Ion-binding properties of the ClC chloride selectivity filter
Lobet, Séverine; Dutzler, Raimund
2006-01-01
The ClC channels are members of a large protein family of chloride (Cl−) channels and secondary active Cl− transporters. Despite their diverse functions, the transmembrane architecture within the family is conserved. Here we present a crystallographic study on the ion-binding properties of the ClC selectivity filter in the close homolog from Escherichia coli (EcClC). The ClC selectivity filter contains three ion-binding sites that bridge the extra- and intracellular solutions. The sites bind Cl− ions with mM affinity. Despite their close proximity within the filter, the three sites can be occupied simultaneously. The ion-binding properties are found conserved from the bacterial transporter EcClC to the human Cl− channel ClC-1, suggesting a close functional link between ion permeation in the channels and active transport in the transporters. In resemblance to K+ channels, ions permeate the ClC channel in a single file, with mutual repulsion between the ions fostering rapid conduction. PMID:16341087
Bosdriesz, Evert; Magnúsdóttir, Stefanía; Bruggeman, Frank J; Teusink, Bas; Molenaar, Douwe
2015-06-01
Microorganisms rely on binding-protein assisted, active transport systems to scavenge for scarce nutrients. Several advantages of using binding proteins in such uptake systems have been proposed. However, a systematic, rigorous and quantitative analysis of the function of binding proteins is lacking. By combining knowledge of selection pressure and physiochemical constraints, we derive kinetic, thermodynamic, and stoichiometric properties of binding-protein dependent transport systems that enable a maximal import activity per amount of transporter. Under the hypothesis that this maximal specific activity of the transport complex is the selection objective, binding protein concentrations should exceed the concentration of both the scarce nutrient and the transporter. This increases the encounter rate of transporter with loaded binding protein at low substrate concentrations, thereby enhancing the affinity and specific uptake rate. These predictions are experimentally testable, and a number of observations confirm them. © 2015 FEBS.
Milles, Sigrid; Lemke, Edward A
2014-07-07
Intrinsically disordered proteins (IDPs) can bind to multiple interaction partners. Numerous binding regions in the IDP that act in concert through complex cooperative effects facilitate such interactions, but complicate studying IDP complexes. To address this challenge we developed a combined fluorescence correlation and time-resolved polarization spectroscopy approach to study the binding properties of the IDP nucleoporin153 (Nup153) to nuclear transport receptors (NTRs). The detection of segmental backbone mobility of Nup153 within the unperturbed complex provided a readout of local, region-specific binding properties that are usually masked in measurements of the whole IDP. The binding affinities of functionally and structurally diverse NTRs to distinct regions of Nup153 can differ by orders of magnitudes-a result with implications for the diversity of transport routes in nucleocytoplasmic transport. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Deniaud, Aurélien; Panwar, Pankaj; Frelet-Barrand, Annie; Bernaudat, Florent; Juillan-Binard, Céline; Ebel, Christine; Rolland, Norbert; Pebay-Peyroula, Eva
2012-01-01
Background Chloroplast ATP/ADP transporters are essential to energy homeostasis in plant cells. However, their molecular mechanism remains poorly understood, primarily due to the difficulty of producing and purifying functional recombinant forms of these transporters. Methodology/Principal Findings In this work, we describe an expression and purification protocol providing good yields and efficient solubilization of NTT1 protein from Arabidopsis thaliana. By biochemical and biophysical analyses, we identified the best detergent for solubilization and purification of functional proteins, LAPAO. Purified NTT1 was found to accumulate as two independent pools of well folded, stable monomers and dimers. ATP and ADP binding properties were determined, and Pi, a co-substrate of ADP, was confirmed to be essential for nucleotide steady-state transport. Nucleotide binding studies and analysis of NTT1 mutants lead us to suggest the existence of two distinct and probably inter-dependent binding sites. Finally, fusion and deletion experiments demonstrated that the C-terminus of NTT1 is not essential for multimerization, but probably plays a regulatory role, controlling the nucleotide exchange rate. Conclusions/Significance Taken together, these data provide a comprehensive molecular characterization of a chloroplast ATP/ADP transporter. PMID:22438876
1992-03-12
Contributes to many transport and regulatory processes and has multifunctional binding properties which range form various metals, to fatty acids, hormones, and a wide spectrum of therapeutic drugs. The most abundant protein of the circulatory system. It binds and transports an incredible variety of biological and pharmaceutical ligands throughout the blood stream. Principal Investigator was Larry DeLucas.
Nanoparticles engineered to bind cellular motors for efficient delivery.
Dalmau-Mena, Inmaculada; Del Pino, Pablo; Pelaz, Beatriz; Cuesta-Geijo, Miguel Ángel; Galindo, Inmaculada; Moros, María; de la Fuente, Jesús M; Alonso, Covadonga
2018-03-30
Dynein is a cytoskeletal molecular motor protein that transports cellular cargoes along microtubules. Biomimetic synthetic peptides designed to bind dynein have been shown to acquire dynamic properties such as cell accumulation and active intra- and inter-cellular motion through cell-to-cell contacts and projections to distant cells. On the basis of these properties dynein-binding peptides could be used to functionalize nanoparticles for drug delivery applications. Here, we show that gold nanoparticles modified with dynein-binding delivery sequences become mobile, powered by molecular motor proteins. Modified nanoparticles showed dynamic properties, such as travelling the cytosol, crossing intracellular barriers and shuttling the nuclear membrane. Furthermore, nanoparticles were transported from one cell to another through cell-to-cell contacts and quickly spread to distant cells through cell projections. The capacity of these motor-bound nanoparticles to spread to many cells and increasing cellular retention, thus avoiding losses and allowing lower dosage, could make them candidate carriers for drug delivery.
Computer Model of Aspirin bound to Human Serum Albumin
NASA Technical Reports Server (NTRS)
1989-01-01
Contributes to many transport and regulatory processes and has multifunctional binding properties which range form various metals, to fatty acids, hormones, and a wide spectrum of therapeutic drugs. The most abundant protein of the circulatory system. It binds and transports an incredible variety of biological and pharmaceutical ligands throughout the blood stream.
Quantum transport in alkane molecular wires: Effects of binding modes and anchoring groups
NASA Astrophysics Data System (ADS)
Sheng, W.; Li, Z. Y.; Ning, Z. Y.; Zhang, Z. H.; Yang, Z. Q.; Guo, H.
2009-12-01
Effects of binding modes and anchoring groups on nonequilibrium electronic transport properties of alkane molecular wires are investigated from atomic first-principles based on density functional theory and nonequilibrium Green's function formalism. Four typical binding modes, top, bridge, hcp-hollow, and fcc-hollow, are considered at one of the two contacts. For wires with three different anchoring groups, dithiol, diamine, or dicarboxylic acid, the low bias conductances resulting from the four binding modes are all found to have either a high or a low value, well consistent with recent experimental observations. The trend can be rationalized by the behavior of electrode-induced gap states at small bias. When bias increases to higher values, states from the anchoring groups enter into the bias window and contribute significantly to the tunneling process so that transport properties become more complicated for the four binding modes. Other low bias behaviors including the values of the inverse length scale for tunneling characteristic, contact resistance, and the ratios of the high/low conductance values are also calculated and compared to experimental results. The conducting capabilities of the three anchoring groups are found to decrease from dithiol, diamine to dicarboxylic-acid, largely owing to a decrease in binding strength to the electrodes. Our results give a clear microscopic picture to the transport physics and provide reasonable qualitative explanations for the corresponding experimental data.
Skvortsov, A N; Zatulovskiĭ, E A; Puchkova, L V
2012-01-01
It was shown recently, that high affinity Cu(I) importer eukaryotic protein CTR1 can also transport in vitro abiogenic Ag(I) ions and anticancer drug cisplatin. At present there is no rational explanation how CTR1 can transfer platinum group, which is different by coordination properties from highly similar Cu(I) and Ag(I). To understand this phenomenon we analyzed 25 sequences of chordate CTR1 proteins, and found out conserved patterns of organization of N-terminal extracellular part of CTR1 which correspond to initial metal binding. Extracellular copper-binding motifs were qualified by their coordination properties. It was shown that relative position of Met- and His-rich copper-binding motifs in CTR1 predisposes the extracellular CTR1 part to binding of copper, silver and cisplatin. Relation between tissue-specific expression of CTR1 gene, steady-state copper concentration, and silver and platinum accumulation in organs of mice in vivo was analyzed. Significant positive but incomplete correlation exists between these variables. Basing on structural and functional peculiarities of N-terminal part of CTR1 a hypothesis of coupled transport of copper and cisplatin has been suggested, which avoids the disagreement between CTR1-mediated cisplatin transport in vitro, and irreversible binding of platinum to Met-rich peptides.
Passive transport and binding of lead by human red blood cells.
Simons, T J
1986-09-01
The uptake of Pb into human red blood cells has been studied using Pb buffers. Passive Pb movements can be studied conveniently when the cells are depleted of adenosine 5'-triphosphate (ATP), to eliminate active transport, and of inorganic phosphate, to prevent precipitation of lead phosphate. Pb can cross the membrane passively in either direction. Influx and efflux show similar properties. Passive Pb transport is strongly stimulated by HCO3-, and is reduced by replacing Cl- with ClO4-. It is inhibited by low concentrations of 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonic acid (SITS) and 4,4'-diisothiocyanostilbene-2.2'-disulphonic acid (DIDS), characteristic inhibitors of anion transport. Pb uptake is unaffected by varying the external concentrations of Na+, K+ and Ca2+. When Pb enters the cell, it binds mainly to haemoglobin. The ratio of bound Pb:free Pb2+ in the cytosol is estimated to be 6000:1. Pb binding to haemoglobin is unaffected by oxygenation. Binding to albumin is quantitatively similar to binding to haemoglobin. The implications of these results for the transport and binding of Pb in the blood are discussed.
1989-02-03
(PCG) Protein Crystal Growth Human Serum Albumin. Contributes to many transport and regulatory processes and has multifunctional binding properties which range from various metals, to fatty acids, hormones, and a wide spectrum of therapeutic drugs. The most abundant protein of the circulatory system. It binds and transports an incredible variety of biological and pharmaceutical ligands throughout the blood stream. Principal Investigator on STS-26 was Larry DeLucas.
Biswas-Fiss, Esther E.; Affet, Stephanie; Ha, Malissa; Biswas, Subhasis B.
2012-01-01
The retina-specific ATP binding cassette transporter, ABCA4 protein, is associated with a broad range of inherited macular degenerations, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. In order to understand its role in retinal transport in rod out segment discs, we have investigated the interactions of the soluble domains of ABCA4 with both 11-cis- and all-trans-retinal. Using fluorescence anisotropy-based binding analysis and recombinant polypeptides derived from the amino acid sequences of the four soluble domains of ABCA4, we demonstrated that the nucleotide binding domain 1 (NBD1) specifically bound 11-cis-retinal. Its affinity for all-trans-retinal was markedly reduced. Stargardt disease-associated mutations in this domain resulted in attenuation of 11-cis-retinal binding. Significant differences in 11-cis-retinal binding affinities were observed between NBD1 and other cytoplasmic and lumenal domains of ABCA4. The results suggest a possible role of ABCA4 and, in particular, the NBD1 domain in 11-cis-retinal binding. These results also correlate well with a recent report on the in vivo role of ABCA4 in 11-cis-retinal transport. PMID:23144455
Bose, Debosreeta; Sarkar, Deboleena; Chattopadhyay, Nitin
2010-01-01
In the present investigation, an attempt has been made to study the interaction of phenosafranin (PSF), a cationic phenazinium dye with the transport proteins, bovine serum albumin (BSA) and human serum albumin (HSA), employing steady-state and time-resolved fluorometric and circular dichroism (CD) techniques. The photophysical properties of the dye are altered on binding with the serum proteins. An explicit study with respect to the modification of the fluorescence and fluorescence anisotropy upon binding, effect of denaturant, fluorescence lifetime and CD measurements reveal that the dye binds to both BSA and HSA with almost the same affinity. Far-UV CD spectra indicate a decrease in the percentage of alpha-helicity only for BSA upon binding with the probe. Near-UV CD responses indicate an alteration in the tertiary structure of both the transport proteins because of binding.
Chen, Chiliang; Malek, Adel A.; Wargo, Matthew J.; Hogan, Deborah A.; Beattie, Gwyn A.
2017-01-01
Summary We identified a choline, betaine and carnitine transporter, designated Cbc, from Pseudomonas syringae and Pseudomonas aeruginosa that is unusual among members of the ATP-binding cassette (ABC) transporter family in its use of multiple periplasmic substrate-binding proteins (SBPs) that are highly specific for their substrates. The SBP encoded by the cbcXWV operon, CbcX, binds choline with a high affinity (Km, 2.6 μM) and, although it also binds betaine (Km, 24.2 μM), CbcXWV-mediated betaine uptake did not occur in the presence of choline. The CbcX orthologue ChoX from Sinorhizobium meliloti was similar to CbcX in these binding properties. The core transporter CbcWV also interacts with the carnitine-specific SBP CaiX (Km, 24 μM) and the betaine-specific SBP BetX (Km, 0.6 μM). Unlike most ABC transporter loci, caiX, betX and cbcXWV are separated in the genome. CaiX-mediated carnitine uptake was reduced by CbcX and BetX only when they were bound by their individual ligands, providing the first in vivo evidence for a higher affinity for ligand-bound than ligand-free SBPs by an ABC transporter. These studies demonstrate not only that the Cbc transporter serves as a useful model for exploring ABC transporter component interactions, but also that the orphan SBP genes common to bacterial genomes can encode functional SBPs. PMID:19919675
Chen, Chiliang; Malek, Adel A; Wargo, Matthew J; Hogan, Deborah A; Beattie, Gwyn A
2010-01-01
We identified a choline, betaine and carnitine transporter, designated Cbc, from Pseudomonas syringae and Pseudomonas aeruginosa that is unusual among members of the ATP-binding cassette (ABC) transporter family in its use of multiple periplasmic substrate-binding proteins (SBPs) that are highly specific for their substrates. The SBP encoded by the cbcXWV operon, CbcX, binds choline with a high affinity (K(m), 2.6 microM) and, although it also binds betaine (K(m), 24.2 microM), CbcXWV-mediated betaine uptake did not occur in the presence of choline. The CbcX orthologue ChoX from Sinorhizobium meliloti was similar to CbcX in these binding properties. The core transporter CbcWV also interacts with the carnitine-specific SBP CaiX (K(m), 24 microM) and the betaine-specific SBP BetX (K(m), 0.6 microM). Unlike most ABC transporter loci, caiX, betX and cbcXWV are separated in the genome. CaiX-mediated carnitine uptake was reduced by CbcX and BetX only when they were bound by their individual ligands, providing the first in vivo evidence for a higher affinity for ligand-bound than ligand-free SBPs by an ABC transporter. These studies demonstrate not only that the Cbc transporter serves as a useful model for exploring ABC transporter component interactions, but also that the orphan SBP genes common to bacterial genomes can encode functional SBPs.
Passive transport and binding of lead by human red blood cells.
Simons, T J
1986-01-01
The uptake of Pb into human red blood cells has been studied using Pb buffers. Passive Pb movements can be studied conveniently when the cells are depleted of adenosine 5'-triphosphate (ATP), to eliminate active transport, and of inorganic phosphate, to prevent precipitation of lead phosphate. Pb can cross the membrane passively in either direction. Influx and efflux show similar properties. Passive Pb transport is strongly stimulated by HCO3-, and is reduced by replacing Cl- with ClO4-. It is inhibited by low concentrations of 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonic acid (SITS) and 4,4'-diisothiocyanostilbene-2.2'-disulphonic acid (DIDS), characteristic inhibitors of anion transport. Pb uptake is unaffected by varying the external concentrations of Na+, K+ and Ca2+. When Pb enters the cell, it binds mainly to haemoglobin. The ratio of bound Pb:free Pb2+ in the cytosol is estimated to be 6000:1. Pb binding to haemoglobin is unaffected by oxygenation. Binding to albumin is quantitatively similar to binding to haemoglobin. The implications of these results for the transport and binding of Pb in the blood are discussed. PMID:3795106
Ion Binding Energies Determining Functional Transport of ClC Proteins
NASA Astrophysics Data System (ADS)
Yu, Tao; Guo, Xu; Zou, Xian-Wu; Sang, Jian-Ping
2014-06-01
The ClC-type proteins, a large family of chloride transport proteins ubiquitously expressed in biological organisms, have been extensively studied for decades. Biological function of ClC proteins can be reflected by analyzing the binding situation of Cl- ions. We investigate ion binding properties of ClC-ec1 protein with the atomic molecular dynamics simulation approach. The calculated electrostatic binding energy results indicate that Cl- at the central binding site Scen has more binding stability than the internal binding site Sint. Quantitative comparison between the latest experimental heat release data isothermal titration calorimetry (ITC) and our calculated results demonstrates that chloride ions prefer to bind at Scen than Sint in the wild-type ClC-ec1 structure and prefer to bind at Sext and Scen than Sint in mutant E148A/E148Q structures. Even though the chloride ions make less contribution to heat release when binding to Sint and are relatively unstable in the Cl- pathway, they are still part contributors for the Cl- functional transport. This work provides a guide rule to estimate the importance of Cl- at the binding sites and how chloride ions have influences on the function of ClC proteins.
Chu, Byron C. H.; Otten, Renee; Krewulak, Karla D.; Mulder, Frans A. A.; Vogel, Hans J.
2014-01-01
The periplasmic binding protein (PBP) FepB plays a key role in transporting the catecholate siderophore ferric enterobactin from the outer to the inner membrane in Gram-negative bacteria. The solution structures of the 34-kDa apo- and holo-FepB from Escherichia coli, solved by NMR, represent the first solution structures determined for the type III class of PBPs. Unlike type I and II PBPs, which undergo large “Venus flytrap” conformational changes upon ligand binding, both forms of FepB maintain similar overall folds; however, binding of the ligand is accompanied by significant loop movements. Reverse methyl cross-saturation experiments corroborated chemical shift perturbation results and uniquely defined the binding pocket for gallium enterobactin (GaEnt). NMR relaxation experiments indicated that a flexible loop (residues 225–250) adopted a more rigid and extended conformation upon ligand binding, which positioned residues for optimal interactions with the ligand and the cytoplasmic membrane ABC transporter (FepCD), respectively. In conclusion, this work highlights the pivotal role that structural dynamics plays in ligand binding and transporter interactions in type III PBPs. PMID:25173704
Alteration of human serum albumin binding properties induced by modifications: A review
NASA Astrophysics Data System (ADS)
Maciążek-Jurczyk, Małgorzata; Szkudlarek, Agnieszka; Chudzik, Mariola; Pożycka, Jadwiga; Sułkowska, Anna
2018-01-01
Albumin, a major transporting protein in the blood, is the main target of modification that affects the binding of drugs to Sudlow's site I and II. These modification of serum protein moderates its physiological function, and works as a biomarker of some diseases. The main goal of the paper was to explain the possible alteration of human serum albumin binding properties induced by modifications such as glycation, oxidation and ageing, their origin, methods of evaluation and positive and negative meaning described by significant researchers.
Jacobs, Miriam T; Zhang, Yuan-Wei; Campbell, Scott D; Rudnick, Gary
2007-10-05
Ibogaine, a hallucinogenic alkaloid with purported anti-addiction properties, inhibited serotonin transporter (SERT) noncompetitively by decreasing V(max) with little change in the K(m) for serotonin (5-HT). Ibogaine also inhibited binding to SERT of the cocaine analog 2beta-2-carbomethoxy-3-(4-[(125)I]iodophenyl)tropane. However, inhibition of binding was competitive, increasing the apparent K(D) without much change in B(max). Ibogaine increased the reactivity of cysteine residues positioned in the proposed cytoplasmic permeation pathway of SERT but not at nearby positions out of that pathway. In contrast, cysteines placed at positions in the extracellular permeation pathway reacted at slower rates in the presence of ibogaine. These results are consistent with the proposal that ibogaine binds to and stabilizes the state of SERT from which 5-HT dissociates to the cytoplasm, in contrast with cocaine, which stabilizes the state that binds extracellular 5-HT.
Effects of pH on transport properties of articular cartilages.
Loret, Benjamin; Simões, Fernando M F
2010-02-01
Articular cartilages swell and shrink depending on the ionic strength of the electrolyte they are in contact with. This electro-chemo-mechanical coupling is due to the presence of fixed electrical charges on proteoglycans (PGs). In addition, at nonphysiological pH, collagen fibers become charged. Therefore, variation of the pH of the electrolyte has strong implications on the electrical charge of cartilages and, by the same token, on their transport and mechanical properties. Articular cartilages are viewed as three-phase multi-species porous media. The constitutive framework is phrased in the theory of thermodynamics of porous media. Acid-base reactions, as well as calcium binding, are embedded in this framework. Although macroscopic in nature, the model accounts for a number of biochemical details defining collagen and PGs. The change of the electrical charge is due to the binding of hydrogen ions on specific sites of PGs and collagen. Simulations are performed mimicking laboratory experiments where either the ionic strength or the pH of the bath, the cartilage piece is in contact with, is varied. They provide the evolutions of the chemical compositions of mobile ions, of the sites of acid-base reactions and calcium binding, and of the charges of collagen and glycosaminoglycans, at constant volume fraction of water. Emphasis is laid on the effects of pH, ionic strength and calcium binding on the transport properties of cartilages, and, in particular, on the electrical conductivity and electro-osmotic coefficient.
Handali, Melody; Neupane, Durga P.; Roychowdhury, Hridindu; Yukl, Erik T.
2015-01-01
ATP-binding cassette (ABC) transporters of the cluster 9 family are ubiquitous among bacteria and essential for acquiring Zn2+ and Mn2+ from the environment or, in the case of pathogens, from the host. These rely on a substrate-binding protein (SBP) to coordinate the relevant metal with high affinity and specificity and subsequently release it to a membrane permease for translocation into the cytoplasm. Although a number of cluster 9 SBP structures have been determined, the structural attributes conferring Zn2+ or Mn2+ specificity remain ambiguous. Here we describe the gene expression profile, in vitro metal binding properties, and crystal structure of a new cluster 9 SBP from Paracoccus denitrificans we have called AztC. Although all of our results strongly indicate Zn2+ over Mn2+ specificity, the Zn2+ ion is coordinated by a conserved Asp residue only observed to date as a metal ligand in Mn2+-specific SBPs. The unusual sequence properties of this protein are shared among close homologues, including members from the human pathogens Klebsiella pneumonia and Enterobacter aerogenes, and would seem to suggest a subclass of Zn2+-specific transporters among the cluster 9 family. In any case, the unusual coordination environment of AztC expands the already considerable range of those available to Zn2+-specific SBPs and highlights the presence of a His-rich loop as the most reliable indicator of Zn2+ specificity. PMID:25787075
Handali, Melody; Neupane, Durga P.; Roychowdhury, Hridindu; ...
2015-03-18
Here, ATP-binding cassette (ABC) transporters of the cluster 9 family are ubiquitous among bacteria and essential for acquiring Zn 2+ and Mn 2+ from the environment or, in the case of pathogens, from the host. These rely on a substrate-binding protein (SBP) to coordinate the relevant metal with high affinity and specificity and subsequently release it to a membrane permease for translocation into the cytoplasm. Although a number of cluster 9 SBP structures have been determined, the structural attributes conferring Zn 2+ or Mn 2+ specificity remain ambiguous. Here we describe the gene expression profile, in vitro metal binding properties,more » and crystal structure of a new cluster 9 SBP from Paracoccus denitrificans we have called AztC. Although all of our results strongly indicate Zn 2+ over Mn 2+ specificity, the Zn 2+ ion is coordinated by a conserved Asp residue only observed to date as a metal ligand in Mn 2+-specific SBPs. The unusual sequence properties of this protein are shared among close homologues, including members from the human pathogens Klebsiella pneumonia and Enterobacter aerogenes, and would seem to suggest a subclass of Zn 2+-specific transporters among the cluster 9 family. In any case, the unusual coordination environment of AztC expands the already considerable range of those available to Zn 2+-specific SBPs and highlights the presence of a His-rich loop as the most reliable indicator of Zn 2+ specificity.« less
Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3
Turrini, Francesco M.; Li, Yen-Hsing; Low, Philip S.
2016-01-01
Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein–protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO4) with Kd = 14 nM; (iii) binding of cdb3-PO4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO4; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3–ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties. PMID:27856737
Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.
Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S
2016-11-29
Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.
Mager, Thomas; Braner, Markus; Kubsch, Bastian; Hatahet, Lina; Alkoby, Dudu; Rimon, Abraham; Padan, Etana; Fendler, Klaus
2013-01-01
Na+/H+ antiporters show a marked pH dependence, which is important for their physiological function in eukaryotic and prokaryotic cells. In NhaA, the Escherichia coli Na+/H+ antiporter, specific single site mutations modulating the pH profile of the transporter have been described in the past. To clarify the mechanism by which these mutations influence the pH dependence of NhaA, the substrate dependence of the kinetics of selected NhaA variants was electrophysiologically investigated and analyzed with a kinetic model. It is shown that the mutations affect NhaA activity in quite different ways by changing the properties of the binding site or the dynamics of the transporter. In the first case, pK and/or KDNa are altered, and in the second case, the rate constants of the conformational transition between the inside and the outside open conformation are modified. It is shown that residues as far apart as 15–20 Å from the binding site can have a significant impact on the dynamics of the conformational transitions or on the binding properties of NhaA. The implications of these results for the pH regulation mechanism of NhaA are discussed. PMID:23836890
Transport capabilities of environmental Pseudomonads for sulfur compounds
Zerbs, Sarah; Korajczyk, Peter J.; Noirot, Philippe H.; ...
2017-01-27
Sulfur is an essential element in plant rhizospheres and microbial activity plays a key role in increasing the biological availability of sulfur in soil environments. To better understand the mechanisms facilitating the exchange of sulfur-containing molecules in soil, we profiled the binding specificities of eight previously uncharacterized ABC transporter solute-binding proteins from plant-associated Pseudomonads. A high-throughput screening procedure indicated eighteen significant organosulfur binding ligands, with at least one high-quality screening hit for each protein target. Calorimetric and spectroscopic methods were used to validate the best ligand assignments and catalog the thermodynamic properties of the protein-ligand interactions. Two novel high-affinity ligandmore » binding activities were identified and quantified in this set of solute binding proteins. Bacteria were cultured in minimal media with screening library components supplied as the sole sulfur sources, demonstrating that these organosulfur compounds can be metabolized and confirming the relevance of ligand assignments. These results expand the set of experimentally validated ligands amenable to transport by this ABC transporter family and demonstrate the complex range of protein-ligand interactions that can be accomplished by solute-binding proteins. As a result, characterizing new nutrient import pathways provides insight into Pseudomonad metabolic capabilities which can be used to further interrogate bacterial survival and participation in soil and rhizosphere communities.« less
Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.
Subramanian, Nandhitha; Scopelitti, Amanda J; Carland, Jane E; Ryan, Renae M; O'Mara, Megan L; Vandenberg, Robert J
2016-01-01
The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.
Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2
Subramanian, Nandhitha; Scopelitti, Amanda J.; Carland, Jane E.; Ryan, Renae M.; O’Mara, Megan L.; Vandenberg, Robert J.
2016-01-01
The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10. PMID:27337045
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woo, Sung Oh; Teizer, Winfried; WPI-Advanced Institute for Materials Research, Tohoku University, Sendai
We report a deterioration of the electrical transport properties of a graphene field effect transistor due to energetic electron irradiation on a stack of Poly Methyl Methacrylate (PMMA) on graphene (PMMA/graphene bilayer). Prior to electron irradiation, we observed that the PMMA layer on graphene does not deteriorate the carrier transport of graphene but improves its electrical properties instead. As a result of the electron irradiation on the PMMA/graphene bilayer, the Raman “D” band appears after removal of PMMA. We argue that the degradation of the transport behavior originates from the binding of hydrogen generated during the PMMA backbone secession process.
Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.
Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto
2018-04-11
We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.
Arimany-Nardi, C; Claudio-Montero, A; Viel-Oliva, A; Schmidtke, P; Estarellas, C; Barril, X; Bidon-Chanal, A; Pastor-Anglada, M
2017-06-05
The family of concentrative Na + /nucleoside cotransporters in humans is constituted by three subtypes, namely, hCNT1, hCNT2, and hCNT3. Besides their different nucleoside selectivity, hCNT1 and hCNT2 have a Na + /nucleoside stoichiometry of 1:1, while for hCNT3 it is 2:1. This distinct stoichiometry of subtype 3 might hint the existence of a secondary sodium-binding site that is not present in the other two subtypes, but to date their three-dimensional structures remain unknown and the residues implicated in Na + binding are unclear. In this work, we have identified and characterized the Na + binding sites of hCNT3 by combining molecular modeling and mutagenesis studies. A model of the transporter was obtained by homology modeling, and key residues of two sodium-binding sites were identified and verified with a mutagenesis strategy. The structural model explains the altered sodium-binding properties of the hCNT3C602R polymorphic variant and supports previously generated data identifying the determinant residues of nucleoside selectivity, paving the way to understand how drugs can target this plasma membrane transporter.
Herranz, M Carmen; Pallás, Vicente
2004-03-01
The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is involved in intercellular virus transport. In this study, putative RNA-binding properties of the PNRSV MP were studied. The PNRSV MP was produced in Escherichia coli using an expression vector. Electrophoretic mobility shift assays (EMSAs) using DIG-labelled riboprobes demonstrated that PNRSV MP bound ssRNA cooperatively without sequence specificity. Two different ribonucleoprotein complexes were found to be formed depending on the molar MP : PNRSV RNA ratio. The different responses of the complexes to urea treatment strongly suggested that they have different structural properties. Deletion mutagenesis followed by Northwestern analysis allowed location of a nucleic acid binding domain to aa 56-88. This 33 aa RNA-binding motif is the smallest region delineated among members of the family Bromoviridae for which RNA-binding properties have been demonstrated. This domain is highly conserved within all phylogenetic subgroups previously described for PNRSV isolates. Interestingly, the RNA-binding domain described here and the one described for Alfamovirus are located at the N terminus of their corresponding MPs, whereas similar domains previously characterized in members of the genera Bromovirus and Cucumovirus are present at the C terminus, strongly reflecting their corresponding phylogenetic relationships. The evolutionary implications of this observation are discussed.
Review: Milk Proteins as Nanocarrier Systems for Hydrophobic Nutraceuticals.
Kimpel, Florian; Schmitt, Joachim J
2015-11-01
Milk proteins and milk protein aggregates are among the most important nanovehicles in food technology. Milk proteins have various functional properties that facilitate their ability to carry hydrophobic nutraceutical substances. The main functional transport properties that were examined in the reviewed studies are binding of molecules or ions, surface activity, aggregation, gelation, and interaction with other polymers. Hydrophobic binding has been investigated using caseins and isolated β-casein as well as whey proteins. Surface activity of caseins has been used to create emulsion-based carrier systems. Furthermore, caseins are able to self-assemble into micelles, which can incorporate molecules. Gelation and interaction with other polymers can be used to encapsulate molecules into protein networks. The release of transported substances mainly depends on pH and swelling behavior of the proteins. The targeted use of nanocarrier systems requires specific knowledge about the binding mechanisms between the proteins and the carried substances in a certain food matrix. © 2015 Institute of Food Technologists®
NASA Astrophysics Data System (ADS)
Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard
2014-03-01
The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.
Free Energy Wells and Barriers to Ion Transport Across Membranes
NASA Astrophysics Data System (ADS)
Rempe, Susan
2014-03-01
The flow of ions across cellular membranes is essential to many biological processes. Ion transport is also important in synthetic materials used as battery electrolytes. Transport often involves specific ions and fast conduction. To achieve those properties, ion conduction pathways must solvate specific ions by just the ``right amount.'' The right amount of solvation avoids ion traps due to deep free energy wells, and avoids ion block due to high free energy barriers. Ion channel proteins in cellular membranes demonstrate this subtle balance in solvation of specific ions. Using ab initio molecular simulations, we have interrogated the link between binding site structure and ion solvation free energies in biological ion binding sites. Our results emphasize the surprisingly important role of the environment that surrounds ion-binding sites for fast transport of specific ions. We acknowledge support from Sandia's LDRD program. Sandia National Labs is a multi-program laboratory operated by Sandia Corp., a wholly owned subsidiary of Lockheed Martin Corp., for the US DOE's NNSA under contract DE-AC04-94AL85000.
The structural basis of secondary active transport mechanisms.
Forrest, Lucy R; Krämer, Reinhard; Ziegler, Christine
2011-02-01
Secondary active transporters couple the free energy of the electrochemical potential of one solute to the transmembrane movement of another. As a basic mechanistic explanation for their transport function the model of alternating access was put forward more than 40 years ago, and has been supported by numerous kinetic, biochemical and biophysical studies. According to this model, the transporter exposes its substrate binding site(s) to one side of the membrane or the other during transport catalysis, requiring a substantial conformational change of the carrier protein. In the light of recent structural data for a number of secondary transport proteins, we analyze the model of alternating access in more detail, and correlate it with specific structural and chemical properties of the transporters, such as their assignment to different functional states in the catalytic cycle of the respective transporter, the definition of substrate binding sites, the type of movement of the central part of the carrier harboring the substrate binding site, as well as the impact of symmetry on fold-specific conformational changes. Besides mediating the transmembrane movement of solutes, the mechanism of secondary carriers inherently involves a mechanistic coupling of substrate flux to the electrochemical potential of co-substrate ions or solutes. Mainly because of limitations in resolution of available transporter structures, this important aspect of secondary transport cannot yet be substantiated by structural data to the same extent as the conformational change aspect. We summarize the concepts of coupling in secondary transport and discuss them in the context of the available evidence for ion binding to specific sites and the impact of the ions on the conformational state of the carrier protein, which together lead to mechanistic models for coupling. Copyright © 2010 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zerbs, Sarah; Korajczyk, Peter J.; Noirot, Philippe H.
Sulfur is an essential element in plant rhizospheres and microbial activity plays a key role in increasing the biological availability of sulfur in soil environments. To better understand the mechanisms facilitating the exchange of sulfur-containing molecules in soil, we profiled the binding specificities of eight previously uncharacterized ABC transporter solute-binding proteins from plant-associated Pseudomonads. A high-throughput screening procedure indicated eighteen significant organosulfur binding ligands, with at least one high-quality screening hit for each protein target. Calorimetric and spectroscopic methods were used to validate the best ligand assignments and catalog the thermodynamic properties of the protein-ligand interactions. Two novel high-affinity ligandmore » binding activities were identified and quantified in this set of solute binding proteins. Bacteria were cultured in minimal media with screening library components supplied as the sole sulfur sources, demonstrating that these organosulfur compounds can be metabolized and confirming the relevance of ligand assignments. These results expand the set of experimentally validated ligands amenable to transport by this ABC transporter family and demonstrate the complex range of protein-ligand interactions that can be accomplished by solute-binding proteins. As a result, characterizing new nutrient import pathways provides insight into Pseudomonad metabolic capabilities which can be used to further interrogate bacterial survival and participation in soil and rhizosphere communities.« less
Mechanisms of Membrane Transport of Folates into Cells and Across Epithelia
Zhao, Rongbao; Diop-Bove, Ndeye; Visentin, Michele; Goldman, I. David
2013-01-01
Until recently, the transport of folates into cells and across epithelia has been interpreted primarily within the context of two transporters with high affinity and specificity for folates, the reduced folate carrier and the folate receptors. However, there were discrepancies between the properties of these transporters and characteristics of folate transport in many tissues, most notably the intestinal absorption of folates, in terms of pH dependency and substrate specificity. With the recent cloning of the proton-coupled folate transporter (PCFT) and the demonstration that this transporter is mutated in hereditary folate malabsorption, an autosomal recessive disorder, the molecular basis for this low-pH transport activity is now understood. This review focuses on the properties of PCFT and briefly addresses the two other folate-specific transporters along with other facilitative and ATP-binding cassette (ABC) transporters with folate transport activities. The role of these transporters in the vectorial transport of folates across epithelia is considered. PMID:21568705
Harrell, Andrew W; Sychterz, Caroline; Ho, May Y; Weber, Andrew; Valko, Klara; Negash, Kitaw
2015-01-01
The ability to explain distribution patterns from drug physicochemical properties and binding characteristics has been explored for more than 200 compounds by interrogating data from quantitative whole body autoradiography studies (QWBA). These in vivo outcomes have been compared to in silico and in vitro drug property data to determine the most influential properties governing drug distribution. Consistent with current knowledge, in vivo distribution was most influenced by ionization state and lipophilicity which in turn affected phospholipid and plasma protein binding. Basic and neutral molecules were generally better distributed than acidic counterparts demonstrating weaker plasma protein and stronger phospholipid binding. The influence of phospholipid binding was particularly evident in tissues with high phospholipid content like spleen and lung. Conversely, poorer distribution of acidic drugs was associated with stronger plasma protein and weaker phospholipid binding. The distribution of a proportion of acidic drugs was enhanced, however, in tissues known to express anionic uptake transporters such as the liver and kidney. Greatest distribution was observed into melanin containing tissues of the eye, most likely due to melanin binding. Basic molecules were consistently better distributed into parts of the eye and skin containing melanin than those without. The data, therefore, suggest that drug binding to macromolecules strongly influences the distribution of total drug for a large proportion of molecules in most tissues. Reducing lipophilicity, a strategy often used in discovery to optimize pharmacokinetic properties such as absorption and clearance, also decreased the influence of nonspecific binding on drug distribution. PMID:26516585
Harmane: an atypical neurotransmitter?
Abu Ghazaleh, Haya; Lalies, Maggie D; Nutt, David J; Hudson, Alan L
2015-03-17
Harmane is an active component of clonidine displacing substance and a candidate endogenous ligand for imidazoline binding sites. The neurochemistry of tritiated harmane was investigated in the present study examining its uptake and release properties in the rat brain central nervous system (CNS) in vitro. At physiological temperature, [(3)H]harmane was shown to be taken up in rat brain cortex. Further investigations demonstrated that treatment with monoamine uptake blockers (citalopram, nomifensine and nisoxetine) did not alter [(3)H]harmane uptake implicating that the route of [(3)H]harmane transport was distinct from the monoamine uptake systems. Furthermore, imidazoline ligands (rilmenidine, efaroxan, 2-BFI and idazoxan) showed no prominent effect on [(3)H]harmane uptake suggesting the lack of involvement of imidazoline binding sites. Subsequent analyses showed that disruption of the Na(+) gradient using ouabain or choline chloride did not block [(3)H]harmane uptake suggesting a Na(+)-independent transport mechanism. Moreover, higher temperatures (50°C) failed to impede [(3)H]harmane uptake implying a non-physiological transporter. The failure of potassium to evoke the release of preloaded [(3)H]harmane from rat brain cortex indicates that the properties of this putative endogenous ligand for imidazoline binding sites do not resemble that of a conventional neurotransmitter. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Mahdavifar, Maryam; Khoeini, Farhad
2018-08-10
We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.
Pedò, Massimo; D'Onofrio, Mariapina; Ferranti, Pasquale; Molinari, Henriette; Assfalg, Michael
2009-11-15
Bile acid binding proteins (BABPs) are cytosolic lipid chaperones contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Liver BABPs act in parallel with ileal transporters to ensure vectorial transport of bile salts in hepatocytes and enterocytes, respectively. We describe the investigation of ligand binding to liver BABP, an essential step in the understanding of intracellular bile salt transport. Binding site occupancies were monitored in NMR titration experiments using (15)N-labelled ligand, while the relative populations of differently bound BABP forms were assessed by mass spectrometry. This site-specific information allowed the determination of intrinsic thermodynamic parameters and the identification of an extremely high cooperativity between two binding sites. Protein-observed NMR experiments revealed a global structural rearrangement which suggests an allosteric mechanism at the basis of the observed cooperativity. The view of a molecular tool capable of buffering against significant concentrations of free bile salts in a large range of solution conditions emerges from the observed pH-dependence of binding. We set to determine the molecular determinants of cooperativity by analysing the binding properties of a protein containing a mutated internal histidine. Both mass spectrometry and NMR experiments are consistent with an overall decreased binding affinity of the mutant, while the measured diffusion coefficients of ligand species reveal that the affinity loss concerns essentially one of the two binding sites. We therefore identified a mutation able to disrupt energetic communication functional to efficient binding and conclude that the buried histidine establishes contacts that stabilize the ternary complex. 2009 Wiley-Liss, Inc.
Characterization of large-pore polymeric supports for use in perfusion biochromatography.
Whitney, D; McCoy, M; Gordon, N; Afeyan, N
1998-05-22
Perfusion chromatography is uniquely characterized by the flow of a portion of the column eluent directly through the resin in the packed bed. The benefits of this phenomenon and some of the properties of perfusive resins have been described before, and can be summarized as enhanced mass transport to interior binding sites. Here we extend the understanding of this phenomenon by comparing resins with different pore size distributions. Resins are chosen to give approximately the same specific pore volumes (as shown in the characterization section) but the varying contribution of large pores is used to control the amount of liquid flowing through the beads. POROS R1 has the largest contribution of throughpores, and therefore the greatest intraparticle flow. POROS R2 has a lower contribution of throughpores, and a higher surface area coming from a greater population of diffusive pores, but still shows significant mass transport enhancements relative to a purely diffusive control. Oligo R3 is dominated by a high population of diffusive pores, and is used comparatively as a non-perfusive resin. Although the pore size distribution can be engineered to control mass transport rates, the resulting surface area is not the only means by which binding capacity can be controlled. Surface coatings are employed to increase binding capacity without fundamentally altering the mass transport properties. Models are used to describe the amount of flow transecting the beads, and comparisons of coated resins to uncoated (polystyrene) resins leads to the conclusion that these coatings do not obstruct the throughpore structures. This is an important conclusion since the binding capacity of the coated product, in some cases, is shown to be over 10-fold higher than the precursor polystyrene scaffold (i.e., POROS R1 or POROS R2).
Impact of the Topological Surface State on the Thermoelectric Transport in Sb2Te3 Thin Films.
Hinsche, Nicki F; Zastrow, Sebastian; Gooth, Johannes; Pudewill, Laurens; Zierold, Robert; Rittweger, Florian; Rauch, Tomáš; Henk, Jürgen; Nielsch, Kornelius; Mertig, Ingrid
2015-04-28
Ab initio electronic structure calculations based on density functional theory and tight-binding methods for the thermoelectric properties of p-type Sb2Te3 films are presented. The thickness-dependent electrical conductivity and the thermopower are computed in the diffusive limit of transport based on the Boltzmann equation. Contributions of the bulk and the surface to the transport coefficients are separated, which enables to identify a clear impact of the topological surface state on the thermoelectric properties. When the charge carrier concentration is tuned, a crossover between a surface-state-dominant and a Fuchs-Sondheimer transport regime is achieved. The calculations are corroborated by thermoelectric transport measurements on Sb2Te3 films grown by atomic layer deposition.
Electronic properties of a molecular system with Platinum
NASA Astrophysics Data System (ADS)
Ojeda, J. H.; Medina, F. G.; Becerra-Alonso, David
2017-10-01
The electronic properties are studied using a finite homogeneous molecule called Trans-platinum-linked oligo(tetraethenylethenes). This system is composed of individual molecules such as benzene rings, platinum, Phosphore and Sulfur. The mechanism for the study of the electron transport through this system is based on placing the molecule between metal contacts to control the current through the molecular system. We study this molecule based on the tight-binding approach for the calculation of the transport properties using the Landauer-Büttiker formalism and the Fischer-Lee relationship, based on a semi-analytic Green's function method within a real-space renormalization approach. Our results show a significant agreement with experimental measurements.
Tan, Kemin; Chang, Changsoo; Cuff, Marianne; Osipiuk, Jerzy; Landorf, Elizabeth; Mack, Jamey C; Zerbs, Sarah; Joachimiak, Andrzej; Collart, Frank R
2013-10-01
Lignin comprises 15-25% of plant biomass and represents a major environmental carbon source for utilization by soil microorganisms. Access to this energy resource requires the action of fungal and bacterial enzymes to break down the lignin polymer into a complex assortment of aromatic compounds that can be transported into the cells. To improve our understanding of the utilization of lignin by microorganisms, we characterized the molecular properties of solute binding proteins of ATP-binding cassette transporter proteins that interact with these compounds. A combination of functional screens and structural studies characterized the binding specificity of the solute binding proteins for aromatic compounds derived from lignin such as p-coumarate, 3-phenylpropionic acid and compounds with more complex ring substitutions. A ligand screen based on thermal stabilization identified several binding protein clusters that exhibit preferences based on the size or number of aromatic ring substituents. Multiple X-ray crystal structures of protein-ligand complexes for these clusters identified the molecular basis of the binding specificity for the lignin-derived aromatic compounds. The screens and structural data provide new functional assignments for these solute-binding proteins which can be used to infer their transport specificity. This knowledge of the functional roles and molecular binding specificity of these proteins will support the identification of the specific enzymes and regulatory proteins of peripheral pathways that funnel these compounds to central metabolic pathways and will improve the predictive power of sequence-based functional annotation methods for this family of proteins. Copyright © 2013 Wiley Periodicals, Inc.
Tan, Kemin; Chang, Changsoo; Cuff, Marianne; Osipiuk, Jerzy; Landorf, Elizabeth; Mack, Jamey C.; Zerbs, Sarah; Joachimiak, Andrzej; Collart, Frank R.
2013-01-01
Lignin comprises 15.25% of plant biomass and represents a major environmental carbon source for utilization by soil microorganisms. Access to this energy resource requires the action of fungal and bacterial enzymes to break down the lignin polymer into a complex assortment of aromatic compounds that can be transported into the cells. To improve our understanding of the utilization of lignin by microorganisms, we characterized the molecular properties of solute binding proteins of ATP.binding cassette transporter proteins that interact with these compounds. A combination of functional screens and structural studies characterized the binding specificity of the solute binding proteins for aromatic compounds derived from lignin such as p-coumarate, 3-phenylpropionic acid and compounds with more complex ring substitutions. A ligand screen based on thermal stabilization identified several binding protein clusters that exhibit preferences based on the size or number of aromatic ring substituents. Multiple X-ray crystal structures of protein-ligand complexes for these clusters identified the molecular basis of the binding specificity for the lignin-derived aromatic compounds. The screens and structural data provide new functional assignments for these solute.binding proteins which can be used to infer their transport specificity. This knowledge of the functional roles and molecular binding specificity of these proteins will support the identification of the specific enzymes and regulatory proteins of peripheral pathways that funnel these compounds to central metabolic pathways and will improve the predictive power of sequence-based functional annotation methods for this family of proteins. PMID:23606130
Lipids and lipid binding proteins: a perfect match.
Glatz, Jan F C
2015-02-01
Lipids serve a great variety of functions, ranging from structural components of biological membranes to signaling molecules affecting various cellular functions. Several of these functions are related to the unique physico-chemical properties shared by all lipid species, i.e., their hydrophobicity. The latter, however, is accompanied by a poor solubility in an aqueous environment and thus a severe limitation in the transport of lipids in aqueous compartments such as blood plasma and the cellular soluble cytoplasm. Specific proteins which can reversibly and non-covalently associate with lipids, designated as lipid binding proteins or lipid chaperones, greatly enhance the aqueous solubility of lipids and facilitate their transport between tissues and within tissue cells. Importantly, transport of lipids across biological membranes also is facilitated by specific (membrane-associated) lipid binding proteins. Together, these lipid binding proteins determine the bio-availability of their ligands, and thereby markedly influence the subsequent processing, utilization, or signaling effect of lipids. The bio-availability of specific lipid species thus is governed by the presence of specific lipid binding proteins, the affinity of these proteins for distinct lipid species, and the presence of competing ligands (including pharmaceutical compounds). Recent studies suggest that post-translational modifications of lipid binding proteins may have great impact on lipid-protein interactions. As a result, several levels of regulation exist that together determine the bio-availability of lipid species. This short review discusses the significance of lipid binding proteins and their potential application as targets for therapeutic intervention. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Altin, S.; Aksan, M. A.; Turkoglu, S.; Yakinci, M. E.
2011-12-01
NdCeCuO superconducting samples were fabricated using ethyl alcohol, acetone and ethylenediaminetetraacetic acid (EDTA) as binding agents. For evaporation of binding agents, the samples were heat treated at 1050 °C for 24 h and then at 950 °C for 6-48 h under argon atmosphere to obtain the superconducting phase. The best superconducting performance was found in the sample heat treated at 1050 °C for 24 h and then 950 °C for 12 h which was fabricated by using acetone as binding agent. The T c and T 0 value was found to be ∼25 K and 23.4 K, respectively. Grain size in the samples fabricated was calculated using Scherer equation and SEM data. It was found that grain size strongly depends on the binding agents and heat treatment conditions. Some cracks and voids on the surface of the samples were observed, which influences the superconducting and electrical transport properties of the samples.
Cai, Jun; Lücke, Christian; Chen, Zhongjing; Qiao, Ye; Klimtchuk, Elena; Hamilton, James A.
2012-01-01
Liver fatty acid binding protein (L-FABP), a cytosolic protein most abundant in liver, is associated with intracellular transport of fatty acids, nuclear signaling, and regulation of intracellular lipolysis. Among the members of the intracellular lipid binding protein family, L-FABP is of particular interest as it can i), bind two fatty acid molecules simultaneously and ii), accommodate a variety of bulkier physiological ligands such as bilirubin and fatty acyl CoA. To better understand the promiscuous binding and transport properties of L-FABP, we investigated structure and dynamics of human L-FABP with and without bound ligands by means of heteronuclear NMR. The overall conformation of human L-FABP shows the typical β-clam motif. Binding of two oleic acid (OA) molecules does not alter the protein conformation substantially, but perturbs the chemical shift of certain backbone and side-chain protons that are involved in OA binding according to the structure of the human L-FABP/OA complex. Comparison of the human apo and holo L-FABP structures revealed no evidence for an “open-cap” conformation or a “swivel-back” mechanism of the K90 side chain upon ligand binding, as proposed for rat L-FABP. Instead, we postulate that the lipid binding process in L-FABP is associated with backbone dynamics. PMID:22713574
Escherichia coli mutants impaired in maltodextrin transport.
Wandersman, C; Schwartz, M; Ferenci, T
1979-10-01
Wild-type Escherichia coli K-12 was found to grow equally well on maltose and on maltodextrins containing up to seven glucose residues. Three classes of mutants unable to grow on maltodextrins, but still able to grow on maltose, were investigated in detail. The first class, already known, was composed of phage lambda-resistant mutants, which lack the outer membrane protein coded by gene lamB. These mutants grow on maltose and maltotriose but not at all on maltotetraose and longer maltodextrins which cannot cross the outer membrane. A second class of mutants were affected in malE, the structural gene of the periplasmic maltose binding protein. The maltose binding proteins isolated from the new mutants were altered in their substrate binding properties, but not in a way that could account for the mutant phenotypes. Rather, the results of growth experiments and transport studies suggest that these malE mutants are impaired in their ability to transport maltodextrins across the outer membrane. This implies that the maltose binding protein (in wild-type strains) cooperates with the lambda receptor in permeation through the outer membrane. The last class of mutants described in this paper were affected in malG, or perhaps in an as yet undetected gene close to malG. They were defective in the transfer of maltodextrins from the periplasmic space to the cytoplasm but only slightly affected in the transport of maltose.
Optical microwell assay of membrane transport kinetics.
Kiskin, Nikolai I; Siebrasse, Jan P; Peters, Reiner
2003-10-01
In optical single transporter recording, membranes are firmly attached to flat solid substrates containing small wells or test compartments (TC). Transport of fluorescent molecules through TC-spanning membrane patches is induced by solution change and recorded by confocal microscopy. Previously, track-etched membrane filters were used to create solid substrates containing populations of randomly distributed TCs. In this study the possibilities offered by orderly TC arrays as created by laser microdrilling were explored. A theoretical framework was developed taking the convolution of membrane transport, solution change, and diffusion into account. The optical properties of orderly TC arrays were studied and the kinetics of solution change measured. Export and import through the nuclear pore complex (NPC) was analyzed in isolated envelopes of Xenopus oocyte nuclei. In accordance with previous reports nuclear transport receptor NTF2, which binds directly to NPC proteins, was found to be translocated much faster than "inert" molecules of similar size. Unexpectedly, NXT1, a homolog of NTF2 reportedly unable to bind to NPC proteins directly, was translocated as fast as NTF2. Thus, microstructured TC arrays were shown to provide optical single transporter recording with a new basis.
Selli, Daniele; Baburin, Igor; Leoni, Stefano; Zhu, Zhen; Tománek, David; Seifert, Gotthard
2013-10-30
We investigate the interaction of a graphene monolayer with the C(111) diamond surface using ab initio density functional theory. To accommodate the lattice mismatch between graphene and diamond, the overlayer deforms into a wavy structure that binds strongly to the diamond substrate. The detached ridges of the wavy graphene overlayer behave electronically as free-standing polyacetylene chains with delocalized π electrons, separated by regions containing only sp(3) carbon atoms covalently bonded to the (111) diamond surface. We performed quantum transport calculations for different geometries of the system to study how the buckling of the graphene layer and the associated bonding to the diamond substrate affect the transport properties. The system displays high carrier mobility along the ridges and a wide transport gap in the direction normal to the ridges. These intriguing, strongly anisotropic transport properties qualify the hybrid graphene-diamond system as a viable candidate for electronic nanodevices.
Tuning transport properties of graphene three-terminal structures by mechanical deformation
NASA Astrophysics Data System (ADS)
Torres, V.; Faria, D.; Latgé, A.
2018-04-01
Straintronic devices made of carbon-based materials have been pushed up due to the graphene high mechanical flexibility and the possibility of interesting changes in transport properties. Properly designed strained systems have been proposed to allow optimized transport responses that can be explored in experimental realizations. In multiterminal systems, comparisons between schemes with different geometries are important to characterize the modifications introduced by mechanical deformations, especially if the deformations are localized at a central part of the system or extended in a large region. Then, in the present analysis, we study the strain effects on the transport properties of triangular and hexagonal graphene flakes, with zigzag and armchair edges, connected to three electronic terminals, formed by semi-infinite graphene nanoribbons. Using the Green's function formalism with circular renormalization schemes, and a single band tight-binding approximation, we find that resonant tunneling transport becomes relevant and is more affected by localized deformations in the hexagonal graphene flakes. Moreover, triangular systems with deformation extended to the leads, like longitudinal three-folded type, are shown as an interesting scenario for building nanoscale waveguides for electronic current.
NASA Astrophysics Data System (ADS)
Ishii, Hiroyuki; Kobayashi, Nobuhiko; Hirose, Kenji
2007-11-01
We investigated the electron-phonon coupling effects on the electronic transport properties of metallic (5,5)- and semiconducting (10,0)-carbon nanotube devices. We calculated the conductance and mobility of the carbon nanotubes with micron-order lengths at room temperature, using the time-dependent wave-packet approach based on the Kubo-Greenwood formula within a tight-binding approximation. We investigated the scattering effects of both longitudinal acoustic and optical phonon modes on the transport properties. The electron-optical phonon coupling decreases the conductance around the Fermi energy for the metallic carbon nanotubes, while the conductance of semiconductor nanotubes is decreased around the band edges by the acoustic phonons. Furthermore, we studied the Schottky-barrier effects on the mobility of the semiconducting carbon nanotube field-effect transistors for various gate voltages. We clarified how the electron mobilities of the devices are changed by the acoustic phonon.
Side population in human glioblastoma is non-tumorigenic and characterizes brain endothelial cells
Golebiewska, Anna; Bougnaud, Sébastien; Stieber, Daniel; Brons, Nicolaas H. C.; Vallar, Laurent; Hertel, Frank; Klink, Barbara; Schröck, Evelin; Bjerkvig, Rolf
2013-01-01
The identification and significance of cancer stem-like cells in malignant gliomas remains controversial. It has been proposed that cancer stem-like cells display increased drug resistance, through the expression of ATP-binding cassette transporters that detoxify cells by effluxing exogenous compounds. Here, we investigated the ‘side population’ phenotype based on efflux properties of ATP-binding cassette transporters in freshly isolated human glioblastoma samples and intracranial xenografts derived thereof. Using fluorescence in situ hybridization analysis on sorted cells obtained from glioblastoma biopsies, as well as human tumour xenografts developed in immunodeficient enhanced green fluorescence protein-expressing mice that allow an unequivocal tumour-stroma discrimination, we show that side population cells in human glioblastoma are non-neoplastic and exclusively stroma-derived. Tumour cells were consistently devoid of efflux properties regardless of their genetic background, tumour ploidy or stem cell associated marker expression. Using multi-parameter flow cytometry we identified the stromal side population in human glioblastoma to be brain-derived endothelial cells with a minor contribution of astrocytes. In contrast with their foetal counterpart, neural stem/progenitor cells in the adult brain did not display the side population phenotype. Of note, we show that CD133-positive cells often associated with cancer stem-like cells in glioblastoma biopsies, do not represent a homogenous cell population and include CD31-positive endothelial cells. Interestingly, treatment of brain tumours with the anti-angiogenic agent bevacizumab reduced total vessel density, but did not affect the efflux properties of endothelial cells. In conclusion our findings contribute to an unbiased identification of cancer stem-like cells and stromal cells in brain neoplasms, and provide novel insight into the complex issue of drug delivery to the brain. Since efflux properties of endothelial cells are likely to compromise drug availability, transiently targeting ATP-binding cassette transporters may be a valuable therapeutic strategy to improve treatment effects in brain tumours. PMID:23460667
Ovens, Matthew J; Davies, Andrew J; Wilson, Marieangela C; Murray, Clare M; Halestrap, Andrew P
2010-01-15
In the present study we characterize the properties of the potent MCT1 (monocarboxylate transporter 1) inhibitor AR-C155858. Inhibitor titrations of L-lactate transport by MCT1 in rat erythrocytes were used to determine the Ki value and number of AR-C155858-binding sites (Et) on MCT1 and the turnover number of the transporter (kcat). Derived values were 2.3+/-1.4 nM, 1.29+/-0.09 nmol per ml of packed cells and 12.2+/-1.1 s-1 respectively. When expressed in Xenopus laevis oocytes, MCT1 and MCT2 were potently inhibited by AR-C155858, whereas MCT4 was not. Inhibition of MCT1 was shown to be time-dependent, and the compound was also active when microinjected, suggesting that AR-C155858 probably enters the cell before binding to an intracellular site on MCT1. Measurement of the inhibitor sensitivity of several chimaeric transporters combining different domains of MCT1 and MCT4 revealed that the binding site for AR-C155858 is contained within the C-terminal half of MCT1, and involves TM (transmembrane) domains 7-10. This is consistent with previous data identifying Phe360 (in TM10) and Asp302 plus Arg306 (TM8) as key residues in substrate binding and translocation by MCT1. Measurement of the Km values of the chimaeras for L-lactate and pyruvate demonstrate that both the C- and N-terminal halves of the molecule influence transport kinetics consistent with our proposed molecular model of MCT1 and its translocation mechanism that requires Lys38 in TM1 in addition to Asp302 and Arg306 in TM8 [Wilson, Meredith, Bunnun, Sessions and Halestrap (2009) J. Biol. Chem. 284, 20011-20021].
Pheromone discrimination by a pH-tuned polymorphism of the Bombyx mori pheromone-binding protein.
Damberger, Fred F; Michel, Erich; Ishida, Yuko; Leal, Walter S; Wüthrich, Kurt
2013-11-12
The Bombyx mori pheromone-binding protein (BmorPBP) is known to adopt two different conformations. These are BmorPBP(A), where a regular helix formed by the C-terminal dodecapeptide segment, α7, occupies the ligand-binding cavity, and BmorPBP(B), where the binding site is free to accept ligands. NMR spectra of delipidated BmorPBP solutions at the physiological pH of the bulk sensillum lymph near pH 6.5 show only BmorPBP(A), and in mixtures, the two species are in slow exchange on the chemical shift frequency scale. This equilibrium has been monitored at variable pH and ligand concentrations, demonstrating that it is an intrinsic property of BmorPBP that is strongly affected by pH variation and ligand binding. This polymorphism tunes BmorPBP for optimal selective pheromone transport: Competition between α7 and lipophilic ligands for its binding cavity enables selective uptake of bombykol at the pore endings in the sensillum wall, whereas compounds with lower binding affinity can only be bound in the bulk sensillum lymph. After transport across the bulk sensillum lymph into the lower pH area near the dendritic membrane surface, bombykol is ejected near the receptor, whereas compounds with lower binding affinity are ejected before reaching the olfactory receptor, rendering them susceptible to degradation by enzymes present in the sensillum lymph.
Structural studies of bovine, equine, and leporine serum albumin complexes with naproxen.
Bujacz, Anna; Zielinski, Kamil; Sekula, Bartosz
2014-09-01
Serum albumin, a protein naturally abundant in blood plasma, shows remarkable ligand binding properties of numerous endogenous and exogenous compounds. Most of serum albumin binding sites are able to interact with more than one class of ligands. Determining the protein-ligand interactions among mammalian serum albumins is essential for understanding the complexity of this transporter. We present three crystal structures of serum albumins in complexes with naproxen (NPS): bovine (BSA-NPS), equine (ESA-NPS), and leporine (LSA-NPS) determined to 2.58 Å (C2), 2.42 Å (P61), and 2.73 Å (P2₁2₁2₁) resolutions, respectively. A comparison of the structurally investigated complexes with the analogous complex of human serum albumin (HSA-NPS) revealed surprising differences in the number and distribution of naproxen binding sites. Bovine and leporine serum albumins possess three NPS binding sites, but ESA has only two. All three complexes of albumins studied here have two common naproxen locations, but BSA and LSA differ in the third NPS binding site. None of these binding sites coincides with the naproxen location in the HSA-NPS complex, which was obtained in the presence of other ligands besides naproxen. Even small differences in sequences of serum albumins from various species, especially in the area of the binding pockets, influence the affinity and the binding mode of naproxen to this transport protein. © 2014 Wiley Periodicals, Inc.
Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H; Henry, L Keith
2014-01-17
Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na(+), Cl(-), and K(+) gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na(+)-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca(2+) (but not other cations) to functionally replace Na(+) for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca(2+) and Na(+) illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca(2+) promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na(+)-binding sites.
Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H.; Henry, L. Keith
2014-01-01
Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na+, Cl−, and K+ gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na+-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca2+ (but not other cations) to functionally replace Na+ for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca2+ and Na+ illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca2+ promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na+-binding sites. PMID:24293367
Electronic transport in methylated fragments of DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
NASA Astrophysics Data System (ADS)
de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.
2015-11-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Vanin, A F
1998-07-01
The physicochemical properties, mechanisms of synthesis and decomposition of dinitrosyl iron complexes (DNICs) with thiol-containing ligands and of S-nitrosothiols (RS-NO), and the potential role of these compounds in storage and transport of NO in biological systems are reviewed. Special attention is given to the phenomenon of mutual transformation of DNIC and RS-NO catalyzed by Fe2+. Each Fe2+ binds two neutral NO molecules in the DNICs, catalyzes their mutual oxidation--reduction with formation of nitrous oxide and nitrosonium ions appearing in the DNICs. These ions S-nitrosate thiol-compounds with RS-NO formation. Fe2+ binds two RS-NO molecules and catalyzes their mutual oxidation--reduction followed by decomposition of the resulting molecules. Mutual conversion of DNICs and RS-NO regulated by iron, thiol, and NO levels is suggested to provide NO transport in cells and tissues.
Emerman, Amy B; Blower, Michael
2018-06-14
RNA-binding proteins (RBPs) are critical regulators of gene expression. Recent studies have uncovered hundreds of mRNA-binding proteins that do not contain annotated RNA-binding domains and have well-established roles in other cellular processes. Investigation of these nonconventional RBPs is critical for revealing novel RNA-binding domains and may disclose connections between RNA regulation and other aspects of cell biology. Endosomal sorting complex required for transport II (ESCRT-II) is a nonconventional RNA-binding complex that has a canonical role in multivesicular body formation. ESCRT-II previously has been identified as an RNA-binding complex in Drosophila oocytes, but whether its RNA-binding properties extend beyond Drosophila is unknown. In this study, we found that the RNA-binding properties of ESCRT-II are conserved in Xenopus eggs, where ESCRT-II interacted with hundreds of mRNAs. Using a UV-crosslinking approach, we demonstrated that ESCRT-II binds directly to RNA through its subunit Vps25. UV-crosslinking and immunoprecipitation (CLIP)-Seq revealed that Vps25 specifically recognizes a polypurine (i.e. GA-rich) motif in RNA. Using purified components, we could reconstitute the selective Vps25-mediated binding of the polypurine motif in vitro. Our results provide insight into the mechanism by which ESCRT-II selectively binds to mRNAs and also suggest an unexpected link between endosome biology and RNA regulation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Marine Natural Products with P-Glycoprotein Inhibitor Properties
Lopez, Dioxelis; Martinez-Luis, Sergio
2014-01-01
P-glycoprotein (P-gp) is a protein belonging to the ATP-binding cassette (ABC) transporters superfamily that has clinical relevance due to its role in drug metabolism and multi-drug resistance (MDR) in several human pathogens and diseases. P-gp is a major cause of drug resistance in cancer, parasitic diseases, epilepsy and other disorders. This review article aims to summarize the research findings on the marine natural products with P-glycoprotein inhibitor properties. Natural compounds that modulate P-gp offer great possibilities for semi-synthetic modification to create new drugs and are valuable research tools to understand the function of complex ABC transporters. PMID:24451193
Damsgaard, Christian; Storz, Jay F.; Hoffmann, Federico G.
2013-01-01
When freshwater turtles acclimatize to winter hibernation, there is a gradual transition from aerobic to anaerobic metabolism, which may require adjustments of blood O2 transport before turtles become anoxic. Here, we report the effects of protons, anionic cofactors, and temperature on the O2-binding properties of isolated hemoglobin (Hb) isoforms, HbA and HbD, in the turtle Trachemys scripta. We determined the primary structures of the constituent subunits of the two Hb isoforms, and we related the measured functional properties to differences in O2 affinity between untreated hemolysates from turtles that were acclimated to normoxia and anoxia. Our data show that HbD has a consistently higher O2 affinity compared with HbA, whereas Bohr and temperature effects, as well as thiol reactivity, are similar. Although sequence data show amino acid substitutions at two known β-chain ATP-binding site positions, we find high ATP affinities for both Hb isoforms, suggesting an alternative and stronger binding site for ATP. The high ATP affinities indicate that, although ATP levels decrease in red blood cells of turtles acclimating to anoxia, the O2 affinity would remain largely unchanged, as confirmed by O2-binding measurements of untreated hemolysates from normoxic and anoxic turtles. Thus, the increase in blood-O2 affinity that accompanies winter acclimation is mainly attributable to a decrease in temperature rather than in concentrations of organic phosphates. This is the first extensive study on freshwater turtle Hb isoforms, providing molecular evidence for adaptive changes in O2 transport associated with acclimation to severe hypoxia. PMID:23986362
A Single Rainbow Trout Cobalamin-binding Protein Stands in for Three Human Binders
Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S.; Højrup, Peter; Poulsen, Steen S.; Nexo, Ebba
2012-01-01
Cobalamin uptake and transport in mammals are mediated by three cobalamin-binding proteins: haptocorrin, intrinsic factor, and transcobalamin. The nature of cobalamin-binding proteins in lower vertebrates remains to be elucidated. The aim of this study was to characterize the cobalamin-binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases, it appeared to be the same protein based on analysis of partial sequences and immunological responses. The trout cobalamin-binding protein was purified from roe fluid, sequenced, and further characterized. Like haptocorrin, the trout cobalamin-binding protein was stable at low pH and had a high binding affinity for the cobalamin analog cobinamide. Like haptocorrin and transcobalamin, the trout cobalamin-binding protein was present in plasma and recognized ligands with altered nucleotide moiety. Like intrinsic factors, the trout cobalamin-binding protein was present in the stomach and resisted degradation by trypsin and chymotrypsin. It also resembled intrinsic factor in the composition of conserved residues in the primary cobalamin-binding site in the C terminus. The trout cobalamin-binding protein was glycosylated and displayed spectral properties comparable with those of haptocorrin and intrinsic factor. In conclusion, only one soluble cobalamin-binding protein was identified in the rainbow trout, a protein that structurally behaves like an intermediate between the three human cobalamin-binding proteins. PMID:22872637
Receptor interaction profiles of novel psychoactive tryptamines compared with classic hallucinogens.
Rickli, Anna; Moning, Olivier D; Hoener, Marius C; Liechti, Matthias E
2016-08-01
The present study investigated interactions between the novel psychoactive tryptamines DiPT, 4-OH-DiPT, 4-OH-MET, 5-MeO-AMT, and 5-MeO-MiPT at monoamine receptors and transporters compared with the classic hallucinogens lysergic acid diethylamide (LSD), psilocin, N,N-dimethyltryptamine (DMT), and mescaline. We investigated binding affinities at human monoamine receptors and determined functional serotonin (5-hydroxytryptamine [5-HT]) 5-HT2A and 5-HT2B receptor activation. Binding at and the inhibition of human monoamine uptake transporters and transporter-mediated monoamine release were also determined. All of the novel tryptamines interacted with 5-HT2A receptors and were partial or full 5-HT2A agonists. Binding affinity to the 5-HT2A receptor was lower for all of the tryptamines, including psilocin and DMT, compared with LSD and correlated with the reported psychoactive doses in humans. Several tryptamines, including psilocin, DMT, DiPT, 4-OH-DiPT, and 4-OH-MET, interacted with the serotonin transporter and partially the norepinephrine transporter, similar to 3,4-methylenedioxymethamphetamine but in contrast to LSD and mescaline. LSD but not the tryptamines interacted with adrenergic and dopaminergic receptors. In conclusion, the receptor interaction profiles of the tryptamines predict hallucinogenic effects that are similar to classic serotonergic hallucinogens but also MDMA-like psychoactive properties. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.
Effects of a detergent micelle environment on P-glycoprotein (ABCB1)-ligand interactions
Shukla, Suneet; Abel, Biebele; Chufan, Eduardo E.; Ambudkar, Suresh V.
