Sample records for tumor involvement pattern

  1. Metastasis of hepatocellular carcinoma to the heart: unusual patterns in three cases with antemortem diagnosis.

    PubMed

    Lei, M H; Ko, Y L; Kuan, P; Lien, W P; Chen, D S

    1992-04-01

    Unusual patterns of cardiac metastasis were noted in three cases of hepatocellular carcinoma (HCC): one patient was noted to have a large right ventricular (RV) tumor mass with intracavitary growth and myocardial invasion; the second had massive pulmonary and left atrial (LA) metastasis; and the third patient had a right atrial tumor mass with concomitant RV and LA involvement. Tumor implantation to the RV without right atrial involvement and extensive myocardial invasion is unusual in HCC. The LA involvement is probably related to tumor growth from the pulmonary veins following massive metastasis to the lung, direct invasion of the atrial septum or tumor implantation via a subclinical right-to-left shunt through the patent foramen ovale. To the best of our knowledge, such unusual intracavitary metastases in HCC have not been reported previously. Cardiac metastasis, without local gross recurrence, may be one of the presentations after lobectomy in patients with HCC.

  2. Collision tumors in the gastrointestinal tract: a rare case series

    PubMed Central

    Bhattacharya, Aruna; Saha, Rama; Biswas, Jayanta; Biswas, Jhuma; Ghosh, Biswajit

    2012-01-01

    A collision tumor is one where histology shows the presence of two distinct primaries involving the same organ without intermixture of individual cell types, ie, a side by side pattern. Here we present three rare cases of collision tumors involving the stomach and transverse colon. There were two cases of collision tumors involving the stomach, one of which was a combination of adenocarcinoma and low-grade non-Hodgkin’s (mucosa-associated lymphoid tissue) lymphoma, and the other showed the presence of non-Hodgkin’s lymphoma involving the entire stomach wall along with adenocarcinoma infiltrating the muscle layer. The third case comprised a mucinous adenocarcinoma and carcinoid tumor in the large gut. PMID:23754928

  3. The ketogenic diet reverses gene expression patterns and reduces reactive oxygen species levels when used as an adjuvant therapy for glioma.

    PubMed

    Stafford, Phillip; Abdelwahab, Mohammed G; Kim, Do Young; Preul, Mark C; Rho, Jong M; Scheck, Adrienne C

    2010-09-10

    Malignant brain tumors affect people of all ages and are the second leading cause of cancer deaths in children. While current treatments are effective and improve survival, there remains a substantial need for more efficacious therapeutic modalities. The ketogenic diet (KD) - a high-fat, low-carbohydrate treatment for medically refractory epilepsy - has been suggested as an alternative strategy to inhibit tumor growth by altering intrinsic metabolism, especially by inducing glycopenia. Here, we examined the effects of an experimental KD on a mouse model of glioma, and compared patterns of gene expression in tumors vs. normal brain from animals fed either a KD or a standard diet. Animals received intracranial injections of bioluminescent GL261-luc cells and tumor growth was followed in vivo. KD treatment significantly reduced the rate of tumor growth and prolonged survival. Further, the KD reduced reactive oxygen species (ROS) production in tumor cells. Gene expression profiling demonstrated that the KD induces an overall reversion to expression patterns seen in non-tumor specimens. Notably, genes involved in modulating ROS levels and oxidative stress were altered, including those encoding cyclooxygenase 2, glutathione peroxidases 3 and 7, and periredoxin 4. Our data demonstrate that the KD improves survivability in our mouse model of glioma, and suggests that the mechanisms accounting for this protective effect likely involve complex alterations in cellular metabolism beyond simply a reduction in glucose.

  4. Histologic pattern of Merkel cell carcinoma sentinel lymph node metastasis improves stratification of Stage III patients

    PubMed Central

    Ko, Jennifer S; Prieto, Victor G; Elson, Paul; Vilain, Ricardo E; Pulitzer, Melissa; Scolyer, Richard A; Reynolds, Jordan P; Piliang, Melissa; Ernstoff, Marc S; Gastman, Brian; Billings, Steven D

    2016-01-01

    Sentinel lymph node biopsy is used to stage Merkel cell carcinoma, but its prognostic value has been questioned. Furthermore, predictors of outcome in sentinel lymph node positive Merkel cell carcinoma patients are poorly defined. In breast carcinoma, isolated immunohistochemically positive tumor cells have no impact, but in melanoma they are considered significant. The significance of sentinel lymph node metastasis tumor burden (including isolated tumor cells) and pattern of involvement in Merkel cell carcinoma are unknown. In this study, 64 Merkel cell carcinomas involving sentinel lymph nodes and corresponding immunohistochemical stains were reviewed and clinicopathologic predictors of outcome were sought. Five metastatic patterns were identified: 1, sheet-like (n=38, 59%); 2, non-solid parafollicular (n=4, 6%); 3, sinusoidal, (n=11, 17%); 4, perivascular hilar (n=1, 2%) and 5, rare scattered parenchymal cells (n=10, 16%). At the time of follow-up, 30/63 (48%) patients had died with 21(33%) attributable to Merkel cell carcinoma. Patients with pattern 1 metastases had poorer overall survival compared with patients with patterns 2–5 metastases (p=0.03), with 22/30 (73%) deaths occurring in pattern 1 patients. 3 (10%) deaths occurred in patients showing pattern 5, all of whom were immunosuppressed. 4 (13%) deaths occurred in pattern 3 patients and 1 (3%) death occurred in a pattern 2 patient. In multivariable analysis, the number of positive sentinel lymph node (1 or 2 versus >2, p<.0001), age (<70 versus ≥70, p=.01), sentinel lymph node metastasis pattern (patterns 2–5 versus 1, p=.02), and immune status (immunocompetent versus suppressed, p=.03) were independent predictors of outcome, and could be used to stratify Stage III patients into 3 groups with markedly different outcomes. In Merkel cell carcinoma, the pattern of sentinel lymph node involvement provides important prognostic information and utilizing this data with other clinicopathologic features facilitates risk stratification of Merkel cell carcinoma patients that may have management implications. PMID:26541273

  5. Histological pattern of Merkel cell carcinoma sentinel lymph node metastasis improves stratification of Stage III patients.

    PubMed

    Ko, Jennifer S; Prieto, Victor G; Elson, Paul J; Vilain, Ricardo E; Pulitzer, Melissa P; Scolyer, Richard A; Reynolds, Jordan P; Piliang, Melissa P; Ernstoff, Marc S; Gastman, Brian R; Billings, Steven D

    2016-02-01

    Sentinel lymph node biopsy is used to stage Merkel cell carcinoma, but its prognostic value has been questioned. Furthermore, predictors of outcome in sentinel lymph node positive Merkel cell carcinoma patients are poorly defined. In breast carcinoma, isolated immunohistochemically positive tumor cells have no impact, but in melanoma they are considered significant. The significance of sentinel lymph node metastasis tumor burden (including isolated tumor cells) and pattern of involvement in Merkel cell carcinoma are unknown. In this study, 64 Merkel cell carcinomas involving sentinel lymph nodes and corresponding immunohistochemical stains were reviewed and clinicopathological predictors of outcome were sought. Five metastatic patterns were identified: (1) sheet-like (n=38, 59%); (2) non-solid parafollicular (n=4, 6%); (3) sinusoidal, (n=11, 17%); (4) perivascular hilar (n=1, 2%); and (5) rare scattered parenchymal cells (n=10, 16%). At the time of follow-up, 30/63 (48%) patients had died with 21 (33%) attributable to Merkel cell carcinoma. Patients with pattern 1 metastases had poorer overall survival compared with patients with patterns 2-5 metastases (P=0.03), with 22/30 (73%) deaths occurring in pattern 1 patients. Three (10%) deaths occurred in patients showing pattern 5, all of whom were immunosuppressed. Four (13%) deaths occurred in pattern 3 patients and 1 (3%) death occurred in a pattern 2 patient. In multivariable analysis, the number of positive sentinel lymph nodes (1 or 2 versus >2, P<0.0001), age (<70 versus ≥70, P=0.01), sentinel lymph node metastasis pattern (patterns 2-5 versus 1, P=0.02), and immune status (immunocompetent versus suppressed, P=0.03) were independent predictors of outcome, and could be used to stratify Stage III patients into three groups with markedly different outcomes. In Merkel cell carcinoma, the pattern of sentinel lymph node involvement provides important prognostic information and utilizing this data with other clinicopathological features facilitates risk stratification of Merkel cell carcinoma patients who may have management implications.

  6. Congenital renal rhabdoid tumor with placental metastases: immunohistochemistry, cytogenetic, and ultrastructural findings.

    PubMed

    de Tar, Michael; Sanford Biggerstaff, Julie

    2006-01-01

    Malignant congenital tumors of fetal origin are rare lesions, the most common type being congenital neuroblastoma. Although prenatal diagnosis is possible in large tumors, occasionally the tumor will be diagnosed first by its metastatic involvement of the placenta. Placental metastases can reflect either maternal or fetal primary sites, and each has relatively specific patterns of placental involvement. We describe the clinical and pathologic features of a widely metastatic congenital renal rhabdoid tumor with its placental and autopsy findings, and include the immunohistochemical, cytogenetic, and ultrastructural features. The pathologic features of the placenta in congenital renal rhabdoid tumor with placental metastasis have not been previously described. The examination of the placenta in this case led to the initial diagnosis and obviated the need for additional diagnostic procedures.

  7. Ontogenetic anatomy of the distal vagina: relevance for local tumor spread and implications for cancer surgery.

    PubMed

    Höckel, Michael; Horn, Lars-Christian; Illig, Romana; Dornhöfer, Nadja; Fritsch, Helga

    2011-08-01

    We have suggested to base cancer surgery on ontogenetic anatomy and the compartment theory of tumor permeation in order to improve local tumor control and to lower treatment-related morbidity. Following the validation of this concept for the uterine cervix, proximal vagina and vulva, this study explores its applicability for the distal vagina. Serial transverse sections of female embryos and fetuses aged 8-17 weeks were assessed for the morphological changes in the region defined by the deep urogenital sinus-vaginal plate complex. Histopathological pattern analysis of local tumor spread was performed with carcinomas of the lower genital tract involving the distal vagina to test the compartment theory. Ontogenetically, the female urethra, urethrovaginal septum, distal vagina and rectovaginal septum represent a morphogenetic unit derived from the deep urogenital sinus-vaginal plate complex. Herein, the posterior urethra, the urethrovaginal septum and the distal vagina form a distinct subcompartment differentiated from the dorsal wall of the urogenital sinus. From 150 consecutive patients with distal vaginectomy as part of their surgical treatment 26 carcinomas of the lower genital tract had infiltrated the distal vagina. All 22 tumors involving the ventral wall invaded the urethra/periurethral tissue. Of the five carcinomas involving the dorsal wall none invaded the rectum/mesorectum. The pattern of local tumor permeation of lower genital tract cancer in the distal vagina can be consistently explained with ontogenetic anatomy and the compartment theory. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. A semi-quantitative World Health Organization grading scheme evaluating worst tumor differentiation predicts disease-free survival in oral squamous carcinoma patients.

    PubMed

    Jain, Dhruv; Tikku, Gargi; Bhadana, Pallavi; Dravid, Chandrashekhar; Grover, Rajesh Kumar

    2017-08-01

    We investigated World Health Organization (WHO) grading and pattern of invasion based histological schemes as independent predictors of disease-free survival, in oral squamous carcinoma patients. Tumor resection slides of eighty-seven oral squamous carcinoma patients [pTNM: I&II/III&IV-32/55] were evaluated. Besides examining various patterns of invasion, invasive front grade, predominant and worst (highest) WHO grade were recorded. For worst WHO grading, poor-undifferentiated component was estimated semi-quantitatively at advancing tumor edge (invasive growth front) in histology sections. Tumor recurrence was observed in 31 (35.6%) cases. The 2-year disease-free survival was 47% [Median: 656; follow-up: 14-1450] days. Using receiver operating characteristic curves, we defined poor-undifferentiated component exceeding 5% of tumor as the cutoff to assign an oral squamous carcinoma as grade-3, when following worst WHO grading. Kaplan-Meier curves for disease-free survival revealed prognostic association with nodal involvement, tumor size, worst WHO grading; most common pattern of invasion and invasive pattern grading score (sum of two most predominant patterns of invasion). In further multivariate analysis, tumor size (>2.5cm) and worst WHO grading (grade-3 tumors) independently predicted reduced disease-free survival [HR, 2.85; P=0.028 and HR, 3.37; P=0.031 respectively]. The inter-observer agreement was moderate for observers who semi-quantitatively estimated percentage of poor-undifferentiated morphology in oral squamous carcinomas. Our results support the value of semi-quantitative method to assign tumors as grade-3 with worst WHO grading for predicting reduced disease-free survival. Despite limitations, of the various histological tumor stratification schemes, WHO grading holds adjunctive value for its prognostic role, ease and universal familiarity. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Glioneuronal tumor with neuropil-like islands of the spinal cord with diffuse leptomeningeal neuraxis dissemination.

    PubMed

    Ruppert, Bree; Welsh, Cynthia T; Hannah, Jessica; Giglio, Pierre; Rumboldt, Zoran; Johnson, Ian; Fortney, John; Jenrette, Joseph M; Patel, Sunil; Scheithauer, Bernd W

    2011-09-01

    A 54-year-old Caucasian female presented with a 1 year history of intermittent numbness of the left leg progressing to bilateral, lower extremity sensory loss that advanced to include impaired vibration and proprioception. The subsequent thoracic spine magnetic resonance imaging (MRI) scan revealed a heterogeneous, avidly enhancing, centrally situated spinal cord mass involving T7 through T10 in association with thick linear enhancement of the anterior and posterior cord surfaces extending both superiorly and inferiorly. Both the cervical and lumbar spine MRI demonstrated diffuse leptomeningeal disease as well. A brain MRI revealed focal leptomeningeal enhancement in the left and right sylvian fissures, the suprasellar cistern, and the posterior fossa; a pattern consistent with metastatic disease. The patient underwent a T6-T10 laminectomy for tumor biopsy and debulking. Histology revealed a WHO grade III glioneuronal tumor with rosetted neuropil-like islands. Synaptophysin and neurofilament (NF) positive staining was noted within the neural appearing component, whereas, glial fibrillary acidic protein (GFAP) immunopositivity was evident in the fibrillary astrocytoma component of the tumor. The Ki-67 labeling index was 7%. This tumor pattern, now included in the 2007 World Health Organization (WHO) classification of central nervous system tumours as a pattern variation of anaplastic astrocytoma (Kleihues et al. In: Louis et al. (eds) WHO classification of tumours of the central nervous system, 2007), was first described in a four-case series by Teo et al. in 1999. The majority of subsequently reported cases described them as primary tumors of the cerebrum. Herein, we report a unique example of a spinal glioneuronal tumor with neuropil-like islands with associated leptomeningeal dissemination involving the entire craniospinal axis.

  10. Skin Cancer of the Head and Neck With Perineural Invasion: Defining the Clinical Target Volumes Based on the Pattern of Failure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gluck, Iris; Ibrahim, Mohannad; Popovtzer, Aron

    2009-05-01

    Purpose: To analyze patterns of failure in patients with head-and-neck cutaneous squamous cell carcinoma (HNCSCC) and clinical/radiologic evidence of perineural invasion (CPNI), in order to define neural clinical target volume (CTV) for treatment planning. Methods and Materials: Patients treated with three-dimensional (3D) conformal or intensity-modulated radiotherapy (IMRT) for HNCSCC with CPNI were included in the study. A retrospective review of the clinical charts, radiotherapy (RT) plans and radiologic studies has been conducted. Results: Eleven consecutive patients with HNCSCCs with CPNI were treated from 2000 through 2007. Most patients underwent multiple surgical procedures and RT courses. The most prevalent failure patternmore » was along cranial nerves (CNs), and multiple CNs were ultimately involved in the majority of cases. In all cases the involved CNs at recurrence were the main nerves innervating the primary tumor sites, as well as their major communicating nerves. We have found several distinct patterns of disease spread along specific CNs depending on the skin regions harboring the primary tumors, including multiple branches of CN V and VII. These patterns and the pertinent anatomy are detailed in the this article. Conclusions: Predictable disease spread patterns along cranial nerves supplying the primary tumor sites were found in this study. Awareness of these patterns, as well as knowledge of the relevant cranial nerve anatomy, should be the basis for CTV definition and delineation for RT treatment planning.« less

  11. Patterns of Invasive Growth in Malignant Gliomas-The Hippocampus Emerges as an Invasion-Spared Brain Region.

    PubMed

    Mughal, Awais A; Zhang, Lili; Fayzullin, Artem; Server, Andres; Li, Yuping; Wu, Yingxi; Glass, Rainer; Meling, Torstein; Langmoen, Iver A; Leergaard, Trygve B; Vik-Mo, Einar O

    2018-05-21

    Widespread infiltration of tumor cells into surrounding brain parenchyma is a hallmark of malignant gliomas, but little data exist on the overall invasion pattern of tumor cells throughout the brain. We have studied the invasive phenotype of malignant gliomas in two invasive mouse models and patients. Tumor invasion patterns were characterized in a patient-derived xenograft mouse model using brain-wide histological analysis and magnetic resonance (MR) imaging. Findings were histologically validated in a cdkn2a-/- PDGF-β lentivirus-induced mouse glioblastoma model. Clinical verification of the results was obtained by analysis of MR images of malignant gliomas. Histological analysis using human-specific cellular markers revealed invasive tumors with a non-radial invasion pattern. Tumors cells accumulated in structures located far from the transplant site, such as the optic white matter and pons, whereas certain adjacent regions were spared. As such, the hippocampus was remarkably free of infiltrating tumor cells despite the extensive invasion of surrounding regions. Similarly, MR images of xenografted mouse brains displayed tumors with bihemispheric pathology, while the hippocampi appeared relatively normal. In patients, most malignant temporal lobe gliomas were located lateral to the collateral sulcus. Despite widespread pathological fluid-attenuated inversion recovery signal in the temporal lobe, 74% of the "lateral tumors" did not show signs of involvement of the amygdalo-hippocampal complex. Our data provide clear evidence for a compartmental pattern of invasive growth in malignant gliomas. The observed invasion patterns suggest the presence of preferred migratory paths, as well as intra-parenchymal boundaries that may be difficult for glioma cells to traverse supporting the notion of compartmental growth. In both mice and human patients, the hippocampus appears to be a brain region that is less prone to tumor invasion. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Immunohistochemistry of the uterine cervix of rats bearing the Walker 256 tumor treated with copaiba balsam.

    PubMed

    Botelho, Nara Macedo; Corrêa, Suelen Costa; Lobato, Rodolfo Costa; Teixeira, Renan Kleber Costa; Quaresma, Juarez Antônio Simões

    2013-03-01

    To investigate the immunohistochemistry of the uterine cervix of 20 Wistar rats (Rattus norvegicus) bearing the Walker 256 tumor, treated with copaiba oil (Copaifera officinalis). The animals were grouped into four subgroups, with five rats each: the GCT and GCopT received distilled water and topically copaiba, respectively, while the GCG and GCopG received distilled water and copaiba by gavage, respectively. The substances were administered for nine days. On the 12th day, after euthanasia, the tumor pieces were sent to the identification of T CD4+, T CD8+ and Natural Killer cells. It was found that the pattern of expression for specific markers of phenotypes of cells involved in tumor immune response was similar in all groups, regardless the administration way of copaiba oil (topical or gavage). Copaiba balsam, administered either topically or by gavage, did not alter the pattern of tumor immune response in rats bearing Walker 256 Tumor.

  13. Intravital multiphoton imaging reveals multicellular streaming as a crucial component of in vivo cell migration in human breast tumors

    PubMed Central

    Patsialou, Antonia; Bravo-Cordero, Jose Javier; Wang, Yarong; Entenberg, David; Liu, Huiping; Clarke, Michael; Condeelis, John S.

    2014-01-01

    Metastasis is the main cause of death in breast cancer patients. Cell migration is an essential component of almost every step of the metastatic cascade, especially the early step of invasion inside the primary tumor. In this report, we have used intravital multiphoton microscopy to visualize the different migration patterns of human breast tumor cells in live primary tumors. We used xenograft tumors of MDA-MB-231 cells as well as a low passage xenograft tumor from orthotopically injected patient-derived breast tumor cells. Direct visualization of human tumor cells in vivo shows two patterns of high-speed migration inside primary tumors: a. single cells and b. multicellular streams (i.e., cells following each other in a single file but without cohesive cell junctions). Critically, we found that only streaming and not random migration of single cells was significantly correlated with proximity to vessels, with intravasation and with numbers of elevated circulating tumor cells in the bloodstream. Finally, although the two human tumors were derived from diverse genetic backgrounds, we found that their migratory tumor cells exhibited coordinated gene expression changes that led to the same end-phenotype of enhanced migration involving activating actin polymerization and myosin contraction. Our data are the first direct visualization and assessment of in vivo migration within a live patient-derived breast xenograft tumor. PMID:25013744

  14. VDJ-Seq: Deep Sequencing Analysis of Rearranged Immunoglobulin Heavy Chain Gene to Reveal Clonal Evolution Patterns of B Cell Lymphoma.

    PubMed

    Jiang, Yanwen; Nie, Kui; Redmond, David; Melnick, Ari M; Tam, Wayne; Elemento, Olivier

    2015-12-28

    Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding the clonal composition changes that occur within a tumor in response to certain micro-environment or treatments may lead to the design of more sophisticated and effective approaches to eradicate tumor cells. However, tracking tumor clonal sub-populations has been challenging due to the lack of distinguishable markers. To address this problem, a VDJ-seq protocol was created to trace the clonal evolution patterns of diffuse large B cell lymphoma (DLBCL) relapse by exploiting VDJ recombination and somatic hypermutation (SHM), two unique features of B cell lymphomas. In this protocol, Next-Generation sequencing (NGS) libraries with indexing potential were constructed from amplified rearranged immunoglobulin heavy chain (IgH) VDJ region from pairs of primary diagnosis and relapse DLBCL samples. On average more than half million VDJ sequences per sample were obtained after sequencing, which contain both VDJ rearrangement and SHM information. In addition, customized bioinformatics pipelines were developed to fully utilize sequence information for the characterization of IgH-VDJ repertoire within these samples. Furthermore, the pipeline allows the reconstruction and comparison of the clonal architecture of individual tumors, which enables the examination of the clonal heterogeneity within the diagnosis tumors and deduction of clonal evolution patterns between diagnosis and relapse tumor pairs. When applying this analysis to several diagnosis-relapse pairs, we uncovered key evidence that multiple distinctive tumor evolutionary patterns could lead to DLBCL relapse. Additionally, this approach can be expanded into other clinical aspects, such as identification of minimal residual disease, monitoring relapse progress and treatment response, and investigation of immune repertoires in non-lymphoma contexts.

  15. Hidradenocarcinoma of the finger.

    PubMed

    Nazerali, Rahim S; Tan, Cynthia; Fung, Maxwell A; Chen, Steven L; Wong, Michael S

    2013-04-01

    Hidradenocarcinoma is a rare adnexal neoplasm representing the malignant counterpart of hidradenoma derived from eccrine sweat glands. Misdiagnosis of this disease is common due to the wide variety of histological patterns and rarity of this malignancy. We report an 87-year-old man presenting with a rare case of biopsy-proven hidradenocarcinoma of the finger. There is no standard care of treatment of hidradenocarcinoma, especially of those tumors in rare locations such as the fingers, given its rarity, variable tumor behavior and histology. Although limited treatment strategies exist, detailed data including TNM, location, histologic type and grade, and patient age should be gathered for optimal treatment strategy. The literature supports a 3-fold approach to these malignancies involving margin-free resection, sentinel lymph node biopsy to evaluate possible metastasis, and long-term follow-up given high risk of recurrence. Our treatment strategy involved a 4-fold, multidisciplinary approach involving reconstruction to optimize tumor-free remission and hand function.

  16. Small Bowel Gastrointestinal Stromal Tumors: Multidetector Computed Tomography Enhancement Pattern and Risk of Progression.

    PubMed

    Verde, Franco; Hruban, Ralph H; Fishman, Elliot K

    Small bowel gastrointestinal stromal tumors (SB-GISTs) are rare lesions with a variable appearance on computed tomography (CT). This case series analyzes the CT enhancement pattern with the histologic risk assessment of tumor progression. Local institutional pathology database was searched for SB-GISTs from 2000 to 2015. Pathology reports and clinical notes were reviewed. Imaging was qualitatively reviewed for pattern of enhancement categorized into homogeneous or heterogeneous groups. Nonparametric statistical analysis was performed comparing enhancement to segment of bowel involved, presence of necrosis, tumor size, histologic grade (ie, G1 or G2), and histologic risk of progression (ie low, moderate, high). For simplicity, risk of progression was binned into low-risk or non-low-risk groups. Twenty-six pathology-proven, first presentation, nonmetastatic SB-GISTs were included into study. Seventeen were located in duodenum, 7 in jejunum, and 2 within the ileum. Dual phase (arterial and venous) CT imaging was available for 22 cases. Four cases did not have dual phase (three venous phase and one arterial phase only). Seventeen cases demonstrated heterogeneous enhancement and 9 cases homogeneous enhancement. Statistically significant difference was found between size versus enhancement groups (3.1 cm for homogeneous versus 6.8 cm for heterogeneous) (Mann-Whitney U test, n = 26, P = 0.002). Presence of necrosis versus enhancement group was statistically significant (Pearson χ, P = 0.001). Low-risk and non-low-risk groups versus enhancement groups was very significant (P = 0.001). Bowel segment involvement and histologic grading versus enhancement group did not reach statistical significance (P = 0.174 and P = 0.07, respectively). This case series reveals an important significant association between heterogeneous enhancement and non-low risk (ie, moderate/high) SB-GISTs. Beyond just describing the tumor, using enhancing pattern, the interpreting radiologist can preoperatively suggest additional prognostic information, potentially helpful for surgical planning.

  17. Evaluating Cancer of the Central Nervous System Through Next-Generation Sequencing of Cerebrospinal Fluid

    PubMed Central

    Pentsova, Elena I.; Shah, Ronak H.; Tang, Jiabin; Boire, Adrienne; You, Daoqi; Briggs, Samuel; Omuro, Antonio; Lin, Xuling; Fleisher, Martin; Grommes, Christian; Panageas, Katherine S.; Meng, Fanli; Selcuklu, S. Duygu; Ogilvie, Shahiba; Distefano, Natalie; Shagabayeva, Larisa; Rosenblum, Marc; DeAngelis, Lisa M.; Viale, Agnes; Berger, Michael F.

    2016-01-01

    Purpose Cancer spread to the central nervous system (CNS) often is diagnosed late and is unresponsive to therapy. Mechanisms of tumor dissemination and evolution within the CNS are largely unknown because of limited access to tumor tissue. Materials and Methods We sequenced 341 cancer-associated genes in cell-free DNA from cerebrospinal fluid (CSF) obtained through routine lumbar puncture in 53 patients with suspected or known CNS involvement by cancer. Results We detected high-confidence somatic alterations in 63% (20 of 32) of patients with CNS metastases of solid tumors, 50% (six of 12) of patients with primary brain tumors, and 0% (zero of nine) of patients without CNS involvement by cancer. Several patients with tumor progression in the CNS during therapy with inhibitors of oncogenic kinases harbored mutations in the kinase target or kinase bypass pathways. In patients with glioma, the most common malignant primary brain tumor in adults, examination of cell-free DNA uncovered patterns of tumor evolution, including temozolomide-associated mutations. Conclusion The study shows that CSF harbors clinically relevant genomic alterations in patients with CNS cancers and should be considered for liquid biopsies to monitor tumor evolution in the CNS. PMID:27161972

  18. Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma.

    PubMed

    Ambrosio, Maria R; Rocca, Bruno J; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T; Tripodi, Sergio A; Tosi, Piero

    2015-01-01

    Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis.

  19. Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma

    PubMed Central

    Ambrosio, Maria R.; Rocca, Bruno J.; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T.; Tripodi, Sergio A.; Tosi, Piero

    2015-01-01

    Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis. PMID:26425551

  20. Clinical patterns and outcome in epithelioid hemangioendothelioma with or without pulmonary involvement: insights from an internet registry in the study of a rare cancer.

    PubMed

    Lau, Kenneth; Massad, Malek; Pollak, Cynthia; Rubin, Charles; Yeh, Joannie; Wang, Jing; Edelman, Guy; Yeh, Jenny; Prasad, Sunil; Weinberg, Guy

    2011-11-01

    Epithelioid hemangioendothelioma (EHE) is a rare vascular neoplasm of endothelial origin with clinical behavior intermediate between hemangioma and angiosarcoma. The natural history of EHE is highly variable. This study uses an Internet registry to identify clinical patterns with prognostic significance in EHE. Cases from the International Hemangioendothioma, Epithelioid Hemangioendothelioma, and Related Vascular Disorders (HEARD) Support Group were evaluated based on demographics, organ involvement, disease progression, presence or absence of pleural effusion, and treatment. Survival among various cohorts was compared using log-rank analysis of Kaplan-Meier plots. Two hundred sixty-four patients were identified from April 2004 to November 2009. Fifty-eight cases were excluded because of inadequate information or wrong diagnosis. EHE was more common in female patients (61%). Male gender and age ≥ 55 years were associated with decreased survival. The most commonly affected organs were liver, lung, and bone. No specific organ or combination of organ involvement differentially affected survival, and survival was no different between patients with multiple vs single organ involvement. However, pattern B, defined as lesions without distinct borders (eg, pulmonary infiltrates, pleural effusion, ascites), hemoptysis, or involvement of more than two bones adversely affected survival in all cohorts. A novel staging system with prognostic value for EHE is proposed. Pleural effusion or other signs of uncontained tumor growth, hemoptysis, and osseous involvement of more than two bones implied worse survival than did localized and discrete tumors, regardless of number of organs involved. A lay registry can provide useful insights into the clinical behavior of a rare cancer.

  1. Patterns of Primary Tumor Invasion and Regional Lymph Node Spread Based on Magnetic Resonance Imaging in Early-Stage Nasal NK/T-cell Lymphoma: Implications for Clinical Target Volume Definition and Prognostic Significance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Run-Ye; Liu, Kang; Wang, Wei-Hu

    Purpose: This study aimed to determine the pathways of primary tumor invasion (PTI) and regional lymph node (LN) spread based on magnetic resonance imaging (MRI) in early-stage nasal NK/T-cell lymphoma (NKTCL), to improve clinical target volume (CTV) delineation and evaluate the prognostic value of locoregional extension patterns. Methods and Materials: A total of 105 patients with newly diagnosed early-stage nasal NKTCL who underwent pretreatment MRI were retrospectively reviewed. All patients received radiation therapy with or without chemotherapy. Results: The incidences of PTI and regional LN involvement were 64.7% and 25.7%, respectively. Based on the incidence of PTI, involved sites surroundingmore » the nasal cavity were classified into 3 risk subgroups: high-risk (>20%), intermediate-risk (5%-20%), and low-risk (<5%). The most frequently involved site was the nasopharynx (35.2%), followed by the maxillary (21.9%) and ethmoid (21.9%) sinuses. Local disease and regional LN spread followed an orderly pattern without LN skipping. The retropharyngeal nodes (RPNs) were most frequently involved (19.0%), followed by level II (11.4%). The 5-year overall survival (OS), progression-free survival (PFS), and locoregional control (LRC) rates for all patients were 72.8%, 65.2%, and 90.0%, respectively. The presence of PTI and regional LN involvement based on MRI significantly and negatively affected PFS and OS. Conclusions: Early-stage nasal NKTCL presents with a high incidence of PTI but a relatively low incidence of regional LN spread. Locoregional spread followed an orderly pattern, and PTI and regional LN spread are powerful prognostic factors for poorer survival outcomes. CTV reduction may be feasible for selected patients.« less

  2. Intra-abdominal primary monophasic synovial sarcoma with hemangiopericytoma-like areas.

    PubMed

    Rao, Lakshmi; Jaiprakash, Padmapriya; Palankar, Nagaraj; Gowda, Vinay

    2013-01-01

    We report a case of retroperitoneal intra-abdominal primary monophasic synovial sarcoma (SS) with hemangiopericytomatous (HPC) pattern in a 25-year-old male arising from the triangular ligament on the superior surface of liver encasing the inferior vena cava (IVC) and masquerading as a hepatic tumor. A large heterogeneously enhancing, well defined, lobulated, exophytic lesion was seen involving segment VIII of the liver with foci of calcification in the periphery. A biopsy, followed by total resection of the tumor, showed a spindle cell sarcoma with HPC pattern, which was consistent with monophasic SS on histology and immunohistochemistry. The unusual clinical presentation, radiology, pathology, and differential diagnosis will be discussed in detail.

  3. Heparan sulfate proteoglycans undergo differential expression alterations in right sided colorectal cancer, depending on their metastatic character.

    PubMed

    Fernández-Vega, Iván; García-Suárez, Olivia; García, Beatriz; Crespo, Ainara; Astudillo, Aurora; Quirós, Luis M

    2015-10-20

    Heparan sulfate proteoglycans (HSPGs) are complex molecules involved in the growth, invasion and metastatic properties of cancerous cells. This study analyses the alterations in the expression patterns of these molecules in right sided colorectal cancer (CRC), both metastatic and non-metastatic. Twenty right sided CRCs were studied. A transcriptomic approach was used, employing qPCR to analyze both the expression of the enzymes involved in heparan sulfate (HS) chains biosynthesis, as well as the proteoglycan core proteins. Since some of these proteoglycans can also carry chondroitin sulfate (CS) chains, we include the study of the genes involved in the biosynthesis of these glycosaminoglycans. Immunohistochemical techniques were also used to analyze tissue expression of particular genes showing significant expression differences, of potential interest. Changes in proteoglycan core proteins differ depending on their location; those located intracellularly or in the extracellular matrix show very similar alteration patterns, while those located on the cell surface vary greatly depending on the nature of the tumor: glypicans 1, 3, 6 and betaglycan are affected in the non-metastatic tumors, whereas in the metastatic, only glypican-1 and syndecan-1 are modified, the latter showing opposing alterations in levels of RNA and of protein, suggesting post-transcriptional regulation in these tumors. Furthermore, in non-metastatic tumors, polymerization of glycosaminoglycan chains is modified, particularly affecting the synthesis of the tetrasaccharide linker and the initiation and elongation of CS chains, HS chains being less affected. Regarding the enzymes responsible for the modificaton of the HS chains, alterations were only found in non-metastatic tumors, affecting N-sulfation and the isoforms HS6ST1, HS3ST3B and HS3ST5. In contrast, synthesis of the CS chains suggests changes in epimerization and sulfation of the C4 and C2 in both types of tumor. Right sided CRCs show alterations in the expression of HSPGs, including the expression of the cell surface core proteins, many glycosiltransferases and some enzymes that modify the HS chains depending on the metastatic nature of the tumor, resulting more affected in non-metastatic ones. However, matrix proteoglycans and enzymes involved in CS fine structure synthesis are extensively modified independetly of the presence of lymph node metastasis.

  4. Fractal analysis of the susceptibility weighted imaging patterns in malignant brain tumors during antiangiogenic treatment: technical report on four cases serially imaged by 7 T magnetic resonance during a period of four weeks.

    PubMed

    Di Ieva, Antonio; Matula, Christian; Grizzi, Fabio; Grabner, Günther; Trattnig, Siegfried; Tschabitscher, Manfred

    2012-01-01

    The need for new and objective indexes for the neuroradiologic follow-up of brain tumors and for monitoring the effects of antiangiogenic strategies in vivo led us to perform a technical study on four patients who received computerized analysis of tumor-associated vasculature with ultra-high-field (7 T) magnetic resonance imaging (MRI). The image analysis involved the application of susceptibility weighted imaging (SWI) to evaluate vascular structures. Four patients affected by recurrent malignant brain tumors were enrolled in the present study. After the first 7-T SWI MRI procedure, the patients underwent antiangiogenic treatment with bevacizumab. The imaging was repeated every 2 weeks for a period of 4 weeks. The SWI patterns visualized in the three MRI temporal sequences were analyzed by means of a computer-aided fractal-based method to objectively quantify their geometric complexity. In two clinically deteriorating patients we found an increase of the geometric complexity of the space-filling properties of the SWI patterns over time despite the antiangiogenic treatment. In one patient, who showed improvement with the therapy, the fractal dimension of the intratumoral structure decreased, whereas in the fourth patient, no differences were found. The qualitative changes of the intratumoral SWI patterns during a period of 4 weeks were quantified with the fractal dimension. Because SWI patterns are also related to the presence of vascular structures, the quantification of their space-filling properties with fractal dimension seemed to be a valid tool for the in vivo neuroradiologic follow-up of brain tumors. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Hilar cholangiocarcinoma: Cross sectional evaluation of disease spectrum

    PubMed Central

    Mahajan, Mangal S; Moorthy, Srikanth; Karumathil, Sreekumar P; Rajeshkannan, R; Pothera, Ramchandran

    2015-01-01

    Although hilar cholangiocarcinoma is relatively rare, it can be diagnosed on imaging by identifying its typical pattern. In most cases, the tumor appears to be centered on the right or left hepatic duct with involvement of the ipsilateral portal vein, atrophy of hepatic lobe on that side, and invasion of adjacent liver parenchyma. Multi-detector computed tomography (MDCT) and magnetic resonance cholangiopancreatography (MRCP) are commonly used imaging modalities to assess the longitudinal and horizontal spread of tumor. PMID:25969643

  6. The role of Fas ligand and transforming growth factor beta in tumor progression: molecular mechanisms of immune privilege via Fas-mediated apoptosis and potential targets for cancer therapy.

