibition curve (e.g., two or three parameter fits) was also investigated. These simulations provide strong quantitative support for the recommendations provided in Bentz et al. (2013) for the determination of IC50 values for P-gp and demonstrate the adverse effect of data transformation prior to fitting. Furthermore, the simulations validate uniform statistical criteria for robust IC50 fits in general, which can be easily implemented across the industry. A calibration of the t-statistic is provided through calculation of confidence intervals associated with the t-statistic. PMID:25692007

Introduction of Shear-Based Transport Mechanisms in Radial-Axial Hybrid Hall Thruster Simulations

NASA Astrophysics Data System (ADS)

Scharfe, Michelle; Gascon, Nicolas; Scharfe, David; Cappelli, Mark; Fernandez, Eduardo

2007-11-01

Electron diffusion across magnetic field lines in Hall effect thrusters is experimentally observed to be higher than predicted by classical diffusion theory. Motivated by theoretical work for fusion applications and experimental measurements of Hall thrusters, numerical models for the electron transport are implemented in radial-axial hybrid simulations in order to compute the electron mobility using simulated plasma properties and fitting parameters. These models relate the cross-field transport to the imposed magnetic field distribution through shear suppression of turbulence-enhanced transport. While azimuthal waves likely enhance cross field mobility, axial shear in the electron fluid may reduce transport due to a reduction in turbulence amplitudes and modification of phase shifts between fluctuating properties. The sensitivity of the simulation results to the fitting parameters is evaluated and an examination is made of the transportability of these parameters to several Hall thruster devices.

Evaluation of Parameter Uncertainty Reduction in Groundwater Flow Modeling Using Multiple Environmental Tracers

NASA Astrophysics Data System (ADS)

Arnold, B. W.; Gardner, P.

2013-12-01

Calibration of groundwater flow models for the purpose of evaluating flow and aquifer heterogeneity typically uses observations of hydraulic head in wells and appropriate boundary conditions. Environmental tracers have a wide variety of decay rates and input signals in recharge, resulting in a potentially broad source of additional information to constrain flow rates and heterogeneity. A numerical study was conducted to evaluate the reduction in uncertainty during model calibration using observations of various environmental tracers and combinations of tracers. A synthetic data set was constructed by simulating steady groundwater flow and transient tracer transport in a high-resolution, 2-D aquifer with heterogeneous permeability and porosity using the PFLOTRAN software code. Data on pressure and tracer concentration were extracted at well locations and then used as observations for automated calibration of a flow and transport model using the pilot point method and the PEST code. Optimization runs were performed to estimate parameter values of permeability at 30 pilot points in the model domain for cases using 42 observations of: 1) pressure, 2) pressure and CFC11 concentrations, 3) pressure and Ar-39 concentrations, and 4) pressure, CFC11, Ar-39, tritium, and He-3 concentrations. Results show significantly lower uncertainty, as indicated by the 95% linear confidence intervals, in permeability values at the pilot points for cases including observations of environmental tracer concentrations. The average linear uncertainty range for permeability at the pilot points using pressure observations alone is 4.6 orders of magnitude, using pressure and CFC11 concentrations is 1.6 orders of magnitude, using pressure and Ar-39 concentrations is 0.9 order of magnitude, and using pressure, CFC11, Ar-39, tritium, and He-3 concentrations is 1.0 order of magnitude. Data on Ar-39 concentrations result in the greatest parameter uncertainty reduction because its half-life of 269 years is similar to the range of transport times (hundreds to thousands of years) in the heterogeneous synthetic aquifer domain. The slightly higher uncertainty range for the case using all of the environmental tracers simultaneously is probably due to structural errors in the model introduced by the pilot point regularization scheme. It is concluded that maximum information and uncertainty reduction for constraining a groundwater flow model is obtained using an environmental tracer whose half-life is well matched to the range of transport times through the groundwater flow system. Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

Discussion of the influence of CO and CH4 in CO2 transport, injection, and storage for CCS technology.

PubMed

Blanco, Sofía T; Rivas, Clara; Bravo, Ramón; Fernández, Javier; Artal, Manuela; Velasco, Inmaculada

2014-09-16

This paper discusses the influence of the noncondensable impurities CO and CH4 on Carbon Capture and Storage (CCS) technology. We calculated and drew conclusions about the impact of both impurities in the CO2 on selected transport, injection, and storage parameters (pipeline pressure drop, storage capacity, etc.), whose analysis is necessary for the safe construction and operation of CO2 pipelines and for the secure long-term geological storage of anthropogenic CO2. To calculate these parameters, it is necessary to acquire data on the volumetric properties and the vapor-liquid equilibrium of the fluid being subjected to CCS. In addition to literature data, we used new experimental data, which are presented here and were obtained for five mixtures of CO2+CO with compositions characteristic of the typical emissions of the E.U. and the U.S.A. Temperatures and pressures are based on relevant CO2 pipeline and geological storage site values. From our experimental results, Peng-Robinson, PC-SAFT, and GERG Equations of State for were validated CO2+CO under the conditions of CCS. We conclude that the concentration of both impurities strongly affects the studied parameters, with CO being the most influential and problematic. The overall result of these negative effects is an increase in the difficulties, risks, and overall costs of CCS.