2017-01-01
P-glycoprotein (P-gp) is a multidrug transporter that uses energy from ATP hydrolysis to export many structurally dissimilar hydrophobic and amphipathic compounds, including anticancer drugs from cells. Several structural studies on purified P-gp have been reported, but only limited and sometimes conflicting information is available on ligand interactions with the isolated transporter in a dodecyl-maltoside detergent environment. In this report we compared the biochemical properties of P-gp in native membranes, detergent micelles, and when reconstituted in artificial membranes. We found that the modulators zosuquidar, tariquidar, and elacridar stimulated the ATPase activity of purified human or mouse P-gp in a detergent micelle environment. In contrast, these drugs inhibited ATPase activity in native membranes or in proteoliposomes, with IC50 values in the 10–40 nm range. Similarly, a 30–150-fold decrease in the apparent affinity for verapamil and cyclic peptide inhibitor QZ59-SSS was observed in detergent micelles compared with native or artificial membranes. Together, these findings demonstrate that the high-affinity site is inaccessible because of either a conformational change or binding of detergent at the binding site in a detergent micelle environment. The ligands bind to a low-affinity site, resulting in altered modulation of P-gp ATPase activity. We, therefore, recommend studying structural and functional aspects of ligand interactions with purified P-gp and other ATP-binding cassette transporters that transport amphipathic or hydrophobic substrates in a detergent-free native or artificial membrane environment. PMID:28283574
Yamada, Nana; Sakakibara, Shota; Tsutsumi, Koichi; Waditee, Rungaroon; Tanaka, Yoshito; Takabe, Teruhiro
2011-09-15
Proline transporters (ProTs) originally described as highly selective transporters for proline, have been shown to also transport glycinebetaine (betaine). Here we examined and compared the transport properties of Bet/ProTs from betaine accumulating (sugar beet, Amaranthus, and Atriplex,) and non-accumulating (Arabidopsis) plants. Using a yeast mutant deficient for uptake of proline and betaine, it was shown that all these transporters exhibited higher affinity for betaine than proline. The uptake of betaine and proline was pH-dependent and inhibited by the proton uncoupler carbonylcyanide m-chlorophenylhydrazone (CCCP). We also investigated choline transport by using a choline transport-deficient yeast mutant. Results revealed that these transporters exhibited a higher affinity for choline uptake rather than betaine. Uptake of choline by sugar beet BvBet/ProT1 was independent of the proton gradient and the inhibition by CCCP was reduced compared with that for uptake of betaine, suggesting different proton binding properties between the transport of choline and betaine. Additionally, in situ hybridization experiments revealed the localization of sugar beet BvBet/ProT1 in phloem and xylem parenchyma cells. Copyright © 2011 Elsevier GmbH. All rights reserved.
Enhanced reaction kinetics in biological cells
NASA Astrophysics Data System (ADS)
Loverdo, C.; Bénichou, O.; Moreau, M.; Voituriez, R.
2008-02-01
The cell cytoskeleton is a striking example of an `active' medium driven out-of-equilibrium by ATP hydrolysis. Such activity has been shown to have a spectacular impact on the mechanical and rheological properties of the cellular medium, as well as on its transport properties: a generic tracer particle freely diffuses as in a standard equilibrium medium, but also intermittently binds with random interaction times to motor proteins, which perform active ballistic excursions along cytoskeletal filaments. Here, we propose an analytical model of transport-limited reactions in active media, and show quantitatively how active transport can enhance reactivity for large enough tracers such as vesicles. We derive analytically the average interaction time with motor proteins that optimizes the reaction rate, and reveal remarkable universal features of the optimal configuration. We discuss why active transport may be beneficial in various biological examples: cell cytoskeleton, membranes and lamellipodia, and tubular structures such as axons.
Binding properties of Clostridium botulinum type C progenitor toxin to mucins.
Nakamura, Toshio; Takada, Noriko; Tonozuka, Takashi; Sakano, Yoshiyuki; Oguma, Keiji; Nishikawa, Atsushi
2007-04-01
It has been reported that Clostridium botulinum type C 16S progenitor toxin (C16S toxin) first binds to the sialic acid on the cell surface of mucin before invading cells [A. Nishikawa, N. Uotsu, H. Arimitsu, J.C. Lee, Y. Miura, Y. Fujinaga, H. Nakada, T. Watanabe, T. Ohyama, Y. Sakano, K. Oguma, The receptor and transporter for internalization of Clostridium botulinum type C progenitor toxin into HT-29 cells, Biochem. Biophys. Res. Commun. 319 (2004) 327-333]. In this study we investigated the binding properties of the C16S toxin to glycoproteins. Although the toxin bound to membrane blotted mucin derived from the bovine submaxillary gland (BSM), which contains a lot of sialyl oligosaccharides, it did not bind to neuraminidase-treated BSM. The binding of the toxin to BSM was inhibited by N-acetylneuraminic acid, N-glycolylneuraminic acid, and sialyl oligosaccharides strongly, but was not inhibited by neutral oligosaccharides. Both sialyl alpha2-3 lactose and sialyl alpha2-6 lactose prevented binding similarly. On the other hand, the toxin also bound well to porcine gastric mucin. In this case, neutral oligosaccharides might play an important role as ligand, since galactose and lactose inhibited binding. These results suggest that the toxin is capable of recognizing a wide variety of oligosaccharide structures.
NASA Astrophysics Data System (ADS)
Borodin, Oleg
2010-03-01
Molecular dynamics simulations are well suited for exploring electrolyte structure and ion transport mechanisms on the nanometer length scale and the nanosecond time scales. In this presentation we will describe how MD simulations assist in answering fundamental questions about the lithium transport mechanisms in polymeric electrolytes and ionic liquids. In particular, in the first part of the presentation the extent of ion aggregation, the structure of ion aggregates and the lithium cation diffusion in binary polymeric electrolytes will be compared with that of single-ion conducting polymers. In the second part of the talk, the lithium transport in polymeric electrolytes will be compared with that of three ionic liquids ( [emim][FSI] doped with LiFSI , [pyr13][FSI] doped with LiFSI, [emim][BF4] doped with LiBF4). The relation between ionic liquid self-diffusion, conductivity and thermodynamic properties will be discussed in details. A number of correlations between heat of vaporization Hvap, cation-anion binding energy (E+/-), molar volume (Vm), self-diffusion coefficient (D) and ionic conductivity for 29 ionic liquids have been investigated using MD simulations. A significant correlation between D and Hvap has been found, while best correlation was found for -log((D Vm)) vs. Hvap+0.28E+/-. A combination of enthalpy of vaporization and a fraction of the cation-anion binding energy was suggested as a measure of the effective cohesive energy for ionic liquids.
Stolzenberg, Sebastian; Quick, Matthias; Zhao, Chunfeng; Gotfryd, Kamil; Khelashvili, George; Gether, Ulrik; Loland, Claus J.; Javitch, Jonathan A.; Noskov, Sergei; Weinstein, Harel; Shi, Lei
2015-01-01
Neurotransmitter:sodium symporters (NSSs) terminate neurotransmission by Na+-dependent reuptake of released neurotransmitters. Previous studies suggested that Na+-binding reconfigures dynamically coupled structural elements in an allosteric interaction network (AIN) responsible for function-related conformational changes, but the intramolecular pathway of this mechanism has remained uncharted. We describe a new approach for the modeling and analysis of intramolecular dynamics in the bacterial NSS homolog LeuT. From microsecond-scale molecular dynamics simulations and cognate experimental verifications in both LeuT and human dopamine transporter (hDAT), we apply the novel method to identify the composition and the dynamic properties of their conserved AIN. In LeuT, two different perturbations disrupting Na+ binding and transport (i.e. replacing Na+ with Li+ or the Y268A mutation at the intracellular gate) affect the AIN in strikingly similar ways. In contrast, other mutations that affect the intracellular gate (i.e. R5A and D369A) do not significantly impair Na+ cooperativity and transport. Our analysis shows these perturbations to have much lesser effects on the AIN, underscoring the sensitivity of this novel method to the mechanistic nature of the perturbation. Notably, this set of observations holds as well for hDAT, where the aligned Y335A, R60A, and D436A mutations also produce different impacts on Na+ dependence. Thus, the detailed AIN generated from our method is shown to connect Na+ binding with global conformational changes that are critical for the transport mechanism. That the AIN between the Na+ binding sites and the intracellular gate in bacterial LeuT resembles that in eukaryotic hDAT highlights the conservation of allosteric pathways underlying NSS function. PMID:25869126
Stolzenberg, Sebastian; Quick, Matthias; Zhao, Chunfeng; ...
2015-04-13
Neurotransmitter:sodium symporters (NSSs) terminate neurotransmission by Na +-dependent reuptake of released neurotransmitters. Previous studies suggested that Na +-binding reconfigures dynamically coupled structural elements in an allosteric interaction network (AIN) responsible for function-related conformational changes, but the intramolecular pathway of this mechanism has remained uncharted. Here we describe a new approach for the modeling and analysis of intramolecular dynamics in the bacterial NSS homolog LeuT. From microsecond-scale molecular dynamics simulations and cognate experimental verifications in both LeuT and human dopamine transporter (hDAT), we apply the novel method to identify the composition and the dynamic properties of their conserved AIN. In LeuT,more » two different perturbations disrupting Na+ binding and transport ( i.e. replacing Na + with Li + or the Y268A mutation at the intracellular gate) affect the AIN in strikingly similar ways. In contrast, other mutations that affect the intracellular gate (i.e. R5A and D369A) do not significantly impair Na + cooperativity and transport. Our analysis shows these perturbations to have much lesser effects on the AIN, underscoring the sensitivity of this novel method to the mechanistic nature of the perturbation. Notably, this set of observations holds as well for hDAT, where the aligned Y335A, R60A, and D436A mutations also produce different impacts on Na + dependence. Furthermore, the detailed AIN generated from our method is shown to connect Na + binding with global conformational changes that are critical for the transport mechanism. Lastly, that the AIN between the Na + binding sites and the intracellular gate in bacterial LeuT resembles that in eukaryotic hDAT highlights the conservation of allosteric pathways underlying NSS function.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Humphreys, C.J.
1989-01-01
The plasmalemmal serotonin transporter uses transmembrane gradients of Na{sup +}, Cl{sup {minus}} and K{sup +} to accumulate serotonin within blood platelets. Transport is competitively inhibited by the antidepressant imipramine. Like serotonin transport, imipramine binding requires Na{sup +}. Unlike serotonin, however, imipramine does not appear to be transported. To gain insight into the mechanism of serotonin transport the author have analyzed the influences of Na{sup +} and Cl{sup {minus}}, the two ions cotransported with serotonin, on both serotonin transport and the interaction of imipramine and other antidepressant drugs with the plasmalemmal serotonin transporter of human platelets. Additionally, the author have synthesized,more » purified and characterized the binding of 2-iodoimipramine to the serotonin transporter. Finally, the author have conducted a preliminary study of the inhibition of serotonin transport and imipramine binding produced by dicyclohexylcarbodiimide. My results reveal many instances of positive heterotropic cooperativity in ligand binding to the serotonin transporter. Na{sup +} binding enhances the transporters affinity for imipramine and several other antidepressant drugs, and also increases the affinity for Cl{sup {minus}}. Cl{sup {minus}} enhances the transporters affinity for imipramine, as well as for Na{sup +}. At concentrations in the range of its K{sub M} for transport serotonin is a competitive inhibitor of imipramine binding. At much higher concentrations, however, serotonin also inhibits imipramines dissociation rate constant. This latter effect which is Na{sup +}-independent and species specific, is apparently produced by serotonin binding at a second, low affinity site on, or near, the transporter complex. Iodoimipramine competitively inhibit both ({sup 3}H)imipramine binding and ({sup 3}H)serotonin transport.« less
NASA Astrophysics Data System (ADS)
Zhdanova, Nadezda; Shirshin, Evgeny; Fadeev, Victor; Priezzhev, Alexander
2016-04-01
Among all plasma proteins human serum albumin (HSA) is the most studied one as it is the main transport protein and can bind a wide variety of ligands especially fatty acids (FAs). The concentration of FAs bound to HSA in human blood plasma differs by three times under abnormal conditions (fasting, physical exercises or in case of social important diseases). In the present study a surfactant sodium dodecyl sulfate (SDS) was used to simulate FAs binding to HSA. It was shown that the increase of Tyr fluorescence of human blood plasma due to SDS addition can be completely explained by HSA-SDS complex formation. Binding parameters of SDS-HSA complex (average number of sites and apparent constant of complex formation) were determined from titration curves based on tyrosine (Tyr) fluorescence.
Lauquin, G J; Villiers, C; Michejda, J W; Hryniewiecka, L V; Vignais, P V
1977-05-11
1. A procedure for preparation of sonic submitochondrial particles competent for adenine nucleotide transport is described. ADP or ATP transport was assayed, in the presence of oligomycin, in a saline medium made of 0.125 M KCl, 1 mM EDTA, 10 mM 4-morpholinopropane sulfonic acid buffer, pH 6.5. 2. Sonic particles transport ADP and ATP by an exchange diffusion process. Externally added ADP (or ATP) is exchanged with internal ADP and ATP with a stoichiometry of one to one. The V value for ADP transport 5 degrees C was between 2 and 3 nmol/min per mg protein. 3. The transport system in sonic particles is specific for ADP and ATP. It is strongly dependent on temperature. The activation energy between 0 and 9 degrees C is approx. 35 kcal/mol. The optimum pH is 6.5, 4, Like in intact mitochondria, externally added ADP is transported into sonic particles faster at a given concentration than externally added ATP. The V value for ADP transport is 1.5-2 times higher than the V value for ATP transport. 5. The transition from the energized to the deenergized state in sonic particles results in a decrease of the pH gradient across the membrane (internal pH less than external pH) and in a 2-4 fold increase in the Km value for ATP. This latter effect is opposite that found for transport of added ATP in intact mitochondria (Souverijn, J.H.M., Huisman, L.A., Rosing J. and Kemp, Jr., A. (1973) Biochim. Biophys. Acta 305, 185-198). Energization has no effect on the V value of ATP transport in sonic particles. 6. In contrast to intact mitochondria, inhibition of ADP transport in sonic particles by bongkrekic acid does not have any lag-time and does not depend on pH. The inhibition caused by bongkrekic acid is a mixed type inhibition with a Ki value of 1.2 micronM. Atractyloside and carboxyatractyloside do not inhibit ADP transport in sonic particles, unless the particles have been preloaded with these inhibitors during the sonication. 7. Palmityl-CoA added to sonic particles inhibits efficiently ADP transport. The mixed type inhibition found with palmityl-CoA has a Ki value of 1.6 micronM. 8. [3H]Bongkrekic acid binds to sonic particles readily and with high affinity. Bongkrekic acic binding to sonic particles does not depend on pH and it has a saturation plateau, corresponding approximately to 1.3 mol of site per mol of cytochrome a. The number of [3H]atracytloside binding sites is much lower (one-fifth of the bongkrekic acid). External carboxyatractyloside does not compete with [3H]bongkrekic acid for binding to sonic particles. However, when carboxyatractyloside is present inside the particles, it inhibits the binding of [3H]bongkrekic acid.
Herrou, Julien; Willett, Jonathan W; Czyż, Daniel M; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean
2017-03-01
Brucella abortus σ E1 is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon, bab1_0223-bab1_0226 , is among the most highly activated gene sets in the σ E1 regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription of yehZYXW is activated by the general stress sigma factor σ S in Enterobacteriaceae , which suggests a functional role for this transport system in bacterial stress response across the classes Alphaproteobacteria and Gammaproteobacteria We present evidence that B. abortus YehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1 -null strain. The sole in vitro phenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li + ion concentrations. A crystal structure of B. abortus YehZ revealed a class II periplasmic binding protein fold with significant structural homology to Archaeoglobus fulgidus ProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCE Brucella abortus σ E1 regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1 remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1 Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure of B. abortus YehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs. Copyright © 2017 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.
ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less
Stein, Matthias; Pilli, Manohar; Bernauer, Sabine; Habermann, Bianca H.; Zerial, Marino; Wade, Rebecca C.
2012-01-01
Background Rab GTPases constitute the largest subfamily of the Ras protein superfamily. Rab proteins regulate organelle biogenesis and transport, and display distinct binding preferences for effector and activator proteins, many of which have not been elucidated yet. The underlying molecular recognition motifs, binding partner preferences and selectivities are not well understood. Methodology/Principal Findings Comparative analysis of the amino acid sequences and the three-dimensional electrostatic and hydrophobic molecular interaction fields of 62 human Rab proteins revealed a wide range of binding properties with large differences between some Rab proteins. This analysis assists the functional annotation of Rab proteins 12, 14, 26, 37 and 41 and provided an explanation for the shared function of Rab3 and 27. Rab7a and 7b have very different electrostatic potentials, indicating that they may bind to different effector proteins and thus, exert different functions. The subfamily V Rab GTPases which are associated with endosome differ subtly in the interaction properties of their switch regions, and this may explain exchange factor specificity and exchange kinetics. Conclusions/Significance We have analysed conservation of sequence and of molecular interaction fields to cluster and annotate the human Rab proteins. The analysis of three dimensional molecular interaction fields provides detailed insight that is not available from a sequence-based approach alone. Based on our results, we predict novel functions for some Rab proteins and provide insights into their divergent functions and the determinants of their binding partner selectivity. PMID:22523562
Generalized Kubo formulas for the transport properties of incommensurate 2D atomic heterostructures
NASA Astrophysics Data System (ADS)
Cancès, Eric; Cazeaux, Paul; Luskin, Mitchell
2017-06-01
We give an exact formulation for the transport coefficients of incommensurate two-dimensional atomic multilayer systems in the tight-binding approximation. This formulation is based upon the C* algebra framework introduced by Bellissard and collaborators [Coherent and Dissipative Transport in Aperiodic Solids, Lecture Notes in Physics (Springer, 2003), Vol. 597, pp. 413-486 and J. Math. Phys. 35(10), 5373-5451 (1994)] to study aperiodic solids (disordered crystals, quasicrystals, and amorphous materials), notably in the presence of magnetic fields (quantum Hall effect). We also present numerical approximations and test our methods on a one-dimensional incommensurate bilayer system.
Chu, X; Korzekwa, K; Elsby, R; Fenner, K; Galetin, A; Lai, Y; Matsson, P; Moss, A; Nagar, S; Rosania, GR; Bai, JPF; Polli, JW; Sugiyama, Y; Brouwer, KLR
2013-01-01
Intracellular concentrations of drugs and metabolites are often important determinants of efficacy, toxicity, and drug interactions. Hepatic drug distribution can be affected by many factors, including physicochemical properties, uptake/efflux transporters, protein binding, organelle sequestration, and metabolism. This white paper highlights determinants of hepatocyte drug/metabolite concentrations and provides an update on model systems, methods, and modeling/simulation approaches used to quantitatively assess hepatocellular concentrations of molecules. The critical scientific gaps and future research directions in this field are discussed. PMID:23588320
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
NASA Astrophysics Data System (ADS)
Jałochowski, M.; Kwapiński, T.; Łukasik, P.; Nita, P.; Kopciuszyński, M.
2016-07-01
Structural and electron transport properties of multiple Pb atomic chains fabricated on the Si(5 5 3)-Au surface are investigated using scanning tunneling spectroscopy, reflection high electron energy diffraction, angular resolved photoemission electron spectroscopy and in situ electrical resistance. The study shows that Pb atomic chains growth modulates the electron band structure of pristine Si(5 5 3)-Au surface and hence changes its sheet resistivity. Strong correlation between chains morphology, electron band structure and electron transport properties is found. To explain experimental findings a theoretical tight-binding model of multiple atomic chains interacting on effective substrate is proposed.
New Computational Approach to Electron Transport in Irregular Graphene Nanostructures
NASA Astrophysics Data System (ADS)
Mason, Douglas; Heller, Eric; Prendergast, David; Neaton, Jeffrey
2009-03-01
For novel graphene devices of nanoscale-to-macroscopic scale, many aspects of their transport properties are not easily understood due to difficulties in fabricating devices with regular edges. Here we develop a framework to efficiently calculate and potentially screen electronic transport properties of arbitrary nanoscale graphene device structures. A generalization of the established recursive Green's function method is presented, providing access to arbitrary device and lead geometries with substantial computer-time savings. Using single-orbital nearest-neighbor tight-binding models and the Green's function-Landauer scattering formalism, we will explore the transmission function of irregular two-dimensional graphene-based nanostructures with arbitrary lead orientation. Prepared by LBNL under contract DE-AC02-05CH11231 and supported by the U.S. Dept. of Energy Computer Science Graduate Fellowship under grant DE-FG02-97ER25308.
Abdizadeh, H; Atilgan, A R; Atilgan, C; Dedeoglu, B
2017-11-15
With the advances in three-dimensional structure determination techniques, high quality structures of the iron transport proteins transferrin and the bacterial ferric binding protein (FbpA) have been deposited in the past decade. These are proteins of relatively large size, and developments in hardware and software have only recently made it possible to study their dynamics using standard computational resources. We review computational techniques towards understanding the equilibrium and kinetic properties of iron transport proteins under different environmental conditions. At the level of detail that requires quantum chemical treatments, the octahedral geometry around iron has been scrutinized and it has been established that the iron coordinating tyrosines are in an unusual deprotonated state. At the atomistic level, both the N-lobe and the full bilobal structure of transferrin have been studied under varying conditions of pH, ionic strength and binding of other metal ions by molecular dynamics (MD) simulations. These studies have allowed questions to be answered, among others, on the function of second shell residues in iron release, the role of synergistic anions in preparing the active site for iron binding, and the differences between the kinetics of the N- and the C-lobe. MD simulations on FbpA have led to the detailed observation of the binding kinetics of phosphate to the apo form, and to the conformational preferences of the holo form under conditions mimicking the environmental niches provided by the periplasmic space. To study the dynamics of these proteins with their receptors, one must resort to coarse-grained methodologies, since these systems are prohibitively large for atomistic simulations. A study of the complex of human transferrin (hTf) with its pathogenic receptor by such methods has revealed a potential mechanistic explanation for the defense mechanism that arises in evolutionary warfare. Meanwhile, the motions in the transferrin receptor bound hTf have been shown to disfavor apo hTf dissociation, explaining why the two proteins remain in complex during the recycling process from the endosome to the cell surface. Open problems and possible technological applications related to metal ion binding-release in iron transport proteins that may be handled by hybrid use of quantum mechanical, MD and coarse-grained approaches are discussed.
Structure and electrostatic property of cytoplasmic domain of ZntB transporter
Tan, Kemin; Sather, Alicia; Robertson, Janice L; Moy, Shiu; Roux, Benoît; Joachimiak, Andrzej
2009-01-01
ZntB is the distant homolog of CorA Mg2+ transporter within the metal ion transporter superfamily. It was early reported that the ZntB from Salmonella typhimurium facilitated efflux of Zn2+ and Cd2+, but not Mg2+. Here, we report the 1.90 Å crystal structure of the intracellular domain of ZntB from Vibrio parahemolyticus. The domain forms a funnel-shaped homopentamer that is similar to the full-length CorA from Thermatoga maritima, but differs from two previously reported dimeric structures of truncated CorA intracellular domains. However, no Zn2+ or Cd2+ binding sites were identified in the high-resolution structure. Instead, 25 well-defined Cl− ions were observed and some of these binding sites are highly conserved within the ZntB family. Continuum electrostatics calculations suggest that the central pore of the funnel is highly attractive for cations, especially divalents. The presence of the bound Cl− ions increases the stability of cations along the pore suggesting they could be important in enhancing cation transport. PMID:19653298
van der Heide, T; Poolman, B
2000-06-20
An osmoregulated ABC transporter (OpuA) with novel structural features has been identified that responds to water stress. This glycine betaine transport system consists of an ATP-binding/hydrolyzing subunit (OpuAA) and a protein (OpuABC) that contains both the translocator and the substrate-binding domain. The components of OpuA have been overexpressed, purified, and functionally incorporated into liposomes with an ATP-regenerating system in the vesicle lumen. A transmembrane osmotic gradient (outside hyperosmotic relative to the inside) of both ionic and nonionic compounds was able to osmotically activate OpuA in the proteoliposomal system. Hypoosmotic medium conditions inhibited the basal activity of the system. The data show that OpuAA and OpuABC are sufficient for osmoregulated transport, indicating that OpuA can act both as osmosensor and osmoregulator. Strikingly, OpuA could also be activated by low concentrations of cationic and anionic amphipaths, which interact with the membrane. This result indicates that activation by a transmembrane osmotic gradient is mediated by changes in membrane properties/protein-lipid interactions.
van der Heide, Tiemen; Poolman, Bert
2000-01-01
An osmoregulated ABC transporter (OpuA) with novel structural features has been identified that responds to water stress. This glycine betaine transport system consists of an ATP-binding/hydrolyzing subunit (OpuAA) and a protein (OpuABC) that contains both the translocator and the substrate-binding domain. The components of OpuA have been overexpressed, purified, and functionally incorporated into liposomes with an ATP-regenerating system in the vesicle lumen. A transmembrane osmotic gradient (outside hyperosmotic relative to the inside) of both ionic and nonionic compounds was able to osmotically activate OpuA in the proteoliposomal system. Hypoosmotic medium conditions inhibited the basal activity of the system. The data show that OpuAA and OpuABC are sufficient for osmoregulated transport, indicating that OpuA can act both as osmosensor and osmoregulator. Strikingly, OpuA could also be activated by low concentrations of cationic and anionic amphipaths, which interact with the membrane. This result indicates that activation by a transmembrane osmotic gradient is mediated by changes in membrane properties/protein–lipid interactions. PMID:10860977
Electronic transport in disordered MoS2 nanoribbons
NASA Astrophysics Data System (ADS)
Ridolfi, Emilia; Lima, Leandro R. F.; Mucciolo, Eduardo R.; Lewenkopf, Caio H.
2017-01-01
We study the electronic structure and transport properties of zigzag and armchair monolayer molybdenum disulfide nanoribbons using an 11-band tight-binding model that accurately reproduces the material's bulk band structure near the band gap. We study the electronic properties of pristine zigzag and armchair nanoribbons, paying particular attention to the edges states that appear within the MoS2 bulk gap. By analyzing both their orbital composition and their local density of states, we find that in zigzag-terminated nanoribbons these states can be localized at a single edge for certain energies independent of the nanoribbon width. We also study the effects of disorder in these systems using the recursive Green's function technique. We show that for the zigzag nanoribbons, the conductance due to the edge states is strongly suppressed by short-range disorder such as vacancies. In contrast, the local density of states still shows edge localization. We also show that long-range disorder has a small effect on the transport properties of nanoribbons within the bulk gap energy window.
Multiple Drug Transport Pathways through human P-Glycoprotein(†)
McCormick, James W.; Vogel, Pia D.; Wise, John G.
2015-01-01
P-glycoprotein (P-gp) is a plasma membrane efflux pump that is commonly associated with therapy resistances in cancers and infectious diseases. P-gp can lower the intracellular concentrations of many drugs to subtherapeutic levels by translocating them out of the cell. Because of the broad range of substrates transported by P-gp, overexpression of P-gp causes multidrug resistance. We reported previously on dynamic transitions of P-gp as it moved through conformations based on crystal structures of homologous ABCB1 proteins using in silico targeted molecular dynamics techniques. We expanded these studies here by docking transport substrates to drug binding sites of P-gp in conformations open to the cytoplasm, followed by cycling the pump through conformations that opened to the extracellular space. We observed reproducible transport of two substrates, daunorubicin and verapamil, by an average of 11 to 12 Å through the plane of the membrane as P-gp progressed through a catalytic cycle. Methyl-pyrophosphate, a ligand that should not be transported by P-gp, did not show this movement through P-gp. Drug binding to either of two subsites on P-gp appeared to determine the initial pathway used for drug movement through the membrane. The specific side-chain interactions with drugs within each pathway seemed to be, at least in part, stochastic. The docking and transport properties of a P-gp inhibitor, tariquidar, were also studied. A mechanism of inhibition by tariquidar is presented that involves stabilization of an outward open conformation with tariquidar bound in intracellular loops or at the drug binding domain of P-gp. PMID:26125482
Multiple Drug Transport Pathways through Human P-Glycoprotein.
McCormick, James W; Vogel, Pia D; Wise, John G
2015-07-21
P-Glycoprotein (P-gp) is a plasma membrane efflux pump that is commonly associated with therapy resistances in cancers and infectious diseases. P-gp can lower the intracellular concentrations of many drugs to subtherapeutic levels by translocating them out of the cell. Because of the broad range of substrates transported by P-gp, overexpression of P-gp causes multidrug resistance. We reported previously on dynamic transitions of P-gp as it moved through conformations based on crystal structures of homologous ABCB1 proteins using in silico targeted molecular dynamics techniques. We expanded these studies here by docking transport substrates to drug binding sites of P-gp in conformations open to the cytoplasm, followed by cycling the pump through conformations that opened to the extracellular space. We observed reproducible transport of two substrates, daunorubicin and verapamil, by an average of 11-12 Å through the plane of the membrane as P-gp progressed through a catalytic cycle. Methylpyrophosphate, a ligand that should not be transported by P-gp, did not show this movement through P-gp. Drug binding to either of two subsites on P-gp appeared to determine the initial pathway used for drug movement through the membrane. The specific side-chain interactions with drugs within each pathway seemed to be, at least in part, stochastic. The docking and transport properties of a P-gp inhibitor, tariquidar, were also studied. A mechanism of inhibition by tariquidar that involves stabilization of an outward open conformation with tariquidar bound in intracellular loops or at the drug binding domain of P-gp is presented.
Nag, Angshuman; Chung, Dae Sung; Dolzhnikov, Dmitriy S; Dimitrijevic, Nada M; Chattopadhyay, Soma; Shibata, Tomohiro; Talapin, Dmitri V
2012-08-22
Colloidal semiconductor nanocrystals (NCs) provide convenient "building blocks" for solution-processed solar cells, light-emitting devices, photocatalytic systems, etc. The use of inorganic ligands for colloidal NCs dramatically improved inter-NC charge transport, enabling fast progress in NC-based devices. Typical inorganic ligands (e.g., Sn(2)S(6)(4-), S(2-)) are represented by negatively charged ions that bind covalently to electrophilic metal surface sites. The binding of inorganic charged species to the NC surface provides electrostatic stabilization of NC colloids in polar solvents without introducing insulating barriers between NCs. In this work we show that cationic species needed for electrostatic balance of NC surface charges can also be employed for engineering almost every property of all-inorganic NCs and NC solids, including photoluminescence efficiency, electron mobility, doping, magnetic susceptibility, and electrocatalytic performance. We used a suite of experimental techniques to elucidate the impact of various metal ions on the characteristics of all-inorganic NCs and developed strategies for engineering and optimizing NC-based materials.
Effects of Astaxanthin on Reverse Cholesterol Transport and Atherosclerosis in Mice
Zou, Tang-Bin; Zhu, Shan-Shan; Luo, Fei; Li, Wei-Qiao
2017-01-01
High plasma level of HDL-cholesterol (HDL-C) has been consistently associated with a decreased risk of atherosclerosis (AS); thus, HDL-C is considered to be an antiatherogenic lipoprotein. The development of novel therapies to enhance the atheroprotective properties of HDL may have the possibility of further reducing the residual AS risk. Reverse cholesterol transport (RCT) is believed to be a primary atheroprotective activity of HDL, which has been shown to promote the efflux of excess cholesterol from macrophage-derived foam cells via ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), and scavenger receptor class B type I (SR-BI) and then transport it back to the liver for excretion into bile and eventually into the feces. In the current study, we investigated the effects of astaxanthin on RCT and AS progression in mice. The results showed that short- and long-term supplementation of astaxanthin promote RCT in C57BL/6J and ApoE−/− mice, respectively. Moreover, astaxanthin can relieve the plaque area of the aortic sinus and aortic cholesterol in mice. These findings suggest that astaxanthin is beneficial for boosting RCT and preventing the development of AS. PMID:29226138
ABC Transporters and Isothiocyanates: Potential for Pharmacokinetic Diet–Drug Interactions
Telang, Urvi; Ji, Yan; Morris, Marilyn E.
2013-01-01
Isothiocyanates, a class of anti-cancer agents, are derived from cruciferous vegetables such as broccoli, cabbage and watercress, and have demonstrated chemopreventive activity in a number of cancer models and epidemiologic studies. Due to public interest in cancer prevention and alternative therapies in cancer, the consumption of herbal supplements and vegetables containing these compounds is widespread and increasing. Isothiocyanates interact with ATP-binding cassette (ABC) efflux transporters such as P-glycoprotein, MRP1, MRP2 and BCRP, and may influence the pharmacokinetics of substrates of these transporters. This review discusses the pharmacokinetic properties of isothiocyanates, their interactions with ABC transporters, and presents some data describing the potential for isothiocyanate-mediated diet–drug interactions. PMID:19623673
Gross, Joshua D; Kaski, Shane W; Schroer, Adam B; Wix, Kimberley A; Siderovski, David P; Setola, Vincent
2018-02-01
Regulators of G protein signaling are proteins that accelerate the termination of effector stimulation after G protein-coupled receptor activation. Many regulators of G protein signaling proteins are highly expressed in the brain and therefore considered potential drug discovery targets for central nervous system pathologies; for example, here we show that RGS12 is highly expressed in microdissected mouse ventral striatum. Given a role for the ventral striatum in psychostimulant-induced locomotor activity, we tested whether Rgs12 genetic ablation affected behavioral responses to amphetamine and cocaine. RGS12 loss significantly decreased hyperlocomotion to lower doses of both amphetamine and cocaine; however, other outcomes of administration (sensitization and conditioned place preference) were unaffected, suggesting that RGS12 does not function in support of the rewarding properties of these psychostimulants. To test whether observed response changes upon RGS12 loss were caused by changes to dopamine transporter expression and/or function, we prepared crude membranes from the brains of wild-type and RGS12-null mice and measured dopamine transporter-selective [ 3 H]WIN 35428 binding, revealing an increase in dopamine transporter levels in the ventral-but not dorsal-striatum of RGS12-null mice. To address dopamine transporter function, we prepared striatal synaptosomes and measured [ 3 H]dopamine uptake. Consistent with increased [ 3 H]WIN 35428 binding, dopamine transporter-specific [ 3 H]dopamine uptake in RGS12-null ventral striatal synaptosomes was found to be increased. Decreased amphetamine-induced locomotor activity and increased [ 3 H]WIN 35428 binding were recapitulated with an independent RGS12-null mouse strain. Thus, we propose that RGS12 regulates dopamine transporter expression and function in the ventral striatum, affecting amphetamine- and cocaine-induced increases in dopamine levels that specifically elicit acute hyperlocomotor responses.
Domonkos, Celesztina; Fitos, Ilona; Visy, Júlia; Zsila, Ferenc
2013-12-02
Harmane and norharmane are representative members of the large group of natural β-carboline alkaloids featured with diverse pharmacological activities. In blood, these agents are transported by human serum albumin (HSA) which has a profound impact on the pharmacokinetic and pharmacodynamic properties of many therapeutic drugs and xenobiotics. By combination of various spectroscopic methods, the present contribution is aimed to elucidate how nonesterified fatty acids (FAs), the primary endogenous ligands of HSA, affect the binding properties of harmane and norharmane. Analysis of induced circular dichroism (CD) and fluorescence spectroscopic data indicates the inclusion of the neutral form of both molecules into the binding pocket of subdomain IIIA, which hosts two FA binding sites, too. The induced CD and UV absorption spectra of harmane and norharmane exhibit peculiar changes upon addition of FAs, suggesting the formation of ternary complexes in which the lipid ligands significantly alter the binding mode of the alkaloids via cooperative allosteric mechanism. To our knowledge, it is the first instance of the demonstration of drug-FA cobinding at site IIIA. In line with these results, molecular docking calculations showed two distinct binding positions of norharmane within subdomain IIIA. The profound increase in the affinity constants of β-carbolines estimated in the presence of FAs predicts that the unbound, pharmacologically active serum fraction of these compounds strongly depends on the actual lipid binding profile of HSA.
Song, Jianing; Ji, Changge; Zhang, John Z H
2014-02-01
MATE (multidrug and toxic compound extrusion) transporter proteins mediate metabolite transport in plants and multidrug resistance in bacteria and mammals. MATE transporter NorM from Vibrio cholerae is an antiporter that is driven by Na+ gradient to extrude the substrates. To understand the molecular mechanism of Na+-substrate exchange, molecular dynamics simulation was performed to study conformational changes of both wild-type and mutant NorM with and without cation bindings. Our results show that NorM is able to bind two Na(+) ions simultaneously, one to each of the carboxylic groups of E255 and D371 in the binding pocket. Furthermore, this di-Na(+) binding state is likely more efficient for conformational changes of NorM_VC toward the inward-facing conformation than single-Na(+) binding state. The observation of two Na(+) binding sites of NorM_VC is consistent with the previous study that two sites for ion binding (denoted as Na1/Na2 sites) are found in the transporter LeuT and BetP, another two secondary transporters. Taken together, our findings shed light on the structure rearrangements of NorM on Na(+) binding and enrich our knowledge of the transport mechanism of secondary transporters. Copyright © 2013 Wiley Periodicals, Inc.
Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng
2013-01-01
Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.
Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng
2013-01-01
Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059
Miller, Jeffrey M; Hesselgrave, Natalie; Ogden, R Todd; Sullivan, Gregory M; Oquendo, Maria A; Mann, J John; Parsey, Ramin V
2013-08-15
Several lines of evidence implicate abnormal serotonergic function in suicidal behavior and completed suicide, including low serotonin transporter binding in postmortem studies of completed suicide. We have also reported low in vivo serotonin transporter binding in major depressive disorder (MDD) during a major depressive episode using positron emission tomography (PET) with [(11)C]McN5652. We quantified regional brain serotonin transporter binding in vivo in depressed suicide attempters, depressed nonattempters, and healthy controls using PET and a superior radiotracer, [(11)C]DASB. Fifty-one subjects with DSM-IV current MDD, 15 of whom were past suicide attempters, and 32 healthy control subjects underwent PET scanning with [(11)C]DASB to quantify in vivo regional brain serotonin transporter binding. Metabolite-corrected arterial input functions and plasma free-fraction were acquired to improve quantification. Depressed suicide attempters had lower serotonin transporter binding in midbrain compared with depressed nonattempters (p = .031) and control subjects (p = .0093). There was no difference in serotonin transporter binding comparing all depressed subjects with healthy control subjects considering six a priori regions of interest simultaneously (p = .41). Low midbrain serotonin transporter binding appears to be related to the pathophysiology of suicidal behavior rather than of major depressive disorder. This is consistent with postmortem work showing low midbrain serotonin transporter binding capacity in depressed suicides and may partially explain discrepant in vivo findings quantifying serotonin transporter in depression. Future studies should investigate midbrain serotonin transporter binding as a predictor of suicidal behavior in MDD and determine the cause of low binding. Copyright © 2013 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
The effect of feeding high corn oil on fatty-acid-binding-protein isolated from rat liver.
Catalá, A
1987-12-01
Fatty-acid-binding-protein isolated from liver of rats receiving normal or high fat diet was studied by three different methods. The effect of high fat diet on the thermal stability of the protein was determined employing differential scanning calorimetry. Fatty acids have a stabilizing effect on the thermal stability of the protein. In order to determine the relative binding affinity of native and delipidated protein a Sephadex G-50 assay was employed using [1-14C] oleate as ligand. The delipidated protein exhibited greater binding of oleate than did the native material. Increases in the transfer of oleic acid from rat liver microsomes to egg lecithin liposomes in vitro were also observed when protein obtained from both sources were delipidated. The results suggest that high corn oil diet would modify the properties of fatty-acid-binding-protein in the uptake and cytosolic transport of long-chain fatty acids.
Werner, Anna M.; Cuboni, Serena; Rudolf, Georg C.; Höfner, Georg; Wanner, Klaus T.; Sieber, Stephan A.; Schmidt, Ulrike; Holsboer, Florian; Rein, Theo; Hausch, Felix
2016-01-01
The aim of this study was to design, synthesize and validate a multifunctional antidepressant probe that is modified at two distinct positions. The purpose of these modifications was to allow covalent linkage of the probe to interaction partners, and decoration of probe-target complexes with fluorescent reporter molecules. The strategy for the design of such a probe (i.e., azidobupramine) was guided by the need for the introduction of additional functional groups, conveying the required properties while keeping the additional moieties as small as possible. This should minimize the risk of changing antidepressant-like properties of the new probe azidobupramine. To control for this, we evaluated the binding parameters of azidobupramine to known target sites such as the transporters for serotonin (SERT), norepinephrine (NET), and dopamine (DAT). The binding affinities of azidobupramine to SERT, NET, and DAT were in the range of structurally related and clinically active antidepressants. Furthermore, we successfully visualized azidobupramine-SERT complexes not only in SERT-enriched protein material but also in living cells stably overexpressing SERT. To our knowledge, azidobupramine is the first structural analogue of a tricyclic antidepressant that can be covalently linked to target structures and further attached to reporter molecules while preserving antidepressant-like properties and avoiding radioactive isotopes. PMID:26863431
Höltje, Markus; Schulze, Sebastian; Strotmeier, Jasmin; Mahrhold, Stefan; Richter, Karin; Binz, Thomas; Bigalke, Hans; Ahnert-Hilger, Gudrun; Rummel, Andreas
2013-12-01
The modular four domain structure of clostridial neurotoxins supports the idea to reassemble individual domains from tetanus and botulinum neurotoxins to generate novel molecules with altered pharmacological properties. To treat disorders of the central nervous system drug transporter molecules based on catalytically inactive clostridial neurotoxins circumventing the passage of the blood-brain-barrier are desired. Such molecules can be produced based on the highly effective botulinum neurotoxin serotype A incorporating the retrograde axonal sorting property of tetanus neurotoxin which is supposed to be encoded within its C-terminal cell binding domain HC. The corresponding exchange of the tetanus neurotoxin HC-fragment in botulinum neurotoxin A yielded the novel hybrid molecule AATT which displayed decreased potency at the neuromuscular junction like tetanus neurotoxin but exerted equal activity in cortical neurons compared to botulinum neurotoxin A wild-type. Minimizing the tetanus neurotoxin cell binding domain to its N- or C-terminal half drastically reduced the potencies of AATA and AAAT in cortical neurons indicating that the structural motif mediating sorting of tetanus neurotoxin is predominantly encoded within the entire HC-fragment. However, the reciprocal exchange resulted in TTAA which showed a similar potency as tetanus neurotoxin at the neuromuscular junction indicating that the tetanus neurotoxin portion prevents a high potency as observed for botulinum neurotoxins. In conclusion, clostridial neurotoxin based inactivated drug transporter for targeting central neurons should contain the cell binding domain of tetanus neurotoxin to exert its tropism for the central nervous system. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Handali, Melody; Neupane, Durga P.; Roychowdhury, Hridindu
Here, ATP-binding cassette (ABC) transporters of the cluster 9 family are ubiquitous among bacteria and essential for acquiring Zn 2+ and Mn 2+ from the environment or, in the case of pathogens, from the host. These rely on a substrate-binding protein (SBP) to coordinate the relevant metal with high affinity and specificity and subsequently release it to a membrane permease for translocation into the cytoplasm. Although a number of cluster 9 SBP structures have been determined, the structural attributes conferring Zn 2+ or Mn 2+ specificity remain ambiguous. Here we describe the gene expression profile, in vitro metal binding properties,more » and crystal structure of a new cluster 9 SBP from Paracoccus denitrificans we have called AztC. Although all of our results strongly indicate Zn 2+ over Mn 2+ specificity, the Zn 2+ ion is coordinated by a conserved Asp residue only observed to date as a metal ligand in Mn 2+-specific SBPs. The unusual sequence properties of this protein are shared among close homologues, including members from the human pathogens Klebsiella pneumonia and Enterobacter aerogenes, and would seem to suggest a subclass of Zn 2+-specific transporters among the cluster 9 family. In any case, the unusual coordination environment of AztC expands the already considerable range of those available to Zn 2+-specific SBPs and highlights the presence of a His-rich loop as the most reliable indicator of Zn 2+ specificity.« less
Blindauer, Claudia A; Khazaipoul, Siavash; Yu, Ruitao; Stewart, Alan J
2016-01-01
Human serum albumin (HSA) is the major protein in blood plasma and is responsible for circulatory transport of a range of small molecules including fatty acids, metal ions and drugs. We previously identified the major plasma Zn2+ transport site on HSA and revealed that fatty-acid binding (at a distinct site called the FA2 site) and Zn2+ binding are interdependent via an allosteric mechanism. Since binding affinities of long-chain fatty acids exceed those of plasma Zn2+, this means that under certain circumstances the binding of fatty acid molecules to HSA is likely to diminish HSA Zn2+-binding, and hence affects the control of circulatory and cellular Zn2+ dynamics. This relationship between circulatory fatty acid and Zn2+ dynamics is likely to have important physiological and pathological implications, especially since it has been recognised that Zn2+ acts as a signalling agent in many cell types. Fatty acid levels in the blood are dynamic, but most importantly, chronic elevation of plasma fatty acid levels is associated with some metabolic disorders and disease states - including myocardial infarction and other cardiovascular diseases. In this article, we briefly review the metal-binding properties of albumin and highlight the importance of their interplay with fatty acid binding. We also consider the impact of this dynamic link upon levels and speciation of plasma Zn2+, its effect upon cellular Zn2+ homeostasis and its relevance to cardiovascular and circulatory processes in health and disease.
NASA Astrophysics Data System (ADS)
Lei, Jie
2011-03-01
In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.
Improvement of the Davydov theory of bioenergy transport in protein molecular systems.
Pang, X F
2000-11-01
The Hamiltonian and the wave function in the Davydov theory have simultaneously been improved and extended, based on some physical and biological grounds and on results from other models. The equations of motion for the improved Davydov model with a quasicoherent two-quanta state and a new interaction term in the Hamiltonian describe bioenergy transport along the molecular chains in protein molecules by a soliton mechanism. Some elementary properties of the soliton, including the nonlinear coupling energy and greatly increased binding energy of the soliton, are also given. The results obtained suggest that the model could be a candidate for a bioenergy transport mechanism in protein molecules.
Structural and mechanistic basis of proton-coupled metal ion transport in the SLC11/NRAMP family
Ehrnstorfer, Ines A.; Manatschal, Cristina; Arnold, Fabian M.; Laederach, Juerg; Dutzler, Raimund
2017-01-01
Secondary active transporters of the SLC11/NRAMP family catalyse the uptake of iron and manganese into cells. These proteins are highly conserved across all kingdoms of life and thus likely share a common transport mechanism. Here we describe the structural and functional properties of the prokaryotic SLC11 transporter EcoDMT. Its crystal structure reveals a previously unknown outward-facing state of the protein family. In proteoliposomes EcoDMT mediates proton-coupled uptake of manganese at low micromolar concentrations. Mutants of residues in the transition-metal ion-binding site severely affect transport, whereas a mutation of a conserved histidine located near this site results in metal ion transport that appears uncoupled to proton transport. Combined with previous results, our study defines the conformational changes underlying transition-metal ion transport in the SLC11 family and it provides molecular insight to its coupling to protons. PMID:28059071
Paula, Stefan; Tabet, Michael R; Keenan, Susan M; Welsh, William J; Ball, W James
2003-01-17
Successful immunotherapy of cocaine addiction and overdoses requires cocaine-binding antibodies with specific properties, such as high affinity and selectivity for cocaine. We have determined the affinities of two cocaine-binding murine monoclonal antibodies (mAb: clones 3P1A6 and MM0240PA) for cocaine and its metabolites by [3H]-radioligand binding assays. mAb 3P1A6 (K(d) = 0.22 nM) displayed a 50-fold higher affinity for cocaine than mAb MM0240PA (K(d) = 11 nM) and also had a greater specificity for cocaine. For the systematic exploration of both antibodies' binding specificities, we used a set of approximately 35 cocaine analogues as structural probes by determining their relative binding affinities (RBAs) using an enzyme-linked immunosorbent competition assay. Three-dimensional quantitative structure-activity relationship (3D-QSAR) models on the basis of comparative molecular field analysis (CoMFA) techniques correlated the binding data with structural features of the ligands. The analysis indicated that despite the mAbs' differing specificities for cocaine, the relative contributions of the steric (approximately 80%) and electrostatic (approximately 20%) field interactions to ligand-binding were similar. Generated three-dimensional CoMFA contour plots then located the specific regions about cocaine where the ligand/receptor interactions occurred. While the overall binding patterns of the two mAbs had many features in common, distinct differences were observed about the phenyl ring and the methylester group of cocaine. Furthermore, using previously published data, a 3D-QSAR model was developed for cocaine binding to the dopamine reuptake transporter (DAT) that was compared to the mAb models. Although the relative steric and electrostatic field contributions were similar to those of the mAbs, the DAT cocaine-binding site showed a preference for negatively charged ligands. Besides establishing molecular level insight into the interactions that govern cocaine binding specificity by biopolymers, the three-dimensional images obtained reflect the properties of the mAbs binding pockets and provide the initial information needed for the possible design of novel antibodies with properties optimized for immunotherapy. Copyright 2003 Elsevier Science Ltd.
Analysis of cholesterol trafficking with fluorescent probes
Maxfield, Frederick R.; Wüstner, Daniel
2013-01-01
Cholesterol plays an important role in determining the biophysical properties of biological membranes, and its concentration is tightly controlled by homeostatic processes. The intracellular transport of cholesterol among organelles is a key part of the homeostatic mechanism, but sterol transport processes are not well understood. Fluorescence microscopy is a valuable tool for studying intracellular transport processes, but this method can be challenging for lipid molecules because addition of a fluorophore may alter the properties of the molecule greatly. We discuss the use of fluorescent molecules that can bind to cholesterol to reveal its distribution in cells. We also discuss the use of intrinsically fluorescent sterols that closely mimic cholesterol, as well as some minimally modified fluorophore-labeled sterols. Methods for imaging these sterols by conventional fluorescence microscopy and by multiphoton microscopy are described. Some label-free methods for imaging cholesterol itself are also discussed briefly. PMID:22325611
Rickli, Anna; Luethi, Dino; Reinisch, Julian; Buchy, Danièle; Hoener, Marius C; Liechti, Matthias E
2015-12-01
N-2-methoxybenzyl-phenethylamines (NBOMe drugs) are newly used psychoactive substances with poorly defined pharmacological properties. The aim of the present study was to characterize the receptor binding profiles of a series of NBOMe drugs compared with their 2,5-dimethoxy-phenethylamine analogs (2C drugs) and lysergic acid diethylamide (LSD) in vitro. We investigated the binding affinities of 2C drugs (2C-B, 2C-C, 2C-D, 2C-E, 2C-H, 2C-I, 2C-N, 2C-P, 2C-T-2, 2C-T-4, 2C-T-7, and mescaline), their NBOMe analogs, and LSD at monoamine receptors and determined functional 5-hydroxytryptamine-2A (5-HT2A) and 5-HT2B receptor activation. Binding at and the inhibition of monoamine uptake transporters were also determined. Human cells that were transfected with the respective human receptors or transporters were used (with the exception of trace amine-associated receptor-1 [TAAR1], in which rat/mouse receptors were used). All of the compounds potently interacted with serotonergic 5-HT2A, 5-HT2B, 5-HT2C receptors and rat TAAR1 (most Ki and EC50: <1 μM). The N-2-methoxybenzyl substitution of 2C drugs increased the binding affinity at serotonergic 5-HT2A, 5-HT2C, adrenergic α1, dopaminergic D1-3, and histaminergic H1 receptors and monoamine transporters but reduced binding to 5-HT1A receptors and TAAR1. As a result, NBOMe drugs were very potent 5-HT2A receptor agonists (EC50: 0.04-0.5 μM) with high 5-HT2A/5-HT1A selectivity and affinity for adrenergic α1 receptors (Ki: 0.3-0.9 μM) and TAAR1 (Ki: 0.06-2.2 μM), similar to LSD, but not dopaminergic D1-3 receptors (most Ki:>1 μM), unlike LSD. The binding profile of NBOMe drugs predicts strong hallucinogenic effects, similar to LSD, but possibly more stimulant properties because of α1 receptor interactions. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.
ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less
Gopal, Pallavi P; Nirschl, Jeffrey J; Klinman, Eva; Holzbaur, Erika L F
2017-03-21
Ribonucleoprotein (RNP) granules are enriched in specific RNAs and RNA-binding proteins (RBPs) and mediate critical cellular processes. Purified RBPs form liquid droplets in vitro through liquid-liquid phase separation and liquid-like non-membrane-bound structures in cells. Mutations in the human RBPs TAR-DNA binding protein 43 (TDP-43) and RNA-binding protein FUS cause amyotrophic lateral sclerosis (ALS), but the biophysical properties of these proteins have not yet been studied in neurons. Here, we show that TDP-43 RNP granules in axons of rodent primary cortical neurons display liquid-like properties, including fusion with rapid relaxation to circular shape, shear stress-induced deformation, and rapid fluorescence recovery after photobleaching. RNP granules formed from wild-type TDP-43 show distinct biophysical properties depending on axonal location, suggesting maturation to a more stabilized structure is dependent on subcellular context, including local density and aging. Superresolution microscopy demonstrates that the stabilized population of TDP-43 RNP granules in the proximal axon is less circular and shows spiculated edges, whereas more distal granules are both more spherical and more dynamic. RNP granules formed by ALS-linked mutant TDP-43 are more viscous and exhibit disrupted transport dynamics. We propose these altered properties may confer toxic gain of function and reflect differential propensity for pathological transformation.
Nagarajan, Yagnesh; Rongala, Jay; Luang, Sukanya; Shadiac, Nadim; Sutton, Tim; Tyerman, Stephen D.; McPhee, Gordon; Voelcker, Nicolas H.; Lee, Jung-Goo
2016-01-01
Plant growth and survival depend upon the activity of membrane transporters that control the movement and distribution of solutes into, around, and out of plants. Although many plant transporters are known, their intrinsic properties make them difficult to study. In barley (Hordeum vulgare), the root anion-permeable transporter Bot1 plays a key role in tolerance to high soil boron, facilitating the efflux of borate from cells. However, its three-dimensional structure is unavailable and the molecular basis of its permeation function is unknown. Using an integrative platform of computational, biophysical, and biochemical tools as well as molecular biology, electrophysiology, and bioinformatics, we provide insight into the origin of transport function of Bot1. An atomistic model, supported by atomic force microscopy measurements, reveals that the protein folds into 13 transmembrane-spanning and five cytoplasmic α-helices. We predict a trimeric assembly of Bot1 and the presence of a Na+ ion binding site, located in the proximity of a pore that conducts anions. Patch-clamp electrophysiology of Bot1 detects Na+-dependent polyvalent anion transport in a Nernstian manner with channel-like characteristics. Using alanine scanning, molecular dynamics simulations, and transport measurements, we show that conductance by Bot1 is abolished by removal of the Na+ ion binding site. Our data enhance the understanding of the permeation functions of Bot1. PMID:26672067
Substrate binding stoichiometry and kinetics of the norepinephrine transporter.
Schwartz, Joel W; Novarino, Gaia; Piston, David W; DeFelice, Louis J
2005-05-13
The human norepinephrine (NE) transporter (hNET) attenuates neuronal signaling by rapid NE clearance from the synaptic cleft, and NET is a target for cocaine and amphetamines as well as therapeutics for depression, obsessive-compulsive disorder, and post-traumatic stress disorder. In spite of its central importance in the nervous system, little is known about how NET substrates, such as NE, 1-methyl-4-tetrahydropyridinium (MPP+), or amphetamine, interact with NET at the molecular level. Nor do we understand the mechanisms behind the transport rate. Previously we introduced a fluorescent substrate similar to MPP+, which allowed separate and simultaneous binding and transport measurement (Schwartz, J. W., Blakely, R. D., and DeFelice, L. J. (2003) J. Biol. Chem. 278, 9768-9777). Here we use this substrate, 4-(4-(dimethylamino)styrl)-N-methyl-pyridinium (ASP+), in combination with green fluorescent protein-tagged hNETs to measure substrate-transporter stoichiometry and substrate binding kinetics. Calibrated confocal microscopy and fluorescence correlation spectroscopy reveal that hNETs, which are homomultimers, bind one substrate molecule per transporter subunit. Substrate residence at the transporter, obtained from rapid on-off kinetics revealed in fluorescence correlation spectroscopy, is 526 micros. Substrate residence obtained by infinite dilution is 1000 times slower. This novel examination of substrate-transporter kinetics indicates that a single ASP+ molecule binds and unbinds thousands of times before being transported or ultimately dissociated from hNET. Calibrated fluorescent images combined with mass spectroscopy give a transport rate of 0.06 ASP+/hNET-protein/s, thus 36,000 on-off binding events (and 36 actual departures) occur for one transport event. Therefore binding has a low probability of resulting in transport. We interpret these data to mean that inefficient binding could contribute to slow transport rates.
Brain uptake of multivalent and multi-specific DVD-Ig proteins after systemic administration.
Karaoglu Hanzatian, Denise; Schwartz, Annette; Gizatullin, Farid; Erickson, Jamie; Deng, Kangwen; Villanueva, Ruth; Stedman, Christopher; Harris, Cristina; Ghayur, Tariq; Goodearl, Andrew
2018-05-17
Therapeutic monoclonal antibodies and endogenous IgG antibodies show limited uptake into the central nervous system (CNS) due to the blood-brain barrier (BBB), which regulates and controls the selective and specific transport of both exogenous and endogenous materials to the brain. The use of natural transport mechanisms, such as receptor-mediated transcytosis (RMT), to deliver antibody therapeutics into the brain have been studied in rodents and monkeys. Recent successful examples include monovalent bispecific antibodies and mono- or bivalent fusion proteins; however, these formats do not have the capability to bind to both the CNS target and the BBB transport receptor in a bivalent fashion as a canonical antibody would. Dual-variable-domain immunoglobulin (DVD-Ig) proteins offer a bispecific format where monoclonal antibody-like bivalency to both the BBB receptor and the therapeutic target is preserved, enabling independent engineering of binding affinity, potency, valency, epitope and conformation, essential for successful generation of clinical candidates for CNS applications with desired drug-like properties. Each of these parameters can affect the binding and transcytosis ability mediated by different receptors on the brain endothelium differentially, allowing exploration of diverse properties. Here, we describe generation and characterization of several different DVD-Ig proteins, specific for four different CNS targets, capable of crossing the BBB through transcytosis mediated by the transferrin receptor 1 (TfR1). After systemic administration of each DVD-Ig, we used two independent methods in parallel to observe specific uptake into the brain. An electrochemiluminescent-based sensitive quantitative assay and a semi-quantitative immunohistochemistry technique were used for brain concentration determination and biodistribution/localization in brain, respectively. Significantly enhanced brain uptake and retention was observed for all TfR1 DVD-Ig proteins regardless of the CNS target or the systemic administration route selected.
Electron-phonon interaction in quantum transport through quantum dots and molecular systems
NASA Astrophysics Data System (ADS)
Ojeda, J. H.; Duque, C. A.; Laroze, D.
2016-12-01
The quantum transport and effects of decoherence properties are studied in quantum dots systems and finite homogeneous chains of aromatic molecules connected to two semi-infinite leads. We study these systems based on the tight-binding approach through Green's function technique within a real space renormalization and polaron transformation schemes. In particular, we calculate the transmission probability following the Landauer-Büttiker formalism, the I - V characteristics and the noise power of current fluctuations taken into account the decoherence. Our results may explain the inelastic effects through nanoscopic systems.
Spin-polarized transport in multiterminal silicene nanodevices
NASA Astrophysics Data System (ADS)
Xu, Ning
2018-01-01
The spin-polarized transport properties of multiterminal silicene nanodevices are studied using the tight binding model and Landauer-Buttier approach. We propose a four-terminal †-shaped junction device and two types of three-terminal T-shaped junction devices, which are made of the crossing of a zigzag and an armchair silicene nanoribbon. If the electrons are injected into the metallic lead, the near-perfect spin polarization with 100% around the Fermi energy can be achieved easily at the other semiconducting leads. Thus the multiterminal silicene nanodevices can act as controllable spin filters.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stolzenberg, Sebastian; Quick, Matthias; Zhao, Chunfeng
Neurotransmitter:sodium symporters (NSSs) terminate neurotransmission by Na +-dependent reuptake of released neurotransmitters. Previous studies suggested that Na +-binding reconfigures dynamically coupled structural elements in an allosteric interaction network (AIN) responsible for function-related conformational changes, but the intramolecular pathway of this mechanism has remained uncharted. Here we describe a new approach for the modeling and analysis of intramolecular dynamics in the bacterial NSS homolog LeuT. From microsecond-scale molecular dynamics simulations and cognate experimental verifications in both LeuT and human dopamine transporter (hDAT), we apply the novel method to identify the composition and the dynamic properties of their conserved AIN. In LeuT,more » two different perturbations disrupting Na+ binding and transport ( i.e. replacing Na + with Li + or the Y268A mutation at the intracellular gate) affect the AIN in strikingly similar ways. In contrast, other mutations that affect the intracellular gate (i.e. R5A and D369A) do not significantly impair Na + cooperativity and transport. Our analysis shows these perturbations to have much lesser effects on the AIN, underscoring the sensitivity of this novel method to the mechanistic nature of the perturbation. Notably, this set of observations holds as well for hDAT, where the aligned Y335A, R60A, and D436A mutations also produce different impacts on Na + dependence. Furthermore, the detailed AIN generated from our method is shown to connect Na + binding with global conformational changes that are critical for the transport mechanism. Lastly, that the AIN between the Na + binding sites and the intracellular gate in bacterial LeuT resembles that in eukaryotic hDAT highlights the conservation of allosteric pathways underlying NSS function.« less
Howlett, Robert M; Hughes, Bethan M; Hitchcock, Andrew; Kelly, David J
2012-06-01
Campylobacter jejuni is a human pathogen of worldwide significance. It is commensal in the gut of many birds and mammals, where hydrogen is a readily available electron donor. The bacterium possesses a single membrane-bound, periplasmic-facing NiFe uptake hydrogenase that depends on the acquisition of environmental nickel for activity. The periplasmic binding protein Cj1584 (NikZ) of the ATP binding cassette (ABC) transporter encoded by the cj1584c-cj1580c (nikZYXWV) operon in C. jejuni strain NCTC 11168 was found to be nickel-repressed and to bind free nickel ions with a submicromolar K(d) value, as measured by fluorescence spectroscopy. Unlike the Escherichia coli NikA protein, NikZ did not bind EDTA-chelated nickel and lacks key conserved residues implicated in metallophore interaction. A C. jejuni cj1584c null mutant strain showed an approximately 22-fold decrease in intracellular nickel content compared with the wild-type strain and a decreased rate of uptake of (63)NiCl(2). The inhibition of residual nickel uptake at higher nickel concentrations in this mutant by hexa-ammine cobalt (III) chloride or magnesium ions suggests that low-affinity uptake occurs partly through the CorA magnesium transporter. Hydrogenase activity was completely abolished in the cj1584c mutant after growth in unsupplemented media, but was fully restored after growth with 0.5 mM nickel chloride. Mutation of the putative metallochaperone gene slyD (cj0115) had no effect on either intracellular nickel accumulation or hydrogenase activity. Our data reveal a strict dependence of hydrogenase activity in C. jejuni on high-affinity nickel uptake through an ABC transporter that has distinct properties compared with the E. coli Nik system.
2016-01-01
The ability of the cellular prion protein (PrPC) to bind copper in vivo points to a physiological role for PrPC in copper transport. Six copper binding sites have been identified in the nonstructured N-terminal region of human PrPC. Among these sites, the His111 site is unique in that it contains a MKHM motif that would confer interesting CuI and CuII binding properties. We have evaluated CuI coordination to the PrP(106–115) fragment of the human PrP protein, using NMR and X-ray absorption spectroscopies and electronic structure calculations. We find that Met109 and Met112 play an important role in anchoring this metal ion. CuI coordination to His111 is pH-dependent: at pH >8, 2N1O1S species are formed with one Met ligand; in the range of pH 5–8, both methionine (Met) residues bind to CuI, forming a 1N1O2S species, where N is from His111 and O is from a backbone carbonyl or a water molecule; at pH <5, only the two Met residues remain coordinated. Thus, even upon drastic changes in the chemical environment, such as those occurring during endocytosis of PrPC (decreased pH and a reducing potential), the two Met residues in the MKHM motif enable PrPC to maintain the bound CuI ions, consistent with a copper transport function for this protein. We also find that the physiologically relevant CuI-1N1O2S species activates dioxygen via an inner-sphere mechanism, likely involving the formation of a copper(II) superoxide complex. In this process, the Met residues are partially oxidized to sulfoxide; this ability to scavenge superoxide may play a role in the proposed antioxidant properties of PrPC. This study provides further insight into the CuI coordination properties of His111 in human PrPC and the molecular mechanism of oxygen activation by this site. PMID:26930130
Barash, H; Halpern, Y S
1975-03-28
Glutamate binding protein released from the periplasmic space of Escherichia coli K-12 by lysozyme-EDTA treatment was purified to homogeneity and its physical and chemical properties were studied. It is a basic protein with a pI of 9.1. Its molecular weight, determined in an analytical ultracentrifuge, and by gel filtration on Sephadex G-100 and dodecylsulphate acrylamide is 29 700, 27 800 and 32 000, respectively. The KD value for glutamate was 6.7 - 10- minus 6 M. L-Aspartate, reduced glutathione, G-glutamate-gamma-benzylester and L-glutamate-gamma-ethylester competitively inhibited glutamate binding with K-i; values of 7.8 - 10- minus 5, 1.1 - 10- minus 5, 1.0 - 10- minus 5 and 1.0 - 10- minus 5 M, respectively. Spheroplasts retained 40% of glutamate transport as compared to intact cells. The glutamate binding activity of a glutamate-utilizing strain (CS7), was 1.6 times as high as that of the glutamate non-utilizing parent strain (CS101). Similarly, the glutamate binding activity of a temperature conditional glutamate-utilizing mutant (CS2-TC) was 1.9 times higher when grown at the permissive temperature (42 degrees C) than when grown at the restrictive temperature (30 degrees C).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jeng, A.Y.
1979-01-01
A protein was isolated from calf heart inner mitochondrial membrane with the aid of an electron paramagnetic resonance assay based on the relative binding properties of Ca/sup 2 +/, Mn/sup 2 +/, and Mg/sup 2 +/ to the protein. Partial delipidation of the protein was performed by using either the organic solvent extraction procedure or the silicic acid column chromatography. Control experiments indicated that the Ca/sup 2 +/ transport properties of the isolated protein were not due to the contaminating phospholipids. A complete delipidation procedure was developd by using Sephadex LH-20 column chromatography. Further characterization of the physical and chemicalmore » properties of the delipidated protein showed that delipidated protein becomes more hydrophobic in the presence of Ca/sup 2 +/ and alkaline pH in the organic solvent extraction experiments. Two possible models of calciphorin-mediated Ca/sup 2 +/ transport in mitochondria are proposed. (PCS)« less
Thinking Like a Chemist: Intuition in Thermoelectric Materials.
Zeier, Wolfgang G; Zevalkink, Alex; Gibbs, Zachary M; Hautier, Geoffroy; Kanatzidis, Mercouri G; Snyder, G Jeffrey
2016-06-06
The coupled transport properties required to create an efficient thermoelectric material necessitates a thorough understanding of the relationship between the chemistry and physics in a solid. We approach thermoelectric material design using the chemical intuition provided by molecular orbital diagrams, tight binding theory, and a classic understanding of bond strength. Concepts such as electronegativity, band width, orbital overlap, bond energy, and bond length are used to explain trends in electronic properties such as the magnitude and temperature dependence of band gap, carrier effective mass, and band degeneracy and convergence. The lattice thermal conductivity is discussed in relation to the crystal structure and bond strength, with emphasis on the importance of bond length. We provide an overview of how symmetry and bonding strength affect electron and phonon transport in solids, and how altering these properties may be used in strategies to improve thermoelectric performance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Novel water soluble NIR dyes: does charge matter?
NASA Astrophysics Data System (ADS)
Patonay, Gabor; Henary, Maged; Beckford, Garfield; Daube, Alison
2012-03-01
Near-Infrared (NIR) dyes are used as reporters, probes or markers in the biological and medical field. NIR dyes can be useful for investigating and characterizing biomolecular interactions or imaging which is possible because biological mammalian tissue has a low absorption window in the NIR region. Biomolecules such as proteins are known to bind to NIR dyes. Upon binding NIR dyes often exhibit spectral changes that can be used for characterizing the binding event. Serum albumins may be responsible for in vivo transport of NIR dyes. Studying this binding event can be useful when correlated to in vivo behavior of the NIR dye. The studies presented here use spectroscopic methods to investigate how NIR dyes that may be used in imaging, biological or bioanalytical applications bind to proteins, such as serum albumins. Our research group systematically synthesized several NIR dyes that have varying hydrophobicity, chromophore size and charge. During these investigations we developed novel NIR cyanine fluorophores having varying aqueous solubility and a variety of net charges. The binding properties of the carbocyanines change when charged or hydrophobic moieties are systematically varied. One of the properties we put a special emphasis on is what we call residual hydrophobicity of the NIR dye molecule which is defined as the unmasked (by the charged moieties) hydrophobicity of the molecule. Residual hydrophobicity may be responsible for binding the otherwise highly water soluble NIR dye to hydrophobic pockets of biomolecules. High residual hydrophobicity of a highly water soluble dye can be disadvantageous during biological, medical or similar applications.
Helledie, Torben; Jørgensen, Claus; Antonius, Marianne; Krogsdam, Ann M; Kratchmarova, Irina; Kristiansen, Karsten; Mandrup, Susanne
2002-10-01
Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that are activated by a number of fatty acids and fatty acid derivatives. By contrast, we have recently shown that acyl-CoA esters display PPAR antagonistic properties in vitro. We have also shown that the adipocyte lipid binding protein (ALBP), the keratinocyte lipid binding protein (KLBP) and the acyl-CoA binding protein (ACBP) exhibit a prominent nuclear localization in differentiating 3T3-L1 adipocytes. Similarly, ectopic expression of these proteins in CV-1 cells resulted in a primarily nuclear localization. We therefore speculated that FABPs and ACBP might regulate the availability of PPAR agonists and antagonists by affecting not only their esterification in the cytoplasm but also their transport to and availability in the nucleus. We show here that coexpression of ALBP or ACBP exerts a negative effect on ligand-dependent PPAR transactivation, when tetradecylthioacetic (TTA) is used as ligand but not when the thiazolidinedione BRL49653 is used as ligand. The results presented here do not support the hypothesis that ALBP facilitates the transport of the fatty acid-type ligands to the nucleus, rather ALBP appears to sequester or increase the turn-over of the agonist. Similarly, our results are in keeping with a model in which ACBP increase the metabolism of these ligands.