    PubMed

    Kim, Ryungsa; Emi, Manabu; Tanabe, Kazuaki; Uchida, Yoko; Toge, Tetsuya

    2004-06-01

    Despite the fact that expression of Fas ligand (FasL) in cytotoxic T lymphocytes (CTLs) and in natural killer (NK) cells plays an important role in Fas-mediated tumor killing, During tumor progression FasL-expressing tumor cells are involved in counterattacking to kill tumor-infiltrating lymphocytes (TILs). Soluble FasL levels also increase with tumor progression in solid tumors, and this increase inhibits Fas-mediated tumor killing by CTLs and NK cells. The increased expression of FasL in tumor cells is associated with decreased expression of Fas; and the promoter region of the FASL gene is regulated by transcription factors, such as neuronal factor kappaB (NF-kappaB) and AP-1, in the tumor microenvironment. Although the ratio of FasL expression to Fas expression in tumor cells is not strongly related to the induction of apoptosis in TILs, increased expression of FasL is associated with decreased Fas levels in tumor cells that can escape immune surveillance and facilitate tumor progression and metastasis. Transforming growth factor beta (TGF-beta) is a potent growth inhibitor and has tumor-suppressing activity in the early phases of carcinogenesis. During subsequent tumor progression, the increased secretion of TGF-beta by both tumor cells and, in a paracrine fashion, stromal cells, is involved in the enhancement of tumor invasion and metastasis accompanied by immunosuppression. Herein, the authors review the clinical significance of FasL and TGF-beta expression patterns as features of immune privilege accompanying tumor progression in the tumor microenvironment. Potential strategies for identifying which molecules can serve as targets for effective antitumor therapy also are discussed. Copyright 2004 American Cancer Society.

  7. Expression of CXCR7 chemokine receptor in human meningioma cells and in intratumoral microvasculature.

    PubMed

    Würth, Roberto; Barbieri, Federica; Bajetto, Adriana; Pattarozzi, Alessandra; Gatti, Monica; Porcile, Carola; Zona, Gianluigi; Ravetti, Jean-Louis; Spaziante, Renato; Florio, Tullio

    2011-05-01

    CXCR4 and CXCR7 chemokine receptors, and their ligands CXCL11 and CXCL12, have been often involved in tumor cell proliferation and survival. We report the expression pattern of these ligand/receptor pairs in 22 human meningiomas. High CXCR7 and CXCL12 expression was associated with high-proliferative tumors. CXCR7 levels were correlated to the content of both ligands, suggesting a possible autocrine regulation. CXCR4 and CXCL12 were homogeneously expressed within tumor cells, while CXCR7 was mainly detected in tumor endothelial cells and CXCL11 in pericytes. Our results highlight the preferential CXCR7 and CXCL12 expression within more aggressive tumors and the possible role of CXCR7 in meningioma vascularization. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Dissociation of sensitivities to tumor promotion and progression in outbred and inbred SENCAR mice.

    PubMed

    Gimenez-Conti, I B; Bianchi, A B; Fischer, S M; Reiners, J J; Conti, C J; Slaga, T J

    1992-06-15

    The sensitivity of outbred SENCAR mice and inbred SENCAR (SSIN) mice to multistage carcinogenesis was studied. Tumors were induced using either 7,12-dimethylbenz[a]anthracene or N-methyl-N'-nitro-N-nitrosoguanidine as initiators and 12-O-tetradecanoylphorbol-13-acetate or benzoyl peroxide as promoting agents. Although the number of papillomas per mouse was higher in SSIN than in outbred SENCAR mice, the number of carcinomas observed in the SSIN strain was significantly lower regardless of the initiator or promoter used. It was also observed that the expression of markers of premalignant progression (i.e., dysplasia, expression of keratin K13, and loss of keratin K1 expression) was markedly suppressed in SSIN papillomas. After 50 wk of promotion with 12-O-tetradecanoylphorbol-13-acetate, the pattern of expression of K13 and K1 in SSIN mice was comparable to the pattern observed in outbred SENCAR mice after 10 to 20 wk of promotion with 12-O-tetradecanoylphorbol-13-acetate. It was also observed that 67% of the tumors induced in SSIN mice by initiation with 7,12-dimethylbenz[a]anthracene exhibited a mutation in codon 61 of the Ha-ras-1 gene. This latter finding suggests that the differences observed in tumor progression between the inbred strain and the outbred stock are not related to a genetic alteration in the Ha-ras-1 gene but rather to an independent event that we have postulated to involve a putative suppressor gene. The data reported here suggest that the putative gene(s) that confers susceptibility to tumor promotion was segregated from the gene(s) involved in tumor progression during selection and inbreeding of the SENCAR mouse stock.

  9. Differentiation of EL4 lymphoma cells by tumoral environment is associated with inappropriate expression of the large chondroitin sulfate proteoglycan PG-M and the tumor-associated antigen HTgp-175.

    PubMed

    Rottiers, P; Verfaillie, T; Contreras, R; Revets, H; Desmedt, M; Dooms, H; Fiers, W; Grooten, J

    1998-11-09

    Progression to malignancy of transformed cells involves complex genetic alterations and aberrant gene expression patterns. While aberrant gene expression is often caused by alterations in individual genes, the contribution of the tumoral environment to the triggering of this gene expression is less well established. The stable but heterogeneous expression in cultured EL4/13 cells of a novel tumor-associated antigen, designated as HTgp-175, was chosen for the investigation of gene expression during tumor formation. Homogeneously HTgp-175-negative EL4/13 cells, isolated by cell sorting or obtained by subcloning, acquired HTgp-175 expression as a result of tumor formation. The tumorigenicity of HTgp-175-negative vs. HTgp-175-positive EL4 variants was identical, indicating that induction but not selection accounted for the phenotypic switch from HTgp-175-negative to HTgp-175-positive. Although mutagenesis experiments showed that the protein was not essential for tumor establishment, tumor-derived cells showed increased malignancy, linking HTgp-175 expression with genetic changes accompanying tumor progression. This novel gene expression was not an isolated event, since it was accompanied by ectopic expression of the large chondroitin sulfate proteoglycan PG-M and of normal differentiation antigens. We conclude that signals derived from the tumoral microenvironment contribute significantly to the aberrant gene expression pattern of malignant cells, apparently by fortuitous activation of differentiation processes and cause expression of novel differentiation antigens as well as of inappropriate tumor-associated and ectopic antigens.

  10. The multislice CT findings of renal carcinoma associated with XP11.2 translocation/TFE gene fusion and collecting duct carcinoma.

    PubMed

    Zhu, Qing-Qiang; Wang, Zhong-Qiu; Zhu, Wen-Rong; Chen, Wen-Xin; Wu, Jing-Tao

    2013-04-01

    Renal cell carcinoma associated with Xp11.2 translocation and TFE gene fusion (Xp11.2/TFE RCC), and collecting duct carcinoma (CDC) are uncommon subtypes of renal cell carcinomas. To investigate the multislice CT (MSCT) characteristics of these two tumor types. Nine patients with Xp11.2/TFE RCC and 10 patients with CDC were studied retrospectively. MSCT was undertaken to investigate differences in tumor characteristics and enhancement patterns. All patients had single tumors centered in the renal medulla. Two patients with each tumor type had lymph node involvement and there was a single case of hepatic metastasis (Xp11.2/TFE RCC). The mean tumor diameter of Xp11.2/TFE RCC tumors was significantly larger than for CDC tumors. Two patients with Xp11.2/TFE RCC had cystic components as did eight patients with CDC (P < 0.05). Calcifications were present in six patients, each with CDC. Clear tumor boundaries were visible in two patients with CDC and in nine with Xp11.2/TFE RCC (P < 0.05). The density of Xp11.2/TFE RCC tumors was greater than that of CDC tumors, normal renal cortex, or medulla on unenhanced CT. Enhancement was higher with Xp11.2/TFE RCC than with CDC tumors during all phases. Xp11.2/TFE RCC enhancement was higher than in the renal medulla during cortical and medullary phase but lower than in normal renal medulla during the delayed phase. CDC tumor enhancement was lower than that for normal renal medulla during all enhanced phases. Both tumor types originated from the renal medulla. Distinguishing features included density on unenhanced CT, enhancement patterns, and capsule signs. Identifying these differences may aid diagnosis.

  11. Insights into the Pathogenesis of Anaplastic Large-Cell Lymphoma through Genome-wide DNA Methylation Profiling.

    PubMed

    Hassler, Melanie R; Pulverer, Walter; Lakshminarasimhan, Ranjani; Redl, Elisa; Hacker, Julia; Garland, Gavin D; Merkel, Olaf; Schiefer, Ana-Iris; Simonitsch-Klupp, Ingrid; Kenner, Lukas; Weisenberger, Daniel J; Weinhaeusel, Andreas; Turner, Suzanne D; Egger, Gerda

    2016-10-04

    Aberrant DNA methylation patterns in malignant cells allow insight into tumor evolution and development and can be used for disease classification. Here, we describe the genome-wide DNA methylation signatures of NPM-ALK-positive (ALK+) and NPM-ALK-negative (ALK-) anaplastic large-cell lymphoma (ALCL). We find that ALK+ and ALK- ALCL share common DNA methylation changes for genes involved in T cell differentiation and immune response, including TCR and CTLA-4, without an ALK-specific impact on tumor DNA methylation in gene promoters. Furthermore, we uncover a close relationship between global ALCL DNA methylation patterns and those in distinct thymic developmental stages and observe tumor-specific DNA hypomethylation in regulatory regions that are enriched for conserved transcription factor binding motifs such as AP1. Our results indicate similarity between ALCL tumor cells and thymic T cell subsets and a direct relationship between ALCL oncogenic signaling and DNA methylation through transcription factor induction and occupancy. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Mammary Analog Secretory Carcinoma (MASC) Involving the Thyroid Gland: A Report of the First 3 Cases.

    PubMed

    Dettloff, Jennifer; Seethala, Raja R; Stevens, Todd M; Brandwein-Gensler, Margaret; Centeno, Barbara A; Otto, Kristen; Bridge, Julia A; Bishop, Justin A; Leon, Marino E

    2017-06-01

    Salivary gland-type tumors have been rarely described in the thyroid gland. Mammary Analog Secretory Carcinoma (MASC) is a recently defined type of salivary gland carcinoma characterized by a t(12;15)(p13;q25) resulting in an ETV6-NTRK3 fusion gene. We report 3 cases of MASC involving the thyroid gland without clinical evidence of a salivary gland or breast primary; the clinico-pathologic characteristics are reviewed. Assessment for rearrangement of the ETV6 (12p13) locus was conducted by fluorescence in situ hybridization (FISH) on representative FFPE sections using an ETV6 break apart probe (Abbott Molecular, Des Plaines, IL, USA). The patients were two females (52 and 55 years-old) and 1 male (74 years-old). The tumors were poorly circumscribed solid white tan nodules involving the thyroid. Histologically, they were invasive and showed solid, microcystic, cribriform, and tubular growth patterns composed of variably bland polygonal eosinophilic cells with vesicular nuclear chromatin and conspicuous nucleoli. All three cases showed metastasis to lymph nodes; one case showed lateral neck involvement. The tumor cells were positive for S100 and mammaglobin. GATA-3 and PAX-8 were positive in 2 cases, one of which only focally so. All three cases were negative for TTF-1 and thyroglobulin. Rearrangement of the ETV6 locus was confirmed in all cases and a diagnosis of MASC rendered for each case. A site of origin distinct from the thyroid gland was not identified, with a median follow up of 24 months. MASC may rarely involve the thyroid gland. The origin of these lesions is unknown; while an origin from ectopic salivary gland-type cells is entertained, a metastatic origin from an occult primary cannot be definitively excluded at this time. Given the histologic (follicular-like microcystic pattern with colloid-like secretions and papillary pattern), immunophenotypic (PAX-8), and even molecular overlap, MASC can be mistaken for papillary thyroid carcinoma and should be considered in the differential diagnosis of a thyroid mass.

  13. Reliability of Task-Based fMRI for Preoperative Planning: A Test-Retest Study in Brain Tumor Patients and Healthy Controls

    PubMed Central

    Morrison, Melanie A.; Churchill, Nathan W.; Cusimano, Michael D.; Schweizer, Tom A.; Das, Sunit; Graham, Simon J.

    2016-01-01

    Background Functional magnetic resonance imaging (fMRI) continues to develop as a clinical tool for patients with brain cancer, offering data that may directly influence surgical decisions. Unfortunately, routine integration of preoperative fMRI has been limited by concerns about reliability. Many pertinent studies have been undertaken involving healthy controls, but work involving brain tumor patients has been limited. To develop fMRI fully as a clinical tool, it will be critical to examine these reliability issues among patients with brain tumors. The present work is the first to extensively characterize differences in activation map quality between brain tumor patients and healthy controls, including the effects of tumor grade and the chosen behavioral testing paradigm on reliability outcomes. Method Test-retest data were collected for a group of low-grade (n = 6) and high-grade glioma (n = 6) patients, and for matched healthy controls (n = 12), who performed motor and language tasks during a single fMRI session. Reliability was characterized by the spatial overlap and displacement of brain activity clusters, BOLD signal stability, and the laterality index. Significance testing was performed to assess differences in reliability between the patients and controls, and low-grade and high-grade patients; as well as between different fMRI testing paradigms. Results There were few significant differences in fMRI reliability measures between patients and controls. Reliability was significantly lower when comparing high-grade tumor patients to controls, or to low-grade tumor patients. The motor task produced more reliable activation patterns than the language tasks, as did the rhyming task in comparison to the phonemic fluency task. Conclusion In low-grade glioma patients, fMRI data are as reliable as healthy control subjects. For high-grade glioma patients, further investigation is required to determine the underlying causes of reduced reliability. To maximize reliability outcomes, testing paradigms should be carefully selected to generate robust activation patterns. PMID:26894279

  14. The genomic heritage of lymph node metastases: implications for clinical management of patients with breast cancer.

    PubMed

    Becker, Tyson E; Ellsworth, Rachel E; Deyarmin, Brenda; Patney, Heather L; Jordan, Rick M; Hooke, Jeffrey A; Shriver, Craig D; Ellsworth, Darrell L

    2008-04-01

    Metastatic breast cancer is an aggressive disease associated with recurrence and decreased survival. To improve outcomes and develop more effective treatment strategies for patients with breast cancer, it is important to understand the molecular mechanisms underlying metastasis. We used allelic imbalance (AI) to determine the molecular heritage of primary breast tumors and corresponding metastases to the axillary lymph nodes. Paraffin-embedded samples from primary breast tumors and matched metastases (n = 146) were collected from 26 patients with node-positive breast cancer involving multiple axillary nodes. Hierarchical clustering was used to assess overall differences in the patterns of AI, and phylogenetic analysis inferred the molecular heritage of axillary lymph node metastases. Overall frequencies of AI were significantly higher (P < 0.01) in primary breast tumors (23%) than in lymph node metastases (15%), and there was a high degree of discordance in patterns of AI between primary breast carcinomas and the metastases. Metastatic tumors in the axillary nodes showed different patterns of chromosomal changes, suggesting that multiple molecular mechanisms may govern the process of metastasis in individual patients. Some metastases progressed with few genomic alterations, while others harbored many chromosomal alterations present in the primary tumor. The extent of genomic heterogeneity in axillary lymph node metastases differs markedly among individual patients. Genomic diversity may be associated with response to adjuvant therapy, recurrence, and survival, and thus may be important in improving clinical management of breast cancer patients.

  15. Characterization of increasing stages of invasiveness identifies stromal/cancer cell crosstalk in rat models of mesothelioma

    PubMed Central

    Nader, Joëlle S.; Abadie, Jérôme; Deshayes, Sophie; Boissard, Alice; Blandin, Stéphanie; Blanquart, Christophe; Boisgerault, Nicolas; Coqueret, Olivier; Guette, Catherine; Grégoire, Marc; Pouliquen, Daniel L.

    2018-01-01

    Sarcomatoid mesothelioma (SM) is a devastating cancer associated with one of the poorest outcome. Therefore, representative preclinical models reproducing different tumor microenvironments (TME) observed in patients would open up new prospects for the identification of markers and evaluation of innovative therapies. Histological analyses of four original models of rat SM revealed their increasing infiltrative and metastatic potential were associated with differences in Ki67 index, blood-vessel density, and T-lymphocyte and macrophage infiltration. In comparison with the noninvasive tumor M5-T2, proteomic analysis demonstrated the three invasive tumors F4-T2, F5-T1 and M5-T1 shared in common a very significant increase in the abundance of the multifunctional proteins galectin-3, prohibitin and annexin A5, and a decrease in proteins involved in cell adhesion, tumor suppression, or epithelial differentiation. The increased metastatic potential of the F5-T1 tumor, relative to F4-T2, was associated with an increased macrophage vs T-cell infiltrate, changes in the levels of expression of a panel of cytokine genes, an increased content of proteins involved in chromatin organization, ribosome structure, splicing, or presenting anti-adhesive properties, and a decreased content of proteins involved in protection against oxidative stress, normoxia and intracellular trafficking. The most invasive tumor, M5-T1, was characterized by a pattern of specific phenotypic and molecular features affecting the presentation of MHC class I-mediated antigens and immune cell infiltration, or involved in the reorganization of the cytoskeleton and composition of the extracellular matrix. These four preclinical models and data represent a new resource available to the cancer research community to catalyze further investigations on invasiveness. PMID:29662647

  16. Human uterus myoma and gene expression profiling: A novel in vitro model for studying secretory leukocyte protease inhibitor-mediated tumor invasion.

    PubMed

    Mikami, Yoshikazu; Fukushima, Atsushi; Komiyama, Yusuke; Iwase, Takashi; Tsuda, Hiromasa; Higuchi, Yasuhiko; Hayakawa, Satoshi; Kuyama, Kayo; Komiyama, Kazuo

    2016-08-28

    Secretory leukocyte protease inhibitor (SLPI) is a serine protease inhibitor that diminishes tissue destruction during inflammation. A recent report revealed high levels of SLPI expression in the oral carcinoma cell. In addition, overexpression of SLPI up-regulates metastasis in lung carcinoma cells. On the other hand, matrix metalloproteinases (MMPs) are proteinases that participate in extracellular matrix degradation. SLPI and MMPs are involved as accelerators of the tumor invasion process; however, their exact roles are not fully understood. Understanding the mechanism of tumor invasion requires models that take the effect of microenvironmental factors into account. In one such in vitro model, different carcinoma cells have been shown to invade myoma tissue in highly distinct patterns. We have used this myoma model, as it provides a more natural stroma-like environment, to investigate the role of SLPI in tumor invasion. Our results indicate that the model provides a relevant matrix for tumor invasion studies, and that SLPI is important for the invasion of oral carcinoma Ca9-22 cells in conjunction with MMPs. Furthermore, using bioinformatics analysis, we have identified candidates as key molecules involved in SLPI-mediated tumor invasion. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Somatic Mutation Patterns in Hemizygous Genomic Regions Unveil Purifying Selection during Tumor Evolution

    PubMed Central

    Basu, Swaraj; Larsson, Erik

    2016-01-01

    Identification of cancer driver genes using somatic mutation patterns indicative of positive selection has become a major goal in cancer genomics. However, cancer cells additionally depend on a large number of genes involved in basic cellular processes. While such genes should in theory be subject to strong purifying (negative) selection against damaging somatic mutations, these patterns have been elusive and purifying selection remains inadequately explored in cancer. Here, we hypothesized that purifying selection should be evident in hemizygous genomic regions, where damaging mutations cannot be compensated for by healthy alleles. Using a 7,781-sample pan-cancer dataset, we first confirmed this in POLR2A, an essential gene where hemizygous deletions are known to confer elevated sensitivity to pharmacological suppression. We next used this principle to identify several genes and pathways that show patterns indicative of purifying selection to avoid deleterious mutations. These include the POLR2A interacting protein INTS10 as well as genes involved in mRNA splicing, nonsense-mediated mRNA decay and other RNA processing pathways. Many of these genes belong to large protein complexes, and strong overlaps were observed with recent functional screens for gene essentiality in human cells. Our analysis supports that purifying selection acts to preserve the remaining function of many hemizygously deleted essential genes in tumors, indicating vulnerabilities that might be exploited by future therapeutic strategies. PMID:28027311

  18. The Involvement of Danger-Associated Molecular Patterns in the Development of Immunoparalysis in Cardiac Arrest Patients.

    PubMed

    Timmermans, Kim; Kox, Matthijs; Gerretsen, Jelle; Peters, Esther; Scheffer, Gert Jan; van der Hoeven, Johannes G; Pickkers, Peter; Hoedemaekers, Cornelia W

    2015-11-01

    After cardiac arrest, patients are highly vulnerable toward infections, possibly due to a suppressed state of the immune system called "immunoparalysis." We investigated if immunoparalysis develops following cardiac arrest and whether the release of danger-associated molecular patterns could be involved. Observational study. ICU of a university medical center. Fourteen post-cardiac arrest patients treated with mild therapeutic hypothermia for 24 hours and 11 control subjects. Plasma cytokines showed highest levels within 24 hours after cardiac arrest and decreased during the next 2 days. By contrast, ex vivo production of cytokines interleukin-6, tumor necrosis factor-α, and interleukin-10 by lipopolysaccharide-stimulated leukocytes was severely impaired compared with control subjects, with most profound effects observed at day 0, and only partially recovering afterward. Compared with incubation at 37°C, incubation at 32°C resulted in higher interleukin-6 and lower interleukin-10 production by lipopolysaccharide-stimulated leukocytes of control subjects, but not of patients. Plasma nuclear DNA, used as a marker for general danger-associated molecular pattern release, and the specific danger-associated molecular patterns (EN-RAGE and heat shock protein 70) were substantially higher in patients at days 0 and 1 compared with control subjects. Furthermore, plasma heat shock protein 70 levels were negatively correlated with ex vivo production of inflammatory mediators interleukin-6, tumor necrosis factor-α, and interleukin-10. Extracellular newly identified receptor for advanced glycation end products-binding protein levels only showed a significant negative correlation with ex vivo production of interleukin-6 and tumor necrosis factor-α and a borderline significant inverse correlation with interleukin-10. No significant correlations were observed between plasma nuclear DNA levels and ex vivo cytokine production. None. Release of danger-associated molecular patterns during the first days after cardiac arrest is associated with the development of immunoparalysis. This could explain the increased susceptibility toward infections in cardiac arrest patients.

  19. Interaction of tumor and host cells with adhesion and extracellular matrix molecules in the development of multiple myeloma.

    PubMed

    Teoh, G; Anderson, K C

    1997-02-01

    Adhesion molecules play an important role in the growth regulation and migration of multiple myeloma (MM) cells. They mediate homing of MM cells to the bone marrow and MM cell to bone marrow stromal cell adhesion, with resultant interleukin-6 related autocrine and paracine growth and antiapoptotic affects. Their pattern of expression on tumor cells correlates with the development of plasma cell leukemia or extramedullary disease. Clinically, expression of adhesion molecules on tumor cells or in the serum has already shown prognostic utility. Finally, since adhesion molecules are involved at multiple steps in the pathogenesis of MM, therapeutic studies may target these molecules.

  20. Msx and dlx homeogene expression in epithelial odontogenic tumors.

    PubMed

    Ruhin-Poncet, Blandine; Ghoul-Mazgar, Sonia; Hotton, Dominique; Capron, Frédérique; Jaafoura, Mohamed Habib; Goubin, Gérard; Berdal, Ariane

    2009-01-01

    Epithelial odontogenic tumors are rare jaw pathologies that raise clinical diagnosis and prognosis dilemmas notably between ameloblastomas and clear cell odontogenic carcinomas (CCOCs). In line with previous studies, the molecular determinants of tooth development-amelogenin, Msx1, Msx2, Dlx2, Dlx3, Bmp2, and Bmp4-were analyzed by RT-PCR, ISH, and immunolabeling in 12 recurrent ameloblastomas and in one case of CCOC. Although Msx1 expression imitates normal cell differentiation in these tumors, other genes showed a distinct pattern depending on the type of tumor and the tissue involved. In benign ameloblastomas, ISH localized Dlx3 transcripts and inconstantly detected Msx2 transcripts in epithelial cells. In the CCOC, ISH established a lack of both Dlx3 and Msx2 transcripts but allowed identification of the antisense transcript of Msx1, which imitates the same scheme of distribution between mesenchyme and epithelium as in the cup stage of tooth development. Furthermore, while exploring the expression pattern of signal molecules by RT-PCR, Bmp2 was shown to be completely inactivated in the CCOC and irregularly noticeable in ameloblastomas. Bmp4 was always expressed in all the tumors. Based on the established roles of Msx and Dlx transcription factors in dental cell fates, these data suggest that their altered expression is a proposed trail to explain the genesis and/or the progression of odontogenic tumors.

  1. Identification of unique expression signatures and therapeutic targets in esophageal squamous cell carcinoma

    PubMed Central

    2012-01-01

    Background Esophageal squamous cell carcinoma (ESCC), the predominant histological subtype of esophageal cancer, is characterized by high mortality. Previous work identified important mRNA expression differences between normal and tumor cells; however, to date there are limited ex vivo studies examining expression changes occurring during normal esophageal squamous cell differentiation versus those associated with tumorigenesis. In this study, we used a unique tissue microdissection strategy and microarrays to measure gene expression profiles associated with cell differentiation versus tumorigenesis in twelve cases of patient-matched normal basal squamous epithelial cells (NB), normal differentiated squamous epithelium (ND), and squamous cell cancer. Class comparison and pathway analysis were used to compare NB versus tumor in a search for unique therapeutic targets. Results As a first step towards this goal, gene expression profiles and pathways were evaluated. Overall, ND expression patterns were markedly different from NB and tumor; whereas, tumor and NB were more closely related. Tumor showed a general decrease in differentially expressed genes relative to NB as opposed to ND that exhibited the opposite trend. FSH and IgG networks were most highly dysregulated in normal differentiation and tumorigenesis, respectively. DNA repair pathways were generally elevated in NB and tumor relative to ND indicating involvement in both normal and pathological growth. PDGF signaling pathway and 12 individual genes unique to the tumor/NB comparison were identified as therapeutic targets, and 10 associated ESCC gene-drug pairs were identified. We further examined the protein expression level and the distribution patterns of four genes: ODC1, POSTN, ASPA and IGF2BP3. Ultimately, three genes (ODC1, POSTN, ASPA) were verified to be dysregulated in the same pattern at both the mRNA and protein levels. Conclusions These data reveal insight into genes and molecular pathways mediating ESCC development and provide information potentially useful in designing novel therapeutic interventions for this tumor type. PMID:22280838

  2. Pattern response of dendritic cells in the tumor microenvironment and breast cancer

    PubMed Central

    da Cunha, Alessandra; Michelin, Marcia A; Murta, Eddie FC

    2014-01-01

    Breast cancer (BC) is the most common malignant neoplasm and the cause of death by cancer among women worldwide. Its development, including malignancy grade and patient prognosis, is influenced by various mutations that occur in the tumor cell and by the immune system’s status, which has a direct influence on the tumor microenvironment and, consequently, on interactions with non-tumor cells involved in the immunological response. Among the immune response cells, dendritic cells (DCs) play a key role in the induction and maintenance of anti-tumor responses owing to their unique abilities for antigen cross-presentation and promotion of the activation of specific lymphocytes that target neoplasic cells. However, the tumor microenvironment can polarize DCs, transforming them into immunosuppressive regulatory DCs, a tolerogenic phenotype which limits the activity of effector T cells and supports tumor growth and progression. Various factors and signaling pathways have been implicated in the immunosuppressive functioning of DCs in cancer, and researchers are working on resolving processes that can circumvent tumor escape and developing viable therapeutic interventions to prevent or reverse the expression of immunosuppressive DCs in the tumor microenvironment. A better understanding of the pattern of DC response in patients with BC is fundamental to the development of specific therapeutic approaches to enable DCs to function properly. Various studies examining DCs immunotherapy have demonstrated its great potential for inducing immune responses to specific antigens and thereby reversing immunosuppression and related to clinical response in patients with BC. DC-based immunotherapy research has led to immense scientific advances, both in our understanding of the anti-tumor immune response and for the treatment of these patients. PMID:25114862

  3. Prognostic Value of FBXO39 and ETS-1 but not BMI-1 in Iranian Colorectal Cancer Patients

    PubMed

    Motalebzadeh, Jamshid; Shabani, Samira; Rezayati, Saeedeh; Shakournia, Narges; Mirzaei, Rezvan; Mahjoubi, Bahar; Hoseini, Kamal; Mahjoubi, Frouzandeh

    2018-05-26

    Background: Colorectal cancer (CRC) is one of the most prevalent cancers worldwide. Despite recent progress in diagnosis and treatment, it remains a major health problem and further studies are needed. We here investigated expression profiles of the FBXO39, ETS-1 and BMI-1 genes in CRCs to validate any possible diagnostic/prognostic significance. Material and Methods: Thirty six patients with locally advanced CRC admitted to Hazrate-Rasoul Hospital-Tehran were enrolled. Initially the expression pattern of FBXO39, ETS-1 and BMI-1 genes were determined using RT-PCR in CRC tumor and adjacent normal tissues then real-time RT-PCR was employed to quantify BMI-1 gene expression. Results: FBXO39 expression was restricted to tumor tissues. Interestingly, expression of this gene was detected in all stage-0 tumor samples. There was a significant relation between FBXO39 gene expression and lymph node involvement. The ETS-1 gene was expressed in 66% of all tumor tissues with p-value=0.03 for increase as compared to the adjacent normal samples. In addition, there was a significant relation between ETS-1 gene expression and tumor size and lymph node involvement. RT-PCR demonstrated BMI-1 gene expression in both tumor and normal tissues and quantification by real-time RT-PCR showed no association between BMI-1 levels and CRC clinicopathological features. Conclusion: Expression of FBXO39 and ETS-1 with lymph node involvement may be considered as an alarm for the occurrence of CRC metastasis, and therfore have prognostic value while BMI-1 appears without importance. Creative Commons Attribution License

  4. [Sinonasal-type hemangiopericytoma: a clinicopathologic analysis of 6 cases].

    PubMed

    Wang, Shu-yi; Zhu, Xiong-zeng

    2006-05-01

    To study the clinicopathologic features, histologic diagnosis and differential diagnosis of sinonasal-type of hemangiopericytoma (SNTHPC). The clinical, radiographic and pathologic findings of 6 cases of SNTHPC were analyzed. Immunohistochemistry and electron microscopy were performed on selected examples. Amongst the 6 patients studied, 4 were males and 2 were females. The age of patients ranged from 56 to 71 years (mean = 60.5 years old). The commonest clinical presentation was nasal obstruction and/or epistaxis. Other symptoms could include increased nasal secretion, eyeball pain, decreased visual acuity, increased tear secretion and headache. The tumor involved nasal cavity and/or paranasal sinuses. Gross examination showed polypoid tumor masses, brownish fleshy tissue or whitish tumor tissue fragments. Histologically, the tumor showed a mixture of diffuse, fascicular, storiform, reticulated and whorled growth patterns. The tumor cells were spindle-shaped and possessed clear to eosinophilic cytoplasm. Mitotic figures were rarely seen. The intervening vasculature was characteristically thin-walled, with focal hyalinization changes and rarely the staghorn pattern. Immunohistochemical study showed that the tumor cells expressed vimentin (6/6), smooth muscle actin (5/6) and CD34 (3/6). Electron microscopy demonstrated the presence of intracytoplasmic myofilaments. The tumor cells were linked together by primitive cell junctions. In general, the histologic diagnosis of SNTHPC was difficult, and only 1 case had the correct initial pathologic diagnosis made. Follow-up data were available in 5 patients and 2 of them had local recurrences. SNTHPC is a low to intermediate grade soft tissue tumor with pericytes differentiation. Correct diagnosis relies on detailed pathologic assessment and application of ancillary investigations.

  5. Promoter methylation profile in gallbladder cancer.

    PubMed

    Roa, Juan Carlos; Anabalón, Leonardo; Roa, Iván; Melo, Angélica; Araya, Juan Carlos; Tapia, Oscar; de Aretxabala, Xavier; Muñoz, Sergio; Schneider, Barbara

    2006-03-01

    Methylation in the promoter region of genes is an important mechanism of inactivation of tumor suppressor genes. Our objective was to analyze the methylation pattern of some of the genes involved in carcinogenesis of the gallbladder, examining the immunohistochemical expression of proteins, clinical features, and patient survival time. Twenty cases of gallbladder cancer were selected from the frozen tumor bank. The DNA extracted was analyzed by means of a methylation-specific polymerase chain reaction test for the CDKN2A (p16), MLH1, APC, FHIT, and CDH1 (E-cadherin) genes. Morphological and clinical data and follow-up information were obtained. All cases were in an advanced stage: histologically moderate or poorly differentiated tumors (95%). Methylation of the promoter area of genes was observed in 5%, 20%, 30%, 40%, and 65% of cases, and an altered immunohistochemical pattern (AIP) in 5%, 35%, 21%, 25%, and 66% for the MLH1, CDKN2A, FHIT, APC, and CDH1 genes, respectively. The Kappa concordance index between methylation of the promoter area and AIP for the MLH1 and CDH1 genes was very high (K > 0.75) and substantial for APC (K > 0.45). No correlation was found between survival time and the methylation of the genes studied. The high frequency of gene methylation (with the exception of MLH1) and the high agreement between AIP and methylation of the gene promoter area for the MLH1, APC, and CDH1 genes suggest that the inactivation of tumor suppressor genes and of the genes related to the control of cellular proliferation through this mechanism is involved in gallbladder carcinogenesis.

  6. Disrupting Tumor Angiogenesis and "the Hunger Games" for Breast Cancer.

    PubMed

    Zhou, Ziwei; Yao, Herui; Hu, Hai

    2017-01-01

    Angiogenesis, one of the hallmarks of cancers, has become an attractive target for cancer therapy since decades ago. It is broadly thought that upregulation of angiogenesis is involved in tumor progression and metastasis. Though tumor vessels are tortuous, disorganized, and leaky, they deliver oxygen and nutrients for tumor development. Based on this knowledge, many kinds of drugs targeting angiogenesis pathways have been developed, such as bevacizumab. However, the clinical outcomes of anti-angiogenesis therapies are moderate in metastatic breast cancer as well as in metastatic colorectal cancer and non-small cell lung cancer, even combined with traditional chemotherapy. In this chapter, the morphologic angiogenesis patterns and the key molecular pathways regulating angiogenesis are elaborated. The FDA-approved anti-angiogenesis drugs and current challenges of anti-angiogenesis therapy are described. The strategies to overcome the barriers will also be elucidated.

  7. Distinctive expression pattern of OCT4 variants in different types of breast cancer.

    PubMed

    Soheili, Saamaaneh; Asadi, Malek Hossein; Farsinejad, Alireza

    2017-01-01

    OCT4 is a key regulator of self-renewal and pluripotency in embryonic stem cells which can potentially encode three spliced variants designated OCT4A, OCT4B and OCT4B1. Based on cancer stem cell concept, it is suggested that the stemness factors misexpressed in cancer cells and potentially is involved in tumorigenesis. Accordingly, in this study, we investigated the potential expression of OCT4 variants in breast cancer tissues. A total of 94 tumoral and peritumoral breast specimens were evaluated with respect to the expression of OCT4 variants using quantitative RT-PCR and immunohistochemical (IHC) analysis. We detected the expression of OCT4 variants in breast tumor tissues with no or very low levels of expression in peritumoral samples of the same patients. While OCT4B was highly expressed in lobular type of breast cancer, OCT4A and OCTB1 variants are highly expressed in low grade (I and II) ductal tumors. Furthermore, the results of this study revealed a considerable association between the expression level of OCT4 variants and the expression of ER, PR, Her2 and P53 factors. All data demonstrated a distinctive expression pattern of OCT4 spliced variants in different types of breast cancer and provide further evidence for the involvement of embryonic genes in carcinogenesis.

  8. Acid, basic, and neutral peptidases present different profiles in chromophobe renal cell carcinoma and in oncocytoma.

    PubMed

    Blanco, Lorena; Larrinaga, Gorka; Pérez, Itxaro; López, José I; Gil, Javier; Agirregoitia, Ekaitz; Varona, Adolfo

    2008-04-01

    Renal cell carcinomas (RCCs) are neoplasias with high prevalence and mortality. We previously reported that several peptidases may be involved in the pathophysiology of clear cell renal cell carcinoma (CCRCC). Now, to gain insight into the reasons that lead the various RCC types to behave very differently with regard to aggressiveness and response to anticancer treatments, we analyzed subsets of chromophobe renal cell carcinoma (ChRCC), and renal oncocytoma (RO), a benign tumor; as well as different grades and stages of CCRCCs. Particulate APN, APB, and APA activities were decreased in both ChRCC and RO (tumor vs. nontumor tissues). Interestingly, activities were downregulated in a tumor-type specific way and the intensities of the decreases were stronger in the benign tumor than in the malignant type. Moreover, when two key histopathological parameters for tumor prognosis (high vs. low stage and grade) were analyzed, increases of activity were also observed in several of these cell surface peptidases (APN, APB). Some soluble activities (APB, Asp-AP) were also downregulated in the RCCs. With respect to genetic expression, PSA and APN were in a positive correlation related to their activities in both ChRCC and RO; but not APB, Asp-AP, APA, and PGI. These results may suggest an involvement of several peptidases in the pathophysiology of renal cancer, since they presented different patterns of activity and expression in tumors with different behaviors.

  9. SMARCB1 involvement in the development of leiomyoma in a patient with schwannomatosis.

    PubMed

    Hulsebos, Theo J M; Kenter, Susan; Siebers-Renelt, Ulrike; Hans, Volkmar; Wesseling, Pieter; Flucke, Uta

    2014-03-01

    Germline SMARCB1 mutations predispose in schwannomatosis patients to the development of multiple benign schwannomas and, in some cases, meningiomas. Here, we report on a 34-year-old female patient who developed multiple schwannomas at various locations and in addition a leiomyoma of the cervix uteri. She carried a c.362+1G>A mutation that inactivates the donor splice site of exon 3. This mutation caused the schwannomatosis phenotype in this patient and was also demonstrated to be present in her affected mother. The leiomyoma displayed the genetic features that are characteristic for germline SMARCB1 mutation-associated tumors. The mutant allele retained in the tumor, whereas the wild-type allele was lost by loss of heterozygosity. Furthermore, the loss of heterozygosity involved net loss of chromosome 22. An NF2 mutation was not found. However, quantitative polymerase chain reaction suggested that both NF2 copies were lost in the tumor. Immunostaining with a SMARCB1 antibody revealed the mosaic expression pattern that is typical for schwannomatosis-associated tumors. To our knowledge, this is the first reported case of leiomyoma associated with a germline SMARCB1 mutation. As such, it widens the spectrum of benign tumors associated with a germline SMARCB1 mutation.