Systematic comparison of jet energy-loss schemes in a realistic hydrodynamic medium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bass, Steffen A.; Majumder, Abhijit; Gale, Charles

2009-02-15

We perform a systematic comparison of three different jet energy-loss approaches. These include the Armesto-Salgado-Wiedemann scheme based on the approach of Baier-Dokshitzer-Mueller-Peigne-Schiff and Zakharov (BDMPS-Z/ASW), the higher twist (HT) approach and a scheme based on the Arnold-Moore-Yaffe (AMY) approach. In this comparison, an identical medium evolution will be utilized for all three approaches: this entails not only the use of the same realistic three-dimensional relativistic fluid dynamics (RFD) simulation, but also the use of identical initial parton-distribution functions and final fragmentation functions. We are, thus, in a unique position to not only isolate fundamental differences between the various approaches butmore » also make rigorous calculations for different experimental measurements using state of the art components. All three approaches are reduced to versions containing only one free tunable parameter, this is then related to the well-known transport parameter q. We find that the parameters of all three calculations can be adjusted to provide a good description of inclusive data on R{sub AA} vs transverse momentum. However, we do observe slight differences in their predictions for the centrality and azimuthal angular dependence of R{sub AA} vs p{sub T}. We also note that the values of the transport coefficient q in the three approaches to describe the data differ significantly.« less

Reconstructing solar magnetic fields from historical observations. II. Testing the surface flux transport model

NASA Astrophysics Data System (ADS)

Virtanen, I. O. I.; Virtanen, I. I.; Pevtsov, A. A.; Yeates, A.; Mursula, K.

2017-07-01

Aims: We aim to use the surface flux transport model to simulate the long-term evolution of the photospheric magnetic field from historical observations. In this work we study the accuracy of the model and its sensitivity to uncertainties in its main parameters and the input data. Methods: We tested the model by running simulations with different values of meridional circulation and supergranular diffusion parameters, and studied how the flux distribution inside active regions and the initial magnetic field affected the simulation. We compared the results to assess how sensitive the simulation is to uncertainties in meridional circulation speed, supergranular diffusion, and input data. We also compared the simulated magnetic field with observations. Results: We find that there is generally good agreement between simulations and observations. Although the model is not capable of replicating fine details of the magnetic field, the long-term evolution of the polar field is very similar in simulations and observations. Simulations typically yield a smoother evolution of polar fields than observations, which often include artificial variations due to observational limitations. We also find that the simulated field is fairly insensitive to uncertainties in model parameters or the input data. Due to the decay term included in the model the effects of the uncertainties are somewhat minor or temporary, lasting typically one solar cycle.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sokolov, Andrei; Kirianov, Eugene; Zlenko, Albina

The effect of substrates on the magnetic and transport properties of Ni{sub 2}Mn{sub 1.5}In{sub 0.5} ultra-thin films were studied theoretically and experimentally. High quality 8-nm films were grown by laser-assisted molecular beam epitaxy deposition. Magneto-transport measurements revealed that the films undergo electronic structure transformation similar to those of bulk materials at the martensitic transformation. The temperature of the transformation depends strongly on lattice parameters of the substrate. To explain this behavior, we performed DFT calculations on the system and found that different substrates change the relative stability of the ferromagnetic (FM) austenite and ferrimagnetic (FiM) martensite states. We conclude thatmore » the energy difference between the FM austenite and FiM martensite states in Ni{sub 2}Mn{sub 1.5}In{sub 0.5} films grown on MgO (001) substrates is ΔE = 0.20 eV per NiMnIn f.u, somewhat lower compared to ΔE = 0.24 eV in the bulk material with the same lattice parameters. When the lattice parameters of Ni{sub 2}Mn{sub 1.5}In{sub 0.5} film have values close to those of the MgO substrate, the energy difference becomes ΔE = 0.08 eV per NiMnIn f.u. These results suggest the possibility to control the martensitic transition in thin films through substrate engineering.« less

Mn Impurity in Bulk GaAs Crystals

NASA Astrophysics Data System (ADS)

Pawłowski, M.; Piersa, M.; Wołoś, A.; Palczewska, M.; Strzelecka, G.; Hruban, A.; Gosk, J.; Kamińska, M.; Twardowski, A.

2006-11-01

Magnetic and electron transport properties of GaAs:Mn crystals grown by Czochralski method were studied. Electron spin resonance showed the presence of Mn acceptor A in two charge states: singly ionized A- in the form of Mn2+(d5), and neutral A0 in the form of Mn2+(d5) plus a bound hole (h). It was possible to determine the relative concentration of both types of centers from intensity of the corresponding electron spin resonance lines. Magnetization measured as a function of magnetic field (up to 6 T) in the temperature range of 2-300 K revealed overall paramagnetic behavior of the samples. Effective spin was found to be about 1.5 value, which was consistent with the presence of two types of Mn configurations. In most of the studied samples the dominance of Mn2+(d5)+h configuration was established and it increased after annealing of native donors. The total value of Mn content was obtained from fitting of magnetization curves with the use of parameters obtained from electron spin resonance. In electron transport, two mechanisms of conductivity were observed: valence band transport dominated above 70 K, and hopping conductivity within Mn impurity band at lower temperatures. From the analysis of the hopping conductivity and using the obtained values of the total Mn content, the effective radius of Mn acceptor in GaAs was estimated as a = 11 ± 3 Å.