Dwivedi, Neeraj; McIntosh, Ross; Dhand, Chetna; Kumar, Sushil; Malik, Hitendra K; Bhattacharyya, Somnath
2015-09-23
We report nitrogen-induced enhanced electron tunnel transport and improved nanomechanical properties in band gap-modulated nitrogen doped DLC (N-DLC) quantum superlattice (QSL) structures. The electrical characteristics of such superlattice devices revealed negative differential resistance (NDR) behavior. The interpretation of these measurements is supported by 1D tight binding calculations of disordered superlattice structures (chains), which include bond alternation in sp(3)-hybridized regions. Tandem theoretical and experimental analysis shows improved tunnel transport, which can be ascribed to nitrogen-driven structural modification of the N-DLC QSL structures, especially the increased sp(2) clustering that provides additional conduction paths throughout the network. The introduction of nitrogen also improved the nanomechanical properties, resulting in enhanced elastic recovery, hardness, and elastic modulus, which is unusual but is most likely due to the onset of cross-linking of the network. Moreover, the materials' stress of N-DLC QSL structures was reduced with the nitrogen doping. In general, the combination of enhanced electron tunnel transport and nanomechanical properties in N-DLC QSL structures/devices can open a platform for the development of a new class of cost-effective and mechanically robust advanced electronic devices for a wide range of applications.
Nie, Laiyin; Grell, Ernst; Malviya, Viveka Nand; Xie, Hao; Wang, Jingkang; Michel, Hartmut
2016-01-01
Multidrug and toxic compound extrusion (MATE) transporters exist in all three domains of life. They confer multidrug resistance by utilizing H+ or Na+ electrochemical gradients to extrude various drugs across the cell membranes. The substrate binding and the transport mechanism of MATE transporters is a fundamental process but so far not fully understood. Here we report a detailed substrate binding study of NorM_PS, a representative MATE transporter from Pseudomonas stutzeri. Our results indicate that NorM_PS is a proton-dependent multidrug efflux transporter. Detailed binding studies between NorM_PS and 4′,6-diamidino-2-phenylindole (DAPI) were performed by isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectrofluorometry. Two exothermic binding events were observed from ITC data, and the high-affinity event was directly correlated with the extrusion of DAPI. The affinities are about 1 μm and 0.1 mm for the high and low affinity binding, respectively. Based on our homology model of NorM_PS, variants with mutations of amino acids that are potentially involved in substrate binding, were constructed. By carrying out the functional characterization of these variants, the critical amino acid residues (Glu-257 and Asp-373) for high-affinity DAPI binding were determined. Taken together, our results suggest a new substrate-binding site for MATE transporters. PMID:27235402
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giulliani, S. E.; Frank, A. E.; Collart, F. R.
2008-12-08
We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less
Balashov, Sergei P.; Imasheva, Eleonora S.; Dioumaev, Andrei K.; ...
2014-11-06
A group of microbial retinal proteins most closely related to the proton pump xanthorhodopsin has a novel sequence motif and a novel function. Instead of, or in addition to, proton transport, they perform light-driven sodium ion transport, as reported for one representative of this group (KR2) from Krokinobacter. In this paper, we examine a similar protein, GLR from Gillisia limnaea, expressed in Escherichia coli, which shares some properties with KR2 but transports only Na +. The absorption spectrum of GLR is insensitive to Na + at concentrations of ≤3 M. However, very low concentrations of Na + cause profound differencesmore » in the decay and rise time of photocycle intermediates, consistent with a switch from a “Na +-independent” to a “Na +-dependent” photocycle (or photocycle branch) at ~60 μM Na +. The rates of photocycle steps in the latter, but not the former, are linearly dependent on Na + concentration. This suggests that a high-affinity Na + binding site is created transiently after photoexcitation, and entry of Na + from the bulk to this site redirects the course of events in the remainder of the cycle. A greater concentration of Na + is needed for switching the reaction path at lower pH. The data suggest therefore competition between H + and Na + to determine the two alternative pathways. The idea that a Na + binding site can be created at the Schiff base counterion is supported by the finding that upon perturbation of this region in the D251E mutant, Na + binds without photoexcitation. Furthermore, binding of Na+ to the mutant shifts the chromophore maximum to the red like that of H +, which occurs in the photocycle of the wild type.« less
Cheng, Mary Hongying; Block, Ethan; Hu, Feizhuo; Cobanoglu, Murat Can; Sorkin, Alexander; Bahar, Ivet
2015-01-01
Human dopamine (DA) transporter (hDAT) regulates dopaminergic signaling in the central nervous system by maintaining the synaptic concentration of DA at physiological levels, upon reuptake of DA into presynaptic terminals. DA translocation involves the co-transport of two sodium ions and the channeling of a chloride ion, and it is achieved via alternating access between outward-facing (OF) and inward-facing states of DAT. hDAT is a target for addictive drugs, such as cocaine, amphetamine (AMPH), and therapeutic antidepressants. Our recent quantitative systems pharmacology study suggested that orphenadrine (ORPH), an anticholinergic agent and anti-Parkinson drug, might be repurposable as a DAT drug. Previous studies have shown that DAT-substrates like AMPH or -blockers like cocaine modulate the function of DAT in different ways. However, the molecular mechanisms of modulation remained elusive due to the lack of structural data on DAT. The newly resolved DAT structure from Drosophila melanogaster opens the way to a deeper understanding of the mechanism and time evolution of DAT–drug/ligand interactions. Using a combination of homology modeling, docking analysis, molecular dynamics simulations, and molecular biology experiments, we performed a comparative study of the binding properties of DA, AMPH, ORPH, and cocaine and their modulation of hDAT function. Simulations demonstrate that binding DA or AMPH drives a structural transition toward a functional form predisposed to translocate the ligand. In contrast, ORPH appears to inhibit DAT function by arresting it in the OF open conformation. The analysis shows that cocaine and ORPH competitively bind DAT, with the binding pose and affinity dependent on the conformational state of DAT. Further assays show that the effect of ORPH on DAT uptake and endocytosis is comparable to that of cocaine. PMID:26106364
DOE Office of Scientific and Technical Information (OSTI.GOV)
C Kantar; H Demiray; N Dogan
2011-12-31
Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kantar, C.; Dodge, C.; Demiray, H.
2011-01-26
Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less
Active and passive transport of cargo in a corrugated channel: A lattice model study
NASA Astrophysics Data System (ADS)
Dey, Supravat; Ching, Kevin; Das, Moumita
2018-04-01
Inside cells, cargos such as vesicles and organelles are transported by molecular motors to their correct locations via active motion on cytoskeletal tracks and passive, Brownian diffusion. During the transportation of cargos, motor-cargo complexes (MCCs) navigate the confining and crowded environment of the cytoskeletal network and other macromolecules. Motivated by this, we study a minimal two-state model of motor-driven cargo transport in confinement and predict transport properties that can be tested in experiments. We assume that the motion of the MCC is directly affected by the entropic barrier due to confinement if it is in the passive, unbound state but not in the active, bound state where it moves with a constant bound velocity. We construct a lattice model based on a Fokker Planck description of the two-state system, study it using a kinetic Monte Carlo method and compare our numerical results with analytical expressions for a mean field limit. We find that the effect of confinement strongly depends on the bound velocity and the binding kinetics of the MCC. Confinement effectively reduces the effective diffusivity and average velocity, except when it results in an enhanced average binding rate and thereby leads to a larger average velocity than when unconfined.
Pliotas, Christos; Grayer, Samuel C; Ekkerman, Silvia; Chan, Anthony K N; Healy, Jess; Marius, Phedra; Bartlett, Wendy; Khan, Amjad; Cortopassi, Wilian A; Chandler, Shane A; Rasmussen, Tim; Benesch, Justin L P; Paton, Robert S; Claridge, Timothy D W; Miller, Samantha; Booth, Ian R; Naismith, James H; Conway, Stuart J
2017-08-15
Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme-substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding.
2017-01-01
Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme–substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding. PMID:28656748
Cytoplasmic Dynein Regulation by Subunit Heterogeneity and Its Role in Apical Transport
Tai, Andrew W.; Chuang, Jen-Zen; Sung, Ching-Hwa
2001-01-01
Despite the existence of multiple subunit isoforms for the microtubule motor cytoplasmic dynein, it has not yet been directly shown that dynein complexes with different compositions exhibit different properties. The 14-kD dynein light chain Tctex-1, but not its homologue RP3, binds directly to rhodopsin's cytoplasmic COOH-terminal tail, which encodes an apical targeting determinant in polarized epithelial Madin-Darby canine kidney (MDCK) cells. We demonstrate that Tctex-1 and RP3 compete for binding to dynein intermediate chain and that overexpressed RP3 displaces endogenous Tctex-1 from dynein complexes in MDCK cells. Furthermore, replacement of Tctex-1 by RP3 selectively disrupts the translocation of rhodopsin to the MDCK apical surface. These results directly show that cytoplasmic dynein function can be regulated by its subunit composition and that cytoplasmic dynein is essential for at least one mode of apical transport in polarized epithelia. PMID:11425878
De novo design of a transmembrane Zn²⁺-transporting four-helix bundle.
Joh, Nathan H; Wang, Tuo; Bhate, Manasi P; Acharya, Rudresh; Wu, Yibing; Grabe, Michael; Hong, Mei; Grigoryan, Gevorg; DeGrado, William F
2014-12-19
The design of functional membrane proteins from first principles represents a grand challenge in chemistry and structural biology. Here, we report the design of a membrane-spanning, four-helical bundle that transports first-row transition metal ions Zn(2+) and Co(2+), but not Ca(2+), across membranes. The conduction path was designed to contain two di-metal binding sites that bind with negative cooperativity. X-ray crystallography and solid-state and solution nuclear magnetic resonance indicate that the overall helical bundle is formed from two tightly interacting pairs of helices, which form individual domains that interact weakly along a more dynamic interface. Vesicle flux experiments show that as Zn(2+) ions diffuse down their concentration gradients, protons are antiported. These experiments illustrate the feasibility of designing membrane proteins with predefined structural and dynamic properties. Copyright © 2014, American Association for the Advancement of Science.
Structure and Function of Caltrin (Calcium Transport Inhibitor) Proteins
Grasso, Ernesto Javier; Coronel, Carlos Enrique
2017-01-01
Caltrin (calcium transport inhibitor) is a family of small and basic proteins of the mammalian seminal plasma which bind to sperm cells during ejaculation and inhibit the extracellular Ca2+ uptake, preventing the premature acrosomal exocytosis and hyperactivation when sperm cells ascend through the female reproductive tract. The binding of caltrin proteins to specific areas of the sperm surface suggests the existence of caltrin receptors, or precise protein-phospholipid arrangements in the sperm membrane, distributed in the regions where Ca2+ influx may take place. However, the molecular mechanisms of recognition and interaction between caltrin and spermatozoa have not been elucidated. Therefore, the aim of this article is to describe in depth the known structural features and functional properties of caltrin proteins, to find out how they may possibly interact with the sperm membranes to control the intracellular signaling that trigger physiological events required for fertilization. PMID:29308010
The electronic transport properties of defected bilayer sliding armchair graphene nanoribbons
NASA Astrophysics Data System (ADS)
Mohammadi, Amin; Haji-Nasiri, Saeed
2018-04-01
By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of perfect and defected bilayer armchair graphene nanoribbons (BAGNRs) under finite bias. Two typical defects which are placed in the middle of top layer (i.e. single vacancy (SV) and stone wale (SW) defects) are examined. The results reveal that in both perfect and defected bilayers, the maximum current refers to β-AB, AA and α-AB stacking orders, respectively, since the intermolecular interactions are stronger in them. Moreover it is observed that a SV decreases the current in all stacking orders, but the effects of a SW defect is nearly unpredictable. Besides, we introduced a sequential switching behavior and the effects of defects on the switching performance is studied as well. We found that a SW defect can significantly improve the switching behavior of a bilayer system. Transmission spectrum, band structure, molecular energy spectrum and molecular projected self-consistent Hamiltonian (MPSH) are analyzed subsequently to understand the electronic transport properties of these bilayer devices which can be used in developing nano-scale bilayer systems.
Novoa, Alexandre; Van Dorpe, Sylvia; Wynendaele, Evelien; Spetea, Mariana; Bracke, Nathalie; Stalmans, Sofie; Betti, Cecilia; Chung, Nga N; Lemieux, Carole; Zuegg, Johannes; Cooper, Matthew A; Tourwé, Dirk; De Spiegeleer, Bart; Schiller, Peter W; Ballet, Steven
2012-11-26
The influence of the side chain charges of the second and fourth amino acid residues in the peptidic μ opioid lead agonist Dmt-d-Arg-Phe-Lys-NH(2) ([Dmt(1)]-DALDA) was examined. Additionally, to increase the overall lipophilicity of [Dmt(1)]-DALDA and to investigate the Phe(3) side chain flexibility, the final amide bond was N-methylated and Phe(3) was replaced by a constrained aminobenzazepine analogue. The in vitro receptor binding and activity of the peptides, as well as their in vivo transport (brain in- and efflux and tissue biodistribution) and antinociceptive properties after peripheral administration (ip and sc) in mice were determined. The structural modifications result in significant shifts of receptor binding, activity, and transport properties. Strikingly, while [Dmt(1)]-DALDA and its N-methyl analogue, Dmt-d-Arg-Phe-NMeLys-NH(2), showed a long-lasting antinociceptive effect (>7 h), the peptides with d-Cit(2) generate potent antinociception more rapidly (maximal effect at 1h postinjection) but also lose their analgesic activity faster when compared to [Dmt(1)]-DALDA and [Dmt(1),NMeLys(4)]-DALDA.
Novoa, Alexandre; Van Dorpe, Sylvia; Wynendaele, Evelien; Spetea, Mariana; Bracke, Nathalie; Stalmans, Sofie; Betti, Cecilia; Chung, Nga N.; Lemieux, Carole; Zuegg, Johannes; Cooper, Matthew A.; Tourwé, Dirk; De Spiegeleer, Bart; Schiller, Peter W.; Ballet, Steven
2012-01-01
The influence of the side chain charges of the second and fourth amino acid residues in the peptidic μ opioid lead agonist Dmt-D-Arg-Phe-Lys-NH2 ([Dmt1]-DALDA) was examined. Additionally, to increase the overall lipophilicity of [Dmt1]-DALDA and to investigate the Phe3 side chain flexibility, the final amide bond was N-methylated and Phe3 was replaced by a constrained aminobenzazepine analogue. The in vitro receptor binding and activity of the peptides, as well as their in vivo transport (brain in- and efflux and tissue biodistribution) and antinociceptive properties after peripheral administration (i.p. and s.c.) in mice were determined. The structural modifications result in significant shifts of receptor binding, activity and transport properties. Strikingly, while [Dmt1]-DALDA and its N-methyl analogue, Dmt-D-Arg-Phe-NMeLys-NH2, showed a long-lasting antinociceptive effect (>7h), the peptides with D-Cit2 generate potent antinociception more rapidly (maximal effect at 1h post-injection) but also lose their analgesic activity faster, when compared to [Dmt1]-DALDA and [Dmt1,NMeLys4]-DALDA. PMID:23102273
Borodin, Oleg; Smith, Grant D
2006-03-30
Classical many-body polarizable force fields were developed for n-alkanes, perflouroalkanes, polyethers, ketones, and linear and cyclic carbonates on the basis of quantum chemistry dimer energies of model compounds and empirical thermodynamic liquid-state properties. The dependence of the electron correlation contribution to the dimer binding energy on basis-set size and level of theory was investigated as a function of molecular separation for a number of alkane, ether, and ketone dimers. Molecular dynamics (MD) simulations of the force fields accurately predicted structural, dynamic, and transport properties of liquids and unentangled polymer melts. On average, gas-phase dimer binding energies predicted with the force field were between those from MP2/aug-cc-pvDz and MP2/aug-cc-pvTz quantum chemistry calculations.
Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins.
Cogliati, Clelia; Tomaselli, Simona; Assfalg, Michael; Pedò, Massimo; Ferranti, Pasquale; Zetta, Lucia; Molinari, Henriette; Ragona, Laura
2009-10-01
Bile acid-binding proteins (BABPs) are cytosolic lipid chaperones that play central roles in driving bile flow, as well as in the adaptation to various pathological conditions, contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Understanding the mode of binding of bile acids with their cytoplasmic transporters is a key issue in providing a model for the mechanism of their transfer from the cytoplasm to the nucleus, for delivery to nuclear receptors. A number of factors have been shown to modulate bile salt selectivity, stoichiometry, and affinity of binding to BABPs, e.g. chemistry of the ligand, protein plasticity and, possibly, the formation of disulfide bridges. Here, the effects of the presence of a naturally occurring disulfide bridge on liver BABP ligand-binding properties and backbone dynamics have been investigated by NMR. Interestingly, the disulfide bridge does not modify the protein-binding stoichiometry, but has a key role in modulating recognition at both sites, inducing site selectivity for glycocholic and glycochenodeoxycholic acid. Protein conformational changes following the introduction of a disulfide bridge are small and located around the inner binding site, whereas significant changes in backbone motions are observed for several residues distributed over the entire protein, both in the apo form and in the holo form. Site selectivity appears, therefore, to be dependent on protein mobility rather than being governed by steric factors. The detected properties further establish a parallelism with the behaviour of human ileal BABP, substantiating the proposal that BABPs have parallel functions in hepatocytes and enterocytes.
NASA Astrophysics Data System (ADS)
Zhao, Ming; Wang, Xuefeng; Nolte, David
2009-02-01
In solid-support immunoassays, the transport of target analyte in sample solution to capture molecules on the sensor surface controls the detected binding signal. Depletion of the target analyte in the sample solution adjacent to the sensor surface leads to deviations from ideal association, and causes inhomogeneity of surface binding as analyte concentration varies spatially across the sensor surface. In the field of label-free optical biosensing, studies of mass-transport-limited reaction kinetics have focused on the average response on the sensor surface, but have not addressed binding inhomogeneities caused by mass-transport limitations. In this paper, we employ Molecular Interferometric Imaging (MI2) to study mass-transport-induced inhomogeneity of analyte binding within a single protein spot. Rabbit IgG binding to immobilized protein A/G was imaged at various concentrations and under different flow rates. In the mass-transport-limited regime, enhanced binding at the edges of the protein spots was caused by depletion of analyte towards the center of the protein spots. The magnitude of the inhomogeneous response was a function of analyte reaction rate and sample flow rate.
Ojelabi, Ogooluwa A; Lloyd, Kenneth P; Simon, Andrew H; De Zutter, Julie K; Carruthers, Anthony
2016-12-23
WZB117 (2-fluoro-6-(m-hydroxybenzoyloxy) phenyl m-hydroxybenzoate) inhibits passive sugar transport in human erythrocytes and cancer cell lines and, by limiting glycolysis, inhibits tumor growth in mice. This study explores how WZB117 inhibits the erythrocyte sugar transporter glucose transport protein 1 (GLUT1) and examines the transporter isoform specificity of inhibition. WZB117 reversibly and competitively inhibits erythrocyte 3-O-methylglucose (3MG) uptake with K i (app) = 6 μm but is a noncompetitive inhibitor of sugar exit. Cytochalasin B (CB) is a reversible, noncompetitive inhibitor of 3MG uptake with K i (app) = 0.3 μm but is a competitive inhibitor of sugar exit indicating that WZB117 and CB bind at exofacial and endofacial sugar binding sites, respectively. WZB117 inhibition of GLUTs expressed in HEK293 cells follows the order of potency: insulin-regulated GLUT4 ≫ GLUT1 ≈ neuronal GLUT3. This may explain WZB117-induced murine lipodystrophy. Molecular docking suggests the following. 1) The WZB117 binding envelopes of exofacial GLUT1 and GLUT4 conformers differ significantly. 2) GLUT1 and GLUT4 exofacial conformers present multiple, adjacent glucose binding sites that overlap with WZB117 binding envelopes. 3) The GLUT1 exofacial conformer lacks a CB binding site. 4) The inward GLUT1 conformer presents overlapping endofacial WZB117, d-glucose, and CB binding envelopes. Interrogating the GLUT1 mechanism using WZB117 reveals that subsaturating WZB117 and CB stimulate erythrocyte 3MG uptake. Extracellular WZB117 does not affect CB binding to GLUT1, but intracellular WZB117 inhibits CB binding. These findings are incompatible with the alternating conformer carrier for glucose transport but are consistent with either a multisubunit, allosteric transporter, or a transporter in which each subunit presents multiple, interacting ligand binding sites. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Ojelabi, Ogooluwa A.; Lloyd, Kenneth P.; Simon, Andrew H.; De Zutter, Julie K.; Carruthers, Anthony
2016-01-01
WZB117 (2-fluoro-6-(m-hydroxybenzoyloxy) phenyl m-hydroxybenzoate) inhibits passive sugar transport in human erythrocytes and cancer cell lines and, by limiting glycolysis, inhibits tumor growth in mice. This study explores how WZB117 inhibits the erythrocyte sugar transporter glucose transport protein 1 (GLUT1) and examines the transporter isoform specificity of inhibition. WZB117 reversibly and competitively inhibits erythrocyte 3-O-methylglucose (3MG) uptake with Ki(app) = 6 μm but is a noncompetitive inhibitor of sugar exit. Cytochalasin B (CB) is a reversible, noncompetitive inhibitor of 3MG uptake with Ki(app) = 0.3 μm but is a competitive inhibitor of sugar exit indicating that WZB117 and CB bind at exofacial and endofacial sugar binding sites, respectively. WZB117 inhibition of GLUTs expressed in HEK293 cells follows the order of potency: insulin-regulated GLUT4 ≫ GLUT1 ≈ neuronal GLUT3. This may explain WZB117-induced murine lipodystrophy. Molecular docking suggests the following. 1) The WZB117 binding envelopes of exofacial GLUT1 and GLUT4 conformers differ significantly. 2) GLUT1 and GLUT4 exofacial conformers present multiple, adjacent glucose binding sites that overlap with WZB117 binding envelopes. 3) The GLUT1 exofacial conformer lacks a CB binding site. 4) The inward GLUT1 conformer presents overlapping endofacial WZB117, d-glucose, and CB binding envelopes. Interrogating the GLUT1 mechanism using WZB117 reveals that subsaturating WZB117 and CB stimulate erythrocyte 3MG uptake. Extracellular WZB117 does not affect CB binding to GLUT1, but intracellular WZB117 inhibits CB binding. These findings are incompatible with the alternating conformer carrier for glucose transport but are consistent with either a multisubunit, allosteric transporter, or a transporter in which each subunit presents multiple, interacting ligand binding sites. PMID:27836974
NASA Astrophysics Data System (ADS)
Pernet-Coudrier, Benoît; Companys, Encarnació; Galceran, Josep; Morey, Margalida; Mouchel, Jean-Marie; Puy, Jaume; Ruiz, Núria; Varrault, Gilles
2011-07-01
Dissolved organic matter (DOM) from the treated effluent of a wastewater treatment plant and from the river Seine under high human pressure has been separated into three fractions: hydrophobic (containing humic and fulvic substances), transphilic and hydrophilic using a two column array of XAD-8 and XAD-4 resins. The acid base properties and the binding characteristics with respect to Pb ions (using the new electroanalytical technique AGNES, Absence of Gradients and Nernstian Equilibrium Stripping) have been studied and fitted to NICA (Non-Ideal Competitive Isotherm). We evaluated the binding potential of each DOM fraction in order to better predict the speciation of Pb and, later, its bioavailability in the river. The total binding capacity of the different fractions to Pb, as well as the total titratable charge, reaches its maximum value at the most hydrophilic fraction from the treated effluent. Specific properties of the distribution of the complexing sites within each DOM fraction have been exposed by plotting the conditional affinity spectrum (CAS). The addition of these distributions, weighted according to the respective abundance of each organic fraction, allows for a full description of the Pb binding properties of the whole DOM of a sampling site. Despite its weak aromaticity, the hydrophilic fraction from the wastewater treatment plant effluent exhibits a high lead binding affinity, so that at typical environmental pH and free Pb levels (0.1 μg L -1), Pb is mainly bound to the most hydrophilic fraction of the treated effluent (49% of bound Pb at pH 7). This feature may greatly enhance the transport of Pb and highlights that Pb speciation should also consider other fractions apart from humic and/or fulvic acids when studying surface waters under high human pressure.
An incoherent feedforward loop facilitates adaptive tuning of gene expression.
Hong, Jungeui; Brandt, Nathan; Abdul-Rahman, Farah; Yang, Ally; Hughes, Tim; Gresham, David
2018-04-05
We studied adaptive evolution of gene expression using long-term experimental evolution of Saccharomyces cerevisiae in ammonium-limited chemostats. We found repeated selection for non-synonymous variation in the DNA binding domain of the transcriptional activator, GAT1, which functions with the repressor, DAL80 in an incoherent type-1 feedforward loop (I1-FFL) to control expression of the high affinity ammonium transporter gene, MEP2. Missense mutations in the DNA binding domain of GAT1 reduce its binding to the GATAA consensus sequence. However, we show experimentally, and using mathematical modeling, that decreases in GAT1 binding result in increased expression of MEP2 as a consequence of properties of I1-FFLs. Our results show that I1-FFLs, one of the most commonly occurring network motifs in transcriptional networks, can facilitate adaptive tuning of gene expression through modulation of transcription factor binding affinities. Our findings highlight the importance of gene regulatory architectures in the evolution of gene expression. © 2018, Hong et al.
Molecular Basis for Differential Anion Binding and Proton Coupling in the Cl−/H+ Exchanger ClC-ec1
Jiang, Tao; Han, Wei; Maduke, Merritt; Tajkhorshid, Emad
2016-01-01
Cl−/H+ transporters of the CLC superfamily form a ubiquitous class of membrane proteins that catalyze stoichiometrically coupled exchange of Cl− and H+ across biological membranes. CLC transporters exchange H+ for halides and certain polyatomic anions, but exclude cations, F−, and larger physiological anions, such as PO43− and SO42−. Despite comparable transport rates of different anions, the H+ coupling in CLC transporters varies significantly depending on the chemical nature of the transported anion. Although the molecular mechanism of exchange remains unknown, studies on bacterial ClC-ec1 transporter revealed that Cl− binding to the central anion-binding site (Scen) is crucial for the anion-coupled H+ transport. Here, we show that Cl−, F−, NO3−, and SCN− display distinct binding coordinations at the Scen site and are hydrated in different manners. Consistent with the observation of differential bindings, ClC-ec1 exhibits markedly variable ability to support the formation of the transient water wires, which are necessary to support the connection of the two H+ transfer sites (Gluin and Gluex), in the presence of different anions. While continuous water wires are frequently observed in the presence of physiologically transported Cl−, binding of F− or NO3− leads to the formation of pseudo-water-wires that are substantially different from the wires formed with Cl−. Binding of SCN−, however, eliminates the water wires altogether. These findings provide structural details of anion binding in ClC-ec1 and reveal a putative atomic-level mechanism for the decoupling of H+ transport to the transport of anions other than Cl−. PMID:26880377
Atabekova, Anastasia K; Pankratenko, Anna V; Makarova, Svetlana S; Lazareva, Ekaterina A; Owens, Robert A; Solovyev, Andrey G; Morozov, Sergey Y
2017-01-01
Human B-cell receptor-associated protein BAP31 (HsBAP31) is the endoplasmic reticulum-resident protein involved in protein sorting and transport as well as pro-apoptotic signaling. Plant orthologs of HsBAP31 termed 'plant BAP-like proteins' (PBL proteins) have thus far remained unstudied. Recently, the PBL protein from Nicotiana tabacum (NtPBL) was identified as an interactor of Nt-4/1, a plant protein known to interact with plant virus movement proteins and affect the long-distance transport of potato spindle tuber viroid (PSTVd) via the phloem. Here, we have compared the sequences of PBL proteins and studied the biochemical properties of NtPBL. Analysis of a number of fully sequenced plant genomes revealed that PBL-encoding genes represent a small multigene family with up to six members per genome. Two conserved motifs were identified in the C-terminal region of PBL proteins. The NtPBL C-terminal hydrophilic region (NtPBL-C) was expressed in bacterial cells, purified, and used for analysis of its RNA binding properties in vitro. In gel shift experiments, NtPBL-C was found to bind several tested RNAs, showing the most efficient binding to microRNA precursors (pre-miRNA) and less efficient interaction with PSTVd. Mutational analysis suggested that NtPBL-C has a composite RNA-binding site, with two conserved lysine residues in the most C-terminal protein region being involved in binding of pre-miRNA but not PSTVd RNA. Virus-mediated transient expression of NtPBL-C in plants resulted in stunting and leaf malformation, developmental abnormalities similar to those described previously for blockage of miRNA biogenesis/function. We hypothesize that the NtPBL protein represents a previously undiscovered component of the miRNA pathway. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Measuring the Valence of Nanocrystal Surfaces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Owen, Jonathan Scharle
2016-11-30
The goal of this project is to understand and control the interplay between nanocrystal stoichiometry, surface ligand binding and exchange, and the optoelectronic properties of semiconductor nanocrystals in solution and in thin solid films. We pursued three research directions with this goal in mind: 1) We characterized nanocrystal stoichiometry and its influence on the binding of L-type and X-type ligands, including the thermodynamics of binding and the kinetics of ligand exchange. 2) We developed a quantitative understanding of the relationship between surface ligand passivation and photoluminescence quantum yield. 3) We developed methods to replace the organic ligands on the nanocrystalmore » with halide ligands and controllably deposit these nanocrystals into thin films, where electrical measurements were used to investigate the electrical transport and internanocrystal electronic coupling.« less
Zhang, Jianhua; Chen, Yong; Qi, Jianxun; Gao, Feng; Liu, Yanjie; Liu, Jun; Zhou, Xuyu; Kaufman, Jim; Xia, Chun; Gao, George F.
2016-01-01
The major histocompatibility complex (MHC) has genetic associations with many diseases, often due to differences in presentation of antigenic peptides by polymorphic MHC molecules to T lymphocytes of the immune system. In chickens, only a single classical class I molecule in each MHC haplotype is expressed well due to co-evolution with the polymorphic transporters associated with antigen presentation (TAPs), which means that resistance and susceptibility to infectious pathogens are particularly easy to observe. Previously, structures of chicken MHC class I molecule BF2*2101 from B21 haplotype showed an unusually large peptide-binding groove that accommodates a broad spectrum of peptides to present as epitopes to cytotoxic T lymphocytes (CTL), explaining the MHC-determined resistance of B21 chickens to Marek's disease. Here, we report the crystal structure of BF2*0401 from the B4 (also known as B13) haplotype, showing a highly positively-charged surface hitherto unobserved in other MHC molecules, as well as a remarkably narrow groove due to the allele-specific residues with bulky side chains. Together, these properties limit the number of epitope peptides that can bind this class I molecule. However, peptide-binding assays show that in vitro BF2*0401 can bind a wider variety of peptides than are found on the surface of B4 cells. Thus, a combination of the specificities of the polymorphic TAP transporter and the MHC results in a very limited set of BF2*0401 peptides with negatively charged anchors to be presented to T lymphocytes. PMID:23041567
Ordway, Gregory A; Jia, Weihong; Li, Jing; Zhu, Meng-Yang; Mandela, Prashant; Pan, Jun
2005-04-30
Previous research has shown that exposure of norepinephrine transporter (NET)-expressing cells to desipramine (DMI) downregulates the norepinephrine transporter, although changes in the several transporter parameters do not demonstrate the same time course. Exposures to desipramine for <1 day reduces only radioligand binding and uptake capacity while transporter-immunoreactivity is unaffected. Recent demonstration of persistent drug retention in cells following desipramine exposures raises the possibility that previous reported changes in the norepinephrine transporter may be partly accountable by residual drug. In this study, potential effects of residual desipramine on norepinephrine transporter binding and uptake were re-evaluated following exposures of PC12 cells to desipramine using different methods to remove residual drug. Using a method that minimizes residual drug, exposure of intact PC12 cells to desipramine for 4h had no effect on uptake capacity or [(3)H]nisoxetine binding to the norepinephrine transporter, while exposures for > or =16 h reduced uptake capacity. Desipramine-induced reductions in binding to the transporter required >24 h or greater periods of desipramine exposure. This study confirms that uptake capacity of the norepinephrine transporter is reduced earlier than changes in radioligand binding, but with a different time course than originally shown. Special pre-incubation procedures are required to abolish effects of residual transporter inhibitor when studying inhibitor-induced transporter regulation.
NASA Astrophysics Data System (ADS)
Zhou, Chenyi; Guo, Hong
2017-01-01
We report a diagrammatic method to solve the general problem of calculating configurationally averaged Green's function correlators that appear in quantum transport theory for nanostructures containing disorder. The theory treats both equilibrium and nonequilibrium quantum statistics on an equal footing. Since random impurity scattering is a problem that cannot be solved exactly in a perturbative approach, we combine our diagrammatic method with the coherent potential approximation (CPA) so that a reliable closed-form solution can be obtained. Our theory not only ensures the internal consistency of the diagrams derived at different levels of the correlators but also satisfies a set of Ward-like identities that corroborate the conserving consistency of transport calculations within the formalism. The theory is applied to calculate the quantum transport properties such as average ac conductance and transmission moments of a disordered tight-binding model, and results are numerically verified to high precision by comparing to the exact solutions obtained from enumerating all possible disorder configurations. Our formalism can be employed to predict transport properties of a wide variety of physical systems where disorder scattering is important.
Slavic, Ksenija; Derbyshire, Elvira T; Naftalin, Richard J; Krishna, Sanjeev; Staines, Henry M
2009-11-01
Here we have investigated the inhibitory properties of green tea catechins on the Plasmodium falciparum hexose transporter (PfHT), the Babesia bovis hexose transporter 1 (BboHT1) and the mammalian facilitative glucose transporters, GLUT1 and GLUT5, expressed in Xenopus laevis oocytes. (-)-Epicatechin-gallate (ECG) and (-)-epigallocatechin-gallate (EGCG) inhibited D-glucose transport by GLUT1 and PfHT, and D-fructose transport by GLUT5, with apparent K(i) values between 45 and 117 microM. BboHT1 was more potently inhibited by the ungallated catechins (-)-epicatechin (EC) and (-)-epigallocatechin (EGC), with apparent K(i) values of 108 and 168 microM, respectively. Site-directed mutagenesis experiments provided little further support for previously reported models of catechin binding to hexose transporters. Furthermore, P. falciparum growth inhibition by catechins was not affected by the external D-glucose concentration. Our results provide new data on the inhibitory action of catechins against sugar transporters but were unable to elucidate the antimalarial mechanism of action of these agents.
Study of polymer molecules and conformations with a nanopore
Golovchenko, Jene A.; Li, Jiali; Stein, Derek; Gershow, Marc H.
2013-03-12
The invention features methods for evaluating the conformation of a polymer, for example, for determining the conformational distribution of a plurality of polymers and to detect binding or denaturation events. The methods employ a nanopore which the polymer, e.g., a nucleic acid, traverses. As the polymer traverses the nanopore, measurements of transport properties of the nanopore yield data on the conformation of the polymer.
Study of polymer molecules and conformations with a nanopore
Golovchenko, Jene A.; Li, Jiali; Stein, Derek; Gershow, Marc H.
2010-12-07
The invention features methods for evaluating the conformation of a polymer, for example, for determining the conformational distribution of a plurality of polymers and to detect binding or denaturation events. The methods employ a nanopore which the polymer, e.g., a nucleic acid, traverses. As the polymer traverses the nanopore, measurements of transport properties of the nanopore yield data on the conformation of the polymer.
Study of polymer molecules and conformations with a nanopore
Golovchenko, Jene A; Li, Jiali; Stein, Derek; Gershow, Marc H
2015-03-03
The invention features methods for evaluating the conformation of a polymer, for example, for determining the conformational distribution of a plurality of polymers and to detect binding or denaturation events. The methods employ a nanopore which the polymer, e.g., a nucleic acid, traverses. As the polymer traverses the nanopore, measurements of transport properties of the nanopore yield data on the conformation of the polymer.
Determinants of cation transport selectivity: Equilibrium binding and transport kinetics
2015-01-01
The crystal structures of channels and transporters reveal the chemical nature of ion-binding sites and, thereby, constrain mechanistic models for their transport processes. However, these structures, in and of themselves, do not reveal equilibrium selectivity or transport preferences, which can be discerned only from various functional assays. In this Review, I explore the relationship between cation transport protein structures, equilibrium binding measurements, and ion transport selectivity. The primary focus is on K+-selective channels and nonselective cation channels because they have been extensively studied both functionally and structurally, but the principles discussed are relevant to other transport proteins and molecules. PMID:26078056
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Keyes, Joseph T.; Simon, Bruce R.; Vande Geest, Jonathan P.
2013-01-01
Purpose Arterial wall mass transport properties dictate local distribution of biomolecules or locally delivered dugs. Knowing how these properties vary between coronary artery locations could provide insight into how therapy efficacy is altered between arterial locations. Methods We introduced an indocarbocyanine drug surrogate to the lumens of left anterior descending and right coronary (LADC; RC) arteries from pigs with or without a pressure gradient. Interstitial fluorescent intensity was measured on live samples with multiphoton microscopy. We also measured binding to porcine coronary SMCs in monoculture. Results Diffusive transport constants peaked in the middle sections of the LADC and RC arteries by 2.09 and 2.04 times, respectively, compared to the proximal and distal segments. There was no statistical difference between the average diffusivity value between LADC and RC arteries. The convection coefficients had an upward trend down each artery, with the RC being higher than the LADC by 3.89 times. Conclusions This study demonstrates that the convective and diffusive transport of lipophilic molecules changes between the LADC and the RC arteries as well as along their length. These results may have important implications in optimizing drug delivery for the treatment of coronary artery disease. PMID:23224981
Recent insights into the biological functions of liver fatty acid binding protein 1
Wang, GuQi; Bonkovsky, Herbert L.; de Lemos, Andrew; Burczynski, Frank J.
2015-01-01
Over four decades have passed since liver fatty acid binding protein (FABP)1 was first isolated. There are few protein families for which most of the complete tertiary structures, binding properties, and tissue occurrences are described in such detail and yet new functions are being uncovered for this protein. FABP1 is known to be critical for fatty acid uptake and intracellular transport and also has an important role in regulating lipid metabolism and cellular signaling pathways. FABP1 is an important endogenous cytoprotectant, minimizing hepatocyte oxidative damage and interfering with ischemia-reperfusion and other hepatic injuries. The protein may be targeted for metabolic activation through the cross-talk among many transcriptional factors and their activating ligands. Deficiency or malfunction of FABP1 has been reported in several diseases. FABP1 also influences cell proliferation during liver regeneration and may be considered as a prognostic factor for hepatic surgery. FABP1 binds and modulates the action of many molecules such as fatty acids, heme, and other metalloporphyrins. The ability to bind heme is another cytoprotective property and one that deserves closer investigation. The role of FABP1 in substrate availability and in protection from oxidative stress suggests that FABP1 plays a pivotal role during intracellular bacterial/viral infections by reducing inflammation and the adverse effects of starvation (energy deficiency). PMID:26443794
Henke, Sarah K; Cronan, John E
2016-11-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.
Ab-initio study of structural, electronic, and transport properties of zigzag GaP nanotubes.
Srivastava, Anurag; Jain, Sumit Kumar; Khare, Purnima Swarup
2014-03-01
Stability and electronic properties of zigzag (3 ≤ n ≤ 16) gallium phosphide nanotubes (GaP NTs) have been analyzed by employing a systematic ab-intio approach based on density functional theory using generalized gradient approximation with revised Perdew Burke Ernzerhoff type parameterization. Diameter dependence of bond length, buckling, binding energy, and band gap has been investigated and the analysis shows that the bond length and buckling decreases with increasing diameter of the tube, highest binding energy of (16, 0) confirms this as the most stable amongst all the NTs taken into consideration. The present GaP NTs shows direct band gap and it increases with diameter of the tubes. Using a two probe model for (4, 0) NT the I-V relationship shows an exponential increase in current on applying bias voltage beyond 1.73 volt.
Binding, uptake, and transport of hypericin by Caco-2 cell monolayers.
Sattler, S; Schaefer, U; Schneider, W; Hoelzl, J; Lehr, C M
1997-10-01
The biological evaluation of hypericin in various test models is hampered by its very poor water solubility. In the present study cyclodextrin formulations and liposomal preparations were investigated for improved delivery and solubility of hypericin in aqueous buffer systems. Caco-2 cells, grown to tight monolayers on 96-well tissue culture plates as well as on Transwell polycarbonate filters, were used to study the membrane binding and the epithelial transport of hypericin. Cumulative transport of hypericin, which could not be measured without the use of cyclodextrins, in apical-to-basolateral direction from cyclodextrin-hypericin buffer solutions was 3-5% at 37 degrees C and approximately 0.12% at 4 degrees C after 5 h. After an incubation time of 1 h at 37 and 4 degrees C, 12.7% +/- 2.6% and 6.5% +/- 0.8%, respectively, of hypericin were found to be bound to or taken up by Caco-2 cells. Liposomal formulations markedly increased the solubility of hypericin in Krebs-Ringer buffer, but there was no effect observed on the binding and transport of hypericin delivered by liposomes in the Caco-2 cell model. Due to the fluorescence properties of hypericin, its interaction with the cells could be visualized by confocal laser scanning microscopy. The results indicate that a significant accumulation of the drug in the cell membrane and the cell nucleus membrane takes place. We conclude that hypericin is absorbed through the intestinal epithelium by passive transcellular diffusion and that increasing its solubility by cyclodextrin appears as a promising approach to increase its oral bioavailability for pharmaceutical formulations.
Hoffart, E; Ghebreghiorghis, L; Nussler, AK; Thasler, WE; Weiss, TS; Schwab, M; Burk, O
2012-01-01
BACKGROUND AND PURPOSE Atorvastatin metabolites differ in their potential for drug interaction because of differential inhibition of drug-metabolizing enzymes and transporters. We here investigate whether they exert differential effects on the induction of these genes via activation of pregnane X receptor (PXR) and constitutive androstane receptor (CAR). EXPERIMENTAL APPROACH Ligand binding to PXR or CAR was analysed by mammalian two-hybrid assembly and promoter/reporter gene assays. Additionally, surface plasmon resonance was used to analyse ligand binding to CAR. Primary human hepatocytes were treated with atorvastatin metabolites, and mRNA and protein expression of PXR-regulated genes was measured. Two-hybrid co-activator interaction and co-repressor release assays were utilized to elucidate the molecular mechanism of PXR activation. KEY RESULTS All atorvastatin metabolites induced the assembly of PXR and activated CYP3A4 promoter activity. Ligand binding to CAR could not be proven. In primary human hepatocytes, the para-hydroxy metabolite markedly reduced or abolished induction of cytochrome P450 and transporter genes. While significant differences in co-activator recruitment were not observed, para-hydroxy atorvastatin demonstrated only 50% release of co-repressors. CONCLUSIONS AND IMPLICATIONS Atorvastatin metabolites are ligands of PXR but not of CAR. Atorvastatin metabolites demonstrate differential induction of PXR target genes, which results from impaired release of co-repressors. Consequently, the properties of drug metabolites have to be taken into account when analysing PXR-dependent induction of drug metabolism and transport. The drug interaction potential of the active metabolite, para-hydroxy atorvastatin, might be lower than that of the parent compound. PMID:21913896
Neumeyer, Tobias; Schiffler, Bettina; Maier, Elke; Lang, Alexander E; Aktories, Klaus; Benz, Roland
2008-02-15
Clostridium botulinum C2 toxin belongs to the family of binary AB type toxins that are structurally organized into distinct enzyme (A, C2I) and binding (B, C2II) components. The proteolytically activated 60-kDa C2II binding component is essential for C2I transport into target cells. It oligomerizes into heptamers and forms channels in lipid bilayer membranes. The C2II channel is cation-selective and can be blocked by chloroquine and related compounds. Residues 303-330 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which has been implicated in the formation of two amphipathic beta-strands involved in membrane insertion and channel formation. In the present study, C2II mutants created by substitution of different negatively charged amino acids by alanine-scanning mutagenesis were analyzed in artificial lipid bilayer membranes. The results suggested that most of the C2II mutants formed SDS-resistant oligomers (heptamers) similar to wild type. The mutated negatively charged amino acids did not influence channel properties with the exception of Glu(399) and Asp(426), which are probably localized in the vestibule near the channel entrance. These mutants show a dramatic decrease in their affinity for binding of chloroquine and its analogues. Similarly, F428A, which represents the Phi-clamp in anthrax protective antigen, was mutated in C2II in several other amino acids. The C2II mutants F428A, F428D, F428Y, and F428W not only showed altered chloroquine binding but also had drastically changed single channel properties. The results suggest that amino acids Glu(399), Asp(426), and Phe(428) have a major impact on the function of C2II as a binding protein for C2I delivery into target cells.
Fibrin structural and diffusional analysis suggests that fibers are permeable to solute transport.
Leonidakis, Kimon Alexandros; Bhattacharya, Pinaki; Patterson, Jennifer; Vos, Bart E; Koenderink, Gijsje H; Vermant, Jan; Lambrechts, Dennis; Roeffaers, Maarten; Van Oosterwyck, Hans
2017-01-01
Fibrin hydrogels are promising carrier materials in tissue engineering. They are biocompatible and easy to prepare, they can bind growth factors and they can be prepared from a patient's own blood. While fibrin structure and mechanics have been extensively studied, not much is known about the relation between structure and diffusivity of solutes within the network. This is particularly relevant for solutes with a size similar to that of growth factors. A novel methodological approach has been used in this study to retrieve quantitative structural characteristics of fibrin hydrogels, by combining two complementary techniques, namely confocal fluorescence microscopy with a fiber extraction algorithm and turbidity measurements. Bulk rheological measurements were conducted to determine the impact of fibrin hydrogel structure on mechanical properties. From these measurements it can be concluded that variations in the fibrin hydrogel structure have a large impact on the rheological response of the hydrogels (up to two orders of magnitude difference in storage modulus) but only a moderate influence on the diffusivity of dextran solutes (up to 25% difference). By analyzing the diffusivity measurements by means of the Ogston diffusion model we further provide evidence that individual fibrin fibers can be semi-permeable to solute transport, depending on the average distance between individual protofibrils. This can be important for reducing mass transport limitations, for modulating fibrinolysis and for growth factor binding, which are all relevant for tissue engineering. Fibrin is a natural biopolymer that has drawn much interest as a biomimetic carrier in tissue engineering applications. We hereby use a novel combined approach for the structural characterization of fibrin networks based on optical microscopy and light scattering methods that can also be applied to other fibrillar hydrogels, like collagen. Furthermore, our findings on the relation between solute transport and fibrin structural properties can lead to the optimized design of fibrin hydrogel constructs for controlled release applications. Finally, we provide new evidence for the fact that fibrin fibers may be permeable for solutes with a molecular weight comparable to that of growth factors. This finding may open new avenues for tailoring mass transport properties of fibrin carriers. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Thermodynamic and Kinetic Properties of Metal Hydrides from First-Principles Calculations
NASA Astrophysics Data System (ADS)
Michel, Kyle Jay
In an effort to minimize the worldwide dependence on fossil fuels, much research has focused on the development of hydrogen fuel cell vehicles. Among the many challenges currently facing the transition to such an alternative energy economy is the storage of hydrogen in an economical and practical way. One class of materials that has presented itself as a possible candidate is solid metal hydrides. These materials chemically bind hydrogen and on heating, release the gas which can then be used to generate power as needed for the vehicle. In order to meet guidelines that have been set for such a storage system, hydrogen must be released rapidly in a narrow temperature range of -40 to 80°C with all reactions being reversible. This sets both thermodynamic and kinetic requirements for the design of candidate metal hydrides. First-principles calculations are well-suited for the task of exploring reactions involving metal hydrides. Here, density-functional theory is used to calculate properties of these materials at the quantum mechanical level of accuracy. In particular, three systems have been investigated: 1. Li-Mg-N-H. Reactions between all known compounds in this system are systematically investigated in order to predict thermodynamically allowed reactions that release hydrogen. The properties of these reactions are compared to the requirements set for hydrogen storage systems. Additionally, ground-state structures are predicted for Li2Mg(NH)2 and Li 4Mg(NH)3. 2. Na-Al-H. The kinetics of mass transport during the (de)hydrogenation of the well-known metal hydride NaAlH4 are investigated. A model is developed to study the flux of native defects through phases involved in these reactions. Since it is also known that titanium is an effective catalyst for both dehydrogenation and rehydrogenation, the effect of Ti substitution in bulk lattices on the kinetics of mass transport is investigated. Results are compared to experiments in order to determine if mass transport represents the rate-limiting process during de- or rehydrogenation and what the effect of Ti may be. 3. Si-H. Properties of the recently synthesized compound SiH4(H 2)2 are investigated. Under high pressures, hydrogen binding to SiH4 exhibits characteristics of both physical and chemical bonds. A ground-state structure is predicted for this phase and the vibrational and bonding properties are investigated in order to determine the origin of the unusual binding between H2 and SiH4.
Schein, Jessica R; Hunt, Kevin A; Minton, Janet A; Schultes, Neil P; Mourad, George S
2013-09-01
The single cell alga Chlamydomonas reinhardtii is capable of importing purines as nitrogen sources. An analysis of the annotated C. reinhardtii genome reveals at least three distinct gene families encoding for known nucleobase transporters. In this study the solute transport and binding properties for the lone C. reinhardtii nucleobase cation symporter 1 (CrNCS1) are determined through heterologous expression in Saccharomyces cerevisiae. CrNCS1 acts as a transporter of adenine, guanine, uracil and allantoin, sharing similar - but not identical - solute recognition specificity with the evolutionary distant NCS1 from Arabidopsis thaliana. The results suggest that the solute specificity for plant NCS1 occurred early in plant evolution and are distinct from solute transport specificities of single cell fungal NCS1 proteins. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
The Antibiotic Novobiocin Binds and Activates the ATPase That Powers Lipopolysaccharide Transport.
May, Janine M; Owens, Tristan W; Mandler, Michael D; Simpson, Brent W; Lazarus, Michael B; Sherman, David J; Davis, Rebecca M; Okuda, Suguru; Massefski, Walter; Ruiz, Natividad; Kahne, Daniel
2017-12-06
Novobiocin is an orally active antibiotic that inhibits DNA gyrase by binding the ATP-binding site in the ATPase subunit. Although effective against Gram-positive pathogens, novobiocin has limited activity against Gram-negative organisms due to the presence of the lipopolysaccharide-containing outer membrane, which acts as a permeability barrier. Using a novobiocin-sensitive Escherichia coli strain with a leaky outer membrane, we identified a mutant with increased resistance to novobiocin. Unexpectedly, the mutation that increases novobiocin resistance was not found to alter gyrase, but the ATPase that powers lipopolysaccharide (LPS) transport. Co-crystal structures, biochemical, and genetic evidence show novobiocin directly binds this ATPase. Novobiocin does not bind the ATP binding site but rather the interface between the ATPase subunits and the transmembrane subunits of the LPS transporter. This interaction increases the activity of the LPS transporter, which in turn alters the permeability of the outer membrane. We propose that novobiocin will be a useful tool for understanding how ATP hydrolysis is coupled to LPS transport.
Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten
2016-11-01
Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.
Eaton, James R. O.; Alenazi, Yara; Singh, Kamayani; Davies, Graham; Geis-Asteggiante, Lucia; Kessler, Benedikt; Robinson, Carol V.; Kawamura, Akane; Bhattacharya, Shoumo
2018-01-01
Tick chemokine-binding proteins (evasins) are an emerging class of biologicals that target multiple chemokines and show anti-inflammatory activities in preclinical disease models. Using yeast surface display, we identified a CCL8-binding evasin, P672, from the tick Rhipicephalus pulchellus. We found that P672 binds CCL8 and eight other CC-class chemokines with a Kd < 10 nm and four other CC chemokines with a Kd between 10 and 100 nm and neutralizes CCL3, CCL3L1, and CCL8 with an IC50 < 10 nm. The CC chemokine–binding profile was distinct from that of evasin 1 (EVA1), which does not bind CCL8. We also show that P672's binding activity can be markedly modulated by the location of a StrepII-His purification tag. Combining native MS and bottom-up proteomics, we further demonstrated that P672 is glycosylated and forms a 1:1 complex with CCL8, disrupting CCL8 homodimerization. Homology modeling of P672 using the crystal structure of the EVA1 and CCL3 complex as template suggested that 44 N-terminal residues of P672 form most of the contacts with CCL8. Replacing the 29 N-terminal residues of EVA1 with the 44 N-terminal residues of P672 enabled this hybrid evasin to bind and neutralize CCL8, indicating that the CCL8-binding properties of P672 reside, in part, in its N-terminal residues. This study shows that the function of certain tick evasins can be manipulated simply by adding a tag. We conclude that homology modeling helps identify regions with transportable chemokine-binding functions within evasins, which can be used to construct hybrid evasins with altered properties. PMID:29487134
Fu, Meng-Meng; Nirschl, Jeffrey J; Holzbaur, Erika L F
2014-06-09
Autophagy is essential for maintaining cellular homeostasis in neurons, where autophagosomes undergo robust unidirectional retrograde transport along axons. We find that the motor scaffolding protein JIP1 binds directly to the autophagosome adaptor LC3 via a conserved LIR motif. This interaction is required for the initial exit of autophagosomes from the distal axon, for sustained retrograde transport along the midaxon, and for autophagosomal maturation in the proximal axon. JIP1 binds directly to the dynein activator dynactin but also binds to and activates kinesin-1 in a phosphorylation-dependent manner. Following JIP1 depletion, phosphodeficient JIP1-S421A rescues retrograde transport, while phosphomimetic JIP1-S421D aberrantly activates anterograde transport. During normal autophagosome transport, residue S421 of JIP1 may be maintained in a dephosphorylated state by autophagosome-associated MKP1 phosphatase. Moreover, binding of LC3 to JIP1 competitively disrupts JIP1-mediated activation of kinesin. Thus, dual mechanisms prevent aberrant activation of kinesin to ensure robust retrograde transport of autophagosomes along the axon. Copyright © 2014 Elsevier Inc. All rights reserved.
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen
2016-07-30
Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.
Noor, Sina Ibne; Dietz, Steffen; Heidtmann, Hella; Boone, Christopher D.; McKenna, Robert; Deitmer, Joachim W.; Becker, Holger M.
2015-01-01
Proton-coupled monocarboxylate transporters (MCTs) mediate the exchange of high energy metabolites like lactate between different cells and tissues. We have reported previously that carbonic anhydrase II augments transport activity of MCT1 and MCT4 by a noncatalytic mechanism, while leaving transport activity of MCT2 unaltered. In the present study, we combined electrophysiological measurements in Xenopus oocytes and pulldown experiments to analyze the direct interaction between carbonic anhydrase II (CAII) and MCT1, MCT2, and MCT4, respectively. Transport activity of MCT2-WT, which lacks a putative CAII-binding site, is not augmented by CAII. However, introduction of a CAII-binding site into the C terminus of MCT2 resulted in CAII-mediated facilitation of MCT2 transport activity. Interestingly, introduction of three glutamic acid residues alone was not sufficient to establish a direct interaction between MCT2 and CAII, but the cluster had to be arranged in a fashion that allowed access to the binding moiety in CAII. We further demonstrate that functional interaction between MCT4 and CAII requires direct binding of the enzyme to the acidic cluster 431EEE in the C terminus of MCT4 in a similar fashion as previously shown for binding of CAII to the cluster 489EEE in the C terminus of MCT1. In CAII, binding to MCT1 and MCT4 is mediated by a histidine residue at position 64. Taken together, our results suggest that facilitation of MCT transport activity by CAII requires direct binding between histidine 64 in CAII and a cluster of glutamic acid residues in the C terminus of the transporter that has to be positioned in surroundings that allow access to CAII. PMID:25561737
Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site
Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.
2015-01-01
Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702
NASA Astrophysics Data System (ADS)
Hammouri, Mahmoud
Perovskite oxides such as lead zirconate titanate, lanthanum manganite and two dimensional, atomically thick materials such as graphene, carbon nanotubes, graphene nanoribbon, and transition-metal dichalcogenides (TMDs) received intensive attention due to their electronic, magnetic, and transport properties. Understanding the properties and structure of these materials in solid state is a longstanding scientific challenge, especially for experimentalists. Using state-of-the-art density functional theory, different properties can be explained with an excellent match with experiments. This thesis presents an Ab initio density functional theory study of the electronic, magnetic, and transport properties of nanostructure systems. Nanostructures studied in this thesis include graphene, carbon nanotubes, graphene nanoribbons, zirconium disulfide, and La0.67Sr0.33MnO3/PbZr 02 Ti0.8O3 (LSMO/PZT) (100) interface. I investigated the mechanism of chemical functionalization of the side walls of carbon nanotubes by benzyne molecules. Binding energies, geometries, and electronic structure changes due to this functionalization are examined in detail. The binding energies between benzyne molecules and carbon nanotubes are found to be inversely proportional to nanotube diameter. We also studied the properties of graphene nanoribbons under compressions. Our study showed that the band gaps of graphene nanoribbons were strongly affected by applied compression. In addition, we found that the effect of compression has a strong influence on the IV-characteristic. We also investigated the effect of uniaxial strain on the electronic and magnetic properties of zirconium disulfide nanoribbons. Our calculation showed that the magnetization of zirconium disulfide nanoribbons can be switched on and off by the applied strain. In the last part, we studied the properties of the interface between two perovskite oxides, lead zirconate titanate and lanthanum strontium manganite. Our study demonstrated that the magnetoelectric coupling observed at this interface can be explained by the magnetic reconstruction of lanthanum strontium manganite.
Brain serotonin and dopamine transporter bindings in adults with high-functioning autism.
Nakamura, Kazuhiko; Sekine, Yoshimoto; Ouchi, Yasuomi; Tsujii, Masatsugu; Yoshikawa, Etsuji; Futatsubashi, Masami; Tsuchiya, Kenji J; Sugihara, Genichi; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Suda, Shiro; Sugiyama, Toshiro; Takei, Nori; Mori, Norio
2010-01-01
Autism is a neurodevelopmental disorder that is characterized by repetitive and/or obsessive interests and behavior and by deficits in sociability and communication. Although its neurobiological underpinnings are postulated to lie in abnormalities of the serotoninergic and dopaminergic systems, the details remain unknown. To determine the occurrence of changes in the binding of serotonin and dopamine transporters, which are highly selective markers for their respective neuronal systems. Using positron emission tomography, we measured the binding of brain serotonin and dopamine transporters in each individual with the radioligands carbon 11 ((11)C)-labeled trans-1,2,3,5,6,10-beta-hexahydro-6-[4-(methylthio)phenyl]pyrrolo-[2,1-a]isoquinoline ([(11)C](+)McN-5652) and 2beta-carbomethoxy-3-beta-(4-fluorophenyl)tropane ([(11)C]WIN-35,428), respectively. Statistical parametric mapping was used for between-subject analysis and within-subject correlation analysis with respect to clinical variables. Participants recruited from the community. Twenty men (age range, 18-26 years; mean [SD] IQ, 99.3 [18.1]) with autism and 20 age- and IQ-matched control subjects. Serotonin transporter binding was significantly lower throughout the brain in autistic individuals compared with controls (P < .05, corrected). Specifically, the reduction in the anterior and posterior cingulate cortices was associated with the impairment of social cognition in the autistic subjects (P < .05, corrected). A significant correlation was also found between repetitive and/or obsessive behavior and interests and the reduction of serotonin transporter binding in the thalamus (P < .05, corrected). In contrast, the dopamine transporter binding was significantly higher in the orbitofrontal cortex of the autistic group (P < .05, corrected in voxelwise analysis). In the orbitofrontal cortex, the dopamine transporter binding was significantly inversely correlated with serotonin transporter binding (r = -0.61; P = .004). The brains of autistic individuals have abnormalities in both serotonin transporter and dopamine transporter binding. The present findings indicate that the gross abnormalities in these neurotransmitter systems may underpin the neurophysiologic mechanism of autism. Our sample was not characteristic or representative of a typical sample of adults with autism in the community.
Transport properties in dilute UN (X ) solid solutions (X =Xe ,Kr )
NASA Astrophysics Data System (ADS)
Claisse, Antoine; Schuler, Thomas; Lopes, Denise Adorno; Olsson, Pär
2016-11-01
Uranium nitride (UN) is a candidate fuel for current GEN III fission reactors, for which it is investigated as an accident-tolerant fuel, as well as for future GEN IV reactors. In this study, we investigate the kinetic properties of gas fission products (Xe and Kr) in UN. Binding and migration energies are obtained using density functional theory, with an added Hubbard correlation to model f electrons, and the occupation matrix control scheme to avoid metastable states. These energies are then used as input for the self-consistent mean field method which enables to determine transport coefficients for vacancy-mediated diffusion of Xe and Kr on the U sublattice. The magnetic ordering of the UN structure is explicitly taken into account, for both energetic and transport properties. Solute diffusivities are compared with experimental measurements and the effect of various parameters on the theoretical model is carefully investigated. We find that kinetic correlations are very strong in this system, and that despite atomic migration anisotropy, macroscopic solute diffusivities show limited anisotropy. Our model indicates that the discrepancy between experimental measurements probably results from different irradiation conditions, and hence different defect concentrations.
NASA Astrophysics Data System (ADS)
Nazirfakhr, Maryam; Shahhoseini, Ali
2018-03-01
By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of H-terminated zigzag graphene nanoribbon (H/ZGNR) and O-terminated ZGNR/H-terminated ZGNR (O/ZGNR-H/ZGNR) heterostructure under finite bias. Moreover, the effect of width and symmetry on the electronic transport properties of both models is also considered. The results reveal that asymmetric H/ZGNRs have linear I-V characteristics in whole bias range, but symmetric H-ZGNRs show negative differential resistance (NDR) behavior which is inversely proportional to the width of the H/ZGNR. It is also shown that the I-V characteristic of O/ZGNR-H/ZGNR heterostructure shows a rectification effect, whether the geometrical structure is symmetric or asymmetric. The fewer the number of zigzag chains, the bigger the rectification ratio. It should be mentioned that, the rectification ratios of symmetric heterostructures are much bigger than asymmetric one. Transmission spectrum, density of states (DOS), molecular projected self-consistent Hamiltonian (MPSH) and molecular eigenstates are analyzed subsequently to understand the electronic transport properties of these ZGNR devices. Our findings could be used in developing nanoscale rectifiers and NDR devices.
Na+ Interactions with the Neutral Amino Acid Transporter ASCT1*
Scopelliti, Amanda J.; Heinzelmann, Germano; Kuyucak, Serdar; Ryan, Renae M.; Vandenberg, Robert J.
2014-01-01
The alanine, serine, cysteine transporters (ASCTs) belong to the solute carrier family 1A (SLC1A), which also includes the excitatory amino acid transporters (EAATs) and the prokaryotic aspartate transporter GltPh. Acidic amino acid transport by the EAATs is coupled to the co-transport of three Na+ ions and one proton, and the counter-transport of one K+ ion. In contrast, neutral amino acid exchange by the ASCTs does not require protons or the counter-transport of K+ ions and the number of Na+ ions required is not well established. One property common to SLC1A family members is a substrate-activated anion conductance. We have investigated the number and location of Na+ ions required by ASCT1 by mutating residues in ASCT1 that correspond to residues in the EAATs and GltPh that are involved in Na+ binding. Mutations to all three proposed Na+ sites influence the binding of substrate and/or Na+, or the rate of substrate exchange. A G422S mutation near the Na2 site reduced Na+ affinity, without affecting the rate of exchange. D467T and D467A mutations in the Na1 site reduce Na+ and substrate affinity and also the rate of substrate exchange. T124A and D380A mutations in the Na3 site selectively reduce the affinity for Na+ and the rate of substrate exchange without affecting substrate affinity. In many of the mutants that reduce the rate of substrate transport the amplitudes of the substrate-activated anion conductances are not substantially affected indicating altered ion dependence for channel activation compared with substrate exchange. PMID:24808181
2017-01-01
Biological chelating molecules called siderophores are used to sequester iron and maintain its ferric state. Bacterial substrate-binding proteins (SBPs) bind iron–siderophore complexes and deliver these complexes to ATP-binding cassette (ABC) transporters for import into the cytoplasm, where the iron can be transferred from the siderophore to catalytic enzymes. In Yersinia pestis, the causative agent of plague, the Yersinia iron-uptake (Yiu) ABC transporter has been shown to improve iron acquisition under iron-chelated conditions. The Yiu transporter has been proposed to be an iron–siderophore transporter; however, the precise siderophore substrate is unknown. Therefore, the precise role of the Yiu transporter in Y. pestis survival remains uncharacterized. To better understand the function of the Yiu transporter, the crystal structure of YiuA (YPO1310/y2875), an SBP which functions to present the iron–siderophore substrate to the transporter for import into the cytoplasm, was determined. The 2.20 and 1.77 Å resolution X-ray crystal structures reveal a basic triad binding motif at the YiuA canonical substrate-binding site, indicative of a metal-chelate binding site. Structural alignment and computational docking studies support the function of YiuA in binding chelated metal. Additionally, YiuA contains two mobile helices, helix 5 and helix 10, that undergo 2–3 Å shifts across crystal forms and demonstrate structural breathing of the c-clamp architecture. The flexibility in both c-clamp lobes suggest that YiuA substrate transfer resembles the Venus flytrap mechanism that has been proposed for other SBPs. PMID:29095164
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
The Structure of a Cyanobacterial Bicarbonate Transport Protein, CmpA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koropatkin, Nicole M.; Koppenaal, David W.; Pakrasi, Himadri B.
2007-01-26
Cyanobacteria, blue-green algae, are the most abundant autotrophs in aquatic environments and form the base of the food chain by fixing carbon and nitrogen into cellular biomass. To compensate for the low selectivity of Rubisco for CO₂ over O₂, Cyanobacteria have developed highly efficient CO₂concentrating machinery of which the ABC transport system CmpABCD from Synechocystis PCC 6803 is one component. Here we describe the structure of the bicarbonate binding protein, CmpA, in the absence and presence of bicarbonate and carbonic acid. CmpA is highly homologous to the nitrate transport protein, NrtA. CmpA binds carbonic acid at the entrance to themore » ligand-binding pocket whereas bicarbonate binds in nearly an identical location compared to nitrate binding to NrtA. Unexpectedly, bicarbonate binding is accompanied by a metal ion, identified as Ca²⁺ via inductively coupled plasma optical emission spectrometry. The binding of bicarbonate and metal is highly cooperative and suggests that CmpA co-transports bicarbonate and calcium.« less
ABC transporters and immunity: mechanism of self-defense.
Hinz, Andreas; Tampé, Robert
2012-06-26
The transporter associated with antigen processing (TAP) is a prototype of an asymmetric ATP-binding cassette (ABC) transporter, which uses ATP binding and hydrolysis to translocate peptides from the cytosol to the lumen of the endoplasmic reticulum (ER). Here, we review molecular details of peptide binding and ATP binding and hydrolysis as well as the resulting allosteric cross-talk between the nucleotide-binding domains and the transmembrane domains that drive translocation of the solute across the ER membrane. We also discuss the general molecular architecture of ABC transporters and demonstrate the importance of structural and functional studies for a better understanding of the role of the noncanonical site of asymmetric ABC transporters. Several aspects of peptide binding and specificity illustrate details of peptide translocation by TAP. Furthermore, this ABC transporter forms the central part of the major histocompatibility complex class I (MHC I) peptide-loading machinery. Hence, TAP is confronted with a number of viral factors, which prevent antigen translocation and MHC I loading in virally infected cells. We review how these viral factors have been used as molecular tools to decipher mechanistic aspects of solute translocation and discuss how they can help in the structural analysis of TAP.
Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.
Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J
2018-03-21
Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.
Addition of lysophospholipids with large head groups to cells inhibits Shiga toxin binding.
Ailte, Ieva; Lingelem, Anne Berit Dyve; Kavaliauskiene, Simona; Bergan, Jonas; Kvalvaag, Audun Sverre; Myrann, Anne-Grethe; Skotland, Tore; Sandvig, Kirsten
2016-07-26
Shiga toxin (Stx), an AB5 toxin, binds specifically to the neutral glycosphingolipid Gb3 at the cell surface before being transported into cells. We here demonstrate that addition of conical lysophospholipids (LPLs) with large head groups inhibit Stx binding to cells whereas LPLs with small head groups do not. Lysophosphatidylinositol (LPI 18:0), the most efficient LPL with the largest head group, was selected for in-depth investigations to study how the binding of Stx is regulated. We show that the inhibition of Stx binding by LPI is reversible and possibly regulated by cholesterol since addition of methyl-β-cyclodextrin (mβCD) reversed the ability of LPI to inhibit binding. LPI-induced inhibition of Stx binding is independent of signalling and membrane turnover as it occurs in fixed cells as well as after depletion of cellular ATP. Furthermore, data obtained with fluorescent membrane dyes suggest that LPI treatment has a direct effect on plasma membrane lipid packing with shift towards a liquid disordered phase in the outer leaflet, while lysophosphoethanolamine (LPE), which has a small head group, does not. In conclusion, our data show that cellular treatment with conical LPLs with large head groups changes intrinsic properties of the plasma membrane and modulates Stx binding to Gb3.
Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh
Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar
2011-01-01
Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736
Deng, Ge; Dyroff, Samantha L; Lockart, Molly; Bowman, Michael K; Vincent, John B
2016-11-01
Chromium (III) has been shown to act as a pharmacological agent improving insulin sensitivity in rodent models of obesity, insulin resistance, and diabetes. To act in beneficial fashion, chromium must reach insulin-sensitive tissues. Chromium is transported from the bloodstream to the tissues by the iron-transport protein transferrin. When blood concentrations of glucose are high (as in a diabetic subject), transferrin can be glycated, modifying its ability to bind and transport iron. However, the effects of glycation of transferrin on its ability to bind and transport Cr have not been examined previously. Storage of transferrin at 37°C in the presence and absence of glucose has significant effects on the binding of Cr. Transferrin stored in the absence of glucose only binds one equivalent of Cr tightly, compared to the normal binding of two equivalents of Cr by transferrin. Glycated transferrin (stored in the presence of glucose) binds two equivalents of Cr but the changes in its extinction coefficient at 245nm that accompany binding suggest that the Cr-bound transferrin possesses a conformation that deviates appreciably from untreated transferrin. These changes have dramatic effects, greatly reducing the ability of transferrin to transport Cr in vivo in rats. The results suggest that glycation of transferrin in subjects with high blood glucose concentrations should reduce the ability of Cr from pharmacological agents to enter tissues. Copyright © 2016 Elsevier Inc. All rights reserved.