  10. Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

    PubMed

    Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

    2011-12-01

    High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Papillary carcinoma occurring within an adenomatous goiter of the thyroid gland in Cowden's disease.

    PubMed

    Kameyama, K; Takami, H; Miyajima, K; Mimura, T; Hosoda, Y; Ito, K; Ito, K

    2001-01-01

    Cowden's disease is an autosomal dominant disorder characterized by multiple benign and malignant neoplastic lesions involving many organs. The presence of characteristic cutaneous lesions is crucial for the diagnosis. Thyroid disease is a major extracutaneous manifestation of this disease; however, the histologic characteristics have not been described in detail. We report a case of thyroid tumor associated with Cowden's disease. Grossly, the tumor showed a multinodular appearance, like an adenomatous goiter. Microscopically, it consisted of follicular adenomas with a trabecular pattern. Some of the nodules had a second component resembling papillary carcinoma. This was thought to be a unique histological feature not described previously, and might be specific to thyroid tumor associated with Cowden's disease.

  12. Biomechanics of metastatic disease in the vertebral column.

    PubMed

    Whyne, Cari M

    2014-06-01

    Metastatic disease in the vertebral column compromises the structural stability of the spine leading to increased risk of fracture. The complex patterns of osteolytic and osteoblastic disease within the bony spine have motivated a multimodal approach to better characterize the biomechanics of tumor-involved bone. This review presents our current understanding of the biomechanical behavior of metastatically involved vertebrae, and experimental and computational image-based approaches that have been employed to quantify structural integrity in preclinical models with translation to clinical data sets.

  13. E6-associated transcription patterns in human papilloma virus 16-positive cervical tissues.

    PubMed

    Lin, Kezhi; Lu, Xulian; Chen, Jun; Zou, Ruanmin; Zhang, Lifang; Xue, Xiangyang

    2015-01-01

    The change in transcription pattern induced by post-transcriptional RNA splicing is an important mechanism in the regulation of the early gene expression of human papilloma virus (HPV). The present study was conducted to establish a method to specifically amplify HPV-16 E6-associated transcripts. The E6-related transcripts from 63 HPV-16-positive cervical tumor tissue samples were amplified, consisting of eight cases of low-risk intraepithelial lesions, 38 cases of high-risk intraepithelial lesions and 17 cases of cervical cancer (CxCa). The appropriate amplified segments were recovered following agarose gel electrophoresis, and subjected to further sequencing and sequence alignment analysis. Six groups of E6 transcription patterns were identified from HPV-16-positive cervical tumor tissue, including five newly-discovered transcripts. Different HPV-16 E6-associated transcription patterns were detected during the development of CxCa. Over the course of the progression of the low-grade squamous intraepithelial lesions to CxCa, the specific HPV-16 E6-associated transcription patterns and the dominant transcripts were all different. As indicated by this study, the transcription pattern of the E6 early gene of HPV-16 was closely associated with the stages of cervical carcinogenesis, and may also be involved in the development of CxCa.

  14. Ghost cells in pilomatrixoma, craniopharyngioma, and calcifying cystic odontogenic tumor: histological, immunohistochemical, and ultrastructural study.

    PubMed

    Rumayor, Alicia; Carlos, Román; Kirsch, Hernán Molina; de Andrade, Bruno A Benevenuto; Romañach, Mario J; de Almeida, Oslei Paes

    2015-04-01

    Pilomatrixoma, craniopharyngioma, and calcifying cystic odontogenic tumor are the main entities presenting ghost cells as an important histological feature, in spite their quite different clinical presentation; it seems that they share a common pathway in the formation of these cells. The aim of this study is to examine and compare the characteristics of ghost and other cells that form these lesions. Forty-three cases including 21 pilomatrixomas, 14 craniopharyngiomas, and eight calcifying cystic odontogenic tumors were evaluated by immunohistochemistry for cytokeratins, CD138, β-catenin, D2-40, Glut-1, FAS, CD10 and also by scanning electron microscopy. The CKs, CD138, β-catenin, Glut-1, FAS, and CD10 were more often expressed by transitional cells of craniopharyngioma and calcifying cystic odontogenic tumor, compared with pilomatrixoma. Basaloid cells of pilomatrixoma showed strong positivity for CD138 and CD10. Differences on expression pattern were identified in transitional and basal cells, as ghost cells were negative for most antibodies used, except by low expression for cytokeratins. By scanning electron microscopy, the morphology of ghost cells were similar in their fibrillar cytoplasm, but their pattern varied from sheets in pilomatrixoma to small clusters in craniopharyngioma and calcifying cystic odontogenic tumor. Mechanisms involved in formation of ghost cells are unknown, but probably they follow different pathways as protein expression in the basal/transitional cells was not uniform in the three tumors studied. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Msx and Dlx Homeogene Expression in Epithelial Odontogenic Tumors

    PubMed Central

    Ruhin-Poncet, Blandine; Ghoul-Mazgar, Sonia; Hotton, Dominique; Capron, Frédérique; Jaafoura, Mohamed Habib; Goubin, Gérard; Berdal, Ariane

    2009-01-01

    Epithelial odontogenic tumors are rare jaw pathologies that raise clinical diagnosis and prognosis dilemmas notably between ameloblastomas and clear cell odontogenic carcinomas (CCOCs). In line with previous studies, the molecular determinants of tooth development—amelogenin, Msx1, Msx2, Dlx2, Dlx3, Bmp2, and Bmp4—were analyzed by RT-PCR, ISH, and immunolabeling in 12 recurrent ameloblastomas and in one case of CCOC. Although Msx1 expression imitates normal cell differentiation in these tumors, other genes showed a distinct pattern depending on the type of tumor and the tissue involved. In benign ameloblastomas, ISH localized Dlx3 transcripts and inconstantly detected Msx2 transcripts in epithelial cells. In the CCOC, ISH established a lack of both Dlx3 and Msx2 transcripts but allowed identification of the antisense transcript of Msx1, which imitates the same scheme of distribution between mesenchyme and epithelium as in the cup stage of tooth development. Furthermore, while exploring the expression pattern of signal molecules by RT-PCR, Bmp2 was shown to be completely inactivated in the CCOC and irregularly noticeable in ameloblastomas. Bmp4 was always expressed in all the tumors. Based on the established roles of Msx and Dlx transcription factors in dental cell fates, these data suggest that their altered expression is a proposed trail to explain the genesis and/or the progression of odontogenic tumors. (J Histochem Cytochem 57:69–78, 2009) PMID:18854600

  16. Solid tumors are poroelastic solids with a chemo-mechanical feedback on growth.

    PubMed

    Ambrosi, D; Pezzuto, S; Riccobelli, D; Stylianopoulos, T; Ciarletta, P

    2017-12-01

    The experimental evidence that a feedback exists between growth and stress in tumors poses challenging questions. First, the rheological properties (the "constitutive equations") of aggregates of malignant cells are still a matter of debate. Secondly, the feedback law (the "growth law") that relates stress and mitotic-apoptotic rate is far to be identified. We address these questions on the basis of a theoretical analysis of in vitro and in vivo experiments that involve the growth of tumor spheroids. We show that solid tumors exhibit several mechanical features of a poroelastic material, where the cellular component behaves like an elastic solid. When the solid component of the spheroid is loaded at the boundary, the cellular aggregate grows up to an asymptotic volume that depends on the exerted compression. Residual stress shows up when solid tumors are radially cut, highlighting a peculiar tensional pattern. By a novel numerical approach we correlate the measured opening angle and the underlying residual stress in a sphere. The features of the mechanobiological system can be explained in terms of a feedback of mechanics on the cell proliferation rate as modulated by the availability of nutrient, that is radially damped by the balance between diffusion and consumption. The volumetric growth profiles and the pattern of residual stress can be theoretically reproduced assuming a dependence of the target stress on the concentration of nutrient which is specific of the malignant tissue.

  17. TFE3-rearranged hepatic epithelioid hemangioendothelioma-a case report with immunohistochemical and molecular study.

    PubMed

    Kuo, Fang-Ying; Huang, Hsuan-Ying; Chen, Chao-Long; Eng, Hock-Liew; Huang, Chao-Cheng

    2017-09-01

    A recurrent YAP1-TFE3 gene fusion has been identified in WWTR1-CAMTA1-negative epithelioid hemangioendotheliomas arising in soft tissue, bone, and lung, but not in liver. We present the first case of TFE3-rearranged hepatic epithelioid hemangioendothelioma in a 39-year-old Taiwanese woman. Computed tomography scan revealed multifocal, ill-defined nodules involving both hepatic lobes. She then underwent deceased donor liver transplantation. Histologically, the tumors in the liver explant showed a biphasic growth pattern. One component was composed of dilated and well-formed blood vessels lined by epithelioid cells with abundant eosinophilic cytoplasm, mimicking an alveolar pattern, whereas the other component was composed of cords and single cells, featuring intracytoplasmic vacuoles, separated by a myxoid stroma. The tumor cells showed vesicular nuclei and small indistinct nucleoli with mild to moderate cytologic atypia. Most tumor cells showed factor VIII, CD34, CD31, and TFE3 positivity in immunohistochemical study. Fluorescence in situ hybridization analysis for the tumor cells exhibited TFE3 gene rearrangement. The patient is currently alive, and no post-operative tumor recurrence developed during a 13-year follow-up. Awareness of this rare vasoformative variant and identification of the gene rearrangement would be helpful on differential diagnosis with other high-grade carcinoma and angiosarcoma of liver. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  18. Leiomyosarcoma of the Inferior Vena Cava - Radical Resection, Vascular Reconstruction and Challenges: A Case Report and Review of Relevant Literature

    PubMed Central

    Biswas, Saptarshi; Amin, Arpit; Chaudry, Suhaib; Joseph, Saju

    2013-01-01

    Leiomyosarcomas of the inferior Vena Cava (IVC) are rare soft tissue sarcomas accounting for only 0.5% of all soft tissue sarcomas in adults with fewer than 300 cases reported. Extraluminal tumor growth along the adventitia of the IVC seems to be the common presentation. Intraluminal tumor growth is rare. The origin of the tumor is divided into three levels in relation to the hepatic and renal veins. The presentations and surgical modalities vary accordingly. Retroperitoneal tumors are often not diagnosed until the disease is at an advanced stage with large tumor growth and involvement of surrounding structures. This is partly because of the nonspecific clinical presentation as well as absence of early symptoms. Most patients present with abdominal or flank pain. Symptoms vary according to the dimensions of the tumor, growth pattern and localization of the tumor. Radical en bloc resection of the affected venous segment remains the only therapeutic option associated with prolonged survival. The goals of surgical management of these tumors include the achievement of local tumor control, maintenance of caval flow, and the prevention of recurrence. The involvement of renal or hepatic veins determines the strategy for vascular reconstruction. Reconstruction of the IVC is not always required, because gradual occlusion of the IVC allows the development of venous collaterals. However, when pararenal leiomyosarcoma of the IVC is present, reconstruction of the IVC and the renal vein is necessary to prevent transient or permanent renal dysfunction. Recent study has shown that radical surgery combined with adjuvant multimodal therapy has improved the cumulative survival rate. We report a case of IVC leiomyosarcoma in a young healthy woman along with details of its diagnostic workup and discussion of the surgical options and reconstruction of caval continuity. PMID:29147340

  19. Molecular Characteristics of Malignant Ovarian Germ Cell Tumors and Comparison With Testicular Counterparts: Implications for Pathogenesis

    PubMed Central

    Kraggerud, Sigrid Marie; Hoei-Hansen, Christina E.; Alagaratnam, Sharmini; Skotheim, Rolf I.; Abeler, Vera M.

    2013-01-01

    This review focuses on the molecular characteristics and development of rare malignant ovarian germ cell tumors (mOGCTs). We provide an overview of the genomic aberrations assessed by ploidy, cytogenetic banding, and comparative genomic hybridization. We summarize and discuss the transcriptome profiles of mRNA and microRNA (miRNA), and biomarkers (DNA methylation, gene mutation, individual protein expression) for each mOGCT histological subtype. Parallels between the origin of mOGCT and their male counterpart testicular GCT (TGCT) are discussed from the perspective of germ cell development, endocrinological influences, and pathogenesis, as is the GCT origin in patients with disorders of sex development. Integrated molecular profiles of the 3 main histological subtypes, dysgerminoma (DG), yolk sac tumor (YST), and immature teratoma (IT), are presented. DGs show genomic aberrations comparable to TGCT. In contrast, the genome profiles of YST and IT are different both from each other and from DG/TGCT. Differences between DG and YST are underlined by their miRNA/mRNA expression patterns, suggesting preferential involvement of the WNT/β-catenin and TGF-β/bone morphogenetic protein signaling pathways among YSTs. Characteristic protein expression patterns are observed in DG, YST and IT. We propose that mOGCT develop through different developmental pathways, including one that is likely shared with TGCT and involves insufficient sexual differentiation of the germ cell niche. The molecular features of the mOGCTs underline their similarity to pluripotent precursor cells (primordial germ cells, PGCs) and other stem cells. This similarity combined with the process of ovary development, explain why mOGCTs present so early in life, and with greater histological complexity, than most somatic solid tumors. PMID:23575763

  20. Harnessing Solute Carrier Transporters for Precision Oncology.

    PubMed

    Nyquist, Michael D; Prasad, Bhagwat; Mostaghel, Elahe A

    2017-03-28

    Solute Carrier (SLC) transporters are a large superfamily of transmembrane carriers involved in the regulated transport of metabolites, nutrients, ions and drugs across cellular membranes. A subset of these solute carriers play a significant role in the cellular uptake of many cancer therapeutics, ranging from chemotherapeutics such as antimetabolites, topoisomerase inhibitors, platinum-based drugs and taxanes to targeted therapies such as tyrosine kinase inhibitors. SLC transporters are co-expressed in groups and patterns across normal tissues, suggesting they may comprise a coordinated regulatory circuit serving to mediate normal tissue functions. In cancer however, there are dramatic changes in expression patterns of SLC transporters. This frequently serves to feed the increased metabolic demands of the tumor cell for amino acids, nucleotides and other metabolites, but also presents a therapeutic opportunity, as increased transporter expression may serve to increase intracellular concentrations of substrate drugs. In this review, we examine the regulation of drug transporters in cancer and how this impacts therapy response, and discuss novel approaches to targeting therapies to specific cancers via tumor-specific aberrations in transporter expression. We propose that among the oncogenic changes in SLC transporter expression there exist emergent vulnerabilities that can be exploited therapeutically, extending the application of precision medicine from tumor-specific drug targets to tumor-specific determinants of drug uptake.

  1. Commitment of Scaffold Proteins in the Onco-Biology of Human Colorectal Cancer and Liver Metastases after Oxaliplatin-Based Chemotherapy.

    PubMed

    Rotoli, Deborah; Morales, Manuel; Ávila, Julio; Maeso, María Del Carmen; García, María Del Pino; Mobasheri, Ali; Martín-Vasallo, Pablo

    2017-04-22

    Scaffold proteins play pivotal roles in the regulation of signaling pathways, integrating external and internal stimuli to various cellular outputs. We report the pattern of cellular and subcellular expression of scaffoldins angiomotin-like 2 (AmotL2), FK506 binding protein 5 (FKBP51) and IQ motif containing GTPase-activating protein 1 (IQGAP1) in colorectal cancer (CRC) and metastases in liver resected after oxaliplatin-based chemotherapy (CT). Positive immunostaining for the three scaffoldins was found in most cells in healthy colon, tumor, healthy liver and metastasized liver. The patterns of expression of AmotL2, FKBP51 and IQGAP1 show the greatest variability in immune system cells and neurons and glia cells and the least in blood vessel cells. The simultaneous subcellular localization in tumor cells and other cell types within the tumor suggest an involvement of these three scaffoldins in cancer biology, including a role in Epithelial Mesenchymal Transition. The display in differential localization and quantitative expression of AmotL2, FKBP51, and IQGAP1 could be used as biomarkers for more accurate tumor staging and as potential targets for anti-cancer therapeutics by blocking or slowing down their interconnecting functions. Tough further research needs to be done in order to improve these assessments.

  2. Tongue Motion Patterns in Post-Glossectomy and Typical Speakers: A Principal Components Analysis

    ERIC Educational Resources Information Center

    Stone, Maureen; Langguth, Julie M.; Woo, Jonghye; Chen, Hegang; Prince, Jerry L.

    2014-01-01

    Purpose: In this study, the authors examined changes in tongue motion caused by glossectomy surgery. A speech task that involved subtle changes in tongue-tip positioning (the motion from /i/ to /s/) was measured. The hypothesis was that patients would have limited motion on the tumor (resected) side and would compensate with greater motion on the…

  3. Pirin Inhibits Cellular Senescence in Melanocytic Cells

    PubMed Central

    Licciulli, Silvia; Luise, Chiara; Scafetta, Gaia; Capra, Maria; Giardina, Giuseppina; Nuciforo, Paolo; Bosari, Silvano; Viale, Giuseppe; Mazzarol, Giovanni; Tonelli, Chiara; Lanfrancone, Luisa; Alcalay, Myriam

    2011-01-01

    Cellular senescence has been widely recognized as a tumor suppressing mechanism that acts as a barrier to cancer development after oncogenic stimuli. A prominent in vivo model of the senescence barrier is represented by nevi, which are composed of melanocytes that, after an initial phase of proliferation induced by activated oncogenes (most commonly BRAF), are blocked in a state of cellular senescence. Transformation to melanoma occurs when genes involved in controlling senescence are mutated or silenced and cells reacquire the capacity to proliferate. Pirin (PIR) is a highly conserved nuclear protein that likely functions as a transcriptional regulator whose expression levels are altered in different types of tumors. We analyzed the expression pattern of PIR in adult human tissues and found that it is expressed in melanocytes and has a complex pattern of regulation in nevi and melanoma: it is rarely detected in mature nevi, but is expressed at high levels in a subset of melanomas. Loss of function and overexpression experiments in normal and transformed melanocytic cells revealed that PIR is involved in the negative control of cellular senescence and that its expression is necessary to overcome the senescence barrier. Our results suggest that PIR may have a relevant role in melanoma progression. PMID:21514450

  4. Electroretinography and Visual Evoked Potentials in Childhood Brain Tumor Survivors.

    PubMed

    Pietilä, Sari; Lenko, Hanna L; Oja, Sakari; Koivisto, Anna-Maija; Pietilä, Timo; Mäkipernaa, Anne

    2016-07-01

    This population-based cross-sectional study evaluates the clinical value of electroretinography and visual evoked potentials in childhood brain tumor survivors. A flash electroretinography and a checkerboard reversal pattern visual evoked potential (or alternatively a flash visual evoked potential) were done for 51 survivors (age 3.8-28.7 years) after a mean follow-up time of 7.6 (1.5-15.1) years. Abnormal electroretinography was obtained in 1 case, bilaterally delayed abnormal visual evoked potentials in 22/51 (43%) cases. Nine of 25 patients with infratentorial tumor location, and altogether 12 out of 31 (39%) patients who did not have tumors involving the visual pathways, had abnormal visual evoked potentials. Abnormal electroretinographies are rarely observed, but abnormal visual evoked potentials are common even without evident anatomic lesions in the visual pathway. Bilateral changes suggest a general and possibly multifactorial toxic/adverse effect on the visual pathway. Electroretinography and visual evoked potential may have clinical and scientific value while evaluating long-term effects of childhood brain tumors and tumor treatment. © The Author(s) 2016.

  5. The role of the cilium in hereditary tumor predisposition syndromes

    PubMed Central

    Klasson, Timothy D.; Giles, Rachel H.

    2014-01-01

    The primary cilium is a highly conserved cell organelle that is closely connected to processes involved in cell patterning and replication. Amongst their many functions, cilia act as “signal towers” through which cell-cell signaling cascades pass. Dysfunction of cilia or the myriad processes that are connected with cilium function can lead to disease. Due to the sheer number of cellular processes that at some point involve the primary cilium, the effects of misregulation are highly heterogeneous between different cell populations. However, because of the importance of primary cilia in the development, growth, patterning and orientation of cells and tissues, a common thread has emerged in which defective cilia can lead to disorganization, which can contribute to the growth of neoplasms, including cancer and pre-cancerous phenotypes. Because cilia are so vital for signaling during cell replication and the cell fate decisions that are important in childhood growth, symptoms often arise early in life. Here we review recent work connecting misregulation of the primary cilium with tumor formation in a variety of tissues in the developing body, with a particular focus on the syndromes in which classic tumor genes are mutated, including von Hippel-Lindau disease (OMIM 193300), adenomatous polyposis coli (OMIM 175100), tuberous sclerosis (OMIM 191100) and Birt-Hogg-Dubé syndrome (OMIM 135150). Timely diagnosis of these syndromes is essential for entry into appropriate screening protocols, which have been shown to effectively prolong life expectancy in these cohorts of patients. PMID:27625869

  6. Parosteal osteosarcoma dedifferentiating into telangiectatic osteosarcoma: importance of lytic changes and fluid cavities at imaging.

    PubMed

    Azura, M; Vanel, D; Alberghini, M; Picci, P; Staals, E; Mercuri, M

    2009-07-01

    This study was performed to assess the imaging findings in cases of parosteal osteosarcoma dedifferentiated into telangiectatic osteosarcoma. Parosteal osteosarcoma is a low-grade well-differentiated malignant tumor. Dedifferentiation into a more aggressive lesion is frequent and usually visible on imaging as a central lytic area in a sclerotic mass. Only one case of differentiation into a telangiectatic osteosarcoma has been reported. As it has practical consequences, with a need for aggressive chemotherapy, we looked for this rather typical imaging pattern. Review of 199 cases of surface osteosarcomas (including 86 parosteal, of which 23 were dedifferentiated) revealed lesions suggesting a possible telangiectatic osteosarcoma on imaging examinations in five cases (cavities with fluid). Histology confirmed three cases (the two other only had hematoma inside a dedifferentiated tumor). There were three males, aged 24, 28, and 32. They had radiographs and CT, and two an MR examination. Lesions involved the distal femur, proximal tibia, and proximal humerus. The parosteal osteosarcoma was a sclerotic, regular mass, attached to the cortex. A purely lytic mass, partially composed of fluid cavities was easily detected on CT and MR. It involved the medullary cavity twice, and remained outside the bone once. Histology confirmed the two components in each case. Two patients died of pulmonary metastases and one is alive. Knowledge of this highly suggestive pattern should help guide the initial biopsy to diagnose the two components of the tumor, and guide aggressive treatment.

  7. Pretreatment dietary intake is associated with tumor suppressor DNA methylation in head and neck squamous cell carcinomas

    PubMed Central

    Colacino, Justin A.; Arthur, Anna E.; Dolinoy, Dana C.; Sartor, Maureen A.; Duffy, Sonia A.; Chepeha, Douglas B.; Bradford, Carol R.; Walline, Heather M.; McHugh, Jonathan B.; D'Silva, Nisha; Carey, Thomas E.; Wolf, Gregory T.; Taylor, Jeremy M.G.; Peterson, Karen E.; Rozek, Laura S.

    2012-01-01

    Diet is associated with cancer prognosis, including head and neck cancer (HNC), and has been hypothesized to influence epigenetic state by determining the availability of functional groups involved in the modification of DNA and histone proteins. The goal of this study was to describe the association between pretreatment diet and HNC tumor DNA methylation. Information on usual pretreatment food and nutrient intake was estimated via food frequency questionnaire (FFQ) on 49 HNC cases. Tumor DNA methylation patterns were assessed using the Illumina Goldengate Methylation Cancer Panel. First, a methylation score, the sum of individual hypermethylated tumor suppressor associated CpG sites, was calculated and associated with dietary intake of micronutrients involved in one-carbon metabolism and antioxidant activity, and food groups abundant in these nutrients. Second, gene specific analyses using linear modeling with empirical Bayesian variance estimation were conducted to identify if methylation at individual CpG sites was associated with diet. All models were controlled for age, sex, smoking, alcohol and HPV status. Individuals reporting in the highest quartile of folate, vitamin B12 and vitamin A intake, compared with those in the lowest quartile, showed significantly less tumor suppressor gene methylation, as did patients reporting the highest cruciferous vegetable intake. Gene specific analyses identified differential associations between DNA methylation and vitamin B12 and vitamin A intake when stratifying by HPV status. These preliminary results suggest that intake of folate, vitamin A and vitamin B12 may be associated with the tumor DNA methylation profile in HNC and enhance tumor suppression. PMID:22722388

  8. Nasopharyngeal carcinoma heterogeneity of DNA content identified on cytologic preparations.

    PubMed

    Maohuai, C; Chang, A R; Lo, D

    2001-06-01

    To evaluate tumor heterogeneity of DNA content in nasopharyngeal carcinoma (NPC) performed on cytologic specimens. Image cytometric analysis of DNA ploidy status of 40 NPCs was performed on nasopharyngeal brushing smears stained with the Feulgen method after hematoxylin eosin staining. If the DNA distribution pattern from the same tumor exhibited diploid, aneuploid or/and tetraploid peaks or some combination of these patterns, the presence of tumor heterogeneity of DNA content was identified. Thirty-four cases (85%) had a nondiploid DNA pattern among the 40 NPCs. Twenty-eight cases exhibited tumor heterogeneity of DNA content (70%). Of the 28 tumors, 13 (46%) had a combination of diploid and tetraploid patterns, 10 (37%) had a combination of diploid and aneuploid patterns, 3 cases (11%) had a combination of tetraploid and aneuploid patterns, and 2 cases had two aneuploid stem lines. The relationship between DNA ploidy pattern and tumor histologic and cytologic morphology was also examined. There is a high incidence of DNA content heterogeneity in NPC. The relevance of tumor heterogeneity to the biologic behavior of NPC awaits further study. DNA quantification with image cytometry on destained cytologic preparations is feasible and reliable.

  9. Dedifferentiated liposarcoma with inflammatory myofibroblastic tumor-like features.

    PubMed

    Lucas, David R; Shukla, Abhishek; Thomas, Dafydd G; Patel, Rajiv M; Kubat, Anthony J; McHugh, Jonathan B

    2010-06-01

    The dedifferentiated component of dedifferentiated liposarcoma shows wide histologic variation including tumors with heterologous differentiation. Myofibroblastic differentiation has been recognized in dedifferentiated liposarcoma. However, tumors closely resembling inflammatory myofibroblastic tumor have not. We report the clinicopathologic, immunohistochemical, and molecular finding in 6 cases of dedifferentiated liposarcoma with inflammatory myofibroblastic tumor-like features treated at our institution. The tumors occurred mostly in middle age or elderly men, involved mostly the inguinal/scrotal region or retroperitoneum, and behaved aggressively. Microscopically, the dedifferentiated component closely resembled or, if taken out of context, was indistinguishable from inflammatory myofibroblastic tumor. All 3 major patterns seen in inflammatory myofibroblastic tumor (myxoid, cellular, and hypocellular fibrous) were represented. Areas resembling nodular fasciitis or desmoid fibromatosis were frequent findings. One tumor had heterologous osseous differentiation. In 4 tumors the inflammatory myofibroblastic tumor-like areas were diffuse, whereas in 2 they were combined with noninflammatory myofibroblastic tumor-like high-grade sarcoma. Five tumors stained for smooth muscle actin or desmin, none stained for ALK-1, 5 stained for MDM2, and 5 had amplified MDM2 by fluorescence in situ hybridization. Well-differentiated liposarcomatous components were present in every tumor. All patients developed locally recurrent or metastatic disease. At last follow-up 2 patients had died of disease and 2 were alive with disease. Dedifferentiated liposarcoma can have prominent inflammatory myofibroblastic tumor-like features, a finding that further expands its histologic spectrum. Awareness of this finding can prevent one from misdiagnosing dedifferentiated liposarcoma as inflammatory myofibroblastic tumor, a much less aggressive neoplasm.

  10. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  11. Acinar cell carcinoma of the pancreas presenting as diffuse pancreatic enlargement: Two case reports and literature review.

    PubMed

    Luo, Yaping; Hu, Guilan; Ma, Yanru; Guo, Ning; Li, Fang

    2017-09-01

    Pancreatic acinar cell carcinoma (ACC) is a rare malignant tumor of exocrine pancreas. It is typically a well-marginated large solid mass arising in a certain aspect of the pancreas. Diffuse involvement of ACC in the pancreas is very rare, and may simulate pancreatitis in radiological findings. We report 2 cases of ACC presenting as diffuse enlargement of the pancreas due to tumor involvement without formation of a distinct mass. The patients consisted of a 41-year-old man with weight loss and a 77-year-old man who was asymptomatic. Computed tomography (CT) and 18F-fluorodeoxyglucose (FDG) positron emission tomography (PET)/CT showed diffuse enlargement of the pancreas forming a sausage-like shape with homogenously increased FDG activity. Endoscopic ultrasound (EUS)-guided fine needle aspiration (FNA) biopsy of the pancreatic lesion was performed. Histopathology results from the pancreas confirmed the diagnosis of pancreatic ACC. Because diffuse enlargement of the pancreas is a common imaging feature of pancreatitis, recognition of this rare morphologic pattern of ACC is important for radiological diagnosis of this tumor.

  12. Angiofibroma of soft tissue with fibrohistiocytic features and intratumor genetic heterogeneity of NCOA2 gene rearrangement revealed by chromogenic in situ hybridization: a case report.

    PubMed

    Fukuda, Yumiko; Motoi, Toru; Kato, Ikuma; Ikegami, Masachika; Funata, Nobuaki; Ohtomo, Rie; Horiguchi, Shinichiro; Goto, Takahiro; Hishima, Tsunekazu

    2014-05-01

    Angiofibroma of soft tissue is a recently described soft tissue tumor that is characterized by fibroblastic spindle tumor cells with arborizing capillary proliferation. Cytogenetically, it harbors a specific fusion gene involving the nuclear receptor coactivator 2 (NCOA2) gene. We report here additional new pathological and cytogenetic features. A soft tissue tumor in the left thigh of 73-year-old female was investigated. Microscopically, histiocytoid tumor cells were scattered in an edematous background with branching capillary proliferation. Immunohistochemically, we identified that the tumor cells were positive for histiocytic markers such as CD68 and CD163. Rearrangement of the NCOA2 gene was detected successfully by chromogenic in situ hybridization; however, abnormal signal patterns were observed in only a small subset of tumor cells. Unlike typical tumors with bland spindle cells, the present tumor needs to be distinguished from myxoid, dendritic and clear cell tumors. This case may suggest that angiofibroma of soft tissue is not in the center of the fibroblastic/myofibroblastic tumor group, but rather shows a fibrohistiocytic nature. We also found intratumor genetic heterogeneity, which is uncommon for a translocation-associated tumor. Therefore, careful evaluation is required to detect the gene rearrangement in this tumor entity. © 2014 The Authors. Pathology International © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  13. Pulmonary lipomatous hemangiopericytoma: report of a rare tumor and comparison with solitary fibrous tumor.

    PubMed

    Yamazaki, Kazuto; Eyden, Brian P

    2007-01-01

    Lipomatous hemangiopericytoma is a rare mesenchymal tumor showing areas of lipid-containing cells admixed with a spindle-cell component. Like other hemangiopericytomas, it shows a similar vascular pattern to solitary fibrous tumor and, partly for this reason, it and other hemangiopericytomas have been subsumed into solitary fibrous tumor. The present study provides a comprehensive documentation of a single case of pulmonary lipomatous hemangiopericytoma of the lung, the first to be described at this site, and compares it with solitary fibrous tumor, in terms of clinical, histological, immunohistochemical, ultrastructural, and cytogenetic findings. Apart from the lipid-laden-cell component, pulmonary lipomatous hemangiopericytoma and solitary fibrous tumor were similar histologically. Bcl-2 was positive in both. CD34 was minimally expressed in pulmonary lipomatous hemangiopericytoma, which possessed some non-descriptive intercellular junctions, a feature shared by solitary fibrous tumor, which was CD34 positive. However, one of the latter was rich in gap junctions, a feature consistent with strong connexin (Cx) 43 staining and the existence, hitherto unappreciated, of a CD34/Cx43-positive tumor cell network. In pulmonary lipomatous hemangiopericytoma, chromosomal deletions of 43-44, X, -Y were found. In solitary fibrous tumor, 46, XY, del(13)(q?) abnormalities and abnormalities involving chromosome 10 were frequently observed. These similarities and differences are discussed in the context of the currently favored diagnostic fusion of hemangiopericytoma and solitary fibrous tumor.

  14. Uterine Serous Carcinomas Frequently Metastasize to the Fallopian Tube and Can Mimic Serous Tubal Intraepithelial Carcinoma.

    PubMed

    Kommoss, Friedrich; Faruqi, Asma; Gilks, C Blake; Lamshang Leen, Sarah; Singh, Naveena; Wilkinson, Nafisa; McCluggage, W Glenn

    2017-02-01

    We investigated the frequency, histopathologic, and immunohistochemical characteristics of tubal involvement in uterine serous carcinoma (USC) and aimed to clarify the relationship between "serous tubal intraepithelial carcinoma (STIC)" and USC in these cases. Cases of USC with complete tubal examination were prospectively collected and reviewed for the presence of tubal involvement. Immunohistochemical analysis for p53 and WT1 was performed on the endometrial and tubal tumor in cases with tubal involvement. Of 161 USC cases (pure USC or a component of a mixed carcinoma or a carcinosarcoma), 32 (20%) showed tubal involvement (unilateral: n=19; bilateral: n=13). The uterine tumors in cases with tubal involvement showed a trend toward increased likelihood of deep myometrial and lymphovascular invasion (LVI) compared with those without tubal involvement. The tubal fimbriae were involved in 15/32 cases. Tubal involvement was mucosal in 30/32 cases, mural in 14/32, serosal in 5/32, invasive in 22/32, and there was LVI in the tube in 13/32. STIC-like features were seen in 17/32 cases (7 as the only pattern of involvement, 9 with associated invasive carcinoma, and 5 with LVI). Immunostaining showed complete concordance of p53 and WT1 between the endometrial and tubal tumors in 26/32 cases, the majority being WT1 negative or only focally positive (19/26), and all exhibiting mutation-type p53 staining. On the basis of the histologic and immunohistochemical features, the tubal tumor was considered to represent metastatic USC in 26/32 cases, most likely metastatic USC in 2/32 cases, an independent tubal primary tumor in 3/32 cases, and to be of uncertain origin in the 1 remaining case. STIC-like lesions were considered to represent metastatic USC in 12/17 cases, most likely metastatic USC in 2/17 cases, an independent tubal primary in 2/17 cases, and of uncertain origin in the 1 remaining case. Tubal involvement, including STIC-like lesions, is seen in one fifth of USC when the tubes are examined in their entirety. The tubal involvement is metastatic in the vast majority of cases. Immunohistochemical studies assist, in most cases, in confirming the metastatic nature of the tubal disease. Consideration should be given to completely examining the fallopian tubes in apparent stage I or II USCs, as this will result in upstaging in a significant minority of cases.

  15. Distinct patterns of dysregulated expression of enzymes involved in androgen synthesis and metabolism in metastatic prostate cancer tumors

    PubMed Central

    Mitsiades, Nicholas; Sung, Clifford C.; Schultz, Nikolaus; Danila, Daniel C.; He, Bin; Eedunuri, Vijay Kumar; Fleisher, Martin; Sander, Chris; Sawyers, Charles L.; Scher, Howard I.

    2012-01-01

    Androgen receptor (AR) signaling persists in castration-resistant prostate carcinomas (CRPCs), due to several mechanisms that include increased AR expression and intratumoral androgen metabolism. We investigated the mechanisms underlying aberrant expression of transcripts involved in androgen metabolism in CRPC. We compared gene expression profiles and DNA copy number alteration (CNA) data from 29 normal prostate tissue samples, 127 primary prostate carcinomas (PCas) and 19 metastatic PCas. Steroidogenic enzyme transcripts were evaluated by qRT-PCR in PCa cell lines and circulating tumor cells (CTCs) from CRPC patients. Metastatic PCas expressed higher transcript levels for AR and several steroidogenic enzymes, including SRD5A1, SRD5A3, and AKR1C3, while expression of SRD5A2, CYP3A4, CYP3A5 and CYP3A7 was decreased. This aberrant expression was rarely associated with CNAs. Instead, our data suggest distinct patterns of coordinated aberrant enzyme expression. Inhibition of AR activity by itself stimulated AKR1C3 expression. The aberrant expression of the steroidogenic enzyme transcripts were detected in CTCs from CRPC patients. In conclusion, our findings identify substantial interpatient heterogeneity and distinct patterns of dysregulated expression of enzymes involved in intratumoral androgen metabolism in PCa. These steroidogenic enzymes represent targets for complete suppression of systemic and intratumoral androgen levels, an objective that is supported by the clinical efficacy of the CYP17 inhibitor abiraterone. A comprehensive AR axis targeting approach via simultaneous, frontline enzymatic blockade and/or transcriptional repression of several steroidogenic enzymes, in combination with GnRH analogs and potent anti-androgens, would represent a powerful future strategy for PCa management. PMID:22971343

  16. Differential Expression of Cytochrome P450 Enzymes in Normal and Tumor Tissues from Childhood Rhabdomyosarcoma

    PubMed Central

    Molina-Ortiz, Dora; Camacho-Carranza, Rafael; González-Zamora, José Francisco; Shalkow-Kalincovstein, Jaime; Cárdenas-Cardós, Rocío; Ností-Palacios, Rosario; Vences-Mejía, Araceli

    2014-01-01

    Intratumoral expression of genes encoding Cytochrome P450 enzymes (CYP) might play a critical role not only in cancer development but also in the metabolism of anticancer drugs. The purpose of this study was to compare the mRNA expression patterns of seven representative CYPs in paired tumor and normal tissue of child patients with rabdomyosarcoma (RMS). Using real time quantitative RT-PCR, the gene expression pattern of CYP1A1, CYP1A2, CYP1B1, CYP2E1, CYP2W1, CYP3A4, and CYP3A5 were analyzed in tumor and adjacent non-tumor tissues from 13 child RMS patients. Protein concentration of CYPs was determined using Western blot. The expression levels were tested for correlation with the clinical and pathological data of the patients. Our data showed that the expression levels of CYP1A1 and CYP1A2 were negligible. Elevated expression of CYP1B1 mRNA and protein was detected in most RMS tumors and adjacent normal tissues. Most cancerous samples exhibit higher levels of both CYP3A4 and CYP3A5 compared with normal tissue samples. Expression of CYP2E1 mRNA was found to be significantly higher in tumor tissue, however no relation was found with protein levels. CYP2W1 mRNA and/or protein are mainly expressed in tumors. In conclusion, we defined the CYP gene expression profile in tumor and paired normal tissue of child patients with RMS. The overexpression of CYP2W1, CYP3A4 and CYP3A5 in tumor tissues suggests that they may be involved in RMS chemoresistance; furthermore, they may be exploited for the localized activation of anticancer prodrugs. PMID:24699256

  17. Molecular events involved in the increased expression of matrix metalloproteinase-9 by T lymphocytes of mammary tumor-bearing mice.