Structural and immunologic characterization of bovine, horse, and rabbit serum albumins
Majorek, Karolina A.; Porebski, Przemyslaw J.; Dayal, Arjun; Zimmerman, Matthew D.; Jablonska, Kamila; Stewart, Alan J.; Chruszcz, Maksymilian; Minor, Wladek
2012-01-01
Serum albumin (SA) is the most abundant plasma protein in mammals. SA is a multifunctional protein with extraordinary ligand binding capacity, making it a transporter molecule for a diverse range of metabolites, drugs, nutrients, metals and other molecules. Due to its ligand binding properties, albumins have wide clinical, pharmaceutical, and biochemical applications. Albumins are also allergenic, and exhibit a high degree of cross-reactivity due to significant sequence and structure similarity of SAs from different organisms. Here we present crystal structures of albumins from cattle (BSA), horse (ESA) and rabbit (RSA) serums. The structural data are correlated with the results of immunological studies of SAs. We also analyze the conservation or divergence of structures and sequences of SAs in the context of their potential allergenicity and cross-reactivity. In addition, we identified a previously uncharacterized ligand binding site in the structure of RSA, and calcium binding sites in the structure of BSA, which is the first serum albumin structure to contain metal ions. PMID:22677715
Ion transport across the exocrine glands of the frog skin.
Mills, J W
1985-01-01
Exposure of the intact frog skin to beta-adrenergic agonists stimulates chloride secretion by the exocrine glands. The secretory response is dependent on Na in the serosal bath and is inhibited by exposure to ouabain and furosemide. Thus the transport mechanism has properties similar to those described for other exocrine glands. Analysis of 3H-ouabain binding sites and determination of intracellular ions by energy dispersive x-ray microanalysis indicates that the transepithelial pathway for Cl flux may be via a distinct group of cells located at the ductal pole of the acinus of two of the gland types; termed mucous and seromucous.
NASA Astrophysics Data System (ADS)
Honson, Nicolette S.; Plettner, Erika
2006-06-01
Males of the gypsy moth, Lymantria dispar, are attracted by a pheromone released by females. Pheromones are detected by olfactory neurons housed in specialized sensory hairs located on the antennae of the male moth. Once pheromone molecules enter the sensilla lymph, a highly abundant pheromone-binding protein (PBP) transports the molecule to the sensory neuron. The PBPs are members of the insect odorant-binding protein family, with six conserved cysteine residues. In this study, the disulfide bond connectivities of the pheromone-binding proteins PBP1 and PBP2 from the gypsy moth were found to be cysteines 19-54, 50-109, and 97-118 for PBP1, and cysteines 19-54, 50-110, and 97-119 for PBP2, as determined by cyanylation reactions and cyanogen bromide chemical cleavage. We have discovered that the second disulfide linkage is the most easily reduced of the three, and this same linkage is missing among four cysteine-containing insect odorant-binding proteins (OBPs). We are the first to identify the unique steric and electronic properties of this second disulfide linkage.
Human granulocyte/pollen-binding protein. Recognition and identification as transferrin.
Sass-Kuhn, S P; Moqbel, R; Mackay, J A; Cromwell, O; Kay, A B
1984-01-01
Normal human serum was found to contain a heat-stable protein which promoted the binding of granulocytes to timothy grass pollen (granulocyte/pollen-binding protein [GPBP]). GPBP was purified by gel filtration, anion exchange, and affinity chromatography. Virtually all of the granulocyte/pollen-binding activity was associated with a beta-1-protein having a molecular mass of approximately 77,000 D and an isoelectric point of between 5.5 and 6.1. By immunoelectrophoresis and sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the protein was identified as transferrin. Monospecific antisera raised against either GPBP or transferrin removed biological activity from GPBP preparations, and GPBP and transferrin gave lines of identity with these two antisera. The apparent heterogeneity in the molecular size and charge of GPBP observed during progressive purification was minimal when GPBP was saturated with ferric ions before the separation procedures. These experiments indicate that granulocyte/pollen binding is a hitherto unrecognized property of transferrin which appears to be unrelated to iron transport and raises the possibility that transferrin might have a physiological role in the removal of certain organic matter. Images PMID:6690479
A Model for Predicting Thermoelectric Properties of Bi2Te3
NASA Technical Reports Server (NTRS)
Lee, Seungwon; VonAllmen, Paul
2009-01-01
A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.
Pérez-Victoria, José M.; Pérez-Victoria, F. Javier; Conseil, Gwenaëlle; Maitrejean, Mathias; Comte, Gilles; Barron, Denis; Di Pietro, Attilio; Castanys, Santiago; Gamarro, Francisco
2001-01-01
In order to overcome the multidrug resistance mediated by P-glycoprotein-like transporters in Leishmania spp., we have studied the effects produced by derivatives of the flavanolignan silybin and related compounds lacking the monolignol unit on (i) the affinity of binding to a recombinant C-terminal nucleotide-binding domain of the L. tropica P-glycoprotein-like transporter and (ii) the sensitization to daunomycin on promastigote forms of a multidrug-resistant L. tropica line overexpressing the transporter. Oxidation of the flavanonol silybin to the corresponding flavonol dehydrosilybin, the presence of the monolignol unit, and the addition of a hydrophobic substituent such as dimethylallyl, especially at position 8 of ring A, considerably increased the binding affinity. The in vitro binding affinity of these compounds for the recombinant cytosolic domain correlated with their modulation of drug resistance phenotype. In particular, 8-(3,3-dimethylallyl)-dehydrosilybin effectively sensitized multidrug-resistant Leishmania spp. to daunomycin. The cytosolic domains are therefore attractive targets for the rational design of inhibitors against P-glycoprotein-like transporters. PMID:11158738
The mechanistic basis for noncompetitive ibogaine inhibition of serotonin and dopamine transporters.
Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H; Sandtner, Walter
2012-05-25
Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study.
The Mechanistic Basis for Noncompetitive Ibogaine Inhibition of Serotonin and Dopamine Transporters*
Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W.; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H.; Sandtner, Walter
2012-01-01
Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study. PMID:22451652
Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K
2016-10-01
Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue expression patterns should help predict net flux in a particular tissue of anionic, cationic, and zwitterionic molecules in normal and pathophysiological states. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Liu, Henry C.; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T.; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben
2016-01-01
Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 “drug” transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach—which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue expression patterns should help predict net flux in a particular tissue of anionic, cationic, and zwitterionic molecules in normal and pathophysiological states. PMID:27488918
Slavic, Ksenija; Derbyshire, Elvira T.; Naftalin, Richard J.; Krishna, Sanjeev; Staines, Henry M.
2009-01-01
Here we have investigated the inhibitory properties of green tea catechins on the Plasmodium falciparum hexose transporter (PfHT), the Babesia bovis hexose transporter 1 (BboHT1) and the mammalian facilitative glucose transporters, GLUT1 and GLUT5, expressed in Xenopus laevis oocytes. (−)-Epicatechin-gallate (ECG) and (−)-epigallocatechin-gallate (EGCG) inhibited d-glucose transport by GLUT1 and PfHT, and d-fructose transport by GLUT5, with apparent Ki values between 45 and 117 μM. BboHT1 was more potently inhibited by the ungallated catechins (−)-epicatechin (EC) and (−)-epigallocatechin (EGC), with apparent Ki values of 108 and 168 μM, respectively. Site-directed mutagenesis experiments provided little further support for previously reported models of catechin binding to hexose transporters. Furthermore, P. falciparum growth inhibition by catechins was not affected by the external d-glucose concentration. Our results provide new data on the inhibitory action of catechins against sugar transporters but were unable to elucidate the antimalarial mechanism of action of these agents. PMID:19577593
Role of Annular Lipids in the Functional Properties of Leucine Transporter LeuT Proteomicelles.
LeVine, Michael V; Khelashvili, George; Shi, Lei; Quick, Matthias; Javitch, Jonathan A; Weinstein, Harel
2016-02-16
Recent work has shown that the choice of the type and concentration of detergent used for the solubilization of membrane proteins can strongly influence the results of functional experiments. In particular, the amino acid transporter LeuT can bind two substrate molecules in low concentrations of n-dodecyl β-d-maltopyranoside (DDM), whereas high concentrations reduce the molar binding stoichiometry to 1:1. Subsequent molecular dynamics (MD) simulations of LeuT in DDM proteomicelles revealed that DDM can penetrate to the extracellular vestibule and make stable contacts in the functionally important secondary substrate binding site (S2), suggesting a potential competitive mechanism for the reduction in binding stoichiometry. Because annular lipids can be retained during solubilization, we performed MD simulations of LeuT proteomicelles at various stages of the solubilization process. We find that at low DDM concentrations, lipids are retained around the protein and penetration of detergent into the S2 site does not occur, whereas at high concentrations, lipids are displaced and the probability of DDM binding in the S2 site is increased. This behavior is dependent on the type of detergent, however, as we find in the simulations that the detergent lauryl maltose-neopentyl glycol, which is approximately twice the size of DDM and structurally more closely resembles lipids, does not penetrate the protein even at very high concentrations. We present functional studies that confirm the computational findings, emphasizing the need for careful consideration of experimental conditions, and for cautious interpretation of data in gathering mechanistic information about membrane proteins.
Role of Annular Lipids in the Functional Properties of Leucine Transporter LeuT Proteomicelles
2016-01-01
Recent work has shown that the choice of the type and concentration of detergent used for the solubilization of membrane proteins can strongly influence the results of functional experiments. In particular, the amino acid transporter LeuT can bind two substrate molecules in low concentrations of n-dodecyl β-d-maltopyranoside (DDM), whereas high concentrations reduce the molar binding stoichiometry to 1:1. Subsequent molecular dynamics (MD) simulations of LeuT in DDM proteomicelles revealed that DDM can penetrate to the extracellular vestibule and make stable contacts in the functionally important secondary substrate binding site (S2), suggesting a potential competitive mechanism for the reduction in binding stoichiometry. Because annular lipids can be retained during solubilization, we performed MD simulations of LeuT proteomicelles at various stages of the solubilization process. We find that at low DDM concentrations, lipids are retained around the protein and penetration of detergent into the S2 site does not occur, whereas at high concentrations, lipids are displaced and the probability of DDM binding in the S2 site is increased. This behavior is dependent on the type of detergent, however, as we find in the simulations that the detergent lauryl maltose-neopentyl glycol, which is approximately twice the size of DDM and structurally more closely resembles lipids, does not penetrate the protein even at very high concentrations. We present functional studies that confirm the computational findings, emphasizing the need for careful consideration of experimental conditions, and for cautious interpretation of data in gathering mechanistic information about membrane proteins. PMID:26811944
Solutions of burnt-bridge models for molecular motor transport.
Morozov, Alexander Yu; Pronina, Ekaterina; Kolomeisky, Anatoly B; Artyomov, Maxim N
2007-03-01
Transport of molecular motors, stimulated by interactions with specific links between consecutive binding sites (called "bridges"), is investigated theoretically by analyzing discrete-state stochastic "burnt-bridge" models. When an unbiased diffusing particle crosses the bridge, the link can be destroyed ("burned") with a probability p , creating a biased directed motion for the particle. It is shown that for probability of burning p=1 the system can be mapped into a one-dimensional single-particle hopping model along the periodic infinite lattice that allows one to calculate exactly all dynamic properties. For the general case of p<1 a theoretical method is developed and dynamic properties are computed explicitly. Discrete-time and continuous-time dynamics for periodic distribution of bridges and different burning dynamics are analyzed and compared. Analytical predictions are supported by extensive Monte Carlo computer simulations. Theoretical results are applied for analysis of the experiments on collagenase motor proteins.
Molecular Dynamics Studies of Structure and Functions of Water-Membrane Interfaces
NASA Technical Reports Server (NTRS)
Pohorille, Andrew; Wilson, Michael A.; DeVincenzi, Donald L. (Technical Monitor)
2001-01-01
A large number of essential cellular processes occur at the interfaces between water and membranes. The selectivity and dynamics of these processes are largely determined by the structural and electrical properties of the water-membrane interface. We investigate these properties by the molecular dynamics method. Over the time scales of the simulations, the membrane undergoes fluctuations described by the capillary wave model. These fluctuations produce occasional thinning defects in the membrane which provide effective pathways for passive transport of ions and small molecules across the membrane. Ions moving through the membrane markedly disrupt its structure and allow for significant water penetration into the membrane interior. Selectivity of transport, with respect to ionic charge, is determined by the interfacial electrostatic potential. Many small molecules. of potential significance in catalysis, bioenergetics and pharmacology, are shown to bind to the interface. The energetics and dynamics of this process will be discussed.
Exact Solutions of Burnt-Bridge Models for Molecular Motor Transport
NASA Astrophysics Data System (ADS)
Morozov, Alexander; Pronina, Ekaterina; Kolomeisky, Anatoly; Artyomov, Maxim
2007-03-01
Transport of molecular motors, stimulated by interactions with specific links between consecutive binding sites (called ``bridges''), is investigated theoretically by analyzing discrete-state stochastic ``burnt-bridge'' models. When an unbiased diffusing particle crosses the bridge, the link can be destroyed (``burned'') with a probability p, creating a biased directed motion for the particle. It is shown that for probability of burning p=1 the system can be mapped into one-dimensional single-particle hopping model along the periodic infinite lattice that allows one to calculate exactly all dynamic properties. For general case of p<1 a new theoretical method is developed, and dynamic properties are computed explicitly. Discrete-time and continuous-time dynamics, periodic and random distribution of bridges and different burning dynamics are analyzed and compared. Theoretical predictions are supported by extensive Monte Carlo computer simulations. Theoretical results are applied for analysis of the experiments on collagenase motor proteins.
Solutions of burnt-bridge models for molecular motor transport
NASA Astrophysics Data System (ADS)
Morozov, Alexander Yu.; Pronina, Ekaterina; Kolomeisky, Anatoly B.; Artyomov, Maxim N.
2007-03-01
Transport of molecular motors, stimulated by interactions with specific links between consecutive binding sites (called “bridges”), is investigated theoretically by analyzing discrete-state stochastic “burnt-bridge” models. When an unbiased diffusing particle crosses the bridge, the link can be destroyed (“burned”) with a probability p , creating a biased directed motion for the particle. It is shown that for probability of burning p=1 the system can be mapped into a one-dimensional single-particle hopping model along the periodic infinite lattice that allows one to calculate exactly all dynamic properties. For the general case of p<1 a theoretical method is developed and dynamic properties are computed explicitly. Discrete-time and continuous-time dynamics for periodic distribution of bridges and different burning dynamics are analyzed and compared. Analytical predictions are supported by extensive Monte Carlo computer simulations. Theoretical results are applied for analysis of the experiments on collagenase motor proteins.
Unified modelling of the thermoelectric properties in SrTiO3
NASA Astrophysics Data System (ADS)
Bouzerar, G.; Thébaud, S.; Adessi, Ch.; Debord, R.; Apreutesei, M.; Bachelet, R.; Pailhès, S.
2017-06-01
Thermoelectric materials are opening a promising pathway to address energy conversion issues governed by a competition between thermal and electronic transport. Improving the efficiency is a difficult task, a challenge that requires new strategies to unearth optimized compounds. We present a theory of thermoelectric transport in electron-doped SrTiO3, based on a realistic tight-binding model that includes relevant scattering processes. We compare our calculations against a wide panel of experimental data, both bulk and thin films. We find a qualitative and quantitative agreement over both a wide range of temperatures and carrier concentrations, from light to heavily doped. Moreover, the results appear insensitive to the nature of the dopant La, B, Gd and Nb. Thus, the quantitative success found in the case of SrTiO3, reveals an efficient procedure to explore new routes to improve the thermoelectric properties in oxides.
Bao, Huan; Duong, Franck
2013-08-16
The signal-transducing protein EIIA(Glc) belongs to the phosphoenolpyruvate carbohydrate phosphotransferase system. In its dephosphorylated state, EIIA(Glc) is a negative regulator for several permeases, including the maltose transporter MalFGK2. How EIIA(Glc) is targeted to the membrane, how it interacts with the transporter, and how it inhibits sugar uptake remain obscure. We show here that acidic phospholipids together with the N-terminal tail of EIIA(Glc) are essential for the high affinity binding of the protein to the transporter. Using protein docking prediction and chemical cross-linking, we demonstrate that EIIA(Glc) binds to the MalK dimer, interacting with both the nucleotide-binding and the C-terminal regulatory domains. Dissection of the ATPase cycle reveals that EIIA(Glc) does not affect the binding of ATP but rather inhibits the capacity of MalK to cleave ATP. We propose a mechanism of maltose transport inhibition by this central amphitropic regulatory protein.
Tao, Zhen; Zhang, Zhou; Grewer, Christof
2008-01-01
Substrate transport by the plasma membrane glutamate transporter EAAC1 is coupled to cotransport of three sodium ions. One of these Na+ ions binds to the transporter already in the absence of glutamate. Here, we have investigated the possible involvement of two conserved aspartic acid residues in transmembrane segments 7 and 8 of EAAC1, D367 and D454, in Na+ cotransport. In order to test the effect of charge neutralization mutations in these positions on Na+ binding to the glutamate-free transporter, we recorded the Na+-induced anion leak current to determine the Km of EAAC1 for Na+. For EAAC1WT, this Km was determined as 120 mM. When the negative charge of D367 was neutralized by mutagenesis to asparagine, Na+ activated the anion leak current with a Km of about 2 M, indicating dramatically impaired Na+ binding to the mutant transporter. In contrast, the Na+ affinity of EAAC1D454N was virtually unchanged compared to the wild type transporter (Km = 90 mM). The reduced occupancy of the Na+ binding site of EAAC1D367N resulted in a dramatic reduction in glutamate affinity (Km = 3.6 mM, 140 mM [Na+]), which could be partially overcome by increasing extracellular [Na+]. In addition to impairing Na+ binding, the D367N mutation slowed glutamate transport, as shown by pre-steady-state kinetic analysis of transport currents, by strongly decreasing the rate of a reaction step associated with glutamate translocation. Our data are consistent with a model in which D367, but not D454 is involved in coordinating the bound Na+ in the glutamate-free transporter form. PMID:16478724
Coppola, Daniela; Abbruzzetti, Stefania; Nicoletti, Francesco; Merlino, Antonello; Gambacurta, Alessandra; Giordano, Daniela; Howes, Barry D; De Sanctis, Giampiero; Vitagliano, Luigi; Bruno, Stefano; di Prisco, Guido; Mazzarella, Lelio; Smulevich, Giulietta; Coletta, Massimo; Viappiani, Cristiano; Vergara, Alessandro; Verde, Cinzia
2012-10-30
The major haemoglobin of the sub-Antarctic fish Eleginops maclovinus was structurally and functionally characterised with the aim to compare molecular environmental adaptations in the O(2)-transport system of sub-Antarctic fishes of the suborder Notothenioidei with those of their high-latitude relatives. Ligand-binding kinetics of the major haemoglobin of E. maclovinus indicated strong stabilisation of the liganded quaternary T state, enhanced in the presence of the physiological allosteric effector ATP, compared to that of high-Antarctic Trematomus bernacchii. The activation enthalpy for O(2) dissociation was dramatically lower than that in T. bernacchii haemoglobin, suggesting remarkable differences in temperature sensitivity and structural changes associated with O(2) release and exit from the protein. The haemoglobin functional properties, together with the X-ray structure of the CO form at 1.49 Å resolution, the first of a temperate notothenioid, strongly support the hypothesis that in E. maclovinus, whose life-style varies according to changes in habitat, the mechanisms that regulate O(2) affinity and the ATP-induced Root effect differ from those of high-Antarctic Notothenioids.
Sugimoto, Yumi; Kajiwara, Yoshinobu; Hirano, Kazufumi; Yamada, Shizuo; Tagawa, Noriko; Kobayashi, Yoshiharu; Hotta, Yoshihiro; Yamada, Jun
2008-09-11
Strain differences in immobility time in the forced swimming test were investigated in five strains of mice, namely, ICR, ddY, C57BL/6, DBA/2 and BALB/c mice. There were significant strain differences. The immobility times of ICR, ddY and C57BL/6 mice were longer than those of DBA/2 and BALB/c mice. Immobility times were not significantly related to locomotor activity in these strains. There were also differences in sensitivity to the selective serotonin reuptake inhibitor (SSRI) fluvoxamine. In ICR, ddY and C57BL/6 mice, fluvoxamine did not affect immobility time, while it reduced the immobility time of DBA/2 and BALB/c mice dose-dependently. The noradrenaline reuptake inhibitor desipramine decreased immobility time in all strains of mice. Serotonin (5-HT) transporter binding in the brains of all five strains of mice was also investigated. Analysis of 5-HT transporter binding revealed significant strain differences, being lower in DBA/2 and BALB/c mice than in other strains of mice. The amount of 5-HT transporter binding was correlated to baseline immobility time. However, there was no significant relation between noradrenaline transporter binding and immobility time. These results suggest that the duration of baseline immobility depends on the levels of 5-HT transporter binding, leading to apparent strain differences in immobility time in the forced swimming test. Furthermore, differences in 5-HT transporter binding may cause variations in responses to fluvoxamine.
Abdel-Malak, Rania; Ahearn, Gregory A
2014-03-01
Effects of luminal Ca(2+) and Mn(2+) on transmural mucosal to serosal (MS) transport of (3) H-L-leucine were characterized in the isolated and perfused intestine of the American lobster, Homarus americanus. (3) H-L-leucine MS transport in the presence of 20 µM Mn(2+) was a sigmoidal function of luminal amino acid concentration, following the Hill equation for multisite cooperative, carrier-mediated, transport. Luminal Ca(2+) was a non-competitive inhibitor of Mn(2+) -stimulated (3) H-L-leucine MS flux. Amino acid transport was hyperbolically stimulated by luminal Ca(2+) or Mn(2+). During 20 µM Mn(2+) -stimulation of (3) H-L-leucine MS flux, addition of 25 mM Ca(2+) strongly reduced amino acid transport Jmax , without affecting amino acid binding properties. Hyperbolic luminal Mn(2+) stimulation of 20 µM (3) H-L-leucine MS flux was also strongly inhibited by 25 mM luminal Ca(2+) , significantly reducing 20 µM (3) H-L-leucine Jmax . Increasing the luminal concentration of verapamil, a calcium channel blocker, significantly increased MS transport of 20 µM (3) H-L-leucine in the presence of 100 nM Mn(2+) by reducing diffusional Ca(2+) uptake into intestinal epithelial cells through verapamil-sensitive channels. A model is proposed supporting the concept of molecular mimicry, whereby (3) H-L-leucine enters lobster intestinal epithelial cells by one or more amino acid-specific transporters and by a dipeptide-like transporter that is capable of binding and transporting peptide molecular mimics (bis-complexes) between Ca(2+) or Mn(2+) and (3) H-L-leucine using the membrane potential as a major driving force for the transport event. According to the model, Ca(2+) entry through apical Ca(2+) channels regulates the magnitude of the membrane potential and therefore the size of the driving force for bis-complex uptake. © 2013 Wiley Periodicals, Inc.
Tuning transport properties on graphene multiterminal structures by mechanical deformations
NASA Astrophysics Data System (ADS)
Latge, Andrea; Torres, Vanessa; Faria, Daiara
The realization of mechanical strain on graphene structures is viewed as a promise route to tune electronic and transport properties such as changing energy band-gaps and promoting localization of states. Using continuum models, mechanical deformations are described by effective gauge fields, mirrored as pseudomagnetic fields that may reach quite high values. Interesting symmetry features are developed due to out of plane deformations on graphene; lift sublattice symmetry was predicted and observed in centrosymmetric bumps and strained nanobubbles. Here we discuss the effects of Gaussian-like strain on a hexagonal graphene flake connected to three leads, modeled as perfect graphene nanoribbons. The Green function formalism is used within a tight-binding approximation. For this particular deformation sharp resonant states are achieved depending on the strained structure details. We also study a fold-strained structure in which the three leads are deformed extending up to the very center of the hexagonal flake. We show that conductance suppressions can be controlled by the strain intensity and important transport features are modeled by the electronic band structure of the leads.
NASA Astrophysics Data System (ADS)
Andelković, M.; Covaci, L.; Peeters, F. M.
2018-03-01
The in-plane dc conductivity of twisted bilayer graphene is calculated using an expansion of the real-space Kubo-Bastin conductivity in terms of Chebyshev polynomials. We investigate within a tight-binding approach the transport properties as a function of rotation angle, applied perpendicular electric field, and vacancy disorder. We find that for high-angle twists, the two layers are effectively decoupled, and the minimum conductivity at the Dirac point corresponds to double the value observed in monolayer graphene. This remains valid even in the presence of vacancies, hinting that chiral symmetry is still preserved. On the contrary, for low twist angles, the conductivity at the Dirac point depends on the twist angle and is not protected in the presence of disorder. Furthermore, for low angles and in the presence of an applied electric field, we find that the chiral boundary states emerging between AB and BA regions contribute to the dc conductivity, despite the appearance of localized states in the AA regions. The results agree qualitatively with recent transport experiments in low-angle twisted bilayer graphene.
Tamoxifen protects male mice nigrostriatal dopamine against methamphetamine-induced toxicity.
Bourque, Mélanie; Liu, Bin; Dluzen, Dean E; Di Paolo, Thérèse
2007-11-01
The selective estrogen receptor modulator tamoxifen and estradiol were shown to protect nigrostriatal dopamine concentration loss by methamphetamine in female mice whereas male mice were protected only by tamoxifen. The present study examined the protective properties of tamoxifen in male mice on several nigrostriatal dopaminergic markers and body temperature. Intact male mice were administered 12.5 or 50 microg tamoxifen 24 h before methamphetamine treatment. Basal body temperatures of male mice remained unchanged by the tamoxifen treatment. Methamphetamine reduced striatal dopamine and its metabolites 3,4-dihydroxyphenylacetic acid and homovanillic acid concentrations, striatal and substantia nigra dopamine and vesicular monoamine transporter specific binding as well substantia nigra dopamine and vesicular monoamine transporter mRNA levels and increased striatal preproenkephalin mRNA levels. These methamphetamine effects were not altered by 12.5 microg tamoxifen except for increased striatal dopamine metabolites and turnover. Tamoxifen at 50 microg reduced the methamphetamine effect on striatal dopamine concentration, dopamine transporter specific binding and prevented the increase in preproenkephalin mRNA levels; in the substantia nigra tamoxifen prevented the decrease of dopamine transporter mRNA levels. The present results show a tamoxifen dose-dependent prevention of loss of various dopaminergic markers against methamphetamine-induced toxicity in male mice. Since this is the only known hormonal protection of male mice against methamphetamine toxicity, these findings provide important new information on specific parameters of nigrostriatal dopaminergic function preserved by tamoxifen.
Periplasmic Binding Protein Dimer Has a Second Allosteric Event Tied to Ligand Binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Le; Ghimire-Rijal, Sudipa; Lucas, Sarah L.
Here, the ligand-induced conformational changes of periplasmic binding proteins (PBP) play a key role in the acquisition of metabolites in ATP binding cassette (ABC) transport systems. This conformational change allows for differential recognition of the ligand occupancy of the PBP by the ABC transporter. This minimizes futile ATP hydrolysis in the transporter, a phenomenon in which ATP hydrolysis is not coupled to metabolite transport. In many systems, the PBP conformational change is insufficient at eliminating futile ATP hydrolysis. Here we identify an additional state of the PBP that is also allosterically regulated by the ligand. Ligand binding to the homodimericmore » apo PBP leads to a tightening of the interface alpha-helices so that the hydrogen bonding pattern shifts to that of a 3 10 helix, in-turn altering the contacts and the dynamics of the protein interface so that the monomer exists in the presence of ligand.« less
Periplasmic Binding Protein Dimer Has a Second Allosteric Event Tied to Ligand Binding
Li, Le; Ghimire-Rijal, Sudipa; Lucas, Sarah L.; ...
2017-09-06
Here, the ligand-induced conformational changes of periplasmic binding proteins (PBP) play a key role in the acquisition of metabolites in ATP binding cassette (ABC) transport systems. This conformational change allows for differential recognition of the ligand occupancy of the PBP by the ABC transporter. This minimizes futile ATP hydrolysis in the transporter, a phenomenon in which ATP hydrolysis is not coupled to metabolite transport. In many systems, the PBP conformational change is insufficient at eliminating futile ATP hydrolysis. Here we identify an additional state of the PBP that is also allosterically regulated by the ligand. Ligand binding to the homodimericmore » apo PBP leads to a tightening of the interface alpha-helices so that the hydrogen bonding pattern shifts to that of a 3 10 helix, in-turn altering the contacts and the dynamics of the protein interface so that the monomer exists in the presence of ligand.« less
Mummery, C L; van der Saag, P T; de Laat, S W
1983-01-01
Mouse neuroblastoma cells (clone N1E-115) differentiate in culture upon withdrawal of serum growth factors and acquire the characteristics of neurons. We have shown tht exponentially growing N1E-115 cells possess functional epidermal growth factor (EGF) receptors but that the capacity for binding EGF and for stimulation of DNA synthesis is lost as the cells differentiate. Furthermore, in exponentially growing cells, EGF induces a rapid increase in amiloride-sensitive Na+ influx, followed by stimulation of the (Na+-K+)ATPase, indicating that activation of the Na+/H+ exchange mechanism in N1E-115 cells [1] may be induced by EGF. The ionic response is also lost during differentiation, but we have shown that the stimulation of both Na+ and K+ influx is directly proportional to the number of occupied receptors in all cells whether exponentially growing or differentiating, thus only indirectly dependent on the external EGF concentration. The linearity of the relationships indicates that there is no rate-limiting step between EGF binding and the ionic response. Our data would suggest that as neuroblastoma cells differentiate and acquire neuronal properties, their ability to respond to mitogens, both biologically and in the activation of cation transport processes, progressively decreases owing to the loss of the appropriate receptors.
Cozzi, Nicholas V; Gopalakrishnan, Anupama; Anderson, Lyndsey L; Feih, Joel T; Shulgin, Alexander T; Daley, Paul F; Ruoho, Arnold E
2009-12-01
N,N-dimethyltryptamine (DMT) is a potent plant hallucinogen that has also been found in human tissues. When ingested, DMT and related N,N-dialkyltryptamines produce an intense hallucinogenic state. Behavioral effects are mediated through various neurochemical mechanisms including activity at sigma-1 and serotonin receptors, modification of monoamine uptake and release, and competition for metabolic enzymes. To further clarify the pharmacology of hallucinogenic tryptamines, we synthesized DMT, N-methyl-N-isopropyltryptamine (MIPT), N,N-dipropyltryptamine (DPT), and N,N-diisopropyltryptamine. We then tested the abilities of these N,N-dialkyltryptamines to inhibit [(3)H]5-HT uptake via the plasma membrane serotonin transporter (SERT) in human platelets and via the vesicle monoamine transporter (VMAT2) in Sf9 cells expressing the rat VMAT2. The tryptamines were also tested as inhibitors of [(3)H]paroxetine binding to the SERT and [(3)H]dihydrotetrabenazine binding to VMAT2. Our results show that DMT, MIPT, DPT, and DIPT inhibit [(3)H]5-HT transport at the SERT with K ( I ) values of 4.00 +/- 0.70, 8.88 +/- 4.7, 0.594 +/- 0.12, and 2.32 +/- 0.46 microM, respectively. At VMAT2, the tryptamines inhibited [(3)H]5-HT transport with K ( I ) values of 93 +/- 6.8, 20 +/- 4.3, 19 +/- 2.3, and 19 +/- 3.1 muM, respectively. On the other hand, the tryptamines were very poor inhibitors of [(3)H]paroxetine binding to SERT and of [(3)H]dihydrotetrabenazine binding to VMAT2, resulting in high binding-to-uptake ratios. High binding-to-uptake ratios support the hypothesis that the tryptamines are transporter substrates, not uptake blockers, at both SERT and VMAT2, and also indicate that there are separate substrate and inhibitor binding sites within these transporters. The transporters may allow the accumulation of tryptamines within neurons to reach relatively high levels for sigma-1 receptor activation and to function as releasable transmitters.
Structures of a Na+-coupled, substrate-bound MATE multidrug transporter
Lu, Min; Symersky, Jindrich; Radchenko, Martha; Koide, Akiko; Guo, Yi; Nie, Rongxin; Koide, Shohei
2013-01-01
Multidrug transporters belonging to the multidrug and toxic compound extrusion (MATE) family expel dissimilar lipophilic and cationic drugs across cell membranes by dissipating a preexisting Na+ or H+ gradient. Despite its clinical relevance, the transport mechanism of MATE proteins remains poorly understood, largely owing to a lack of structural information on the substrate-bound transporter. Here we report crystal structures of a Na+-coupled MATE transporter NorM from Neisseria gonorrheae in complexes with three distinct translocation substrates (ethidium, rhodamine 6G, and tetraphenylphosphonium), as well as Cs+ (a Na+ congener), all captured in extracellular-facing and drug-bound states. The structures revealed a multidrug-binding cavity festooned with four negatively charged amino acids and surprisingly limited hydrophobic moieties, in stark contrast to the general belief that aromatic amino acids play a prominent role in multidrug recognition. Furthermore, we discovered an uncommon cation–π interaction in the Na+-binding site located outside the drug-binding cavity and validated the biological relevance of both the substrate- and cation-binding sites by conducting drug resistance and transport assays. Additionally, we uncovered potential rearrangement of at least two transmembrane helices upon Na+-induced drug export. Based on our structural and functional analyses, we suggest that Na+ triggers multidrug extrusion by inducing protein conformational changes rather than by directly competing for the substrate-binding amino acids. This scenario is distinct from the canonical antiport mechanism, in which both substrate and counterion compete for a shared binding site in the transporter. Collectively, our findings provide an important step toward a detailed and mechanistic understanding of multidrug transport. PMID:23341609
Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M
2012-09-01
Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.
The actin cytoskeleton may control the polar distribution of an auxin transport protein
NASA Technical Reports Server (NTRS)
Muday, G. K.; Hu, S.; Brady, S. R.; Davies, E. (Principal Investigator)
2000-01-01
The gravitropic bending of plants has long been linked to the changes in the transport of the plant hormone auxin. To understand the mechanism by which gravity alters auxin movement, it is critical to know how polar auxin transport is initially established. In shoots, polar auxin transport is basipetal (i.e., from the shoot apex toward the base). It is driven by the basal localization of the auxin efflux carrier complex. One mechanism for localizing this efflux carrier complex to the basal membrane may be through attachment to the actin cytoskeleton. The efflux carrier protein complex is believed to consist of several polypeptides, including a regulatory subunit that binds auxin transport inhibitors, such as naphthylphthalamic acid (NPA). Several lines of experimentation have been used to determine if the NPA binding protein interacts with actin filaments. The NPA binding protein has been shown to partition with the actin cytoskeleton during detergent extraction. Agents that specifically alter the polymerization state of the actin cytoskeleton change the amount of NPA binding protein and actin recovered in these cytoskeletal pellets. Actin-affinity columns were prepared with polymers of actin purified from zucchini hypocotyl tissue. NPA binding activity was eluted in a single peak from the actin filament column. Cytochalasin D, which fragments the actin cytoskeleton, was shown to reduce polar auxin transport in zucchini hypocotyls. The interaction of the NPA binding protein with the actin cytoskeleton may localize it in one plane of the plasma membrane, and thereby control the polarity of auxin transport.
The actin cytoskeleton may control the polar distribution of an auxin transport protein.
Muday, G K; Hu, S; Brady, S R
2000-06-01
The gravitropic bending of plants has long been linked to the changes in the transport of the plant hormone auxin. To understand the mechanism by which gravity alters auxin movement, it is critical to know how polar auxin transport is initially established. In shoots, polar auxin transport is basipetal (i.e., from the shoot apex toward the base). It is driven by the basal localization of the auxin efflux carrier complex. One mechanism for localizing this efflux carrier complex to the basal membrane may be through attachment to the actin cytoskeleton. The efflux carrier protein complex is believed to consist of several polypeptides, including a regulatory subunit that binds auxin transport inhibitors, such as naphthylphthalamic acid (NPA). Several lines of experimentation have been used to determine if the NPA binding protein interacts with actin filaments. The NPA binding protein has been shown to partition with the actin cytoskeleton during detergent extraction. Agents that specifically alter the polymerization state of the actin cytoskeleton change the amount of NPA binding protein and actin recovered in these cytoskeletal pellets. Actin-affinity columns were prepared with polymers of actin purified from zucchini hypocotyl tissue. NPA binding activity was eluted in a single peak from the actin filament column. Cytochalasin D, which fragments the actin cytoskeleton, was shown to reduce polar auxin transport in zucchini hypocotyls. The interaction of the NPA binding protein with the actin cytoskeleton may localize it in one plane of the plasma membrane, and thereby control the polarity of auxin transport.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giuliani, Sarah E; Frank, Ashley M; Corgliano, Danielle M
Abstract Background: Transporter proteins are one of an organism s primary interfaces with the environment. The expressed set of transporters mediates cellular metabolic capabilities and influences signal transduction pathways and regulatory networks. The functional annotation of most transporters is currently limited to general classification into families. The development of capabilities to map ligands with specific transporters would improve our knowledge of the function of these proteins, improve the annotation of related genomes, and facilitate predictions for their role in cellular responses to environmental changes. Results: To improve the utility of the functional annotation for ABC transporters, we expressed and purifiedmore » the set of solute binding proteins from Rhodopseudomonas palustris and characterized their ligand-binding specificity. Our approach utilized ligand libraries consisting of environmental and cellular metabolic compounds, and fluorescence thermal shift based high throughput ligand binding screens. This process resulted in the identification of specific binding ligands for approximately 64% of the purified and screened proteins. The collection of binding ligands is representative of common functionalities associated with many bacterial organisms as well as specific capabilities linked to the ecological niche occupied by R. palustris. Conclusion: The functional screen identified specific ligands that bound to ABC transporter periplasmic binding subunits from R. palustris. These assignments provide unique insight for the metabolic capabilities of this organism and are consistent with the ecological niche of strain isolation. This functional insight can be used to improve the annotation of related organisms and provides a route to evaluate the evolution of this important and diverse group of transporter proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tirado-Lee, Leidamarie; Lee, Allen; Rees, Douglas C.
2014-10-02
molA (HI1472) from H. influenzae encodes a periplasmic binding protein (PBP) that delivers substrate to the ABC transporter MolB{sub 2}C{sub 2} (formerly HI1470/71). The structures of MolA with molybdate and tungstate in the binding pocket were solved to 1.6 and 1.7 {angstrom} resolution, respectively. The MolA-binding protein binds molybdate and tungstate, but not other oxyanions such as sulfate and phosphate, making it the first class III molybdate-binding protein structurally solved. The {approx}100 {mu}M binding affinity for tungstate and molybdate is significantly lower than observed for the class II ModA molybdate-binding proteins that have nanomolar to low micromolar affinity for molybdate.more » The presence of two molybdate loci in H. influenzae suggests multiple transport systems for one substrate, with molABC constituting a low-affinity molybdate locus.« less
Siebert, Matthias; Böhme, Mathias A; Driller, Jan H; Babikir, Husam; Mampell, Malou M; Rey, Ulises; Ramesh, Niraja; Matkovic, Tanja; Holton, Nicole; Reddy-Alla, Suneel; Göttfert, Fabian; Kamin, Dirk; Quentin, Christine; Klinedinst, Susan; Andlauer, Till Fm; Hell, Stefan W; Collins, Catherine A; Wahl, Markus C; Loll, Bernhard; Sigrist, Stephan J
2015-08-14
Synaptic vesicles (SVs) fuse at active zones (AZs) covered by a protein scaffold, at Drosophila synapses comprised of ELKS family member Bruchpilot (BRP) and RIM-binding protein (RBP). We here demonstrate axonal co-transport of BRP and RBP using intravital live imaging, with both proteins co-accumulating in axonal aggregates of several transport mutants. RBP, via its C-terminal Src-homology 3 (SH3) domains, binds Aplip1/JIP1, a transport adaptor involved in kinesin-dependent SV transport. We show in atomic detail that RBP C-terminal SH3 domains bind a proline-rich (PxxP) motif of Aplip1/JIP1 with submicromolar affinity. Pointmutating this PxxP motif provoked formation of ectopic AZ-like structures at axonal membranes. Direct interactions between AZ proteins and transport adaptors seem to provide complex avidity and shield synaptic interaction surfaces of pre-assembled scaffold protein transport complexes, thus, favouring physiological synaptic AZ assembly over premature assembly at axonal membranes.
LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou,Z.; Zhen, J.; Karpowich, N.
2007-01-01
Tricyclic antidepressants exert their pharmacological effect -- inhibiting the reuptake of serotonin, norepinephrine, and dopamine -- by directly blocking neurotransmitter transporters (SERT, NET, and DAT, respectively) in the presynaptic membrane. The drug-binding site and the mechanism of this inhibition are poorly understood. We determined the crystal structure at 2.9 angstroms of the bacterial leucine transporter (LeuT), a homolog of SERT, NET, and DAT, in complex with leucine and the antidepressant desipramine. Desipramine binds at the inner end of the extracellular cavity of the transporter and is held in place by a hairpin loop and by a salt bridge. This bindingmore » site is separated from the leucine-binding site by the extracellular gate of the transporter. By directly locking the gate, desipramine prevents conformational changes and blocks substrate transport. Mutagenesis experiments on human SERT and DAT indicate that both the desipramine-binding site and its inhibition mechanism are probably conserved in the human neurotransmitter transporters.« less
NASA Astrophysics Data System (ADS)
Flechsig, Holger
2016-02-01
ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter. Possible explanations are discussed in the light of currently debated transport scenarios of ABC transporters.
Substrate-bound structure of the E. coli multidrug resistance transporter MdfA
Heng, Jie; Zhao, Yan; Liu, Ming; Liu, Yue; Fan, Junping; Wang, Xianping; Zhao, Yongfang; Zhang, Xuejun C
2015-01-01
Multidrug resistance is a serious threat to public health. Proton motive force-driven antiporters from the major facilitator superfamily (MFS) constitute a major group of multidrug-resistance transporters. Currently, no reports on crystal structures of MFS antiporters in complex with their substrates exist. The E. coli MdfA transporter is a well-studied model system for biochemical analyses of multidrug-resistance MFS antiporters. Here, we report three crystal structures of MdfA-ligand complexes at resolutions up to 2.0 Å, all in the inward-facing conformation. The substrate-binding site sits proximal to the conserved acidic residue, D34. Our mutagenesis studies support the structural observations of the substrate-binding mode and the notion that D34 responds to substrate binding by adjusting its protonation status. Taken together, our data unveil the substrate-binding mode of MFS antiporters and suggest a mechanism of transport via this group of transporters. PMID:26238402
Transport of Gold Nanoparticles by Vascular Endothelium from Different Human Tissues
Gromnicova, Radka; Kaya, Mehmet; Romero, Ignacio A.; Williams, Phil; Satchell, Simon; Sharrack, Basil; Male, David
2016-01-01
The selective entry of nanoparticles into target tissues is the key factor which determines their tissue distribution. Entry is primarily controlled by microvascular endothelial cells, which have tissue-specific properties. This study investigated the cellular properties involved in selective transport of gold nanoparticles (<5 nm) coated with PEG-amine/galactose in two different human vascular endothelia. Kidney endothelium (ciGENC) showed higher uptake of these nanoparticles than brain endothelium (hCMEC/D3), reflecting their biodistribution in vivo. Nanoparticle uptake and subcellular localisation was quantified by transmission electron microscopy. The rate of internalisation was approximately 4x higher in kidney endothelium than brain endothelium. Vesicular endocytosis was approximately 4x greater than cytosolic uptake in both cell types, and endocytosis was blocked by metabolic inhibition, whereas cytosolic uptake was energy-independent. The cellular basis for the different rates of internalisation was investigated. Morphologically, both endothelia had similar profiles of vesicles and cell volumes. However, the rate of endocytosis was higher in kidney endothelium. Moreover, the glycocalyces of the endothelia differed, as determined by lectin-binding, and partial removal of the glycocalyx reduced nanoparticle uptake by kidney endothelium, but not brain endothelium. This study identifies tissue-specific properties of vascular endothelium that affects their interaction with nanoparticles and rate of transport. PMID:27560685
NASA Astrophysics Data System (ADS)
Szczesniak, Dominik
Recently, monolayer transition metal dichalcogenides have attracted much attention due to their potential use in both nano- and opto-electronics. In such applications, the electronic and transport properties of group-VIB transition metal dichalcogenides (MX2 , where M=Mo, W; X=S, Se, Te) are particularly important. Herein, new insight into these properties is presented by studying the complex band structures (CBS's) of MX2 monolayers while accounting for spin-orbit coupling effects. By using the symmetry-based tight-binding model a nonlinear generalized eigenvalue problem for CBS's is obtained. An efficient method for solving such class of problems is presented and gives a complete set of physically relevant solutions. Next, these solutions are characterized and classified into propagating and evanescent states, where the latter states present not only monotonic but also oscillatory decay character. It is observed that some of the oscillatory evanescent states create characteristic complex loops at the direct band gaps, which describe the tunneling currents in the MX2 materials. The importance of CBS's and tunneling currents is demonstrated by the analysis of the quantum transport across MX2 monolayers within phase field matching theory. Present work has been prepared within the Qatar Energy and Environment Research Institute (QEERI) grand challenge ATHLOC project (Project No. QEERI- GC-3008).
Agmatine is transported into liver mitochondria by a specific electrophoretic mechanism
Salvi, Mauro; Battaglia, Valentina; Mancon, Mario; Colombatto, Sebastiano; Cravanzola, Carlo; Calheiros, Rita; Marques, Maria P. M.; Grillo, Maria A.; Toninello, Antonio
2006-01-01
Agmatine, a divalent diamine with two positive charges at physiological pH, is transported into the matrix of liver mitochondria by an energy-dependent mechanism the driving force of which is ΔΨ (electrical membrane potential). Although this process showed strict electrophoretic behaviour, qualitatively similar to that of polyamines, agmatine is most probably transported by a specific uniporter. Shared transport with polyamines by means of their transporter is excluded, as divalent putrescine and cadaverine are ineffective in inhibiting agmatine uptake. Indeed, the use of the electroneutral transporter of basic amino acids can also be discarded as ornithine, arginine and lysine are completely ineffective at inducing the inhibition of agmatine uptake. The involvement of the monoamine transporter or the existence of a leak pathway are also unlikely. Flux-voltage analysis and the determination of activation enthalpy, which is dependent upon the valence of agmatine, are consistent with the hypothesis that the mitochondrial agmatine transporter is a channel or a single-binding centre-gated pore. The transport of agmatine was non-competitively inhibited by propargylamines, in particular clorgilyne, that are known to be inhibitors of MAO (monoamine oxidase). However, agmatine is normally transported in mitoplasts, thus excluding the involvement of MAO in this process. The I2 imidazoline receptor, which binds agmatine to the mitochondrial membrane, can also be excluded as a possible transporter since its inhibitor, idazoxan, was ineffective at inducing the inhibition of agmatine uptake. Scatchard analysis of membrane binding revealed two types of binding site, S1 and S2, both with mono-co-ordination, and exhibiting high-capacity and low-affinity binding for agmatine compared with polyamines. Agmatine transport in liver mitochondria may be of physiological importance as an indirect regulatory system of cytochrome c oxidase activity and as an inducer mechanism of mitochondrial-mediated apoptosis. PMID:16509824
Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang
2016-01-01
Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703
Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.
Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V
1998-05-26
To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.
Zhang, Zhou; Tao, Zhen; Gameiro, Armanda; Barcelona, Stephanie; Braams, Simona; Rauen, Thomas; Grewer, Christof
2007-01-01
Glutamate transport by the excitatory amino acid carrier EAAC1 is known to be reversible. Thus, glutamate can either be taken up into cells, or it can be released from cells through reverse transport, depending on the electrochemical gradient of the co- and countertransported ions. However, it is unknown how fast and by which reverse transport mechanism glutamate can be released from cells. Here, we determined the steady- and pre-steady-state kinetics of reverse glutamate transport with submillisecond time resolution. First, our results suggest that glutamate and Na+ dissociate from their cytoplasmic binding sites sequentially, with glutamate dissociating first, followed by the three cotransported Na+ ions. Second, the kinetics of glutamate transport depend strongly on transport direction, with reverse transport being faster but less voltage-dependent than forward transport. Third, electrogenicity is distributed over several reverse transport steps, including intracellular Na+ binding, reverse translocation, and reverse relocation of the K+-bound EAAC1. We propose a kinetic model, which is based on a “first-in-first-out” mechanism, suggesting that glutamate association, with its extracellular binding site as well as dissociation from its intracellular binding site, precedes association and dissociation of at least one Na+ ion. Our model can be used to predict rates of glutamate release from neurons under physiological and pathophysiological conditions. PMID:17991780
Kaufmann, Kristian W.; Dawson, Eric S.; Henry, L. Keith; Field, Julie R.; Blakely, Randy D.; Meiler, Jens
2009-01-01
To identify potential determinants of substrate selectivity in serotonin (5-HT) transporters (SERT), models of human and Drosophila serotonin transporters (hSERT, dSERT) were built based on the leucine transporter (LeuTAa) structure reported by Yamashita et al. (Nature 2005;437:215–223), PBDID 2A65. Although the overall amino acid identity between SERTs and the LeuTAa is only 17%, it increases to above 50% in the first shell of the putative 5-HT binding site, allowing de novo computational docking of tryptamine derivatives in atomic detail. Comparison of hSERT and dSERT complexed with substrates pinpoints likely structural determinants for substrate binding. Forgoing the use of experimental transport and binding data of tryptamine derivatives for construction of these models enables us to cHitically assess and validate their predictive power: A single 5-HT binding mode was identified that retains the amine placement observed in the LeuTAa structure, matches site-directed mutagenesis and substituted cysteine accessibility method (SCAM) data, complies with support vector machine derived relations activity relations, and predicts computational binding energies for 5-HT analogs with a significant correlation coefficient (R = 0.72). This binding mode places 5-HT deep in the binding pocket of the SERT with the 5-position near residue hSERT A169/dSERT D164 in transmembrane helix 3, the indole nitrogen next to residue Y176/Y171, and the ethylamine tail under residues F335/F327 and S336/S328 within 4 Å of residue D98. Our studies identify a number of potential contacts whose contribution to substrate binding and transport was previously unsuspected. PMID:18704946
Quasi-bound states in strained graphene
NASA Astrophysics Data System (ADS)
Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David
In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.
Feroz, S R; Mohamad, S B; Lee, G S; Malek, S N A; Tayyab, S
2015-06-01
6-Shogaol, one of the main bioactive constituents of Zingiber officinale has been shown to possess various therapeutic properties. Interaction of a therapeutic compound with plasma proteins greatly affects its pharmacokinetic and pharmacodynamic properties. The present investigation was undertaken to characterize the interaction between 6-shogaol and the main in vivo transporter, human serum albumin (HSA). Various binding characteristics of 6-shogaol-HSA interaction were studied using fluorescence spectroscopy. Thermal stability of 6-shogaol-HSA system was determined by circular dichroism (CD) and differential scanning calorimetric (DSC) techniques. Identification of the 6-shogaol binding site on HSA was made by competitive drug displacement and molecular docking experiments. Fluorescence quench titration results revealed the association constant, Ka of 6-shogaol-HSA interaction as 6.29 ± 0.33 × 10(4) M(-1) at 25 ºC. Values of the enthalpy change (-11.76 kJ mol(-1)) and the entropy change (52.52 J mol(-1) K(-1)), obtained for the binding reaction suggested involvement of hydrophobic and van der Waals forces along with hydrogen bonds in the complex formation. Higher thermal stability of HSA was noticed in the presence of 6-shogaol, as revealed by DSC and thermal denaturation profiles. Competitive ligand displacement experiments along with molecular docking results suggested the binding preference of 6-shogaol for Sudlow's site I of HSA. All these results suggest that 6-shogaol binds to Sudlow's site I of HSA through moderate binding affinity and involves hydrophobic and van der Waals forces along with hydrogen bonds. Copyright © 2015 Elsevier GmbH. All rights reserved.
Snapshots of the maltose transporter during ATP hydrolysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oldham, Michael L.; Chen, Jue
2011-12-05
ATP-binding cassette transporters are powered by ATP, but the mechanism by which these transporters hydrolyze ATP is unclear. In this study, four crystal structures of the full-length wild-type maltose transporter, stabilized by adenosine 5{prime}-({beta},{gamma}-imido)triphosphate or ADP in conjunction with phosphate analogs BeF{sub 3}{sup -}, VO{sub 4}{sup 3-}, or AlF{sub 4}{sup -}, were determined to 2.2- to 2.4-{angstrom} resolution. These structures led to the assignment of two enzymatic states during ATP hydrolysis and demonstrate specific functional roles of highly conserved residues in the nucleotide-binding domain, suggesting that ATP-binding cassette transporters catalyze ATP hydrolysis via a general base mechanism.
Sankar, R; Neupane, M; Xu, S-Y; Butler, C J; Zeljkovic, I; Panneer Muthuselvam, I; Huang, F-T; Guo, S-T; Karna, Sunil K; Chu, M-W; Lee, W L; Lin, M-T; Jayavel, R; Madhavan, V; Hasan, M Z; Chou, F C
2015-08-14
The three dimensional (3D) Dirac semimetal is a new quantum state of matter that has attracted much attention recently in physics and material science. Here, we report on the growth of large plate-like single crystals of Cd3As2 in two major orientations by a self-selecting vapor growth (SSVG) method, and the optimum growth conditions have been experimentally determined. The crystalline imperfections and electrical properties of the crystals were examined with transmission electron microscopy (TEM), scanning tunneling microscopy (STM), and transport property measurements. This SSVG method makes it possible to control the as-grown crystal compositions with excess Cd or As leading to mobilities near 5-10(5) cm(2)V(-1)s(-1). Zn-doping can effectively reduce the carrier density to reach the maximum residual resistivity ratio (RRRρ300K/ρ5K) of 7.6. A vacuum-cleaved single crystal has been investigated using angle-resolved photoemission spectroscopy (ARPES) to reveal a single Dirac cone near the center of the surface Brillouin zone with a binding energy of approximately 200 meV.
Structural basis of RND-type multidrug exporters
Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke
2015-01-01
Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway. PMID:25941524
Structural basis of RND-type multidrug exporters.
Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke
2015-01-01
Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway.
Sarker, Subhodeep; Weissensteiner, René; Steiner, Ilka; Sitte, Harald H.; Ecker, Gerhard F.; Freissmuth, Michael; Sucic, Sonja
2015-01-01
The structure of the bacterial leucine transporter from Aquifex aeolicus (LeuTAa) has been used as a model for mammalian Na+/Cl−-dependent transporters, in particular the serotonin transporter (SERT). The crystal structure of LeuTAa liganded to tricyclic antidepressants predicts simultaneous binding of inhibitor and substrate. This is incompatible with the mutually competitive inhibition of substrates and inhibitors of SERT. We explored the binding modes of tricyclic antidepressants by homology modeling and docking studies. Two approaches were used subsequently to differentiate between three clusters of potential docking poses: 1) a diagnostic SERTY95F mutation, which greatly reduced the affinity for [3H]imipramine but did not affect substrate binding; 2) competition binding experiments in the presence and absence of carbamazepine (i.e., a tricyclic imipramine analog with a short side chain that competes with [3H]imipramine binding to SERT). Binding of releasers (para-chloroamphetamine, methylene-dioxy-methamphetamine/ecstasy) and of carbamazepine were mutually exclusive, but Dixon plots generated in the presence of carbamazepine yielded intersecting lines for serotonin, MPP+, paroxetine, and ibogaine. These observations are consistent with a model, in which 1) the tricyclic ring is docked into the outer vestibule and the dimethyl-aminopropyl side chain points to the substrate binding site; 2) binding of amphetamines creates a structural change in the inner and outer vestibule that precludes docking of the tricyclic ring; 3) simultaneous binding of ibogaine (which binds to the inward-facing conformation) and of carbamazepine is indicative of a second binding site in the inner vestibule, consistent with the pseudosymmetric fold of monoamine transporters. This may be the second low-affinity binding site for antidepressants. PMID:20829432
Evidence that forskolin binds to the glucose transporter of human erythrocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lavis, V.R.; Lee, D.P.; Shenolikar, S.
1987-10-25
Binding of (4-/sup 3/H)cytochalasin B and (12-/sup 3/H)forskolin to human erythrocyte membranes was measured by a centrifugation method. Glucose-displaceable binding of cytochalasin B was saturable, with KD = 0.11 microM, and maximum binding approximately 550 pmol/mg of protein. Forskolin inhibited the glucose-displaceable binding of cytochalasin B in an apparently competitive manner, with K1 = 3 microM. Glucose-displaceable binding of (12-/sup 3/H)forskolin was also saturable, with KD = 2.6 microM and maximum binding approximately equal to 400 pmol/mg of protein. The following compounds inhibited binding of (12-/sup 3/H)forskolin and (4-/sup 3/H)cytochalasin B equivalently, with relative potencies parallel to their reported affinitiesmore » for the glucose transport system: cytochalasins A and D, dihydrocytochalasin B, L-rhamnose, L-glucose, D-galactose, D-mannose, D-glucose, 2-deoxy-D-glucose, 3-O-methyl-D-glucose, phloretin, and phlorizin. A water-soluble derivative of forskolin, 7-hemisuccinyl-7-desacetylforskolin, displaced equivalent amounts of (4-/sup 3/H)cytochalasin B or (12-/sup 3/H)forskolin. Rabbit erythrocyte membranes, which are deficient in glucose transporter, did not bind either (4-/sup 3/H)cytochalasin B or (12-/sup 3/H)forskolin in a glucose-displaceable manner. These results indicate that forskolin, in concentrations routinely employed for stimulation of adenylate cyclase, binds to the glucose transporter. Endogenous ligands with similar specificities could be important modulators of cellular metabolism.« less
Sekula, Bartosz; Ciesielska, Anna; Rytczak, Przemyslaw; Koziołkiewicz, Maria; Bujacz, Anna
2016-01-01
Cyclic phosphatidic acids (cPAs) are naturally occurring, very active signalling molecules, which are involved in several pathological states, such as cancer, diabetes or obesity. As molecules of highly lipidic character found in the circulatory system, cPAs are bound and transported by the main extracellular lipid binding protein–serum albumin. Here, we present the detailed interactions between human serum albumin (HSA) and equine serum albumin (ESA) with a derivative of cPA, 1-O-myristoyl-sn-glycerol-2,3-cyclic phosphorodithioate (Myr-2S-cPA). Initial selection of the ligand used for the structural study was made by the analysis of the therapeutically promising properties of the sulfur containing analogues of cPA in respect to the unmodified lysophospholipids (LPLs). Substitution of one or two non-bridging oxygen atoms in the phosphate group with one or two sulfur atoms increases the cytotoxic effect of cPAs up to 60% on the human prostate cancer (PC) cells. Myr-2S-cPA reduces cancer cell viability in a dose-dependent manner, with IC50 value of 29.0 μM after 24 h incubation, which is almost 30% lower than IC50 of single substituted phosphorothioate cPA. Although, the structural homology between HSA and ESA is big, their crystal complexes with Myr-2S-cPA demonstrate significantly different mode of binding of this LPL analogue. HSA binds three molecules of Myr-2S-cPA, whereas ESA only one. Moreover, none of the identified Myr-2S-cPA binding sites overlap in both albumins. PMID:27129297
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.
Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less
Structure-activity relationships for serotonin transporter and dopamine receptor selectivity.
Agatonovic-Kustrin, Snezana; Davies, Paul; Turner, Joseph V
2009-05-01
Antipsychotic medications have a diverse pharmacology with affinity for serotonergic, dopaminergic, adrenergic, histaminergic and cholinergic receptors. Their clinical use now also includes the treatment of mood disorders, thought to be mediated by serotonergic receptor activity. The aim of our study was to characterise the molecular properties of antipsychotic agents, and to develop a model that would indicate molecular specificity for the dopamine (D(2)) receptor and the serotonin (5-HT) transporter. Back-propagation artificial neural networks (ANNs) were trained on a dataset of 47 ligands categorically assigned antidepressant or antipsychotic utility. The structure of each compound was encoded with 63 calculated molecular descriptors. ANN parameters including hidden neurons and input descriptors were optimised based on sensitivity analyses, with optimum models containing between four and 14 descriptors. Predicted binding preferences were in excellent agreement with clinical antipsychotic or antidepressant utility. Validated models were further tested by use of an external prediction set of five drugs with unknown mechanism of action. The SAR models developed revealed the importance of simple molecular characteristics for differential binding to the D(2) receptor and the 5-HT transporter. These included molecular size and shape, solubility parameters, hydrogen donating potential, electrostatic parameters, stereochemistry and presence of nitrogen. The developed models and techniques employed are expected to be useful in the rational design of future therapeutic agents.
McKenna, Mary M.; Krump, Nathan A.; Zheng, Suilan; Mendelsohn, Laurel; Thein, Swee Lay; Garrett, Lisa J.; Bodine, David M.
2016-01-01
Functional studies have shown that the oxygenation state of the erythrocyte regulates many important pathways, including glucose metabolism, membrane mechanical stability, and cellular adenosine triphosphate (ATP) release. Deoxyhemoglobin (deoxyHb), but not oxyhemoglobin, binds avidly and reversibly to band 3, the major erythrocyte membrane protein. Because band 3 associates with multiple metabolic, solute transport, signal transduction, and structural proteins, the hypothesis naturally arises that the O2-dependent regulation of erythrocyte properties might be mediated by the reversible association of deoxyHb with band 3. To explore whether the band 3–deoxyHb interaction constitutes a “molecular switch” for regulating erythrocyte biology, we have generated transgenic mice with mutations in the deoxyHb-binding domain of band 3. One strain of mouse contains a “humanized” band 3 in which the N-terminal 45 residues of mouse band 3 are replaced by the homologous sequence from human band 3, including the normal human band 3 deoxyHb-binding site. The second mouse contains the same substitution as the first, except the deoxyHb site on band 3 (residues 12-23) has been deleted. Comparison of these animals with wild-type mice demonstrates that the following erythrocyte properties are controlled by the O2-dependent association of hemoglobin with band 3: (1) assembly of a glycolytic enzyme complex on the erythrocyte membrane which is associated with a shift in glucose metabolism between the pentose phosphate pathway and glycolysis, (2) interaction of ankyrin with band 3 and the concomitant regulation of erythrocyte membrane stability, and (3) release of ATP from the red cell which has been linked to vasodilation. PMID:27688804
Acid-base properties of humic and fulvic acids formed during composting.
Plaza, César; Senesi, Nicola; Polo, Alfredo; Brunetti, Gennaro
2005-09-15
The soil acid-base buffering capacity and the biological availability, mobilization, and transport of macro- and micronutrients, toxic metal ions, and xenobiotic organic cations in soil are strongly influenced by the acid-base properties of humic substances, of which humic and fulvic acids are the major fractions. For these reasons, the proton binding behavior of the humic acid-like (HA) and fulvic acid-like (FA) fractions contained in a compost are believed to be instrumental in its successful performance in soil. In this work, the acid-base properties of the HAs and FAs isolated from a mixture of the sludge residue obtained from olive oil mill wastewater (OMW) evaporated in an open-air pond and tree cuttings (TC) at different stages of composting were investigated by a current potentiometric titration method and the nonideal competitive adsorption (NICA)-Donnan model. The NICA-Donnan model provided an excellent description of the acid-base titration data, and pointed out substantial differences in site density and proton-binding affinity between the HAs and FAs examined. With respect to FAs, HAs were characterized by a smaller content of carboxylic- and phenolic-type groups and their larger affinities for proton binding. Further, HAs featured a greater heterogeneity in carboxylic-type groups than FAs. The composting process increased the content and decreased the proton affinity of carboxylic- and phenolic-type groups of HAs and FAs, and increased the heterogeneity of phenolic-type groups of HAs. As a whole, these effects indicated that the composting process could produce HA and FA fractions with greater cation binding capacities. These results suggest that composting of organic materials improves their agronomic and environmental value by increasing their potential to retain and exchange macro- and micronutrients, and to reduce the bioavailability of organic and inorganic pollutants.
Hasenhuetl, Peter S; Freissmuth, Michael; Sandtner, Walter
2016-12-09
The plasmalemmal monoamine transporters clear the extracellular space from their cognate substrates and sustain cellular monoamine stores even during neuronal activity. In some instances, however, the transporters enter a substrate-exchange mode, which results in release of intracellular substrate. Understanding what determines the switch between these two transport modes demands time-resolved measurements of intracellular (co-)substrate binding and release. Here, we report an electrophysiological investigation of intracellular solute-binding to the human serotonin transporter (SERT) expressed in HEK-293 cells. We measured currents induced by rapid application of serotonin employing varying intracellular (co-)substrate concentrations and interpreted the data using kinetic modeling. Our measurements revealed that the induction of the substrate-exchange mode depends on both voltage and intracellular Na + concentrations because intracellular Na + release occurs before serotonin release and is highly electrogenic. This voltage dependence was blunted by electrogenic binding of intracellular K + and, notably, also H + In addition, our data suggest that Cl - is bound to SERT during the entire catalytic cycle. Our experiments, therefore, document an essential role of electrogenic binding of K + or of H + to the inward-facing conformation of SERT in (i) cancelling out the electrogenic nature of intracellular Na + release and (ii) in selecting the forward-transport over the substrate-exchange mode. Finally, the kinetics of intracellular Na + release and K + (or H + ) binding result in a voltage-independent rate-limiting step where SERT may return to the outward-facing state in a KCl- or HCl-bound form. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
2014-01-01
The binding-induced fluorescence of 4-(4-(dimethylamino)-phenyl)-1-methylpyridinium (APP+) and two new serotonin transporter (SERT)-binding fluorescent analogues, 1-butyl-4-[4-(1-dimethylamino)phenyl]-pyridinium bromide (BPP+) and 1-methyl-4-[4-(1-piperidinyl)phenyl]-pyridinium (PPP+), has been investigated. Optical spectroscopy reveals that these probes are highly sensitive to their chemical microenvironment, responding to variations in polarity with changes in transition energies and responding to changes in viscosity or rotational freedom with emission enhancements. Molecular docking calculations reveal that the probes are able to access the nonpolar and conformationally restrictive binding pocket of SERT. As a result, the probes exhibit previously not identified binding-induced turn-on emission that is spectroscopically distinct from dyes that have accumulated intracellularly. Thus, binding and transport dynamics of SERT ligands can be resolved both spatially and spectroscopically. PMID:24460204
Kang, Hyeran; Bradley, Michael J.; McCullough, Brannon R.; Pierre, Anaëlle; Grintsevich, Elena E.; Reisler, Emil; De La Cruz, Enrique M.
2012-01-01
The assembly of actin monomers into filaments and networks plays vital roles throughout eukaryotic biology, including intracellular transport, cell motility, cell division, determining cellular shape, and providing cells with mechanical strength. The regulation of actin assembly and modulation of filament mechanical properties are critical for proper actin function. It is well established that physiological salt concentrations promote actin assembly and alter the overall bending mechanics of assembled filaments and networks. However, the molecular origins of these salt-dependent effects, particularly if they involve nonspecific ionic strength effects or specific ion-binding interactions, are unknown. Here, we demonstrate that specific cation binding at two discrete sites situated between adjacent subunits along the long-pitch helix drive actin polymerization and determine the filament bending rigidity. We classify the two sites as “polymerization” and “stiffness” sites based on the effects that mutations at the sites have on salt-dependent filament assembly and bending mechanics, respectively. These results establish the existence and location of the cation-binding sites that confer salt dependence to the assembly and mechanics of actin filaments. PMID:23027950
Li, Qian; Zhang, Tianlong; Bian, Liujiao
2016-03-01
Serum albumins are the most abundant carrier proteins in blood plasma and participate in the binding and transportation of various exogenous and endogenous compounds in the body. This work was designed to investigate the recognition and binding of three typical β-lactam antibiotics including penicillin G (Pen G), penicillin V (Pen V) and cefalexin (Cef) with bovine serum albumin (BSA) by frontal affinity chromatography in combination with UV-vis absorption spectra, fluorescence emission spectra, binding site marker competitive experiment and molecular docking under simulated physiological conditions. The results showed that a BSA only bound with one antibiotic molecule in the binding process, and the binding constants for Pen G-BSA, Pen V-BSA and Cef-BSA complexes were 4.22×10(1), 4.86×10(2) and 3.32×10(3) (L/mol), respectively. All the three β-lactam antibiotics were mainly inserted into the subdomain IIA (binding site 1) of BSA by hydrogen bonds and Van der Waals forces. The binding capacity between the antibiotics and BSA was closely related to the functional groups and flexibility of side chains in antibiotics. This study provided an important insight into the molecular recognition and binding interaction of BSA with β-lactam antibiotics, which may be a useful guideline for the innovative clinical medications and new antibiotic designs with effective pharmacological properties. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Tsukanov, A. A.; Psakhie, S. G.
2016-01-01
The application of hybrid and hierarchical nanomaterials based on layered hydroxides and oxyhydroxides of metals is a swiftly progressing field in biomedicine. Layered double hydroxides (LDH) possess a large specific surface area, significant surface electric charge and biocompatibility. Their physical and structural properties enable them to adsorb various kinds of anionic species and to transport them into cells. However, possible side effects resulting from the interaction of LDH with anions of the intercellular and intracellular medium need to be considered, since such interaction can potentially disrupt ion transport, signaling processes, apoptosis, nutrition and proliferation of living cells. In the present paper molecular dynamics is used to determine the energies of interaction of organic anions (aspartic acid, glutamic acid and bicarbonate) with a fragment of layered double hydroxide Mg/Al-LDH. The average number of hydrogen bonds between the anions and the hydroxide surface and characteristic binding configurations are determined. Possible effects of LDH on the cell resulting from binding of protein fragments and replacement of native intracellular anions with delivered anions are considered.