    PubMed

    Owen, Jennifer L; Torroella-Kouri, Marta; Iragavarapu-Charyulu, Vijaya

    2008-01-01

    Matrix metalloproteinases (MMPs) are a family of extracellular proteinases whose contributions to cancer progression have been studied because of their matrix-degrading abilities and elevated expression in advanced stage tumors. Recent findings suggest a role for MMPs during the multiple stages of tumor progression including establishment and growth, migration, invasion, metastasis, and angiogenesis. MMP-9 regulation at the molecular level can be studied by measuring the effect(s) of a variety of physiological and pharmacological agents on cells. Multiple signaling molecules such as protein kinase C, pertussis toxin-sensitive guanine nucleotide-binding protein G, and protein tyrosine kinases are known to mediate the secretion of MMPs in cell lines. We previously reported an upregulation of MMP-9 in T cells of mammary tumor-bearing mice. In this study, pharmacologic inhibitors were used to dissect the signaling pathways involved in the upregulation of MMP-9 in the splenic T cells of normal and mammary tumor-bearing mice. Staurosporine, a protein kinase inhibitor, stimulated MMP-9 secretion by normal T lymphocytes, while the constitutively high levels of MMP-9 produced by tumor bearers' T cells were decreased by Genistein, a specific tyrosine kinase inhibitor, and Rottlerin, a PKC inhibitor. Using a NF-kappaB specific probe to the murine MMP-9 promoter, electromobility shift assays of nuclear proteins from normal and tumor bearers' splenic T cells revealed a pattern of higher intensity bands from the tumor bearers' nuclear extracts, indicating a greater amount of these transcription factors bound to the recognition motif. When mammary tumor bearers' T cells were cultured with the NF-kappaB inhibitors, N-p-Tosyl-L-lysine chloromethyl ketone hydrochloride and Bay 11-7082, there was a subsequent decreased production of MMP-9. These results suggest that the tumor burden may be activating various signaling pathways within splenic T lymphocytes to upregulate MMP-9 expression.

  18. Spontaneous extraskeletal osteosarcoma with various histological growth patterns in the abdominal wall of an ICR mouse

    PubMed Central

    Ito, Tsuyoshi; Katoh, Yoshitaka; Shimada, Yuko; Ohnuma-Koyama, Aya; Takahashi, Naofumi; Kuwahara, Maki; Harada, Takanori

    2015-01-01

    Extraskeletal osteosarcoma is extremely rare in mice. This case report demonstrates a spontaneous murine extraskeletal osteosarcoma that exhibited various histological growth patterns in an ICR mouse. At necropsy, the tumor mass was located in the abdominal wall and was 45 × 30 × 25 mm in size. Histopathologically, the tumor showed the following four growth patterns: a solid pattern of polygonal cells embedded in an osteoid eosinophilic matrix with calcification, an irregular sheet pattern of short spindle cells accompanying some eosinophilic multinucleated cells, a fascicular pattern of spindle cells and a cystic pattern lined by short spindle cells. Immunohistochemically, most of the tumor cells were positive for vimentin, proliferating cell nuclear antigen and osterix. The multinucleated cells mentioned above were desmin positive and were regarded as regenerative striated muscles but not tumor cells. Since no clear continuity with normal bone tissues was observed, the tumor was diagnosed as an “extraskeletal osteosarcoma.” PMID:26989300

  19. A New Gene Expression Signature for Triple-Negative Breast Cancer Using Frozen Fresh Tissue before Neoadjuvant Chemotherapy

    PubMed Central

    Santuario-Facio, Sandra K; Cardona-Huerta, Servando; Perez-Paramo, Yadira X; Trevino, Victor; Hernandez-Cabrera, Francisco; Rojas-Martinez, Augusto; Uscanga-Perales, Grecia; Martinez-Rodriguez, Jorge L; Martinez-Jacobo, Lizeth; Padilla-Rivas, Gerardo; Muñoz-Maldonado, Gerardo; Gonzalez-Guerrero, Juan Francisco; Valero-Gomez, Javier; Vazquez-Guerrero, Ana L; Martinez-Rodriguez, Herminia G; Barboza-Quintana, Alvaro; Barboza-Quintana, Oralia; Garza-Guajardo, Raquel; Ortiz-Lopez, Rocio

    2017-01-01

    Triple-negative breast cancer (TNBC) is an aggressive subtype of breast cancer tumors. Comparisons between TNBC and non–triple-negative breast cancer (nTNBC) may help to differentiate key components involved in TNBC neoplasms. The purpose of the study was to analyze the expression profile of TNBC versus nTNBC tumors in a homogeneous population from northeastern Mexico. A prospective study of 50 patients (25 TNBC and 25 nTNBC) was conducted. Clinic parameters were equally distributed for TNBC and nTNBC: age at diagnosis (51 versus 47 years, p = 0.1), glucose level (107 mg/dl versus 104 mg/dl, p = 0.64), and body mass index (28 versus 29, p = 0.14). Core biopsies were collected for histopathological diagnosis and gene expression analysis. Total RNA was isolated and expression profiling was performed. Forty genes showed differential expression pattern in TNBC tumors. Among these, nine overexpressed genes (PRKX/PRKY, UGT8, HMGA1, LPIN1, HAPLN3, FAM171A1, BCL141A, FOXC1, and ANKRD11), and one underexpressed gene (ANX9) are involved in general metabolism. Based on this biochemical peculiarity and the overexpression of BCL11A and FOXC1 (involved in tumor growth and metastasis, respectively), we validated by quantitative polymerase chain reaction the expression profiles of seven genes out of the signature. In this report, a new gene signature for TNBC is proposed. To our knowledge, this is the first TNBC signature that describes genes involved in general metabolism. The findings may be pertinent for Mexican patients and require evaluation in other ethnic groups and populations. PMID:28474731

  20. Pan-Cancer Molecular Classes Transcending Tumor Lineage Across 32 Cancer Types, Multiple Data Platforms, and over 10,000 Cases.

    PubMed

    Chen, Fengju; Zhang, Yiqun; Gibbons, Don L; Deneen, Benjamin; Kwiatkowski, David J; Ittmann, Michael; Creighton, Chad J

    2018-05-01

    Purpose: The Cancer Genome Atlas data resources represent an opportunity to explore commonalities across cancer types involving multiple molecular levels, but tumor lineage and histology can represent a barrier in moving beyond differences related to cancer type. Experimental Design: On the basis of gene expression data, we classified 10,224 cancers, representing 32 major types, into 10 molecular-based "classes." Molecular patterns representing tissue or histologic dominant effects were first removed computationally, with the resulting classes representing emergent themes across tumor lineages. Results: Key differences involving mRNAs, miRNAs, proteins, and DNA methylation underscored the pan-cancer classes. One class expressing neuroendocrine and cancer-testis antigen markers represented ∼4% of cancers surveyed. Basal-like breast cancers segregated into an exclusive class, distinct from all other cancers. Immune checkpoint pathway markers and molecular signatures of immune infiltrates were most strongly manifested within a class representing ∼13% of cancers. Pathway-level differences involving hypoxia, NRF2-ARE, Wnt, and Notch were manifested in two additional classes enriched for mesenchymal markers and miR200 silencing. Conclusions: All pan-cancer molecular classes uncovered here, with the important exception of the basal-like breast cancer class, involve a wide range of cancer types and would facilitate understanding the molecular underpinnings of cancers beyond tissue-oriented domains. Numerous biological processes associated with cancer in the laboratory setting were found here to be coordinately manifested across large subsets of human cancers. The number of cancers manifesting features of neuroendocrine tumors may be much higher than previously thought, which disease is known to occur in many different tissues. Clin Cancer Res; 24(9); 2182-93. ©2018 AACR . ©2018 American Association for Cancer Research.

  1. Protocol, pattern and paper: interactive stabilization of immunohistochemical knowledge.

    PubMed

    Nederbragt, Hubertus

    2010-12-01

    This paper analyzes the investigation of the distribution of the protein tenascin-C in canine mammary tumors. The method involved immunohistochemistry of tissue slices, performed by the application of an antibody to tenascin-C that specifically can be made visible for microscopic inspection. The first phase of the project is the making of the protocol, the second the deduction of a pattern of tenascin-C distribution in tumors and the third the writing of a paper. Each of the phases is analyzed separately, using the concept of resistance and accommodation. My purpose is to show that in each phase of the process of producing knowledge, the scientist meets resistances which force him to accommodate by changing his conceptual, technical and methodological approaches. In reverse, the details of the non-human agent (protocol, pattern or paper) have to be accommodated to the wishes and expectations of the scientist. Through this interaction a situation of stability of knowledge is reached at the end of each phase. In the protocol phase, resistance is found in the antibody and tissue slices. In the phase of pattern deduction the resistance is in the pathological diagnosis of the tumors and the expectations and hypothesis with which the scientist had entered the project; in the criteria to be used for assigning the slices to a tenascin-C pattern; and in the responses of colleagues and supervisor. In the paper-writing phase the interaction is between the scientist and the scientific community which should take on board the knowledge from the research project. When stabilization of knowledge is obtained in one of the phases, the agents of resistance turn into allies in the next phase, giving support to accommodating the resistances in this later phase. Second, the stabilization of knowledge of the protocol is further enhanced when stabilization of the pattern is achieved; in addition, knowledge of the pattern is more definite when it has become stabilized and closed knowledge within the science community. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. DNA methylation profiles distinguish different subtypes of gastroenteropancreatic neuroendocrine tumors.

    PubMed

    How-Kit, Alexandre; Dejeux, Emelyne; Dousset, Bertrand; Renault, Victor; Baudry, Marion; Terris, Benoit; Tost, Jörg

    2015-01-01

    Most studies have considered gastroenteropancreatic neuroendocrine tumors (GEP-NETs) as a homogenous group of samples or distinguish only gastrointestinal from pancreatic endocrine tumors. This article investigates if DNA methylation patterns could distinguish subtypes of GEP-NETs. The DNA methylation level of 807 cancer-related genes was investigated in insulinomas, gastrinomas, non-functioning pancreatic endocrine tumors and small intestine endocrine tumors. DNA methylation patterns were found to be tumor type specific for each of the pancreatic tumor subtypes and identified two distinct methylation-based groups in small intestine endocrine tumors. Differences of DNA methylation levels were validated by pyrosequencing for 20 candidate genes and correlated with differences at the transcriptional level for four candidate genes. The heterogeneity of DNA methylation patterns in the different subtypes of gastroenteropancreatic neuroendocrine tumors suggests different underlying pathways and, therefore, these tumors should be considered as distinct entities in molecular and clinical studies.

  3. Binary Classification using Decision Tree based Genetic Programming and Its Application to Analysis of Bio-mass Data

    NASA Astrophysics Data System (ADS)

    To, Cuong; Pham, Tuan D.

    2010-01-01

    In machine learning, pattern recognition may be the most popular task. "Similar" patterns identification is also very important in biology because first, it is useful for prediction of patterns associated with disease, for example cancer tissue (normal or tumor); second, similarity or dissimilarity of the kinetic patterns is used to identify coordinately controlled genes or proteins involved in the same regulatory process. Third, similar genes (proteins) share similar functions. In this paper, we present an algorithm which uses genetic programming to create decision tree for binary classification problem. The application of the algorithm was implemented on five real biological databases. Base on the results of comparisons with well-known methods, we see that the algorithm is outstanding in most of cases.

  4. Amelogenin in odontogenic cysts and tumors: An immunohistochemical study

    PubMed Central

    Anigol, Praveen; Kamath, Venkatesh V.; Satelur, Krishnanand; Anand, Nagaraja; Yerlagudda, Komali

    2014-01-01

    Background: Amelogenins are the major enamel proteins that play a major role in the biomineralization and structural organization of enamel. Aberrations of enamel-related proteins are thought to be involved in oncogenesis of odontogenic epithelium. The expression of amelogenin is possibly an indicator of differentiation of epithelial cells in the odontogenic lesions. Aims and Objectives: The present study aimed to observe the expression of amelogenin immunohistochemically in various odontogenic lesions. Materials and Methods: Paraffin sections of 40 odontogenic lesions were stained immunohistochemically with amelogenin antibodies. The positivity, pattern and intensity of expression of the amelogenin antibody were assessed, graded and statistically compared between groups of odontogenic cysts and tumors. Results: Almost all the odontogenic lesions expressed amelogenin in the epithelial component with the exception of an ameloblastic carcinoma. Differing grades of intensity and pattern were seen between the cysts and tumors. Intensity of expression was uniformly prominent in all odontogenic lesions with hard tissue formation. Statistical analysis however did not indicate significant differences between the two groups. Conclusion: The expression of amelogenin antibody is ubiquitous in odontogenic tissues and can be used as a definitive marker for identification of odontogenic epithelium. PMID:25937729

  5. Differential expression of alternatively spliced transcripts related to energy metabolism in colorectal cancer.

    PubMed

    Snezhkina, Anastasiya Vladimirovna; Krasnov, George Sergeevich; Zaretsky, Andrew Rostislavovich; Zhavoronkov, Alex; Nyushko, Kirill Mikhailovich; Moskalev, Alexey Alexandrovich; Karpova, Irina Yurievna; Afremova, Anastasiya Isaevna; Lipatova, Anastasiya Valerievna; Kochetkov, Dmitriy Vladimitovich; Fedorova, Maria Sergeena; Volchenko, Nadezhda Nikolaevna; Sadritdinova, Asiya Fayazovna; Melnikova, Nataliya Vladimirovna; Sidorov, Dmitry Vladimirovich; Popov, Anatoly Yurievich; Kalinin, Dmitry Valerievich; Kaprin, Andrey Dmitrievich; Alekseev, Boris Yakovlevich; Dmitriev, Alexey Alexandrovich; Kudryavtseva, Anna Viktorovna

    2016-12-28

    Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. CRC molecular pathogenesis is heterogeneous and may be followed by mutations in oncogenes and tumor suppressor genes, chromosomal and microsatellite instability, alternative splicing alterations, hypermethylation of CpG islands, oxidative stress, impairment of different signaling pathways and energy metabolism. In the present work, we have studied the alterations of alternative splicing patterns of genes related to energy metabolism in CRC. Using CrossHub software, we analyzed The Cancer Genome Atlas (TCGA) RNA-Seq datasets derived from colon tumor and matched normal tissues. The expression of 1014 alternative mRNA isoforms involved in cell energy metabolism was examined. We found 7 genes with differentially expressed alternative transcripts whereas overall expression of these genes was not significantly altered in CRC. A set of 8 differentially expressed transcripts of interest has been validated by qPCR. These eight isoforms encoded by OGDH, COL6A3, ICAM1, PHPT1, PPP2R5D, SLC29A1, and TRIB3 genes were up-regulated in colorectal tumors, and this is in concordance with the bioinformatics data. The alternative transcript NM_057167 of COL6A3 was also strongly up-regulated in breast, lung, prostate, and kidney tumors. Alternative transcript of SLC29A1 (NM_001078177) was up-regulated only in CRC samples, but not in the other tested tumor types. We identified tumor-specific expression of alternative spliced transcripts of seven genes involved in energy metabolism in CRC. Our results bring new knowledge on alternative splicing in colorectal cancer and suggest a set of mRNA isoforms that could be used for cancer diagnosis and development of treatment methods.

  6. Recurrent plexiform schwannoma involving the carotid canal.

    PubMed

    Ijichi, Kei; Muto, Masahiro; Masaki, Ayako; Murakami, Shingo

    2018-04-01

    Plexiform schwannoma (PS) is a rare variety of benign nerve sheath tumor characterized by a multinodular plexiform growth pattern. PS is usually confined to the head and neck or skin. The pre-operative diagnosis of PS is difficult, and this has lead to a common misdiagnosis as a schwannoma. In addition, studies have indicated that an incomplete resection of PS often results in tumor recurrence. Here we describe a rare case of PS presented in the parapharyngeal space. Our case involved a 36-year-old man with swelling of the pharynx, who presented with a soft cervical mass. MRI revealed a multinodular mass in the left parapharyngeal space, and further pathological diagnosis by the referral hospital indicated schwannoma. A cervical approach was taken and the tumor was removed with preservation of the nerve sheath by intracapsular resection. The tumor recurred within one year after the first surgery in the same lesion of the left parapharyngeal space. The second surgical approach was a combination of a facial dismasking flap and trans-pterygopalatine fossa. The mass was resected completely, and the diagnosis of PS was confirmed by histopathology. While schwannoma commonly occurs in the head and neck, parapharyngeal space PS is rare, and pre-operative pathological diagnosis of PS is difficult. MRI studies of PS revealed distinctive features that we found useful in pre-operative diagnosis. Intracapsular resection of PS with nerve preservation has a very high recurrence rate of the tumor. Therefore, if MRI findings suggest PS we recommend removing the tumor completely without nerve preservation will offer the most curative outcome. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Clinicopathologic Association and Prognostic Value of Microcystic, Elongated, and Fragmented (MELF) Pattern in Endometrial Endometrioid Carcinoma.

    PubMed

    Kihara, Atsushi; Yoshida, Hiroshi; Watanabe, Reiko; Takahashi, Kenta; Kato, Tomoyasu; Ino, Yoshinori; Kitagawa, Masanobu; Hiraoka, Nobuyoshi

    2017-07-01

    Microcystic, elongated, and fragmented (MELF) pattern is seen in the invasive front of some endometrial endometrioid carcinomas. Although MELF pattern can be expected as an indicator of patient outcomes, its prognostic significance remains unclear. This study was conducted to elucidate clinicopathologic features and the prognostic impact of MELF pattern in patients with endometrial endometrioid carcinoma. We retrospectively analyzed data of 479 consecutive patients with endometrial endometrioid carcinoma that had been surgically resected. In 45 of 427 patients (11%) with low-grade endometrioid carcinoma, MELF pattern was found, but it was found in none of the 52 patients with high-grade endometrioid carcinoma. Among the patients with low-grade endometrioid carcinoma, MELF pattern was associated significantly with larger tumor size, myometrial invasion of more than 50%, advanced International Federation of Gynecology and Obstetrics stages, lymphovascular space invasion, lymph node metastasis, papillary architecture, and mucinous differentiation. However, survival analysis revealed that the patients with MELF pattern showed no significantly worse prognosis than those without MELF pattern either in disease-specific survival or in recurrence-free survival. MELF was not a significant prognosticator after adjustment for International Federation of Gynecology and Obstetrics stage (disease-specific survival [hazard ratio, 1.47; 95% confidence interval, 0.28-7.67; P=0.64], recurrence-free survival [hazard ratio, 0.98, 95% confidence interval, 0.32-2.99, P=0.98]). Immunohistochemical analysis revealed that MELF pattern was positive for p16 and p21 and almost negative for Ki-67 labeling, which suggested that tumor cells in MELF pattern were involved in growth arrest or cellular senescence. We conclude that MELF pattern could have little impact on outcomes of patients with low-grade endometrial endometrioid carcinoma.

  8. Intra-tumor distribution of PEGylated liposome upon repeated injection: No possession by prior dose.

    PubMed

    Nakamura, Hiroyuki; Abu Lila, Amr S; Nishio, Miho; Tanaka, Masao; Ando, Hidenori; Kiwada, Hiroshi; Ishida, Tatsuhiro

    2015-12-28

    Liposomes have proven to be a viable means for the delivery of chemotherapeutic agents to solid tumors. However, significant variability has been detected in their intra-tumor accumulation and distribution, resulting in compromised therapeutic outcomes. We recently examined the intra-tumor accumulation and distribution of weekly sequentially administered oxaliplatin (l-OHP)-containing PEGylated liposomes. In that study, the first and second doses of l-OHP-containing PEGylated liposomes were distributed diversely and broadly within tumor tissues, resulting in a potent anti-tumor efficacy. However, little is known about the mechanism underlying such a diverse and broad liposome distribution. Therefore, in the present study, we investigated the influence of dosage interval on the intra-tumor accumulation and distribution of "empty" PEGylated liposomes. Intra-tumor distribution of sequentially administered "empty" PEGylated liposomes was altered in a dosing interval-dependent manner. In addition, the intra-tumor distribution pattern was closely related to the chronological alteration of tumor blood flow as well as vascular permeability in the growing tumor tissue. These results suggest that the sequential administrations of PEGylated liposomes in well-spaced intervals might allow the distribution to different areas and enhance the total bulk accumulation within tumor tissue, resulting in better therapeutic efficacy of the encapsulated payload. This study may provide useful information for a better design of therapeutic regimens involving multiple administrations of nanocarrier drug delivery systems. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Laparoscopic Treatment of Sclerosing Stromal Tumor of the Ovary in a Woman With Gorlin-Goltz Syndrome: A Case Report and Review of the Literature.

    PubMed

    Grechi, Gianluca; Clemente, Nicolò; Tozzi, Alessandra; Ciavattini, Andrea

    2015-01-01

    Gorlin-Goltz syndrome is a rare hereditary multisystemic disease. Multiple basal cell carcinomas, odontogenic keratocysts, and skeletal abnormalities are the main clinical manifestations of the syndrome, but several organs can be involved. Moreover, this condition is associated with the development of various benign and malignant tumors, even in the genital tract. This report describes a rare association between Gorlin-Goltz syndrome and the sclerosing stromal tumor of the ovary. Because the ultrasound and magnetic resonance imaging patterns of this tumor can be similar to those of a malignant neoplasm, prompt surgical intervention and histological confirmation of diagnosis is mandatory; however, this is a benign lesion and thus can be approached with a laparoscopic fertility-sparing surgery. Gynecologists should be aware of this possible association to provide appropriate counseling for these women, and to take a fertility-sparing laparoscopic approach whenever possible. Copyright © 2015 AAGL. Published by Elsevier Inc. All rights reserved.

  10. Dedifferentiated liposarcoma involving the spleen and splenic hilum: a report of a case with a rare growth pattern.

    PubMed

    Nishikawa, Gen; Minamiguchi, Sachiko; Hata, Hiroaki; Ogiso, Satoshi; Yamaguchi, Takashi; Otani, Tethushi; Ikai, Iwao

    2015-01-01

    We present a rare case of dedifferentiated liposarcoma confined to the spleen and splenic hilum. An 81-year-old man was referred to our hospital with a large asymptomatic splenic tumor. The patient underwent splenectomy, and the adipose tissue surrounding the splenic hilum was also resected. Microscopically, the tumor mainly consisted of high-grade spindle cells similar to those seen in undifferentiated pleomorphic liposarcoma. In the splenic hilum, scattered atypical cells were detected in the sclerosing component and adipose tissue. Immunohistochemically, both the spindle cells in the spleen and the atypical cells in the splenic hilum were positive for MDM2 and CDK4. The histopathologic diagnosis was dedifferentiated liposarcoma derived from an atypical lipomatous tumor/well-differentiated liposarcoma of the adipose tissue in the splenic hilum with extension into the spleen. Dedifferentiated liposarcoma in the spleen and splenic hilum should be considered as a differential diagnosis of splenic tumors.

  11. A differential pattern of gene expression in skeletal muscle of tumor-bearing rats reveals dysregulation of excitation–contraction coupling together with additional muscle alterations.

    PubMed

    Fontes-Oliveira, Cibely Cristine; Busquets, Sílvia; Fuster, Gemma; Ametller, Elisabet; Figueras, Maite; Olivan, Mireia; Toledo, Míriam; López-Soriano, Francisco J; Qu, Xiaoyan; Demuth, Jeffrey; Stevens, Paula; Varbanov, Alex; Wang, Feng; Isfort, Robert J; Argilés, Josep M

    2014-02-01

    Cachexia is a wasting condition that manifests in several types of cancer. The main characteristic of this condition is a profound loss of muscle mass. By using a microarray system, expression of several hundred genes was screened in skeletal muscle of rats bearing a cachexia-inducing tumor, the AH-130 Yoshida ascites hepatoma. This model induced a strong decrease in muscle mass in the tumor-bearing animals, as compared with their healthy counterparts. The results show important differences in gene expression in EDL skeletal muscle between tumor-bearing animals with cachexia and control animals. The differences observed pertain to genes related to intracellular calcium homeostasis and genes involved in the control of mitochondrial oxidative phosphorylation and protein turnover, both at the level of protein synthesis and proteolysis. Assessment of these differences may be a useful tool for the design of novel therapeutic strategies to fight this devastating syndrome.

  12. Schwannomatosis presenting as pancreatic and submandibular gland schwannoma.

    PubMed

    Val-Bernal, José Fernando; Mayorga, Marta; Sedano-Tous, María José

    2013-12-01

    Schwannomatosis is a well-established third form of neurofibromatosis, characterized by the presence of multiple non-vestibular, non-intradermal schwannomas, often associated with chronic pain. Herein, we report a 41-year-old man with a history of paternal neurofibromatosis 1, who presented with partially cystic tumors in the pancreas and in the right submandibular gland. Besides, he complained of neuropathic pain in the right inguinal and suprapubic area. Magnetic resonance imaging revealed multiple intradural-extramedullary tumors at the cervical, thoracic and lumbar spinal canal, suggestive of schwannomas. The vestibular nerves were not involved. Pathological examination of the glandular tumors disclosed benign schwannomas. These tumors had substantial myxoid stroma and prominent cystic change, and showed a mosaic pattern of loss of INI1/SMARCB1 expression by immunohistochemistry. Later, the patient developed three nodules in the right lung which were interpreted as schwannomas. To our knowledge, this is the first report of schwannomatosis presenting as pancreatic and salivary gland schwannomas. Copyright © 2013 Elsevier GmbH. All rights reserved.

  13. Desmoid-Type Fibromatosis of the Thorax: CT, MRI, and FDG PET Characteristics in a Large Series From a Tertiary Referral Center.

    PubMed

    Xu, Hai; Koo, Hyun Jung; Lim, Soyeoun; Lee, Jae Wook; Lee, Han Na; Kim, Dong Kwan; Song, Joon Seon; Kim, Mi Young

    2015-09-01

    The purpose of this study was to describe the radiologic findings of computed tomography (CT), magnetic resonance (MR) imaging, and ¹⁸F-fluorodeoxy glucose positron emission tomography (FDG PET) in desmoid-type fibromatosis of the thorax. We retrospectively evaluated 47 consecutive patients with pathologically proven desmoid-type fibromatosis from January 2005 to March 2015. Patients underwent CT (n = 36) and/or MR (n = 32), and 13 patients also underwent FDG PET. Based on CT and MR, the sizes, locations, margins, contours, presence of surrounding fat, extra-compartment extension, bone involvement, and neurovascular involvement of the tumors were recorded. The attenuation, signal intensity, enhancement pattern, and presence of internal low signal band or signal void of the tumors were evaluated. Initial image findings were then compared between 2 groups of tumors: group 1 with recurrence or progression, and group 2 with no recurrence or stable without treatment. Median age at diagnosis of the tumors was 45 years, range 4 to 96, female-to-male ratio 1.8. Median tumor long diameter was 65 mm (range, 22-126 mm). The most common locations were chest wall (42.6%), followed by supraclavicular area, shoulder or axillary area, and mediastinum. The tumors had well-defined margins (83.0%), lobulated in contours (66.0%) surrounding fat (63.8%), extra-compartment extensions (42.6%), bone involvements (42.6%), and neurovascular involvements (27.7%). On CT, tumors had low attenuation (60.0%) with mild enhancement (median 24 HU, range 0-52). On MR, they showed iso-signal intensity (SI) (96.9%) on T1-weighted images (WI), and high SI (90.6%) on T2WI images, with strong (87.5%) and heterogeneous (96.9%) enhancement. Internal low signal bands (84.4%) and signal voids (68.8%) were noted. The median value of maxSUV was 3.1 (range, 2.0-7.3). In group 1 (n = 19, 40.4%), 13 patients suffered recurrence and 6 experienced progression. Group 2 (n = 28, 59.6%) consisted of 21 patients with no recurrence and 7 stable patients receiving no treatment. Partially ill-defined margins (OR, 0.167; 95% CI 0.029-0.943; P = 0.043) was the independent predictor for recurrence or progression of tumor. Knowledge of the radiological findings in desmoid-type fibromatosis on CT, MR, and FDG PET may help to improve diagnosis. Tumors with partially ill-defined margins have a tendency to recur or progress.

  14. Desmoid-Type Fibromatosis of the Thorax: CT, MRI, and FDG PET Characteristics in a Large Series From a Tertiary Referral Center

    PubMed Central

    Xu, Hai; Koo, Hyun Jung; Lim, Soyeoun; Lee, Jae Wook; Lee, Han Na; Kim, Dong Kwan; Song, Joon Seon; Kim, Mi Young

    2015-01-01

    Abstract The purpose of this study was to describe the radiologic findings of computed tomography (CT), magnetic resonance (MR) imaging, and 18F-fluorodeoxy glucose positron emission tomography (FDG PET) in desmoid-type fibromatosis of the thorax. We retrospectively evaluated 47 consecutive patients with pathologically proven desmoid-type fibromatosis from January 2005 to March 2015. Patients underwent CT (n = 36) and/or MR (n = 32), and 13 patients also underwent FDG PET. Based on CT and MR, the sizes, locations, margins, contours, presence of surrounding fat, extra-compartment extension, bone involvement, and neurovascular involvement of the tumors were recorded. The attenuation, signal intensity, enhancement pattern, and presence of internal low signal band or signal void of the tumors were evaluated. Initial image findings were then compared between 2 groups of tumors: group 1 with recurrence or progression, and group 2 with no recurrence or stable without treatment. Median age at diagnosis of the tumors was 45 years, range 4 to 96, female-to-male ratio 1.8. Median tumor long diameter was 65 mm (range, 22–126 mm). The most common locations were chest wall (42.6%), followed by supraclavicular area, shoulder or axillary area, and mediastinum. The tumors had well-defined margins (83.0%), lobulated in contours (66.0%) surrounding fat (63.8%), extra-compartment extensions (42.6%), bone involvements (42.6%), and neurovascular involvements (27.7%). On CT, tumors had low attenuation (60.0%) with mild enhancement (median 24 HU, range 0–52). On MR, they showed iso-signal intensity (SI) (96.9%) on T1-weighted images (WI), and high SI (90.6%) on T2WI images, with strong (87.5%) and heterogeneous (96.9%) enhancement. Internal low signal bands (84.4%) and signal voids (68.8%) were noted. The median value of maxSUV was 3.1 (range, 2.0–7.3). In group 1 (n = 19, 40.4%), 13 patients suffered recurrence and 6 experienced progression. Group 2 (n = 28, 59.6%) consisted of 21 patients with no recurrence and 7 stable patients receiving no treatment. Partially ill-defined margins (OR, 0.167; 95% CI 0.029–0.943; P = 0.043) was the independent predictor for recurrence or progression of tumor. Knowledge of the radiological findings in desmoid-type fibromatosis on CT, MR, and FDG PET may help to improve diagnosis. Tumors with partially ill-defined margins have a tendency to recur or progress. PMID:26402812

  15. [Recent incidences and trends of childhood malignant solid tumors in Shanghai, 2002-2010].

    PubMed

    Bao, Ping-Ping; Li, Kai; Wu, Chun-Xiao; Huang, Zhe-Zhou; Wang, Chun-Fang; Xiang, Yong-Mei; Peng, Peng; Gong, Yang-Ming; Xiao, Xian-Min; Zheng, Ying

    2013-04-01

    To examine the recent incidences and trends of childhood malignant solid tumors in Shanghai. Data from the population-based Shanghai Cancer Registry and related retrospective survey were used to analyze the patterns of incidence and trends of malignant solid tumors diagnosed between 2002 and 2010 in children aged 0-14 years. The distributions of incidences were described according to gender, age and cancer types which were classified according to International Classification of Childhood Cancer (ICCC). Annual age-standardized rates (ASRs) were adjusted by the world standard population. Approximate confidence intervals for standardized rate ratios (SRR) based Poisson distribution test-based methods were used to assess changes in incidence over the period 2002 - 2006 and 2007 - 2010. (1)A total of 868 cases of childhood malignant solid tumors were diagnosed in Shanghai during 2002 - 2010, accounting for 65.8% of all childhood cancers. The ASR of 2002 - 2010 was 80.2 per million for all solid tumors. (2) The ASR was higher in boys (86.3 per million) than in girls (73.8 per million) with SRR 1.2 (95%CI 1.0 - 1.3). Incidence rate was the highest in the first five years of life with 93.4 per million. The age-specific incidence rates in 5 - 9 and 10 - 14 age groups were 65.2 and 79.3 per million, respectively. (3) CNS tumors, lymphomas, germ cell tumors, neuroblastoma, and soft tissue sarcomas were the top 5 most common solid tumors in children, with the incidence rate of 23.8, 11.0, 7.8, 7.7 and 6.8 per million, respectively. The patterns of subgroups varied in different age groups. Blastomas, such as neuroblastoma, retinoblastoma, were more common in the children aged 0 - 4 years, whereas epithelial carcinomas and bone tumors developed more frequently in elder children aged 10 - 14 years. (4) Compared with the ASR in 2002 - 2006, the ASR for both genders in 2007 - 2010 had no substantial changes (78.7 per million in 2002 - 2006 and 82.9 per million in 2007 - 2010). However, among boys, the incidence rate in 2007 - 2010 was significantly higher than that in 2002 - 2006 with SRR 1.2 (95%CI: 1.0 - 1.4). For specific subgroups of cancer, there were no substantial changes. Some cautions should be taken when interpreting results involving a small number of cases per year and those with wide 95% confidence intervals. The incidence rate of pediatric malignant solid tumors among males was higher than females during 2002 - 2010, and it differed among different age groups with the highest in the first five years of life. CNS tumor was the most common type of solid tumors in children. This was a unique characteristics comparing with adult reflected in disease spectrum and age of onset. The patterns of incidence and its trends for childhood malignant solid tumors in Shanghai could provide a basis for etiologic research and preventive interventions. The findings also suggest an urgent need for longer population-based surveillance to verify the pattern and changing trends.

  16. Pattern of skin cancer among Saudi patients attending a tertiary care center in Dhahran, Eastern Province of Saudi Arabia. A 20-year retrospective study.

    PubMed

    Al-Dawsari, Najla A; Amra, Nasir

    2016-12-01

    Skin cancer is the ninth most common malignancy in Saudi Arabia. It represented 3.2% of all newly diagnosed cancer cases in the year 2010. The aim of this study was to determine the epidemiology of skin cancer in relation to age, sex, and anatomic location among Saudi patients attending the Johns Hopkins Aramco Healthcare center in Dhahran, Eastern province of Saudi Arabia. We retrospectively reviewed the surgical pathology records of Saudi nationals from 1995 to 2014 at the Johns Hopkins Aramco Healthcare center, which directly provides for the healthcare needs of Saudi Aramco company employees and dependents in the Eastern Province of Saudi Arabia. Tumor metastases to skin, skin involvement by primary breast carcinoma, and B-cell leukemia/lymphoma with secondary involvement by skin were excluded. The total number of primary skin tumors was 204. The commonest cutaneous malignancies were basal cell carcinoma (36%) followed by squamous cell carcinoma (23%), with the head and neck being the commonest location for both tumors. Mycosis fungoides (MF) was the third most common malignancy (11%). Malignant melanoma was the fourth commonest skin malignancy (7%) with the lower extremities being the commonest location. The four most common skin cancers in our tertiary center in the Eastern Province of Saudi Arabia were squamous cell carcinoma, basal cell carcinoma, MF, and malignant melanoma. Other regions of Saudi Arabia report a similar pattern of skin cancers as our center, with MF having a higher frequency at our center. © 2016 The International Society of Dermatology.

  17. A 13-year-old female with Xp11.2 translocation renal cell carcinoma; the first case diagnosed at Siriraj Hospital.

    PubMed

    Hanamornroongruang, Suchanan; Treetipsatit, Jitsupa; Pongtanakul, Bunchoo; Seangchai, Napakorn

    2012-07-01

    Xp11.2 translocation renal cell carcinomas are rare tumors characterized by translocations involving chromosome Xp11.2. These tumors are predominantly reported in pediatric patients. The authors report Xp11.2 translocation renal cell carcinoma in a 13-year-old girl who presented with asymptomatic palpable right renal mass. Right radical nephrectomy was performed and revealed a well-defined solid mass at the lower pole of the kidney. Microscopically, the tumor was composed of sheets and nests of clear to pale eosinophilic cells with some alveolar growth pattern. Psammoma bodies were detected. Immunohistochemically, the tumor cells marked with TFE3, focally marked with smooth muscle actin, HMB-45, CD68, progesterone receptor (PR) and CD10 but did not mark with epithelial markers (AE1/AE3, EMA and CAM5.2), vimentin, S-100 and p53. The presence of psammoma bodies is an important diagnostic clue for these tumors. Cytogenetic study and/or immunohistochemistry for TFE3 protein are needed for confirming the diagnosis. Currently, surgery seems to be the most effective therapy Pediatric patients with these tumors are believed to have a favorable prognosis.

  18. In vivo use of hyperspectral imaging to develop a noncontact endoscopic diagnosis support system for malignant colorectal tumors

    NASA Astrophysics Data System (ADS)

    Han, Zhimin; Zhang, Aoyu; Wang, Xiguang; Sun, Zongxiao; Wang, May D.; Xie, Tianyu

    2016-01-01

    The early detection and diagnosis of malignant colorectal tumors enables the initiation of early-stage therapy and can significantly increase the survival rate and post-treatment quality of life among cancer patients. Hyperspectral imaging (HSI) is recognized as a powerful tool for noninvasive cancer detection. In the gastrointestinal field, most of the studies on HSI have involved ex vivo biopsies or resected tissues. In the present study, we aimed to assess the difference in the in vivo spectral reflectance of malignant colorectal tumors and normal mucosa. A total of 21 colorectal tumors or adenomatous polyps from 12 patients at Shanghai Zhongshan Hospital were examined using a flexible hyperspectral (HS) colonoscopy system that can obtain in vivo HS images of the colorectal mucosa. We determined the optimal wavelengths for differentiating tumors from normal tissue based on these recorded images. The application of the determined wavelengths in spectral imaging in clinical trials indicated that such a clinical support system comprising a flexible HS colonoscopy unit and band selection unit is useful for outlining the tumor region and enhancing the display of the mucosa microvascular pattern in vivo.

  19. Lung Tumors Treated With Percutaneous Radiofrequency Ablation: Computed Tomography Imaging Follow-Up

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palussiere, Jean, E-mail: palussiere@bergonie.org; Marcet, Benjamin; Descat, Edouard

    2011-10-15

    Purpose: To describe the morphologic evolution of lung tumors treated with radiofrequency ablation (RFA) by way of computed tomography (CT) images and to investigate patterns of incomplete RFA at the site of ablation. Materials and Methods: One hundred eighty-nine patients with 350 lung tumors treated with RFA underwent CT imaging at 2, 4, 6, and 12 months. CT findings were interpreted separately by two reviewers with consensus. Five different radiologic patterns were predefined: fibrosis, cavitation, nodule, atelectasis, and disappearance. The appearance of the treated area was evaluated at each follow-up CT using the predefined patterns. Results: At 1 year aftermore » treatment, the most common evolutions were fibrosis (50.5%) or nodules (44.8%). Differences were noted depending on the initial size of the tumor, with fibrosis occurring more frequently for tumors <2 cm (58.6% vs. 22.9%, P = 1 Multiplication-Sign 10{sup -5}). Cavitation and atelectasis were less frequent patterns (2.4% and 1.4%, respectively, at 1 year). Tumor location (intraparenchymatous, with pleural contact <50% or >50%) was not significantly correlated with follow-up image pattern. Local tumor progressions were observed with each type of evolution. At 1 year, 12 local recurrences were noted: 2 cavitations, which represented 40% of the cavitations noted at 1 year; 2 fibroses (1.9%); 7 nodules (7.4%); and 1 atelectasis (33.3%). Conclusion: After RFA of lung tumors, follow-up CT scans show that the shape of the treatment zone can evolve in five different patterns. None of these patterns, however, can confirm the absence of further local tumor progression at subsequent follow-up.« less

  20. Tumor abolition and antitumor immunostimulation by physico-chemical tumor ablation.

    PubMed

    Keisari, Yona

    2017-01-01

    Tumor ablation by thermal, chemical and radiological sources has received substantial attention for the treatment of many localized malignancies. The primary goal of most ablation procedures is to eradicate all viable malignant cells within a designated target volume through the application of energy or chemicals. Methods such as radiotherapy, chemical and biological ablation, photodynamic therapy, cryoablation, high-temperature ablation (radiofrequency, microwave, laser, and ultrasound), and electric-based ablation have been developed for focal malignancies. In recent years a large volume of data emerged on the effect of in situ tumor destruction (ablation) on inflammatory and immune components resulting in systemic anti-tumor reactions. It is evident that in situ tumor ablation can involve tumor antigen release, cross presentation and the release of DAMPS and make the tumor its own cellular vaccine. Tumor tissue destruction by in situ ablation may stimulate antigen-specific cellular immunity engendered by an inflammatory milieu. Dendritic cells (DCs) attracted to this microenvironment, will undergo maturation after internalizing cellular debris containing tumor antigens and will be exposed to damage associated molecular pattern (DAMP). Mature DCs can mediate antigen-specific cellular immunity via presentation of processed antigens to T cells. The immunomodulatory properties, exhibited by in situ ablation could portend a future collaboration with immunotherapeutic measures. In this review are summarized and discuss the preclinical and clinical studies pertinent to the phenomena of stimulation of specific anti-tumor immunity by various ablation modalities and the immunology related measures used to boost this response.

  1. Parallels between Global Transcriptional Programs of Polarizing Caco-2 Intestinal Epithelial Cells In Vitro and Gene Expression Programs in Normal Colon and Colon Cancer

    PubMed Central

    Sääf, Annika M.; Halbleib, Jennifer M.; Chen, Xin; Yuen, Siu Tsan; Leung, Suet Yi

    2007-01-01

    Posttranslational mechanisms are implicated in the development of epithelial cell polarity, but little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized temporal patterns of gene expression during cell–cell adhesion-initiated polarization of cultured human Caco-2 cells, which develop structural and functional polarity resembling enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts. Comparison to gene expression patterns in normal human colon and colon tumors revealed that the pattern in proliferating, nonpolarized Caco-2 cells paralleled patterns seen in human colon cancer in vivo, including expression of genes involved in cell proliferation. The pattern switched in polarized Caco-2 cells to one more closely resembling that in normal colon tissue, indicating that regulation of transcription underlying Caco-2 cell polarization is similar to that during enterocyte differentiation in vivo. Surprisingly, the temporal program of gene expression in polarizing Caco-2 cells involved changes in signaling pathways (e.g., Wnt, Hh, BMP, FGF) in patterns similar to those during migration and differentiation of intestinal epithelial cells in vivo, despite the absence of morphogen gradients and interactions with stromal cells characteristic of enterocyte differentiation in situ. The full data set is available at http://microarray-pubs.stanford.edu/CACO2. PMID:17699589

  2. DNA Hypomethylation Affects Cancer-Related Biological Functions and Genes Relevant in Neuroblastoma Pathogenesis

    PubMed Central

    Mayol, Gemma; Martín-Subero, José I.; Ríos, José; Queiros, Ana; Kulis, Marta; Suñol, Mariona; Esteller, Manel; Gómez, Soledad; Garcia, Idoia; de Torres, Carmen; Rodríguez, Eva; Galván, Patricia; Mora, Jaume; Lavarino, Cinzia

    2012-01-01

    Neuroblastoma (NB) pathogenesis has been reported to be closely associated with numerous genetic alterations. However, underlying DNA methylation patterns have not been extensively studied in this developmental malignancy. Here, we generated microarray-based DNA methylation profiles of primary neuroblastic tumors. Stringent supervised differential methylation analyses allowed us to identify epigenetic changes characteristic for NB tumors as well as for clinical and biological subtypes of NB. We observed that gene-specific loss of DNA methylation is more prevalent than promoter hypermethylation. Remarkably, such hypomethylation affected cancer-related biological functions and genes relevant to NB pathogenesis such as CCND1, SPRR3, BTC, EGF and FGF6. In particular, differential methylation in CCND1 affected mostly an evolutionary conserved functionally relevant 3′ untranslated region, suggesting that hypomethylation outside promoter regions may play a role in NB pathogenesis. Hypermethylation targeted genes involved in cell development and proliferation such as RASSF1A, POU2F2 or HOXD3, among others. The results derived from this study provide new candidate epigenetic biomarkers associated with NB as well as insights into the molecular pathogenesis of this tumor, which involves a marked gene-specific hypomethylation. PMID:23144874

  3. Synovial sarcoma in cerebellum: a case report and literature review.

    PubMed

    Xiao, Guan-ying; Pan, Bin-cai; Tian, Xiao-ying; Li, Yang; Li, Bin; Li, Zhi

    2014-01-01

    Synovial sarcoma is a tumor of unknown origin and is extremely rare in the central nervous system. We present a case involving an unusual cerebellar synovial sarcoma in a male infant. Neuroimaging revealed a large, solid, gadolinium-enhancing mass located in the parenchyma of the right cerebellar hemisphere and associated with multiple cyst formation. Histologically, the tumor was composed of uniform spindle cells with indistinct borders and numerous mitotic figures. The tumor cells were observed to form dense cellular sheets, but in some areas the tumor showed a hemangiopericytomatous vascular pattern consisting of tumor cells arranged around dilated, thin-walled blood vessels. Immunohistochemistry showed that vimentin, CD99 and Bcl-2 were diffusely positive in most cells, and focal reactivity for cytokeratin (AE1/AE3) and S-100 protein was also observed. The tumor cells were, however, negative for CK19, EMA, CD34, synaptophysin, GFAP, desmin, myogenin, and smooth muscle actin. Cytogenetic analysis using fluorescence in situ hybridization demonstrated the translocation t(X;18)(p11;q11). A diagnosis of primary cerebellar monophasic synovial sarcoma was made. To our knowledge, this is the first report of a synovial sarcoma in brain parenchyma. The present case indicates that it is essential to select the appropriate immunohistochemical panel and-especially-perform molecular analysis to accurately diagnose intracranial spindle cell tumors.

  4. Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors.

    PubMed

    Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart

    2014-01-01

    The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions or 3' untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment.

  5. Alternative Polyadenylation of Tumor Suppressor Genes in Small Intestinal Neuroendocrine Tumors

    PubMed Central

    Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart

    2014-01-01

    The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3′ untranslated regions. Additionally, APA can also produce mRNAs containing different 3′-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3′ truncation of mRNA coding regions or 3′ untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment. PMID:24782827

  6. The epigenome as a therapeutic target in prostate cancer.

    PubMed

    Perry, Antoinette S; Watson, R William G; Lawler, Mark; Hollywood, Donal

    2010-12-01

    During cancer development and progression, tumor cells undergo abnormal epigenetic modifications, including DNA methylation, histone deacetylation and nucleosome remodeling. Collectively, these aberrations promote genomic instability and lead to silencing of tumor-suppressor genes and reactivation of oncogenic retroviruses. Epigenetic modifications, therefore, provide exciting new avenues for prostate cancer research. Promoter hypermethylation is widespread during neoplastic transformation of prostate cells, which suggests that restoration of a 'normal' epigenome through treatment with inhibitors of the enzymes involved could be clinically beneficial. Global patterns of histone modifications are also being defined and have been associated with clinical and pathologic predictors of prostate cancer outcome. Although treatment for localized prostate cancer can be curative, the development of successful therapies for the management of castration-resistant metastatic disease is urgently needed. Reactivation of tumor-suppressor genes by demethylating agents and histone deacetylase inhibitors could be a potential treatment option for patients with advanced disease.

  7. Monitoring PDT effects in murine tumors by spectroscopic and imaging techniques

    NASA Astrophysics Data System (ADS)

    Ramaprasad, Subbaraya; Rzepka, Elzbieta; Pi, Jiaxiong; Joshi, Shantaram S.; Dobhal, Mahabeer; Missert, Joseph; Pandey, Ravindra K.

    2004-04-01

    The changes in the tumor that occur following photodynamic therapy (PDT) were studied using a small animal MR imager operating at 7Tesla. The animal model used in these studies was mice bearing radiation induced fibrosarcoma (RIF) tumor on the foot dorsum. The mice were injected with 10μM/kg of one of the photosensitizers: (1) Photofrin, (2) Non-fluorinated porphyrin photosensitizer (DOD-1), (3) Fluorinated porphyrin photosensitizer (DOD-2) and, (4) Fluorinated chlorin photosensitizer (DOD-6). Laser light at 630 or 650 nm (150 mW/cm2, 270 joules/cm2) was delivered to the tumor at 2-24 hours of photosensitizer administration. The MR spectroscopic and imaging examination of the tumors involved both the 1H and 31P nuclei. The tumor bioenergetics was measured by 31P spectroscopy. The water proton relaxivity and diffusion measurements were used to obtain local changes in different regions of the tumor. Changes in 31P MR spectra were observed following PDT using Photofrin and fluorinated chlorin sensitizer (DOD-6). However, no significant changes were observed when the fluorinated porphyrin and its nonfluorinated analog were used. The PDT induced changes in tumor volumes showed significant tumor regression with Photofrin, fluorinated porphyrin and chlorin sensitizers. No tumor regression was observed with the non labeled porphyrin sensitizer and the growth profile followed the general pattern of unperturbed tumors. Serial noninvasive measurements of tumor response to PDT are measurable by both MRI and MRS. The MR derived parameters that are characteristic of the tumor status before and after the therapy are discussed here.

  8. Retrospective Analysis of Radiological Recurrence Patterns in Glioblastoma, Their Prognostic Value And Association to Postoperative Infarct Volume.

    PubMed

    Bette, Stefanie; Barz, Melanie; Huber, Thomas; Straube, Christoph; Schmidt-Graf, Friederike; Combs, Stephanie E; Delbridge, Claire; Gerhardt, Julia; Zimmer, Claus; Meyer, Bernhard; Kirschke, Jan S; Boeckh-Behrens, Tobias; Wiestler, Benedikt; Gempt, Jens

    2018-03-14

    Recent studies suggested that postoperative hypoxia might trigger invasive tumor growth, resulting in diffuse/multifocal recurrence patterns. Aim of this study was to analyze distinct recurrence patterns and their association to postoperative infarct volume and outcome. 526 consecutive glioblastoma patients were analyzed, of which 129 met our inclusion criteria: initial tumor diagnosis, surgery, postoperative diffusion-weighted imaging and tumor recurrence during follow-up. Distinct patterns of contrast-enhancement at initial diagnosis and at first tumor recurrence (multifocal growth/progression, contact to dura/ventricle, ependymal spread, local/distant recurrence) were recorded by two blinded neuroradiologists. The association of radiological patterns to survival and postoperative infarct volume was analyzed by uni-/multivariate survival analyses and binary logistic regression analysis. With increasing postoperative infarct volume, patients were significantly more likely to develop multifocal recurrence, recurrence with contact to ventricle and contact to dura. Patients with multifocal recurrence (Hazard Ratio (HR) 1.99, P = 0.010) had significantly shorter OS, patients with recurrent tumor with contact to ventricle (HR 1.85, P = 0.036), ependymal spread (HR 2.97, P = 0.004) and distant recurrence (HR 1.75, P = 0.019) significantly shorter post-progression survival in multivariate analyses including well-established prognostic factors like age, Karnofsky Performance Score (KPS), therapy, extent of resection and patterns of primary tumors. Postoperative infarct volume might initiate hypoxia-mediated aggressive tumor growth resulting in multifocal and diffuse recurrence patterns and impaired survival.

  9. Mammary analog secretory carcinoma of salivary gland origin with the ETV6 gene rearrangement by FISH: expanded morphologic and immunohistochemical spectrum of a recently described entity.

    PubMed

    Connor, Ashton; Perez-Ordoñez, Bayardo; Shago, Mary; Skálová, Alena; Weinreb, Ilan

    2012-01-01

    Mammary analog secretory carcinoma (MASC) is a recently described tumor predominantly arising in the parotid gland. These tumors represent locally invasive malignancies with microcystic architecture, low-grade nuclei, and granular pink vacuolated cytoplasm. They display strong vimentin and S100 positivity and harbor an identical t(12;15)(p13;q25) to their breast counterpart, leading to a ETV6-NTRK3 fusion oncogene. These features help exclude the most important differential diagnostic considerations, namely, acinic cell carcinoma (AciCC) and low-grade cystadenocarcinoma, not otherwise specified. Here we present a series of 7 recent examples of MASC, which showed features not previously described. These 7 cases were observed in patients ranging in age from 14 to 77 years (mean, 40 y), occurred almost exclusively in male patients (6:1), and showed >50% (4 of 7 cases) involvement of the oral cavity, with only 2 arising in the parotid. The remaining case is the first reported in the submandibular gland. The tumors showed a variety of patterns including single macrocysts, combined macrocystic and microcystic spaces, and solid architecture. They showed prominent hobnailing in the cystic areas. Secretions within the cysts and tubular areas tended to be positive for periodic acid schiff, periodic acid schiff diastage and mucicarmine, the latter also showing occasional intracytoplasmic mucin droplets, a feature not previously recognized. One case showed prominent mucinous differentiation, which, coupled with high-molecular-weight keratins (HMWK) positivity, mimicked mucoepidermoid carcinoma (MEC). The tumors were generally positive for HMWK (6 of 7), S100 (5 of 7), vimentin, CK19, and other epithelial markers. The finding of duct involvement, proven with an incomplete p63-positive basal layer surrounding a minority of tumor cell nests and cysts, raised the possibility of a ductal epithelial origin for MASC. Alternatively, this could represent secondary ductal involvement by tumor. All cases showed rearrangement of the ETV6 gene by fluorescence in situ hybridization, confirming the diagnosis of MASC. These findings reinforce MASC as a unique low-grade salivary gland tumor entity with morphologic overlap with AciCC, MEC, and cystadenocarcinoma.

  10. Searching for molecular markers in head and neck squamous cell carcinomas (HNSCC) by statistical and bioinformatic analysis of larynx-derived SAGE libraries

    PubMed Central

    Silveira, Nelson JF; Varuzza, Leonardo; Machado-Lima, Ariane; Lauretto, Marcelo S; Pinheiro, Daniel G; Rodrigues, Rodrigo V; Severino, Patrícia; Nobrega, Francisco G; Silva, Wilson A; de B Pereira, Carlos A; Tajara, Eloiza H

    2008-01-01

    Background Head and neck squamous cell carcinoma (HNSCC) is one of the most common malignancies in humans. The average 5-year survival rate is one of the lowest among aggressive cancers, showing no significant improvement in recent years. When detected early, HNSCC has a good prognosis, but most patients present metastatic disease at the time of diagnosis, which significantly reduces survival rate. Despite extensive research, no molecular markers are currently available for diagnostic or prognostic purposes. Methods Aiming to identify differentially-expressed genes involved in laryngeal squamous cell carcinoma (LSCC) development and progression, we generated individual Serial Analysis of Gene Expression (SAGE) libraries from a metastatic and non-metastatic larynx carcinoma, as well as from a normal larynx mucosa sample. Approximately 54,000 unique tags were sequenced in three libraries. Results Statistical data analysis identified a subset of 1,216 differentially expressed tags between tumor and normal libraries, and 894 differentially expressed tags between metastatic and non-metastatic carcinomas. Three genes displaying differential regulation, one down-regulated (KRT31) and two up-regulated (BST2, MFAP2), as well as one with a non-significant differential expression pattern (GNA15) in our SAGE data were selected for real-time polymerase chain reaction (PCR) in a set of HNSCC samples. Consistent with our statistical analysis, quantitative PCR confirmed the upregulation of BST2 and MFAP2 and the downregulation of KRT31 when samples of HNSCC were compared to tumor-free surgical margins. As expected, GNA15 presented a non-significant differential expression pattern when tumor samples were compared to normal tissues. Conclusion To the best of our knowledge, this is the first study reporting SAGE data in head and neck squamous cell tumors. Statistical analysis was effective in identifying differentially expressed genes reportedly involved in cancer development. The differential expression of a subset of genes was confirmed in additional larynx carcinoma samples and in carcinomas from a distinct head and neck subsite. This result suggests the existence of potential common biomarkers for prognosis and targeted-therapy development in this heterogeneous type of tumor. PMID:19014460

  11. Magnifying Endoscopy with Narrow Band Imaging of Early Gastric Cancer: Correlation with Histopathology and Mucin Phenotype

    PubMed Central

    Ok, Kyung-Sun; Kim, Gwang Ha; Park, Do Youn; Lee, Hyun Jeong; Jeon, Hye Kyung; Baek, Dong Hoon; Lee, Bong Eun; Song, Geun Am

    2016-01-01

    Background/Aims Magnifying endoscopy with narrow band imaging (ME-NBI) is a useful modality for the detailed visualization of microsurface (MS) and microvascular (MV) structures in the gastrointestinal tract. This study aimed to determine whether the MS and MV patterns in ME-NBI differ according to the histologic type, invasion depth, and mucin phenotype of early gastric cancers (EGCs). Methods The MS and MV patterns of 160 lesions in 160 patients with EGC who underwent ME-NBI before endoscopic or surgical resection were prospectively collected and analyzed. EGCs were categorized as either differentiated or undifferentiated and as either mucosal or submucosal, and their mucin phenotypes were determined via immunohistochemistry of the tumor specimens. Results Differentiated tumors mainly displayed an oval and/or tubular MS pattern and a fine network or loop MV pattern, whereas undifferentiated tumors mainly displayed an absent MS pattern and a corkscrew MV pattern. The destructive MS pattern was associated with submucosal invasion, and this association was more prominent in the differentiated tumors than in the undifferentiated tumors. MUC5AC expression was increased in lesions with either a papillary or absent MS pattern and a corkscrew MV pattern, whereas MUC6 expression was increased in lesions with a papillary MS pattern and a loop MV pattern. CD10 expression was more frequent in lesions with a fine network MV pattern. Conclusions ME-NBI can be useful for predicting the histopathology and mucin phenotype of EGCs. PMID:27021504

  12. Reversal of hypermethylation and reactivation of glutathione S-transferase pi 1 gene by curcumin in breast cancer cell line.

    PubMed

    Kumar, Umesh; Sharma, Ujjawal; Rathi, Garima

    2017-02-01

    One of the mechanisms for epigenetic silencing of tumor suppressor genes is hypermethylation of cytosine residue at CpG islands at their promoter region that contributes to malignant progression of tumor. Therefore, activation of tumor suppressor genes that have been silenced by promoter methylation is considered to be very attractive molecular target for cancer therapy. Epigenetic silencing of glutathione S-transferase pi 1, a tumor suppressor gene, is involved in various types of cancers including breast cancer. Epigenetic silencing of tumor suppressor genes can be reversed by several molecules including natural compounds such as polyphenols that can act as a hypomethylating agent. Curcumin has been found to specifically target various tumor suppressor genes and alter their expression. To check the effect of curcumin on the methylation pattern of glutathione S-transferase pi 1 gene in MCF-7 breast cancer cell line in dose-dependent manner. To check the reversal of methylation pattern of hypermethylated glutathione S-transferase pi 1, MCF-7 breast cancer cell line was treated with different concentrations of curcumin for different time periods. DNA and proteins of treated and untreated cell lines were isolated, and methylation status of the promoter region of glutathione S-transferase pi 1 was analyzed using methylation-specific polymerase chain reaction assay, and expression of this gene was analyzed by immunoblotting using specific antibodies against glutathione S-transferase pi 1. A very low and a nontoxic concentration (10 µM) of curcumin treatment was able to reverse the hypermethylation and led to reactivation of glutathione S-transferase pi 1 protein expression in MCF-7 cells after 72 h of treatment, although the IC 50 value of curcumin was found to be at 20 µM. However, curcumin less than 3 µM of curcumin could not alter the promoter methylation pattern of glutathione S-transferase pi 1. Treatment of breast cancer MCF-7 cells with curcumin causes complete reversal of glutathione S-transferase pi 1 promoter hypermethylation and leads to re-expression of glutathione S-transferase pi 1, suggesting it to be an excellent nontoxic hypomethylating agent.

  13. Peri-tumoral leakage during intra-tumoral convection-enhanced delivery has implications for efficacy of peri-tumoral infusion before removal of tumor.

    PubMed

    Yang, Xiaoliang; Saito, Ryuta; Nakamura, Taigen; Zhang, Rong; Sonoda, Yukihiko; Kumabe, Toshihiro; Forsayeth, John; Bankiewicz, Krystof; Tominaga, Teiji

    2016-01-01

    In cases of malignant brain tumors, infiltrating tumor cells that exist at the tumor-surrounding brain tissue always escape from cytoreductive surgery and, protected by blood-brain barrier (BBB), survive the adjuvant chemoradiotherapy, eventually leading to tumor recurrence. Local interstitial delivery of chemotherapeutic agents is a promising strategy to target these cells. During our effort to develop effective drug delivery methods by intra-tumoral infusion of chemotherapeutic agents, we found consistent pattern of leakage from the tumor. Here we describe our findings and propose promising strategy to cover the brain tissue surrounding the tumor with therapeutic agents by means of convection-enhanced delivery. First, the intracranial tumor isograft model was used to define patterns of leakage from tumor mass after intra-tumoral infusion of the chemotherapeutic agents. Liposomal doxorubicin, although first distributed inside the tumor, distributed diffusely into the surrounding normal brain once the leakage happen. Trypan blue dye was used to evaluate the distribution pattern of peri-tumoral infusions. When infused intra- or peri-tumorally, infusates distributed robustly into the tumor border. Subsequently, volume of distributions with different infusion scheduling; including intra-tumoral infusion, peri-tumoral infusion after tumor resection, peri-tumoral infusion without tumor removal with or without systemic infusion of steroids, were compared with Evans-blue dye. Peri-tumoral infusion without tumor removal resulted in maximum volume of distribution. Prior use of steroids further increased the volume of distribution. Local interstitial drug delivery targeting tumor surrounding brain tissue before tumor removal should be more effective when targeting the invading cells.

  14. Preferential tumor cellular uptake and retention of indocyanine green for in vivo tumor imaging.

    PubMed

    Onda, Nobuhiko; Kimura, Masayuki; Yoshida, Toshinori; Shibutani, Makoto

    2016-08-01

    Indocyanine green (ICG) is a fluorescent agent approved for clinical applications by the Food and Drug Administration and European Medicines Agency. This study examined the mechanism of tumor imaging using intravenously administered ICG. The in vivo kinetics of intravenously administered ICG were determined in tumor xenografts using microscopic approaches that enabled both spatio-temporal and high-magnification analyses. The mechanism of ICG-based tumor imaging was examined at the cellular level in six phenotypically different human colon cancer cell lines exhibiting different grades of epithelioid organization. ICG fluorescence imaging detected xenograft tumors, even those < 1 mm in size, based on their preferential cellular uptake and retention of the dye following its rapid tissue-non-specific delivery, in contrast to its rapid clearance by normal tissue. Live-cell imaging revealed that cellular ICG uptake is temperature-dependent and occurs after ICG binding to the cellular membrane, a pattern suggesting endocytic uptake as the mechanism. Cellular ICG uptake correlated inversely with the formation of tight junctions. Intracellular ICG was entrapped in the membrane traffic system, resulting in its slow turnover and prolonged retention by tumor cells. Our results suggest that tumor-specific imaging by ICG involves non-specific delivery of the dye to tissues followed by preferential tumor cellular uptake and retention. The tumor cell-preference of ICG is driven by passive tumor cell-targeting, the inherent ability of ICG to bind to cell membranes, and the high endocytic activity of tumor cells in association with the disruption of their tight junctions. © 2016 UICC.

  15. Does tumor size have its prognostic role in colorectal cancer? Re-evaluating its value in colorectal adenocarcinoma with different macroscopic growth pattern.

    PubMed

    Dai, Weixing; Li, Yaqi; Meng, Xianke; Cai, Sanjun; Li, Qingguo; Cai, Guoxiang

    2017-09-01

    Few previous studies have taken the growth pattern into consideration when analyzing the prognostic value of tumor size in colorectal cancer (CRC). We sought to reveal the prognostic role of tumor size in different macroscopic growth patterns of CRC. Using Cancer Center datasets, we identified 4057 cases with colorectal adenocarcinoma treated with curative resection. Macroscopic growth patterns of tumors were classified into three types: infiltrative, ulcerative and expansive types based on tumor gross appearance. Univariate and multivariate Cox regression analyses were performed to evaluate the prognostic factors for overall survival (OS) and disease-free survival (DFS). In whole cohort, tumor size was an independent factor for OS (HR 1.10, 95%CI 1.04-1.16, p < 0.001). Subgroup analysis based on macroscopic growth pattern suggested that tumor size was an independent factor for OS both in the infiltrative (HR 1.37, 95%CI 1.12-1.66, p = 0.002) group and ulcerative group (HR 1.08, 95%CI 1.00-1.16, p = 0.044) and tumor size (HR 1.22, 95%CI 1.06-1.40, p = 0.004) was found as an independent factor for DFS only in infiltrative group. Tumor size is an independent factor for OS and DFS in patients with colorectal adenocarcinoma of infiltrative type, while only for OS in patients of ulcerative type. Copyright © 2017. Published by Elsevier Ltd.

  16. Targeting Heparan Sulfate Proteoglycans and their Modifying Enzymes to Enhance Anticancer Chemotherapy Efficacy and Overcome Drug Resistance.

    PubMed

    Lanzi, Cinzia; Zaffaroni, Nadia; Cassinelli, Giuliana

    2017-01-01

    Targeting heparan sulfate proteoglycans (HSPGs) and enzymes involved in heparan sulfate (HS) chain editing is emerging as a new anticancer strategy. The involvement of HSPGs in tumor cell signaling, inflammation, angiogenesis and metastasis indicates that agents able to inhibit aberrant HSPG functions can potentially act as multitarget drugs affecting both tumor cell growth and the supportive boost provided by the microenvironment. Moreover, accumulating evidence supports that an altered expression or function of HSPGs, or of the complex enzyme system regulating their activities, can also depress the tumor response to anticancer treatments in several tumor types. Thereby, targeting HSPGs or HSPG modifying enzymes appears an appealing approach to enhance chemotherapy efficacy. A great deal of effort from academia and industry has led to the development of agents mimicking HS, and/or inhibiting HSPG modifying enzymes. Inhibitors of Sulf-2, an endosulfatase that edits the HS sulfation pattern, and inhibitors of heparanase, the endoglycosidase that produces functional HS fragments, appear particularly promising. In fact, a Sulf-2 inhibitor (OKN-007), and two heparanase inhibitors/HS mimics (roneparstat, PG545) are currently under early clinical investigation. In this review, we summarized preclinical studies in experimental tumor models of the main chemical classes of Sulf-2 and heparanase inhibitors. We described examples of different mechanisms through which heparanase and HSPGs, often in cooperation, may impact tumor sensitivity to various antitumor agents. Finally, we reported a few preclinical studies showing increased antitumor efficacy obtained with the use of candidate clinical HS mimics in combination regimens. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Location of subventricular zone recurrence and its radiation dose predicts survival in patients with glioblastoma.

    PubMed

    Weinberg, Brent D; Boreta, Lauren; Braunstein, Steve; Cha, Soonmee

    2018-07-01

    Glioblastomas are aggressive brain tumors that frequently recur in the subventricular zone (SVZ) despite maximal treatment. The purpose of this study was to evaluate imaging patterns of subventricular progression and impact of recurrent subventricular tumor involvement and radiation dose to patient outcome. Retrospective review of 50 patients diagnosed with glioblastoma and treated with surgery, radiation, and concurrent temozolomide from January 2012 to June 2013 was performed. Tumors were classified based on location, size, and cortical and subventricular zone involvement. Survival was compared based on recurrence type, distance from the initial enhancing tumor (local ≤ 2 cm, distant > 2 cm), and the radiation dose at the recurrence site. Progression of enhancing subventricular tumor was common at both local (58%) and distant (42%) sites. Median survival was better after local SVZ recurrence than distant SVZ recurrence (8.7 vs. 4.3 months, p = 0.04). Radiation doses at local SVZ recurrence sites recurrence averaged 57.0 ± 4.0 Gy compared to 44.7 ± 6.7 Gy at distant SVZ recurrence sites (p = 0.008). Distant subventricular progression at a site receiving ≤ 45 Gy predicted worse subsequent survival (p = 0.05). Glioblastomas frequently recurred in the subventricular zone, and patient survival was worse when enhancing tumor occurred at sites that received lower radiation doses. This recurrent disease may represent disease undertreated at the time of diagnosis, and further study is needed to determine if improved treatment strategies, such as including the subventricular zone in radiation fields, could improve clinical outcomes.

  18. CD34-positive infantile myofibromatosis: Case report and review of hemangiopericytoma-like pattern tumors.

    PubMed

    Kiyohara, Takahiro; Maruta, Naoki; Iino, Shiro; Ido, Hideki; Tokuriki, Atsushi; Hasegawa, Minoru

    2016-09-01

    We describe a case of CD34-positive infantile myofibromatosis with hemangiopericytoma-like pattern. A 2-day-old Japanese boy presented with multiple hemispherical nodules on the extremities and back. There was a biphasic histological growth in the dermis, accompanied by a hemangiopericytoma-like pattern with antler-like branching vessels. Tumor cells were oval to spindle-shaped myoid cells with bland appearance. Immunohistochemically, vimentin, calponin and CD34 were positive, while α-smooth muscle actin, h-caldesmon, HHF35 and desmin were negative. Although CD34 was positive, the present case could be diagnosed as infantile myofibromatosis. Myopericytoma, myofibroma/myofibromatosis, glomus tumor, glomangiopericytoma and angioleiomyoma share a continuous spectrum of benign hemangiopericytoma-like pattern tumors. Myofibroma/myofibromatosis is nearly included in myopericytoma among pericytic (perivascular) tumors, and could be positive for CD34. Several immunohistochemical panels of smooth muscle markers are needed for the diagnosis of pericytic (perivascular) tumors. © 2016 Japanese Dermatological Association.

  19. Primary peritoneal serous carcinoma presenting as inflammatory breast cancer.

    PubMed

    Khalifeh, Ibrahim; Deavers, Michael T; Cristofanilli, Massimo; Coleman, Robert L; Malpica, Anais; Gilcrease, Michael Z

    2009-01-01

    Metastasis to the breast from extramammary malignancies is rare. Nevertheless, its recognition is important because the prognosis and treatment differ from that of primary breast cancer. We report a unique case of primary peritoneal serous carcinoma that initially presented as inflammatory breast cancer. The patient received neoadjuvant chemotherapy for breast cancer and subsequently underwent bilateral total mastectomy and bilateral sentinel lymph node biopsy. She was found to have extensive intralymphatic carcinoma in both breasts, with only focal minimal breast parenchymal involvement, and residual metastatic carcinoma in bilateral sentinel lymph nodes. Further work-up revealed pelvic ascites and omental nodularities. The patient underwent laparoscopic bilateral salpingo-oophorectomy, which revealed high-grade serous carcinoma involving both ovaries and fallopian tubes. Molecular testing of tumor from the ovary and axillary lymph node showed an identical pattern of allelic loss, confirming a common origin for both tumors. To our knowledge, this is the first reported case of an extramammary primary malignancy that not only presented as inflammatory breast cancer but also was diagnosed and initially treated as such.

  20. A Precious Diagnostic "Pearl": The Necklace Pattern in Germ Cell Tumors of the Testis.

    PubMed

    Snow, Justin; Mosquera, Juan Miguel; Scognamiglio, Theresa; Robinson, Brian D; Khani, Francesca

    2018-04-01

    Diffuse embryoma is a rare pattern of nonseminomatous germ cell tumor of the testis originally described in 1983. We report a case with this predominant pattern in an 18-year-old male with a painless palpable testicular mass. Although it is relatively common to see a diffuse embryoma pattern focally in mixed nonseminomatous germ cell tumors of the testis, it is rarely the predominant pattern and can represent a diagnostic pitfall on routine hematoxylin and eosin stain. We emphasize the importance of recognizing the individual components within the diffuse embryoma pattern, review the literature, and briefly discuss the ancillary immunohistochemical stains that may be utilized to help support the diagnosis.

  1. Resection of tumors of the neck of the pancreas with venous invasion: the "Whipple at the Splenic Artery (WATSA)" procedure.

    PubMed

    Strasberg, Steven M; Sanchez, Luis A; Hawkins, William G; Fields, Ryan C; Linehan, David C

    2012-05-01

    Tumors of the neck of the pancreas may involve the superior mesenteric and portal veins as well as the termination of the splenic vein. This presents a difficult problem since the pancreas cannot be transected through the neck as is standard in a Whipple procedure. Here, we present our method of resecting such tumors, which we term "Whipple at the Splenic Artery (WATSA)". The superior mesenteric and portal veins are isolated below and above the pancreas, respectively. The pancreas and splenic vein are divided just to the right of the point that the splenic artery contacts the superior border of the pancreas. This plane of transection is approximately 2 cm to the left of the pancreatic neck and away from the tumor. The superior mesenteric artery is cleared from the left side of the patient. With the specimen remaining attached only by the superior mesenteric and portal veins, these structures are clamped and divided. Reconstruction is performed with or without a superficial femoral vein graft. The splenic vein is not reconstructed. Ten cases have been performed to date without mortality. We have previously shown that the pattern of venous collateral development following occlusion of the termination of the splenic vein in the manner described is not similar to that of cases of sinistral (left sided) portal hypertension. Whipple at the splenic artery (WATSA) is a safe method for resection of tumors of the neck of the pancreas with vein involvement. It should be performed in high-volume pancreatic surgery centers.

  2. Peripheral neuroblastoma in a young Beagle dog.

    PubMed

    Matsushima, S; Maruyama, T; Torii, M

    1998-01-01

    A peripheral neuroblastoma was found in the abdominal cavity of a young male beagle dog. The large tumor mass involved the left kidney and both adrenal glands. Histologically, a major portion of the neoplasm consisted of lobulated sheets of small round cells with hyperchromatic nuclei mixed with polygonal cells and neuropil. Small clusters of polygonal cells with abundant eosinophilic cytoplasm and a trabecular growth pattern were observed adjacent to some of the tumor lobules. Small, round neoplastic cells metastasized to lumbar lymph nodes and also to the adrenal glands. The neoplastic cells were positive for neuron-specific enolase, synaptophysin, and neurofilament protein. Electron micrographs revealed intracytoplasmic dense core granules, microtubules, intermediate filaments, and desmosomes in the cytoplasm of the neoplastic cells.

  3. Loss of membranous Ep-CAM in budding colorectal carcinoma cells.

    PubMed

    Gosens, Marleen J E M; van Kempen, Léon C L; van de Velde, Cornelis J H; van Krieken, J Han J M; Nagtegaal, Iris D

    2007-02-01

    Tumor budding is a histological feature that reflects loss of adhesion of tumor cells and is associated with locoregional metastasis of colorectal carcinoma. Although nuclear localization of beta-catenin is associated with tumor budding, the molecular mechanism remains largely elusive. In this study, we hypothesize that the epithelial cell adhesion molecule (Ep-CAM) is involved in tumor budding. In order to address this question, we performed immunohistochemistry on Ep-CAM using three different antibodies (monoclonal antibodies Ber-ep4 and 311-1K1 and a polyclonal antibody) and a double staining on beta-catenin and Ep-CAM. In addition, Ep-CAM mRNA was monitored with mRNA in situ hybridization. Subsequently, we determined the effect of Ep-CAM staining patterns on tumor spread in rectal cancer. In contrast to the tumor mass, budding cells of colorectal carcinoma displayed lack of membranous but highly increased cytoplasmic Ep-CAM staining and nuclear translocation of beta-catenin. mRNA in situ hybridization suggested no differences in Ep-CAM expression between the invasive front and the tumor mass. Importantly, reduced Ep-CAM staining at the invasive margin of rectal tumor specimens (n=133) correlated significantly with tumor budding, tumor grade and an increased risk of local recurrence (P=0.001, P=0.04 and P=0.03, respectively). These data demonstrate abnormal processing of Ep-CAM at the invasive margin of colorectal carcinomas. Our observations indicate that loss of membranous Ep-CAM is associated with nuclear beta-catenin localization and suggest that this contributes to reduced cell-cell adhesions, increased migratory potential and tumor budding.