Górska, Sabina; Dylus, Ewa; Rudawska, Angelika; Brzozowska, Ewa; Srutkova, Dagmar; Schwarzer, Martin; Razim, Agnieszka; Kozakova, Hana; Gamian, Andrzej
2016-01-01
The Bifidobacteria show great diversity in the cell surface architecture which may influence the physicochemical properties of the bacterial cell and strain specific properties. The immunomodulatory role of bifidobacteria has been extensively studied, however studies on the immunoreactivity of their protein molecules are very limited. Here, we compared six different methods of protein isolation and purification and we report identification of immunogenic and immunoreactive protein of two human Bifidobacterium longum ssp. longum strains. We evaluated potential immunoreactive properties of proteins employing polyclonal sera obtained from germ free mouse, rabbit and human. The protein yield was isolation method-dependent and the reactivity of proteins detected by SDS-PAGE and Western blotting was heterogeneous and varied between different serum samples. The proteins with the highest immunoreactivity were isolated, purified and have them sequenced. Among the immunoreactive proteins we identified enolase, aspartokinase, pyruvate kinase, DnaK (B. longum ssp. longum CCM 7952) and sugar ABC transporter ATP-binding protein, phosphoglycerate kinase, peptidoglycan synthethase penicillin-binding protein 3, transaldolase, ribosomal proteins and glyceraldehyde 3-phosphate dehydrogenase (B. longum ssp. longum CCDM 372). PMID:27746766
Górska, Sabina; Dylus, Ewa; Rudawska, Angelika; Brzozowska, Ewa; Srutkova, Dagmar; Schwarzer, Martin; Razim, Agnieszka; Kozakova, Hana; Gamian, Andrzej
2016-01-01
The Bifidobacteria show great diversity in the cell surface architecture which may influence the physicochemical properties of the bacterial cell and strain specific properties. The immunomodulatory role of bifidobacteria has been extensively studied, however studies on the immunoreactivity of their protein molecules are very limited. Here, we compared six different methods of protein isolation and purification and we report identification of immunogenic and immunoreactive protein of two human Bifidobacterium longum ssp. longum strains. We evaluated potential immunoreactive properties of proteins employing polyclonal sera obtained from germ free mouse, rabbit and human. The protein yield was isolation method-dependent and the reactivity of proteins detected by SDS-PAGE and Western blotting was heterogeneous and varied between different serum samples. The proteins with the highest immunoreactivity were isolated, purified and have them sequenced. Among the immunoreactive proteins we identified enolase, aspartokinase, pyruvate kinase, DnaK ( B. longum ssp. longum CCM 7952) and sugar ABC transporter ATP-binding protein, phosphoglycerate kinase, peptidoglycan synthethase penicillin-binding protein 3, transaldolase, ribosomal proteins and glyceraldehyde 3-phosphate dehydrogenase ( B. longum ssp. longum CCDM 372).
Calixarenes in analytical and separation chemistry.
Ludwig, R
2000-05-01
Discovered in the 1940's, [1n]metacyclophanes with the common name calix[n]arenes which is derived from for the molecule's shape enjoyed a remarkable interest in almost all fields of chemistry since the 1980's, which is highlighted by several books [1-8]. Over 50 reviews concerning their synthesis, properties and applicabilities were published, many of those with emphasis on organic synthesis and structural properties are cited in [P. 5-6 in 2]. Of interest for analytical chemists are reviews on calixarenes and the structurally related resorcin[n]arenes (or calix[n]resorcarenes) and calixpyrroles concerning potentiometric sensors [9-12], chromo- and fluorophores [13, 14], molecular switches [15], metal ion binding in solution [16-19], redox properties [20] and anion binding [21-24]. Other recent reviews deal with thermodynamic aspects [25], organometallic compounds [26], P-containing calixarenes [27-29], as well as molecular dynamics modeling [30-33]. It is a vital field with over 200 publications per year. Therefore, this article presents only selected results on complexation, solvent extraction and membrane transport with the emphasis on ion and molecular recognition which can be used for analytical purposes, without attempting to cover all available references.
Structure–activity relationships for the binding of polymyxins with human α-1-acid glycoprotein
Azad, Mohammad A.K.; Huang, Johnny X.; Cooper, Matthew A.; Roberts, Kade D.; Thompson, Philip E.; Nation, Roger L.; Li, Jian; Velkov, Tony
2012-01-01
Here, for the first time, we have characterized binding properties of the polymyxin class of antibiotics for human α-1-acid glycoprotein (AGP) using a combination of biophysical techniques. The binding affinity of colistin, polymyxin B, polymyxin B3, colistin methansulfonate, and colistin nona-peptide was determined by isothermal titration calorimetry (ITC), surface plasma resonance (SPR) and fluorometric assay methods. All assay techniques indicated colistin, polymyxin B and polymyxin B3 display a moderate binding affinity for AGP. ITC and SPR showed there was no detectable binding affinity for colistin methansulfonate and colistin nona-peptide, suggesting both the positive charges of the diaminobutyric acid (Dab) side chains and the N-terminal fatty acyl chain of the polymyxin molecule are required to drive binding to AGP. In addition, the ITC and fluorometric data suggested that endogenous lipidic substances bound to AGP provide part of the polymyxin binding surface. A molecular model of the polymyxin B3–AGP F1*S complex was presented that illustrates the pivotal role of the N-terminal fatty acyl chain and the D-Phe6-L-Leu7 hydrophobic motif of polymyxin B3 for binding to the cleft-like ligand binding cavity of AGP F1*S variant. The model conforms with the entropy driven binding interaction characterized by ITC which suggests hydrophobic interactions coupled to desolvation events and conformational changes are the primary driving force for polymyxins binding to AGP. Collectively, the data are consistent with a role of this acute-phase reactant protein in the transport of polymyxins in plasma. PMID:22587817
Allosteric Signaling Is Bidirectional in an Outer-Membrane Transport Protein.
Sikora, Arthur; Joseph, Benesh; Matson, Morgan; Staley, Jacob R; Cafiso, David S
2016-11-01
In BtuB, the Escherichia coli TonB-dependent transporter for vitamin B 12 , substrate binding to the extracellular surface unfolds a conserved energy coupling motif termed the Ton box into the periplasm. This transmembrane signaling event facilitates an interaction between BtuB and the inner-membrane protein TonB. In this study, continuous-wave and pulse electron paramagnetic resonance in a native outer-membrane preparation demonstrate that signaling also occurs from the periplasmic to the extracellular surface in BtuB. The binding of a TonB fragment to the periplasmic interface alters the configuration of the second extracellular loop and partially dissociates a spin-labeled substrate analog. Moreover, mutants in the periplasmic Ton box that are transport-defective alter the binding site for vitamin B 12 in BtuB. This work demonstrates that the Ton box and the extracellular substrate binding site are allosterically coupled in BtuB, and that TonB binding may initiate a partial round of transport. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Shelburne, Samuel A.; Fang, Han; Okorafor, Nnaja; Sumby, Paul; Sitkiewicz, Izabela; Keith, David; Patel, Payal; Austin, Celest; Graviss, Edward A.; Musser, James M.; Chow, Dar-Chone
2007-01-01
Study of the maltose/maltodextrin binding protein MalE in Escherichia coli has resulted in fundamental insights into the molecular mechanisms of microbial transport. Whether gram-positive bacteria employ a similar pathway for maltodextrin transport is unclear. The maltodextrin binding protein MalE has previously been shown to be key to the ability of group A Streptococcus (GAS) to colonize the oropharynx, the major site of GAS infection in humans. Here we used a multifaceted approach to elucidate the function and binding characteristics of GAS MalE. We found that GAS MalE is a central part of a highly efficient maltodextrin transport system capable of transporting linear maltodextrins that are up to at least seven glucose molecules long. Of the carbohydrates tested, GAS MalE had the highest affinity for maltotriose, a major breakdown product of starch in the human oropharynx. The thermodynamics and fluorescence changes induced by GAS MalE-maltodextrin binding were essentially opposite those reported for E. coli MalE. Moreover, unlike E. coli MalE, GAS MalE exhibited no specific binding of maltose or cyclic maltodextrins. Our data show that GAS developed a transport system optimized for linear maltodextrins longer than two glucose molecules that has several key differences from its well-studied E. coli counterpart. PMID:17259319
The bacterial dicarboxylate transporter, VcINDY, uses a two-domain elevator-type mechanism
Mulligan, Christopher; Fenollar-Ferrer, Cristina; Fitzgerald, Gabriel A.; Vergara-Jaque, Ariela; Kaufmann, Desirée; Li, Yan; Forrest, Lucy R.; Mindell, Joseph A.
2016-01-01
Secondary transporters use alternating access mechanisms to couple uphill substrate movement to downhill ion flux. Most known transporters utilize a “rocking bundle” motion, where the protein moves around an immobile substrate binding site. However, the glutamate transporter homolog, GltPh, translocates its substrate binding site vertically across the membrane, an “elevator” mechanism. Here, we used the “repeat swap” approach to computationally predict the outward-facing state of the Na+/succinate transporter VcINDY, from Vibrio cholerae. Our model predicts a substantial “elevator”-like movement of vcINDY’s substrate binding site, with a vertical translation of ~15 Å and a rotation of ~43°; multiple disulfide crosslinks which completely inhibit transport provide experimental confirmation and demonstrate that such movement is essential. In contrast, crosslinks across the VcINDY dimer interface preserve transport, revealing an absence of large scale coupling between protomers. PMID:26828963
Bogdanov, Ivan V; Shenkarev, Zakhar O; Finkina, Ekaterina I; Melnikova, Daria N; Rumynskiy, Eugene I; Arseniev, Alexander S; Ovchinnikova, Tatiana V
2016-04-30
Plant lipid transfer proteins (LTPs) assemble a family of small (7-9 kDa) ubiquitous cationic proteins with an ability to bind and transport lipids as well as participate in various physiological processes including defense against phytopathogens. They also form one of the most clinically relevant classes of plant allergens. Nothing is known to date about correlation between lipid-binding and IgE-binding properties of LTPs. The garden pea Pisum sativum is widely consumed crop and important allergenic specie of the legume family. This work is aimed at isolation of a novel LTP from pea seeds and characterization of its structural, functional, and allergenic properties. Three novel lipid transfer proteins, designated as Ps-LTP1-3, were found in the garden pea Pisum sativum, their cDNA sequences were determined, and mRNA expression levels of all the three proteins were measured at different pea organs. Ps-LTP1 was isolated for the first time from the pea seeds, and its complete amino acid sequence was determined. The protein exhibits antifungal activity and is a membrane-active compound that causes a leakage from artificial liposomes. The protein binds various lipids including bioactive jasmonic acid. Spatial structure of the recombinant uniformly (13)C,(15)N-labelled Ps-LTP1 was solved by heteronuclear NMR spectroscopy. In solution the unliganded protein represents the mixture of two conformers (relative populations ~ 85:15) which are interconnected by exchange process with characteristic time ~ 100 ms. Hydrophobic residues of major conformer form a relatively large internal tunnel-like lipid-binding cavity (van der Waals volume comes up to ~1000 Å(3)). The minor conformer probably corresponds to the protein with the partially collapsed internal cavity. For the first time conformational heterogeneity in solution was shown for an unliganded plant lipid transfer protein. Heat denaturation profile and simulated gastrointestinal digestion assay showed that Ps-LTP1 displayed a high thermal and digestive proteolytic resistance proper for food allergens. The reported structural and immunological findings seem to describe Ps-LTP1 as potential cross-reactive allergen in LTP-sensitized patients, mostly Pru p 3(+) ones. Similarly to allergenic LTPs the potential IgE-binding epitope of Ps-LTP1 is located near the proposed entrance into internal cavity and could be involved in lipid-binding.
Melatonin transport into mitochondria.
Mayo, Juan C; Sainz, Rosa M; González-Menéndez, Pedro; Hevia, David; Cernuda-Cernuda, Rafael
2017-11-01
Melatonin is a well-known, nighttime-produced indole found in bacteria, eukaryotic unicellulars, animals or vascular plants. In vertebrates, melatonin is the major product of the pineal gland, which accounts for its increase in serum during the dark phase, but it is also produced by many other organs and cell types. Such a wide distribution is consistent with its multiple and well-described functions which include from the circadian regulation and adaptation to seasonal variations to immunomodulatory and oncostatic actions in different types of tumors. The discovery of its antioxidant properties in the early 1990s opened a new field of potential protective functions in multiple tissues. A special mention should be made regarding the nervous system, where the indole is considered a major neuroprotector. Furthermore, mitochondria appear as one of the most important targets for the indole's protective actions. Melatonin's mechanisms of action vary from the direct molecular interaction with free radicals (free radical scavenger) to the binding to membrane (MLT1A and MLT1B) or nuclear receptors (RZR/RORα). Receptor binding has been associated with some, but not all of the indole functions reported to date. Recently, two new mechanisms of cellular uptake involving the facilitative glucose transporters GLUT/SLC2A and the proton-driven oligopeptide transporter PEPT1/2 have been reported. Here we discuss the potential importance that these newly discovered transport systems could have in determining the actions of melatonin, particularly in the mitochondria. We also argue the relative importance of passive diffusion vs active transport in different parts of the cell.
Lipid - Motor Interactions: Soap Opera or Symphony?
Pathak, Divya; Mallik, Roop
2017-02-01
Intracellular transport of organelles can be driven by multiple motor proteins that bind to the lipid membrane of the organelle and work as a team. We review present knowledge on how lipids orchestrate the recruitment of motors to a membrane. Looking beyond recruitment, we also discuss how heterogeneity and local mechanical properties of the membrane may influence function of motor-teams. These issues gain importance because phagocytosed pathogens use lipid-centric strategies to manipulate motors and survive in host cells. Copyright © 2016 Elsevier Ltd. All rights reserved.
Comparison of mechanistic transport cycle models of ABC exporters.
Szöllősi, Dániel; Rose-Sperling, Dania; Hellmich, Ute A; Stockner, Thomas
2018-04-01
ABC (ATP binding cassette) transporters, ubiquitous in all kingdoms of life, carry out essential substrate transport reactions across cell membranes. Their transmembrane domains bind and translocate substrates and are connected to a pair of nucleotide binding domains, which bind and hydrolyze ATP to energize import or export of substrates. Over four decades of investigations into ABC transporters have revealed numerous details from atomic-level structural insights to their functional and physiological roles. Despite all these advances, a comprehensive understanding of the mechanistic principles of ABC transporter function remains elusive. The human multidrug resistance transporter ABCB1, also referred to as P-glycoprotein (P-gp), is one of the most intensively studied ABC exporters. Using ABCB1 as the reference point, we aim to compare the dominating mechanistic models of substrate transport and ATP hydrolysis for ABC exporters and to highlight the experimental and computational evidence in their support. In particular, we point out in silico studies that enhance and complement available biochemical data. "This article is part of a Special Issue entitled: Beyond the Structure-Function Horizon of Membrane Proteins edited by Ute Hellmich, Rupak Doshi and Benjamin McIlwain." Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Gonzalez, Paulina; Bossak, Karolina; Stefaniak, Ewelina; Hureau, Christelle; Raibaut, Laurent; Bal, Wojciech; Faller, Peter
2018-06-07
Peptides and proteins with N-terminal amino acid sequences NH 2 -Xxx-His (XH) and NH 2 -Xxx-Zzz-His (XZH) form well-established high-affinity Cu II -complexes. Key examples are Asp-Ala-His (in serum albumin) and Gly-His-Lys, the wound healing factor. This opens a straightforward way to add a high-affinity Cu II -binding site to almost any peptide or protein, by chemical or recombinant approaches. Thus, these motifs, NH 2 -Xxx-Zzz-His in particular, have been used to equip peptides and proteins with a multitude of functions based on the redox activity of Cu, including nuclease, protease, glycosidase, or oxygen activation properties, useful in anticancer or antimicrobial drugs. More recent research suggests novel biological functions, mainly based on the redox inertness of Cu II in XZH, like PET imaging (with 64 Cu), chelation therapies (for instance in Alzheimer's disease and other types of neurodegeneration), antioxidant units, Cu transporters and activation of biological functions by strong Cu II binding. This Review gives an overview of the chemical properties of Cu-XH and -XZH motifs and discusses the pros and cons of the vastly different biological applications, and how they could be improved depending on the application. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Zhao, Qin; Wang, Chengcheng; Wang, Chengyuan; Guo, Hui; Bao, Zhihao; Zhang, Minhua; Zhang, Peng
2015-07-01
Energy-coupling factor (ECF) transporters are a new family of ABC transporters that consist of four subunits, two cytoplasmic ATPases EcfA and EcfA' and two transmembrane proteins namely EcfS for substrate-specific binding and EcfT for energy coupling. Here, we report the 3.2-Å resolution crystal structure of the EcfS protein of a folate ECF transporter from Enterococcus faecalis-EfFolT, a close homologue of FolT from Lactobacillus brevis-LbFolT. Structural and biochemical analyses reveal the residues constituting the folate-binding pocket and determining the substrate-binding specificity. Structural comparison of the folate-bound EfFolT with the folate-free LbFolT contained in the holotransporter complex discloses significant conformational change at the L1 loop, and reveals a gating mechanism of ECF transporters in which the L1 loop of EcfS acts as a gate in the substrate binding and release.
An Aromatic Cap Seals the Substrate Binding Site in an ECF-Type S Subunit for Riboflavin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karpowich, Nathan K.; Song, Jinmei; Wang, Da-Neng
2016-06-13
ECF transporters are a family of active membrane transporters for essential micronutrients, such as vitamins and trace metals. Found exclusively in archaea and bacteria, these transporters are composed of four subunits: an integral membrane substrate-binding subunit (EcfS), a transmembrane coupling subunit (EcfT), and two ATP-binding cassette ATPases (EcfA and EcfA'). We have characterized the structural basis of substrate binding by the EcfS subunit for riboflavin from Thermotoga maritima, TmRibU. TmRibU binds riboflavin with high affinity, and the protein–substrate complex is exceptionally stable in solution. The crystal structure of riboflavin-bound TmRibU reveals an electronegative binding pocket at the extracellular surface inmore » which the substrate is completely buried. Analysis of the intermolecular contacts indicates that nearly every available substrate hydrogen bond is satisfied. A conserved aromatic residue at the extracellular end of TM5, Tyr130, caps the binding site to generate a substrate-bound, occluded state, and non-conservative mutation of Tyr130 reduces the stability of this conformation. Using a novel fluorescence binding assay, we find that an aromatic residue at this position is essential for high-affinity substrate binding. Comparison with other S subunit structures suggests that TM5 and Loop5-6 contain a dynamic, conserved motif that plays a key role in gating substrate entry and release by S subunits of ECF transporters.« less
Abdullahi, Wazir; Davis, Thomas P; Ronaldson, Patrick T
2017-07-01
Drug delivery to the central nervous system (CNS) is greatly limited by the blood-brain barrier (BBB). Physical and biochemical properties of the BBB have rendered treatment of CNS diseases, including those with a hypoxia/reoxygenation (H/R) component, extremely difficult. Targeting endogenous BBB transporters from the ATP-binding cassette (ABC) superfamily (i.e., P-glycoprotein (P-gp)) or from the solute carrier (SLC) family (i.e., organic anion transporting polypeptides (OATPs in humans; Oatps in rodents)) has been suggested as a strategy that can improve delivery of drugs to the brain. With respect to P-gp, direct pharmacological inhibition using small molecules or selective regulation by targeting intracellular signaling pathways has been explored. These approaches have been largely unsuccessful due to toxicity issues and unpredictable pharmacokinetics. Therefore, our laboratory has proposed that optimization of CNS drug delivery, particularly for treatment of diseases with an H/R component, can be achieved by targeting Oatp isoforms at the BBB. As the major drug transporting Oatp isoform, Oatp1a4 has demonstrated blood-to-brain transport of substrate drugs with neuroprotective properties. Furthermore, our laboratory has shown that targeting Oatp1a4 regulation (i.e., TGF-β signaling mediated via the ALK-1 and ALK-5 transmembrane receptors) represents an opportunity to control Oatp1a4 functional expression for the purpose of delivering therapeutics to the CNS. In this review, we will discuss limitations of targeting P-gp-mediated transport activity and the advantages of targeting Oatp-mediated transport. Through this discussion, we will also provide critical information on novel approaches to improve CNS drug delivery by targeting endogenous uptake transporters expressed at the BBB.
Cao, Kun; Li, Nan; Wang, Hongcui; Cao, Xin; He, Jiaojiao; Zhang, Bing; He, Qing-Yu; Zhang, Gong; Sun, Xuesong
2018-04-20
Zinc is an essential metal in bacteria. One important bacterial zinc transporter is AdcA, and most bacteria possess AdcA homologs that are single-domain small proteins due to better efficiency of protein biogenesis. However, a double-domain AdcA with two zinc-binding sites is significantly overrepresented in Streptococcus species, many of which are major human pathogens. Using molecular simulation and experimental validations of AdcA from Streptococcus pyogenes , we found here that the two AdcA domains sequentially stabilize the structure upon zinc binding, indicating an organization required for both increased zinc affinity and transfer speed. This structural organization appears to endow Streptococcus species with distinct advantages in zinc-depleted environments, which would not be achieved by each single AdcA domain alone. This enhanced zinc transport mechanism sheds light on the significance of the evolution of the AdcA domain fusion, provides new insights into double-domain transporter proteins with two binding sites for the same ion, and indicates a potential target of antimicrobial drugs against pathogenic Streptococcus species. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
NASA Technical Reports Server (NTRS)
Butler, J. H.; Hu, S.; Brady, S. R.; Dixon, M. W.; Muday, G. K.
1998-01-01
The N-1-naphthylphthalamic acid (NPA)-binding protein is part of the auxin efflux carrier, the protein complex that controls polar auxin transport in plant tissues. This study tested the hypothesis that the NPA-binding protein (NBP) is associated with the actin cytoskeleton in vitro and that an intact actin cytoskeleton is required for polar auxin transport in vivo. Cytoskeletal polymerization was altered in extracts of zucchini hypocotyls with reagents that stabilized either the polymeric or monomeric forms of actin or tubulin. Phalloidin treatment altered actin polymerization, as demonstrated by immunoblot analyses following native and denaturing electrophoresis. Phalloidin increased both filamentous actin (F-actin) and NPA-binding activity, while cytochalasin D and Tris decreased both F-actin and NPA-binding activity in cytoskeletal pellets. The microtubule stabilizing drug taxol increased pelletable tubulin, but did not alter either the amount of pelletable actin or NPA-binding activity. Treatment of etiolated zucchini hypocotyls with cytochalasin D decreased the amount of auxin transport and its regulation by NPA. These experimental results are consistent with an in vitro actin cytoskeletal association of the NPA-binding protein and with the requirement of an intact actin cytoskeleton for maximal polar auxin transport in vivo.
Fischer, Marcus; Hopkins, Adam P.; Severi, Emmanuele; Hawkhead, Judith; Bawdon, Daniel; Watts, Andrew G.; Hubbard, Roderick E.; Thomas, Gavin H.
2015-01-01
Tripartite ATP-independent periplasmic (TRAP) transporters are secondary transporters that have evolved an obligate dependence on a substrate-binding protein (SBP) to confer unidirectional transport. Different members of the DctP family of TRAP SBPs have binding sites that recognize a diverse range of organic acid ligands but appear to only share a common electrostatic interaction between a conserved arginine and a carboxylate group in the ligand. We investigated the significance of this interaction using the sialic acid-specific SBP, SiaP, from the Haemophilus influenzae virulence-related SiaPQM TRAP transporter. Using in vitro, in vivo, and structural methods applied to SiaP, we demonstrate that the coordination of the acidic ligand moiety of sialic acid by the conserved arginine (Arg-147) is essential for the function of the transporter as a high affinity scavenging system. However, at high substrate concentrations, the transporter can function in the absence of Arg-147 suggesting that this bi-molecular interaction is not involved in further stages of the transport cycle. As well as being required for high affinity binding, we also demonstrate that the Arg-147 is a strong selectivity filter for carboxylate-containing substrates in TRAP transporters by engineering the SBP to recognize a non-carboxylate-containing substrate, sialylamide, through water-mediated interactions. Together, these data provide biochemical and structural support that TRAP transporters function predominantly as high affinity transporters for carboxylate-containing substrates. PMID:26342690
Calcium binding and transport by coenzyme Q.
Bogeski, Ivan; Gulaboski, Rubin; Kappl, Reinhard; Mirceski, Valentin; Stefova, Marina; Petreska, Jasmina; Hoth, Markus
2011-06-22
Coenzyme Q10 (CoQ10) is one of the essential components of the mitochondrial electron-transport chain (ETC) with the primary function to transfer electrons along and protons across the inner mitochondrial membrane (IMM). The concomitant proton gradient across the IMM is essential for the process of oxidative phosphorylation and consequently ATP production. Cytochrome P450 (CYP450) monoxygenase enzymes are known to induce structural changes in a variety of compounds and are expressed in the IMM. However, it is unknown if CYP450 interacts with CoQ10 and how such an interaction would affect mitochondrial function. Using voltammetry, UV-vis spectrometry, electron paramagnetic resonance (EPR), nuclear magnetic resonance (NMR), fluorescence microscopy and high performance liquid chromatography-mass spectrometry (HPLC-MS), we show that both CoQ10 and its analogue CoQ1, when exposed to CYP450 or alkaline media, undergo structural changes through a complex reaction pathway and form quinone structures with distinct properties. Hereby, one or both methoxy groups at positions 2 and 3 on the quinone ring are replaced by hydroxyl groups in a time-dependent manner. In comparison with the native forms, the electrochemically reduced forms of the new hydroxylated CoQs have higher antioxidative potential and are also now able to bind and transport Ca(2+) across artificial biomimetic membranes. Our results open new perspectives on the physiological importance of CoQ10 and its analogues, not only as electron and proton transporters, but also as potential regulators of mitochondrial Ca(2+) and redox homeostasis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hsu, Hao-Chi; Tong, Simon; Zhou, Yuchen
Human FABP5 and FABP7 are intracellular endocannabinoid transporters. SBFI-26 is an α-truxillic acid 1-naphthyl monoester that competitively inhibits the activities of FABP5 and FABP7 and produces antinociceptive and anti-inflammatory effects in mice. The synthesis of SBFI-26 yields several stereoisomers, and it is not known how the inhibitor binds the transporters. Here we report co-crystal structures of SBFI-26 in complex with human FABP5 and FABP7 at 2.2 and 1.9 Å resolution, respectively. We found that only (S)-SBFI-26 was present in the crystal structures. The inhibitor largely mimics the fatty acid binding pattern, but it also has several unique interactions. Notably, themore » FABP7 complex corroborates key aspects of the ligand binding pose at the canonical site previously predicted by virtual screening. In FABP5, SBFI-26 was unexpectedly found to bind at the substrate entry portal region in addition to binding at the canonical ligand-binding pocket. Our structural and binding energy analyses indicate that both R and S forms appear to bind the transporter equally well. We suggest that the S enantiomer observed in the crystal structures may be a result of the crystallization process selectively incorporating the (S)-SBFI-26–FABP complexes into the growing lattice, or that the S enantiomer may bind to the portal site more rapidly than to the canonical site, leading to an increased local concentration of the S enantiomer for binding to the canonical site. Our work reveals two binding poses of SBFI-26 in its target transporters. This knowledge will guide the development of more potent FABP inhibitors based upon the SBFI-26 scaffold.« less
Human Erythrocyte Glucose Transporter: Normal Asymmetric Orientation and Function in Liposomes
NASA Astrophysics Data System (ADS)
Chen, Chia-Chen; Kurokawa, Tomonori; Shaw, Shyh-Yu; Tillotson, Loyal G.; Kalled, Susan; Isselbacher, Kurt J.
1986-04-01
The transport function and orientation of the reconstituted human erythrocyte glucose transporter was studied with liposomes made with bovine brain lipid or Escherichia coli lipid. Reconstitution was achieved by a simple octyl glucoside dilution method. The reconstituted transporters with either lipid showed identical counterflow transport activity, the same response to various inhibitors, and characteristic cytochalasin B (CB) labeling. Functional location and purification of the glucose transporter was performed by using gel-permeation high-performance liquid chromatography with octyl glucoside-containing buffer. The reconstituted transport activity was associated only with band 4.5 protein (preactin) and not with band 3 protein. Both CB binding and transport function of the reconstituted transporters were resistant to trypsin but susceptible to chymotrypsin digestion. However, both trypsin and chymotrypsin treatment of unsealed ghosts completely eliminated the CB labeling and transport function of the glucose transporter. In our reconstitution system the glucose transporters maintained a normal asymmetrical (rightside-out) orientation and good transport function. A specific monoclonal antibody against the glucose transporter inhibited CB labeling of the transporters on unsealed ghosts. This was not found with the reconstituted system; however, after freeze-thawing there was a significant inhibition of CB binding by the antibody. These findings suggest that the CB-binding site of the reconstituted transporter is on the inner side of the proteoliposomes.
The transition in hemoglobin proton-binding characteristics within the basal actinopterygian fishes.
Regan, Matthew Daniel; Brauner, Colin J
2010-04-01
Carbon dioxide (CO(2)) transport in the blood of fishes is aided by the proton-binding properties of hemoglobin (Hb) through either a high-intrinsic buffer value and small oxylabile proton binding (Haldane effect), or a low buffer value and large Haldane effect. Primitive species, such as elasmobranchs and sarcopterygians have been shown to rely on the former, while derived species, such as teleosts rely on the latter. Both strategies are effective in the transport of CO(2) in the blood. However, there is a paucity of information on the nature of the transition between these two strategies that appears to occur within the intermediate group of fishes, the basal actinopterygians. The objective of the present study was to simultaneously assess the intrinsic Hb buffer values and Haldane effects of species within the basal actinopterygian lineage to characterize the transition in Hb-proton-binding strategy seen among the fishes. Expressed in order of most basal to most derived, the species investigated included American paddlefish (Polyodon spathula), white sturgeon (Acipenser transmontanus), spotted gar (Lepisosteus oculatus), alligator gar (Atractosteus spatula), bowfin (Amia calva), and mooneye (Hiodon tergisus). Hemolysates from these species were prepared and Hb titrations (under oxygenated and deoxygenated conditions) were performed in both the presence and absence of saturating levels of organic phosphates (GTP). The findings suggest that the nature of the Hb-proton-binding transition may have been punctuated rather than gradual, with the Hb buffer value decreasing and the Haldane effect increasing significantly in bowfin from fairly steady ancestral levels in the four more basal species. This change is coupled with the initial appearance of the choroid rete, as well as an increase in the magnitude and onset pH of the Root effect in bowfin, suggesting that the change in Hb-proton-binding strategy may be associated with the evolution of enhanced O(2) delivery to the eye and an in vivo operational Root effect.
Positive selection in octopus haemocyanin indicates functional links to temperature adaptation.
Oellermann, Michael; Strugnell, Jan M; Lieb, Bernhard; Mark, Felix C
2015-07-05
Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the active centre, suggesting a role as allosteric binding site. The prevalence of methionine at this site in polar octopods, implies regulation of oxygen affinity via increased sensitivity to allosteric metal binding. High sequence conservation of sites directly involved in oxygen binding indicates that functional modifications of octopod haemocyanin rather occur via more subtle mechanisms, as observed in this study.
Choline Uptake in Agrobacterium tumefaciens by the High-Affinity ChoXWV Transporter▿
Aktas, Meriyem; Jost, Kathinka A.; Fritz, Christiane; Narberhaus, Franz
2011-01-01
Agrobacterium tumefaciens is a facultative phytopathogen that causes crown gall disease. For successful plant transformation A. tumefaciens requires the membrane lipid phosphatidylcholine (PC), which is produced via the methylation and the PC synthase (Pcs) pathways. The latter route is dependent on choline. Although choline uptake has been demonstrated in A. tumefaciens, the responsible transporter(s) remained elusive. In this study, we identified the first choline transport system in A. tumefaciens. The ABC-type choline transporter is encoded by the chromosomally located choXWV operon (ChoX, binding protein; ChoW, permease; and ChoV, ATPase). The Cho system is not critical for growth and PC synthesis. However, [14C]choline uptake is severely reduced in A. tumefaciens choX mutants. Recombinant ChoX is able to bind choline with high affinity (equilibrium dissociation constant [KD] of ≈2 μM). Since other quaternary amines are bound by ChoX with much lower affinities (acetylcholine, KD of ≈80 μM; betaine, KD of ≈470 μM), the ChoXWV system functions as a high-affinity transporter with a preference for choline. Two tryptophan residues (W40 and W87) located in the predicted ligand-binding pocket are essential for choline binding. The structural model of ChoX built on Sinorhizobium meliloti ChoX resembles the typical structure of substrate binding proteins with a so-called “Venus flytrap mechanism” of substrate binding. PMID:21803998
An Expanding Range of Functions for the Copper Chaperone/Antioxidant Protein Atox1
Hatori, Yuta
2013-01-01
Abstract Significance: Antioxidant protein 1 (Atox1 in human cells) is a copper chaperone for the copper export pathway with an essential role in cellular copper distribution. In vitro, Atox1 binds and transfers copper to the copper-transporting ATPases, stimulating their catalytic activity. Inactivation of Atox1 in cells inhibits maturation of secreted cuproenzymes as well as copper export from cells. Recent Advances: Accumulating data suggest that cellular functions of Atox1 are not limited to its copper-trafficking role and may include storage of labile copper, modulation of transcription, and antioxidant defense. The conserved metal binding site of Atox1, CxGC, differs from the metal-binding sites of copper-transporting ATPases and has a physiologically relevant redox potential that equilibrates with the GSH:GSSG pair. Critical Issues: Tight relationship appears to exist between intracellular copper levels and glutathione (GSH) homeostasis. The biochemical properties of Atox1 place it at the intersection of cellular networks that regulate copper distribution and cellular redox balance. Mechanisms through which Atox1 facilitates copper export and contributes to oxidative defense are not fully understood. Future Directions: The current picture of cellular redox homeostasis and copper physiology will be enhanced by further mechanistic studies of functional interactions between the GSH:GSSG pair and copper-trafficking machinery. Antioxid. Redox Signal. 19, 945–957. PMID:23249252
USDA-ARS?s Scientific Manuscript database
ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...
Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations
Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère
1998-01-01
To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896
Single molecule junction conductance and binding geometry
NASA Astrophysics Data System (ADS)
Kamenetska, Maria
This Thesis addresses the fundamental problem of controlling transport through a metal-organic interface by studying electronic and mechanical properties of single organic molecule-metal junctions. Using a Scanning Tunneling Microscope (STM) we image, probe energy-level alignment and perform STM-based break junction (BJ) measurements on molecules bound to a gold surface. Using Scanning Tunneling Microscope-based break-junction (STM-BJ) techniques, we explore the effect of binding geometry on single-molecule conductance by varying the structure of the molecules, metal-molecule binding chemistry and by applying sub-nanometer manipulation control to the junction. These experiments are performed both in ambient conditions and in ultra high vacuum (UHV) at cryogenic temperatures. First, using STM imaging and scanning tunneling spectroscopy (STS) measurements we explore binding configurations and electronic properties of an amine-terminated benzene derivative on gold. We find that details of metal-molecule binding affect energy-level alignment at the interface. Next, using the STM-BJ technique, we form and rupture metal-molecule-metal junctions ˜104 times to obtain conductance-vs-extension curves and extract most likely conductance values for each molecule. With these measurements, we demonstrated that the control of junction conductance is possible through a choice of metal-molecule binding chemistry and sub-nanometer positioning. First, we show that molecules terminated with amines, sulfides and phosphines bind selectively on gold and therefore demonstrate constant conductance levels even as the junction is elongated and the metal-molecule attachment point is modified. Such well-defined conductance is also obtained with paracyclophane molecules which bind to gold directly through the pi system. Next, we are able to create metal-molecule-metal junctions with more than one reproducible conductance signatures that can be accessed by changing junction geometry. In the case of pyridine-linked molecules, conductance can be reliably switched between two distinct conductance states using sub-nanometer mechanical manipulation. Using a methyl sulfide linker attached to an oligoene backbone, we are able to create a 3-nm-long molecular potentiometer, whose resistance can be tuned exponentially with Angstom-scale modulations in metal-molecule configuration. These experiments points to a new paradigm for attaining reproducible electrical characteristics of metal-organic devices which involves controlling linker-metal chemistry rather than fabricating identically structured metal-molecule interfaces. By choosing a linker group which is either insensitive to or responds reproducibly to changes in metal-molecule configuration, one can design single molecule devices with functionality more complex than a simple resistor. These ambient temperature experiments were combined with UHV conductance measurements performed in a commercial STM on amine-terminated benzene derivatives which conduct through a non-resonant tunneling mechanism, at temperatures varying from 5 to 300 Kelvin. Our results indicate that while amine-gold binding remains selective irrespective of environment, conductance is not temperature independent, in contrast to what is expected for a tunneling mechanism. Furthermore, using temperature-dependent measurements in ambient conditions we find that HOMO-conducting amines and LUMO-conducting pyridines show opposite dependence of conductance on temperature. These results indicate that energy-level alignment between the molecule and the electrodes changes as a result of varying electrode structure at different temperatures. We find that temperature can serve as a knob with which to tune transport properties of single molecule-metal junctions.
Cytosine arabinoside influx and nucleoside transport sites in acute leukemia.
Wiley, J S; Jones, S P; Sawyer, W H; Paterson, A R
1982-02-01
Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells, since mean influxes for myeloblasts and lymphoblasts were 6- and 2.3-fold greater than polymorphs and lymphocytes, respectively. Also, the mean influx for myeloblasts was fourfold greater than the mean for lymphoblasts. The number of nucleoside transport sites was estimated for each cell type by measuring the equilibrium binding of [(3)H]nitrobenzylthioinosine (NBMPR), which inhibits nucleoside fluxes by binding with high affinity to specific sites on the transport mechanism. The mean binding site numbers for myeloblasts and lymphoblasts were 5- and 2.8-fold greater, respectively, than for the mature cells of the same maturation series. The mean number of NBMPR binding sites for myeloblasts was fourfold greater than for lymphoblasts. Patients with AUL were heterogeneous since blasts from some gave values within the myeloblastic range and others within the lymphoblastic range. The araC influx correlated closely with the number of NBMPR binding sites measured in the same cells on the same day. Transport parameters were measured on blasts from 15 patients with AML or AUL who were then treated with standard induction therapy containing araC. Eight patients entered complete remission, while seven failed therapy, among whom were the three patients with the lowest araC influx (<0.4 pmol/10(7) cells per min) and NBMPR binding (<3,000 sites/cell) for the treated group. In summary, myeloblasts have both higher araC transport rates and more nucleoside transport sites than lymphoblasts and this factor may contribute to the greater sensitivity of AML to this drug. AraC transport varied >10-fold between leukemic blasts and normal leukocytes, but transport capacity related directly to the number of nucleoside transport sites on the cell. Finally, low araC transport rates or few NBMPR binding sites on blasts were observed in a subset of patients with acute leukemia who failed to achieve remission with drug combinations containing araC.
NASA Astrophysics Data System (ADS)
Laghaei, M.; Heidari Semiromi, E.
2018-03-01
Quantum transport properties and spin polarization in hexagonal graphene nanostructures with zigzag edges and different sizes were investigated in the presence of Rashba spin-orbit interaction (RSOI). The nanostructure was considered as a channel to which two semi-infinite armchair graphene nanoribbons were coupled as input and output leads. Spin transmission and spin polarization in x, y, and z directions were calculated through applying Landauer-Buttiker formalism with tight binding model and the Green's function to the system. In these quantum structures it is shown that changing the size of system, induce and control the spin polarized currents. In short, these graphene systems are typical candidates for electrical spintronic devices as spin filtering.
Hydration of AMP and ATP molecules in aqueous solution and solid films.
Faizullin, Dzhigangir; Zakharchenko, Nataliya; Zuev, Yuriy; Puzenko, Alexander; Levy, Evgeniya; Feldman, Yuri
2013-11-20
Water enables life and plays a critical role in biology. Considered as a versatile and adaptive component of the cell, water engages a wide range of biomolecular interactions. An organism can exist and function only if its self-assembled molecular structures are hydrated. It was shown recently that switching of AMP/ATP binding to the insulin-independent glucose transporter Human Erythrocyte Glucose Transport Protein (GLUT1) may greatly influence the ratio of bulk and bound water during regulation of glucose uptake by red blood cells. In this paper, we present the results on the hydration properties of AMP/ATP obtained by means of dielectric spectroscopy in aqueous solution and for fully ionized forms in solid amorphous films with the help of gravimetric studies.
Kerr, Ian D; Jones, Peter M; George, Anthony M
2010-02-01
One of the Holy Grails of ATP-binding cassette transporter research is a structural understanding of drug binding and transport in a eukaryotic multidrug resistance pump. These transporters are front-line mediators of drug resistance in cancers and represent an important therapeutic target in future chemotherapy. Although there has been intensive biochemical research into the human multidrug pumps, their 3D structure at atomic resolution remains unknown. The recent determination of the structure of a mouse P-glycoprotein at subatomic resolution is complemented by structures for a number of prokaryotic homologues. These structures have provided advances into our knowledge of the ATP-binding cassette exporter structure and mechanism, and have provided the template data for a number of homology modelling studies designed to reconcile biochemical data on these clinically important proteins.
Aza-Bambusurils En Route to Anion Transporters.
Singh, Mandeep; Solel, Ephrath; Keinan, Ehud; Reany, Ofer
2016-06-20
Previous calculations of anion binding with various bambusuril analogs predicted that the replacement of oxygen by nitrogen atoms to produce semiaza-bambus[6]urils would award these new cavitands with multiple anion binding properties. This study validates the hypothesis by efficient synthesis, crystallography, thermogravimetric analysis and calorimetry. These unique host molecules are easily accessible from the corresponding semithio-bambusurils in a one-pot reaction, which converts a single anion receptor into a potential anion channel. Solid-state structures exhibit simultaneous accommodation of three anions, linearly positioned within the cavity along the main symmetry axis. The ability to hold anions at a short distance of about 4 Å is reminiscent of natural chloride channels in E. coli, which exhibit similar distances between their adjacent anion binding sites. The calculated transition-state energy for double-anion movement through the channel suggests that although these host-guest complexes are thermodynamically stable they enjoy high kinetic flexibility to render them efficient anion channels. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Kwapiński, Tomasz
2017-03-01
The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.
Wear and interfacial transport of material
NASA Technical Reports Server (NTRS)
Buckley, D. H.
1975-01-01
Bonding across the interface for two solids in contact and the subsequent transfer of material from one surface to another is a direct result of the interfacial bonds being stronger than the cohesive bonds in either of the two solids. Surface tools such as LEED, Auger emission spectroscopy, field ion microscopy, and the atom probe are used to examine adhesive contacts and to determine the direction, nature, quantity of material transfer and properties of the solids which effect transfer and wear. The electronic nature, cohesive binding energies, surface structure, lattice disregistry and distribution of species in surface layers are all found to effect adhesion and transfer or transport for clean surfaces in solid state contact. The influence of adsorbed and reacted surface films from fractions of a monolayer to multilayer reactive films are considered. It is shown that even fractions of a monolayer of surface active species such as oxygen and sulfur can markedly inhibit adhesion and transport.
Diallinas, George
2014-01-01
Transporters are ubiquitous proteins mediating the translocation of solutes across cell membranes, a biological process involved in nutrition, signaling, neurotransmission, cell communication and drug uptake or efflux. Similarly to enzymes, most transporters have a single substrate binding-site and thus their activity follows Michaelis-Menten kinetics. Substrate binding elicits a series of structural changes, which produce a transporter conformer open toward the side opposite to the one from where the substrate was originally bound. This mechanism, involving alternate outward- and inward-facing transporter conformers, has gained significant support from structural, genetic, biochemical and biophysical approaches. Most transporters are specific for a given substrate or a group of substrates with similar chemical structure, but substrate specificity and/or affinity can vary dramatically, even among members of a transporter family that show high overall amino acid sequence and structural similarity. The current view is that transporter substrate affinity or specificity is determined by a small number of interactions a given solute can make within a specific binding site. However, genetic, biochemical and in silico modeling studies with the purine transporter UapA of the filamentous ascomycete Aspergillus nidulans have challenged this dogma. This review highlights results leading to a novel concept, stating that substrate specificity, but also transport kinetics and transporter turnover, are determined by subtle intramolecular interactions between a major substrate binding site and independent outward- or cytoplasmically-facing gating domains, analogous to those present in channels. This concept is supported by recent structural evidence from several, phylogenetically and functionally distinct transporter families. The significance of this concept is discussed in relationship to the role and potential exploitation of transporters in drug action. PMID:25309439
Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya
2014-07-01
Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which oftenmore » takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.« less
NASA Astrophysics Data System (ADS)
Vinodha, M.; Senthilkumar, K.
2018-05-01
The structure-activity relationship of fused π-conjugated imidazolium cation with three counter anion molecules, BF4-, CF3SO3- and (CF3SO2)2N-, was studied using electronic structure calculations. The structural, opto-electronic and charge transport properties of these complexes were studied. The charge transfer from π-conjugated imidazolium(I) to counter anion was confirmed in all the studied complexes. Interaction energy varies significantly depending on the counter anion and the stability was found higher for I-BF4 complex than both I-CF3SO3 and I-(CF3SO2)2N complexes. The strong (C-H)+...F- hydrogen bond of length 1.95 Å between fused π-conjugated imidazolium and BF-4 anion is the driving force for the strongest interaction energy in I-BF4 complex. The energy decomposition analysis confirms that the interaction between imidazolium and counter anion is mainly driven by electrostatic and orbital interaction. It has been observed that the absorption spectra of the complex are independent of anion nature but the influence of anion character is observed on frontier molecular orbital pattern. The charge transport property of I-BF4 complex was studied by using tight-binding Hamiltonian approach and found that the hole mobility in I-BF4 is 1.13 × 10-4 cm2 V-1 s-1.
Toninello, A; Via, L D; Di Noto, V; Mancon, M
1999-12-15
This study evaluated the effect of the anticancer drug methylglyoxal-bis(guanylhydrazone) (MGBG) on the binding of the polyamine spermine to the mitochondrial membrane and its transport into the inner compartment of this organelle. Spermine binding was studied by applying a new thermodynamic treatment of ligand-receptor interactions (Di Noto et al., Macromol Theory Simul 5: 165-181, 1996). Results showed that MGBG inhibited the binding of spermine to the site competent for the first step in polyamine transport; the interaction of spermine with this site, termed S1, also mediates the inhibitory effect of the polyamine on the mitochondrial permeability transition (Dalla Via et al., Biochim Biophys Acta 1284: 247-252, 1996). In the presence of 1 mM MGBG, the binding capacity and affinity of this site were reduced by about 2.6-fold; on the contrary, the binding capacity of the S2 site, which is most likely responsible for the internalization of cytoplasmic proteins (see Dalla Via et al., reference cited above), increased by about 1.3-fold, and its binding affinity remained unaffected. MGBG also inhibited the initial rate of spermine transport in a dose-dependent manner by establishing apparently sigmoidal kinetics. Consequently, the total extent of spermine accumulation inside mitochondria was inhibited. This inhibition in transport seems to reflect a conformational change at the level of the channel protein constituting the polyamine transport system, rather than competitive inhibition at the inner active site of the channel, thereby excluding the possibility that the polyamine and drug use the same transport pathway. Furthermore, it is suggested that, in the presence of MGBG, the S2 site is able to participate in residual spermine transport. MGBG also strongly inhibits deltapH-dependent spermine efflux, resulting in a complete block in the bidirectional flux of the polyamine and its sequestration inside the matrix space. The effects of MGBG on spermine accumulation are consistent with in vivo disruption of the regulator of energy metabolism and replication of the mitochondrial genome.
Laakso, A; Bergman, J; Haaparanta, M; Vilkman, H; Solin, O; Hietala, J
1998-03-01
We have characterized the usage of [18F]CFT (also known as [18F]WIN 35,428) as a radioligand for in vivo studies of human dopamine transporter by PET. CFT was labeled with 18F to a high specific activity, and dynamic PET scans were conducted in healthy volunteers at various time points up to 5 h from [18F]CFT injection. The regional distribution of [18F]CFT uptake correlated well with the known distribution of dopaminergic nerve terminals in the human brain and also with that of other dopamine transporter radioligands. Striatal binding peaked at 225 min after injection and declined thereafter, demonstrating the reversible nature of the binding to the dopamine transporter. Therefore, due to the relatively long half-life of 18F (109.8 min), PET scans with [18F]CFT could easily be conducted during the binding equilibrium, allowing estimation of Bmax/Kd values (i.e., binding potential). Binding potentials for putamen and caudate measured at equilibrium were 4.79+/-0.11 and 4.50+/-0.23, respectively. We were able to also visualize midbrain dopaminergic neurons (substantia nigra) with [18F]CFT in some subjects. In conclusion, the labeling of CFT with 18F allows PET scans to be conducted at binding equilibrium, and therefore a high signal-to-noise ratio and reliable quantification of binding potential can be achieved. With a high resolution 3D PET scanner, the quantification of extrastriatal dopamine transporters should become possible.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ding, Y.S.; Fowler, J.S.; Volkow, N.D.
1994-05-01
Methylphenidate (MP, ritalin) is a psychostimulant drug widely used to treat attention deficit hyperactivity disorder and narcolepsy. Its therapeutic properties are attributed to inhibition of the dopamine (DA) transporter enhancing synaptic DA. MP has two chiral centers and is marketed as the dl-threo racemic form. However, its pharmacological activity is believed due solely to the d-enantiomer. We have synthesized [{sup 11}C]d,l-threo-methylphenidate ([{sup 11}C]MP) in order to examine its pharmacokinetics in vivo and to examine its suitability as a radioligand for PET studies of the presynaptic DA neuron. [{sup 11}C]MP was prepared by O-{sup 11}C-alkylation of a protected derivative of ritalinicmore » acid with labeled methyl iodide. Serial studies at baseline and after treatment with methylphenidate (0.5 mg/kg, 20 min prior); GBR 12909 (1.5 mg/kg; 30 min prior); tomoxetine (1.5 mg/kg, 20 min prior) and citalopram (2.0 mg/kg, 30 min prior) were performed to assess non-specific binding and binding to the DA, norepinephrine and serotonin transporters respectively. Only MP and GBR 12909 changed the SR/CB distribution volume ratio (decrease of 38 and 37% respectively) demonstrating selectivity for DA transporters over other monoamine transporters. We then pursued the synthesis of enantiomerically pure C-{sup 11} labeled d- and l-MP by using enantiomerically pure protected d- and l-ritalinic acids as precursors. A striking difference in SR/CB ratio (3.3 and 1.1 for d- and l-respectively at 1 hr. after i.v. injections) strongly suggests that the pharmacological specificity of MP resides entirely in the d-isomer and the binding of l-isomer was mostly non-specific. Further evaluations are underway. Radioligand reversibility, selectivity and the fact that MP is an approved drug are advantages of using [{sup 11}C]MP.« less
Sekula, Bartosz; Ciesielska, Anna; Rytczak, Przemyslaw; Koziołkiewicz, Maria; Bujacz, Anna
2016-07-01
Cyclic phosphatidic acids (cPAs) are naturally occurring, very active signalling molecules, which are involved in several pathological states, such as cancer, diabetes or obesity. As molecules of highly lipidic character found in the circulatory system, cPAs are bound and transported by the main extracellular lipid binding protein-serum albumin. Here, we present the detailed interactions between human serum albumin (HSA) and equine serum albumin (ESA) with a derivative of cPA, 1-O-myristoyl-sn-glycerol-2,3-cyclic phosphorodithioate (Myr-2S-cPA). Initial selection of the ligand used for the structural study was made by the analysis of the therapeutically promising properties of the sulfur containing analogues of cPA in respect to the unmodified lysophospholipids (LPLs). Substitution of one or two non-bridging oxygen atoms in the phosphate group with one or two sulfur atoms increases the cytotoxic effect of cPAs up to 60% on the human prostate cancer (PC) cells. Myr-2S-cPA reduces cancer cell viability in a dose-dependent manner, with IC50 value of 29.0 μM after 24 h incubation, which is almost 30% lower than IC50 of single substituted phosphorothioate cPA. Although, the structural homology between HSA and ESA is big, their crystal complexes with Myr-2S-cPA demonstrate significantly different mode of binding of this LPL analogue. HSA binds three molecules of Myr-2S-cPA, whereas ESA only one. Moreover, none of the identified Myr-2S-cPA binding sites overlap in both albumins. © 2016 The Author(s).
Nakashima, Keisuke; Nakamura, Takumi; Takeuchi, Satoshi; Shibata, Mikihiro; Demura, Makoto; Tahara, Tahei; Kandori, Hideki
2009-06-18
Halorhodopsin (HR) is a light-driven chloride pump. Cl(-) is bound in the Schiff base region of the retinal chromophore, and unidirectional Cl(-) transport is probably enforced by the specific hydrogen-bonding interaction with the protonated Schiff base and internal water molecules. It is known that HR from Natronobacterium pharaonis (pHR) also pumps NO(3)(-) with similar efficiency, suggesting that NO(3)(-) binds to the Cl(-)-binding site. In the present study, we investigated the properties of the anion-binding site by means of ultrafast pump-probe spectroscopy and low-temperature FTIR spectroscopy. The obtained data were surprisingly similar between pHR-NO(3)(-) and pHR-Cl(-), even though the shapes and sizes of the two anions are quite different. Femtosecond pump-probe spectroscopy showed very similar excited-state dynamics between pHR-NO(3)(-) and pHR-Cl(-). Low-temperature FTIR spectroscopy of unlabeled and [zeta-(15)N]Lys-labeled pHR revealed almost identical hydrogen-bonding strengths of the protonated retinal Schiff base between pHR-NO(3)(-) and pHR-Cl(-), which is similarly strengthened after retinal isomerization. There were spectral variations for water stretching vibrations between pHR-NO(3)(-) and pHR-Cl(-), suggesting that the water molecules hydrate each anion. Nevertheless, the overall spectral features were similar for the two species. These observations strongly suggest that the anion-binding site has a flexible structure and that the interaction between retinal and the anions is weak, despite the presence of an electrostatic interaction. Such a flexible hydrogen-bonding network in the Schiff base region in HR appears to be in remarkable contrast to that in light-driven proton-pumping proteins.
The cyanobacterial cytochrome b6f subunit PetP adopts an SH3 fold in solution.
Veit, Sebastian; Nagadoi, Aritaka; Rögner, Matthias; Rexroth, Sascha; Stoll, Raphael; Ikegami, Takahisa
2016-06-01
PetP is a peripheral subunit of the cytochrome b(6)f complex (b(6)f) present in both, cyanobacteria and red algae. It is bound to the cytoplasmic surface of this membrane protein complex where it greatly affects the efficiency of the linear photosynthetic electron flow although it is not directly involved in the electron transfer reactions. Despite the crystal structures of the b(6)f core complex, structural information for the transient regulatory b(6)f subunits is still missing. Here we present the first structure of PetP at atomic resolution as determined by solution NMR. The protein adopts an SH3 fold, which is a common protein motif in eukaryotes but comparatively rare in prokaryotes. The structure of PetP enabled the identification of the potential interaction site for b(6)f binding by conservation mapping. The interaction surface is mainly formed by two large loop regions and one short 310 helix which also exhibit an increased flexibility as indicated by heteronuclear steady-state {(1)H}-(15)N NOE and random coil index parameters. The properties of this potential b(6)f binding site greatly differ from the canonical peptide binding site which is highly conserved in eukaryotic SH3 domains. Interestingly, three other proteins of the photosynthetic electron transport chain share this SH3 fold with PetP: NdhS of the photosynthetic NADH dehydrogenase-like complex (NDH-1), PsaE of the photosystem 1 and subunit α of the ferredoxin-thioredoxin reductase have, similar to PetP, a great impact on the photosynthetic electron transport. Finally, a model is presented to illustrate how SH3 domains modulate the photosynthetic electron transport processes in cyanobacteria. Copyright © 2016 Elsevier B.V. All rights reserved.
Intracellular transport of fat-soluble vitamins A and E.
Kono, Nozomu; Arai, Hiroyuki
2015-01-01
Vitamins are compounds that are essential for the normal growth, reproduction and functioning of the human body. Of the 13 known vitamins, vitamins A, D, E and K are lipophilic compounds and are therefore called fat-soluble vitamins. Because of their lipophilicity, fat-soluble vitamins are solubilized and transported by intracellular carrier proteins to exert their actions and to be metabolized properly. Vitamin A and its derivatives, collectively called retinoids, are solubilized by intracellular retinoid-binding proteins such as cellular retinol-binding protein (CRBP), cellular retinoic acid-binding protein (CRABP) and cellular retinal-binding protein (CRALBP). These proteins act as chaperones that regulate the metabolism, signaling and transport of retinoids. CRALBP-mediated intracellular retinoid transport is essential for vision in human. α-Tocopherol, the main form of vitamin E found in the body, is transported by α-tocopherol transfer protein (α-TTP) in hepatic cells. Defects of α-TTP cause vitamin E deficiency and neurological disorders in humans. Recently, it has been shown that the interaction of α-TTP with phosphoinositides plays a critical role in the intracellular transport of α-tocopherol and is associated with familial vitamin E deficiency. In this review, we summarize the mechanisms and biological significance of the intracellular transport of vitamins A and E. © 2014 The Authors. Traffic published by John Wiley & Sons Ltd.
TonB-dependent ligand trapping in the BtuB transporter.
Mills, Allan; Le, Hai-Tuong; Duong, Franck
2016-12-01
TonB-dependent transporters are β-barrel outer membrane proteins occluded by a plug domain. Upon ligand binding, these transporters extend a periplasmic motif termed the TonB box. The TonB box permits the recruitment of the inner membrane protein complex TonB-ExbB-ExbD, which drives import of ligands in the cell periplasm. It is unknown precisely how the plug domain is moved aside during transport nor have the intermediate states between TonB recruitment and plug domain movement been characterized biochemically. Here we employ nanodiscs, native gel electrophoresis, and scintillation proximity assays to determine the binding kinetics of vitamin B 12 to BtuB. The results show that ligand-bound BtuB recruits a monomer of TonB (TonB ∆1-31 ), which in turn increases retention of vitamin B 12 within the transporter. The TonB box and the extracellular residue valine 90 that forms part of the vitamin B 12 binding site are essential for this event. These results identify a novel step in the TonB-dependent transport process. They show that TonB binding to BtuB trap the ligand, possibly until the ExbB-ExbD complex is activated or recruited to ensure subsequent transport. Copyright © 2016 Elsevier B.V. All rights reserved.
Derrer, Carmen; Wittek, Anke; Bamberg, Ernst; Carpaneto, Armando; Dreyer, Ingo; Geiger, Dietmar
2013-01-01
Proton-driven Suc transporters allow phloem cells of higher plants to accumulate Suc to more than 1 M, which is up to ∼1000-fold higher than in the surrounding extracellular space. The carrier protein can accomplish this task only because proton and Suc transport are tightly coupled. This study provides insights into this coupling by resolving the first step in the transport cycle of the Suc transporter SUT1 from maize (Zea mays). Voltage clamp fluorometry measurements combining electrophysiological techniques with fluorescence-based methods enable the visualization of conformational changes of SUT1 expressed in Xenopus laevis oocytes. Using the Suc derivate sucralose, binding of which hinders conformational changes of SUT1, the association of protons to the carrier could be dissected from transport-associated movements of the protein. These combined approaches enabled us to resolve the binding of protons to the carrier and its interrelationship with the alternating movement of the protein. The data indicate that the rate-limiting step of the reaction cycle is determined by the accessibility of the proton binding site. This, in turn, is determined by the conformational change of the SUT1 protein, alternately exposing the binding pockets to the inward and to the outward face of the membrane. PMID:23964025
NASA Astrophysics Data System (ADS)
Jean, Bernandie
The monoamine transporter (MAT) proteins responsible for the reuptake of the neurotransmitter substrates, dopamine, serotonin, and norepinephrine, are drug targets for the treatment of psychiatric disorders including depression, anxiety, and attention deficit hyperactivity disorder. Small molecules that inhibit these proteins can serve as useful therapeutic agents. However, some dopamine transporter (DAT) inhibitors, such as cocaine and methamphetamine, are highly addictive and abusable. Efforts have been made to develop small molecules that will inhibit the transporters and elucidate specific binding site interactions. This work provides knowledge of molecular interactions associated with MAT inhibitors by offering an atomistic perspective that can guide designs of new pharmacotherapeutics with enhanced activity. The work described herein evaluates intermolecular interactions using computational methods to reveal the mechanistic detail of inhibitors binding in the DAT. Because cocaine recognizes the extracellular-facing or outward-facing (OF) DAT conformation and benztropine recognizes the intracellular-facing or inward-facing (IF) conformation, it was postulated that behaviorally "typical" (abusable, locomotor psychostimulant) inhibitors stabilize the OF DAT and "atypical" (little or no abuse potential) inhibitors favor IF DAT. Indeed, behaviorally-atypical cocaine analogs have now been shown to prefer the OF DAT conformation. Specifically, the binding interactions of two cocaine analogs, LX10 and LX11, were studied in the OF DAT using molecular dynamics simulations. LX11 was able to interact with residues of transmembrane helix 8 and bind in a fashion that allowed for hydration of the primary binding site (S1) from the intracellular space, thus impacting the intracellular interaction network capable of regulating conformational transitions in DAT. Additionally, a novel serotonin transporter (SERT) inhibitor previously discovered through virtual screening at the SERT secondary binding site (S2) was studied. Intermolecular interactions between SM11 and SERT have been assessed using binding free energy calculations to predict the ligand-binding site and optimize ligand-binding interactions. Results indicate the addition of atoms to the 4-chlorobenzyl moiety were most energetically favorable. The simulations carried out in DAT and SERT were supported by experimental results. Furthermore, the co-crystal structures of DAT and SERT share similar ligand-binding interactions with the homology models used in this study.
Li, Yuelong; Yoo, Kicheon; Lee, Doh-Kwon; Kim, Jin Young; Kim, Honggon; Kim, Bongsoo; Ko, Min Jae
2013-06-07
An interparticle binding agent, or nanoglue, was synthesized by a sol-gel process, which facilitated the preparation of well-interconnected TiO2 electrodes at low-temperatures for plastic dye-sensitized solar cells. The viscosity of the nanoglue-based pastes was seven times higher than that obtained in pastes without any nanoglue. The increased viscosity was sufficiently high enough for coating thick films to fabricate TiO2 electrodes. The structural and photovoltaic properties of the films were extensively investigated by varying the amounts of nanoglue. A reduced pore size and greatly enhanced surface area were observed in the nanoglue-based films. Improved interparticle connectivity, resulting in faster electron transport, was confirmed by photocurrent transient spectroscopy and electrochemical impedance measurements of the nanoglue-based films. The electron diffusion length and charge collection efficiency were also enhanced in these nanoglue-based films. A maximum conversion efficiency of 5.43% was achieved in films containing 20 wt% nanoglue fabricated on a plastic substrate under one-sun illumination, even without any additional treatment.
NASA Astrophysics Data System (ADS)
Li, Debin; Gu, Jianhua; Chye, Yewhee; Lederman, David; Kabulski, Jarod; Gannett, Peter; Tracy, Timothy
2006-03-01
There is a growing interest in measuring the conductivity of electron-transfer proteins. The cytochrome P450 (CP450) enzymes represent an important class of heme-containing enzymes. Immobilizing CP450 enzymes on a surface can be used for studying a single enzyme with respect to electron transfer. The spin state of the heme iron can change upon binding of a substrate. In our experiment, CP450 (diameter ˜ 5 nm) has been bonded to a metal surface. Nano-electrodes (gap < 10 nm) were fabricated by defining a bridge via e-beam lithography and then breaking the junction by electromigration at low temperatures. We have examined the electronic properties of CP450 by itself and after binding CP450 with flurbiprofen. The room temperature I-V conductivity is reminiscent to cyclic voltammetry measurements, indicating the presence of strong ionic transfer. At lower temperatures (100 K) the I-V characteristics indicate electronic transport dominated by tunneling processes. The conductive AFM is an additional method used to examine the enzyme's electronic properties. The results from two methods will be discussed..
Cockerell, Steven R.; Rutkovsky, Alex C.; Zayner, Josiah P.; Cooper, Rebecca E.; Porter, Lindsay R.; Pendergraft, Sam S.; Parker, Zach M.; McGinnis, Marcus W.
2014-01-01
The polyamines norspermidine and spermidine are among the environmental signals that regulate Vibrio cholerae biofilm formation. The effects of these polyamines are mediated by NspS, a member of the bacterial periplasmic solute binding protein superfamily. Almost all members of this superfamily characterized to date are components of ATP-binding cassette-type transporters involved in nutrient uptake. Consequently, in the current annotation of the V. cholerae genome, NspS has been assigned a function in transport. The objective of this study was to further characterize NspS and investigate its potential role in transport. Our results support a role for NspS in signal transduction in response to norspermidine and spermidine, but not their transport. In addition, we provide evidence that these polyamine signals are processed by c-di-GMP signalling networks in the cell. Furthermore, we present comparative genomics analyses which reveal the presence of NspS-like proteins in a variety of bacteria, suggesting that periplasmic ligand binding proteins may be widely utilized for sensory transduction. PMID:24530989
NASA Astrophysics Data System (ADS)
Pandey, Ras; Kuang, Zhifeng; Farmer, Barry; Kim, Sang; Naik, Rajesh
2012-02-01
Recently, Kim et al. [1] have found that peptides P1: HSSYWYAFNNKT and P2: EPLQLKM bind selectively to graphene surfaces and edges respectively which are critical in modulating both the mechanical as well as electronic transport properties of graphene. Such distinctions in binding sites (edge versus surface) observed in electron micrographs were verified by computer simulation by an all-atomic model that captures the pi-pi bonding. We propose a hierarchical approach that involves input from the all-atom Molecular Dynamics (MD) study (with atomistic detail) into a coarse-grained Monte Carlo simulation to extend this study further to a larger scale. The binding energy of a free amino acid with the graphene sheet from all-atom simulation is used in the interaction parameter for the coarse-grained approach. Peptide chain executes its stochastic motion with the Metropolis algorithm. We investigate a number of local and global physical quantities and find that peptide P1 is likely to bind more strongly to graphene sheet than P2 and that it is anchored by three residues ^4Y^5W^6Y. [1] S.N. Kim et al J. Am. Chem. Soc. 133, 14480 (2011).
A Plasmodium falciparum copper-binding membrane protein with copper transport motifs
2012-01-01
Background Copper is an essential catalytic co-factor for metabolically important cellular enzymes, such as cytochrome-c oxidase. Eukaryotic cells acquire copper through a copper transport protein and distribute intracellular copper using molecular chaperones. The copper chelator, neocuproine, inhibits Plasmodium falciparum ring-to-trophozoite transition in vitro, indicating a copper requirement for malaria parasite development. How the malaria parasite acquires or secretes copper still remains to be fully elucidated. Methods PlasmoDB was searched for sequences corresponding to candidate P. falciparum copper-requiring proteins. The amino terminal domain of a putative P. falciparum copper transport protein was cloned and expressed as a maltose binding fusion protein. The copper binding ability of this protein was examined. Copper transport protein-specific anti-peptide antibodies were generated in chickens and used to establish native protein localization in P. falciparum parasites by immunofluorescence microscopy. Results Six P. falciparum copper-requiring protein orthologs and a candidate P. falciparum copper transport protein (PF14_0369), containing characteristic copper transport protein features, were identified in PlasmoDB. The recombinant amino terminal domain of the transport protein bound reduced copper in vitro and within Escherichia coli cells during recombinant expression. Immunolocalization studies tracked the copper binding protein translocating from the erythrocyte plasma membrane in early ring stage to a parasite membrane as the parasites developed to schizonts. The protein appears to be a PEXEL-negative membrane protein. Conclusion Plasmodium falciparum parasites express a native protein with copper transporter characteristics that binds copper in vitro. Localization of the protein to the erythrocyte and parasite plasma membranes could provide a mechanism for the delivery of novel anti-malarial compounds. PMID:23190769
Saleem, Muhammad; Prince, Stephen M.; Rigby, Stephen E. J.; Imran, Muhammad; Patel, Hema; Chan, Hannah; Sanders, Holly; Maiden, Martin C. J.; Feavers, Ian M.; Derrick, Jeremy P.
2013-01-01
FrpB is an outer membrane transporter from Neisseria meningitidis, the causative agent of meningococcal meningitis. It is a member of the TonB-dependent transporter (TBDT) family and is responsible for iron uptake into the periplasm. FrpB is subject to a high degree of antigenic variation, principally through a region of hypervariable sequence exposed at the cell surface. From the crystal structures of two FrpB antigenic variants, we identify a bound ferric ion within the structure which induces structural changes on binding which are consistent with it being the transported substrate. Binding experiments, followed by elemental analysis, verified that FrpB binds Fe3+ with high affinity. EPR spectra of the bound Fe3+ ion confirmed that its chemical environment was consistent with that observed in the crystal structure. Fe3+ binding was reduced or abolished on mutation of the Fe3+-chelating residues. FrpB orthologs were identified in other Gram-negative bacteria which showed absolute conservation of the coordinating residues, suggesting the existence of a specific TBDT sub-family dedicated to the transport of Fe3+. The region of antigenic hypervariability lies in a separate, external sub-domain, whose structure is conserved in both the F3-3 and F5-1 variants, despite their sequence divergence. We conclude that the antigenic sub-domain has arisen separately as a result of immune selection pressure to distract the immune response from the primary transport function. This would enable FrpB to function as a transporter independently of antibody binding, by using the antigenic sub-domain as a ‘molecular decoy’ to distract immune surveillance. PMID:23457610
Saleem, Muhammad; Prince, Stephen M; Rigby, Stephen E J; Imran, Muhammad; Patel, Hema; Chan, Hannah; Sanders, Holly; Maiden, Martin C J; Feavers, Ian M; Derrick, Jeremy P
2013-01-01
FrpB is an outer membrane transporter from Neisseria meningitidis, the causative agent of meningococcal meningitis. It is a member of the TonB-dependent transporter (TBDT) family and is responsible for iron uptake into the periplasm. FrpB is subject to a high degree of antigenic variation, principally through a region of hypervariable sequence exposed at the cell surface. From the crystal structures of two FrpB antigenic variants, we identify a bound ferric ion within the structure which induces structural changes on binding which are consistent with it being the transported substrate. Binding experiments, followed by elemental analysis, verified that FrpB binds Fe(3+) with high affinity. EPR spectra of the bound Fe(3+) ion confirmed that its chemical environment was consistent with that observed in the crystal structure. Fe(3+) binding was reduced or abolished on mutation of the Fe(3+)-chelating residues. FrpB orthologs were identified in other Gram-negative bacteria which showed absolute conservation of the coordinating residues, suggesting the existence of a specific TBDT sub-family dedicated to the transport of Fe(3+). The region of antigenic hypervariability lies in a separate, external sub-domain, whose structure is conserved in both the F3-3 and F5-1 variants, despite their sequence divergence. We conclude that the antigenic sub-domain has arisen separately as a result of immune selection pressure to distract the immune response from the primary transport function. This would enable FrpB to function as a transporter independently of antibody binding, by using the antigenic sub-domain as a 'molecular decoy' to distract immune surveillance.
Neurotransmitter and psychostimulant recognition by the dopamine transporter
Wang, Kevin H.; Penmatsa, Aravind; Gouaux, Eric
2015-01-01
Na+/Cl−-coupled biogenic amine transporters are the primary targets of therapeutic and abused drugs, ranging from antidepressants to the psychostimulants cocaine and amphetamines, and to their cognate substrates. Here we determine x-ray crystal structures of the Drosophila melanogaster dopamine transporter (dDAT) bound to its substrate dopamine (DA), a substrate analogue 3,4-dichlorophenethylamine, the psychostimulants D-amphetamine, methamphetamine, or to cocaine and cocaine analogues. All ligands bind to the central binding site, located approximately halfway across the membrane bilayer, in close proximity to bound sodium and chloride ions. The central binding site recognizes three chemically distinct classes of ligands via conformational changes that accommodate varying sizes and shapes, thus illustrating molecular principles that distinguish substrates from inhibitors in biogenic amine transporters. PMID:25970245
Tripartite ATP-independent periplasmic (TRAP) transporters in bacteria and archaea.
Mulligan, Christopher; Fischer, Marcus; Thomas, Gavin H
2011-01-01
The tripartite ATP-independent periplasmic (TRAP) transporters are the best-studied family of substrate-binding protein (SBP)-dependent secondary transporters and are ubiquitous in prokaryotes, but absent from eukaryotes. They are comprised of an SBP of the DctP or TAXI families and two integral membrane proteins of unequal sizes that form the DctQ and DctM protein families, respectively. The SBP component has a structure comprised of two domains connected by a hinge that closes upon substrate binding. In DctP-TRAP transporters, substrate binding is mediated through a conserved and specific arginine/carboxylate interaction in the SBP. While the SBP component has now been relatively well characterized, the membrane components of TRAP transporters are still poorly understood both in terms of their structure and function. We review the expanding repertoire of substrates and physiological roles for experimentally characterized TRAP transporters in bacteria and discuss mechanistic aspects of these transporters using data primarily from the sialic acid-specific TRAP transporter SiaPQM from Haemophilus influenzae, which suggest that TRAP transporters are high-affinity, Na(+)-dependent unidirectional secondary transporters. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Stochastic steps in secondary active sugar transport
Adelman, Joshua L.; Ghezzi, Chiara; Bisignano, Paola; Loo, Donald D. F.; Choe, Seungho; Abramson, Jeff; Rosenberg, John M.; Wright, Ernest M.; Grabe, Michael
2016-01-01
Secondary active transporters, such as those that adopt the leucine-transporter fold, are found in all domains of life, and they have the unique capability of harnessing the energy stored in ion gradients to accumulate small molecules essential for life as well as expel toxic and harmful compounds. How these proteins couple ion binding and transport to the concomitant flow of substrates is a fundamental structural and biophysical question that is beginning to be answered at the atomistic level with the advent of high-resolution structures of transporters in different structural states. Nonetheless, the dynamic character of the transporters, such as ion/substrate binding order and how binding triggers conformational change, is not revealed from static structures, yet it is critical to understanding their function. Here, we report a series of molecular simulations carried out on the sugar transporter vSGLT that lend insight into how substrate and ions are released from the inward-facing state of the transporter. Our simulations reveal that the order of release is stochastic. Functional experiments were designed to test this prediction on the human homolog, hSGLT1, and we also found that cytoplasmic release is not ordered, but we confirmed that substrate and ion binding from the extracellular space is ordered. Our findings unify conflicting published results concerning cytoplasmic release of ions and substrate and hint at the possibility that other transporters in the superfamily may lack coordination between ions and substrate in the inward-facing state. PMID:27325773
Stochastic steps in secondary active sugar transport.
Adelman, Joshua L; Ghezzi, Chiara; Bisignano, Paola; Loo, Donald D F; Choe, Seungho; Abramson, Jeff; Rosenberg, John M; Wright, Ernest M; Grabe, Michael
2016-07-05
Secondary active transporters, such as those that adopt the leucine-transporter fold, are found in all domains of life, and they have the unique capability of harnessing the energy stored in ion gradients to accumulate small molecules essential for life as well as expel toxic and harmful compounds. How these proteins couple ion binding and transport to the concomitant flow of substrates is a fundamental structural and biophysical question that is beginning to be answered at the atomistic level with the advent of high-resolution structures of transporters in different structural states. Nonetheless, the dynamic character of the transporters, such as ion/substrate binding order and how binding triggers conformational change, is not revealed from static structures, yet it is critical to understanding their function. Here, we report a series of molecular simulations carried out on the sugar transporter vSGLT that lend insight into how substrate and ions are released from the inward-facing state of the transporter. Our simulations reveal that the order of release is stochastic. Functional experiments were designed to test this prediction on the human homolog, hSGLT1, and we also found that cytoplasmic release is not ordered, but we confirmed that substrate and ion binding from the extracellular space is ordered. Our findings unify conflicting published results concerning cytoplasmic release of ions and substrate and hint at the possibility that other transporters in the superfamily may lack coordination between ions and substrate in the inward-facing state.
Stoichiometry for binding and transport by the twin arginine translocation system.
Celedon, Jose M; Cline, Kenneth
2012-05-14
Twin arginine translocation (Tat) systems transport large folded proteins across sealed membranes. Tat systems accomplish this feat with three membrane components organized in two complexes. In thylakoid membranes, cpTatC and Hcf106 comprise a large receptor complex containing an estimated eight cpTatC-Hcf106 pairs. Protein transport occurs when Tha4 joins the receptor complex as an oligomer of uncertain size that is thought to form the protein-conducting structure. Here, binding analyses with intact membranes or purified complexes indicate that each receptor complex could bind eight precursor proteins. Kinetic analysis of translocation showed that each precursor-bound site was independently functional for transport, and, with sufficient Tha4, all sites were concurrently active for transport. Tha4 titration determined that ∼26 Tha4 protomers were required for transport of each OE17 (oxygen-evolving complex subunit of 17 kD) precursor protein. Our results suggest that, when fully saturated with precursor proteins and Tha4, the Tat translocase is an ∼2.2-megadalton complex that can individually transport eight precursor proteins or cooperatively transport multimeric precursors.
Milic, Bojan; Andreasson, Johan O. L.; Hogan, Daniel W.; Block, Steven M.
2017-01-01
Homodimeric KIF17 and heterotrimeric KIF3AB are processive, kinesin-2 family motors that act jointly to carry out anterograde intraflagellar transport (IFT), ferrying cargo along microtubules (MTs) toward the tips of cilia. How IFT trains attain speeds that exceed the unloaded rate of the slower, KIF3AB motor remains unknown. By characterizing the motility properties of kinesin-2 motors as a function of load we find that the increase in KIF3AB velocity, elicited by forward loads from KIF17 motors, cannot alone account for the speed of IFT trains in vivo. Instead, higher IFT velocities arise from an increased likelihood that KIF3AB motors dissociate from the MT, resulting in transport by KIF17 motors alone, unencumbered by opposition from KIF3AB. The rate of transport is therefore set by an equilibrium between a faster state, where only KIF17 motors move the train, and a slower state, where at least one KIF3AB motor on the train remains active in transport. The more frequently the faster state is accessed, the higher the overall velocity of the IFT train. We conclude that IFT velocity is governed by (i) the absolute numbers of each motor type on a given train, (ii) how prone KIF3AB is to dissociation from MTs relative to KIF17, and (iii) how prone both motors are to dissociation relative to binding MTs. PMID:28761002
Milic, Bojan; Andreasson, Johan O L; Hogan, Daniel W; Block, Steven M
2017-08-15
Homodimeric KIF17 and heterotrimeric KIF3AB are processive, kinesin-2 family motors that act jointly to carry out anterograde intraflagellar transport (IFT), ferrying cargo along microtubules (MTs) toward the tips of cilia. How IFT trains attain speeds that exceed the unloaded rate of the slower, KIF3AB motor remains unknown. By characterizing the motility properties of kinesin-2 motors as a function of load we find that the increase in KIF3AB velocity, elicited by forward loads from KIF17 motors, cannot alone account for the speed of IFT trains in vivo. Instead, higher IFT velocities arise from an increased likelihood that KIF3AB motors dissociate from the MT, resulting in transport by KIF17 motors alone, unencumbered by opposition from KIF3AB. The rate of transport is therefore set by an equilibrium between a faster state, where only KIF17 motors move the train, and a slower state, where at least one KIF3AB motor on the train remains active in transport. The more frequently the faster state is accessed, the higher the overall velocity of the IFT train. We conclude that IFT velocity is governed by ( i ) the absolute numbers of each motor type on a given train, ( ii ) how prone KIF3AB is to dissociation from MTs relative to KIF17, and ( iii ) how prone both motors are to dissociation relative to binding MTs.
21 CFR 866.5765 - Retinol-binding protein immunological test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...
21 CFR 866.5765 - Retinol-binding protein immunological test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...
21 CFR 866.5765 - Retinol-binding protein immunological test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...
21 CFR 866.5765 - Retinol-binding protein immunological test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...
Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc
2017-05-04
Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1 mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Fung, E-Dean; Adak, Olgun; Lovat, Giacomo; Scarabelli, Diego; Venkataraman, Latha
2017-02-08
We investigate light-induced conductance enhancement in single-molecule junctions via photon-assisted transport and hot-electron transport. Using 4,4'-bipyridine bound to Au electrodes as a prototypical single-molecule junction, we report a 20-40% enhancement in conductance under illumination with 980 nm wavelength radiation. We probe the effects of subtle changes in the transmission function on light-enhanced current and show that discrete variations in the binding geometry result in a 10% change in enhancement. Importantly, we prove theoretically that the steady-state behavior of photon-assisted transport and hot-electron transport is identical but that hot-electron transport is the dominant mechanism for optically induced conductance enhancement in single-molecule junctions when the wavelength used is absorbed by the electrodes and the hot-electron relaxation time is long. We confirm this experimentally by performing polarization-dependent conductance measurements of illuminated 4,4'-bipyridine junctions. Finally, we perform lock-in type measurements of optical current and conclude that currents due to laser-induced thermal expansion mask optical currents. This work provides a robust experimental framework for studying mechanisms of light-enhanced transport in single-molecule junctions and offers tools for tuning the performance of organic optoelectronic devices by analyzing detailed transport properties of the molecules involved.
Mullen, Anna; Hall, Jenny; Diegel, Janika; Hassan, Isa; Fey, Adam; MacMillan, Fraser
2016-06-15
During their mechanistic cycles membrane transporters often undergo extensive conformational changes, sampling a range of orientations, in order to complete their function. Such membrane transporters present somewhat of a challenge to conventional structural studies; indeed, crystallization of membrane-associated proteins sometimes require conditions that vary vastly from their native environments. Moreover, this technique currently only allows for visualization of single selected conformations during any one experiment. EPR spectroscopy is a magnetic resonance technique that offers a unique opportunity to study structural, environmental and dynamic properties of such proteins in their native membrane environments, as well as readily sampling their substrate-binding-induced dynamic conformational changes especially through complementary computational analyses. Here we present a review of recent studies that utilize a variety of EPR techniques in order to investigate both the structure and dynamics of a range of membrane transporters and associated proteins, focusing on both primary (ABC-type transporters) and secondary active transporters which were key interest areas of the late Professor Stephen Baldwin to whom this review is dedicated. © 2016 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Boos, Terrence L; Greiner, Elisabeth; Calhoun, W Jason; Prisinzano, Thomas E; Nightingale, Barbara; Dersch, Christina M; Rothman, Richard B; Jacobson, Arthur E; Rice, Kenner C
2006-06-01
A series of 4-(2-(bis(4-fluorophenyl)methoxy)ethyl)-(substituted benzyl) piperidines with substituents at the ortho and meta positions in the aromatic ring of the N-benzyl side chain were synthesized and their affinities and selectivities for the dopamine transporter (DAT), serotonin transporter (SERT), and norepinephrine transporter (NET) were determined. One analogue, 4-(2-(bis(4-fluorophenyl)methoxy)ethyl)-1-(2-trifluoromethylbenzyl)piperidine (the C(2)-trifluoromethyl substituted compound), has been found to act as an allosteric modulator of hSERT binding and function. It had little affinity for any of the transporters. Several compounds showed affinity for the DAT in the low nanomolar range and displayed a broad range of SERT/DAT selectivity ratios and very little affinity for the NET. The pharmacological tools provided by the availability of compounds with varying transporter affinity and selectivity could be used to obtain additional information about the properties a compound should have to act as a useful pharmacotherapeutic agent for cocaine addiction and help unravel the pharmacological mechanisms relevant to stimulant abuse.
Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A
2014-07-29
ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.
Li, Yang; Mayer, Felix P.; Hasenhuetl, Peter S.; Burtscher, Verena; Schicker, Klaus; Sitte, Harald H.; Freissmuth, Michael; Sandtner, Walter
2017-01-01
The human dopamine transporter (DAT) has a tetrahedral Zn2+-binding site. Zn2+-binding sites are also recognized by other first-row transition metals. Excessive accumulation of manganese or of copper can lead to parkinsonism because of dopamine deficiency. Accordingly, we examined the effect of Mn2+, Co2+, Ni2+, and Cu2+ on transport-associated currents through DAT and DAT-H193K, a mutant with a disrupted Zn2+-binding site. All transition metals except Mn2+ modulated the transport cycle of wild-type DAT with affinities in the low micromolar range. In this concentration range, they were devoid of any action on DAT-H193K. The active transition metals reduced the affinity of DAT for dopamine. The affinity shift was most pronounced for Cu2+, followed by Ni2+ and Zn2+ (= Co2+). The extent of the affinity shift and the reciprocal effect of substrate on metal affinity accounted for the different modes of action: Ni2+ and Cu2+ uniformly stimulated and inhibited, respectively, the substrate-induced steady-state currents through DAT. In contrast, Zn2+ elicited biphasic effects on transport, i.e. stimulation at 1 μm and inhibition at 10 μm. A kinetic model that posited preferential binding of transition metal ions to the outward-facing apo state of DAT and a reciprocal interaction of dopamine and transition metals recapitulated all experimental findings. Allosteric activation of DAT via the Zn2+-binding site may be of interest to restore transport in loss-of-function mutants. PMID:28096460
Kish, Stephen J; Lerch, Jason; Furukawa, Yoshiaki; Tong, Junchao; McCluskey, Tina; Wilkins, Diana; Houle, Sylvain; Meyer, Jeffrey; Mundo, Emanuela; Wilson, Alan A; Rusjan, Pablo M; Saint-Cyr, Jean A; Guttman, Mark; Collins, D Louis; Shapiro, Colin; Warsh, Jerry J; Boileau, Isabelle
2010-06-01
Animal data indicate that the recreational drug ecstasy (3,4-methylenedioxymethamphetamine) can damage brain serotonin neurons. However, human neuroimaging measurements of serotonin transporter binding, a serotonin neuron marker, remain contradictory, especially regarding brain areas affected; and the possibility that structural brain differences might account for serotonin transporter binding changes has not been explored. We measured brain serotonin transporter binding using [(11)C] N,N-dimethyl-2-(2-amino-4-cyanophenylthio) benzylamine in 50 control subjects and in 49 chronic (mean 4 years) ecstasy users (typically one to two tablets bi-monthly) withdrawn from the drug (mean 45 days). A magnetic resonance image for positron emission tomography image co-registration and structural analyses was acquired. Hair toxicology confirmed group allocation but also indicated use of other psychoactive drugs in most users. Serotonin transporter binding in ecstasy users was significantly decreased throughout all cerebral cortices (range -19 to -46%) and hippocampus (-21%) and related to the extent of drug use (years, maximum dose), but was normal in basal ganglia and midbrain. Substantial overlap was observed between control and user values except for insular cortex, in which 51% of ecstasy user values fell below the lower limit of the control range. Voxel-based analyses confirmed a caudorostral gradient of cortical serotonin transporter binding loss with occipital cortex most severely affected. Magnetic resonance image measurement revealed no overall regional volume differences between groups; however, a slight left-hemispheric biased cortical thinning was detected in methamphetamine-using ecstasy users. The serotonin transporter binding loss was not related to structural changes or partial volume effect, use of other stimulant drugs, blood testosterone or oestradiol levels, major serotonin transporter gene promoter polymorphisms, gender, psychiatric status, or self-reported hyperthermia or tolerance. The ecstasy group, although 'grossly behaviourally normal', reported subnormal mood and demonstrated generally modest deficits on some tests of attention, executive function and memory, with the latter associated with serotonin transporter decrease. Our findings suggest that the 'typical'/low dose (one to two tablets/session) chronic ecstasy-polydrug user might display a highly selective mild to marked loss of serotonin transporter in cerebral cortex/hippocampus in the range of that observed in Parkinson's disease, which is not gender-specific or completely accounted for by structural brain changes, recent use of other drugs (as assessed by hair analyses) or other potential confounds that we could address. The striking sparing of serotonin transporter-rich striatum (although possibly affected in 'heavier' users) suggests that serotonergic neurons innervating cerebral cortex are more susceptible, for unknown reasons, to ecstasy than those innervating subcortical regions and that behavioural problems in some ecstasy users during abstinence might be related to serotonin transporter changes limited to cortical regions.
Transport characteristics of endomorphin-2 analogues in brain capillary endothelial cells.
Mallareddy, Jayapal Reddy; Tóth, Géza; Fazakas, Csilla; Molnár, Judit; Nagyőszi, Péter; Lipkowski, Andrzej W; Krizbai, István A; Wilhelm, Imola
2012-04-01
Because of their poor metabolic stability and limited blood-brain barrier permeability, endomorphins have a low analgesic efficacy when administered systemically. Therefore, it is of great importance to design analogues with improved peptidase resistance and better delivery to the central nervous system. Recently, novel endomorphin-2 analogues have been synthesized, which proved to bind with high affinity and selectivity to the μ-opioid receptors and showed proteolytic resistance. In this study, we have analysed the transport characteristics of endomorphin-2 and three of its analogues [Dmt-Pro-Phe-Phe-NH(2) , Tyr-(1S,2R)Acpc-Phe-Phe-NH(2) and Tyr-(1S,2R)Achc-Phe-Phe-NH(2) ] using an in vitro blood-brain barrier model. The lipophilicity of the analogues, as assessed by their octanol/water partition coefficients, was higher than that of endomorphin-2. The flux of all four peptides from the apical (blood) side to the basolateral (brain) side was not saturable in the 10nm-1mm concentration range, suggesting that a passive mechanism plays a major role in their transport. The permeability coefficient of the analogues was significantly higher than that of endomorphin-2, suggesting increased blood-brain barrier penetration properties. We conclude that because of their good peptidase resistance and improved transport through brain endothelial cells, these endomorphin-2 analogues will have better analgesic properties in vivo. © 2011 John Wiley & Sons A/S.
Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.
2015-01-01
Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465
Carbon-11-cocaine binding compared at subpharmacological and pharmacological doses: A PET study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Volkow, N.D.; Fowler, J.S.; Logan, J.
The authors have characterized cocaine binding in the brain to a high-affinity site on the dopamine transporter using PET and tracer doses of [{sup 11}C]cocaine in the baboon in vivo. The binding pattern, however, of cocaine at tracer (subpharmacological) doses may differ from that observed when the drug is taken in behaviorally active doses, particularly since in vitro studies have shown that cocaine also binds to low affinity binding sites. PET was used to compare and characterize [{sup 11}C]cocaine binding in the baboon brain at low subpharmacological (18 {mu}g average dose) and at pharmacological (8000 {mu}g) doses. Serial studies onmore » the same day in the same baboon were used to assess the reproducibility of repeated measures and to assess the effects of drugs which inhibit the dopamine, norepinephrine and serotonin transporters. Time-activity curves from brain and the arterial plasma input function were used to calculate the steady-state distribution volume (DV). At subpharmacological doses, [{sup 11}C]cocaine had a more homogeneous distribution. Bmax/Kd for sub-pharmacological [{sup 11}C]cocaine corresponded to 0.5-0.6 and for pharmacological [{sup 11}C]cocaine it corresponded to 0.1-0.2. Two-point Scatchard analysis gave Bmax = 2300 pmole/g and Kd = 3600 nM. Bmax/Kd for sub-pharmacological doses of [{sup 11}C]cocaine was decreased by cocaine and drugs that inhibit the dopamine transporter, to 0.1-0.2, but not by drugs that inhibit the serotonin or the norepinephrine transporter. None of these drugs changed Bmax/Kd for a pharmacological dose of [{sup 11}C]cocaine. At subpharmacological doses, [{sup 11}C]cocaine binds predominantly to a high-affinity site on the dopamine transporter. 36 refs., 4 figs., 5 tabs.« less
Peer reviewed: Characterizing aquatic dissolved organic matter
Leenheer, Jerry A.; Croué, Jean-Philippe
2003-01-01
Whether it causes aesthetic concerns such as color, taste, and odor; leads to the binding and transport of organic and inorganic contaminants; produces undesirable disinfection byproducts; provides sources and sinks for carbon; or mediates photochemical processes, the nature and properties of dissolved organic matter (DOM) in water are topics of significant environmental interest. DOM is also a major reactant in and product of biogeochemical processes in which the material serves as a carbon and energy source for biota and controls levels of dissolved oxygen, nitrogen, phosphorus, sulfur, numerous trace metals, and acidity.
Lattice distortion and electron charge redistribution induced by defects in graphene
Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...
2016-09-14
Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.
Effects of Structural Deformation and Tube Chirality on Electronic Conductance of Carbon Nanotubes
NASA Technical Reports Server (NTRS)
Svizhenko, Alexei; Maiti, Amitesh; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)
2002-01-01
A combination of large scale classical force-field (UFF), density functional theory (DFT), and tight-binding Green's function transport calculations is used to study the electronic properties of carbon nanotubes under the twist, bending, and atomic force microscope (AFM)-tip deformation. We found that in agreement with experiment a significant change in electronic conductance can be induced by AFM-tip deformation of metallic zigzag tubes and by twist deformation of armchair tubes. The effect is explained in terms of bandstructure change under deformation.
NASA Astrophysics Data System (ADS)
Sandford, Scott A.; Allamandola, Louis J.
1993-12-01
The present compilation of measurements of the physical and IR spectral properties of ices whose molecular compositions are relevant to the case of Io encompasses ice systems containing SO2, H2S, and CO2. Surface-binding energies used to calculate the residence times of molecules on a surface as a function of temperature furnish crucially important parameters for models attending to the transport of such molecules to the surface of Io. The values thus derived show that SO2 frosts anneal rapidly.
Proton movement and coupling in the POT family of peptide transporters
Parker, Joanne L.; Li, Chenghan; Brinth, Allete; Wang, Zhi; Vogeley, Lutz; Solcan, Nicolae; Ledderboge-Vucinic, Gregory; Swanson, Jessica M. J.; Caffrey, Martin; Voth, Gregory A.
2017-01-01
POT transporters represent an evolutionarily well-conserved family of proton-coupled transport systems in biology. An unusual feature of the family is their ability to couple the transport of chemically diverse ligands to an inwardly directed proton electrochemical gradient. For example, in mammals, fungi, and bacteria they are predominantly peptide transporters, whereas in plants the family has diverged to recognize nitrate, plant defense compounds, and hormones. Although recent structural and biochemical studies have identified conserved sites of proton binding, the mechanism through which transport is coupled to proton movement remains enigmatic. Here we show that different POT transporters operate through distinct proton-coupled mechanisms through changes in the extracellular gate. A high-resolution crystal structure reveals the presence of ordered water molecules within the peptide binding site. Multiscale molecular dynamics simulations confirm proton transport occurs through these waters via Grotthuss shuttling and reveal that proton binding to the extracellular side of the transporter facilitates a reorientation from an inward- to outward-facing state. Together these results demonstrate that within the POT family multiple mechanisms of proton coupling have likely evolved in conjunction with variation of the extracellular gate. PMID:29180426
Proton movement and coupling in the POT family of peptide transporters.
Parker, Joanne L; Li, Chenghan; Brinth, Allete; Wang, Zhi; Vogeley, Lutz; Solcan, Nicolae; Ledderboge-Vucinic, Gregory; Swanson, Jessica M J; Caffrey, Martin; Voth, Gregory A; Newstead, Simon
2017-12-12
POT transporters represent an evolutionarily well-conserved family of proton-coupled transport systems in biology. An unusual feature of the family is their ability to couple the transport of chemically diverse ligands to an inwardly directed proton electrochemical gradient. For example, in mammals, fungi, and bacteria they are predominantly peptide transporters, whereas in plants the family has diverged to recognize nitrate, plant defense compounds, and hormones. Although recent structural and biochemical studies have identified conserved sites of proton binding, the mechanism through which transport is coupled to proton movement remains enigmatic. Here we show that different POT transporters operate through distinct proton-coupled mechanisms through changes in the extracellular gate. A high-resolution crystal structure reveals the presence of ordered water molecules within the peptide binding site. Multiscale molecular dynamics simulations confirm proton transport occurs through these waters via Grotthuss shuttling and reveal that proton binding to the extracellular side of the transporter facilitates a reorientation from an inward- to outward-facing state. Together these results demonstrate that within the POT family multiple mechanisms of proton coupling have likely evolved in conjunction with variation of the extracellular gate. Copyright © 2017 the Author(s). Published by PNAS.
Regulation of amino acid transport in Escherichia coli by transcription termination factor rho.
Quay, S C; Oxender, D L
1977-06-01
Amino acid transport rates and amino acid binding proteins were examined in a strain containing the rho-120 mutation (formerly SuA), which has been shown to lower the rho-dependent, ribonucleic acid-activated adenosine triphosphatase activity to 9% of the rho activity in the isogenic wild-type strain. Tryptophan and proline transport, which occur by membrane-bound systems, were not altered. On the other hand, arginine, histidine, leucine, isoleucine, and valine transport were variably increased by a factor of 1.4 to 5.0. Kinetics of leucine transport showed that the LIV (leucine, isoleucine, and valine)-I (binding protein-associated) transport system is increased 8.5-fold, whereas the LIV-II (membrane-bound) system is increased 1.5-fold in the rho mutant under leucine-limited growth conditions. The leucine binding protein is increased fourfold under the same growth conditions. The difference in leucine transport in these strains was greatest during leucine-limited growth; growth on complex media repressed both strains to the same transport activity. We propose that rho-dependent transcriptional termination is important for leucine-specific repression of branched-chain amino acid transport, although rho-independent regulation, presumably by a corepressor-aporepressor-type mechanism, must also occur.
Tuning the electrical conductance of metalloporphyrin supramolecular wires
NASA Astrophysics Data System (ADS)
Noori, Mohammed; Aragonès, Albert C.; di Palma, Giuseppe; Darwish, Nadim; Bailey, Steven W. D.; Al-Galiby, Qusiy; Grace, Iain; Amabilino, David B.; González-Campo, Arántzazu; Díez-Pérez, Ismael; Lambert, Colin J.
2016-11-01
In contrast with conventional single-molecule junctions, in which the current flows parallel to the long axis or plane of a molecule, we investigate the transport properties of M(II)-5,15-diphenylporphyrin (M-DPP) single-molecule junctions (M=Co, Ni, Cu, or Zn divalent metal ions), in which the current flows perpendicular to the plane of the porphyrin. Novel STM-based conductance measurements combined with quantum transport calculations demonstrate that current-perpendicular-to-the-plane (CPP) junctions have three-orders-of-magnitude higher electrical conductances than their current-in-plane (CIP) counterparts, ranging from 2.10-2 G0 for Ni-DPP up to 8.10-2 G0 for Zn-DPP. The metal ion in the center of the DPP skeletons is strongly coordinated with the nitrogens of the pyridyl coated electrodes, with a binding energy that is sensitive to the choice of metal ion. We find that the binding energies of Zn-DPP and Co-DPP are significantly higher than those of Ni-DPP and Cu-DPP. Therefore when combined with its higher conductance, we identify Zn-DPP as the favoured candidate for high-conductance CPP single-molecule devices.
Gameiro, Armanda; Braams, Simona; Rauen, Thomas; Grewer, Christof
2011-06-08
Excitatory amino acid transporters (EAATs) control the glutamate concentration in the synaptic cleft by glial and neuronal glutamate uptake. Uphill glutamate transport is achieved by the co-/countertransport of Na(+) and other ions down their concentration gradients. Glutamate transporters also display an anion conductance that is activated by the binding of Na(+) and glutamate but is not thermodynamically coupled to the transport process. Of the five known glutamate transporter subtypes, the retina-specific subtype EAAT5 has the largest conductance relative to glutamate uptake activity. Our results suggest that EAAT5 behaves as a slow-gated anion channel with little glutamate transport activity. At steady state, EAAT5 was activated by glutamate, with a K(m)= 61 ± 11 μM. Binding of Na(+) to the empty transporter is associated with a K(m) = 229 ± 37 mM, and binding to the glutamate-bound form is associated with a K(m) = 76 ± 40 mM. Using laser-pulse photolysis of caged glutamate, we determined the pre-steady-state kinetics of the glutamate-induced anion current of EAAT5. This was characterized by two exponential components with time constants of 30 ± 1 ms and 200 ± 15 ms, which is an order of magnitude slower than those observed in other glutamate transporters. A voltage-jump analysis of the anion currents indicates that the slow activation behavior is caused by two slow, rate-limiting steps in the transport cycle, Na(+) binding to the empty transporter, and translocation of the fully loaded transporter. We propose a kinetic transport scheme that includes these two slow steps and can account for the experimentally observed data. Overall, our results suggest that EAAT5 may not act as a classical high-capacity glutamate transporter in the retina; rather, it may function as a slow-gated glutamate receptor and/or glutamate buffering system. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Structural Basis for Induction of Peripheral Neuropathy by Microtubule-Targeting Cancer Drugs.
Smith, Jennifer A; Slusher, Barbara S; Wozniak, Krystyna M; Farah, Mohamed H; Smiyun, Gregoriy; Wilson, Leslie; Feinstein, Stuart; Jordan, Mary Ann
2016-09-01
Peripheral neuropathy is a serious, dose-limiting side effect of cancer treatment with microtubule-targeting drugs. Symptoms present in a "stocking-glove" distribution, with longest nerves affected most acutely, suggesting a length-dependent component to the toxicity. Axonal transport of ATP-producing mitochondria along neuronal microtubules from cell body to synapse is crucial to neuronal function. We compared the effects of the drugs paclitaxel and ixabepilone that bind along the lengths of microtubules and the drugs eribulin and vincristine that bind at microtubule ends, on mitochondrial trafficking in cultured human neuronal SK-N-SH cells and on axonal transport in mouse sciatic nerves. Antiproliferative concentrations of paclitaxel and ixabepilone significantly inhibited the anterograde transport velocity of mitochondria in neuronal cells, whereas eribulin and vincristine inhibited transport only at significantly higher concentrations. Confirming these observations, anterogradely transported amyloid precursor protein accumulated in ligated sciatic nerves of control and eribulin-treated mice, but not in paclitaxel-treated mice, indicating that paclitaxel inhibited anterograde axonal transport, whereas eribulin did not. Electron microscopy of sciatic nerves of paclitaxel-treated mice showed reduced organelle accumulation proximal to the ligation consistent with inhibition of anterograde (kinesin based) transport by paclitaxel. In contrast, none of the drugs significantly affected retrograde (dynein based) transport in neuronal cells or mouse nerves. Collectively, these results suggest that paclitaxel and ixabepilone, which bind along the lengths and stabilize microtubules, inhibit kinesin-based axonal transport, but not dynein-based transport, whereas the microtubule-destabilizing drugs, eribulin and vincristine, which bind preferentially to microtubule ends, have significantly less effect on all microtubule-based axonal transport. Cancer Res; 76(17); 5115-23. ©2016 AACR. ©2016 American Association for Cancer Research.
Zhu, Jing; Hu, Yueqing; Ho, Maurice K C; Wong, Yung H
2011-01-01
Developing subtype-selective melatoninergic ligands has been a subject of considerable interest in drug discovery. A series of 3-methoxyphenylpropyl amide derivatives showing selective binding capacity to type 2 melatonin receptor with subnanomolar range of affinities has been identified recently by our laboratory. In the present study, their physicochemical properties, Caco-2 cell and mdr1-MDCK cell permeability, plasma protein binding, and metabolic stability were investigated. The selected compounds are lipophilic in nature, exhibiting aqueous solubility ranging from 40 to 200 microg/mL. Cell permeability studies on Caco-2 and mdr1-MDCK model revealed that they were readily transported through intestinal epithelium and possessed high penetration potential through blood-brain barrier, implying good oral absorption and central nervous system (CNS) distribution potential. They also showed substantial binding to human plasma protein ranging from 78.5% to 92.3%. These compounds were, however, subjected to rapid cytochrome P450-mediated degradation in rat and human liver microsomes with in vitro half-life of 9.5-31.9 min in rat and 5.5-66.7 min in human, which were much shorter than that of melatonin (approximately 73 min). Metabolite profiling unveiled that C6-ether linkage and methoxy substituents were likely the major metabolic soft spots in their structures, which provided important information for further improvement of their structural stability.
Electrocatalysis in DNA Sensors
Furst, Ariel; Hill, Michael G.; Barton, Jacqueline K.
2014-01-01
Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647
Electrocatalysis in DNA Sensors.
Furst, Ariel; Hill, Michael G; Barton, Jacqueline K
2014-12-14
Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology.
Vermersch, P S; Lemon, D D; Tesmer, J J; Quiocho, F A
1991-07-16
In addition to hydrogen bonds, van der Waals forces contribute to the affinity of protein-carbohydrate interactions. Nonpolar van der Waals contacts in the complexes of the L-arabinose-binding protein (ABP) with monosaccharides have been studied by means of site-directed mutagenesis, equilibrium and rapid kinetic binding techniques, and X-ray crystallography. ABP, a periplasmic transport receptor of Escherichia coli, binds L-arabinose, D-galactose, and D-fucose with preferential affinity in the order of Ara greater than Gal much greater than Fuc. Well-refined, high-resolution structures of ABP complexed with the three sugars revealed that the structural differences in the ABP-sugar complexes are localized around C5 of the sugars, where the equatorial H of Ara has been substituted for CH3 (Fuc) or CH2OH (Gal). The side chain of Met108 undergoes a sterically dictated, ligand-specific, conformational change to optimize nonpolar interactions between its methyl group and the sugar. We found that the Met108Leu ABP binds Gal tighter than wild-type ABP binds Ara and exhibits a preference for ligand in the order of Gal much greater than Fuc greater than Ara. The differences in affinity can be attributed to differences in the dissociation rates of the ABP-sugar complexes. We have refined at better than 1.7-A resolution the crystal structures of the Met108Leu ABP complexed with each of the sugars and offer a molecular explanation for the altered binding properties.
Tavoulari, Sotiria; Forrest, Lucy R.; Rudnick, Gary
2010-01-01
Serotonin transporter (SERT) is the main target for widely used antidepressant agents. Several of these drugs, including imipramine, citalopram, sertraline, and fluoxetine (Prozac), bound more avidly to SERT in the presence of Cl–. In contrast, Cl– did not enhance cocaine or paroxetine binding. A Cl– binding site recently identified in SERT, and shown to be important for Cl– dependent transport, was also critical for the Cl– dependence of antidepressant affinity. Mutation of the residues contributing to this site eliminated the Cl–-mediated affinity increase for imipramine and fluoxetine. Analysis of ligand docking to a single state of SERT indicated only small differences in the energy of interaction between bound ligands and Cl–. These differences in interaction energy cannot account for the affinity differences observed for Cl– dependence. However, fluoxetine binding led to a conformational change, detected by cysteine accessibility experiments, that was qualitatively different from that induced by cocaine or other ligands. Given the known Cl– requirement for serotonin-induced conformational changes, we propose that Cl– binding facilitates conformational changes required for optimal binding of fluoxetine and other antidepressant drugs. PMID:19641126
Serotonin and dopamine transporter binding in children with autism determined by SPECT.
Makkonen, Ismo; Riikonen, Raili; Kokki, Hannu; Airaksinen, Mauno M; Kuikka, Jyrki T
2008-08-01
Disturbances in the serotonergic system have been recognized in autism. To investigate the association between serotonin and dopamine transporters and autism, we studied 15 children (14 males, one female; mean age 8 y 8 mo [SD 3 y 10 mo]) with autism and 10 non-autistic comparison children (five males, five females; mean age 9 y 10 mo [SD 2 y 8 mo]) using single-photon emission computed tomography (SPECT) with [123 I] nor-beta-CIT. The children, with autism were studied during light sedation. They showed reduced serotonin transporter (SERT) binding capacity in the medial frontal cortex, midbrain, and temporal lobe areas. However, after correction due to the estimated effect of sedation, the difference remained significant only in the medial frontal cortex area (p=0.002). In the individuals with autism dopamine transporter (DAT) binding did not differ from that of the comparison group. The results indicate that SERT binding capacity is disturbed in autism. The reduction is more evident in adolescence than in earlier childhood. The low SERT binding reported here and the low serotonin synthesis capacity shown elsewhere may indicate maturation of a lesser number of serotonergic nerve terminals in individuals with autism.
Solving the Mechanism of Na+/H+ Antiporters Using Molecular Dynamics Simulations
NASA Astrophysics Data System (ADS)
Dotson, David L.
Na+/H+ antiporters are vital membrane proteins for cell homeostasis, transporting Na+ ions in exchange for H+ across the lipid bilayer. In humans, dysfunction of these transporters are implicated in hypertension, heart failure, epilepsy, and autism, making them well-established drug targets. Although experimental structures for bacterial homologs of the human Na+/H+ have been obtained, the detailed mechanism for ion transport is still not well-understood. The most well-studied of these transporters, Escherichia coli NhaA, known to transport 2 H+ for every Na+ extruded, was recently shown to bind H+ and Na+ at the same binding site, for which the two ion species compete. Using molecular dynamics simulations, the work presented in this dissertation shows that Na+ binding disrupts a previously-unidentified salt bridge between two conserved residues, suggesting that one of these residues, Lys300, may participate directly in transport of H+. This work also demonstrates that the conformational change required for ion translocation in a homolog of NhaA, Thermus thermophilus NapA, thought by some to involve only small helical movements at the ion binding site, is a large-scale, rigid-body movement of the core domain relative to the dimerization domain. This elevator-like transport mechanism translates a bound Na+ up to 10 A across the membrane. These findings constitute a major shift in the prevailing thought on the mechanism of these transporters, and serve as an exciting launchpad for new developments toward understanding that mechanism in detail.
Rapp, Micah; Schein, Jessica; Hunt, Kevin A; Nalam, Vamsi; Mourad, George S; Schultes, Neil P
2016-03-01
The solute specificity profiles (transport and binding) for the nucleobase cation symporter 1 (NCS1) proteins, from the closely related C4 grasses Zea mays and Setaria viridis, differ from that of Arabidopsis thaliana and Chlamydomonas reinhardtii NCS1. Solute specificity profiles for NCS1 from Z. mays (ZmNCS1) and S. viridis (SvNCS1) were determined through heterologous complementation studies in NCS1-deficient Saccharomyces cerevisiae strains. The four Viridiplantae NCS1 proteins transport the purines adenine and guanine, but unlike the dicot and algal NCS1, grass NCS1 proteins fail to transport the pyrimidine uracil. Despite the high level of amino acid sequence similarity, ZmNCS1 and SvNCS1 display distinct solute transport and recognition profiles. SvNCS1 transports adenine, guanine, hypoxanthine, cytosine, and allantoin and competitively binds xanthine and uric acid. ZmNCS1 transports adenine, guanine, and cytosine and competitively binds, 5-fluorocytosine, hypoxanthine, xanthine, and uric acid. The differences in grass NCS1 profiles are due to a limited number of amino acid alterations. These amino acid residues do not correspond to amino acids essential for overall solute and cation binding or solute transport, as previously identified in bacterial and fungal NCS1, but rather may represent residues involved in subtle solute discrimination. The data presented here reveal that within Viridiplantae, NCS1 proteins transport a broad range of nucleobase compounds and that the solute specificity profile varies with species.
Vargiu, Attilio V; Collu, Francesca; Schulz, Robert; Pos, Klaas M; Zacharias, Martin; Kleinekathöfer, Ulrich; Ruggerone, Paolo
2011-07-20
The tripartite efflux pump AcrAB-TolC is responsible for the intrinsic and acquired multidrug resistance in Escherichia coli. Its active part, the homotrimeric transporter AcrB, is in charge of the selective binding of substrates and energy transduction. The mutation F610A has been shown to significantly reduce the minimum inhibitory concentration of doxorubicin and many other substrates, although F610 does not appear to interact strongly with them. Biochemical study of transport kinetics in AcrB is not yet possible, except for some β-lactams, and other techniques should supply this important information. Therefore, in this work, we assess the impact of the F610A mutation on the functionality of AcrB by means of computational techniques, using doxorubicin as substrate. We found that the compound slides deeply inside the binding pocket after mutation, increasing the strength of the interaction. During subsequent conformational alterations of the transporter, doxorubicin was either not extruded from the binding site or displaced along a direction other than the one associated with extrusion. Our study indicates how subtle interactions determine the functionality of multidrug transporters, since decreased transport might not be simplistically correlated to decreased substrate binding affinity.
Peroxisomal ATP-binding cassette transporters form mainly tetramers
Geillon, Flore; Gondcaille, Catherine; Raas, Quentin; Dias, Alexandre M. M.; Pecqueur, Delphine; Truntzer, Caroline; Lucchi, Géraldine; Ducoroy, Patrick; Falson, Pierre; Savary, Stéphane; Trompier, Doriane
2017-01-01
ABCD1 and its homolog ABCD2 are peroxisomal ATP-binding cassette (ABC) half-transporters of fatty acyl-CoAs with both distinct and overlapping substrate specificities. Although it is established that ABC half-transporters have at least to dimerize to generate a functional unit, functional equivalents of tetramers (i.e. dimers of full-length transporters) have also been reported. However, oligomerization of peroxisomal ABCD transporters is incompletely understood but is of potential significance because more complex oligomerization might lead to differences in substrate specificity. In this work, we have characterized the quaternary structure of the ABCD1 and ABCD2 proteins in the peroxisomal membrane. Using various biochemical approaches, we clearly demonstrate that both transporters exist as both homo- and heterotetramers, with a predominance of homotetramers. In addition to tetramers, some larger molecular ABCD assemblies were also found but represented only a minor fraction. By using quantitative co-immunoprecipitation assays coupled with tandem mass spectrometry, we identified potential binding partners of ABCD2 involved in polyunsaturated fatty-acid metabolism. Interestingly, we identified calcium ATPases as ABCD2-binding partners, suggesting a role of ABCD2 in calcium signaling. In conclusion, we have shown here that ABCD1 and its homolog ABCD2 exist mainly as homotetramers in the peroxisomal membrane. PMID:28258215
Yaffe, Dana; Vergara-Jaque, Ariela; Forrest, Lucy R; Schuldiner, Shimon
2016-11-22
Neurotransporters located in synaptic vesicles are essential for communication between nerve cells in a process mediated by neurotransmitters. Vesicular monoamine transporter (VMAT), a member of the largest superfamily of transporters, mediates transport of monoamines to synaptic vesicles and storage organelles in a process that involves exchange of two H + per substrate. VMAT transport is inhibited by the competitive inhibitor reserpine, a second-line agent to treat hypertension, and by the noncompetitive inhibitor tetrabenazine, presently in use for symptomatic treatment of hyperkinetic disorders. During the transport cycle, VMAT is expected to occupy at least three different conformations: cytoplasm-facing, occluded, and lumen-facing. The lumen- to cytoplasm-facing transition, facilitated by protonation of at least one of the essential membrane-embedded carboxyls, generates a binding site for reserpine. Here we have identified residues in the cytoplasmic gate and show that mutations that disrupt the interactions in this gate also shift the equilibrium toward the cytoplasm-facing conformation, emulating the effect of protonation. These experiments provide significant insight into the role of proton translocation in the conformational dynamics of a mammalian H + -coupled antiporter, and also identify key aspects of the mode of action and binding of two potent inhibitors of VMAT2: reserpine binds the cytoplasm-facing conformation, and tetrabenazine binds the lumen-facing conformation.
Hayashi, Shigehiko
2017-01-01
The mitochondrial ADP/ATP carrier (AAC) is a membrane transporter that exchanges a cytosolic ADP for a matrix ATP. Atomic structures in an outward-facing (OF) form which binds an ADP from the intermembrane space have been solved by X-ray crystallography, and revealed their unique pseudo three-fold symmetry fold which is qualitatively different from pseudo two-fold symmetry of most transporters of which atomic structures have been solved. However, any atomic-level information on an inward-facing (IF) form, which binds an ATP from the matrix side and is fixed by binding of an inhibitor, bongkrekic acid (BA), is not available, and thus its alternating access mechanism for the transport process is unknown. Here, we report an atomic structure of the IF form predicted by atomic-level molecular dynamics (MD) simulations of the alternating access transition with a recently developed accelerating technique. We successfully obtained a significantly stable IF structure characterized by newly formed well-packed and -organized inter-domain interactions through the accelerated simulations of unprecedentedly large conformational changes of the alternating access without a prior knowledge of the target protein structure. The simulation also shed light on an atomistic mechanism of the strict transport selectivity of adenosine nucleotides over guanosine and inosine ones. Furthermore, the IF structure was shown to bind ATP and BA, and thus revealed their binding mechanisms. The present study proposes a qualitatively novel view of the alternating access of transporters having the unique three-fold symmetry in atomic details and opens the way for rational drug design targeting the transporter in the dynamic functional cycle. PMID:28727843
Hayashi, Tomohiko; Chiba, Shuntaro; Kaneta, Yusuke; Furuta, Tadaomi; Sakurai, Minoru
2014-11-06
ATP binding cassette (ABC) proteins belong to a superfamily of active transporters. Recent experimental and computational studies have shown that binding of ATP to the nucleotide binding domains (NBDs) of ABC proteins drives the dimerization of NBDs, which, in turn, causes large conformational changes within the transmembrane domains (TMDs). To elucidate the active substrate transport mechanism of ABC proteins, it is first necessary to understand how the NBD dimerization is driven by ATP binding. In this study, we selected MalKs (NBDs of a maltose transporter) as a representative NBD and calculated the free-energy change upon dimerization using molecular mechanics calculations combined with a statistical thermodynamic theory of liquids, as well as a method to calculate the translational, rotational, and vibrational entropy change. This combined method is applied to a large number of snapshot structures obtained from molecular dynamics simulations containing explicit water molecules. The results suggest that the NBD dimerization proceeds with a large gain of water entropy when ATP molecules bind to the NBDs. The energetic gain arising from direct NBD-NBD interactions is canceled by the dehydration penalty and the configurational-entropy loss. ATP hydrolysis induces a loss of the shape complementarity between the NBDs, which leads to the dissociation of the dimer, due to a decrease in the water-entropy gain and an increase in the configurational-entropy loss. This interpretation of the NBD dimerization mechanism in concert with ATP, especially focused on the water-mediated entropy force, is potentially applicable to a wide variety of the ABC transporters.
Wile, Daryl J; Agarwal, Pankaj A; Schulzer, Michael; Mak, Edwin; Dinelle, Katherine; Shahinfard, Elham; Vafai, Nasim; Hasegawa, Kazuko; Zhang, Jing; McKenzie, Jessamyn; Neilson, Nicole; Strongosky, Audrey; Uitti, Ryan J; Guttman, Mark; Zabetian, Cyrus P; Ding, Yu-Shin; Adam, Mike; Aasly, Jan; Wszolek, Zbigniew K; Farrer, Matthew; Sossi, Vesna; Stoessl, A Jon
2017-05-01
People with Parkinson's disease can show premotor neurochemical changes in the dopaminergic and non-dopaminergic systems. Using PET, we assessed whether dopaminergic and serotonin transporter changes are similar in LRRK2 mutation carriers with Parkinson's disease and individuals with sporadic Parkinson's disease, and whether LRRK2 mutation carriers without motor symptoms show PET changes. We did two cross-sectional PET studies at the Pacific Parkinson's Research Centre in Vancouver, BC, Canada. We included LRRK2 mutation carriers with or without manifest Parkinson's disease, people with sporadic Parkinson's disease, and age-matched healthy controls, all aged 18 years or older. People with Parkinson's disease were diagnosed by a neurologist with movement disorder training, in accordance with the UK Parkinson's Disease Society Brain Bank criteria. LRRK2 carrier status was confirmed by bidirectional Sanger sequencing. In the first study, LRRK2 mutation carriers with or without manifest Parkinson's disease who were referred for investigation between July, 1999, and January, 2012, were scanned with PET tracers for the membrane dopamine transporter, and dopamine synthesis and storage ( 18 F-6-fluoro-L-dopa; 18 F-FDOPA). We compared findings with those in people with sporadic Parkinson's disease and age-matched healthy controls. In the second study, distinct groups of LRRK2 mutation carriers, individuals with sporadic Parkinson's disease, and age-matched healthy controls seen from November, 2012, to May, 2016, were studied with tracers for the serotonin transporter and vesicular monoamine transporter 2 (VMAT2). Striatal dopamine transporter binding, VMAT2 binding, 18 F-FDOPA uptake, and serotonin transporter binding in multiple brain regions were compared by ANCOVA, adjusted for age. Between January, 1997, and January, 2012, we obtained data for our first study from 40 LRRK2 mutation carriers, 63 individuals with sporadic Parkinson's disease, and 35 healthy controls. We identified significant group differences in striatal dopamine transporter binding (all age ranges in caudate and putamen, p<0·0001) and 18 F-FDOPA uptake (in caudate: age ≤50 years, p=0·0002; all other age ranges, p<0·0001; in putamen: all age ranges, p<0·0001). LRRK2 mutation carriers with manifest Parkinson's disease (n=15) had reduced striatal dopamine transporter binding and 18 F-FDOPA uptake, comparable with amounts seen in individuals with sporadic Parkinson's disease of similar duration. LRRK2 mutation carriers without manifest Parkinson's disease (n=25) had greater 18 F-FDOPA uptake and dopamine transporter binding than did individuals with sporadic Parkinson's disease, with 18 F-FDOPA uptake comparable with controls and dopamine transporter binding lower than in controls. Between November, 2012, and May, 2016, we obtained data for our second study from 16 LRRK2 mutation carriers, 13 individuals with sporadic Parkinson's disease, and nine healthy controls. Nine LRRK2 mutation carriers without manifest Parkinson's disease had significantly elevated serotonin transporter binding in the hypothalamus (compared with controls, individuals with LRRK2 Parkinson's disease, and people with sporadic Parkinson's disease, p<0·0001), striatum (compared with people with sporadic Parkinson's disease, p=0·02), and brainstem (compared with LRRK2 mutation carriers with manifest Parkinson's disease, p=0·01), after adjustment for age. Serotonin transporter binding in the cortex did not differ significantly between groups after age adjustment. Striatal VMAT2 binding was reduced in all individuals with manifest Parkinson's disease and reduced asymmetrically in one LRRK2 mutation carrier without manifest disease. Dopaminergic and serotonergic changes progress in a similar fashion in LRRK2 mutation carriers with manifest Parkinson's disease and individuals with sporadic Parkinson's disease, but LRRK2 mutation carriers without manifest Parkinson's disease show increased serotonin transporter binding in the striatum, brainstem, and hypothalamus, possibly reflecting compensatory changes in serotonergic innervation preceding the motor onset of Parkinson's disease. Increased serotonergic innervation might contribute to clinical differences in LRRK2 Parkinson's disease, including the emergence of non-motor symptoms and, potentially, differences in the long-term response to levodopa. Canada Research Chairs, Michael J Fox Foundation, National Institutes of Health, Pacific Alzheimer Research Foundation, Pacific Parkinson's Research Institute, National Research Council of Canada. Copyright © 2017 Elsevier Ltd. All rights reserved.
Deng, Ge; Wu, Kristi; Cruce, Alex A; Bowman, Michael K; Vincent, John B
2015-02-01
Transferrin, the major iron transport protein in the blood, also transports trivalent chromium in vivo. Recent in vitro studies have, however, suggested that the binding of chromic ions to apotransferrin is too slow to be biologically relevant. Nevertheless, the in vitro studies have generally failed to adequately take physiological bicarbonate concentrations into account. In aqueous buffer (with ambient (bi)carbonate concentrations), the binding of chromium to transferrin is too slow to be physiologically relevant, taking days to reach equilibrium with the protein's associated conformational changes. However, in the presence of 25mM (bi)carbonate, the concentration in human blood, chromic ions bind rapidly and tightly to transferrin. Details of the kinetics of chromium binding to human serum transferrin and conalbumin (egg white transferrin) in the presence of bicarbonate and other major potential chromium ligands are described and are consistent with transferrin being the major chromic ion transporter from the blood to tissues. Copyright © 2014 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhou, Huan-Xiang
2011-04-01
Ion permeation through transmembrane channels has traditionally been modeled using two different approaches. In one approach, the translocation of the permeant ion through the channel pore is modeled as continuous diffusion and the rate of ion transport is obtained from solving the steady-state diffusion equation. In the other approach, the translocation of the permeant ion through the pore is modeled as hopping along a discrete set of internal binding sites and the rate of ion transport is obtained from solving a set of steady-state rate equations. In a recent work [Zhou, J. Phys. Chem. Lett. 1, 1973 (2010)], the rate constants for binding to an internal site were further calculated by modeling binding as diffusion-influenced reactions. That work provided the foundation for bridging the two approaches. Here we show that, by representing a binding site as an energy well, the two approaches indeed give the same result for the rate of ion transport.
Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vognsen, Tina, E-mail: tv@farma.ku.dk; Kristensen, Ole, E-mail: ok@farma.ku.dk
2012-03-30
Highlights: Black-Right-Pointing-Pointer The crystal structure of the NTF2-like domain of Rasputin protein is presented. Black-Right-Pointing-Pointer Differences to known ligand binding sites of nuclear transport factor 2 are discussed. Black-Right-Pointing-Pointer A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 A resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a {beta}-sheet and three {alpha}-helices forming a cone-like shape. However, known binding sites formore » RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.« less
Functions of Intracellular Retinoid Binding-Proteins.
Napoli, Joseph L
Multiple binding and transport proteins facilitate many aspects of retinoid biology through effects on retinoid transport, cellular uptake, metabolism, and nuclear delivery. These include the serum retinol binding protein sRBP (aka Rbp4), the plasma membrane sRBP receptor Stra6, and the intracellular retinoid binding-proteins such as cellular retinol-binding proteins (CRBP) and cellular retinoic acid binding-proteins (CRABP). sRBP transports the highly lipophilic retinol through an aqueous medium. The major intracellular retinol-binding protein, CRBP1, likely enhances efficient retinoid use by providing a sink to facilitate retinol uptake from sRBP through the plasma membrane or via Stra6, delivering retinol or retinal to select enzymes that generate retinyl esters or retinoic acid, and protecting retinol/retinal from excess catabolism or opportunistic metabolism. Intracellular retinoic acid binding-proteins (CRABP1 and 2, and FABP5) seem to have more diverse functions distinctive to each, such as directing retinoic acid to catabolism, delivering retinoic acid to specific nuclear receptors, and generating non-canonical actions. Gene ablation of intracellular retinoid binding-proteins does not cause embryonic lethality or gross morphological defects. Metabolic and functional defects manifested in knockouts of CRBP1, CRBP2 and CRBP3, however, illustrate their essentiality to health, and in the case of CRBP2, to survival during limited dietary vitamin A. Future studies should continue to address the specific molecular interactions that occur between retinoid binding-proteins and their targets and their precise physiologic contributions to retinoid homeostasis and function.
Modelling of human transplacental transport as performed in Copenhagen, Denmark.
Mathiesen, Line; Mørck, Thit Aarøe; Zuri, Giuseppina; Andersen, Maria Helena; Pehrson, Caroline; Frederiksen, Marie; Mose, Tina; Rytting, Erik; Poulsen, Marie S; Nielsen, Jeanette K S; Knudsen, Lisbeth E
2014-07-01
Placenta perfusion models are very effective when studying the placental mechanisms in order to extrapolate to real-life situations. The models are most often used to investigate the transport of substances between mother and foetus, including the potential metabolism of these. We have studied the relationships between maternal and foetal exposures to various compounds including pollutants such as polychlorinated biphenyls, polybrominated flame retardants, nanoparticles as well as recombinant human antibodies. The compounds have been studied in the human placenta perfusion model and to some extent in vitro with an established human monolayer trophoblast cell culture model. Results from our studies distinguish placental transport of substances by physicochemical properties, adsorption to placental tissue, binding to transport and receptor proteins and metabolism. We have collected data from different classes of chemicals and nanoparticles for comparisons across chemical structures as well as different test systems. Our test systems are based on human material to bypass the extrapolation from animal data. By combining data from our two test systems, we are able to rank and compare the transport of different classes of substances according to their transport ability. Ultimately, human data including measurements in cord blood contribute to the study of placental transport. © 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).
2015-01-01
The high-affinity choline transporter (CHT) is the rate-limiting determinant of acetylcholine (ACh) synthesis, yet the transporter remains a largely undeveloped target for the detection and manipulation of synaptic cholinergic signaling. To expand CHT pharmacology, we pursued a high-throughput screen for novel CHT-targeted small molecules based on the electrogenic properties of transporter-mediated choline transport. In this effort, we identified five novel, structural classes of CHT-specific inhibitors. Chemical diversification and functional analysis of one of these classes identified ML352 as a high-affinity (Ki = 92 nM) and selective CHT inhibitor. At concentrations that fully antagonized CHT in transfected cells and nerve terminal preparations, ML352 exhibited no inhibition of acetylcholinesterase (AChE) or cholineacetyltransferase (ChAT) and also lacked activity at dopamine, serotonin, and norepinephrine transporters, as well as many receptors and ion channels. ML352 exhibited noncompetitive choline uptake inhibition in intact cells and synaptosomes and reduced the apparent density of hemicholinium-3 (HC-3) binding sites in membrane assays, suggesting allosteric transporter interactions. Pharmacokinetic studies revealed limited in vitro metabolism and significant CNS penetration, with features predicting rapid clearance. ML352 represents a novel, potent, and specific tool for the manipulation of CHT, providing a possible platform for the development of cholinergic imaging and therapeutic agents. PMID:25560927
He, Yongning; Bjorkman, Pamela J.
2011-01-01
Fc receptors transport maternal antibodies across epithelial cell barriers to passively immunize newborns. FcRY, the functional counterpart of mammalian FcRn (a major histocompatibility complex homolog), transfers IgY across the avian yolk sac, and represents a new class of Fc receptor related to the mammalian mannose receptor family. FcRY and FcRn bind immunoglobulins at pH ≤6.5, but not pH ≥7, allowing receptor–ligand association inside intracellular vesicles and release at the pH of blood. We obtained structures of monomeric and dimeric FcRY and an FcRY–IgY complex and explored FcRY's pH-dependent binding mechanism using electron cryomicroscopy (cryoEM) and small-angle X-ray scattering. The cryoEM structure of FcRY at pH 6 revealed a compact double-ring “head,” in which the N-terminal cysteine-rich and fibronectin II domains were folded back to contact C-type lectin-like domains 1–6, and a “tail” comprising C-type lectin-like domains 7–8. Conformational changes at pH 8 created a more elongated structure that cannot bind IgY. CryoEM reconstruction of FcRY dimers at pH 6 and small-angle X-ray scattering analysis at both pH values confirmed both structures. The cryoEM structure of the FcRY–IgY revealed symmetric binding of two FcRY heads to the dimeric FcY, each head contacting the CH4 domain of one FcY chain. FcRY shares structural properties with mannose receptor family members, including a head and tail domain organization, multimerization that may regulate ligand binding, and pH-dependent conformational changes. Our results facilitate understanding of immune recognition by the structurally related mannose receptor family and comparison of diverse methods of Ig transport across evolution. PMID:21746914
Ferenci, T; Lee, K S
1989-01-01
Maltoporin trimers constitute maltodextrin-selective channels in the outer membrane of Escherichia coli. To study the organization of the maltodextrin-binding site within trimers, dominance studies were undertaken with maltoporin variants of altered binding affinity. It has been established that amino acid substitutions at three dispersed regions of the maltoporin sequence (at residues 8, 82, and 360) resulted specifically in maltodextrin-binding defects and loss of maltodextrin channel selectivity; a substitution at residue 118 increased both binding affinity and maltodextrin transport. Strains heterodiploid for lamB were constructed in which these substitutions were encoded by chromosomal and plasmid-borne genes, and the relative level of maltoporin expression from these genes was estimated. Binding assays with bacteria forming maltoporin heterotrimers were performed in order to test for complementation between binding-negative alleles, negative dominance of negative over wild-type alleles, and possible dominance of negatives over the high-affinity allele. Double mutants with mutations affecting residues 8 and 118, 82 and 118, and 118 and 360 were constructed in vitro, and the dominance properties of the mutations in cis were also tested. There was no complementation between negatives and no negative dominance in heterotrimers. The high-affinity mutation was dominant over negatives in trans but not in cis. The affinity of binding sites in heterotrimer populations was characteristic of the high-affinity allele present and uninfluenced by the negative allele. These results are consistent with the presence of three discrete binding sites in a maltoporin trimer and suggest that the selectivity filter for maltodextrins is not at the interface between the three subunits. PMID:2521623
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Zhongshan; College of Life Sciences, Sichuan University, Chengdu 610065; Biomedical Sciences Research Complex, School of Chemistry, University of St Andrews, North Haugh, St Andrews KY16 9ST
2014-09-26
Highlights: • Determination of the structure of the wild-type LptB in complex with ATP and Mg{sup 2+}. • Demonstrated that ATP binding residues are essential for LptB’s ATPase activity and LPS transport. • Dimerization is required for the LptB’s function and LPS transport. • Revealed relationship between activity of the LptB and the vitality of E. coli cells. - Abstract: Lipopolysaccharide (LPS) is the main component of the outer membrane of Gram-negative bacteria, which plays an essential role in protecting the bacteria from harsh conditions and antibiotics. LPS molecules are transported from the inner membrane to the outer membrane bymore » seven LPS transport proteins. LptB is vital in hydrolyzing ATP to provide energy for LPS transport, however this mechanism is not very clear. Here we report wild-type LptB crystal structure in complex with ATP and Mg{sup 2+}, which reveals that its structure is conserved with other nucleotide-binding proteins (NBD). Structural, functional and electron microscopic studies demonstrated that the ATP binding residues, including K42 and T43, are crucial for LptB’s ATPase activity, LPS transport and the vitality of Escherichia coli cells with the exceptions of H195A and Q85A; the H195A mutation does not lower its ATPase activity but impairs LPS transport, and Q85A does not alter ATPase activity but causes cell death. Our data also suggest that two protomers of LptB have to work together for ATP hydrolysis and LPS transport. These results have significant impacts in understanding the LPS transport mechanism and developing new antibiotics.« less
Suzuki, M; Desmond, T J; Albin, R L; Frey, K A
2001-09-15
Markers of identified neuronal populations have previously suggested selective degeneration of projection neurons in Huntington's disease (HD) striatum. Interpretations are, however, limited by effects of compensatory regulation and atrophy. Studies of the vesicular monoamine transporter type-2 (VMAT2) and of the vesicular acetylcholine transporter (VAChT) in experimental animals indicate that they are robust markers of presynaptic integrity and are not subject to regulation. We measured dopamine and acetylcholine vesicular transporters to characterize the selectivity of degeneration in HD striatum. Brains were obtained at autopsy from four HD patients and five controls. Autoradiography was used to quantify radioligand binding to VMAT2, VAChT, the dopamine plasmalemmal transporter (DAT), benzodiazepine (BZ) binding sites, and D2-type dopamine receptors. The activity of choline acetyltransferase (ChAT) was determined as an additional marker of cholinergic neurons. Autoradiograms were analyzed by video-assisted densitometry and assessment of atrophy was made from regional structural areas in the coronal projection. Striatal VMAT2, DAT, and VAChT concentrations were unchanged or increased, while D2 and BZ binding and ChAT activity were decreased in HD. After atrophy correction, all striatal binding sites were decreased. However, the decrease in ChAT activity was 3-fold greater than that of VAChT binding. In addition to degeneration of striatal projection neurons, there are losses of extrinsic nigrostriatal projections and of striatal cholinergic interneurons in HD on the basis of vesicular transporter measures. There is also markedly reduced expression of ChAT by surviving cholinergic striatal interneurons. Copyright 2001 Wiley-Liss, Inc.
Cell permeability beyond the rule of 5.
Matsson, Pär; Doak, Bradley C; Over, Björn; Kihlberg, Jan
2016-06-01
Drug discovery for difficult targets that have large and flat binding sites is often better suited to compounds beyond the "rule of 5" (bRo5). However, such compounds carry higher pharmacokinetic risks, such as low solubility and permeability, and increased efflux and metabolism. Interestingly, recent drug approvals and studies suggest that cell permeable and orally bioavailable drugs can be discovered far into bRo5 space. Tactics such as reduction or shielding of polarity by N-methylation, bulky side chains and intramolecular hydrogen bonds may be used to increase cell permeability in this space, but often results in decreased solubility. Conformationally flexible compounds can, however, combine high permeability and solubility, properties that are keys for cell permeability and intestinal absorption. Recent developments in computational conformational analysis will aid design of such compounds and hence prediction of cell permeability. Transporter mediated efflux occurs for most investigated drugs in bRo5 space, however it is commonly overcome by high local intestinal concentrations on oral administration. In contrast, there is little data to support significant impact of transporter-mediated intestinal absorption in bRo5 space. Current knowledge of compound properties that govern transporter effects of bRo5 drugs is limited and requires further fundamental and comprehensive studies. Copyright © 2016 Elsevier B.V. All rights reserved.
Electronic transport in the quantum spin Hall state due to the presence of adatoms in graphene
NASA Astrophysics Data System (ADS)
Lima, Leandro; Lewenkopf, Caio
Heavy adatoms, even at low concentrations, are predicted to turn a graphene sheet into a topological insulator with substantial gap. The adatoms mediate the spin-orbit coupling that is fundamental to the quantum spin Hall effect. The adatoms act as local spin-orbit scatterer inducing hopping processes between distant carbon atoms giving origin to transverse spin currents. Although there are effective models that describe spectral properties of such systems with great detail, quantitative theoretical work for the transport counterpart is still lacking. We developed a multiprobe recursive Green's function technique with spin resolution to analyze the transport properties for large geometries. We use an effective tight-binding Hamiltonian to describe the problem of adatoms randomly placed at the center of the honeycomb hexagons, which is the case for most transition metals. Our choice of current and voltage probes is favorable to experiments since it filters the contribution of only one spin orientation, leading to a quantized spin Hall conductance of e2 / h . We also discuss the electronic propagation in the system by imaging the local density of states and the electronic current densities. The authors acknowledge the Brazilian agencies CNPq, CAPES, FAPERJ and INCT de Nanoestruturas de Carbono for financial support.
2011-01-01
Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der Waals volume, pK (pK-C, pK-N, pK-COOH and pK-a(RCOOH)), etc. Conclusions The proposed approach Auto-IDPCPs would help designers to investigate informative physicochemical and biochemical properties by considering both prediction accuracy and analysis of binding mechanism simultaneously. The approach Auto-IDPCPs can be also applicable to predict and analyze other protein functions from sequences. PMID:21342579
Contemplating Transport Characteristics by Augmenting the Length of Molecule
NASA Astrophysics Data System (ADS)
Kaur, Milanpreet; Sawhney, Ravinder Singh; Engles, Derick
2013-11-01
In this paper, we contemplated the transport characteristics of a single molecular device junction by augmenting the length of the molecule in the scattering region. The molecules considered here belongs to class of alkanedithiols (CnH2n+2S2). Specifically, we used a tight binding semi-empirical model to compute the transport characteristics of butanedithiol, pentanedithiol, hexanedithiol and heptanedithiol connected to semi-infinite gold electrodes through thiol anchoring elements. The exploration of transport properties of considered alkanes was completed for different bias voltages within the sphere of Keldysh's Non Equilibrium Green's Function (NEGF) and Extended Hückel Theory (EHT), for studying the self-consistent steady-state solution, analyzing the out-of-equilibrium electron distribution, and the behavior of the self-consistent potential. We perceived that the current and conductance retrenches with aggravation with the increase in length of the molecule with exhibition of single electron tunneling. We observed that the coupling regime shifts from strong coupling to weak for higher order alkanedithiols and the transmission is function of evenness or oddness of the carbon atoms forming an alkane.
McCauliff, Leslie A; Xu, Zhi; Li, Ran; Kodukula, Sarala; Ko, Dennis C; Scott, Matthew P; Kahn, Peter C; Storch, Judith
2015-11-06
The cholesterol storage disorder Niemann-Pick type C (NPC) disease is caused by defects in either of two late endosomal/lysosomal proteins, NPC1 and NPC2. NPC2 is a 16-kDa soluble protein that binds cholesterol in a 1:1 stoichiometry and can transfer cholesterol between membranes by a mechanism that involves protein-membrane interactions. To examine the structural basis of NPC2 function in cholesterol trafficking, a series of point mutations were generated across the surface of the protein. Several NPC2 mutants exhibited deficient sterol transport properties in a set of fluorescence-based assays. Notably, these mutants were also unable to promote egress of accumulated intracellular cholesterol from npc2(-/-) fibroblasts. The mutations mapped to several regions on the protein surface, suggesting that NPC2 can bind to more than one membrane simultaneously. Indeed, we have previously demonstrated that WT NPC2 promotes vesicle-vesicle interactions. These interactions were abrogated, however, by mutations causing defective sterol transfer properties. Molecular modeling shows that NPC2 is highly plastic, with several intense positively charged regions across the surface that could interact favorably with negatively charged membrane phospholipids. The point mutations generated in this study caused changes in NPC2 surface charge distribution with minimal conformational changes. The plasticity, coupled with membrane flexibility, probably allows for multiple cholesterol transfer routes. Thus, we hypothesize that, in part, NPC2 rapidly traffics cholesterol between closely appositioned membranes within the multilamellar interior of late endosomal/lysosomal proteins, ultimately effecting cholesterol egress from this compartment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Lerch, Jason; Furukawa, Yoshiaki; Tong, Junchao; McCluskey, Tina; Wilkins, Diana; Houle, Sylvain; Meyer, Jeffrey; Mundo, Emanuela; Wilson, Alan A.; Rusjan, Pablo M.; Saint-Cyr, Jean A.; Guttman, Mark; Collins, D. Louis; Shapiro, Colin; Warsh, Jerry J.; Boileau, Isabelle
2010-01-01
Animal data indicate that the recreational drug ecstasy (3,4-methylenedioxymethamphetamine) can damage brain serotonin neurons. However, human neuroimaging measurements of serotonin transporter binding, a serotonin neuron marker, remain contradictory, especially regarding brain areas affected; and the possibility that structural brain differences might account for serotonin transporter binding changes has not been explored. We measured brain serotonin transporter binding using [11C] N,N-dimethyl-2-(2-amino-4-cyanophenylthio) benzylamine in 50 control subjects and in 49 chronic (mean 4 years) ecstasy users (typically one to two tablets bi-monthly) withdrawn from the drug (mean 45 days). A magnetic resonance image for positron emission tomography image co-registration and structural analyses was acquired. Hair toxicology confirmed group allocation but also indicated use of other psychoactive drugs in most users. Serotonin transporter binding in ecstasy users was significantly decreased throughout all cerebral cortices (range –19 to –46%) and hippocampus (–21%) and related to the extent of drug use (years, maximum dose), but was normal in basal ganglia and midbrain. Substantial overlap was observed between control and user values except for insular cortex, in which 51% of ecstasy user values fell below the lower limit of the control range. Voxel-based analyses confirmed a caudorostral gradient of cortical serotonin transporter binding loss with occipital cortex most severely affected. Magnetic resonance image measurement revealed no overall regional volume differences between groups; however, a slight left-hemispheric biased cortical thinning was detected in methamphetamine-using ecstasy users. The serotonin transporter binding loss was not related to structural changes or partial volume effect, use of other stimulant drugs, blood testosterone or oestradiol levels, major serotonin transporter gene promoter polymorphisms, gender, psychiatric status, or self-reported hyperthermia or tolerance. The ecstasy group, although ‘grossly behaviourally normal’, reported subnormal mood and demonstrated generally modest deficits on some tests of attention, executive function and memory, with the latter associated with serotonin transporter decrease. Our findings suggest that the ‘typical’/low dose (one to two tablets/session) chronic ecstasy-polydrug user might display a highly selective mild to marked loss of serotonin transporter in cerebral cortex/hippocampus in the range of that observed in Parkinson’s disease, which is not gender-specific or completely accounted for by structural brain changes, recent use of other drugs (as assessed by hair analyses) or other potential confounds that we could address. The striking sparing of serotonin transporter-rich striatum (although possibly affected in ‘heavier’ users) suggests that serotonergic neurons innervating cerebral cortex are more susceptible, for unknown reasons, to ecstasy than those innervating subcortical regions and that behavioural problems in some ecstasy users during abstinence might be related to serotonin transporter changes limited to cortical regions. PMID:20483717
Rashba quantum wire: exact solution and ballistic transport.