  4. Astroblastoma: a distinct tumor entity characterized by alterations of the X chromosome and MN1 rearrangement.

    PubMed

    Hirose, Takanori; Nobusawa, Sumihito; Sugiyama, Kazuhiko; Amatya, Vishwa J; Fujimoto, Naomi; Sasaki, Atsushi; Mikami, Yoshiki; Kakita, Akiyoshi; Tanaka, Shinya; Yokoo, Hideaki

    2017-10-09

    Astroblastoma is a rare, enigmatic tumor of the central nervous system (CNS) which shares some clinicopathologic aspects with other CNS tumors, especially ependymoma. To further clarify the nature of astroblastoma, we performed clinicopathologic and molecular genetic studies on eight cases of astroblastoma. The median age of the patients was 14.5 years, ranging from 5 to 60 years, and seven of the patients were female. All tumors arose in the cerebral hemisphere and radiologically appeared to be well-bordered, nodular tumors often associated with cystic areas and contrast-enhancement. Six of the seven patients with prognosis data survived without recurrences during the follow-up periods ranging from six to 76 months. One patient had multiple recurrences and died six years later. All tumors exhibited salient microscopic features, such as being well demarcated from the surrounding brain tissue, perivascular arrangement of epithelioid tumor cells (represented by "astroblastic" pseudorosettes, trabecular alignment, and pseudopapillary patterns), and hyalinized blood vessels. Immunoreactivity for GFAP, S-100 protein, Olig2, and EMA was variably demonstrated in all tumors, and IDH1 R132H and L1CAM were negative. Array comparative genomic hybridization revealed numerous heterozygous deletions on chromosome X in the four tumors studied, and break-apart fluorescence in situ hybridization demonstrated rearrangement of MN1 in five tumors with successful testing. The characteristic clinicopathologic and genetic findings support the idea that astroblastoma is distinct from other CNS tumors, in particular, ependymoma. In addition, MN1 rearrangement and aberrations of chromosome X may partly be involved in the pathogenesis of astroblastoma. © 2017 International Society of Neuropathology.

  5. Expression of plakophilin 3 in diffuse malignant pleural mesothelioma.

    PubMed

    Mašić, Silvija; Brčić, Luka; Krušlin, Božo; Šepac, Ana; Pigac, Biserka; Stančić-Rokotov, Dinko; Jakopović, Marko; Seiwerth, Sven

    2018-05-03

    Diffuse malignant pleural mesothelioma (DMPM) is the most common primary malignant pleural neoplasm still posing major diagnostic, prognostic and therapeutic challenges. Plakophilins are structural proteins considered to be important for cell stability and adhesion in both tumor and normal tissues. Plakophilin 3 is a protein present in desmosomes of stratified and simple epithelia of normal tissues with presence in malignant cells of various tumors where it participates in the process of tumorigenesis. The aim of this study was to investigate the expression of plakophilin 3 protein in DMPM, but also to study its prognostic significance and relation to histologically accessible parameters of aggressive growth. Archival samples of tissue with established diagnosis of DMPM and samples of normal pleural tissue were used. Tumor samples were classified into three histological types of DMPM (epithelioid, sarcomatoid and biphasic). Additional subclassification of epithelioid mesotheliomas into nine patterns based on the prevalent histological component of the tumor was then performed. After immunohistochemical staining, cytoplasmic and membrane immunopositivity of tumor cells was assesed by scoring the intensity of the staining from 0 (no staining) to 4 (very strong staining). Prognostic value and expression of plakophilin 3 with consideration to histologically estimated aggression in tumor growth were then statistically analyzed using non- parametric tests. The results demonstrated higher level of plakophilin 3 expression in tumor samples with histologically more aggressive tumor growth, but no significant prognostic value. According to our study, plakophilin 3 appears to be involved in tumor invasion in malignant mesothelioma.

  6. Selection for avian leukosis virus integration sites determines the clonal progression of B-cell lymphomas

    PubMed Central

    Malhotra, Sanandan; Justice, James; Morgan, Robin

    2017-01-01

    Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869

  7. Sorting Five Human Tumor Types Reveals Specific Biomarkers and Background Classification Genes.

    PubMed

    Roche, Kimberly E; Weinstein, Marvin; Dunwoodie, Leland J; Poehlman, William L; Feltus, Frank A

    2018-05-25

    We applied two state-of-the-art, knowledge independent data-mining methods - Dynamic Quantum Clustering (DQC) and t-Distributed Stochastic Neighbor Embedding (t-SNE) - to data from The Cancer Genome Atlas (TCGA). We showed that the RNA expression patterns for a mixture of 2,016 samples from five tumor types can sort the tumors into groups enriched for relevant annotations including tumor type, gender, tumor stage, and ethnicity. DQC feature selection analysis discovered 48 core biomarker transcripts that clustered tumors by tumor type. When these transcripts were removed, the geometry of tumor relationships changed, but it was still possible to classify the tumors using the RNA expression profiles of the remaining transcripts. We continued to remove the top biomarkers for several iterations and performed cluster analysis. Even though the most informative transcripts were removed from the cluster analysis, the sorting ability of remaining transcripts remained strong after each iteration. Further, in some iterations we detected a repeating pattern of biological function that wasn't detectable with the core biomarker transcripts present. This suggests the existence of a "background classification" potential in which the pattern of gene expression after continued removal of "biomarker" transcripts could still classify tumors in agreement with the tumor type.

  8. Collagen type IV alpha 1 (COL4A1) and collagen type XIII alpha 1 (COL13A1) produced in cancer cells promote tumor budding at the invasion front in human urothelial carcinoma of the bladder

    PubMed Central

    Miyake, Makito; Hori, Shunta; Morizawa, Yosuke; Tatsumi, Yoshihiro; Toritsuka, Michihiro; Ohnishi, Sayuri; Shimada, Keiji; Furuya, Hideki; Khadka, Vedbar S.; Deng, Youping; Ohnishi, Kenta; Iida, Kota; Gotoh, Daisuke; Nakai, Yasushi; Inoue, Takeshi; Anai, Satoshi; Torimoto, Kazumasa; Aoki, Katsuya; Tanaka, Nobumichi; Konishi, Noboru; Fujimoto, Kiyohide

    2017-01-01

    Current knowledge of the molecular mechanism driving tumor budding is limited. Here, we focused on elucidating the detailed mechanism underlying tumor budding in urothelial cancer of the bladder. Invasive urothelial cancer was pathologically classified into three groups as follows: nodular, trabecular, and infiltrative (tumor budding). Pathohistological analysis of the orthotopic tumor model revealed that human urothelial cancer cell lines MGH-U3, UM-UC-14, and UM-UC-3 displayed typical nodular, trabecular, and infiltrative patterns, respectively. Based on the results of comprehensive gene expression analysis using microarray (25 K Human Oligo chip), we identified two collagens, COL4A1 and COL13A1, which may contribute to the formation of the infiltrative pattern. Visualization of protein interaction networks revealed that proteins associated with connective tissue disorders, epithelial-mesenchymal transition, growth hormone, and estrogen were pivotal factors in tumor cells. To evaluate the invasion pattern of tumor cells in vitro, 3-D collective cell invasion assay using Matrigel was performed. Invadopodial formation was evaluated using Gelatin Invadopodia Assay. Knockdown of collagens with siRNA led to dramatic changes in invasion patterns and a decrease in invasion capability through decreased invadopodia. The in vivo orthotopic experimental model of bladder tumors showed that intravesical treatment with siRNA targeting COL4A1 and COL13A1 inhibited the formation of the infiltrative pattern. COL4A1 and COL13A1 production by cancer cells plays a pivotal role in tumor invasion through the induction of tumor budding. Blocking of these collagens may be an attractive therapeutic approach for treatment of human urothelial cancer of the bladder. PMID:28415608

  9. The energy landscape of a selective tumor-homing pentapeptide

    PubMed Central

    Zanuy, David; Flores-Ortega, Alejandra; Casanovas, Jordi; Curco, David; Nussinov, Ruth; Aleman, Carlos

    2009-01-01

    Recently, a potentially powerful strategy based on the of phage-display libraries has been presented to target tumors via homing peptides attached to nanoparticles. The Cys-Arg-Glu-Lys-Ala (CREKA) peptide sequence has been identified as a tumor-homing peptide that binds to clotted plasmas proteins present in tumor vessels and interstitium. The aim of this work consists of mapping the conformational profile of CREKA to identify the bioactive conformation. For this purpose, a conformational search procedure based on modified Simulated Annealing combined with Molecular Dynamics was applied to three systems that mimic the experimentally used conditions: (i) the free peptide; (ii) the peptide attached to a nanoparticle; and (iii) the peptide inserted in a phage display protein. In addition, the free peptide was simulated in an ionized aqueous solution environment, which mimics the ionic strength of the physiological medium. Accessible minima of all simulated systems reveal a multiple interaction pattern involving the ionized side chains of Arg, Glu and Lys, which induces a β-turn motif in the backbone observed in all simulated CREKA systems. PMID:18588341

  10. Alterations in expression pattern of splicing factors in epithelial ovarian cancer and its clinical impact.

    PubMed

    Iborra, Severine; Hirschfeld, Marc; Jaeger, Markus; Zur Hausen, Axel; Braicu, Iona; Sehouli, Jalid; Gitsch, Gerald; Stickeler, Elmar

    2013-07-01

    Alternative splicing represents an important nuclear mechanism in the posttranscriptional regulation of gene expression, which is frequently altered during tumorigenesis. Previously, we described marked changes in alternative splicing of the CD44 gene in ovarian and breast cancer as well as specific induction of distinct splicing factors during tumor development. The present study was focused on the expression profiles of different splicing factors, including classical serine-arginine (SR) proteins including ASF/SF2, hTra2β1, hTra2α, and Y-box-binding protein (YB-1) in physiological and malignant epithelial ovarian tissue to evaluate their expression pattern with regard to tumor development and disease progression. Expression levels of the different splicing factors were analyzed in physiological epithelial ovarian tissue samples, primary tumors, and metastatic samples of patients with a diagnosis of epithelial ovarian cancer using quantified reverse transcription polymerase chain reaction analysis. We examined more closely the splicing factor hTra2β1 using Western blot analysis and immunohistochemistry. The analysis revealed a marked and specific induction of ASF/SF2, SRp20, hTra2β1, and YB-1 in primary tumors as well as in their metastatic sites. However, in our patient cohort, no induction was seen for the other investigated splicing factors SRp55, SRp40, and hTra2α. Our results suggest a specific induction of distinct splicing factors in ovarian cancer tumorigenesis. The involvement of hTra2β1, YB-1, SRp20, and ASF/SF2 in exon recognition and alternative splicing may be important for gene regulation of alternatively spliced genes like CD44 with potential functional consequences in this tumor type leading to progression and metastasis.

  11. COMPREHENSIVE MOLECULAR CHARACTERIZATION OF CLEAR CELL RENAL CELL CARCINOMA

    PubMed Central

    2013-01-01

    Genetic changes underlying clear cell renal cell carcinoma (ccRCC) include alterations in genes controlling cellular oxygen sensing (e.g. VHL) and the maintenance of chromatin states (e.g. PBRM1). We surveyed more than 400 tumors using different genomic platforms and identified 19 significantly mutated genes. The PI3K/Akt pathway was recurrently mutated, suggesting this pathway as a potential therapeutic target. Widespread DNA hypomethylation was associated with mutation of the H3K36 methyltransferase SETD2, and integrative analysis suggested that mutations involving the SWI/SNF chromatin remodeling complex (PBRM1, ARID1A, SMARCA4) could have far-reaching effects on other pathways. Aggressive cancers demonstrated evidence of a metabolic shift, involving down-regulation of genes involved in the TCA cycle, decreased AMPK and PTEN protein levels, up-regulation of the pentose phosphate pathway and the glutamine transporter genes, increased acetyl-CoA carboxylase protein, and altered promoter methylation of miR-21 and GRB10. Remodeling cellular metabolism thus constitutes a recurrent pattern in ccRCC that correlates with tumor stage and severity and offers new views on the opportunities for disease treatment. PMID:23792563

  12. An integrated genomics analysis of epigenetic subtypes in human breast tumors links DNA methylation patterns to chromatin states in normal mammary cells.

    PubMed

    Holm, Karolina; Staaf, Johan; Lauss, Martin; Aine, Mattias; Lindgren, David; Bendahl, Pär-Ola; Vallon-Christersson, Johan; Barkardottir, Rosa Bjork; Höglund, Mattias; Borg, Åke; Jönsson, Göran; Ringnér, Markus

    2016-02-29

    Aberrant DNA methylation is frequently observed in breast cancer. However, the relationship between methylation patterns and the heterogeneity of breast cancer has not been comprehensively characterized. Whole-genome DNA methylation analysis using Illumina Infinium HumanMethylation450 BeadChip arrays was performed on 188 human breast tumors. Unsupervised bootstrap consensus clustering was performed to identify DNA methylation epigenetic subgroups (epitypes). The Cancer Genome Atlas data, including methylation profiles of 669 human breast tumors, was used for validation. The identified epitypes were characterized by integration with publicly available genome-wide data, including gene expression levels, DNA copy numbers, whole-exome sequencing data, and chromatin states. We identified seven breast cancer epitypes. One epitype was distinctly associated with basal-like tumors and with BRCA1 mutations, one epitype contained a subset of ERBB2-amplified tumors characterized by multiple additional amplifications and the most complex genomes, and one epitype displayed a methylation profile similar to normal epithelial cells. Luminal tumors were stratified into the remaining four epitypes, with differences in promoter hypermethylation, global hypomethylation, proliferative rates, and genomic instability. Specific hyper- and hypomethylation across the basal-like epitype was rare. However, we observed that the candidate genomic instability drivers BRCA1 and HORMAD1 displayed aberrant methylation linked to gene expression levels in some basal-like tumors. Hypomethylation in luminal tumors was associated with DNA repeats and subtelomeric regions. We observed two dominant patterns of aberrant methylation in breast cancer. One pattern, constitutively methylated in both basal-like and luminal breast cancer, was linked to genes with promoters in a Polycomb-repressed state in normal epithelial cells and displayed no correlation with gene expression levels. The second pattern correlated with gene expression levels and was associated with methylation in luminal tumors and genes with active promoters in normal epithelial cells. Our results suggest that hypermethylation patterns across basal-like breast cancer may have limited influence on tumor progression and instead reflect the repressed chromatin state of the tissue of origin. On the contrary, hypermethylation patterns specific to luminal breast cancer influence gene expression, may contribute to tumor progression, and may present an actionable epigenetic alteration in a subset of luminal breast cancers.

  13. Perivascular Epithelioid Cell Tumor of the Uterus with Ovarian Involvement: A Case Report and Review of the Literature

    PubMed Central

    Fitzpatrick, Megan; Pulver, Tanya; Klein, Molly; Murugan, Paari; Khalifa, Mahmoud; Amin, Khalid

    2016-01-01

    Patient: Female, 61 Final Diagnosis: Uterine PEComa with ovarian involvement Symptoms: Palpable abdominal mass Medication: — Clinical Procedure: Hysterectomy and bilateral salpingo-oophorectomy Specialty: Obstetrics and Gynecology Objective: Rare disease Background: Perivascular epithelioid cell tumors (PEComas) are a rare group of neoplasms composed of epithelioid cells that express both melanocytic and myoid markers. When considering PEComas of the female genital tract, the uterus is the most common location. Involvement of the ovary in the context of a primary uterine PEComa, in the absence of systemic disease associated with tuberous sclerosis, however, has only been reported in 1 previous case. Case Report: We report a case of a PEComa of the uterus with metastasis to the left ovary in a 61-year-old Caucasian woman. Gross examination of the uterus revealed a 10.7×10.5×10.2 cm tan-brown, mostly solid, partially cystic mass. Microscopic examination showed epithelioid cells with clear to eosinophilic cytoplasm, arranged in fascicles. Intranuclear pseudoinclusions were also noted. The tumor cells were smooth muscle actin, caldesmon, and desmin positive (diffuse); HMB-45 positive (focal); and Melan-A, AE1/AE3, CD10, and S100 negative by immunohistochemistry. Conclusions: Distinguishing among mesenchymal neoplasms, including PEComas, endometrial stromal sarcomas, and leiomyosarcomas, can be difficult. Careful analysis of morphologic and immunohistochemical features is of the utmost importance. Differential diagnosis, including morphologic features and immunohistochemical patterns, is also discussed. PMID:27150246

  14. Genome-Wide Transcriptional Reorganization Associated with Senescence-to-Immortality Switch during Human Hepatocellular Carcinogenesis

    PubMed Central

    Konu, Ozlen; Yuzugullu, Haluk; Gursoy-Yuzugullu, Ozge; Ozturk, Nuri; Ozen, Cigdem; Ozdag, Hilal; Erdal, Esra; Karademir, Sedat; Sagol, Ozgul; Mizrak, Dilsa; Bozkaya, Hakan; Ilk, Hakki Gokhan; Ilk, Ozlem; Bilen, Biter; Cetin-Atalay, Rengul; Akar, Nejat; Ozturk, Mehmet

    2013-01-01

    Senescence is a permanent proliferation arrest in response to cell stress such as DNA damage. It contributes strongly to tissue aging and serves as a major barrier against tumor development. Most tumor cells are believed to bypass the senescence barrier (become “immortal”) by inactivating growth control genes such as TP53 and CDKN2A. They also reactivate telomerase reverse transcriptase. Senescence-to-immortality transition is accompanied by major phenotypic and biochemical changes mediated by genome-wide transcriptional modifications. This appears to happen during hepatocellular carcinoma (HCC) development in patients with liver cirrhosis, however, the accompanying transcriptional changes are virtually unknown. We investigated genome-wide transcriptional changes related to the senescence-to-immortality switch during hepatocellular carcinogenesis. Initially, we performed transcriptome analysis of senescent and immortal clones of Huh7 HCC cell line, and identified genes with significant differential expression to establish a senescence-related gene list. Through the analysis of senescence-related gene expression in different liver tissues we showed that cirrhosis and HCC display expression patterns compatible with senescent and immortal phenotypes, respectively; dysplasia being a transitional state. Gene set enrichment analysis revealed that cirrhosis/senescence-associated genes were preferentially expressed in non-tumor tissues, less malignant tumors, and differentiated or senescent cells. In contrast, HCC/immortality genes were up-regulated in tumor tissues, or more malignant tumors and progenitor cells. In HCC tumors and immortal cells genes involved in DNA repair, cell cycle, telomere extension and branched chain amino acid metabolism were up-regulated, whereas genes involved in cell signaling, as well as in drug, lipid, retinoid and glycolytic metabolism were down-regulated. Based on these distinctive gene expression features we developed a 15-gene hepatocellular immortality signature test that discriminated HCC from cirrhosis with high accuracy. Our findings demonstrate that senescence bypass plays a central role in hepatocellular carcinogenesis engendering systematic changes in the transcription of genes regulating DNA repair, proliferation, differentiation and metabolism. PMID:23691139

  15. Proteomic Approaches Identify Members of Cofilin Pathway Involved in Oral Tumorigenesis

    PubMed Central

    Polachini, Giovana M.; Sobral, Lays M.; Mercante, Ana M. C.; Paes-Leme, Adriana F.; Xavier, Flávia C. A.; Henrique, Tiago; Guimarães, Douglas M.; Vidotto, Alessandra; Fukuyama, Erica E.; Góis-Filho, José F.; Cury, Patricia M.; Curioni, Otávio A.; Michaluart Jr, Pedro; Silva, Adriana M. A.; Wünsch-Filho, Victor; Nunes, Fabio D.; Leopoldino, Andréia M.; Tajara, Eloiza H.

    2012-01-01

    The prediction of tumor behavior for patients with oral carcinomas remains a challenge for clinicians. The presence of lymph node metastasis is the most important prognostic factor but it is limited in predicting local relapse or survival. This highlights the need for identifying biomarkers that may effectively contribute to prediction of recurrence and tumor spread. In this study, we used one- and two-dimensional gel electrophoresis, mass spectrometry and immunodetection methods to analyze protein expression in oral squamous cell carcinomas. Using a refinement for classifying oral carcinomas in regard to prognosis, we analyzed small but lymph node metastasis-positive versus large, lymph node metastasis-negative tumors in order to contribute to the molecular characterization of subgroups with risk of dissemination. Specific protein patterns favoring metastasis were observed in the “more-aggressive” group defined by the present study. This group displayed upregulation of proteins involved in migration, adhesion, angiogenesis, cell cycle regulation, anti-apoptosis and epithelial to mesenchymal transition, whereas the “less-aggressive” group was engaged in keratinocyte differentiation, epidermis development, inflammation and immune response. Besides the identification of several proteins not yet described as deregulated in oral carcinomas, the present study demonstrated for the first time the role of cofilin-1 in modulating cell invasion in oral carcinomas. PMID:23227181

  16. Perivascular Epithelioid Cell Tumor of the Uterus with Ovarian Involvement: A Case Report and Review of the Literature.

    PubMed

    Fitzpatrick, Megan; Pulver, Tanya; Klein, Molly; Murugan, Paari; Khalifa, Mahmoud; Amin, Khalid

    2016-05-06

    Perivascular epithelioid cell tumors (PEComas) are a rare group of neoplasms composed of epithelioid cells that express both melanocytic and myoid markers. When considering PEComas of the female genital tract, the uterus is the most common location. Involvement of the ovary in the context of a primary uterine PEComa, in the absence of systemic disease associated with tuberous sclerosis, however, has only been reported in 1 previous case. We report a case of a PEComa of the uterus with metastasis to the left ovary in a 61-year-old Caucasian woman. Gross examination of the uterus revealed a 10.7×10.5×10.2 cm tan-brown, mostly solid, partially cystic mass. Microscopic examination showed epithelioid cells with clear to eosinophilic cytoplasm, arranged in fascicles. Intranuclear pseudoinclusions were also noted. The tumor cells were smooth muscle actin, caldesmon, and desmin positive (diffuse); HMB-45 positive (focal); and Melan-A, AE1/AE3, CD10, and S100 negative by immunohistochemistry. Distinguishing among mesenchymal neoplasms, including PEComas, endometrial stromal sarcomas, and leiomyosarcomas, can be difficult. Careful analysis of morphologic and immunohistochemical features is of the utmost importance. Differential diagnosis, including morphologic features and immunohistochemical patterns, is also discussed.

  17. Tumor growth affects the metabonomic phenotypes of multiple mouse non-involved organs in an A549 lung cancer xenograft model.

    PubMed

    Xu, Shan; Tian, Yuan; Hu, Yili; Zhang, Nijia; Hu, Sheng; Song, Dandan; Wu, Zhengshun; Wang, Yulan; Cui, Yanfang; Tang, Huiru

    2016-06-22

    The effects of tumorigenesis and tumor growth on the non-involved organs remain poorly understood although many research efforts have already been made for understanding the metabolic phenotypes of various tumors. To better the situation, we systematically analyzed the metabolic phenotypes of multiple non-involved mouse organ tissues (heart, liver, spleen, lung and kidney) in an A549 lung cancer xenograft model at two different tumor-growth stages using the NMR-based metabonomics approaches. We found that tumor growth caused significant metabonomic changes in multiple non-involved organ tissues involving numerous metabolic pathways, including glycolysis, TCA cycle and metabolisms of amino acids, fatty acids, choline and nucleic acids. Amongst these, the common effects are enhanced glycolysis and nucleoside/nucleotide metabolisms. These findings provided essential biochemistry information about the effects of tumor growth on the non-involved organs.

  18. Xp11.2 translocation renal cell carcinoma occurring during pregnancy with a novel translocation involving chromosome 19: a case report with review of the literature

    PubMed Central

    Armah, Henry B; Parwani, Anil V; Surti, Urvashi; Bastacky, Sheldon I

    2009-01-01

    The recently recognized renal cell carcinomas (RCCs) associated with Xp11.2 translocations (TFE3 transcription factor gene fusions) are rare tumors predominantly reported in children. They comprise at least one-third of pediatric RCCs and only few adult cases have been reported. Here, we present a case of Xp11.2 translocation RCC in 26-year-old pregnant female. Her routine antenatal ultrasonography accidentally found a complex cystic right renal mass. Further radiologic studies revealed unilocular cyst with multiple mural nodules at inferior pole of right kidney, which was suspicious for RCC. She underwent right radical nephrectomy at 15 weeks gestation. Macroscopically, the cystic tumor was well encapsulated with multiple friable mural nodules on its inner surface. Microscopically, the tumor consisted of clear and eosinophilic/oncocytic voluminous cells arranged in papillary, trabecular, and nested/alveolar patterns. Occasional hyaline nodules and numerous psammoma bodies were present. Immunohistochemically, the tumor showed strong nuclear positivity for TFE3. Epithelial membrane antigen, CD10, and E-cadherin were strongly positive. Cytokeratin AE1/AE3, cytokeratin CAM-5.2, calveolin, and parvalbumin were moderately positive. Cytokeratin 7, renal cell carcinoma antigen, and colloidal iron were focally weakly positive. BerEP4 and carbonic anhydrase IX were negative. Cytogenetically, the tumor harbored a novel variant translocation involving chromosomes X and 19, t(X;19)(p11.2;q13.1). Interphase FISH analysis performed on cultured and uncultured tumor cells using a dual-color break-apart DNA probe within the BCL3 gene on 19q13.3 was negative for the BCL3 gene rearrangement. She received no adjuvant therapy, delivered a normal term baby five months later, and is alive without evidence of disease 27 months after diagnosis and surgery. Unlike most recently reported Xp11.2 translocation RCCs in adult patients with aggressive clinical course, this adult case occurring during pregnancy with a novel translocation involving chromosome 19 followed an indolent clinical course. PMID:19450277

  19. Xp11.2 translocation renal cell carcinoma occurring during pregnancy with a novel translocation involving chromosome 19: a case report with review of the literature.

    PubMed

    Armah, Henry B; Parwani, Anil V; Surti, Urvashi; Bastacky, Sheldon I

    2009-05-18

    The recently recognized renal cell carcinomas (RCCs) associated with Xp11.2 translocations (TFE3 transcription factor gene fusions) are rare tumors predominantly reported in children. They comprise at least one-third of pediatric RCCs and only few adult cases have been reported. Here, we present a case of Xp11.2 translocation RCC in 26-year-old pregnant female. Her routine antenatal ultrasonography accidentally found a complex cystic right renal mass. Further radiologic studies revealed unilocular cyst with multiple mural nodules at inferior pole of right kidney, which was suspicious for RCC. She underwent right radical nephrectomy at 15 weeks gestation. Macroscopically, the cystic tumor was well encapsulated with multiple friable mural nodules on its inner surface. Microscopically, the tumor consisted of clear and eosinophilic/oncocytic voluminous cells arranged in papillary, trabecular, and nested/alveolar patterns. Occasional hyaline nodules and numerous psammoma bodies were present.Immunohistochemically, the tumor showed strong nuclear positivity for TFE3. Epithelial membrane antigen, CD10, and E-cadherin were strongly positive. Cytokeratin AE1/AE3, cytokeratin CAM-5.2, calveolin, and parvalbumin were moderately positive. Cytokeratin 7, renal cell carcinoma antigen, and colloidal iron were focally weakly positive. BerEP4 and carbonic anhydrase IX were negative. Cytogenetically, the tumor harbored a novel variant translocation involving chromosomes X and 19, t(X;19)(p11.2;q13.1). Interphase FISH analysis performed on cultured and uncultured tumor cells using a dual-color break-apart DNA probe within the BCL3 gene on 19q13.3 was negative for the BCL3 gene rearrangement. She received no adjuvant therapy, delivered a normal term baby five months later, and is alive without evidence of disease 27 months after diagnosis and surgery. Unlike most recently reported Xp11.2 translocation RCCs in adult patients with aggressive clinical course, this adult case occurring during pregnancy with a novel translocation involving chromosome 19 followed an indolent clinical course.

  20. Breast cancer lung metastasis: Molecular biology and therapeutic implications.

    PubMed

    Jin, Liting; Han, Bingchen; Siegel, Emily; Cui, Yukun; Giuliano, Armando; Cui, Xiaojiang

    2018-03-26

    Distant metastasis accounts for the vast majority of deaths in patients with cancer. Breast cancer exhibits a distinct metastatic pattern commonly involving bone, liver, lung, and brain. Breast cancer can be divided into different subtypes based on gene expression profiles, and different breast cancer subtypes show preference to distinct organ sites of metastasis. Luminal breast tumors tend to metastasize to bone while basal-like breast cancer (BLBC) displays a lung tropism of metastasis. However, the mechanisms underlying this organ-specific pattern of metastasis still remain to be elucidated. In this review, we will summarize the recent advances regarding the molecular signaling pathways as well as the therapeutic strategies for treating breast cancer lung metastasis.

  1. Gene expression profiles in primary pancreatic tumors and metastatic lesions of Ela-c-myc transgenic mice.

    PubMed

    Thakur, Archana; Bollig, Aliccia; Wu, Jiusheng; Liao, Dezhong J

    2008-01-24

    Pancreatic carcinoma usually is a fatal disease with no cure, mainly due to its invasion and metastasis prior to diagnosis. We analyzed the gene expression profiles of paired primary pancreatic tumors and metastatic lesions from Ela-c-myc transgenic mice in order to identify genes that may be involved in the pancreatic cancer progression. Differentially expressed selected genes were verified by semi-quantitative and quantitative RT-PCR. To further evaluate the relevance of some of the selected differentially expressed genes, we investigated their expression pattern in human pancreatic cancer cell lines with high and low metastatic potentials. Data indicate that genes involved in posttranscriptional regulation were a major functional category of upregulated genes in both primary pancreatic tumors (PT) and liver metastatic lesions (LM) compared to normal pancreas (NP). In particular, differential expression for splicing factors, RNA binding/pre-mRNA processing factors and spliceosome related genes were observed, indicating that RNA processing and editing related events may play critical roles in pancreatic tumor development and progression. High expression of insulin growth factor binding protein-1 (Igfbp1) and Serine proteinase inhibitor A1 (Serpina1), and low levels or absence of Wt1 gene expression were exclusive to liver metastatic lesion samples. We identified Igfbp1, Serpina1 and Wt1 genes that are likely to be clinically useful biomarkers for prognostic or therapeutic purposes in metastatic pancreatic cancer, particularly in pancreatic cancer where c-Myc is overexpressed.

  2. Dynamic infrared imaging for biological and medical applications in Boron neutron capture therapy

    NASA Astrophysics Data System (ADS)

    Santa Cruz, Gustavo A.; González, Sara J.; Dagrosa, Alejandra; Schwint, Amanda E.; Carpano, Marina; Trivillin, Verónica A.; Boggio, Esteban F.; Bertotti, José; Marín, Julio; Monti Hughes, Andrea; Molinari, Ana J.; Albero, Miguel

    2011-05-01

    Boron Neutron Capture Therapy (BNCT) is a treatment modality, currently focused on the treatment of cancer, which involves a tumor selective 10B compound and a specially tuned neutron beam to produce a lethal nuclear reaction. BNCT kills target cells with microscopic selectivity while sparing normal tissues from potentially lethal doses of radiation. In the context of the Argentine clinical and research BNCT projects at the National Atomic Energy Commission and in a strong collaboration with INVAP SE, we successfully implemented Dynamic Infrared Imaging (DIRI) in the clinical setting for the observation of cutaneous melanoma patients and included DIRI as a non invasive methodology in several research protocols involving small animals. We were able to characterize melanoma lesions in terms of temperature and temperature rate-of-recovery after applying a mild cold thermal stress, distinguishing melanoma from other skin pigmented lesions. We observed a spatial and temporal correlation between skin acute reactions after irradiation, the temperature pattern and the dose distribution. We studied temperature distribution as a function of tumor growth in mouse xenografts, observing a significant correlation between tumor temperature and drug uptake; we investigated temperature evolution in the limbs of Wistar rats for a protocol of induced rheumatoid arthritis (RA), DIRI being especially sensitive to RA induction even before the development of clinical signs and studied surface characteristics of tumors, precancerous and normal tissues in a model of oral cancer in the hamster cheek pouch.

  3. Diffusion tensor eigenvector directional color imaging patterns in the evaluation of cerebral white matter tracts altered by tumor.

    PubMed

    Field, Aaron S; Alexander, Andrew L; Wu, Yu-Chien; Hasan, Khader M; Witwer, Brian; Badie, Behnam

    2004-10-01

    To categorize the varied appearances of tumor-altered white matter (WM) tracts on diffusion tensor eigenvector directional color maps. Diffusion tensor imaging (DTI) was obtained preoperatively in 13 patients with brain tumors ranging from benign to high-grade malignant, including primary and metastatic lesions, and maps of apparent diffusion coefficient (ADC), fractional anisotropy (FA), and major eigenvector direction were generated. Regions of interest (ROIs) were drawn within identifiable WM tracts affected by tumor, avoiding grossly cystic and necrotic regions, known fiber crossings, and gray matter. Patterns of WM tract alteration were categorized on the basis of qualitative analysis of directional color maps and correlation analysis of ADC and FA. Four basic patterns of WM alteration were identified: 1) normal or nearly normal FA and ADC, with abnormal tract location or tensor directions attributable to bulk mass displacement, 2) moderately decreased FA and increased ADC with normal tract locations and tensor directions, 3) moderately decreased FA and increased ADC with abnormal tensor directions, and 4) near isotropy. FA and ADC were inversely correlated for Patterns 1-3 but did not discriminate edema from infiltrating tumor. However, in the absence of mass displacement, infiltrating tumor was found to produce tensor directional changes that were not observed with vasogenic edema, suggesting the possibility of discrimination on the basis of directional statistics. Tumor alteration of WM tracts tends to produce one of four patterns on FA and directional color maps. Clinical application of these patterns must await further study. Copyright 2004 Wiley-Liss, Inc.

  4. Mullerian papilloma-like proliferation arising in cystic pelvic endosalpingiosis.

    PubMed

    McCluggage, W Glenn; O'Rourke, Declan; McElhenney, Clodagh; Crooks, Michael

    2002-09-01

    This report describes an unusual epithelial proliferation occurring in pelvic cystic endosalpingiosis. A cyst mass lined by a layer of ciliated epithelial cells involved the posterior surface of the cervix and vagina. The epithelial proliferation within the wall resembled a mullerian papilloma with fibrous and fibrovascular cores lined by bland cuboidal epithelial cells. Other areas had a microglandular growth pattern resembling cervical microglandular hyperplasia, and focally there was a solid growth pattern. Foci of typical endosalpingiosis involved the surface of both ovaries and pelvic soft tissues. The cystic lesion recurred after partial cystectomy and drainage and was followed up radiologically and with periodic fine-needle aspiration. Part of the wall of the cyst removed 11 years after the original surgery showed an identical epithelial proliferation. MIB1 staining showed a proliferation index of less than 5%, contrasting with the higher proliferation index of a typical serous borderline tumor. The differential diagnosis is discussed. As far as we are aware, this is the first report of such a benign epithelial proliferation involving cystic endosalpingiosis. Copyright 2002, Elsevier Science (USA). All rights reserved.

  5. Vascular Pattern Analysis on Microvascular Sonography for Differentiation of Pleomorphic Adenomas and Warthin Tumors of Salivary Glands.

    PubMed

    Ryoo, Inseon; Suh, Sangil; Lee, Young Hen; Seo, Hyung Suk; Seol, Hae Young; Woo, Jeong-Soo; Kim, Soo Chin

    2018-03-01

    Pleomorphic adenomas and Warthin tumors are the most common salivary gland tumors. It is important to differentiate between them because at least a partial parotidectomy is necessary for pleomorphic adenomas, whereas enucleation is sufficient for Warthin tumors. This study aimed to evaluate the usefulness of vascular pattern analysis using microvascular sonography to differentiate between the tumors. Sixty-two patients with pathologically proven pleomorphic adenomas (n = 38) and Warthin tumors (n = 24) were included. For all tumors, grayscale, power Doppler, and microvascular sonographic examinations were performed. Differences in vascular patterns (vascular distribution and internal vascularity) on power Doppler and microvascular sonography as well as grayscale sonographic features (size, shape, border, echogenicity, heterogeneity, and cystic change) between pleomorphic adenomas and Warthin tumors were evaluated. A comparison of diagnostic performances of grayscale sonography with power Doppler sonography and grayscale sonography with microvascular sonography was performed. The level of interobserver agreement between 2 reviewers in diagnosing tumors was evaluated. No grayscale sonographic features showed a significant difference between the tumors. Vascular distributions and internal vascularity on power Doppler sonography (P = .01 and .002) and microvascular sonography (both P < .001) were all significantly different. The diagnostic accuracy of grayscale sonography with microvascular sonography (79.0%) was higher than that of grayscale sonography with power Doppler sonography (72.6%). This difference was significant according to the McNemar test (P = .004). Interobserver agreement was excellent in diagnosing tumors on both grayscale sonography with power Doppler sonography (κ = 0.83) and grayscale sonography with microvascular sonography (κ = 0.94). Vascular pattern analysis using microvascular sonography with other sonographic features is helpful for differentiating between pleomorphic adenomas and Warthin tumors. © 2017 by the American Institute of Ultrasound in Medicine.

  6. Neoadjuvant Chemotherapy of Ovarian Cancer Results in Three Patterns of Tumor-Infiltrating Lymphocyte Response with Distinct Implications for Immunotherapy.