Perroni, C A; Bercioux, D; Ramaglia, V Marigliano; Cataudella, V
2007-05-08
The effect of Rashba spin-orbit interaction in quantum wires with hard-wall boundaries is discussed. The exact wavefunction and eigenvalue equation are worked out, pointing out the mixing between the spin and spatial parts. The spectral properties are also studied within perturbation theory with respect to the strength of the spin-orbit interaction and diagonalization procedure. A comparison is made with the results of a simple model, the two-band model, that takes account only of the first two sub-bands of the wire. Finally, the transport properties within the ballistic regime are analytically calculated for the two-band model and through a tight-binding Green function for the entire system. Single and double interfaces separating regions with different strengths of spin-orbit interaction are analysed by injecting carriers into the first and the second sub-band. It is shown that in the case of a single interface the spin polarization in the Rashba region is different from zero, and in the case of two interfaces the spin polarization shows oscillations due to spin-selective bound states.
Bera, Krishnendu; Rani, Priyanka; Kishor, Gaurav; Agarwal, Shikha; Kumar, Antresh; Singh, Durg Vijay
2017-09-20
ATP-Binding cassette (ABC) transporters play an extensive role in the translocation of diverse sets of biologically important molecules across membrane. EchnocandinB (antifungal) and EcdL protein of Aspergillus rugulosus are encoded by the same cluster of genes. Co-expression of EcdL and echinocandinB reflects tightly linked biological functions. EcdL belongs to Multidrug Resistance associated Protein (MRP) subfamily of ABC transporters with an extra transmembrane domain zero (TMD0). Complete structure of MRP subfamily comprising of TMD0 domain, at atomic resolution is not known. We hypothesized that the transportation of echonocandinB is mediated via EcdL protein. Henceforth, it is pertinent to know the topological arrangement of TMD0, with other domains of protein and its possible role in transportation of echinocandinB. Absence of effective template for TMD0 domain lead us to model by I-TASSER, further structure has been refined by multiple template modelling using homologous templates of remaining domains (TMD1, NBD1, TMD2, NBD2). The modelled structure has been validated for packing, folding and stereochemical properties. MD simulation for 0.1 μs has been carried out in the biphasic environment for refinement of modelled protein. Non-redundant structures have been excavated by clustering of MD trajectory. The structural alignment of modelled structure has shown Z-score -37.9; 31.6, 31.5 with RMSD; 2.4, 4.2, 4.8 with ABC transporters; PDB ID 4F4C, 4M1 M, 4M2T, respectively, reflecting the correctness of structure. EchinocandinB has been docked to the modelled as well as to the clustered structures, which reveals interaction of echinocandinB with TMD0 and other TM helices in the translocation path build of TMDs.
Ion transport across the biological membrane by computational protein design
NASA Astrophysics Data System (ADS)
Grigoryan, Gevorg
The cellular membrane is impermeable to most of the chemicals the cell needs to take in or discard to survive. Therefore, transporters-a class of transmembrane proteins tasked with shuttling cargo chemicals in and out of the cell-are essential to all cellular life. From existing crystal structures, we know transporters to be complex machines, exquisitely tuned for specificity and controllability. But how could membrane-bound life have evolved if it needed such complex machines to exist first? To shed light onto this question, we considered the task of designing a transporter de novo. As our guiding principle, we took the ``alternating-access model''-a conceptual mechanism stating that transporters work by rocking between two conformations, each exposing the cargo-binding site to either the intra- or the extra-cellular environment. A computational design framework was developed to encode an anti-parallel four-helix bundle that rocked between two alternative states to orchestrate the movement of Zn(II) ions across the membrane. The ensemble nature of both states was accounted for using a free energy-based approach, and sequences were chosen based on predicted formation of the targeted topology in the membrane and bi-stability. A single sequence was prepared experimentally and shown to function as a Zn(II) transporter in lipid vesicles. Further, transport was specific to Zn(II) ions and several control peptides supported the underlying design principles. This included a mutant designed to retain all properties but with reduced rocking, which showed greatly depressed transport ability. These results suggest that early transporters could have evolved in the context of simple topologies, to be later tuned by evolution for improved properties and controllability. Our study also serves as an important advance in computational protein design, showing the feasibility of designing functional membrane proteins and of tuning conformational landscapes for desired function. Alfred P. Sloan Foundation Research Fellowship.
NASA Astrophysics Data System (ADS)
Yan, Jiawei; Wang, Shizhuo; Xia, Ke; Ke, Youqi
2017-03-01
Because disorders are inevitable in realistic nanodevices, the capability to quantitatively simulate the disorder effects on electron transport is indispensable for quantum transport theory. Here, we report a unified and effective first-principles quantum transport method for analyzing effects of chemical or substitutional disorder on transport properties of nanoelectronics, including averaged transmission coefficient, shot noise, and disorder-induced device-to-device variability. All our theoretical formulations and numerical implementations are worked out within the framework of the tight-binding linear muffin tin orbital method. In this method, we carry out the electronic structure calculation with the density functional theory, treat the nonequilibrium statistics by the nonequilbrium Green's function method, and include the effects of multiple impurity scattering with the generalized nonequilibrium vertex correction (NVC) method in coherent potential approximation (CPA). The generalized NVC equations are solved from first principles to obtain various disorder-averaged two-Green's-function correlators. This method provides a unified way to obtain different disorder-averaged transport properties of disordered nanoelectronics from first principles. To test our implementation, we apply the method to investigate the shot noise in the disordered copper conductor, and find all our results for different disorder concentrations approach a universal Fano factor 1 /3 . As the second test, we calculate the device-to-device variability in the spin-dependent transport through the disordered Cu/Co interface and find the conductance fluctuation is very large in the minority spin channel and negligible in the majority spin channel. Our results agree well with experimental measurements and other theories. In both applications, we show the generalized nonequilibrium vertex corrections play a determinant role in electron transport simulation. Our results demonstrate the effectiveness of the first-principles generalized CPA-NVC for atomistic analysis of disordered nanoelectronics, extending the capability of quantum transport simulation.
Pérez-Díaz, Ricardo; Madrid-Espinoza, José; Salinas-Cornejo, Josselyn; González-Villanueva, Enrique; Ruiz-Lara, Simón
2016-01-01
In plant cells, flavonoids are synthesized in the cytosol and then are transported and accumulated in the vacuole. Glutathione S-transferase-mediated transport has been proposed as a mechanism involved in flavonoid transport, however, whether binding of flavonoids to glutathione S-transferase (GST) or their transport is glutathione-dependent is not well understood. Glutathione S-transferases from Vitis vinífera (VviGSTs) have been associated with the transport of anthocyanins, however, their ability to transport other flavonoids such as proanthocyanidins (PAs) has not been established. Following bioinformatics approaches, we analyzed the capability of VviGST1, VviGST3, VviGST4, and Arabidopsis TT19 to bind different flavonoids. Analyses of protein-ligand interactions indicate that these GSTs can bind glutathione and monomers of anthocyanin, PAs and flavonols. A total or partial overlap of the binding sites for glutathione and flavonoids was found in VviGST1, and a similar condition was observed in VviGST3 using anthocyanin and flavonols as ligands, whereas VviGST4 and TT19 have both sites for GSH and flavonoids separated. To validate the bioinformatics predictions, functional complementation assays using the Arabidopsis tt19 mutant were performed. Overexpression of VviGST3 in tt19-1 specifically rescued the dark seed coat phenotype associated to correct PA transport, which correlated with higher binding affinity for PA precursors. VviGST4, originally characterized as an anthocyanin-related GST, complemented both the anthocyanin and PA deposition, resembling the function of TT19. By contrast, VviGST1 only partially rescued the normal seed color. Furthermore the expression pattern of these VviGSTs showed that each of these genes could be associated with the accumulation of different flavonoids in specific tissues during grapevine fruit development. These results provide new insights into GST-mediated PA transport in grapevine and suggest that VviGSTs present different specificities for flavonoid ligands. In addition, our data provide evidence to suggest that GST-mediate flavonoid transport is glutathione-dependent. PMID:27536314
Computational insights of water droplet transport on graphene sheet with chemical density
NASA Astrophysics Data System (ADS)
Zhang, Liuyang; Wang, Xianqiao
2014-05-01
Surface gradient has been emerging as an intriguing technique for nanoscale particle manipulation and transportation. Owing to its outstanding and stable chemical properties, graphene with covalently bonded chemical groups represents extraordinary potential for the investigation of nanoscale transport in the area of physics and biology. Here, we employ molecular dynamics simulations to investigate the fundamental mechanism of utilizing a chemical density on a graphene sheet to control water droplet motions on it. Simulation results have demonstrated that the binding energy difference among distinct segment of graphene in terms of interaction between the covalently bonded oxygen atoms on graphene and the water molecules provides a fundamental driving force to transport the water droplet across the graphene sheet. Also, the velocity of the water droplet has showed a strong dependence on the relative concentration of oxygen atoms between successive segments. Furthermore, a multi-direction channel provides insights to guide the transportation of objects towards a targeted position, separating the mixtures with a system of specific chemical functionalization. Our findings shed illuminating lights on the surface gradient method and therefore provide a feasible way to control nanoscale motion on the surface and mimic the channelless microfluidics.
Howard, John; Finch, Nicole A; Ochrietor, Judith D
2010-07-01
The purpose of this study was to determine the binding affinities of Basigin gene products and neural cell adhesion molecule L1cam for monocarboxylate transporter-1 (MCT1). ELISA binding assays were performed in which recombinant proteins of the transmembrane domains of Basigin gene products and L1cam were incubated with MCT1 captured from mouse brain. It was determined that Basigin gene products bind MCT1 with moderate affinity, but L1cam does not bind MCT1. Despite a high degree of sequence conservation between Basigin gene products and L1cam, the sequences are different enough to prevent L1cam from interacting with MCT1.
The Role of Cytosine Methylation on Charge Transport through a DNA Strand
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qi, Jianqing; Govind, Niranjan; Anantram, M. P.
Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modifi-cation remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Buttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. Specifically, we compare the results generated with the widely used B3LYP exchange-correlation (XC) functional and CAM-B3LYP based tuned range-separated hybrid density functional. We first analyze the effectmore » of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that with both functionals, the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and interstrand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital (HOMO) level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with both functionals. We also study the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit. Our results suggest that the effect of the two different functionals is to alter the on-site energies of the DNA bases at the HOMO level, while the transport properties don't depend much on the two functionals.« less
Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate
Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.
2013-01-01
NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581
Zhong, Huailing; Haddjeri, Nasser; Sánchez, Connie
2012-01-01
Escitalopram is a widely used antidepressant for the treatment of patients with major depression. It is the pure S-enantiomer of racemic citalopram. Several clinical trials and meta-analyses indicate that escitalopram is quantitatively more efficacious than many other antidepressants with a faster onset of action. This paper reviews current knowledge about the mechanism of action of escitalopram. The primary target for escitalopram is the serotonin transporter (SERT), which is responsible for serotonin (or 5-hydroxytryptamine [5-HT]) reuptake at the terminals and cell bodies of serotonergic neurons. Escitalopram and selective serotonin reuptake inhibitors bind with high affinity to the 5-HT binding site (orthosteric site) on the transporter. This leads to antidepressant effects by increasing extracellular 5-HT levels which enhance 5-HT neurotransmission. SERT also has one or more allosteric sites, binding to which modulates activity at the orthosteric binding site but does not directly affect 5-HT reuptake by the transporter. In vitro studies have shown that through allosteric binding, escitalopram decreases its own dissociation rate from the orthosteric site on the SERT. R-citalopram, the nontherapeutic enantiomer in citalopram, is also an allosteric modulator of SERT but can inhibit the actions of escitalopram by interfering negatively with its binding. Both nonclinical studies and some clinical investigations have demonstrated the cellular, neurochemical, neuroadaptive, and neuroplastic changes induced by escitalopram with acute and chronic administration. The findings from binding, neurochemical, and neurophysiological studies may provide a mechanistic rationale for the clinical difference observed with escitalopram compared to other antidepressant therapies.
Neundlinger, Isabel; Puntheeranurak, Theeraporn; Wildling, Linda; Rankl, Christian; Wang, Lai-Xi; Gruber, Hermann J.; Kinne, Rolf K. H.; Hinterdorfer, Peter
2014-01-01
Single molecule force spectroscopy was employed to investigate the dynamics of the sodium glucose co-transporter (SGLT1) upon substrate and inhibitor binding on the single molecule level. CHO cells stably expressing rbSGLT1 were probed by using atomic force microscopy tips carrying either thioglucose, 2′-aminoethyl β-d-glucopyranoside, or aminophlorizin. Poly(ethylene glycol) (PEG) chains of different length and varying end groups were used as tether. Experiments were performed at 10, 25 and 37 °C to address different conformational states of SGLT1. Unbinding forces between ligands and SGLT1 were recorded at different loading rates by changing the retraction velocity, yielding binding probability, width of energy barrier of the binding pocket, and the kinetic off rate constant of the binding reaction. With increasing temperature, width of energy barrier and average life time increased for the interaction of SGLT1 with thioglucose (coupled via acrylamide to a long PEG) but decreased for aminophlorizin binding. The former indicates that in the membrane-bound SGLT1 the pathway to sugar translocation involves several steps with different temperature sensitivity. The latter suggests that also the aglucon binding sites for transport inhibitors have specific, temperature-sensitive conformations. PMID:24962566
Yu, Tao; Wang, Xiao-Qing; Sang, Jian-Ping; Pan, Chun-Xu; Zou, Xian-Wu; Chen, Tsung-Yu; Zou, Xiaoqin
2012-01-01
Mutations in ClC channel proteins may cause serious functional changes and even diseases. The function of ClC proteins mainly manifests as Cl− transport, which is related to the binding free energies of chloride ions. Therefore, the influence of a mutation on ClC function can be studied by investigating the mutational effect on the binding free energies of chloride ions. The present study provides quantitative and systematic investigations on the influences of residue mutations on the electrostatic binding free energies in Escherichia coli ClC (EcClC) proteins, using all-atom molecular dynamics simulations. It was found that the change of the electrostatic binding free energy decreases linearly with the increase of the residue-chloride ion distance for a mutation. This work reveals how changes in the charge of a mutated residue and in the distance between the mutated residue and the binding site govern the variations in the electrostatic binding free energies, and therefore influence the transport of chloride ions and conduction in EcClC. This work would facilitate our understanding of the mutational effects on transport of chloride ions and functions of ClC proteins, and provide a guideline to estimate which residue mutations will have great influences on ClC functions. PMID:22612693
Bevers, Loes E.; Hagedoorn, Peter-Leon; Krijger, Gerard C.; Hagen, Wilfred R.
2006-01-01
A novel tungstate and molybdate binding protein has been discovered from the hyperthermophilic archaeon Pyrococcus furiosus. This tungstate transport protein A (WtpA) is part of a new ABC transporter system selective for tungstate and molybdate. WtpA has very low sequence similarity with the earlier-characterized transport proteins ModA for molybdate and TupA for tungstate. Its structural gene is present in the genome of numerous archaea and some bacteria. The identification of this new tungstate and molybdate binding protein clarifies the mechanism of tungstate and molybdate transport in organisms that lack the known uptake systems associated with the ModA and TupA proteins, like many archaea. The periplasmic protein of this ABC transporter, WtpA (PF0080), was cloned and expressed in Escherichia coli. Using isothermal titration calorimetry, WtpA was observed to bind tungstate (dissociation constant [KD] of 17 ± 7 pM) and molybdate (KD of 11 ± 5 nM) with a stoichiometry of 1.0 mol oxoanion per mole of protein. These low KD values indicate that WtpA has a higher affinity for tungstate than do ModA and TupA and an affinity for molybdate similar to that of ModA. A displacement titration of molybdate-saturated WtpA with tungstate showed that the tungstate effectively replaced the molybdate in the binding site of the protein. PMID:16952940
NASA Technical Reports Server (NTRS)
Ruegger, M.; Dewey, E.; Hobbie, L.; Brown, D.; Bernasconi, P.; Turner, J.; Muday, G.; Estelle, M.
1997-01-01
Polar auxin transport plays a key role in the regulation of plant growth and development. To identify genes involved in this process, we have developed a genetic procedure to screen for mutants of Arabidopsis that are altered in their response to auxin transport inhibitors. We recovered a total of 16 independent mutants that defined seven genes, called TRANSPORT INHIBITOR RESPONSE (TIR) genes. Recessive mutations in one of these genes, TIR3, result in altered responses to transport inhibitors, a reduction in polar auxin transport, and a variety of morphological defects that can be ascribed to changes in indole-3-acetic acid distribution. Most dramatically, tir3 seedlings are strongly deficient in lateral root production, a process that is known to depend on polar auxin transport from the shoot into the root. In addition, tir3 plants display a reduction in apical dominance as well as decreased elongation of siliques, pedicels, roots, and the inflorescence. Biochemical studies indicate that tir3 plants have a reduced number of N-1-naphthylphthalamic (NPA) binding sites, suggesting that the TIR3 gene is required for expression, localization, or stabilization of the NPA binding protein (NBP). Alternatively, the TIR3 gene may encode the NBP. Because the tir3 mutants have a substantial defect in NPA binding, their phenotype provides genetic evidence for a role for the NBP in plant growth and development.
Structural and functional basis of amino acid specificity in the invertebrate cotransporter KAAT1
Miszner, Andreea; Peres, Antonio; Castagna, Michela; Bettè, Sara; Giovannardi, Stefano; Cherubino, Francesca; Bossi, Elena
2007-01-01
The substrate specificity of KAAT1, a Na+- and K+-dependent neutral amino acid cotransporter cloned from the larva of the invertebrate Manduca sexta and belonging to the SLC6A gene family has been investigated using electrophysiological and radiotracer methods. The specificity of KAAT1 was compared to that of CAATCH1, a strictly related transporter with different amino acid selectivity. Competition experiments between different substrates indicate that both transporters bind leucine more strongly than threonine and proline, the difference between KAAT1 and CAATCH1 residing in the incapacity of the latter to complete the transport cycle in presence of leucine. The behaviour of CAATCH1 is mimicked by the S308T mutant form of KAAT1, constructed on the basis of the atomic structure of a leucine-transporting bacterial member of the family, which indicates the participation of this residue in the leucine-binding site. The reverse mutation T308S in CAATCH1 conferred to this transporter the ability to transport leucine in presence of K+. These results may be interpreted by a kinetic scheme in which, in presence of Na+, the leucine-bound state of the transporter is relatively stable, while in presence of K+ and at negative potentials the progression of the leucine-bound form along the cycle is favoured. In this context serine 308 appears to be important in allowing the change to the inward-facing conformation of the transporter following substrate binding, rather than in determining the binding specificity. PMID:17412764
Microwave emulations and tight-binding calculations of transport in polyacetylene
NASA Astrophysics Data System (ADS)
Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.
2017-01-01
A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.
Demonstration of clomipramine and venlafaxine occupation at serotonin reuptake sites in man in vivo.
Malizia, A L; Melichar, J M; Brown, D J; Gunn, R N; Reynolds, A; Jones, T; Nutt, D J
1997-01-01
We describe the use of 11CRTI-55 and the Multiple Objects Coincidences Counter (MOCC) to detect in-vivo binding to peripheral serotonin reuptake sites (left chest comprising platelet and lung serotonin reuptake sites) in man. Displacement and preloading experiments with clomipramine and venlafaxine in two healthy volunteers demonstrated that 11CRTI-55 binding is decreased in a dose-dependent fashion by both these drugs which bind to the serotonin transporter. In addition parallel data from the total head curve (representing 11CRTI-55 binding to central serotonin and dopamine (DA) reuptake sites) suggest that prior blockade of the serotonin transporter may be a useful strategy to maximize radioactive counts in the head when measuring the DA transporter. The MOCC is likely to be useful to determine sequential indices of relative serotonin reuptake blockade in patients on treatment.
Zahn, Raphael; Osmanović, Dino; Ehret, Severin; Araya Callis, Carolina; Frey, Steffen; Stewart, Murray; You, Changjiang; Görlich, Dirk; Hoogenboom, Bart W; Richter, Ralf P
2016-04-08
The permeability barrier of nuclear pore complexes (NPCs) controls bulk nucleocytoplasmic exchange. It consists of nucleoporin domains rich in phenylalanine-glycine motifs (FG domains). As a bottom-up nanoscale model for the permeability barrier, we have used planar films produced with three different end-grafted FG domains, and quantitatively analyzed the binding of two different nuclear transport receptors (NTRs), NTF2 and Importin β, together with the concomitant film thickness changes. NTR binding caused only moderate changes in film thickness; the binding isotherms showed negative cooperativity and could all be mapped onto a single master curve. This universal NTR binding behavior - a key element for the transport selectivity of the NPC - was quantitatively reproduced by a physical model that treats FG domains as regular, flexible polymers, and NTRs as spherical colloids with a homogeneous surface, ignoring the detailed arrangement of interaction sites along FG domains and on the NTR surface.
NASA Astrophysics Data System (ADS)
Korolenko, E. A.; Korolik, E. V.; Korolik, A. K.; Kirkovskii, V. V.
2007-07-01
We present results from an investigation of the binding ability of the main transport proteins (albumin, lipoproteins, and α-1-acid glycoprotein) of blood plasma from patients at different stages of liver cirrhosis by the fluorescent probe method. We used the hydrophobic fluorescent probes anionic 8-anilinonaphthalene-1-sulfonate, which interacts in blood plasma mainly with albumin; cationic Quinaldine red, which interacts with α-1-acid glycoprotein; and neutral Nile red, which redistributes between lipoproteins and albumin in whole blood plasma. We show that the binding ability of albumin and α-1-acid glycoprotein to negatively charged and positively charged hydrophobic metabolites, respectively, increases in the compensation stage of liver cirrhosis. As the pathology process deepens and transitions into the decompensation stage, the transport abilities of albumin and α-1-acid glycoprotein decrease whereas the binding ability of lipoproteins remains high.
USDA-ARS?s Scientific Manuscript database
Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...
Quantum transport modelling of silicon nanobeams using heterogeneous computing scheme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harb, M., E-mail: harbm@physics.mcgill.ca; Michaud-Rioux, V., E-mail: vincentm@physics.mcgill.ca; Guo, H., E-mail: guo@physics.mcgill.ca
We report the development of a powerful method for quantum transport calculations of nanowire/nanobeam structures with large cross sectional area. Our approach to quantum transport is based on Green's functions and tight-binding potentials. A linear algebraic formulation allows us to harness the massively parallel nature of Graphics Processing Units (GPUs) and our implementation is based on a heterogeneous parallel computing scheme with traditional processors and GPUs working together. Using our software tool, the electronic and quantum transport properties of silicon nanobeams with a realistic cross sectional area of ∼22.7 nm{sup 2} and a length of ∼81.5 nm—comprising 105 000 Si atoms and 24 000more » passivating H atoms in the scattering region—are investigated. The method also allows us to perform significant averaging over impurity configurations—all possible configurations were considered in the case of single impurities. Finally, the effect of the position and number of vacancy defects on the transport properties was considered. It is found that the configurations with the vacancies lying closer to the local density of states (LDOS) maxima have lower transmission functions than the configurations with the vacancies located at LDOS minima or far away from LDOS maxima, suggesting both a qualitative method to tune or estimate optimal impurity configurations as well as a physical picture that accounts for device variability. Finally, we provide performance benchmarks for structures as large as ∼42.5 nm{sup 2} cross section and ∼81.5 nm length.« less
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Electric transport through circular graphene quantum dots: Presence of disorder
NASA Astrophysics Data System (ADS)
Pal, G.; Apel, W.; Schweitzer, L.
2011-08-01
The electronic states of an electrostatically confined cylindrical graphene quantum dot and the electric transport through this device are studied theoretically within the continuum Dirac-equation approximation and compared with numerical results obtained from a tight-binding lattice description. A spectral gap, which may originate from strain effects, additional adsorbed atoms, or substrate-induced sublattice-symmetry breaking, allows for bound and scattering states. As long as the diameter of the dot is much larger than the lattice constant, the results of the continuum and the lattice model are in very good agreement. We also investigate the influence of a sloping dot-potential step, of on-site disorder along the sample edges, of uncorrelated short-range disorder potentials in the bulk, and of random magnetic fluxes that mimic ripple disorder. The quantum dot's spectral and transport properties depend crucially on the specific type of disorder. In general, the peaks in the density of bound states are broadened but remain sharp only in the case of edge disorder.
Haem Recognition By a Staphylococcus Aureus NEAT Domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grigg, J.C.; Vermeiren, C.; Heinrichs, D.E.
2009-06-01
Successful pathogenic organisms have developed mechanisms to thrive under extreme levels of iron restriction. Haem-iron represents the largest iron reservoir in the human body and is a significant source of iron for some bacterial pathogens. NEAT (NEAr Transporter) domains are found exclusively in a family of cell surface proteins in Gram-positive bacteria. Many NEAT domain-containing proteins, including IsdA in Staphylococcus aureus, are implicated in haem binding. Here, we show that overexpression of IsdA in S. aureus enhances growth and an inactivation mutant of IsdA has a growth defect, compared with wild type, when grown in media containing haem as themore » sole iron source. Furthermore, the haem-binding property of IsdA is contained within the NEAT domain. Crystal structures of the apo-IsdA NEAT domain and in complex with haem were solved and reveal a clathrin adapter-like beta-sandwich fold with a large hydrophobic haem-binding pocket. Haem is bound with the propionate groups directed at the molecular surface and the iron is co-ordinated solely by Tyr(166). The phenol groups of Tyr(166) and Tyr(170) form an H-bond that may function in regulating haem binding and release. An analysis of IsdA structure-sequence alignments indicate that conservation of Tyr(166) is a predictor of haem binding by NEAT domains.« less
Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN
NASA Astrophysics Data System (ADS)
Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro
2017-03-01
Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.
Jiang, Long; Li, Yu
2016-04-15
In this study, the properties of AhR binding affinity, bio-concentration factor, half-life and vapor pressure were selected as the typical indicators of biological toxicity, bio-concentration, persistence and atmospheric long-range transport potential for polybrominated diphenyl ethers (PBDEs), respectively. A three-dimensional pharmacophore modeling assistant with a full factor experimental design for each property was used to reveal the significant pharmacophore features and the substituent effects to obtain reasonable modified schemes for the selected target PBDEs. Finally, the performances of the persistent organic pollutant (POP) properties, the synthesis feasibility and the fire resistance of the modified compounds were evaluated. The most influential pharmacophore feature for all POP properties was the hydrophobic group, especially the vinyl and propyl groups. Modified compounds with two additional hydrophobic groups exhibited a better regulatory performance. The average reduction in the proportions of the four POP properties for the modified compounds (except for 3-phenyl-BDE-15) was 70.60%, 52.44%, 47.04% and 70.88%. In addition, the energy and the C-Br bond dissociation enthalpy of the four typical PBDEs were higher than those of the modified compounds (except for 3-phenyl-BDE-15), indicating the synthesis feasibility and the lower energy barrier of the modified compounds to release Br free radicals to provide fire resistance. Copyright © 2015 Elsevier B.V. All rights reserved.
Muller, François L L; Cuscov, Marco
2017-03-21
Blanket bogs contain vast amounts of Sphagnum-derived organic substances which can act as powerful chelators for dissolved iron and thus enhance its export to the coastal ocean. To investigate the variations in quantity and quality of these exports, adsorptive cathodic stripping voltammetry (CSV) was used to characterize the metal binding properties of molecular weight-fractionated dissolved organic matter (MW-fractionated DOM) in the catchment and coastal plume of a small peat-draining river over a seasonal cycle. Within the plume, both iron- and copper-binding organic ligands showed a linear, conservative distribution with increasing salinity, illustrating the high stability of peatland-derived humic substances (HS). Within the catchment, humic colloids lost up to 50% of their copper-binding capacity, expressed as a molar ratio to organic carbon, after residing for 1 week or more in the main reservoir of the catchment. Immediately downstream of the reservoir, the molar ratio [L 2 ]/[C org ], where L 2 was the second strongest copper-binding ligand, was 0.75 × 10 -4 when the reservoir residence time was 5 h but 0.34 × 10 -4 when it was 25 days. Residence time did not affect the carbon specific iron-binding capacity of the humic substances which was [L]/[C org ] = (0.80 ± 0.20) × 10 -2 . Our results suggest that the loss of copper-binding capacity with increasing residence time is caused by intracolloidal interactions between iron and HS during transit from peat soil to river mouth.
Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne
2014-10-03
Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne
2014-01-01
Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. PMID:25118291
Rice, Austin J; Harrison, Alistair; Alvarez, Frances J D; Davidson, Amy L; Pinkett, Heather W
2014-05-23
Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Zhang, Tong; Mu, Yuguang
2012-01-01
Crystal structures of Thermotoga maritima magnesium transporter CorA, reported in 2006, revealed its homo-pentameric constructions. However, the structure of the highly conserved extracellular interhelical loops remains unsolved, due to its high flexibility. We have explored the configurations of the loops through extensive replica exchange molecular dynamics simulations in explicit solvent model with the presence of either Co(III) Hexamine ions or Mg2+ ions. We found that there are multiple binding sites available on the interhelical loops in which the negatively charged residues, E316 and E320, are located notably close to the positively charged ions during the simulations. Our simulations resolved the distinct binding patterns of the two kinds of ions: Co(III) Hexamine ions were found to bind stronger with the loop than Mg2+ ions with binding free energy −7.3 kJ/mol lower, which is nicely consistent with the previous data. Our study provides an atomic basis description of the initial binding process of Mg2+ ions on the extracellular interhelical loops of CorA and the detailed inhibition mechanism of Co(III) Hexamine ions on CorA ions transportation. PMID:22952795
The Yeast Plasma Membrane ATP Binding Cassette (ABC) Transporter Aus1
Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L.; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther
2011-01-01
The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter. PMID:21521689
Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther
2011-06-17
The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter.
Switch loop flexibility affects substrate transport of the AcrB efflux pump
Muller, Reinke T.; Travers, Timothy; Cha, Hi-jea; ...
2017-10-05
The functionally important switch-loop of the trimeric multidrug transporter AcrB separates the access and deep drug binding pockets in every protomer. This loop, comprising 11 amino acid residues, has been shown to be crucial for substrate transport, as drugs have to travel past the loop to reach the deep binding pocket and from there are transported outside the cell via the connected AcrA and TolC channels. It contains four symmetrically arranged glycine residues suggesting that flexibility is a key feature for pump activity. Upon combinatorial substitution of these glycine residues to proline, functional and structural asymmetry was observed. Proline substitutionsmore » on the PC1 proximal side completely abolished transport and reduced backbone flexibility of the switch loop, which adopted a conformation restricting the pathway towards the deep binding pocket. Here, two phenylalanine residues located adjacent to the substitution sensitive glycine residues play a role in blocking the pathway upon rigidification of the loop, since the removal of the phenyl rings from the rigid loop restores drug transport activity.« less
Switch loop flexibility affects substrate transport of the AcrB efflux pump
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muller, Reinke T.; Travers, Timothy; Cha, Hi-jea
The functionally important switch-loop of the trimeric multidrug transporter AcrB separates the access and deep drug binding pockets in every protomer. This loop, comprising 11 amino acid residues, has been shown to be crucial for substrate transport, as drugs have to travel past the loop to reach the deep binding pocket and from there are transported outside the cell via the connected AcrA and TolC channels. It contains four symmetrically arranged glycine residues suggesting that flexibility is a key feature for pump activity. Upon combinatorial substitution of these glycine residues to proline, functional and structural asymmetry was observed. Proline substitutionsmore » on the PC1 proximal side completely abolished transport and reduced backbone flexibility of the switch loop, which adopted a conformation restricting the pathway towards the deep binding pocket. Here, two phenylalanine residues located adjacent to the substitution sensitive glycine residues play a role in blocking the pathway upon rigidification of the loop, since the removal of the phenyl rings from the rigid loop restores drug transport activity.« less
Wiley, J S; Brocklebank, A M; Snook, M B; Jamieson, G P; Sawyer, W H; Craik, J D; Cass, C E; Robins, M J; McAdam, D P; Paterson, A R
1991-02-01
The N6-(4-nitrobenzyl) derivative of adenosine is a tight-binding inhibitor of the equilibrative inhibitor-sensitive nucleoside transporter of mammalian cells. A fluorescent ligand for this transporter has been synthesized by allowing an adenosine analogue. 5'-S-(2-aminoethyl)-N6-(4-nitrobenzyl)-5'-thioadenosine (SAENTA), to react with fluorescein isothiocyanate. The purified adduct had a SAENTA/fluorescein molar ratio of 0.92:1 calculated from its absorption spectrum. The intensity of fluorescent emission from the SAENTA-chi 2-fluorescein adduct was 30% that of fluorescein isothiocyanate (chi 2 is the number of atoms in the linkage between fluorescein and SAENTA). SAENTA-chi 2-fluorescein inhibited the influx of nucleosides into cultured leukaemic cells with an IC50 (total concentration of inhibitor producing 50% inhibition) of 40 nM. The adduct inhibited the binding of [3H]nitrobenzylthioinosine ([3H]NBMPR) with half-maximal inhibition at 50-100 nM. Mass Law analysis of the competitive-binding data suggested the presence of two classes of sites for [3H]NBMPR binding, only one of which was accessible to SAENTA-chi 2-fluorescein. Flow cytometry was used to analyse equilibrium binding of SAENTA-chi 2-fluorescein to leukaemic cells and a Kd of 6 nM was obtained. SAENTA-chi 2-fluorescein is a high-affinity ligand for the equilibrative inhibitor-sensitive nucleoside transporter which allows rapid assessment of transport capacity by flow cytometry.
Law, Christopher J.; Almqvist, Jonas; Bernstein, Adam; Goetz, Regina M.; Huang, Yafei; Soudant, Celine; Laaksonen, Aatto; Hovmöller, Sven; Wang, Da-Neng
2008-01-01
Summary Active transport of substrates across cytoplasmic membranes is of great physiological, medical and pharmaceutical importance. The glycerol-3-phosphate (G3P) transporter (GlpT) of the E. coli inner membrane is a secondary active antiporter from the ubiquitous major facilitator superfamily that couples the import of G3P to the efflux of inorganic phosphate (Pi) down its concentration gradient. Integrating information from a novel combination of structural, molecular dynamics simulations and biochemical studies, we identify the residues involved directly in binding of substrate to the inward-facing conformation of GlpT, thus defining the structural basis for the substrate-specificity of this transporter. The substrate binding mechanism involves protonation of a histidine residue at the binding site. Furthermore, our data suggest that the formation and breaking of inter- and intradomain salt bridges control the conformational change of the transporter that accompanies substrate translocation across the membrane. The mechanism we propose may be a paradigm for organophosphate/phosphate antiporters. PMID:18395745
Quercetin inhibits glucose transport by binding to an exofacial site on GLUT1.
Hamilton, Kathryn E; Rekman, Janelle F; Gunnink, Leesha K; Busscher, Brianna M; Scott, Jordan L; Tidball, Andrew M; Stehouwer, Nathan R; Johnecheck, Grace N; Looyenga, Brendan D; Louters, Larry L
2018-05-29
Quercetin, a common dietary flavone, is a competitive inhibitor of glucose uptake and is also thought to be transported into cells by GLUT1. In this study, we confirm that quercetin is a competitive inhibitor of GLUT1 and also demonstrate that newly synthesized compounds, WZB-117 and BAY-876 are robust inhibitors of GLUT1 in L929 cells. To measure quercetin interaction with L929 cells, we develop a new fluorescent assay using flow cytometry. The binding of quercetin and its inhibitory effects on 2-deoxyglucose (2DG) uptake showed nearly identical dose dependent effects, with both having maximum effects between 50 and 100 μM and similar half maximum effects at 8.9 and 8.5 μM respectively. The interaction of quercetin was rapid with t 1/2 of 54 s and the onset and loss of its inhibitory effects on 2DG uptake were equally fast. This suggests that either quercetin is simply binding to surface GLUT1 or its transport in and out of the cell reaches equilibrium very quickly. If quercetin is transported, the co-incubation of quercetin with other glucose inhibitors should block quercetin uptake. However, we observed that WZB-117, an exofacial binding inhibitor of GLUT1 reduced quercetin interaction, while cytochalasin B, an endofacial binding inhibitor, enhanced quercetin interaction, and BAY-876 had no effect on quercetin interaction. Taken together, these data are more consistent with quercetin simply binding to GLUT1, but not actually being transported into L929 cells via the glucose channel in GLUT1. Copyright © 2018. Published by Elsevier B.V.
Nerada, Zsuzsanna; Hegyi, Zoltán; Szepesi, Áron; Tóth, Szilárd; Hegedüs, Csilla; Várady, György; Matula, Zsolt; Homolya, László; Sarkadi, Balázs; Telbisz, Ágnes
2016-09-01
ABC multidrug transporters are key players in cancer multidrug resistance and in determining the ADME-Tox properties of drugs and xenobiotics. The most sensitive and specific detection of these transporters is based on functional assays. Assessment of the transporter-dependent reduction of cellular uptake of the fluorescent dyes, such as Hoechst 33342 (Ho) and more recently DyeCycle Violet (DCV), have been widely advocated for the characterization of both ABCB1 and ABCG2 multidrug transporters. Detailed comparison of these supravital DNA-binding dyes revealed that DCV is less toxic to ABCG2- and ABCB1-expressing cells than Ho. ATPase measurements imply that DCV and Ho are similarly handled by ABCB1, whereas ABCG2 seems to transport DVC more effectively. In addition, we have developed an image-based high content microscopy screening method for simultaneous in situ measurement of the cellular activity and expression of the ABCG2 multidrug transporter. We demonstrated the applicability of this method for identifying ABCG2-positive cells in heterogeneous cell population by a single dye uptake measurement. These results may promote multidrug transporter studies at a single cell level and allow the quantitative detection of clinically important drug-resistant sub-populations. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.
Azouzi, Slim; Collec, Emmanuel; Mohandas, Narla; An, Xiuli; Colin, Yves; Le Van Kim, Caroline
2015-01-01
Summary Protein 4.1R plays an important role in maintaining the mechanical properties of the erythrocyte membrane. We analysed the expression of Kell blood group protein in erythrocytes from a patient with hereditary elliptocytosis associated with complete 4.1R deficiency (4.1(−) HE). Flow cytometry and Western blot analyses revealed a severe reduction of Kell. In vitro pull down and co-immunoprecipitation experiments from erythrocyte membranes showed a direct interaction between Kell and 4.1R. Using different recombinant domains of 4.1R and the cytoplasmic domain of Kell, we demonstrated that the R46R motif in the juxta-membrane region of Kell binds to lobe B of the 4.1R FERM domain. We also observed that 4.1R deficiency is associated with a reduction of XK and DARC (also termed ACKR1) proteins, the absence of the glycosylated form of the urea transporter B and a slight decrease of band 3. The functional alteration of the 4.1(−) HE erythrocyte membranes was also determined by measuring various transport activities. We documented a slower rate of HCO3−/Cl− exchange, but normal water and ammonia transport across erythrocyte membrane in the absence of 4.1. These findings provide novel insights into the structural organization of blood group antigen proteins into the 4.1R complex of the human red cell membrane. PMID:26455906
Steglich, Matthias; Hofmann, Julia D; Helmecke, Julia; Sikorski, Johannes; Spröer, Cathrin; Riedel, Thomas; Bunk, Boyke; Overmann, Jörg; Neumann-Schaal, Meina; Nübel, Ulrich
2018-01-01
We report the frequent, convergent loss of two genes encoding the substrate-binding protein and the ATP-binding protein of an ATP-binding cassette (ABC) transporter from the genomes of unrelated Clostridioides difficile strains. This specific genomic deletion was strongly associated with the reduced uptake of tyrosine and phenylalanine and production of derived Stickland fermentation products, including p -cresol, suggesting that the affected ABC transporter had been responsible for the import of aromatic amino acids. In contrast, the transporter gene loss did not measurably affect bacterial growth or production of enterotoxins. Phylogenomic analysis of publically available genome sequences indicated that this transporter gene deletion had occurred multiple times in diverse clonal lineages of C. difficile , with a particularly high prevalence in ribotype 027 isolates, where 48 of 195 genomes (25%) were affected. The transporter gene deletion likely was facilitated by the repetitive structure of its genomic location. While at least some of the observed transporter gene deletions are likely to have occurred during the natural life cycle of C. difficile , we also provide evidence for the emergence of this mutation during long-term laboratory cultivation of reference strain R20291.
Steglich, Matthias; Hofmann, Julia D.; Helmecke, Julia; Sikorski, Johannes; Spröer, Cathrin; Riedel, Thomas; Bunk, Boyke; Overmann, Jörg; Neumann-Schaal, Meina; Nübel, Ulrich
2018-01-01
We report the frequent, convergent loss of two genes encoding the substrate-binding protein and the ATP-binding protein of an ATP-binding cassette (ABC) transporter from the genomes of unrelated Clostridioides difficile strains. This specific genomic deletion was strongly associated with the reduced uptake of tyrosine and phenylalanine and production of derived Stickland fermentation products, including p-cresol, suggesting that the affected ABC transporter had been responsible for the import of aromatic amino acids. In contrast, the transporter gene loss did not measurably affect bacterial growth or production of enterotoxins. Phylogenomic analysis of publically available genome sequences indicated that this transporter gene deletion had occurred multiple times in diverse clonal lineages of C. difficile, with a particularly high prevalence in ribotype 027 isolates, where 48 of 195 genomes (25%) were affected. The transporter gene deletion likely was facilitated by the repetitive structure of its genomic location. While at least some of the observed transporter gene deletions are likely to have occurred during the natural life cycle of C. difficile, we also provide evidence for the emergence of this mutation during long-term laboratory cultivation of reference strain R20291. PMID:29867812
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miao, Y.C.; Liu, C.
2010-12-28
Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitorsmore » in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.« less
Assembly and mechanism of a group II ECF transporter.
Karpowich, Nathan K; Wang, Da-Neng
2013-02-12
Energy-coupling factor (ECF) transporters are a recently discovered family of primary active transporters for micronutrients and vitamins, such as biotin, thiamine, and riboflavin. Found exclusively in archaea and bacteria, including the human pathogens Listeria, Streptococcus, and Staphylococcus, ECF transporters may be the only means of vitamin acquisition in these organisms. The subunit composition of ECF transporters is similar to that of ATP binding cassette (ABC) importers, whereby both systems share two homologous ATPase subunits (A and A'), a high affinity substrate-binding subunit (S), and a transmembrane coupling subunit (T). However, the S subunit of ECF transporters is an integral membrane protein, and the transmembrane coupling subunits do not share an obvious sequence homology between the two transporter families. Moreover, the subunit stoichiometry of ECF transporters is controversial, and the detailed molecular interactions between subunits and the conformational changes during substrate translocation are unknown. We have characterized the ECF transporters from Thermotoga maritima and Streptococcus thermophilus. Our data suggests a subunit stoichiometry of 2S:2T:1A:1A' and that S subunits for different substrates can be incorporated into the same transporter complex simultaneously. In the first crystal structure of the A-A' heterodimer, each subunit contains a novel motif called the Q-helix that plays a key role in subunit coupling with the T subunits. Taken together, these findings suggest a mechanism for coupling ATP binding and hydrolysis to transmembrane transport by ECF transporters.
Albumin-based drug delivery: harnessing nature to cure disease.
Larsen, Maja Thim; Kuhlmann, Matthias; Hvam, Michael Lykke; Howard, Kenneth A
2016-01-01
The effectiveness of a drug is dependent on accumulation at the site of action at therapeutic levels, however, challenges such as rapid renal clearance, degradation or non-specific accumulation requires drug delivery enabling technologies. Albumin is a natural transport protein with multiple ligand binding sites, cellular receptor engagement, and a long circulatory half-life due to interaction with the recycling neonatal Fc receptor. Exploitation of these properties promotes albumin as an attractive candidate for half-life extension and targeted intracellular delivery of drugs attached by covalent conjugation, genetic fusions, association or ligand-mediated association. This review will give an overview of albumin-based products with focus on the natural biological properties and molecular interactions that can be harnessed for the design of a next-generation drug delivery platform.
Ren, Xiao M; Guo, Liang-Hong
2012-04-17
Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions on experimental animals, and one of the proposed disruption mechanisms is the competitive binding of PBDE metabolites to TH transport proteins. In this report, a nonradioactive, site-specific fluorescein-thyroxine (F-T4) conjugate was designed and synthesized as a fluorescence probe to study the binding interaction of hydroxylated PBDEs to thyroxine-binding globulin (TBG) and transthyretin (TTR), two major TH transport proteins in human plasma. Compared with free F-T4, the fluorescence intensity of TTR-bound conjugate was enhanced by as much as 2-fold, and the fluorescence polarization value of TBG-bound conjugate increased by more than 20-fold. These changes provide signal modulation mechanisms for F-T4 as a fluorescence probe. Based on fluorescence quantum yield and lifetime measurements, the fluorescence intensity enhancement was likely due to the elimination of intramolecular fluorescence quenching of fluorescein by T4 after F-T4 was bound to TTR. In circular dichroism and intrinsic tryptophan fluorescence measurements, F-T4 induced similar spectroscopic changes of the proteins as T4 did, suggesting that F-T4 bound to the proteins at the T4 binding site. By using F-T4 as the fluorescence probe in competitive binding assays, 11 OH-PBDEs with different levels of bromination and different hydroxylation positions were assessed for their binding affinity with TBG and TTR, respectively. The results indicate that the binding affinity generally increased with bromine number and OH position also played an important role. 3-OH-BDE-47 and 3'-OH-BDE-154 bound to TTR and TBG even stronger, respectively, than T4. With rising environmental level and high bioaccumulation capability, PBDEs have the potential to disrupt thyroid homeostasis by competitive binding with TH transport proteins.
Structural Characterization of Two Metastable ATP-Bound States of P-Glycoprotein
O’Mara, Megan L.; Mark, Alan E.
2014-01-01
ATP Binding Cassette (ABC) transporters couple the binding and hydrolysis of ATP to the transport of substrate molecules across the membrane. The mechanism by which ATP binding and/or hydrolysis drives the conformational changes associated with substrate transport has not yet been characterized fully. Here, changes in the conformation of the ABC export protein P-glycoprotein on ATP binding are examined in a series of molecular dynamics simulations. When one molecule of ATP is placed at the ATP binding site associated with each of the two nucleotide binding domains (NBDs), the membrane-embedded P-glycoprotein crystal structure adopts two distinct metastable conformations. In one, each ATP molecule interacts primarily with the Walker A motif of the corresponding NBD. In the other, the ATP molecules interacts with both Walker A motif of one NBD and the Signature motif of the opposite NBD inducing the partial dimerization of the NBDs. This interaction is more extensive in one of the two ATP binding site, leading to an asymmetric structure. The overall conformation of the transmembrane domains is not altered in either of these metastable states, indicating that the conformational changes associated with ATP binding observed in the simulations in the absence of substrate do not lead to the outward-facing conformation and thus would be insufficient in themselves to drive transport. Nevertheless, the metastable intermediate ATP-bound conformations observed are compatible with a wide range of experimental cross-linking data demonstrating the simulations do capture physiologically important conformations. Analysis of the interaction between ATP and its cofactor Mg2+ with each NBD indicates that the coordination of ATP and Mg2+ differs between the two NBDs. The role structural asymmetry may play in ATP binding and hydrolysis is discussed. Furthermore, we demonstrate that our results are not heavily influenced by the crystal structure chosen for initiation of the simulations. PMID:24632881
Kim, Sang Eun; Han, Seung-Moo
2009-07-01
The effect of substances which alter extracellular dopamine (DA) concentration has been studied by measuring changes in the binding of radiolabelled raclopride, a DA D2 receptor ligand that is sensitive to endogenous DA. To better characterize the relationship between extracellular DA concentration and DA D2 receptor binding of raclopride, we compared the changes of extracellular DA concentration (measured using in-vivo microdialysis) and in-vivo [3H]raclopride binding induced by different doses of methamphetamine (Meth) and nicotine, drugs that enhance DA release with and without blocking DA transporters (DATs), respectively, in rat striatum. Nicotine elicited a modest increase of striatal extrasynaptic extracellular DA, while Meth produced a marked increase of striatal extrasynaptic DA in a dose-dependent manner. There was a close correlation between the decrease in [3H]raclopride in-vivo binding and the increase in extrasynaptic DA concentration induced by both nicotine (r2=0.95, p<0.001) and Meth (r2=0.98, p=0.001), supporting the usefulness of the radiolabelled raclopride-binding measurement for the non-invasive assessment of DA release following interventions in the living brain. However, the linear regression analysis revealed that the ratio of percent DA increase to percent [3H]raclopride binding reduction was 25-fold higher for Meth (34.8:1) than for nicotine (1.4:1). The apparent discrepancy in the extrasynaptic DA-[3H]raclopride binding relationship between the DA-enhancing drugs with and without DAT-blocking property indicates that the competition between endogenous DA and radiolabelled raclopride takes place at the intrasynaptic rather than extrasynaptic DA D2 receptors and reflects synaptic concentration of DA.
Sheikh, Ishfaq A; Beg, Mohd A
2017-12-01
Endocrine disruption is a phenomenon when a man-made or natural compound interferes with normal hormone function in human or animal body systems. Endocrine-disrupting compounds (EDCs) have assumed considerable importance as a result of industrial activity, mass production of synthetic chemicals and environmental pollution. Phthalate plasticizers are a group of chemicals used widely and diversely in industry especially in the plastic industry, and many of the phthalate compounds have endocrine-disrupting properties. Increasing evidence indicates that steroid nuclear receptors and steroid binding proteins are the main targets of endocrine disruption. Corticosteroid-binding globulin (CBG) is a steroid binding protein that binds and transports cortisol in the blood circulation and is a potential target for endocrine disruption. An imbalance of cortisol in the body leads to many health problems. Induced fit docking of nine important and environmentally relevant phthalate plasticizers (DMP, BBP, DBP, DIBP, DnHP, DEHP, DINP, DnOP, DIDP) showed interactions with 10-19 amino acid residues of CBG. Comparison of the interacting residues of CBG with phthalate ligands and cortisol showed an overlapping of the majority (53-82%) of residues for each phthalate. Five of nine phthalate compounds and cortisol shared a hydrogen bonding interaction with the Arg-252 residue of CBG. Long-chain phthalates, such as DEHP, DINP, DnOP and DIDP displayed a higher binding affinity and formed a number of interactions with CBG in comparison to short-chain phthalates. The similarity in structural binding characteristics of phthalate compounds and native ligand cortisol suggested potential competitive conflicts in CBG-cortisol binding function and possible disruption of cortisol and progesterone homeostasis. Copyright © 2017 John Wiley & Sons, Ltd.
Tracing Cytoplasmic Ca2+ Ion and Water Access Points in the Ca2+-ATPase
Musgaard, Maria; Thøgersen, Lea; Schiøtt, Birgit; Tajkhorshid, Emad
2012-01-01
Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) transports two Ca2+ ions across the membrane of the sarco(endo)plasmic reticulum against the concentration gradient, harvesting the required energy by hydrolyzing one ATP molecule during each transport cycle. Although SERCA is one of the best structurally characterized membrane transporters, it is still largely unknown how the transported Ca2+ ions reach their transmembrane binding sites in SERCA from the cytoplasmic side. Here, we performed extended all-atom molecular dynamics simulations of SERCA. The calculated electrostatic potential of the protein reveals a putative mechanism by which cations may be attracted to and bind to the Ca2+-free state of the transporter. Additional molecular dynamics simulations performed on a Ca2+-bound state of SERCA reveal a water-filled pathway that may be used by the Ca2+ ions to reach their buried binding sites from the cytoplasm. Finally, several residues that are involved in attracting and guiding the cations toward the possible entry channel are identified. The results point to a single Ca2+ entry site close to the kinked part of the first transmembrane helix, in a region loaded with negatively charged residues. From this point, a water pathway outlines a putative Ca2+ translocation pathway toward the transmembrane ion-binding sites. PMID:22339863
Zhang, Peng; Cyriac, George; Kopajtic, Theresa; Zhao, Yongfang; Javitch, Jonathan A.; Katz, Jonathan L.; Newman, Amy Hauck
2010-01-01
(±)-Citalopram (1, 1-(3-(dimethylamino)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile), and its eutomer, escitalopram (S(+)-1) are selective serotonin reuptake inhibitors (SSRIs) that are used clinically to treat anxiety and depression. To further explore structure-activity relationships at the serotonin transporter (SERT), a series of (±)-4- and 5-substituted citalopram analogues were designed, synthesized and evaluated for binding at the SERT, dopamine transporter (DAT) and norepinephrine transporter (NET) in native rodent tissue. Many of these analogues showed high SERT binding affinities (Ki = 1–40 nM) and selectivities over both NET and DAT. Selected enantiomeric pairs of analogues were synthesized and both retained enantioselectivity as with S- and R-1, wherein S > R at the SERT. In addition, the enantiomeric pairs of 1 and 5 were tested for binding at the homologous bacterial Leucine transporter (LeuT), wherein low affinities and the absence of enantioselectivity suggested distinctive binding sites for these compounds at SERT as compared to LeuT. These novel ligands will provide molecular tools to elucidate drug-protein interactions at the SERT and to relate those to behavioral actions, in vivo. PMID:20672825
Nkongolo, Shirin; Ni, Yi; Lempp, Florian A; Kaufman, Christina; Lindner, Thomas; Esser-Nobis, Katharina; Lohmann, Volker; Mier, Walter; Mehrle, Stefan; Urban, Stephan
2014-04-01
Chronic hepatitis B and hepatitis D are global health problems caused by the human hepatitis B and hepatitis D virus. The myristoylated preS1 domain of the large envelope protein mediates specific binding to hepatocytes by sodium taurocholate co-transporting polypeptide (NTCP). NTCP is a bile salt transporter known to be inhibited by cyclosporin A. This study aimed to characterize the effect of cyclosporin A on HBV/HDV infection. HepaRG cells, primary human hepatocytes, and susceptible NTCP-expressing hepatoma cell lines were applied for infection experiments. The mode of action of cyclosporin A was studied by comparing the effect of different inhibitors, cyclophilin A/B/C-silenced cell lines as well as NTCP variants and mutants. Bile salt transporter and HBV receptor functions were investigated by taurocholate uptake and quantification of HBVpreS binding. Cyclosporin A inhibited hepatitis B and D virus infections during and--less pronounced--prior to virus inoculation. Binding of HBVpreS to NTCP was blocked by cyclosporin A concentrations at 8 μM. An NTCP variant deficient in HBVpreS binding but competent for bile salt transport showed resistance to cyclosporin A. Silencing of cyclophilins A/B/C did not abrogate transporter and receptor inhibition. In contrast, tacrolimus, a cyclophilin-independent calcineurin inhibitor, was inactive. HBV and HDV entry via sodium taurocholate co-transporting polypeptide is inhibited by cyclosporin A. The interaction between the drug and the viral receptor is direct and overlaps with a functional binding site of the preS1 domain, which mediates viral entry. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Mohamadi, Maryam; Faghih-Mirzaei, Ehsan; Ebrahimipour, S. Yousef; Sheikhshoaie, Iran; Haase, Wolfgang; Foro, Sabine
2017-07-01
A cis-dioxido Mo(VI) complex, [MoO2(L)(MeOH)], [L2-: (3-methoxy-2-oxidobenzylidene) benzohydrazonate], has been synthesized and characterized using physicochemical and spectroscopic techniques including elemental analysis, FT-IR, 1HNMR, UV-Vis spectroscopy, molar conductivity and single crystal X-ray diffraction. DFT calculations in the ground state of the complex were carried out using hybrid functional B3LYP with DGDZVP as basis set. Non-linear optical properties including electric dipole moment (μ), polarizability (α) and molecular first hyperpolarizability (β) of the compound were also computed. The values of linear polarizability and first hyperpolarizability obtained for the studied molecule indicated that the compound could be a good candidate of nonlinear optical materials. TD-DFT calculation and molecular electrostatic potential (MEP) were also performed. The thermodynamic properties (heat capacity, entropy, and enthalpy) of the complex at different temperatures have been calculated. The interaction of a synthesized complex, with bovine serum albumin was also thoroughly investigated using experimental and theoretical studies. UV-Vis absorption and fluorescence quenching techniques were used to determine the binding parameters as well as the mechanism of the interaction. The values of binding constants were in the range of 104-105 M-1 demonstrating a moderate interaction between the synthesized complex and BSA making the protein suitable for transportation and delivery of the compound. Thermodynamic parameters were also indicating a binding through van der Waals force or hydrogen bond of [MoO2(L)(MeOH)] to BSA. The results obtained from docking studies were consistent to those obtained from experimental studies.
Felgueiras, Helena P; Wang, L M; Ren, K F; Querido, M M; Jin, Q; Barbosa, M A; Ji, J; Martins, M C L
2017-03-08
Infection and thrombus formation are still the biggest challenges for the success of blood contact medical devices. This work aims the development of an antimicrobial and hemocompatible biomaterial coating through which selective binding of albumin (passivant protein) from the bloodstream is promoted and, thus, adsorption of other proteins responsible for bacterial adhesion and thrombus formation can be prevented. Polyurethane (PU) films were coated with hyaluronic acid, an antifouling agent, that was previously modified with thiol groups (HA-SH), using polydopamine as the binding agent. Octadecyl acrylate (C18) was used to attract albumin since it resembles the circulating free fatty acids and albumin is a fatty acid transporter. Thiol-ene "click chemistry" was explored for C18 immobilization on HA-SH through a covalent bond between the thiol groups from the HA and the alkene groups from the C18 chains. Surfaces were prepared with different C18 concentrations (0, 5, 10, and 20%) and successful immobilization was demonstrated by scanning electron microscopy (SEM), water contact angle determinations, X-ray photoelectron spectroscopy (XPS) and Fourier transform infrared spectroscopy (FTIR). The ability of surfaces to bind albumin selectively was determined by quartz crystal microbalance with dissipation (QCM-D). Albumin adsorption increased in response to the hydrophobic nature of the surfaces, which augmented with C18 saturation. HA-SH coating reduced albumin adsorption to PU. C18 immobilized onto HA-SH at 5% promoted selective binding of albumin, decreased Staphylococcus aureus adhesion and prevented platelet adhesion and activation to PU in the presence of human plasma. C18/HA-SH coating was established as an innovative and promising strategy to improve the antimicrobial properties and hemocompatibility of any blood contact medical device.
Tosh, Dilip K; Janowsky, Aaron; Eshleman, Amy J; Warnick, Eugene; Gao, Zhan-Guo; Chen, Zhoumou; Gizewski, Elizabeth; Auchampach, John A; Salvemini, Daniela; Jacobson, Kenneth A
2017-04-13
We have repurposed (N)-methanocarba adenosine derivatives (A 3 adenosine receptor (AR) agonists) to enhance radioligand binding allosterically at the human dopamine (DA) transporter (DAT) and inhibit DA uptake. We extended the structure-activity relationship of this series with small N 6 -alkyl substitution, 5'-esters, deaza modifications of adenine, and ribose restored in place of methanocarba. C2-(5-Halothien-2-yl)-ethynyl 5'-methyl 9 (MRS7292) and 5'-ethyl 10 (MRS7232) esters enhanced binding at DAT (EC 50 ∼ 35 nM) and at the norepinephrine transporter (NET). 9 and 10 were selective for DAT compared to A 3 AR in the mouse but not in humans. At DAT, the binding of two structurally dissimilar radioligands was enhanced; NET binding of only one radioligand was enhanced; SERT radioligand binding was minimally affected. 10 was more potent than cocaine at inhibiting DA uptake (IC 50 = 107 nM). Ribose analogues were weaker in DAT interaction than the corresponding bicyclics. Thus, we enhanced the neurotransmitter transporter activity of rigid nucleosides while reducing A 3 AR affinity.
Computational characterization of DNA/peptide/nanotube self assembly for bioenergy applications
NASA Astrophysics Data System (ADS)
Ortiz, Vanessa; Araki, Ruriko; Collier, Galen
2012-02-01
Multi-enzyme pathways have become a subject of increasing interest for their role in the engineering of biomimetic systems for applications including biosensors, bioelectronics, and bioenergy. The efficiencies found in natural metabolic pathways partially arise from biomolecular self-assembly of the component enzymes in an effort to avoid transport limitations. The ultimate goal of this effort is to design and build biofuel cells with efficiencies similar to those of native systems by introducing biomimetic structures that immobilize multiple enzymes in specific orientations on a bioelectrode. To achieve site-specific immobilization, the specificity of DNA-binding domains is exploited with an approach that allows any redox enzyme to be modified to site-specifically bind to double stranded (ds) DNA while retaining activity. Because of its many desirable properties, the bioelectrode of choice is single-wall carbon nanotubes (SWNTs), but little is known about dsDNA/SWNT assembly and how this might affect the activity of the DNA-binding domains. Here we evaluate the feasibility of the proposed assembly by performing atomistic molecular dynamics simulations to look at the stability and conformations adopted by dsDNA when bound to a SWNT. We also evaluate the effects of the presence of a SWNT on the stability of the complex formed by a DNA-binding domain and DNA.
Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1.
Bischoff, F R; Krebber, H; Smirnova, E; Dong, W; Ponstingl, H
1995-01-01
RCC1 (the regulator of chromosome condensation) stimulates guanine nucleotide dissociation on the Ras-related nuclear protein Ran. Both polypeptides are components of a regulatory pathway that has been implicated in regulating DNA replication, onset of and exit from mitosis, mRNA processing and transport, and import of proteins into the nucleus. In a search for further members of the RCC1-Ran signal pathway, we have identified proteins of 23, 45 and 300 kDa which tightly bind to Ran-GTP but not Ran-GDP. The purified soluble 23 kDa Ran binding protein RanBP1 does not activate RanGTPase, but increases GTP hydrolysis induced by the RanGTPase-activating protein RanGAP1 by an order of magnitude. In the absence of RanGAP, it strongly inhibits RCC1-induced exchange of Ran-bound GTP. In addition, it forms a stable complex with nucleotide-free RCC1-Ran. With these properties, it differs markedly from guanine diphosphate dissociation inhibitors which preferentially prevent the exchange of protein-bound GDP and in some cases were shown to inhibit GAP-induced GTP hydrolysis. RanBP1 is the first member of a new class of proteins regulating the binding and hydrolysis of GTP by Ras-related proteins. Images PMID:7882974
Owen, R L; Bhalla, D K
1983-10-01
M cells in Peyer's patch follicle epithelium endocytose and transport luminal materials to intraepithelial lymphocytes. We examined (1) enzymatic characteristics of the epithelium covering mouse and rat Peyer's patches by using cytochemical techniques, (2) distribution of lectin-binding sites by peroxidase-labeled lectins, and (3) anionic site distribution by using cationized ferritin to develop a profile of M cell surface properties. Alkaline phosphatase activity resulted in deposits of dense reaction product over follicle surfaces but was markedly reduced over M cells, unlike esterase which formed equivalent or greater product over M cells. Concanavalin A, ricinus communis agglutinin, wheat germ agglutinin and peanut agglutinin reacted equally with M cells and with surrounding enterocytes over follicle surfaces. Cationized ferritin distributed in a random fashion along microvillus membranes of both M cells and enterocytes, indicating equivalent anionic site distribution. Staining for alkaline phosphatase activity provides a new approach for distinguishing M cells from enterocytes at the light microscopic level. Identical binding of lectins indicates that M cells and enterocytes share common glycoconjugates even though molecular groupings may differ. Lectin binding and anionic charge similarities of M cells and enterocytes may facilitate antigen sampling by M cells of particles and compounds that adhere to intestinal surfaces in non-Peyer's patch areas.
Mihajlica, Nebojsa; Betsholtz, Christer; Hammarlund-Udenaes, Margareta
2018-06-19
Pericytes are perivascular cells that play important roles in the regulation of the blood-brain barrier (BBB) properties. Pericyte-deficiency causes compromised BBB integrity and increase in permeability to different macromolecules mainly by upregulated transcytosis. The aim of the present study was to investigate pericyte involvement in the extent of small-molecular drug transport across the BBB. This was performed with five compounds: diazepam, digoxin, levofloxacin, oxycodone and paliperidone. Compounds were administered at low doses via subcutaneous injections as a cassette (simultaneously) to pericyte-deficient Pdgfb ret/ret mice and corresponding WT controls. Total drug partitioning across the BBB was calculated as the ratio of total drug exposures in brain tissue and plasma (K p,brain ). In addition, equilibrium dialysis experiments were performed to estimate unbound drug fractions in brain (f u,brain ) and plasma (f u,plasma ). This enabled estimation of unbound drug partitioning coefficients (K p,uu,brain ). The results indicated slight tendencies towards increase of total brain exposures in Pdgfb ret/ret mice as reflected in K p,brain values, which were within the 2-fold limit. Part of these differences could be explained by differences in plasma protein binding. No difference was found in brain tissue binding. The combined in vivo and in vitro data resulted in no differences in BBB transport in pericyte-deficiency, as described by similar K p,uu,brain values in Pdgfb ret/ret and control mice. In conclusion, these findings imply no influence of pericytes on the extent of BBB transport of small-molecular drugs, and suggest preserved BBB features relevant for handling of this type of molecules irrespective of pericyte presence at the brain endothelium. Copyright © 2018. Published by Elsevier B.V.
On optima: the case of myoglobin-facilitated oxygen diffusion.
Wittenberg, Jonathan B
2007-08-15
The process of myoglobin/leghemoglobin-facilitated oxygen diffusion is adapted to function in different environments in diverse organisms. We enquire how the functional parameters of the process are optimized in particular organisms. The ligand-binding properties of the proteins, myoglobin and plant symbiotic hemoglobins, we discover, suggest that they have been adapted under genetic selection pressure for optimal performance. Since carrier-mediated oxygen transport has probably evolved independantly many times, adaptation of diverse proteins for a common functionality exemplifies the process of convergent evolution. The progenitor proteins may be built on the myoglobin scaffold or may be very different.
Study on spin filtering and switching action in a double-triangular network chain
NASA Astrophysics Data System (ADS)
Zhang, Yongmei
2018-04-01
Spin transport properties of a double-triangular quantum network with local magnetic moment on backbones and magnetic flux penetrating the network plane are studied. Numerical simulation results show that such a quantum network will be a good candidate for spin filter and spin switch. Local dispersion and density of states are considered in the framework of tight-binding approximation. Transmission coefficients are calculated by the method of transfer matrix. Spin transmission is regulated by substrate magnetic moment and magnetic flux piercing those triangles. Experimental realization of such theoretical research will be conducive to designing of new spintronic devices.
ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.
ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...
The Greenland shark Somniosus microcephalus-Hemoglobins and ligand-binding properties.
Russo, Roberta; Giordano, Daniela; Paredi, Gianluca; Marchesani, Francesco; Milazzo, Lisa; Altomonte, Giovanna; Del Canale, Pietro; Abbruzzetti, Stefania; Ascenzi, Paolo; di Prisco, Guido; Viappiani, Cristiano; Fago, Angela; Bruno, Stefano; Smulevich, Giulietta; Verde, Cinzia
2017-01-01
A large amount of data is currently available on the adaptive mechanisms of polar bony fish hemoglobins, but structural information on those of cartilaginous species is scarce. This study presents the first characterisation of the hemoglobin system of one of the longest-living vertebrate species (392 ± 120 years), the Arctic shark Somniosus microcephalus. Three major hemoglobins are found in its red blood cells and are made of two copies of the same α globin combined with two copies of three very similar β subunits. The three hemoglobins show very similar oxygenation and carbonylation properties, which are unaffected by urea, a very important compound in marine elasmobranch physiology. They display identical electronic absorption and resonance Raman spectra, indicating that their heme-pocket structures are identical or highly similar. The quaternary transition equilibrium between the relaxed (R) and the tense (T) states is more dependent on physiological allosteric effectors than in human hemoglobin, as also demonstrated in polar teleost hemoglobins. Similar to other cartilaginous fishes, we found no evidence for functional differentiation among the three isoforms. The very similar ligand-binding properties suggest that regulatory control of O2 transport may be at the cellular level and that it may involve changes in the cellular concentrations of allosteric effectors and/or variations of other systemic factors. The hemoglobins of this polar shark have evolved adaptive decreases in O2 affinity in comparison to temperate sharks.