    PubMed

    Lo, Charlotte S; Sanii, Sanaz; Kroeger, David R; Milne, Katy; Talhouk, Aline; Chiu, Derek S; Rahimi, Kurosh; Shaw, Patricia A; Clarke, Blaise A; Nelson, Brad H

    2017-02-15

    Purpose: Some forms of chemotherapy can enhance antitumor immunity through immunogenic cell death, resulting in increased T-cell activation and tumor infiltration. Such effects could potentially sensitize tumors to immunotherapies, including checkpoint blockade. We investigated whether platinum- and taxane-based chemotherapy for ovarian cancer induces immunologic changes consistent with this possibility. Experimental Design: Matched pre- and post-neoadjuvant chemotherapy tumor samples from 26 high-grade serous carcinoma (HGSC) patients were analyzed by immunohistochemistry (IHC) for a large panel of immune cells and associated factors. The prognostic significance of post-chemotherapy TIL patterns was assessed in an expanded cohort ( n = 90). Results: Neoadjuvant chemotherapy was associated with increased densities of CD3 + , CD8 + , CD8 + TIA-1 + , PD-1 + and CD20 + TIL. Other immune subsets and factors were unchanged, including CD79a + CD138 + plasma cells, CD68 + macrophages, and MHC class I on tumor cells. Immunosuppressive cell types were also unchanged, including FoxP3 + PD-1 + cells (putative regulatory T cells), IDO-1 + cells, and PD-L1 + cells (both macrophages and tumor cells). Hierarchical clustering revealed three response patterns: (i) TIL high tumors showed increases in multiple immune markers after chemotherapy; (ii) TIL low tumors underwent similar increases, achieving patterns indistinguishable from the first group; and (iii) TIL negative cases generally remained negative. Despite the dramatic increases seen in the first two patterns, post-chemotherapy TIL showed limited prognostic significance. Conclusions: Chemotherapy augments pre-existing TIL responses but fails to relieve major immune-suppressive mechanisms or confer significant prognostic benefit. Our findings provide rationale for multipronged approaches to immunotherapy tailored to the baseline features of the tumor microenvironment. Clin Cancer Res; 23(4); 925-34. ©2016 AACR . ©2016 American Association for Cancer Research.

  7. Tumor vascularity and hematogenous metastasis in experimental murine intraocular melanoma.

    PubMed Central

    Grossniklaus, H E

    1998-01-01

    PURPOSE: The purpose of this study is to test the hypothesis that primary tumor vascularity in a murine model of intraocular melanoma positively correlates with the development and hematogenous spread of metastasis. METHODS: Forty 12-week-old C57BL6 mice were inoculated in either the anterior chamber (AC) or posterior compartment (PC) of 1 eye with 5 x 10(5) cells/microL of Queens tissue culture melanoma cells. The inoculated eye was enucleated at 2 weeks; the mice were sacrificed at 4 weeks postinoculation, and necropsies were performed. The enucleated eyes were examined for histologic and ultrastructural features, including relationship of tumor cells to tumor vascular channels, vascular pattern, and mean vascular density. RESULTS: Melanoma grew and was confined to the eye in 12 of 20 AC eyes and 10 of 20 PC eyes. Histologic and electron microscopic examination showed tumor invasion into vascular channels. Five of 12 AC tumors (42%) and 8 of 10 PC tumors (80%) metastasized. All of the AC tumors, but none of the PC tumors, that distantly metastasized also metastasized to ipsilateral cervical lymph nodes (P = .00535). There was no statistically significant difference of vascular pattern between the melanomas that did and did not metastasize to lungs in the PC group (P = .24), although there was a significant difference in the AC group (P = .02). Tumors with high-grade vascular patterns were more likely to metastasize than tumors with low-grade vascular patterns in the AC group. The mean vascular density positively correlated with the presence and number of metastases in both groups (P = .0000 and P < .001, respectively). There was no statistically significant difference of vascular pattern and mean vascular density for AC versus PC melanoma (P = .97). CONCLUSIONS: The rate of metastasis in this murine intraocular melanoma model positively correlates with primary tumor vascularity. The melanoma metastasizes via invasion of tumor vascular channels. AC melanoma also metastasizes through regional lymphatics. Images FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 PMID:10360307

  8. Does prostate acinar adenocarcinoma with Gleason Score 3+3=6 have the potential to metastasize?

    PubMed

    Montironi, Rodolfo; Scarpelli, Marina; Mazzucchelli, Roberta; Lopez-Beltran, Antonio; Santoni, Matteo; Briganti, Alberto; Montorsi, Francesco; Cheng, Liang

    2014-10-18

    There is a worldwide debate involving clinicians, uropathologists as well as patients and their families on whether Gleason score 6 adenocarcinoma should be labelled as cancer. We report a case of man diagnosed with biopsy Gleason score 6 acinar adenocarcinoma and classified as low risk (based on a PSA of 5 ng/mL and stage cT2a) whose radical prostatectomy specimen initially showed organ confined Gleason score 3+3=6, WHO nuclear grade 3, acinar adenocarcinoma with lymphovascular invasion and secondary deposit in a periprostatic lymph node. When deeper sections were cut to the point that almost all the slice present in the paraffin block was sectioned, a small tumor area (<5% of the whole tumor) of Gleason pattern 4 (poorly formed glands) was found in an extraprostatic position. The epilogue was that the additional finding changed the final Gleason score to 3+3=6 with tertiary pattern 4 and the stage to pT3a. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/13000_2014_190.

  9. Identification of the Lymphatic Drainage Pattern of Esophageal Cancer with Near-Infrared Fluorescent Imaging.

    PubMed

    Schlottmann, Francisco; Barbetta, Arianna; Mungo, Benedetto; Lidor, Anne O; Molena, Daniela

    2017-03-01

    Nodal status is one of the most important long-term prognostic factors for esophageal cancer. The aim of this study was to evaluate the ability of near-infrared (NIR) light fluorescent imaging to identify the lymphatic drainage pattern of esophageal cancer. Patients with distal esophageal cancer or esophagogastric junction cancer scheduled for esophagectomy were enrolled in this study. Before surgery, an endoscopy was performed with submucosal injection of 2 cc of indocyanine green (ICG) around the tumor. Real-time NIR images from the surgical field were obtained for each patient to visualize the lymphatic ICG drainage. A total of nine patients were included in this study. Ivor Lewis esophagectomy was performed in all cases. ICG drainage was visualized to first drain along the left gastric nodes in eight patients (88.9%) and toward the diaphragmatic nodes in one patient (11.1%). The median number of resected nodes was 32. Three patients (33.3%) presented nodal involvement. All of them had positive nodes in the first nodal station identified with ICG. Evaluation of the lymphatic drainage pattern with real-time NIR light fluorescent technique is feasible. Distal and esophagogastric junction tumors showed to drain first in the left gastric nodes in most of the cases.

  10. Malignant perivascular epithelioid cell tumor of mesentery with lymph node involvement: a case report and review of literature

    PubMed Central

    2013-01-01

    Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1309992178882788 Perivascular epithelioid cell tumor (PEComa) is a rare but distinct mesenchymal neoplasm composed of histologically and immunohistochemically unique perivascular epithelioid cells. Due to its relative rarity, little is known about the histogenesis and prognostic factors of this tumor. We describe a case of unusual mesenteric PEComa in a 38-year-old female patient with regional lymph node involvement. Histologically, the tumor was composed of sheet of epithelioid cells with abundant clear or eosinophillic cytoplasms. Extensive coagulative necrosis and a few mitotic figures (2/50 high power field) could be found in tumor. The epithelioid tumor cells were diffusely positive for HMB-45, Melan-A, and focally positive for calponin. One of enlarged mesenteric lymph nodes was observed to be involved by tumor. A diagnosis of malignant mesenteric PEComa with lymph node involvement was made. The patient received chemotherapy after total resection of tumor and segmental resection of involved jejunum. There was no sign of recurrence of tumor found in period of 6-month regular follow-up after chemotherapy. To our knowledge, this is the first case of malignant PEComa in mesentery accompanied with regional lymph node involvement. The literature on this rare tumor is reviewed and diagnostic criteria of malignant PEComa are discussed. PMID:23587410

  11. Malignant perivascular epithelioid cell tumor of mesentery with lymph node involvement: a case report and review of literature.

    PubMed

    Fu, Xinge; Jiang, Ju-hong; Gu, Xia; Li, Zhi

    2013-04-15

    Perivascular epithelioid cell tumor (PEComa) is a rare but distinct mesenchymal neoplasm composed of histologically and immunohistochemically unique perivascular epithelioid cells. Due to its relative rarity, little is known about the histogenesis and prognostic factors of this tumor. We describe a case of unusual mesenteric PEComa in a 38-year-old female patient with regional lymph node involvement. Histologically, the tumor was composed of sheet of epithelioid cells with abundant clear or eosinophillic cytoplasms. Extensive coagulative necrosis and a few mitotic figures (2/50 high power field) could be found in tumor. The epithelioid tumor cells were diffusely positive for HMB-45, Melan-A, and focally positive for calponin. One of enlarged mesenteric lymph nodes was observed to be involved by tumor. A diagnosis of malignant mesenteric PEComa with lymph node involvement was made. The patient received chemotherapy after total resection of tumor and segmental resection of involved jejunum. There was no sign of recurrence of tumor found in period of 6-month regular follow-up after chemotherapy. To our knowledge, this is the first case of malignant PEComa in mesentery accompanied with regional lymph node involvement. The literature on this rare tumor is reviewed and diagnostic criteria of malignant PEComa are discussed. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1309992178882788.

  12. Clinicopathological Features, Patterns of Recurrence, and Survival Among Women With Triple-Negative Breast Cancer in the National Comprehensive Cancer Network

    PubMed Central

    Lin, Nancy U.; Vanderplas, Ann; Hughes, Melissa E.; Theriault, Richard L.; Edge, Stephen B.; Wong, Yu-Ning; Blayney, Douglas W.; Niland, Joyce C.; Winer, Eric P.; Weeks, Jane C.

    2012-01-01

    Background We aimed to describe clinicopathological features, patterns of recurrence, and survival according to breast cancer subtype, with a focus on triple-negative tumors. Methods We evaluated 15,204 women presenting to NCCN centers with stage I-III breast cancer between January 2000 and December 2006. Tumors were classified as hormone receptor positive [HR+]/HER2− (ER+ and/or PR+, and HER2−), HER2+ (HER2+, any ER or PR), or triple-negative (ER−, PR−, and HER2−). Results Subtype distribution was: triple-negative 17% (n=2,569), HER2+ 17% (n=2,602), HR+/HER2− 66% (n=10,033). Triple-negative subtype was more frequent in African-Americans, compared with Caucasians (adjusted odds ratio [OR] 1.98; p<0.0001). Premenopausal, but not postmenopausal, women with high body mass index had an increased likelihood of triple negative subtype (p=0.02). Women with triple-negative cancers were less likely to present on the basis of an abnormal screening mammogram (29% vs. 48%, p<0.0001), more likely to present with higher T stage, but less likely to have nodal involvement. Relative to HR+/HER2− tumors, triple-negative tumors were associated with a higher risk of brain or lung metastases, and had worse breast cancer-specific and overall survival, even after adjusting for age, stage, race, grade, and receipt of adjuvant chemotherapy (adjusted hazard ratio [HR] for overall survival 2.72, 95% CI 2.39–3.10, p<0.0001). The difference in risk of death by subtype was most dramatic within the first two years after diagnosis (HR for OS for 0 to 2 yrs 6.10 [95% CI 4.81, 7.74]). Conclusions Triple-negative tumors are associated with unique risk factors and worse outcomes compared to HR+/HER2− tumors. PMID:22544643

  13. DNA Methylation Mediated Control of Gene Expression Is Critical for Development of Crown Gall Tumors

    PubMed Central

    Kneitz, Susanne; Weber, Dana; Fuchs, Joerg; Hedrich, Rainer; Deeken, Rosalia

    2013-01-01

    Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA–encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA) in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA–mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes regulate gene expression, physiological processes, and the development of crown gall tumors. PMID:23408907

  14. DNA methylation mediated control of gene expression is critical for development of crown gall tumors.

    PubMed

    Gohlke, Jochen; Scholz, Claus-Juergen; Kneitz, Susanne; Weber, Dana; Fuchs, Joerg; Hedrich, Rainer; Deeken, Rosalia

    2013-01-01

    Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA) in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes regulate gene expression, physiological processes, and the development of crown gall tumors.

  15. High-dose proton beam therapy for sinonasal mucosal malignant melanoma.

    PubMed

    Fuji, Hiroshi; Yoshikawa, Shusuke; Kasami, Masako; Murayama, Shigeyuki; Onitsuka, Tetsuro; Kashiwagi, Hiroya; Kiyohara, Yoshio

    2014-07-23

    The significance of definitive radiotherapy for sinonasal mucosal melanoma (SMM) is sill controvertial. This study was to evaluate the role of high-dose proton beam therapy (PBT) in patients with SMM. The cases of 20 patients with SMM localized to the primary site who were treated by PBT between 2006 and 2012 were retrospectively analyzed. The patterns of overall survival and morbidity were assessed. The median follow-up time was 35 months (range, 6-77 months). The 5-year overall and disease-free survival rates were 51% and 38%, respectively. Four patients showed local failure, 2 showed regrowth of the primary tumor, and 2 showed new sinonasal tumors beyond the primary site. The 5-year local control rate after PBT was 62%. Nodal and distant failure was seen in 7 patients. Three grade 4 late toxicities were observed in tumor-involved optic nerve. Our findings suggested that high-dose PBT is an effective local treatment that is less invasive than surgery but with comparable outcomes.

  16. The role of LKB1 in lung cancer.

    PubMed

    Sanchez-Cespedes, Montse

    2011-09-01

    In humans, the LKB1 gene is located on the short arm of chromosome 19, which is frequently deleted in lung tumors. Unlike most cancers of sporadic origin, in non-small cell lung cancer (NSCLC) nearly half of the tumors harbor somatic and homozygous inactivating mutations in LKB1. In NSCLC, LKB1 inactivation strongly predominates in adenocarcinomas from smokers and coexists with mutations at other important cancer genes, including KRAS and TP53. Remarkably, LKB1 alterations frequently occur simultaneously with inactivation at another important tumor suppressor gene, BRG1 (also called SMARCA4), which is also located on chromosome 19p. The present review considers the frequency and pattern of LKB1 mutations in lung cancer and the distinct biological pathways in which the LKB1 protein is involved in the development of this type of cancer. Finally, the possible clinical applications in cancer management, especially in lung cancer treatment, associated with the presence of absence of LKB1 are discussed.

  17. The role of immunohistochemistry, electron microscopy, and ultrastructural cytochemistry in the diagnosis of mixed carcinoma-neuroendocrine neoplasms.

    PubMed

    Graham, A R; Payne, C M; Nagle, R B; Angel, E

    1987-02-01

    We studied four mixed carcinoma-neuroendocrine neoplasms from gastrointestinal tract and pancreas by routine light microscopy (LM), immunohistochemistry (IH), electron microscopy (EM), and ultrastructural cytochemistry (UC). By LM, the individual tumors showed fairly pure neuroendocrine (carcinoid) or epithelial (papillary) patterns, mixed neuroendocrine-carcinoma features and poorly-differentiated tumor in sheets and nests which did not lend itself to morphologic characterization. IH demonstrated mixed expression, within different areas of the same neoplasm, of epithelial antigens (keratins and carcinoembryonic antigen [CEA]) and neuroendocrine markers (neuron-specific enolase [NSE], bombesin and neurohormonal peptides). By EM, each tumor showed ultrastructural features of epithelial and neuroendocrine differentiation which varied substantially in terms of number of cells involved and their distribution; two of the neoplasms showed biphasic differentiation within single cells. The nature of the neurosecretory granules was verified with the uranaffin reaction (UR). This study illustrates the value of combining LM, IH, EM and UC for the identification of mixed carcinoma-neuroendocrine lesions.

  18. Differentiation of Effector CD4 T Cell Populations*

    PubMed Central

    Zhu, Jinfang; Yamane, Hidehiro; Paul, William E.

    2012-01-01

    CD4 T cells play critical roles in mediating adaptive immunity to a variety of pathogens. They are also involved in autoimmunity, asthma, and allergic responses as well as in tumor immunity. During TCR activation in a particular cytokine milieu, naive CD4 T cells may differentiate into one of several lineages of T helper (Th) cells, including Th1, Th2, Th17, and iTreg, as defined by their pattern of cytokine production and function. In this review, we summarize the discovery, functions, and relationships among Th cells; the cytokine and signaling requirements for their development; the networks of transcription factors involved in their differentiation; the epigenetic regulation of their key cytokines and transcription factors; and human diseases involving defective CD4 T cell differentiation. PMID:20192806

  19. Incidental diagnosis of tumor thrombosis on FDG PET/CT imaging.

    PubMed

    Erhamamci, S; Reyhan, M; Nursal, G N; Torun, N; Yapar, A F

    2015-01-01

    Clinical data are presented on patients with tumor thrombosis (TT) incidentally detected on FDG PET/CT imaging, as well as determining its prevalence and metabolic characteristics. Out of 12,500 consecutive PET/CT examinations of patients with malignancy, the PET/CT images of 15 patients with TT as an incidental finding were retrospectively investigated. A visual and semiquantitative analyses was performed on the PET/CT scans. An evaluation was made of the pattern of FDG uptake in the involved vessel as linear or focal via visual analyses. For the semiquantitative analyses, the metabolic activity was measured using SUVmax by drawing the region of interest at the site of the thrombosis and tumor (if any). The prevalence of occult TT was 0.12%. A total of 15 patients had various malignancies including renal (1 patient), liver (4), pancreas (2), stomach (1), colon (1), non-Hodgkin lymphoma (1), leiomyosarcoma (1), endometrial (1), ovarian (1), malign melanoma (1) and parotid (1). Nineteen vessels with TT were identified in 15 patients; three patients had more than one vessel. Various vessels were affected; the most common was the inferior vena cava (n=7) followed by the portal (n=5), renal (n=3), splenic (n=1), jugular (n=1), common iliac (n=1) and ovarian vein (n=1). The FDG uptake pattern was linear in 12 and focal in 3 patients. The mean SUVmax values in the TT and primary tumors were 8.40±4.56 and 13.77±6.80, respectively. Occult TT from various malignancies and locations was found incidentally in 0.12% of patients. Interesting cases with malign melanoma and parotid carcinoma and with TT in ovarian vein were first described by FDG PET/CT. Based on the linear FDG uptake pattern and high SUVmax value, PET/CT may accurately detect occult TT, help with the assessment of treatment response, contribute to correct tumor staging, and provide additional information on the survival rates of oncology patients. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.

  20. Expression of RAGE and HMGB1 in thymic epithelial tumors, thymic hyperplasia and regular thymic morphology.

    PubMed

    Moser, Bernhard; Janik, Stefan; Schiefer, Ana-Iris; Müllauer, Leonhard; Bekos, Christine; Scharrer, Anke; Mildner, Michael; Rényi-Vámos, Ferenc; Klepetko, Walter; Ankersmit, Hendrik Jan

    2014-01-01

    Recently, a role of the receptor for advanced glycation endproducts (RAGE) in myasthenia gravis was described. RAGE and its ligand high mobility group box 1 (HMGB1) play key roles in autoimmunity and cancer. To test whether these molecules are involved in patients with thymic abnormalities we applied immunohistochemical analysis in 33 cases of thymic epithelial tumors, comprising 27 thymomas and 6 thymic carcinomas, and 21 nonneoplastic thymuses. Both molecules were detected in neoplastic epithelial cells: RAGE staining was most intense in WHO type B2 thymomas and thymic carcinomas (p<0.001). HMGB1 nuclear staining was strongest in A and AB, and gradually less in B1 = B2>B3>thymic carcinoma (p<0.001). Conversely, HMGB1 cytoplasmic staining intensities were as follows: A and AB (none), B1 (strong), B2 (moderate), B3 and thymic carcinoma (weak); (p<0.001). Fetal thymic tissue showed a distinct expression of RAGE and HMGB1 in subcapsular cortical epithelial cells which was found in 50% of myasthenic patients. Furthermore RAGE and HMGB1 were expressed in thymocytes, macrophages, Hassall's corpuscles, thymic medulla, and germinal center cells in myasthenic patients. Immunohistochemistry results were complemented by systemic measurements (immunosorbent assay): serum levels of soluble RAGE were significantly reduced in patients with epithelial tumors (p = 0.008); and in invasive tumors (p = 0.008). Whereas RAGE was equally reduced in thymic hyperplasia and epithelial tumors (p = 0.003), HMGB1 was only elevated in malignancies (p = 0.036). Results were most pronounced in thymic carcinomas. Thus, RAGE and HMGB1 are involved in the (patho-)physiology of thymus, as evidenced by differentiated thymic and systemic expression patterns that may act as diagnostic or therapeutic targets in autoimmune disease and cancer.

  1. Dynamic Tumor Growth Patterns in a Novel Murine Model of Colorectal Cancer

    PubMed Central

    Olson, Terrah J. Paul; Hadac, Jamie N.; Sievers, Chelsie K.; Leystra, Alyssa A.; Deming, Dustin A.; Zahm, Christopher D.; Albrecht, Dawn M.; Nomura, Alice; Nettekoven, Laura A.; Plesh, Lauren K.; Clipson, Linda; Sullivan, Ruth; Newton, Michael A.; Schelman, William R.; Halberg, Richard B.

    2014-01-01

    Colorectal cancer (CRC) often arises from adenomatous colonic polyps. Polyps can grow and progress to cancer, but may also remain static in size, regress, or resolve. Predicting which progress and which remain benign is difficult. We developed a novel long-lived murine model of CRC with tumors that can be followed by colonoscopy. Our aim was to assess whether these tumors have similar growth patterns and histologic fates to human colorectal polyps to identify features to aid in risk-stratification of colonic tumors. Long-lived ApcMin/+ mice were treated with dextran sodium sulfate to promote colonic tumorigenesis. Tumor growth patterns were characterized by serial colonoscopy with biopsies obtained for immunohistochemistry and gene expression profiling. Tumors grew, remained static, regressed, or resolved over time with different relative frequencies. Newly developed tumors demonstrated higher rates of growth and resolution than more established tumors that tended to remain static in size. Colonic tumors were hyperplastic lesions (3%), adenomas (73%), intramucosal carcinomas (20%), or adenocarcinomas (3%). Interestingly, the level of β-catenin was higher in adenomas that became intratumoral carcinomas as compared to those that failed to progress. In addition, differentially expressed genes between adenomas and intramucosal carcinomas were identified. This novel murine model of intestinal tumorigenesis develops colonic tumors that can be monitored by serial colonoscopy, mirror growth patterns seen in human colorectal polyps, and progress to CRC. Further characterization of cellular and molecular features are needed to determine which features can be used to risk-stratify polyps for progression to CRC and potentially guide prevention strategies. PMID:24196829

  2. Male breast carcinoma: an evaluation of prognostic factors contributing to a poorer outcome.

    PubMed

    Joshi, M G; Lee, A K; Loda, M; Camus, M G; Pedersen, C; Heatley, G J; Hughes, K S

    1996-02-01

    Although breast cancer in men is far less common than breast cancer in women, it is associated with a less favorable prognosis. Conventional histopathologic features and new prognostic markers were evaluated to explain the less favorable survival outcome. Forty-six consecutive male breast carcinomas were studied for size, histologic and nuclear grade, histologic subtype, presence of carcinoma in situ, nipple involvement, lymphovascular invasion, hormone receptor status, c-erbB-2 protein overexpression, and p53 protein accumulation. These findings were correlated with survival. Of the 46 carcinomas, 4 were noninvasive and 42 were invasive. In the invasive carcinomas, the median patient age was 64 years, and the median tumor size was 2 cm. The predominant histologic patterns were invasive ductal (45%) and mixed invasive ductal and cribriform (28%). Most tumors were of low histologic and nuclear grades (histologic grades: I, 17%; II, 50%; III, 33%; nuclear grade: I, 12%; II, 44%; III, 44%). Of those surgically staged, 22 patients (60%) were lymph node positive and 15 patients (40%) were node negative. Stage at presentation was higher than in women (0, 10%; 1, 17%; 2, 50%; 3, 13%; 4, 10%). The estrogen and progesterone receptor status was positive in 76% and 83% of tumors, respectively. Lymphatic vessel invasion (63%) and nipple involvement (48%) were also more common than in women. True Paget's disease of the nipple was not seen; all cases with nipple ulceration were the result of direct tumor extension to the epidermis. Of the 17 tumors tested, 41% were c-erbB-2 positive and 29% were p53 positive. Survival analysis was limited by the relatively small cohort size. Five- and 10-year adjusted overall survival rates for invasive tumors were 76 +/- 7% and 42 +/- 9%, respectively. Skin and nipple involvement (P = 0.03) and c-erbB-2-positivity (P = 0.03) were significant predictors of adverse survival. Male breast carcinoma presents in an advanced stage with less favorable survival, despite low histologic grade, high estrogen receptor content, and small size. Anatomic factors may have been responsible for the poor survival outcome (i.e., paucity of breast tissue and close tumor proximity to skin and nipple, facilitating dermal lymphatic spread and early regional and distant metastasis).

  3. Spatiotemporal Patterns of Tumor Occurrence in Children with Intraocular Retinoblastoma.

    PubMed

    King, Benjamin A; Parra, Carlos; Li, Yimei; Helton, Kathleen J; Qaddoumi, Ibrahim; Wilson, Matthew W; Ogg, Robert J

    2015-01-01

    To accurately map the retinal area covered by tumor in a prospectively enrolled cohort of children diagnosed with retinoblastoma. Orbital MRI in 106 consecutive retinoblastoma patients (44 bilateral) was analyzed. For MRI-visible tumors, the polar angle and angle of eccentricity of points defining tumor perimeter on the retina were determined by triangulation from images in three orthogonal planes. The centroid of the mapped area was calculated to approximate tumor origin, and the location and cumulative tumor burden were analyzed in relation to mutation type (germline vs. somatic), tumor area, and patient age at diagnosis. Location of small tumors undetected by MRI was approximated with fundoscopic images. Mapping was successful for 129 tumors in 91 eyes from 67 patients (39 bilateral, 43 germline mutation). Cumulative tumor burden was highest within the macula and posterior pole and was asymmetrically higher within the inferonasal periphery. Tumor incidence was lowest in the superotemporal periphery. Tumor location varied with age at diagnosis in a complex pattern. Tumor location was concentrated in the macula and superonasal periphery in patients <5.6 months, in the inferotemporal quadrant of the posterior pole in patients 5.6-8.8 months, in the inferonasal quadrant in patients 8.8-13.2 months, and in the nasal and superotemporal periphery in patients >13.2 months. The distribution of MRI-invisible tumors was consistent with the asymmetry of mapped tumors. MRI-based mapping revealed a previously unrecognized pattern of retinoblastoma localization that evolves with age at diagnosis. The structured spatiotemporal distribution of tumors may provide valuable clues about cellular or molecular events associated with tumorigenesis in the developing retina.

  4. Platinum sensitivity and DNA repair in a recently established panel of patient-derived ovarian carcinoma xenografts

    PubMed Central

    Guffanti, Federica; Fratelli, Maddalena; Ganzinelli, Monica; Bolis, Marco; Ricci, Francesca; Bizzaro, Francesca; Chilà, Rosaria; Sina, Federica Paola; Fruscio, Robert; Lupia, Michela; Cavallaro, Ugo; Cappelletti, Maria Rosa; Generali, Daniele; Giavazzi, Raffaella; Damia, Giovanna

    2018-01-01

    A xenobank of patient-derived (PDX) ovarian tumor samples has been established consisting of tumors with different sensitivity to cisplatin (DDP), from very responsive to resistant. As the DNA repair pathway is an important driver in tumor response to DDP, we analyzed the mRNA expression of 20 genes involved in the nucleotide excision repair, fanconi anemia, homologous recombination, base excision repair, mismatch repair and translesion repair pathways and the methylation patterns of some of these genes. We also investigated the correlation with the response to platinum-based therapy. The mRNA levels of the selected genes were evaluated by Real Time-PCR (RT-PCR) with ad hoc validated primers and gene promoter methylation by pyrosequencing. All the DNA repair genes were variably expressed in all 42 PDX samples analyzed, with no particular histotype-specific pattern of expression. In high-grade serous/endometrioid PDXs, the CDK12 mRNA expression levels positively correlated with the expression of TP53BP1, PALB2, XPF and POLB. High-grade serous/endometrioid PDXs with TP53 mutations had significantly higher levels of POLQ, FANCD2, RAD51 and POLB than high-grade TP53 wild type PDXs. The mRNA levels of CDK12, PALB2 and XPF inversely associated with the in vivo DDP antitumor activity; higher CDK12 mRNA levels were associated with a higher recurrence rate in ovarian patients with low residual tumor. These data support the important role of CDK12 in the response to a platinum based therapy in ovarian patients. PMID:29872499

  5. The mucin expression profile of endometrial carcinoma and correlation with clinical-pathologic parameters.

    PubMed

    Morrison, Carl; Merati, Kambiz; Marsh, William L; De Lott, Lindsey; Cohn, David E; Young, Gregory; Frankel, Wendy L

    2007-12-01

    Mucin expression patterns have been studied in tumors from various sites. Previous studies have shown an association of MUC1 with poor prognosis and MUC2 and MUC5AC with a mucinous phenotype. The pattern of mucin expression in endometrial carcinomas has not been documented in a large series. We determined the mucin expression profile in endometrial carcinomas and evaluated the relationship between mucin expression and clinical-pathologic parameters. A tissue microarray of 310 cases of endometrial carcinoma with known clinical outcome was constructed from formalin-fixed, paraffin-embedded donor blocks using two 0.6 mm cores from each tumor. Sections were stained with monoclonal antibodies against MUC1, MUC2, MUC4, MUC5AC, and MUC6. Staining was considered positive if greater than or equal to 5% of cells stained positively in either core. Mucin expression was correlated with tumor type, histologic grade, International Federation Gynecology and Obstetrics stage, lymph node involvement, depth of myometrial invasion, patient age, ethnicity, and clinical outcome. MUC1 was expressed in 267/310 (86.1%) of endometrial carcinomas, MUC2 in 2/310 (0.6%), MUC4 in 73/310 (23.5%), MUC5AC in 1/310 (0.3%), and MUC6 in 4/310 (1.2%). Endometrioid endometrial carcinoma showed a higher rate of MUC1 expression than nonendometrioid endometrial carcinoma (227/258, 88.0% vs. 39/52, 75.0%, P=0.01). No significant differences in any of the mucins were noted among the other end points evaluated. Mucin expression did not correlate with tumor grade, stage, or patient outcome.

  6. [Development of a Computer-aided Diagnosis System to Distinguish between Benign and Malignant Mammary Tumors in Dynamic Magnetic Resonance Images: Automatic Detection of the Position with the Strongest Washout Effect in the Tumor].

    PubMed

    Miyazaki, Yoshiaki; Tabata, Nobuyuki; Taroura, Tomomi; Shinozaki, Kenji; Kubo, Yuichiro; Tokunaga, Eriko; Taguchi, Kenichi

    We propose a computer-aided diagnostic (CAD) system that uses time-intensity curves to distinguish between benign and malignant mammary tumors. Many malignant tumors show a washout pattern in time-intensity curves. Therefore, we designed a program that automatically detects the position with the strongest washout effect using the technique, such as the subtraction technique, which extracts only the washout area in the tumor, and by scanning data in 2×2 pixel region of interest (ROI). Operation of this independently developed program was verified using a phantom system that simulated tumors. In three cases of malignant tumors, the washout pattern detection rate in images with manually set ROI was ≤6%, whereas the detection rate with our novel method was 100%. In one case of a benign tumor, when the same method was used, we checked that there was no washout effect and detected the persistent pattern. Thus, the distinction between benign and malignant tumors using our method was completely consistent with the pathological diagnoses made. Our novel method is therefore effective for differentiating between benign and malignant mammary tumors in dynamic magnetic resonance images.

  7. Clinical application of a color map pattern on shear-wave elastography for invasive breast cancer.

    PubMed

    Lee, Seokwon; Jung, Younglae; Bae, Youngtae

    2016-03-01

    The aim of this study was to classify the color map pattern on shear-wave elastography (SWE) and to determine its association with clinicopathological factors for clinical application in invasive breast cancer. From June to December 2014, 103 invasive breast cancers were imaged by B-mode ultrasonography (US) and SWE just before surgery. The color map pattern identified on the SWE could be classified into three main categories: type 1 (diffuse pattern), increased stiffness in the surrounding stroma and the interior lesion itself; type 2 (lateral pattern), marked peri-tumoral stiffness at the anterior and lateral portions with no or minor stiffness at the posterior portion; and type 3 (rim-off pattern), marked peri-tumoral stiffness at the anterior and posterior portion with no or minor stiffness at both lateral portions. High-grade density on mammography (grade 3-4) was more frequent in the type 1 pattern than the other pattern types (80.5% in high-grade density vs. 19.5% in low-grade density). For type 1 tumors, the extent of synchronous non-invasive cancers (pT0), ductal carcinoma in situ (DCIS), was 1.8-2.0 times wider than that measured by US or magnetic resonance imaging (MRI). For type 2 tumors, the invasive tumor components (pT size) size was 1.3 times greater than measured by MRI (p = 0.049). On the other hand, the pT size and pT0 extent of type 3 tumors were almost equal to the preoperative US and MRI measurements. In terms of immunohistochemical (IHC) profiles, type 3 tumors showed a high histologic grade (p = 0.021), poor differentiation (p = 0.009), presence of necrosis (p = 0.018), and high Ki-67 (p = 0.002). The percentage of HER2-positive cancers was relatively high within the type 2 group, and the percentage of triple negative breast cancer was relatively high in the type 3 group (p = 0.011). We expect that assessments of the SWE color map pattern will prove useful for surgical or therapeutic plan decisions and to predict prognosis in invasive breast cancer patients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Different Subcellular Localization of ALCAM Molecules in Neuroblastoma: Association with Relapse

    PubMed Central

    Corrias, Maria Valeria; Gambini, Claudio; Gregorio, Andrea; Croce, Michela; Barisione, Gaia; Cossu, Claudia; Rossello, Armando; Ferrini, Silvano; Fabbi, Marina

    2010-01-01

    Background: The Activated Leukocyte Cell Adhesion Molecule (ALCAM/CD), involved in nervous system development, has been linked to tumor progression and metastasis in several tumors. No information is available on ALCAM expression in neuroblastoma, a childhood neoplasia originating from the sympathetic nervous system. Methods: ALCAM expression was analysed by immunofluorescence and immunohistochemistry on differentiated neuroblastoma cell lines and on archival specimens of stroma-poor, not MYCN amplified, resectable neuroblastoma tumors, respectively. Results: ALCAM is variously expressed in neuroblastoma cell lines, is shed by metalloproteases and is cleaved by ADAM17/TACE in vitro. ALCAM is expressed in neuroblastoma primary tumors with diverse patterns of subcellular localization and is highly expressed in the neuropil area in a subgroup of cases. Tumor specimens showing high expression of ALCAM at the membrane of the neuroblast body or low levels in the neuropil area are associated with relapse (P = 0.044 and P < 0.0001, respectively). In vitro differentiated neuroblastoma cells show strong ALCAM expression on neurites, suggesting that ALCAM expression in the neuropil is related to a differentiated phenotype. Conclusions: Assessment of ALCAM localization by immunohistochemistry may help to identify patients who, in the absence of negative prognostic factors, are at risk of relapse and require a more careful follow-up. PMID:20208136

  9. Testicular cancer from diagnosis to epigenetic factors

    PubMed Central

    Boccellino, Mariarosaria; Vanacore, Daniela; Zappavigna, Silvia; Cavaliere, Carla; Rossetti, Sabrina; D’Aniello, Carmine; Chieffi, Paolo; Amler, Evzen; Buonerba, Carlo; Di Lorenzo, Giuseppe; Di Franco, Rossella; Izzo, Alessandro; Piscitelli, Raffaele; Iovane, Gelsomina; Muto, Paolo; Botti, Gerardo; Perdonà, Sisto; Caraglia, Michele; Facchini, Gaetano

    2017-01-01

    Testicular cancer (TC) is one of the most common neoplasms that occurs in male and includes germ cell tumors (GCT), sex cord-gonadal stromal tumors and secondary testicular tumors. Diagnosis of TC involves the evaluation of serum tumor markers alpha-fetoprotein, human chorionic gonadotropin and lactate dehydrogenase, but clinically several types of immunohistochemical markers are more useful and more sensitive in GCT, but not in teratoma. These new biomarkers are genes expressed in primordial germ cells/gonocytes and embryonic pluripotency-related cells but not in normal adult germ cells and they include PLAP, OCT3/4 (POU5F1), NANOG, SOX2, REX1, AP-2γ (TFAP2C) and LIN28. Gene expression in GCT is regulated, at least in part, by DNA and histone modifications, and the epigenetic profile of these tumours is characterised by genome-wide demethylation. There are different epigenetic modifications in TG-subtypes that reflect the normal developmental switch in primordial germ cells from an under- to normally methylated genome. The main purpose of this review is to illustrate the findings of recent investigations in the classification of male genital organs, the discoveries in the use of prognostic and diagnostic markers and the epigenetic aberrations mainly affecting the patterns of DNA methylation/histone modifications of genes (especially tumor suppressors) and microRNAs (miRNAs). PMID:29262668

  10. Continuous representation of tumor microvessel density and detection of angiogenic hotspots in histological whole-slide images.

    PubMed

    Kather, Jakob Nikolas; Marx, Alexander; Reyes-Aldasoro, Constantino Carlos; Schad, Lothar R; Zöllner, Frank Gerrit; Weis, Cleo-Aron

    2015-08-07

    Blood vessels in solid tumors are not randomly distributed, but are clustered in angiogenic hotspots. Tumor microvessel density (MVD) within these hotspots correlates with patient survival and is widely used both in diagnostic routine and in clinical trials. Still, these hotspots are usually subjectively defined. There is no unbiased, continuous and explicit representation of tumor vessel distribution in histological whole slide images. This shortcoming distorts angiogenesis measurements and may account for ambiguous results in the literature. In the present study, we describe and evaluate a new method that eliminates this bias and makes angiogenesis quantification more objective and more efficient. Our approach involves automatic slide scanning, automatic image analysis and spatial statistical analysis. By comparing a continuous MVD function of the actual sample to random point patterns, we introduce an objective criterion for hotspot detection: An angiogenic hotspot is defined as a clustering of blood vessels that is very unlikely to occur randomly. We evaluate the proposed method in N=11 images of human colorectal carcinoma samples and compare the results to a blinded human observer. For the first time, we demonstrate the existence of statistically significant hotspots in tumor images and provide a tool to accurately detect these hotspots.