The Greenland shark Somniosus microcephalus—Hemoglobins and ligand-binding properties
Paredi, Gianluca; Marchesani, Francesco; Milazzo, Lisa; Altomonte, Giovanna; Del Canale, Pietro; Abbruzzetti, Stefania; Ascenzi, Paolo; di Prisco, Guido; Viappiani, Cristiano; Fago, Angela; Bruno, Stefano; Smulevich, Giulietta
2017-01-01
A large amount of data is currently available on the adaptive mechanisms of polar bony fish hemoglobins, but structural information on those of cartilaginous species is scarce. This study presents the first characterisation of the hemoglobin system of one of the longest-living vertebrate species (392 ± 120 years), the Arctic shark Somniosus microcephalus. Three major hemoglobins are found in its red blood cells and are made of two copies of the same α globin combined with two copies of three very similar β subunits. The three hemoglobins show very similar oxygenation and carbonylation properties, which are unaffected by urea, a very important compound in marine elasmobranch physiology. They display identical electronic absorption and resonance Raman spectra, indicating that their heme-pocket structures are identical or highly similar. The quaternary transition equilibrium between the relaxed (R) and the tense (T) states is more dependent on physiological allosteric effectors than in human hemoglobin, as also demonstrated in polar teleost hemoglobins. Similar to other cartilaginous fishes, we found no evidence for functional differentiation among the three isoforms. The very similar ligand-binding properties suggest that regulatory control of O2 transport may be at the cellular level and that it may involve changes in the cellular concentrations of allosteric effectors and/or variations of other systemic factors. The hemoglobins of this polar shark have evolved adaptive decreases in O2 affinity in comparison to temperate sharks. PMID:29023598
Mulligan, Christopher; Mindell, Joseph A.
2013-01-01
Secondary transporters in the excitatory amino acid transporter family terminate glutamatergic synaptic transmission by catalyzing Na+-dependent removal of glutamate from the synaptic cleft. Recent structural studies of the aspartate-specific archaeal homolog, GltPh, suggest that transport is achieved by a rigid body, piston-like movement of the transport domain, which houses the substrate-binding site, between the extracellular and cytoplasmic sides of the membrane. This transport domain is connected to an immobile scaffold by three loops, one of which, the 3–4 loop (3L4), undergoes substrate-sensitive conformational change. Proteolytic cleavage of the 3L4 was found to abolish transport activity indicating an essential function for this loop in the transport mechanism. Here, we demonstrate that despite the presence of fully cleaved 3L4, GltPh is still able to sample conformations relevant for transport. Optimized reconstitution conditions reveal that fully cleaved GltPh retains some transport activity. Analysis of the kinetics and temperature dependence of transport accompanied by direct measurements of substrate binding reveal that this decreased transport activity is not due to alteration of the substrate binding characteristics but is caused by the significantly reduced turnover rate. By measuring solute counterflow activity and cross-link formation rates, we demonstrate that cleaving 3L4 severely and specifically compromises one or more steps contributing to the movement of the substrate-loaded transport domain between the outward- and inward-facing conformational states, sparing the equivalent step(s) during the movement of the empty transport domain. These results reveal a hitherto unknown role for the 3L4 in modulating an essential step in the transport process. PMID:24155238
Schmitt, Kyle C; Mamidyala, Sreeman; Biswas, Swati; Dutta, Aloke K; Reith, Maarten E A
2010-03-01
Bivalent ligands--compounds incorporating two receptor-interacting moieties linked by a flexible chain--often exhibit profoundly enhanced binding affinity compared with their monovalent components, implying concurrent binding to multiple sites on the target protein. It is generally assumed that neurotransmitter sodium symporter (NSS) proteins, such as the dopamine transporter (DAT), contain a single domain responsible for recognition of substrate molecules. In this report, we show that molecules possessing two substrate-like phenylalkylamine moieties linked by a progressively longer aliphatic spacer act as progressively more potent DAT inhibitors (rather than substrates). One compound bearing two dopamine (DA)-like pharmacophoric 'heads' separated by an 8-carbon linker achieved an 82-fold gain in inhibition of [(3)H] 2beta-carbomethoxy-3beta-(4-fluorophenyl)-tropane (CFT) binding compared with DA itself; bivalent compounds with a 6-carbon linker and heterologous combinations of DA-, amphetamine- and beta-phenethylamine-like heads all resulted in considerable and comparable gains in DAT affinity. A series of short-chain bivalent-like compounds with a single N-linkage was also identified, the most potent of which displayed a 74-fold gain in binding affinity. Computational modelling of the DAT protein and docking of the two most potent bivalent (-like) ligands suggested simultaneous occupancy of two discrete substrate-binding domains. Assays with the DAT mutants W84L and D313N--previously employed by our laboratory to probe conformation-specific binding of different structural classes of DAT inhibitors--indicated a bias of the bivalent ligands for inward-facing transporters. Our results strongly indicate the existence of multiple DAT substrate-interaction sites, implying that it is possible to design novel types of DAT inhibitors based upon the 'multivalent ligand' strategy.
Busby, Jason N.; Fritz, Georg; Moreland, Nicole J.; Cook, Gregory M.; Lott, J. Shaun; Baker, Edward N.
2014-01-01
Bacterial uptake of phosphate is usually accomplished via high-affinity transporters that are commonly regulated by two-component systems, which are activated when the concentration of phosphate is low. Mycobacterium smegmatis possesses two such transporters, the widely distributed PstSCAB system and PhnDCE, a transporter that in other bacteria mediates the uptake of alternative phosphorus sources. We previously reported that the transcriptional regulator PhnF controls the production of the Phn system, acting as a repressor under high-phosphate conditions. Here we show that the phnDCE genes are common among environmental mycobacteria, where they are often associated with phnF-like genes. In contrast, pathogenic mycobacteria were not found to encode Phn-like systems but instead were found to possess multiple copies of the pst genes. A detailed biochemical analysis of PhnF binding to its identified binding sites in the phnD-phnF intergenic region of M. smegmatis has allowed us to propose a quantitative model for repressor binding, which shows that a PhnF dimer binds independently to each site. We present the crystal structure of M. smegmatis PhnF at 1.8-Å resolution, showing a homodimer with a helix-turn-helix N-terminal domain and a C-terminal domain with a UbiC transcription regulator-associated fold. The C-terminal domain crystallized with a bound sulfate ion instead of the so far unidentified physiological ligand, allowing the identification of residues involved in effector binding. Comparison of the positioning of the DNA binding domains in PhnF with that in homologous proteins suggests that its DNA binding activity is regulated via a conformational change in the linker region, triggering a movement of the N-terminal domains. PMID:25049090
Wright, David J.; Tate, Christopher G.
2015-01-01
The tetracycline antiporter TetA(B) is a member of the Major Facilitator Superfamily which confers tetracycline resistance to cells by coupling the efflux of tetracycline to the influx of protons down their chemical potential gradient. Although it is a medically important transporter, its structure has yet to be determined. One possibility for why this has proven difficult is that the transporter may be conformationally heterogeneous in the purified state. To overcome this, we developed two strategies to rapidly identify TetA(B) mutants that were transport-defective and that could still bind tetracycline. Up to 9 amino acid residues could be deleted from the loop between transmembrane α-helices 6 and 7 with only a slight decrease in affinity of tetracycline binding as measured by isothermal titration calorimetry, although the mutant was transport-defective. Scanning mutagenesis where all the residues between 2 and 389 were mutated to either valine, alanine or glycine (VAG scan) identified 15 mutants that were significantly impaired in tetracycline transport. Of these mutants, 12 showed no evidence of tetracycline binding by isothermal titration calorimetry performed on the purified transporters. In contrast, the mutants G44V and G346V bound tetracycline 4–5 fold more weakly than TetA(B), with Kds of 28 μM and 36 μM, respectively, whereas the mutant R70G bound tetracycline 3-fold more strongly (Kd 2.1 μM). Systematic mutagenesis is thus an effective strategy for isolating transporter mutants that may be conformationally constrained and which represent attractive targets for crystallisation and structure determination. PMID:26143388
Bartoccioni, Paola; del Rio, César; Ratera, Merce; Kowalczyk, Lukasz; Baldwin, Jocelyn M.; Zorzano, Antonio; Quick, Matthias; Baldwin, Stephen A.; Vázquez-Ibar, José Luis; Palacín, Manuel
2010-01-01
System l-amino acid transporters (LAT) belong to the amino acid, polyamine, and organic cation superfamily of transporters and include the light subunits of heteromeric amino acid transporters and prokaryotic homologues. Cysteine reactivity of SteT (serine/threonine antiporter) has been used here to study the substrate-binding site of LAT transporters. Residue Cys-291, in transmembrane domain 8 (TM8), is inactivated by thiol reagents in a substrate protectable manner. Surprisingly, DTT activated the transporter by reducing residue Cys-291. Cysteine-scanning mutagenesis of TM8 showed DTT activation in the single-cysteine mutants S287C, G294C, and S298C, lining the same α-helical face. S-Thiolation in Escherichia coli cells resulted in complete inactivation of the single-cysteine mutant G294C. l-Serine blocked DTT activation with an EC50 similar to the apparent KM of this mutant. Thus, S-thiolation abolished substrate translocation but not substrate binding. Mutation of Lys-295, to Cys (K295C) broadened the profile of inhibitors and the spectrum of substrates with the exception of imino acids. A structural model of SteT based on the structural homologue AdiC (arginine/agmatine antiporter) positions residues Cys-291 and Lys-295 in the putative substrate binding pocket. All this suggests that Lys-295 is a main determinant in the recognition of the side chain of SteT substrates. In contrast, Gly-294 is not facing the surface, suggesting conformational changes involving TM8 during the transport cycle. Our results suggest that TM8 sculpts the substrate-binding site and undergoes conformational changes during the transport cycle of SteT. PMID:20610400
Shen, Jiang-Sheng; Geoffroy, Valérie; Neshat, Shadi; Jia, Zongchao; Meldrum, Allison; Meyer, Jean-Marie; Poole, Keith
2005-12-01
A number of aromatic residues were seen to cluster in the upper portion of the three-dimensional structure of the FpvA ferric pyoverdine receptor of Pseudomonas aeruginosa, reminiscent of the aromatic binding pocket for ferrichrome in the FhuA receptor of Escherichia coli. Alanine substitutions in three of these, W362, W391, and F795, markedly compromised ferric pyoverdine binding and transport, consistent with a role of FpvA in ferric pyoverdine recognition.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Visualizing the kinetic power stroke that drives proton-coupled Zn(II) transport
Gupta, Sayan; Chai, Jin; Cheng, Jie; D'Mello, Rhijuta; Chance, Mark R.; Fu, Dax
2014-01-01
The proton gradient is a principal energy source for respiration-dependent active transport, but the structural mechanisms of proton-coupled transport processes are poorly understood. YiiP is a proton-coupled zinc transporter found in the cytoplasmic membrane of E. coli, and the transport-site of YiiP receives protons from water molecules that gain access to its hydrophobic environment and transduces the energy of an inward proton gradient to drive Zn(II) efflux1,2. This membrane protein is a well characterized member3-7 of the protein family of cation diffusion facilitators (CDFs) that occurs at all phylogenetic levels8-10. X-ray mediated hydroxyl radical labeling of YiiP and mass spectrometric analysis showed that Zn(II) binding triggered a highly localized, all-or-none change of water accessibility to the transport-site and an adjacent hydrophobic gate. Millisecond time-resolved dynamics revealed a concerted and reciprocal pattern of accessibility changes along a transmembrane helix, suggesting a rigid-body helical reorientation linked to Zn(II) binding that triggers the closing of the hydrophobic gate. The gated water access to the transport-site enables a stationary proton gradient to facilitate the conversion of zinc binding energy to the kinetic power stroke of a vectorial zinc transport. The kinetic details provide energetic insights into a proton-coupled active transport reaction. PMID:25043033
Sheena, Aswathy; Mohan, Suma S; Haridas, Nidhina Pachakkil A; Anilkumar, Gopalakrishnapillai
2011-01-01
GLUT4 is a predominant insulin regulated glucose transporter expressed in major glucose disposal tissues such as adipocytes and muscles. Under the unstimulated state, GLUT4 resides within intracellular vesicles. Various stimuli such as insulin translocate this protein to the plasma membrane for glucose transport. In the absence of a crystal structure for GLUT4, very little is known about the mechanism of glucose transport by this protein. Earlier we proposed a homology model for GLUT4 and performed a conventional molecular dynamics study revealing the conformational rearrangements during glucose and ATP binding. However, this study could not explain the transport of glucose through the permeation tunnel. To elucidate the molecular mechanism of glucose transport and its energetic, a steered molecular dynamics study (SMD) was used. Glucose was pulled from the extracellular end of GLUT4 to the cytoplasm along the pathway using constant velocity pulling method. We identified several key residues within the tunnel that interact directly with either the backbone ring or the hydroxyl groups of glucose. A rotation of glucose molecule was seen near the sugar binding site facilitating the sugar recognition process at the QLS binding site. This study proposes a possible glucose transport pathway and aids the identification of several residues that make direct interactions with glucose during glucose transport. Mutational studies are required to further validate the observation made in this study.
Witz, Sandra; Panwar, Pankaj; Schober, Markus; Deppe, Johannes; Pasha, Farhan Ahmad; Lemieux, M. Joanne; Möhlmann, Torsten
2014-01-01
Plastidic uracil salvage is essential for plant growth and development. So far, PLUTO, the plastidic nucleobase transporter from Arabidopsis thaliana is the only known uracil importer at the inner plastidic membrane which represents the permeability barrier of this organelle. We present the first homology model of PLUTO, the sole plant NCS1 member from Arabidopsis based on the crystal structure of the benzyl hydantoin transporter MHP1 from Microbacterium liquefaciens and validated by molecular dynamics simulations. Polar side chains of residues Glu-227 and backbones of Val-145, Gly-147 and Thr-425 are proposed to form the binding site for the three PLUTO substrates uracil, adenine and guanine. Mutational analysis and competition studies identified Glu-227 as an important residue for uracil and to a lesser extent for guanine transport. A differential response in substrate transport was apparent with PLUTO double mutants E227Q G147Q and E227Q T425A, both of which most strongly affected adenine transport, and in V145A G147Q, which markedly affected guanine transport. These differences could be explained by docking studies, showing that uracil and guanine exhibit a similar binding mode whereas adenine binds deep into the catalytic pocket of PLUTO. Furthermore, competition studies confirmed these results. The present study defines the molecular determinants for PLUTO substrate binding and demonstrates key differences in structure-function relations between PLUTO and other NCS1 family members. PMID:24621654
Witz, Sandra; Panwar, Pankaj; Schober, Markus; Deppe, Johannes; Pasha, Farhan Ahmad; Lemieux, M Joanne; Möhlmann, Torsten
2014-01-01
Plastidic uracil salvage is essential for plant growth and development. So far, PLUTO, the plastidic nucleobase transporter from Arabidopsis thaliana is the only known uracil importer at the inner plastidic membrane which represents the permeability barrier of this organelle. We present the first homology model of PLUTO, the sole plant NCS1 member from Arabidopsis based on the crystal structure of the benzyl hydantoin transporter MHP1 from Microbacterium liquefaciens and validated by molecular dynamics simulations. Polar side chains of residues Glu-227 and backbones of Val-145, Gly-147 and Thr-425 are proposed to form the binding site for the three PLUTO substrates uracil, adenine and guanine. Mutational analysis and competition studies identified Glu-227 as an important residue for uracil and to a lesser extent for guanine transport. A differential response in substrate transport was apparent with PLUTO double mutants E227Q G147Q and E227Q T425A, both of which most strongly affected adenine transport, and in V145A G147Q, which markedly affected guanine transport. These differences could be explained by docking studies, showing that uracil and guanine exhibit a similar binding mode whereas adenine binds deep into the catalytic pocket of PLUTO. Furthermore, competition studies confirmed these results. The present study defines the molecular determinants for PLUTO substrate binding and demonstrates key differences in structure-function relations between PLUTO and other NCS1 family members.
The role of mammalian Staufen on mRNA traffic: a view from its nucleocytoplasmic shuttling function.
Miki, Takashi; Takano, Keizo; Yoneda, Yoshihiro
2005-01-01
The localization of mRNA in neuronal dendrites plays a role in both locally and temporally regulated protein synthesis, which is required for certain forms of synaptic plasticity. RNA granules constitute a dendritic mRNA transport machinery in neurons, which move along microtubules. RNA granules contain densely packed clusters of ribosomes, but lack some factors that are required for translation, suggesting that they are translationally incompetent. Recently some of the components of RNA granules have been identified, and their functions are in the process of being examined, in attempts to better understand the properties of RNA granules. Mammalian Staufen, a double-stranded RNA binding protein, is a component of RNA granules. Staufen is localized in the somatodendritic domain of neurons, and plays an important role in dendritic mRNA targeting. Recently, one of the mammalian homologs of Staufen, Staufen2 (Stau2), was shown to shuttle between the nucleus and the cytoplasm. This finding suggests the possibility that Stau2 binds RNA in the nucleus and that this ribonucleoprotein particle is transported from the nucleus to RNA granules in the cytoplasm. A closer study of this process might provide a clue to the mechanism by which RNA granules are formed.
Ganguly, Aniruddha; Paul, Bijan Kumar; Ghosh, Soumen; Dalapati, Sasanka; Guchhait, Nikhil
2014-05-14
The present work demonstrates a detailed characterization of the interaction of a potential chloride channel blocker, 9-methyl anthroate (9-MA), with a model transport protein, Bovine Serum Albumin (BSA). The modulated photophysical properties of the emissive drug molecule within the microheterogeneous bio-environment of the protein have been exploited spectroscopically to monitor the probe-protein binding interaction. Apart from evaluating the binding constant, the probable location of the neutral molecule within the protein cavity (subdomain IB) is explored by an AutoDock-based blind docking simulation. The absence of the Red-Edge Effect has been corroborated by the enhanced lifetime of the probe, being substantially greater than the solvent reorientation time. A dip-and-rise characteristic of the rotational relaxation profile of the drug within the protein has been argued to originate from a significant difference in the lifetime as well as amplitude of the free and protein-bound drug molecule. Unfolding of the protein in the presence of the drug molecule has been probed by the decrease of the α-helical content, obtained via circular dichroism (CD) spectroscopy, which is also supported by the gradual loss of the esterase activity of the protein in the presence of the drug molecule.
Wang, Shengjun; Mao, Yang; Narimatsu, Yoshiki; Ye, Zilu; Tian, Weihua; Goth, Christoffer K; Lira-Navarrete, Erandi; Pedersen, Nis B; Benito-Vicente, Asier; Martin, Cesar; Uribe, Kepa B; Hurtado-Guerrero, Ramon; Christoffersen, Christina; Seidah, Nabil G; Nielsen, Rikke; Christensen, Erik I; Hansen, Lars; Bennett, Eric P; Vakhrushev, Sergey Y; Schjoldager, Katrine T; Clausen, Henrik
2018-05-11
The low-density lipoprotein receptor (LDLR) and related receptors are important for the transport of diverse biomolecules across cell membranes and barriers. Their functions are especially relevant for cholesterol homeostasis and diseases, including neurodegenerative and kidney disorders. Members of the LDLR-related protein family share LDLR class A (LA) repeats providing binding properties for lipoproteins and other biomolecules. We previously demonstrated that short linker regions between these LA repeats contain conserved O -glycan sites. Moreover, we found that O -glycan modifications at these sites are selectively controlled by the GalNAc-transferase isoform, GalNAc-T11. However, the effects of GalNAc-T11-mediated O -glycosylation on LDLR and related receptor localization and function are unknown. Here, we characterized O -glycosylation of LDLR-related proteins and identified conserved O -glycosylation sites in the LA linker regions of VLDLR, LRP1, and LRP2 (Megalin) from both cell lines and rat organs. Using a panel of gene-edited isogenic cell line models, we demonstrate that GalNAc-T11-mediated LDLR and VLDLR O -glycosylation is not required for transport and cell-surface expression and stability of these receptors but markedly enhances LDL and VLDL binding and uptake. Direct ELISA-based binding assays with truncated LDLR constructs revealed that O -glycosylation increased affinity for LDL by ∼5-fold. The molecular basis for this observation is currently unknown, but these findings open up new avenues for exploring the roles of LDLR-related proteins in disease. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Bestembayeva, Aizhan; Kramer, Armin; Labokha, Aksana A; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V; Ford, Ian J; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W
2015-01-01
The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ∼5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC. Although the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins, and is therefore not well understood. Here, we show that stiffness topography with sharp atomic force microscopy tips can generate nanoscale cross-sections of the NPC. The cross-sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel.
Labokha, Aksana A.; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V.; Ford, Ian J.; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W.
2014-01-01
The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ~5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC1. Whilst the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized2-5, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins5,6, and is therefore not well understood. Here, we show that stiffness topography7 with sharp atomic force microscopy tips can generate nanoscale cross sections of the NPC. The cross sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy2-5. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport, and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel. PMID:25420031
NASA Astrophysics Data System (ADS)
Bestembayeva, Aizhan; Kramer, Armin; Labokha, Aksana A.; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V.; Ford, Ian J.; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W.
2015-01-01
The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ∼5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC. Although the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins, and is therefore not well understood. Here, we show that stiffness topography with sharp atomic force microscopy tips can generate nanoscale cross-sections of the NPC. The cross-sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel.
Milne, E; Martinez Pereira, Y; Muir, C; Scase, T; Shaw, D J; McGregor, G; Oldroyd, L; Scurrell, E; Martin, M; Devine, C; Hodgkiss-Geere, H
2018-05-01
To develop a provisional immunohistochemistry panel for distinguishing reactive pericardium, atypical mesothelial proliferation and mesothelioma in dogs. Archived pericardial biopsies were subject to haematoxylin and eosin staining, immunohistochemistry for cytokeratin, vimentin, insulin-like growth factor II mRNA-binding protein 3, glucose transporter 1 and desmin. Samples were scored for intensity and number of cells stained. Ten biopsies of reactive mesothelium, 17 of atypical mesothelial proliferation, 26 of mesothelioma and five of normal pericardium were identified on the basis of haematoxylin and eosin staining. Cytokeratin and vimentin were expressed in all biopsies, confirming mesothelial origin. Normal pericardial samples had the lowest scores for insulin-like growth factor II mRNA-binding protein 3, glucose transporter 1 and desmin. Mesothelioma and atypical proliferative samples were similar to each other, with higher scores for insulin-like growth factor II mRNA-binding protein 3 and glucose transporter 1 than the reactive samples. Desmin staining was variable. Insulin-like growth factor II mRNA-binding protein 3 was the best to distinguish between disease groups. An immunohistochemistry panel of cytokeratin, vimentin, insulin-like growth factor II mRNA-binding protein 3 and glucose transporter 1 could provide superior information compared with haematoxylin and eosin staining alone in the diagnosis of cases of mesothelial proliferation in canine pericardium, but further validation is warranted. © 2018 British Small Animal Veterinary Association.
dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.
Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L
2008-12-26
Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.
USDA-ARS?s Scientific Manuscript database
Odorant-binding proteins (OBPs) are important components in insect olfactory systems that transport semiochemicals through the aqueous sensillum lymph to surface of olfactory receptor neurons. In this study, we cloned the cDNA of odorant-binding protein 2 (BhorOBP2) in Batocera horsfieldi (Hope) and...
A new metal binding domain involved in cadmium, cobalt and zinc transport
Smith, Aaron T.; Barupala, Dulmini; Stemmler, Timothy L.; ...
2015-07-20
The P 1B-ATPases, which couple cation transport across membranes to ATP hydrolysis, are central to metal homeostasis in all organisms. An important feature of P 1B-ATPases is the presence of soluble metal binding domains (MBDs) that regulate transport activity. Only one type of MBD has been characterized extensively, but bioinformatics analyses indicate that a diversity of MBDs may exist in nature. In this paper, we report the biochemical, structural and functional characterization of a new MBD from the Cupriavidus metallidurans P 1B-4-ATPase CzcP (CzcP MBD). The CzcP MBD binds two Cd 2+, Co 2+ or Zn 2+ ions in distinctmore » and unique sites and adopts an unexpected fold consisting of two fused ferredoxin-like domains. Both in vitro and in vivo activity assays using full-length CzcP, truncated CzcP and several variants indicate a regulatory role for the MBD and distinct functions for the two metal binding sites. Finally, taken together, these findings elucidate a previously unknown MBD and suggest new regulatory mechanisms for metal transport by P 1B-ATPases.« less
Schlemmer, S R; Sirotnak, F M
1994-12-09
Active [3H]vinblastine (VBL) transport (efflux) was documented for inside-out plasma membrane vesicles from murine erythroleukemia cells (MEL/VCR-6) resistant to vinca alkaloids and overexpressing MDR 3 P-glycoprotein (P-gp) 80-fold. Uptake of [3H]VBL at 37 degrees C by these inside-out vesicles, but not rightside-out vesicles or inside-out vesicles from wild-type cells, was obtained in the form of a rapid, initial phase (0-1 min) and a slower, later phase (> 1 min). The rapidity of each phase correlated with relative P-gp content among different MEL/VCR cell lines. The initial MDR-specific phase was temperature- and pH-dependent (optimum at pH 7), osmotically insensitive, and did not require ATP. The second MDR-specific phase was temperature-dependent, osmotically sensitive, and strictly dependent upon the presence of ATP (Km = 0.37 +/- 0.04 mM). Although other triphosphate nucleotides were partially effective in replacing ATP, the nonhydrolyzable analogue ATP gamma S (adenosine 5'-O-(thiotriphosphate)) was ineffective. This time course appears to represent tandem binding of [3H]VBL by P-gp and its mediated transport, with the latter process representing the rate-limiting step. In support of this conclusion, both binding and transport were inhibited by verapamil, quinidine, and reserpine, all known to be inhibitors of photoaffinity labeling of P-gp, but only transport was inhibited by C219 anti-P-gp antibody or orthovanadate. Although the rate of transport of [3H]VBL was 7-7.5-fold lower than the rate of binding (Vmax = 104 +/- 15 pmol/min/mg protein, Kon = 1.5 - 2 x 10(5) mol-1 s-1) to P-gp, each phase exhibited saturation kinetics and values for apparent Km and KD for each process were approximately the same (215 +/- 35 and 195 +/- 30 nM). Intravesicular accumulation of [3H]VBL was almost completely eliminated by high concentrations of nonradioactive VBL, suggesting that simple diffusion does not contribute appreciably to total accumulation of [3H]VBL in this vesicle system. This could be at least partially explained by the fact that these inside-out vesicles under the conditions employed did not maintain a P-gp mediated pH gradient. However, ATP-dependent, intravesicular accumulation of osmotically sensitive [3H]VBL occurred against a substantial permeant concentration gradient in both a time- and concentration-dependent manner consistent with an active, saturable process.
Stapleton, Nigel M; Armstrong-Fisher, Sylvia S; Andersen, Jan Terje; van der Schoot, C Ellen; Porter, Charlene; Page, Kenneth R; Falconer, Donald; de Haas, Masja; Williamson, Lorna M; Clark, Michael R; Vidarsson, Gestur; Armour, Kathryn L
2018-03-01
We have previously generated human IgG1 antibodies that were engineered for reduced binding to the classical Fcγ receptors (FcγRI-III) and C1q, thereby eliminating their destructive effector functions (constant region G1Δnab). In their potential use as blocking agents, favorable binding to the neonatal Fc receptor (FcRn) is important to preserve the long half-life typical of IgG. An ability to cross the placenta, which is also mediated, at least in part, by FcRn is desirable in some indications, such as feto-maternal alloimmune disorders. Here, we show that G1Δnab mutants retain pH-dependent binding to human FcRn but that the amino acid alterations reduce the affinity of the IgG1:FcRn interaction by 2.0-fold and 1.6-fold for the two antibodies investigated. The transport of the modified G1Δnab mutants across monolayers of human cell lines expressing FcRn was approximately 75% of the wild-type, except that no difference was observed with human umbilical vein endothelial cells. G1Δnab mutation also reduced transport in an ex vivo placenta model. In conclusion, we demonstrate that, although the G1Δnab mutations are away from the FcRn-binding site, they have long-distance effects, modulating FcRn binding and transcellular transport. Our findings have implications for the design of therapeutic human IgG with tailored effector functions. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Modeling of flux, binding and substitution of urea molecules in the urea transporter dvUT.
Zhang, Hai-Tian; Wang, Zhe; Yu, Tao; Sang, Jian-Ping; Zou, Xian-Wu; Zou, Xiaoqin
2017-09-01
Urea transporters (UTs) are transmembrane proteins that transport urea molecules across cell membranes and play a crucial role in urea excretion and water balance. Modeling the functional characteristics of UTs helps us understand how their structures accomplish the functions at the atomic level, and facilitates future therapeutic design targeting the UTs. This study was based on the crystal structure of Desulfovibrio vulgaris urea transporter (dvUT). To model the binding behavior of urea molecules in dvUT, we constructed a cooperative binding model. To model the substitution of urea by the urea analogue N,N'-dimethylurea (DMU) in dvUT, we calculated the occupation probability of DMU along the urea pore and the ratio of the occupation probabilities of DMU at the external (S ext ) and internal (S int ) binding sites, and we established the mutual substitution rule for binding and substitution of urea and DMU. Based on these calculations and modelings, together with the use of the Monte Carlo (MC) method, we further modeled the urea flux in dvUT, equilibrium urea binding to dvUT, and the substitution of urea by DMU in the dvUT. Our modeling results are in good agreement with the existing experimental functional data. Furthermore, the modelings have discovered the microscopic process and mechanisms of those functional characteristics. The methods and the results would help our future understanding of the underlying mechanisms of the diseases associated with impaired UT functions and rational drug design for the treatment of these diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Jing-Fang; Chou, Kuo-Chen
2012-01-01
Human mitochondrial ornithine transporter-1 is reported in coupling with the hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome, which is a rare autosomal recessive disorder. For in-depth understanding of the molecular mechanism of the disease, it is crucially important to acquire the 3D structure of human mitochondrial ornithine transporter-1. Since no such structure is available in the current protein structure database, we have developed it via computational approaches based on the recent NMR structure of human mitochondrial uncoupling protein (Berardi MJ, Chou JJ, et al. Nature 2011, 476:109–113). Subsequently, we docked the ligand L-ornithine into the computational structure to search for the favorable binding mode. It was observed that the binding interaction for the most favorable binding mode is featured by six remarkable hydrogen bonds between the receptor and ligand, and that the most favorable binding mode shared the same ligand-binding site with most of the homologous mitochondrial carriers from different organisms, implying that the ligand-binding sites are quite conservative in the mitochondrial carriers family although their sequences similarity is very low with 20% or so. Moreover, according to our structural analysis, the relationship between the disease-causing mutations of human mitochondrial ornithine transporter-1 and the HHH syndrome can be classified into the following three categories: (i) the mutation occurs in the pseudo-repeat regions so as to change the region of the protein closer to the mitochondrial matrix; (ii) the mutation is directly affecting the substrate binding pocket so as to reduce the substrate binding affinity; (iii) the mutation is located in the structural region closer to the intermembrane space that can significantly break the salt bridge networks of the protein. These findings may provide useful insights for in-depth understanding of the molecular mechanism of the HHH syndrome and developing effective drugs against the disease. PMID:22292090
Plasticity of an ultrafast interaction between nucleoporins and nuclear transport receptors.
Milles, Sigrid; Mercadante, Davide; Aramburu, Iker Valle; Jensen, Malene Ringkjøbing; Banterle, Niccolò; Koehler, Christine; Tyagi, Swati; Clarke, Jane; Shammas, Sarah L; Blackledge, Martin; Gräter, Frauke; Lemke, Edward A
2015-10-22
The mechanisms by which intrinsically disordered proteins engage in rapid and highly selective binding is a subject of considerable interest and represents a central paradigm to nuclear pore complex (NPC) function, where nuclear transport receptors (NTRs) move through the NPC by binding disordered phenylalanine-glycine-rich nucleoporins (FG-Nups). Combining single-molecule fluorescence, molecular simulations, and nuclear magnetic resonance, we show that a rapidly fluctuating FG-Nup populates an ensemble of conformations that are prone to bind NTRs with near diffusion-limited on rates, as shown by stopped-flow kinetic measurements. This is achieved using multiple, minimalistic, low-affinity binding motifs that are in rapid exchange when engaging with the NTR, allowing the FG-Nup to maintain an unexpectedly high plasticity in its bound state. We propose that these exceptional physical characteristics enable a rapid and specific transport mechanism in the physiological context, a notion supported by single molecule in-cell assays on intact NPCs. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Plasticity of an Ultrafast Interaction between Nucleoporins and Nuclear Transport Receptors
Milles, Sigrid; Mercadante, Davide; Aramburu, Iker Valle; Jensen, Malene Ringkjøbing; Banterle, Niccolò; Koehler, Christine; Tyagi, Swati; Clarke, Jane; Shammas, Sarah L.; Blackledge, Martin; Gräter, Frauke; Lemke, Edward A.
2015-01-01
Summary The mechanisms by which intrinsically disordered proteins engage in rapid and highly selective binding is a subject of considerable interest and represents a central paradigm to nuclear pore complex (NPC) function, where nuclear transport receptors (NTRs) move through the NPC by binding disordered phenylalanine-glycine-rich nucleoporins (FG-Nups). Combining single-molecule fluorescence, molecular simulations, and nuclear magnetic resonance, we show that a rapidly fluctuating FG-Nup populates an ensemble of conformations that are prone to bind NTRs with near diffusion-limited on rates, as shown by stopped-flow kinetic measurements. This is achieved using multiple, minimalistic, low-affinity binding motifs that are in rapid exchange when engaging with the NTR, allowing the FG-Nup to maintain an unexpectedly high plasticity in its bound state. We propose that these exceptional physical characteristics enable a rapid and specific transport mechanism in the physiological context, a notion supported by single molecule in-cell assays on intact NPCs. PMID:26456112
Li, Weihui; He, Zheng-Guo
2012-01-01
In a bis-(3′-5′)-cyclic dimeric guanosine monophosphate (c-di-GMP)/transcription factor binding screen, we identified Mycobacterium smegmatis Ms6479 as the first c-di-GMP-responsive transcriptional factor in mycobacteria. Ms6479 could specifically bind with c-di-GMP and recognize the promoters of 37 lipid transport and metabolism genes. c-di-GMP could enhance the ability of Ms6479 to bind to its target DNA. Furthermore, our results establish Ms6479 as a global activator that positively regulates the expression of diverse target genes. Overexpression of Ms6479 in M. smegmatis significantly reduced the permeability of the cell wall to crystal violet and increased mycobacterial resistance to anti-tuberculosis antibiotics. Interestingly, Ms6479 lacks the previously reported c-di-GMP binding motifs. Our findings introduce Ms6479 (here designated LtmA for lipid transport and metabolism activator) as a new c-di-GMP-responsive regulator. PMID:23047950
Zahn, Raphael; Osmanović, Dino; Ehret, Severin; Araya Callis, Carolina; Frey, Steffen; Stewart, Murray; You, Changjiang; Görlich, Dirk; Hoogenboom, Bart W; Richter, Ralf P
2016-01-01
The permeability barrier of nuclear pore complexes (NPCs) controls bulk nucleocytoplasmic exchange. It consists of nucleoporin domains rich in phenylalanine-glycine motifs (FG domains). As a bottom-up nanoscale model for the permeability barrier, we have used planar films produced with three different end-grafted FG domains, and quantitatively analyzed the binding of two different nuclear transport receptors (NTRs), NTF2 and Importin β, together with the concomitant film thickness changes. NTR binding caused only moderate changes in film thickness; the binding isotherms showed negative cooperativity and could all be mapped onto a single master curve. This universal NTR binding behavior – a key element for the transport selectivity of the NPC – was quantitatively reproduced by a physical model that treats FG domains as regular, flexible polymers, and NTRs as spherical colloids with a homogeneous surface, ignoring the detailed arrangement of interaction sites along FG domains and on the NTR surface. DOI: http://dx.doi.org/10.7554/eLife.14119.001 PMID:27058170
Chaudhary, Nitika; Sandhu, Padmani; Ahmed, Mushtaq; Akhter, Yusuf
2017-02-01
Trichothecenes are the sesquiterpenes secreted by Trichoderma spp. residing in the rhizosphere. These compounds have been reported to act as plant growth promoters and bio-control agents. The structural knowledge for the transporter proteins of their efflux remained limited. In this study, three-dimensional structure of Thmfs1 protein, a trichothecene transporter from Trichoderma harzianum, was homology modelled and further Molecular Dynamics (MD) simulations were used to decipher its mechanism. Fourteen transmembrane helices of Thmfs1 protein are observed contributing to an inward-open conformation. The transport channel and ligand binding sites in Thmfs1 are identified based on heuristic, iterative algorithm and structural alignment with homologous proteins. MD simulations were performed to reveal the differential structural behaviour occurring in the ligand free and ligand bound forms. We found that two discrete trichothecene binding sites are located on either side of the central transport tunnel running from the cytoplasmic side to the extracellular side across the Thmfs1 protein. Detailed analysis of the MD trajectories showed an alternative access mechanism between N and C-terminal domains contributing to its function. These results also demonstrate that the transport of trichodermin occurs via hopping mechanism in which the substrate molecule jumps from one binding site to another lining the transport tunnel. Copyright © 2016 Elsevier B.V. All rights reserved.
Monoamine receptor interaction profiles of 4-thio-substituted phenethylamines (2C-T drugs).
Luethi, Dino; Trachsel, Daniel; Hoener, Marius C; Liechti, Matthias E
2018-05-15
4-Thio-substituted phenethylamines (2C-T drugs) are potent psychedelics with poorly defined pharmacological properties. Because of their psychedelic effects, 2C-T drugs are sometimes sold as new psychoactive substances (NPSs). The aim of the present study was to characterize the monoamine receptor and transporter interaction profiles of a series of 2C-T drugs. We determined the binding affinities of 2C-T drugs at monoamine receptors and transporters in human cells that were transfected with the respective receptors or transporters. We also investigated the functional activation of serotonergic 5-hydroxytryptamine 2A (5-HT 2A ) and 5-HT 2B receptors, activation of human trace amine-associated receptor 1 (TAAR 1 ), and inhibition of monoamine uptake transporters. 2C-T drugs had high affinity for 5-HT 2A and 5-HT 2C receptors (1-54 nM and 40-350 nM, respectively). With activation potencies of 1-53 nM and 44-370 nM, the drugs were potent 5-HT 2A receptor and 5-HT 2B receptor, respectively, partial agonists. An exception to this were the benzylthiophenethylamines, which did not potently activate the 5-HT 2B receptor (EC 50 > 3000 nM). Furthermore, the compounds bound to serotonergic 5-HT 1A and adrenergic receptors. The compounds had high affinity for the rat TAAR 1 (5-68 nM) and interacted with the mouse but not human TAAR 1 . The 2C-T drugs did not potently interact with monoamine transporters (K i > 4000 nM). The receptor binding profile of 2C-T drugs predicts psychedelic effects that are mediated by potent 5-HT 2 receptor interactions. This article is part of the Special Issue entitled 'Designer Drugs and Legal Highs.' Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Xuefeng; Yang, Yunhuang; Neville, T.
2007-06-12
Apolipoprotein A-I (apoAI, 243-residues) is the major protein component of the high-density lipoprotein (HDL) that has been a hot subject of interests because of its anti-atherogenic properties. This important property of apoAI is related to its roles in reverse cholesterol transport pathway. Upon lipid-binding, apoAI undergoes conformational changes from lipid-free to several different HDL-associated states (1). These different conformational states regulate HDL formation, maturation and transportation. Two initial conformational states of apoAI are lipid-free apoAI and apoAI/preβHDL that recruit phospholipids and cholesterol to form HDL particles. In particular, lipid-free apoAI specifically binds to phospholipids to form lipid-poor apoAI, including apoAI/preβ-HDLmore » (~37 kDa). As a unique class of lipid poor HDL, both in vitro and in vivo evidence demonstrates that apoAI/preβ-HDLs are the most effective acceptors specifically for free cholesterol in human plasma and serves as the precursor of HDL particles (2). Here we report a complete backbone spectral assignment of human apoAI/preβHDL. Secondary structure prediction using backbone NMR parameters indicates that apoAI/preβHDL displays a two-domain structure: the N-terminal four helix-bundle domain (residues 1-186) and the C-terminal flexible domain (residues 187-243). A structure of apoAI/preβ-HDL is the first lipid-associated structure of apoAI and is critical for us to understand how apoAI recruits cholesterol to initialize HDL formation. BMRB deposit with accession number: 15093.« less
Peluffo, R. Daniel; Argüello, José M.; Berlin, Joshua R.
2000-01-01
The roles of Ser775 and Glu779, two amino acids in the putative fifth transmembrane segment of the Na,K -ATPase α subunit, in determining the voltage and extracellular K + (K + o) dependence of enzyme-mediated ion transport, were examined in this study. HeLa cells expressing the α1 subunit of sheep Na,K -ATPase were voltage clamped via patch electrodes containing solutions with 115 mM Na+ (37°C). Na,K -pump current produced by the ouabain-resistant control enzyme (RD), containing amino acid substitutions Gln111Arg and Asn122Asp, displayed a membrane potential and K + o dependence similar to wild-type Na,K -ATPase during superfusion with 0 and 148 mM Na+-containing salt solutions. Additional substitution of alanine at Ser775 or Glu779 produced 155- and 15-fold increases, respectively, in the K + o concentration that half-maximally activated Na,K -pump current at 0 mV in extracellular Na+-free solutions. However, the voltage dependence of Na,K -pump current was unchanged in RD and alanine-substituted enzymes. Thus, large changes in apparent K + o affinity could be produced by mutations in the fifth transmembrane segment of the Na,K -ATPase with little effect on voltage-dependent properties of K + transport. One interpretation of these results is that protein structures responsible for the kinetics of K + o binding and/or occlusion may be distinct, at least in part, from those that are responsible for the voltage dependence of K + o binding to the Na,K -ATPase. PMID:10871639
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halvorsen, Bente, E-mail: Bente.Halvorsen@rr-research.no; Institute of Clinical Medicine, University of Oslo, Oslo; K.G. Jebsen Inflammation Research Center, University of Oslo, Oslo
Highlights: • IL-10 promotes reverse cholesterol efflux from lipid loaded macrophages. • IL-10 increases the expression of ABCA-1 and ABCG-1. • IL-10 exhibits cross-talk with the nuclear receptor LXRα. - Abstract: Interleukin (IL)-10 is a prototypical anti-inflammatory cytokine that has been shown to attenuate atherosclerosis development. In addition to its anti-inflammatory properties, the anti-atherogenic effect of IL-10 has recently also been suggested to reflect a complex effect of IL-10 on lipid metabolism in macrophages. In the present study we examined the effects of IL-10 on cholesterol efflux mechanism in lipid-loaded THP-1 macrophages. Our main findings were: (i) IL-10 significantly enhancedmore » cholesterol efflux induced by fetal-calf serum, high-density lipoprotein (HDL){sub 2} and apolipoprotein A-1. (ii) The IL-10-mediated effects on cholesterol efflux were accompanied by an increased IL-10-mediated expression of the ATP-binding cassette transporters ABCA1 and ABCG1, that was further enhanced when the cells were co-activated with the liver X receptor (LXR)α agonist (22R)-hydroxycholesterol. (iii) The effect of LXRα activation on the IL-10-mediated effects on the ATP-binding cassette transporters seems to include enhancing effects on the IL-10 receptor 1 (IL10R1) expression and interaction with STAT-3 signaling. (iv) These enhancing effects on ABCA1 and ABCG1 was not seen when the cells were stimulated with the IL-10 family members IL-22 and IL-24. This study suggests that the anti-atherogenic properties of IL-10 may include enhancing effects on cholesterol efflux mechanism that involves cross-talk with LXRα activation.« less
Midde, Narasimha M.; Yuan, Yaxia; Quizon, Pamela M.; Sun, Wei-Lun; Huang, Xiaoqin; Zhan, Chang-Guo; Zhu, Jun
2015-01-01
HIV-1 transactivator of transcription (Tat) protein disrupts the dopamine (DA) neurotransmission by inhibiting DA transporter (DAT) function, leading to increased neurocognitive impairment in HIV-1 infected individuals. Through integrated computational modeling and pharmacological studies, we have demonstrated that mutation of tyrosine470 (Y470H) of human DAT (hDAT) attenuates Tat-induced inhibition of DA uptake by changing the transporter conformational transitions. The present study examined the functional influences of other substitutions at tyrosine470 (Y470F and Y470A) and tyrosine88 (Y88F) and lysine92 (K92M), two other relevant residues for Tat binding to hDAT, in Tat-induced inhibitory effects on DA transport. Y88F, K92M and Y470A attenuated Tat-induced inhibition of DA transport, implicating the functional relevance of these residues for Tat binding to hDAT. Compared to wild type hDAT, Y470A and K92M but not Y88F reduced the maximal velocity of [3H]DA uptake without changes in the Km. Y88F and K92M enhanced IC50 values for DA inhibition of [3H]DA uptake and [3H]WIN35,428 binding but decreased IC50 for cocaine and GBR12909 inhibition of [3H]DA uptake, suggesting that these residues are critical for substrate and these inhibitors. Y470F, Y470A, Y88F and K92M attenuated zinc-induced increase of [3H]WIN35,428 binding. Moreover, only Y470A and K92M enhanced DA efflux relative to wild type hDAT, suggesting mutations of these residues differentially modulate transporter conformational transitions. These results demonstrate Tyr88 and Lys92 along with Tyr470 as functional recognition residues in hDAT for Tat-induced inhibition of DA transport and provide mechanistic insights into identifying target residues on the DAT for Tat binding. PMID:25604666
Ganeshnarayan, Krishnaraj; Shah, Suhagi M; Libera, Matthew R; Santostefano, Anthony; Kaplan, Jeffrey B
2009-03-01
Biofilms are composed of bacterial cells encased in a self-synthesized, extracellular polymeric matrix. Poly-beta(1,6)-N-acetyl-d-glucosamine (PNAG) is a major biofilm matrix component in phylogenetically diverse bacteria. In this study we investigated the physical and chemical properties of the PNAG matrix in biofilms produced in vitro by the gram-negative porcine respiratory pathogen Actinobacillus pleuropneumoniae and the gram-positive device-associated pathogen Staphylococcus epidermidis. The effect of PNAG on bulk fluid flow was determined by measuring the rate of fluid convection through biofilms cultured in centrifugal filter devices. The rate of fluid convection was significantly higher in biofilms cultured in the presence of the PNAG-degrading enzyme dispersin B than in biofilms cultured without the enzyme, indicating that PNAG decreases bulk fluid flow. PNAG also blocked transport of the quaternary ammonium compound cetylpyridinium chloride (CPC) through the biofilms. Binding of CPC to biofilms further impeded fluid convection and blocked transport of the azo dye Allura red. Bioactive CPC was efficiently eluted from biofilms by treatment with 1 M sodium chloride. Taken together, these findings suggest that CPC reacts directly with the PNAG matrix and alters its physical and chemical properties. Our results indicate that PNAG plays an important role in controlling the physiological state of biofilms and may contribute to additional biofilm-associated processes such as biocide resistance.
Marsh, Lorraine
2015-01-01
Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.
NASA Astrophysics Data System (ADS)
Yan, Jiawei; Ke, Youqi
2016-07-01
Electron transport properties of nanoelectronics can be significantly influenced by the inevitable and randomly distributed impurities/defects. For theoretical simulation of disordered nanoscale electronics, one is interested in both the configurationally averaged transport property and its statistical fluctuation that tells device-to-device variability induced by disorder. However, due to the lack of an effective method to do disorder averaging under the nonequilibrium condition, the important effects of disorders on electron transport remain largely unexplored or poorly understood. In this work, we report a general formalism of Green's function based nonequilibrium effective medium theory to calculate the disordered nanoelectronics. In this method, based on a generalized coherent potential approximation for the Keldysh nonequilibrium Green's function, we developed a generalized nonequilibrium vertex correction method to calculate the average of a two-Keldysh-Green's-function correlator. We obtain nine nonequilibrium vertex correction terms, as a complete family, to express the average of any two-Green's-function correlator and find they can be solved by a set of linear equations. As an important result, the averaged nonequilibrium density matrix, averaged current, disorder-induced current fluctuation, and averaged shot noise, which involve different two-Green's-function correlators, can all be derived and computed in an effective and unified way. To test the general applicability of this method, we applied it to compute the transmission coefficient and its fluctuation with a square-lattice tight-binding model and compared with the exact results and other previously proposed approximations. Our results show very good agreement with the exact results for a wide range of disorder concentrations and energies. In addition, to incorporate with density functional theory to realize first-principles quantum transport simulation, we have also derived a general form of conditionally averaged nonequilibrium Green's function for multicomponent disorders.
Effect of endosomal acidification on small ion transport through the anthrax toxin PA63 channel.
Kalu, Nnanya; Alcaraz, Antonio; Yamini, Goli; Momben Abolfath, Sanaz; Lucas, Laura; Kenney, Clare; Aguilella, Vicente M; Nestorovich, Ekaterina M
2017-11-01
Tight regulation of pH is critical for the structure and function of cells and organelles. The pH environment changes dramatically along the endocytic pathway, an internalization transport process that is 'hijacked' by many intracellularly active bacterial exotoxins, including the anthrax toxin. Here, we investigate the role of pH on single-channel properties of the anthrax toxin protective antigen (PA 63 ). Using conductance and current noise analysis, blocker binding, ion selectivity, and poly(ethylene glycol) partitioning measurements, we show that the channel exists in two different open states ('maximum' and 'main') at pH ≥ 5.5, while only a maximum conductance state is detected at pH < 5.5. We describe two substantially distinct patterns of PA 63 conductance dependence on KCl concentration uncovered at pH 6.5 and 4.5. © 2017 Federation of European Biochemical Societies.
Sato, Takafumi; Ota, Merime; Takemura, Miki; Nishikawa, Toru; Toba, Shinsuke; Kohira, Naoki; Miyagawa, Satoshi; Ishibashi, Naoki; Nakamura, Rio; Tsuji, Masakatsu; Yamano, Yoshinori
2017-01-01
ABSTRACT Cefiderocol (CFDC; S-649266), a novel parenteral siderophore cephalosporin conjugated with a catechol moiety, has a characteristic antibacterial spectrum with a potent activity against a broad range of aerobic Gram-negative bacterial species, including carbapenem-resistant strains of Enterobacteriaceae and nonfermenting bacteria such as Pseudomonas aeruginosa and Acinetobacter baumannii. Cefiderocol has affinity mainly for penicillin-binding protein 3 (PBP3) of Enterobacteriaceae and nonfermenting bacteria similar to that of ceftazidime. A deficiency of the iron transporter PiuA in P. aeruginosa or both CirA and Fiu in Escherichia coli caused 16-fold increases in cefiderocol MICs, suggesting that these iron transporters contribute to the permeation of cefiderocol across the outer membrane. The deficiency of OmpK35/36 in Klebsiella pneumoniae and the overproduction of efflux pump MexA-MexB-OprM in P. aeruginosa showed no significant impact on the activity of cefiderocol. PMID:29061741
D'Acunto, Cosimo Walter; Kaplánek, Robert; Gbelcová, Helena; Kejík, Zdeněk; Bříza, Tomáš; Vasina, Liudmila; Havlík, Martin; Ruml, Tomáš; Král, Vladimír
2018-04-25
Alzheimer's disease (AD) is a progressive neurodegenerative disorder affecting tens of million people. Currently marketed drugs have limited therapeutic efficacy and only slowing down the neurodegenerative process. Interestingly, it has been suggested that biometal cations in the amyloid beta (Aβ) aggregate deposits contribute to neurotoxicity and degenerative changes in AD. Thus, chelation therapy could represent novel mode of therapeutic intervention. Here we describe the features of chelators with therapeutically relevant mechanism of action. We have found that the tested compounds effectively reduce the toxicity of exogenous Aβ and suppress its endogenous production as well as decrease oxidative stress. Cholyl hydrazones were found to be the most active compounds. In summary, our data show that cation complexation, together with improving transport efficacy may represent basis for eventual treatment strategy in AD. Copyright © 2018. Published by Elsevier Masson SAS.
Self-organized pseudo-graphene on grain boundaries in topological band insulators
NASA Astrophysics Data System (ADS)
Slager, Robert-Jan; Juričić, Vladimir; Lahtinen, Ville; Zaanen, Jan
2016-06-01
Semimetals are characterized by nodal band structures that give rise to exotic electronic properties. The stability of Dirac semimetals, such as graphene in two spatial dimensions, requires the presence of lattice symmetries, while akin to the surface states of topological band insulators, Weyl semimetals in three spatial dimensions are protected by band topology. Here we show that in the bulk of topological band insulators, self-organized topologically protected semimetals can emerge along a grain boundary, a ubiquitous extended lattice defect in any crystalline material. In addition to experimentally accessible electronic transport measurements, these states exhibit a valley anomaly in two dimensions influencing edge spin transport, whereas in three dimensions they appear as graphenelike states that may exhibit an odd-integer quantum Hall effect. The general mechanism underlying these semimetals—the hybridization of spinon modes bound to the grain boundary—suggests that topological semimetals can emerge in any topological material where lattice dislocations bind localized topological modes.
Gating Topology of the Proton-Coupled Oligopeptide Symporters
Fowler, Philip W.; Orwick-Rydmark, Marcella; Radestock, Sebastian; Solcan, Nicolae; Dijkman, Patricia M.; Lyons, Joseph A.; Kwok, Jane; Caffrey, Martin; Watts, Anthony; Forrest, Lucy R.; Newstead, Simon
2015-01-01
Summary Proton-coupled oligopeptide transporters belong to the major facilitator superfamily (MFS) of membrane transporters. Recent crystal structures suggest the MFS fold facilitates transport through rearrangement of their two six-helix bundles around a central ligand binding site; how this is achieved, however, is poorly understood. Using modeling, molecular dynamics, crystallography, functional assays, and site-directed spin labeling combined with double electron-electron resonance (DEER) spectroscopy, we present a detailed study of the transport dynamics of two bacterial oligopeptide transporters, PepTSo and PepTSt. Our results identify several salt bridges that stabilize outward-facing conformations and we show that, for all the current structures of MFS transporters, the first two helices of each of the four inverted-topology repeat units form half of either the periplasmic or cytoplasmic gate and that these function cooperatively in a scissor-like motion to control access to the peptide binding site during transport. PMID:25651061
A kinesin-1 binding motif in vaccinia virus that is widespread throughout the human genome
Dodding, Mark P; Mitter, Richard; Humphries, Ashley C; Way, Michael
2011-01-01
Transport of cargoes by kinesin-1 is essential for many cellular processes. Nevertheless, the number of proteins known to recruit kinesin-1 via its cargo binding light chain (KLC) is still quite small. We also know relatively little about the molecular features that define kinesin-1 binding. We now show that a bipartite tryptophan-based kinesin-1 binding motif, originally identified in Calsyntenin is present in A36, a vaccinia integral membrane protein. This bipartite motif in A36 is required for kinesin-1-dependent transport of the virus to the cell periphery. Bioinformatic analysis reveals that related bipartite tryptophan-based motifs are present in over 450 human proteins. Using vaccinia as a surrogate cargo, we show that regions of proteins containing this motif can function to recruit KLC and promote virus transport in the absence of A36. These proteins interact with the kinesin light chain outside the context of infection and have distinct preferences for KLC1 and KLC2. Our observations demonstrate that KLC binding can be conferred by a common set of features that are found in a wide range of proteins associated with diverse cellular functions and human diseases. PMID:21915095
Banik, Bhabatosh; Wen, Ru; Marrache, Sean; Kumar, Anil; Kolishetti, Nagesh; Howerth, Elizabeth W; Dhar, Shanta
2017-12-21
Atherosclerosis, the deadliest disease in the United States, arises due to the build up of plaques in the arteries as a result of excessive cholesterol deposition and an impaired cholesterol removal process. High density lipoproteins (HDL), popularly known as "good cholesterol", are naturally occurring nano-sized particles that, along with apolipoproteins, are deployed to maintain cholesterol homeostasis in the body. Both cholesterol efflux, from the fat-laden macrophages in the arteries, and intracellular lipid transport, to deliver cholesterol to the mitochondria of liver cells for metabolism, hold key responsibilities to maintain healthy lipid levels inside the body. We designed a library of nine mitochondria targeted polymer-lipid hybrid nanoparticles (NPs), comprised of completely synthetic yet biodegradable components, that are capable of performing HDL-like functions. Using this library, we optimized a superior mitochondria targeted NP candidate, which can show favourable organ distribution, therapeutic potential, and non-toxic properties. Two targeted NP formulations with optimum NP size, zeta potential, and cholesterol binding and release properties were identified. Lipid reduction and anti-oxidative properties of these two NPs demonstrated cholesterol removal ability. In vivo therapeutic evaluation of the targeted-NP formulations in apolipoprotein E knockout (apoE - / - ) mice indicated lipid reduction and anti-inflammatory properties compared to non-targeted NPs. This synthetic targeted NP with potential abilities to participate in both extra- and intracellular cholesterol transport might potentiate therapeutic interventions for heart diseases.
LAL (Lysosomal Acid Lipase) Promotes Reverse Cholesterol Transport In Vitro and In Vivo.
Bowden, Kristin L; Dubland, Joshua A; Chan, Teddy; Xu, You-Hai; Grabowski, Gregory A; Du, Hong; Francis, Gordon A
2018-05-01
To explore the role of LAL (lysosomal acid lipase) in macrophage cholesterol efflux and whole-body reverse cholesterol transport. Immortalized peritoneal macrophages from lal -/- mice showed reduced expression of ABCA1 (ATP-binding cassette transporter A1) and ABCG1 (ATP-binding cassette transporter G1), reduced production of the regulatory oxysterol 27-hydroxycholesterol, and impaired suppression of cholesterol synthesis on exposure to acetylated low-density lipoprotein when compared with lal +/+ macrophages. LAL-deficient mice also showed reduced hepatic ABCG5 (ATP-binding cassette transporter G5) and ABCG8 (ATP-binding cassette transporter G8) expression compared with lal +/+ mice. LAL-deficient macrophages loaded with [ 3 H]-cholesteryl oleate-labeled acetylated low-density lipoprotein showed impaired efflux of released [ 3 H]-cholesterol to apoA-I (apolipoprotein A-I), with normalization of [ 3 H]-cholesteryl ester levels and partial correction of ABCA1 expression and cholesterol efflux to apoA-I when treated with exogenous rhLAL (recombinant human LAL protein). LAL-deficient mice injected intraperitoneally with lal -/- macrophages cholesterol loaded and labeled in the same way exhibited only 1.55±0.35% total injected [ 3 H]-cholesterol counts appearing in the feces for 48 h (n=30), compared with 5.38±0.92% in lal +/+ mice injected with labeled lal +/+ macrophages (n=27), P <0.001. To mimic the therapeutic condition of delivery of supplemental LAL in vivo, injection of labeled lal -/- macrophages into lal +/+ mice resulted in a significant increase in reverse cholesterol transport (2.60±0.46% of 3 H-cholesterol counts in feces at 48 hours [n=19]; P <0.001 when compared with injection into lal -/- mice). These results indicate a critical role for LAL in promoting both macrophage and whole-body reverse cholesterol transport and the ability of supplemental LAL to be taken up and correct reverse cholesterol transport in vivo. © 2018 American Heart Association, Inc.
Electromechanical and Chemical Sensing at the Nanoscale: DFT and Transport Modeling
NASA Astrophysics Data System (ADS)
Maiti, Amitesh
Of the many nanoelectronic applications proposed for near to medium-term commercial deployment, sensors based on carbon nanotubes (CNT) and metal-oxide nanowires are receiving significant attention from researchers. Such devices typically operate on the basis of the changes of electrical response characteristics of the active component (CNT or nanowire) when subjected to an externally applied mechanical stress or the adsorption of a chemical or bio-molecule. Practical development of such technologies can greatly benefit from quantum chemical modeling based on density functional theory (DFT), and from electronic transport modeling based on non-equilibrium Green's function (NEGF). DFT can compute useful quantities like possible bond-rearrangements, binding energy, charge transfer, and changes to the electronic structure, while NEGF can predict changes in electronic transport behavior and contact resistance. Effects of surrounding medium and intrinsic structural defects can also be taken into account. In this work we review some recent DFT and transport investigations on (1) CNT-based nano-electromechanical sensors (NEMS) and (2) gas-sensing properties of CNTs and metal-oxide nanowires. We also briefly discuss our current understanding of CNT-metal contacts which, depending upon the metal, the deposition technique, and the masking method can have a significant effect on device performance.
Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter
2006-04-15
We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.
Seppala, Susanna; Solomon, Kevin V.; Gilmore, Sean P.; ...
2016-12-20
Here, engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive andmore » rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. In conclusion, we report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.« less
Seppälä, Susanna; Solomon, Kevin V; Gilmore, Sean P; Henske, John K; O'Malley, Michelle A
2016-12-20
Engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive and rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. We report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.
Anion Binding and Transport by Prodigiosin and Its Analogs
NASA Astrophysics Data System (ADS)
Davis, Jeffery T.
The red-colored prodiginines, exemplified by prodigiosin 1, are secondary metabolites produced by a number of microorganisms, including the bacterium Serratia marcescens. These tripyrrole natural products and their synthetic analogs have received renewed attention over the past deacade, primarily because of their promising immunosuppressive and anticancer activities. One of the hallmarks of prodiginin chemistry is the ability of the monoprotonated ligand to bind anions, including the essential chloride and bicarbonate ions. The resulting lipophilic ion pair is then able to diffuse across the hydrophobic barrier presented by phospholipid bilayers. Thus, prodiginines have been found to be potent transmembrane anion transporters and HCl cotransporters. In this chapter, the author reviews what is known about the solid-state structure of prodiginins and their anion complexes, the solution conformation of prodiginines, and the biochemcal evidence for the ability to bind anions and to transport HCl across cell membranes. Recent progress in making synthetic models of prodiginines and recent results on the ability of prodigiosin to transport HCO 3 - across lipid membranes are discussed.
Grossmann, Nina; Vakkasoglu, Ahmet S.; Hulpke, Sabine; ...
2014-11-07
The ATP-binding cassette (ABC) transporter associated with antigen processing (TAP) participates in immune surveillance by moving proteasomal products into the endoplasmic reticulum (ER) lumen for major histocompatibility complex class I loading and cell surface presentation to cytotoxic T cells. Here we delineate the mechanistic basis for antigen translocation. Notably, TAP works as a molecular diode, translocating peptide substrates against the gradient in a strict unidirectional way. We reveal the importance of the D-loop at the dimer interface of the two nucleotide-binding domains (NBDs) in coupling substrate translocation with ATP hydrolysis and defining transport vectoriality. Substitution of the converved aspartate, whichmore » coordinates the ATP-binding site, decreases NBD dimerization affinity and turns the unidirectional primary active pump into a passive bidirectional nucleotide-gated facilitator. Thus, ATP hydrolysis is not required for translocation per se, but is essential for both active and unidirectional transport. As a result, our data provide detailed mechanistic insight into how heterodimeric ABC exporters operate.« less
Structural basis of Na(+)-independent and cooperative substrate/product antiport in CaiT.
Schulze, Sabrina; Köster, Stefan; Geldmacher, Ulrike; Terwisscha van Scheltinga, Anke C; Kühlbrandt, Werner
2010-09-09
Transport of solutes across biological membranes is performed by specialized secondary transport proteins in the lipid bilayer, and is essential for life. Here we report the structures of the sodium-independent carnitine/butyrobetaine antiporter CaiT from Proteus mirabilis (PmCaiT) at 2.3-A and from Escherichia coli (EcCaiT) at 3.5-A resolution. CaiT belongs to the family of betaine/carnitine/choline transporters (BCCT), which are mostly Na(+) or H(+) dependent, whereas EcCaiT is Na(+) and H(+) independent. The three-dimensional architecture of CaiT resembles that of the Na(+)-dependent transporters LeuT and BetP, but in CaiT a methionine sulphur takes the place of the Na(+) ion to coordinate the substrate in the central transport site, accounting for Na(+)-independent transport. Both CaiT structures show the fully open, inward-facing conformation, and thus complete the set of functional states that describe the alternating access mechanism. EcCaiT contains two bound butyrobetaine substrate molecules, one in the central transport site, the other in an extracellular binding pocket. In the structure of PmCaiT, a tryptophan side chain occupies the transport site, and access to the extracellular site is blocked. Binding of both substrates to CaiT reconstituted into proteoliposomes is cooperative, with Hill coefficients up to 1.7, indicating that the extracellular site is regulatory. We propose a mechanism whereby the occupied regulatory site increases the binding affinity of the transport site and initiates substrate translocation.
Ni, Nanting; Laughlin, Sarah; Wang, Yingji; Feng, You; Zheng, Yujun
2012-01-01
The boronic acid group is widely used in chemosensor design due to its ability to reversibly bind diol-containing compounds. The thermodynamic properties of the boronic acid-diol binding process have been investigated extensively. However, there are few studies of the kinetic properties of such binding processes. In this report, stopped-flow method was used for the first time to study the kinetic properties of the binding between three model arylboronic acids, 4-, 5-, and 8-isoquinolinylboronic acids, and various sugars. With all the boronic acid-diol pair sexamined, reactions were complete within seconds. The kon values with various sugars follow the order of D-fructose >D-tagatose>D-mannose >D-glucose. This trend tracks the thermodynamic binding affinities for these sugars and demonstrates that the “on” rate is the key factor determining the binding constant. PMID:22464680
Scopelliti, Amanda J.; Ryan, Renae M.; Vandenberg, Robert J.
2013-01-01
The ASCTs (alanine, serine, and cysteine transporters) belong to the solute carrier family 1 (SLC1), which also includes the human glutamate transporters (excitatory amino acid transporters, EAATs) and the prokaryotic aspartate transporter GltPh. Despite the high degree of amino acid sequence identity between family members, ASCTs function quite differently from the EAATs and GltPh. The aim of this study was to mutate ASCT1 to generate a transporter with functional properties of the EAATs and GltPh, to further our understanding of the structural basis for the different transport mechanisms of the SLC1 family. We have identified three key residues involved in determining differences between ASCT1, the EAATs and GltPh. ASCT1 transporters containing the mutations A382T, T459R, and Q386E were expressed in Xenopus laevis oocytes, and their transport and anion channel functions were investigated. A382T and T459R altered the substrate selectivity of ASCT1 to allow the transport of acidic amino acids, particularly l-aspartate. The combination of A382T and T459R within ASCT1 generates a transporter with a similar profile to that of GltPh, with preference for l-aspartate over l-glutamate. Interestingly, the amplitude of the anion conductance activated by the acidic amino acids does not correlate with rates of transport, highlighting the distinction between these two processes. Q386E impaired the ability of ASCT1 to bind acidic amino acids at pH 5.5; however, this was reversed by the additional mutation A382T. We propose that these residues differences in TM7 and TM8 combine to determine differences in substrate selectivity between members of the SLC1 family. PMID:23393130
Ma, Xianyue; Cline, Kenneth
2013-03-01
Twin arginine translocation (Tat) systems of thylakoid and bacterial membranes transport folded proteins using the proton gradient as the sole energy source. Tat substrates have hydrophobic signal peptides with an essential twin arginine (RR) recognition motif. The multispanning cpTatC plays a central role in Tat operation: It binds the signal peptide, directs translocase assembly, and may facilitate translocation. An in vitro assay with pea (Pisum sativum) chloroplasts was developed to conduct mutagenesis and analysis of cpTatC functions. Ala scanning mutagenesis identified mutants defective in substrate binding and receptor complex assembly. Mutations in the N terminus (S1) and first stromal loop (S2) caused specific defects in signal peptide recognition. Cys matching between substrate and imported cpTatC confirmed that S1 and S2 directly and specifically bind the RR proximal region of the signal peptide. Mutations in four lumen-proximal regions of cpTatC were defective in receptor complex assembly. Copurification and Cys matching analyses suggest that several of the lumen proximal regions may be important for cpTatC-cpTatC interactions. Surprisingly, RR binding domains of adjacent cpTatCs directed strong cpTatC-cpTatC cross-linking. This suggests clustering of binding sites on the multivalent receptor complex and explains the ability of Tat to transport cross-linked multimers. Transport of substrate proteins cross-linked to the signal peptide binding site tentatively identified mutants impaired in the translocation step.
Song, Xin-Mi; Zhang, Lin-Ya; Fu, Xiao-Bin; Wu, Fan; Tan, Jing; Li, Hong-Liang
2018-01-01
Odorant-binding proteins (OBPs) are the critical elements responsible for binding and transporting odors and pheromones in the sensitive olfactory system in insects. Honey bees are representative social insects that have complex odorants and pheromone communication systems relative to solitary insects. Here, we first cloned and characterized OBP11 ( AcerOBP11 ), from the worker bees antennae of Eastern honey bee, Apis cerana . Based on sequence and phylogenetic analysis, most sequences homologous to AcerOBP11 belong to the typical OBPs family. The transcriptional expression profiles showed that AcerOBP11 was expressed throughout the developmental stages and highly specifically expressed in adult antennae. Using immunofluorescence localization, AcerOBP11 in worker bee's antennae was only localized in the sensilla basiconica (SB) near the fringe of each segment. Fluorescence ligand-binding assay showed that AcerOBP11 protein had strong binding affinity with the tested various bee pheromones components, including the main queen mandibular pheromones (QMPs), methyl p-hydroxybenzoate (HOB), and ( E )-9-oxo-2-decanoic acid (9-ODA), alarm pheromone (n-hexanol), and worker pheromone components. AcerOBP11 also had strong binding affinity to plant volatiles, such as 4-Allylveratrole. Based on the docking and site-directed mutagenesis, two key amino acid residues (Ile97 and Ile140) were involved in the binding of AcerOBP11 to various bee pheromones. Taken together, we identified that AcerOBP11 was localized in a single type of antennal chemosensilla and had complex ligand-binding properties, which confer the dual-role with the primary characteristics of sensing various bee pheromones and secondary characteristics of sensing general odorants. This study not only prompts the theoretical basis of OBPs-mediated bee pheromones recognition of honey bee, but also extends the understanding of differences in pheromone communication between social and solitary insects.
Sankova, Tatiana P.; Orlov, Iurii A.; Saveliev, Andrey N.; Kirilenko, Demid A.; Babich, Polina S.; Brunkov, Pavel N.; Puchkova, Ludmila V.
2017-01-01
There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell’s copper metabolism and its chelating properties are discussed. PMID:29099786
Sankova, Tatiana P; Orlov, Iurii A; Saveliev, Andrey N; Kirilenko, Demid A; Babich, Polina S; Brunkov, Pavel N; Puchkova, Ludmila V
2017-11-03
There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell's copper metabolism and its chelating properties are discussed.