  11. Targeting Cytosolic Nucleic Acid-Sensing Pathways for Cancer Immunotherapies.

    PubMed

    Iurescia, Sandra; Fioretti, Daniela; Rinaldi, Monica

    2018-01-01

    The innate immune system provides the first line of defense against pathogen infection though also influences pathways involved in cancer immunosurveillance. The innate immune system relies on a limited set of germ line-encoded sensors termed pattern recognition receptors (PRRs), signaling proteins and immune response factors. Cytosolic receptors mediate recognition of danger damage-associated molecular patterns (DAMPs) signals. Once activated, these sensors trigger multiple signaling cascades, converging on the production of type I interferons and proinflammatory cytokines. Recent studies revealed that PRRs respond to nucleic acids (NA) released by dying, damaged, cancer cells, as danger DAMPs signals, and presence of signaling proteins across cancer types suggests that these signaling mechanisms may be involved in cancer biology. DAMPs play important roles in shaping adaptive immune responses through the activation of innate immune cells and immunological response to danger DAMPs signals is crucial for the host response to cancer and tumor rejection. Furthermore, PRRs mediate the response to NA in several vaccination strategies, including DNA immunization. As route of double-strand DNA intracellular entry, DNA immunization leads to expression of key components of cytosolic NA-sensing pathways. The involvement of NA-sensing mechanisms in the antitumor response makes these pathways attractive drug targets. Natural and synthetic agonists of NA-sensing pathways can trigger cell death in malignant cells, recruit immune cells, such as DCs, CD8 + T cells, and NK cells, into the tumor microenvironment and are being explored as promising adjuvants in cancer immunotherapies. In this minireview, we discuss how cGAS-STING and RIG-I-MAVS pathways have been targeted for cancer treatment in preclinical translational researches. In addition, we present a targeted selection of recent clinical trials employing agonists of cytosolic NA-sensing pathways showing how these pathways are currently being targeted for clinical application in oncology.

  12. Membrane localization of insulin receptor substrate-2 (IRS-2) is associated with decreased overall survival in breast cancer

    PubMed Central

    Clark, Jennifer L.; Dresser, Karen; Hsieh, Chung-Cheng; Sabel, Michael; Kleer, Celina G.; Khan, Ashraf

    2011-01-01

    Recent studies have identified a role for insulin receptor substrate-2 (IRS-2) in promoting motility and metastasis in breast cancer. However, no published studies to date have examined IRS-2 expression in human breast tumors. We examined IRS-2 expression by immunohistochemistry (IHC) in normal breast tissue, benign breast lesions, and malignant breast tumors from the institutional pathology archives and a tumor microarray from a separate institution. Three distinct IRS-2 staining patterns were noted: diffusely cytoplasmic, punctate cytoplasmic, and localized to the cell membrane. The individual and pooled datasets were analyzed for associations of IRS-2 staining pattern with core clinical parameters and clinical outcomes. Univariate analysis revealed a trend toward decreased overall survival (OS) with IRS-2 membrane staining, and this association became significant upon multivariate analysis (P = 0.01). In progesterone receptor negative (PR−) tumors, in particular, IRS-2 staining at the membrane correlated with significantly worse OS than other IRS-2 staining patterns (P < 0.001). When PR status and IRS-2 staining pattern were evaluated in combination, PR− tumors with IRS-2 at the membrane were associated with a significantly decreased OS when compared with all other combinations (P = 0.002). Evaluation of IRS-2 staining patterns could potentially be used to identify patients with PR− tumors who would most benefit from aggressive treatment. PMID:21258861

  13. Copy number gain at 8q12.1-q22.1 is associated with a malignant tumor phenotype in salivary gland myoepitheliomas.

    PubMed

    Vékony, Hedy; Röser, Kerstin; Löning, Thomas; Ylstra, Bauke; Meijer, Gerrit A; van Wieringen, Wessel N; van de Wiel, Mark A; Carvalho, Beatriz; Kok, Klaas; Leemans, C René; van der Waal, Isaäc; Bloemena, Elisabeth

    2009-02-01

    Salivary gland myoepithelial tumors are relatively uncommon tumors with an unpredictable clinical course. More knowledge about their genetic profiles is necessary to identify novel predictors of disease. In this study, we subjected 27 primary tumors (15 myoepitheliomas and 12 myoepithelial carcinomas) to genome-wide microarray-based comparative genomic hybridization (array CGH). We set out to delineate known chromosomal aberrations in more detail and to unravel chromosomal differences between benign myoepitheliomas and myoepithelial carcinomas. Patterns of DNA copy number aberrations were analyzed by unsupervised hierarchical cluster analysis. Both benign and malignant tumors revealed a limited amount of chromosomal alterations (median of 5 and 7.5, respectively). In both tumor groups, high frequency gains (> or =20%) were found mainly at loci of growth factors and growth factor receptors (e.g., PDGF, FGF(R)s, and EGFR). In myoepitheliomas, high frequency losses (> or =20%) were detected at regions of proto-cadherins. Cluster analysis of the array CGH data identified three clusters. Differential copy numbers on chromosome arm 8q and chromosome 17 set the clusters apart. Cluster 1 contained a mixture of the two phenotypes (n = 10), cluster 2 included mostly benign tumors (n = 10), and cluster 3 only contained carcinomas (n = 7). Supervised analysis between malignant and benign tumors revealed a 36 Mbp-region at 8q being more frequently gained in malignant tumors (P = 0.007, FDR = 0.05). This is the first study investigating genomic differences between benign and malignant myoepithelial tumors of the salivary glands at a genomic level. Both unsupervised and supervised analysis of the genomic profiles revealed chromosome arm 8q to be involved in the malignant phenotype of salivary gland myoepitheliomas.

  14. G-protein coupled receptor expression patterns delineate medulloblastoma subgroups

    PubMed Central

    2013-01-01

    Background Medulloblastoma is the most common malignant brain tumor in children. Genetic profiling has identified four principle tumor subgroups; each subgroup is characterized by different initiating mutations, genetic and clinical profiles, and prognoses. The two most well-defined subgroups are caused by overactive signaling in the WNT and SHH mitogenic pathways; less is understood about Groups 3 and 4 medulloblastoma. Identification of tumor subgroup using molecular classification is set to become an important component of medulloblastoma diagnosis and staging, and will likely guide therapeutic options. However, thus far, few druggable targets have emerged. G-protein coupled receptors (GPCRs) possess characteristics that make them ideal targets for molecular imaging and therapeutics; drugs targeting GPCRs account for 30-40% of all current pharmaceuticals. While expression patterns of many proteins in human medulloblastoma subgroups have been discerned, the expression pattern of GPCRs in medulloblastoma has not been investigated. We hypothesized that analysis of GPCR expression would identify clear subsets of medulloblastoma and suggest distinct GPCRs that might serve as molecular targets for both imaging and therapy. Results Our study found that medulloblastoma tumors fall into distinct clusters based solely on GPCR expression patterns. Normal cerebellum clustered separately from the tumor samples. Further, two of the tumor clusters correspond with high fidelity to the WNT and SHH subgroups of medulloblastoma. Distinct over-expressed GPCRs emerge; for example, LGR5 and GPR64 are significantly and uniquely over-expressed in the WNT subgroup of tumors, while PTGER4 is over-expressed in the SHH subgroup. Uniquely under-expressed GPCRs were also observed. Our key findings were independently validated using a large international dataset. Conclusions Our results identify GPCRs with potential to act as imaging and therapeutic targets. Elucidating tumorigenic pathways is a secondary benefit to identifying differential GPCR expression patterns in medulloblastoma tumors. PMID:24252460

  15. Acute hypopituitarism associated with periorbital swelling and cardiac dysfunction in a patient with pituitary tumor apoplexy: a case report.

    PubMed

    Ohara, Nobumasa; Yoneoka, Yuichiro; Seki, Yasuhiro; Akiyama, Katsuhiko; Arita, Masataka; Ohashi, Kazumasa; Suzuki, Kazuo; Takada, Toshinori

    2017-08-24

    Pituitary tumor apoplexy is a rare clinical syndrome caused by acute hemorrhage or infarction in a preexisting pituitary adenoma. It typically manifests as an acute episode of headache, visual disturbance, mental status changes, cranial nerve palsy, and endocrine pituitary dysfunction. However, not all patients present with classical symptoms, so it is pertinent to appreciate the clinical spectrum of pituitary tumor apoplexy presentation. We report an unusual case of a patient with pituitary tumor apoplexy who presented with periorbital edema associated with hypopituitarism. An 83-year-old Japanese man developed acute anterior hypopituitarism; he showed anorexia, fatigue, lethargy, severe bilateral periorbital edema, and mild cardiac dysfunction in the absence of headache, visual disturbance, altered mental status, and cranial nerve palsy. Magnetic resonance imaging showed a 2.5-cm pituitary tumor containing a mixed pattern of solid and liquid components indicating pituitary tumor apoplexy due to hemorrhage in a preexisting pituitary adenoma. Replacement therapy with oral hydrocortisone and levothyroxine relieved his symptoms of central adrenal insufficiency, central hypothyroidism, periorbital edema, and cardiac dysfunction. Common causes of periorbital edema include infections, inflammation, trauma, allergy, kidney or cardiac dysfunction, and endocrine disorders such as primary hypothyroidism. In the present case, the patient's acute central hypothyroidism was probably involved in the development of both periorbital edema and cardiac dysfunction. The present case highlights the need for physicians to consider periorbital edema as an unusual predominant manifestation of pituitary tumor apoplexy.

  16. Breast tumor angiogenesis analysis using 3D power Doppler ultrasound

    NASA Astrophysics Data System (ADS)

    Chang, Ruey-Feng; Huang, Sheng-Fang; Lee, Yu-Hau; Chen, Dar-Ren; Moon, Woo Kyung

    2006-03-01

    Angiogenesis is the process that correlates to tumor growth, invasion, and metastasis. Breast cancer angiogenesis has been the most extensively studied and now serves as a paradigm for understanding the biology of angiogenesis and its effects on tumor outcome and patient prognosis. Most studies on characterization of angiogenesis focus on pixel/voxel counts more than morphological analysis. Nevertheless, in cancer, the blood flow is greatly affected by the morphological changes, such as the number of vessels, branching pattern, length, and diameter. This paper presents a computer-aided diagnostic (CAD) system that can quantify vascular morphology using 3-D power Doppler ultrasound (US) on breast tumors. We propose a scheme to extract the morphological information from angiography and to relate them to tumor diagnosis outcome. At first, a 3-D thinning algorithm helps narrow down the vessels into their skeletons. The measurements of vascular morphology significantly rely on the traversing of the vascular trees produced from skeletons. Our study of 3-D assessment of vascular morphological features regards vessel count, length, bifurcation, and diameter of vessels. Investigations into 221 solid breast tumors including 110 benign and 111 malignant cases, the p values using the Student's t-test for all features are less than 0.05 indicating that the proposed features are deemed statistically significant. Our scheme focuses on the vascular architecture without involving the technique of tumor segmentation. The results show that the proposed method is feasible, and have a good agreement with the diagnosis of the pathologists.

  17. IDH1 R132H mutation generates a distinct phospholipid metabolite profile in glioma.

    PubMed

    Esmaeili, Morteza; Hamans, Bob C; Navis, Anna C; van Horssen, Remco; Bathen, Tone F; Gribbestad, Ingrid S; Leenders, William P; Heerschap, Arend

    2014-09-01

    Many patients with glioma harbor specific mutations in the isocitrate dehydrogenase gene IDH1 that associate with a relatively better prognosis. IDH1-mutated tumors produce the oncometabolite 2-hydroxyglutarate. Because IDH1 also regulates several pathways leading to lipid synthesis, we hypothesized that IDH1-mutant tumors have an altered phospholipid metabolite profile that would impinge on tumor pathobiology. To investigate this hypothesis, we performed (31)P-MRS imaging in mouse xenograft models of four human gliomas, one of which harbored the IDH1-R132H mutation. (31)P-MR spectra from the IDH1-mutant tumor displayed a pattern distinct from that of the three IDH1 wild-type tumors, characterized by decreased levels of phosphoethanolamine and increased levels of glycerophosphocholine. This spectral profile was confirmed by ex vivo analysis of tumor extracts, and it was also observed in human surgical biopsies of IDH1-mutated tumors by (31)P high-resolution magic angle spinning spectroscopy. The specificity of this profile for the IDH1-R132H mutation was established by in vitro (31)P-NMR of extracts of cells overexpressing IDH1 or IDH1-R132H. Overall, our results provide evidence that the IDH1-R132H mutation alters phospholipid metabolism in gliomas involving phosphoethanolamine and glycerophosphocholine. These new noninvasive biomarkers can assist in the identification of the mutation and in research toward novel treatments that target aberrant metabolism in IDH1-mutant glioma. ©2014 American Association for Cancer Research.

  18. Phosphaturic mesenchymal tumor of the brain without tumor-induced osteomalacia in an 8-year-old girl: case report.

    PubMed

    Ellis, Mark B; Gridley, Daniel; Lal, Suresh; Nair, Geetha R; Feiz-Erfan, Iman

    2016-05-01

    Phosphaturic mesenchymal tumor (mixed connective tissue variant) (PMT-MCT) are tumors that may cause tumor-induced osteomalacia and rarely appear intracranially. The authors describe the case of an 8-year-old girl who was found to have PMT-MCT with involvement of the cerebellar hemisphere and a small tumor pedicle breaching the dura mater and involving the skull. This was removed surgically in gross-total fashion without further complication. Histologically the tumor was confirmed to be a PMT-MCT. There was no evidence of tumor-induced osteomalacia. At the 42-month follow-up, the patient is doing well, has no abnormalities, and is free of recurrence. PMT-MCTs are rare tumors that may involve the brain parenchyma. A gross-total resection may be effective to cure these lesions.

  19. Dynamic Patterns of Clonal Evolution in Tumor Vasculature Underlie Alterations in Lymphocyte-Endothelial Recognition to Foster Tumor Immune Escape.

    PubMed

    Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L

    2016-03-15

    Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.

  20. Alterations in gene expression profiles during prostate cancer progression: functional correlations to tumorigenicity and down-regulation of selenoprotein-P in mouse and human tumors.

    PubMed

    Calvo, Alfonso; Xiao, Nianqing; Kang, Jason; Best, Carolyn J M; Leiva, Isabel; Emmert-Buck, Michael R; Jorcyk, Cheryl; Green, Jeffrey E

    2002-09-15

    To identify molecular changes that occur during prostate tumor progression, we have characterized a series of prostate cancer cell lines isolated at different stages of tumorigenesis from C3(1)/Tag transgenic mice. Cell lines derived from low- and high-grade prostatic intraepithelial neoplasia, invasive carcinoma, and a lung metastasis exhibited significant differences in cell growth, tumorigenicity, invasiveness, and angiogenesis. cDNA microarray analysis of 8700 features revealed correlations between the tumorigenicity of the C3(1)/Tag-Pr cells and changes in the expression levels of genes regulating cell growth, angiogenesis, and invasion. Many changes observed in transcriptional regulation in this in vitro system are similar to those reported for human prostate cancer, as well as other types of human tumors. This analysis of expression patterns has also identified novel genes that may be involved in mechanisms of prostate oncogenesis or serve as potential biomarkers or therapeutic targets for prostate cancer. Examples include the L1-cell adhesion molecule, metastasis-associated gene (MTA-2), Rab-25, tumor-associated signal transducer-2 (Trop-2), and Selenoprotein-P, a gene that binds selenium and prevents oxidative stress. Many genes identified in the Pr-cell line model have been shown to be altered in human prostate cancer. The comprehensive microarray data provides a rational basis for using this model system for studies where alterations of specific genes or pathways are of particular interest. Quantitative real-time reverse transcription-PCR for Selenoprotein-P demonstrated a similar down-regulation of the transcript of this gene in a subset of human prostate tumors, mouse tumors, and prostate carcinoma cell lines. This work demonstrates that expression profiling in animal models may lead to the identification of novel genes involved in human prostate cancer biology.

  1. Invasive endocervical adenocarcinoma: proposal for a new pattern-based classification system with significant clinical implications: a multi-institutional study.

    PubMed

    Diaz De Vivar, Andrea; Roma, Andres A; Park, Kay J; Alvarado-Cabrero, Isabel; Rasty, Golnar; Chanona-Vilchis, Jose G; Mikami, Yoshiki; Hong, Sung R; Arville, Brent; Teramoto, Norihiro; Ali-Fehmi, Rouba; Rutgers, Joanne K L; Tabassum, Farah; Barbuto, Denise; Aguilera-Barrantes, Irene; Shaye-Brown, Alexandra; Daya, Dean; Silva, Elvio G

    2013-11-01

    The management of endocervical adenocarcinoma is largely based on tumor size and depth of invasion (DOI); however, DOI is difficult to measure accurately. The surgical treatment includes resection of regional lymph nodes, even though most lymph nodes are negative and lymphadenectomies can cause significant morbidity. We have investigated alternative parameters to better identify patients at risk of node metastases. Cases of invasive endocervical adenocarcinoma from 12 institutions were reviewed, and clinical/pathologic features assessed: patients' age, tumor size, DOI, differentiation, lymph-vascular invasion, lymph node metastases, recurrences, and stage. Cases were classified according to a new pattern-based system into Pattern A (well-demarcated glands), B (early destructive stromal invasion arising from well-demarcated glands), and C (diffuse destructive invasion). In total, 352 cases (FIGO Stages I-IV) were identified. Patients' age ranged from 20 to 83 years (mean 45), DOI ranged from 0.2 to 27 mm (mean 6.73), and lymph-vascular invasion was present in 141 cases. Forty-nine (13.9%) demonstrated lymph node metastases. Using this new system, 73 patients (20.7%) with Pattern A tumors (all Stage I) were identified. None had lymph node metastases and/or recurrences. Ninety patients (25.6%) had Pattern B tumors, of which 4 (4.4%) had positive nodes; whereas 189 (53.7%) had Pattern C tumors, of which 45 (23.8%) had metastatic nodes. The proposed classification system can spare 20.7% of patients (Pattern A) of unnecessary lymphadenectomy. Patients with Pattern B rarely present with positive nodes. An aggressive approach is justified in patients with Pattern C. This classification system is simple, easy to apply, and clinically significant.

  2. The G protein-coupled estrogen receptor 1 (GPER/GPR30) does not predict survival in patients with ovarian cancer

    PubMed Central

    2012-01-01

    Background Even though ovarian tumors are not generally considered estrogen-sensitive, estrogens may still have an impact on ovarian tumor progression. The recently identified trans-membrane estrogen receptor GPER is involved in rapid estrogen signaling. Furthermore, it binds selective estrogen receptor modulators with agonistic effect, which could explain tamoxifen controversies. Methods GPER mRNA was assayed with quantitative real-time PCR (qPCR) in 42 primary ovarian tumors and 7 ovarian cancer cell lines. ERα and ERβ mRNA were analyzed for comparison. GPER protein was semi-quantified with densitometric scanning of Western blots and its tissue distribution analyzed with immunohistochemistry (IHC) in 40 ovarian tumors. In addition, IHC was evaluated in a tissue microarray (TMA) of 150 primary malignant ovarian tumors. Results All tumor samples contained GPER mRNA. The content of mRNA was not different between benign and malignant tumors, but one third of malignant samples over-expressed GPER mRNA. The content of ERα mRNA was higher in malignant than in benign tumors, whereas ERβ mRNA was higher in benign than in malignant tumors. GPER mRNA was detected in all seven ovarian cancer cell lines with highest levels in TOV21G and TOV112D cells. Similar expression pattern was seen for ERβ mRNA. Western blot demonstrated GPER protein in all tumor samples. Semi-quantification showed no difference between benign and malignant tumors, but about one third of malignant samples over-expressed GPER protein. GPER staining was localized mainly in epithelial cells. In the TMA study we found no correlation between GPER staining and clinical stage, histological grade or patient survival. Conclusions GPER mRNA as well as GPER protein is present in both benign and malignant ovarian tumor tissue. About one third of malignant tumors over-expressed both GPER mRNA and protein. This, however, correlated neither with histological or clinical parameters nor with patient survival. PMID:22424333

  3. A single-center experience and review of the literature: 64 cases of phyllodes tumors to better understand risk factors and disease management.

    PubMed

    Lightner, Amy L; Shurell, Elizabeth; Dawson, Nicole; Omidvar, Yasaman; Foster, Nova

    2015-03-01

    Phyllodes tumors of the breast are rare fibroepithelial tumors that are characterized as benign, borderline, or malignant based on cellular characteristics such as stromal overgrowth and number of mitoses. Currently, there is a lack of consensus on risk factors and management of patients with phyllodes tumors, which has led to variation in treatment patterns as well as patient outcomes across many institutions. This study seeks to understand the clinicopathologic features, risk factors for local and metastatic recurrence, and clinical outcomes of patients with phyllodes tumors to better define optimal treatment patterns.

  4. Anti-melanoma activity of Forsythiae Fructus aqueous extract in mice involves regulation of glycerophospholipid metabolisms by UPLC/Q-TOF MS-based metabolomics study

    PubMed Central

    Bao, Jiaolin; Liu, Fang; Zhang, Chao; Wang, Kai; Jia, Xuejing; Wang, Xiaotong; Chen, Meiwan; Li, Peng; Su, Huanxing; Wang, Yitao; Wan, Jian-Bo; He, Chengwei

    2016-01-01

    Metabolomics is a comprehensive assessment of endogenous metabolites of a biological system in a holistic context. In this study, we evaluated the in vivo anti-melanoma activity of aqueous extract of Forsythiae Fructus (FAE) and globally explored the serum metabolome characteristics of B16-F10 melanoma-bearing mice. UPLC/Q-TOF MS combined with pattern recognition approaches were employed to examine the comprehensive metabolic signatures and differentiating metabolites. The results demonstrated that FAE exhibited remarkable antitumor activity against B16-F10 melanoma in C57BL/6 mice and restored the disturbed metabolic profile by tumor insult. We identified 17 metabolites which were correlated with the antitumor effect of FAE. Most of these metabolites are involved in glycerophospholipid metabolisms. Notably, several lysophosphatidylcholines (LysoPCs) significantly decreased in tumor model group, while FAE treatment restored the changes of these phospholipids to about normal condition. Moreover, we found that lysophosphatidylcholine acyltransferase 1 (LPCAT1) and autotaxin (ATX) were highly expressed in melanoma, and FAE markedly down-regulated their expression. These findings indicated that modulation of glycerophospholipid metabolisms may play a pivotal role in the growth of melanoma and the antitumor activity of FAE. Besides, our results suggested that serum LysoPCs could be potential biomarkers for the diagnosis and prognosis of melanoma and other malignant tumors. PMID:27991567

  5. Precision medicine for hepatocelluar carcinoma using molecular pattern diagnostics: results from a preclinical pilot study.

    PubMed

    Agarwal, Rahul; Cao, Yuan; Hoffmeier, Klaus; Krezdorn, Nicolas; Jost, Lukas; Meisel, Alejandro Rodriguez; Jüngling, Ruth; Dituri, Francesco; Mancarella, Serena; Rotter, Björn; Winter, Peter; Giannelli, Gianluigi

    2017-06-08

    The aim of this study was to design a road map for personalizing cancer therapy in hepatocellular carcinoma (HCC) by using molecular pattern diagnostics. As an exploratory study, we investigated molecular patterns of tissues of two tumors from individual HCC patients, which in previous experiments had shown contrasting reactions to the phase 2 transforming growth factor beta receptor 1 inhibitor galunisertib. Cancer-driving molecular patterns encompass - inter alias - altered transcription profiles and somatic mutations in coding regions differentiating tumors from their respective peritumoral tissues and from each other. Massive analysis of cDNA ends and all-exome sequencing demonstrate a highly divergent transcriptional and mutational landscape, respectively, for the two tumors, that offers potential explanations for the tumors contrasting responses to galunisertib. Molecular pattern diagnostics (MPDs) suggest alternative, individual-tumor-specific therapies, which in both cases deviate from the standard sorafenib treatment and from each other. Suggested personalized therapies use kinase inhibitors and immune-focused drugs as well as low-toxicity natural compounds identified using an advanced bioinformatics routine included in the MPD protocol. The MPD pipeline we describe here for the prediction of suitable drugs for treatment of two contrasting HCCs may serve as a blueprint for the design of therapies for various types of cancer.

  6. Endometrial stromal sarcoma involving the urinary bladder: a study of 6 cases.

    PubMed

    Tian, Wei; Latour, Mathieu; Epstein, Jonathan I

    2014-07-01

    Endometrial stromal sarcoma (ESS) involving the urinary bladder is very rare, with no prior series reported. We identified 6 cases of low-grade ESS involving the bladder at our institution (1998 to 2013), 5 of them consults. The median age at bladder involvement was 60 years (range, 44 to 77 y). One patient presented with bladder involvement at initial diagnosis of ESS. The remaining 5 cases with bladder involvement presented 7 to 30 years (mean 18 y) after a known diagnosis of ESS (n=2) or after a remote history of hysterectomy with an uncertain diagnosis (n=3). The location of bladder involvement included dome (n=1), trigone (n=2), diffuse (n=1), and unknown (n=2). Two cases demonstrated worm-like infiltrating tumor nests classic of low-grade ESS with little stromal reaction with retraction artifact mimicking vascular invasion. One case originating from the ovary showed focal glandular differentiation in the bladder, resembling endometriosis. Two cases had abundant keloidal collagen formation, arranged haphazardly or in a sunburst pattern. One case showed primitive cells infiltrating entirely hyalinized stroma, after chemotherapy given for a misdiagnosis of urothelial carcinoma. CD31 was negative in all cases, except for 1 case with obvious large vessel invasion. The differential diagnosis included a large nested variant of urothelial carcinoma, carcinoid tumor, synovial sarcoma, solitary fibrous tumor, Ewing sarcoma/primitive neuroectodermal tumors, and endometriosis. CD10 was strongly positive in 5 cases, and 1 case had very focal, moderate staining. Estrogen receptor showed strong and diffuse staining in all 6 cases. Progesterone receptor showed moderate to strong staining in 5 cases and focal staining in 1 case. One case showed PAX8 expression, and 2 cases showed p16 nuclear and cytoplasmic expression. CD56 showed weak to strong staining in 4 cases. Two cases had diffuse synaptophysin, and 1 case had focal p63 positivity. GATA-3, CD34, and CD99 were negative in all cases. The Ki-67 index was 1% to 10% (mean 4%). The mitotic count was 0 to 3/10 HPF (mean <1/10 HPF). Two patients had metastases to pelvic lymph nodes, and 1 had possible lung metastasis. Three patients were treated with Megace and 1 with Arimidex after surgery. Follow-up averaged 19 years (0 to 33 y) after the initial diagnosis of ESS or hysterectomy and 3.5 years (0 to 11 y) after bladder surgery. ESS involving the bladder is extremely rare with a very long interval from onset to bladder involvement. In female patients, low-grade spindle cell lesions involving the bladder should include ESS in the differential diagnosis.

  7. Cancer-induced anorexia in tumor-bearing mice is dependent on cyclooxygenase-1.

    PubMed

    Ruud, Johan; Nilsson, Anna; Engström Ruud, Linda; Wang, Wenhua; Nilsberth, Camilla; Iresjö, Britt-Marie; Lundholm, Kent; Engblom, David; Blomqvist, Anders

    2013-03-01

    It is well-established that prostaglandins (PGs) affect tumorigenesis, and evidence indicates that PGs also are important for the reduced food intake and body weight loss, the anorexia-cachexia syndrome, in malignant cancer. However, the identity of the PGs and the PG producing cyclooxygenase (COX) species responsible for cancer anorexia-cachexia is unknown. Here, we addressed this issue by transplanting mice with a tumor that elicits anorexia. Meal pattern analysis revealed that the anorexia in the tumor-bearing mice was due to decreased meal frequency. Treatment with a non-selective COX inhibitor attenuated the anorexia, and also tumor growth. When given at manifest anorexia, non-selective COX-inhibitors restored appetite and prevented body weight loss without affecting tumor size. Despite COX-2 induction in the cerebral blood vessels of tumor-bearing mice, a selective COX-2 inhibitor had no effect on the anorexia, whereas selective COX-1 inhibition delayed its onset. Tumor growth was associated with robust increase of PGE(2) levels in plasma - a response blocked both by non-selective COX-inhibition and by selective COX-1 inhibition, but not by COX-2 inhibition. However, there was no increase in PGE(2)-levels in the cerebrospinal fluid. Neutralization of plasma PGE(2) with specific antibodies did not ameliorate the anorexia, and genetic deletion of microsomal PGE synthase-1 (mPGES-1) affected neither anorexia nor tumor growth. Furthermore, tumor-bearing mice lacking EP(4) receptors selectively in the nervous system developed anorexia. These observations suggest that COX-enzymes, most likely COX-1, are involved in cancer-elicited anorexia and weight loss, but that these phenomena occur independently of host mPGES-1, PGE(2) and neuronal EP(4) signaling. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Improved brain tumor segmentation by utilizing tumor growth model in longitudinal brain MRI

    NASA Astrophysics Data System (ADS)

    Pei, Linmin; Reza, Syed M. S.; Li, Wei; Davatzikos, Christos; Iftekharuddin, Khan M.

    2017-03-01

    In this work, we propose a novel method to improve texture based tumor segmentation by fusing cell density patterns that are generated from tumor growth modeling. To model tumor growth, we solve the reaction-diffusion equation by using Lattice-Boltzmann method (LBM). Computational tumor growth modeling obtains the cell density distribution that potentially indicates the predicted tissue locations in the brain over time. The density patterns is then considered as novel features along with other texture (such as fractal, and multifractal Brownian motion (mBm)), and intensity features in MRI for improved brain tumor segmentation. We evaluate the proposed method with about one hundred longitudinal MRI scans from five patients obtained from public BRATS 2015 data set, validated by the ground truth. The result shows significant improvement of complete tumor segmentation using ANOVA analysis for five patients in longitudinal MR images.

  9. Improved brain tumor segmentation by utilizing tumor growth model in longitudinal brain MRI.

    PubMed

    Pei, Linmin; Reza, Syed M S; Li, Wei; Davatzikos, Christos; Iftekharuddin, Khan M

    2017-02-11

    In this work, we propose a novel method to improve texture based tumor segmentation by fusing cell density patterns that are generated from tumor growth modeling. In order to model tumor growth, we solve the reaction-diffusion equation by using Lattice-Boltzmann method (LBM). Computational tumor growth modeling obtains the cell density distribution that potentially indicates the predicted tissue locations in the brain over time. The density patterns is then considered as novel features along with other texture (such as fractal, and multifractal Brownian motion (mBm)), and intensity features in MRI for improved brain tumor segmentation. We evaluate the proposed method with about one hundred longitudinal MRI scans from five patients obtained from public BRATS 2015 data set, validated by the ground truth. The result shows significant improvement of complete tumor segmentation using ANOVA analysis for five patients in longitudinal MR images.

  10. Comparative evaluation of iodine-131 metaiodobenzylguanidine and 18-fluorodeoxyglucose positron emission tomography in assessing neural crest tumors: Will they play a complementary role?

    PubMed

    Kundu, Soumyakanti; Kand, Purushottam; Basu, Sandip

    2017-01-01

    18-Fluorodeoxyglucose positron emission tomography (FDG-PET) has established a role in the evaluation of several malignancies. However, its precise clinical role in the neural crest cell tumors continues to evolve. The purpose of this study was to compare iodine-131 metaiodobenzylguanidine ( 131 I-MIBG) and FDG-PET of head to head in patients with neural crest tumors both qualitatively and semiquantitatively and to determine their clinical utility in disease status evaluation and further management. A total of 32 patients who had undergone 131 I-MIBG and FDG-PET prospectively were evaluated and clinicopathologically grouped into three categories: neuroblastoma, pheochromocytoma, and medullary carcinoma thyroid. In 18 patients of neuroblastoma, FDG PET and 131 I-MIBG showed patient-specific sensitivity of 84% and 72%, respectively. The mean maximum standardized uptake value (SUV max ) of primary lesions in patients with unfavorable histology was found to be relatively higher than those with favorable histology (5.18 ± 2.38 vs. 3.21 ± 1.69). The mean SUV max of two common sites (posterior superior iliac spine [PSIS] and greater trochanter) was higher in patients with involved marrow than those with uninvolved one (2.36 and 2.75 vs. 1.26 and 1.34, respectively). The ratio of SUV max of the involved/contralateral normal sites was 2.16 ± 1.9. In equivocal bone marrow results, the uptake pattern with SUV estimation can depict metastatic involvement and help in redirecting the biopsy site. Among seven patients of pheochromocytoma, FDG-PET revealed 100% patient-specific sensitivity. FDG-PET detected more metastatic foci than 131 I-MIBG (18 vs. 13 sites). In seven patients of medullary carcinoma thyroid, FDG-PET localized residual, recurrent, or metastatic disease with much higher sensitivity (32 metastatic foci with 72% patient specific sensitivity) than 131 I-MIBG, trending along the higher serum calcitonin levels. FDG-PET is not only a good complementary modality in the management of neural crest cell tumors but also it can even be superior, especially in cases of 131 I-MIBG nonavid tumors.

  11. Blood vessel endothelium-directed tumor cell streaming in breast tumors requires the HGF/C-Met signaling pathway

    PubMed Central

    Leung, E; Xue, A; Wang, Y; Rougerie, P; Sharma, V P; Eddy, R; Cox, D; Condeelis, J

    2017-01-01

    During metastasis to distant sites, tumor cells migrate to blood vessels. In vivo, breast tumor cells utilize a specialized mode of migration known as streaming, where a linear assembly of tumor cells migrate directionally towards blood vessels on fibronectin-collagen I-containing extracellular matrix (ECM) fibers in response to chemotactic signals. We have successfully reconstructed tumor cell streaming in vitro by co-plating tumors cells, macrophages and endothelial cells on 2.5 μm thick ECM-coated micro-patterned substrates. We found that tumor cells and macrophages, when plated together on the micro-patterned substrates, do not demonstrate sustained directional migration in only one direction (sustained directionality) but show random bi-directional walking. Sustained directionality of tumor cells as seen in vivo was established in vitro when beads coated with human umbilical vein endothelial cells were placed at one end of the micro-patterned ‘ECM fibers' within the assay. We demonstrated that these endothelial cells supply the hepatocyte growth factor (HGF) required for the chemotactic gradient responsible for sustained directionality. Using this in vitro reconstituted streaming system, we found that directional streaming is dependent on, and most effectively blocked, by inhibiting the HGF/C-Met signaling pathway between endothelial cells and tumor cells. Key observations made with the in vitro reconstituted system implicating C-Met signaling were confirmed in vivo in mammary tumors using the in vivo invasion assay and intravital multiphoton imaging of tumor cell streaming. These results establish HGF/C-Met as a central organizing signal in blood vessel-directed tumor cell migration in vivo and highlight a promising role for C-Met inhibitors in blocking tumor cell streaming and metastasis in vivo, and for use in human trials. PMID:27893712

  12. Pattern of SMARCB1 (INI1) and SMARCA4 (BRG1) in poorly differentiated endometrioid adenocarcinoma of the uterus: analysis of a series with emphasis on a novel SMARCA4-deficient dedifferentiated rhabdoid variant.

    PubMed

    Strehl, Johanna D; Wachter, David L; Fiedler, Jutta; Heimerl, Engelbert; Beckmann, Matthias W; Hartmann, Arndt; Agaimy, Abbas

    2015-08-01

    The role of the switch/sucrose nonfermenting chromatin remodeling complex in the initiation and progression of cancer is emerging. In the female genital tract, only ovarian small cell carcinoma, hypercalcemic type harbors recurrent inactivating SMARCA4 mutations. Otherwise, only rare case reports documented SMARCB1 involvement in endometrial cancer. We analyzed 24 grade 3 uterine endometrioid adenocarcinomas and 2 undifferentiated carcinomas for immunohistochemical expression of SMARCB1 and SMARCA4. All tumors showed high-grade nuclear features with a predominance of solid growth pattern. All cases showed intact nuclear SMARCB1 expression in all tumor cells. However, 1 case of a 78-year-old woman showed complete loss of SMARCA4 in 90% of the tumor with retained expression in 10% of the tumor. The SMARCA4-intact component was a moderate-to-poorly differentiated endometrioid adenocarcinoma. The SMARCA4-deficient dominating component showed solid growth of highly anaplastic undifferentiated large cells with prominent rhabdoid features. None of the 25 SMARCA4-intact cases showed rhabdoid cell morphology. To our knowledge, this is the first systematic study of SMARCB1 and SMARCA4 expression in endometrioid adenocarcinoma of uterus and the first description of a novel SMARCA4-deficient variant of dedifferentiated/undifferentiated endometrial carcinoma. The presence of a differentiated SMARCA4-intact endometrioid component points to a novel pathway of dedifferentiation in endometrioid adenocarcinoma as a consequence of a "second hit." This case further underlines the close link between the "rhabdoid phenotype" and the SWI/SNF pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Patterns of response and relapse in primary CNS lymphomas after first-line chemotherapy: imaging analysis of the ANOCEF-GOELAMS prospective randomized trial

    PubMed Central

    Tabouret, Emeline; Houillier, Caroline; Martin-Duverneuil, Nadine; Blonski, Marie; Soussain, Carole; Ghesquières, Herve; Houot, Roch; Larrieu, Delphine; Soubeyran, Pierre; Gressin, Remy; Gyan, Emmanuel; Chinot, Olivier; Taillandier, Luc; Choquet, Sylvain; Alentorn, Agusti; Leclercq, Delphine; Omuro, Antonio; Tanguy, Marie-Laure

    2017-01-01

    Abstract Background. Our aim was to review MRI characteristics of patients with primary CNS lymphoma (PCNSL) enrolled in a randomized phase II trial and to evaluate their potential prognostic value and patterns of relapse, including T2 fluid attenuated inversion recovery (FLAIR) MRI abnormalities. Methods. Neuroimaging findings in 85 patients with PCNSL enrolled in a prospective trial were reviewed blinded to outcomes. MRI characteristics and responses according to International PCNSL Collaborative Group (IPCG) criteria were correlated with progression-free survival (PFS) and overall survival (OS). Results. Multivariate analysis showed that objective response at 2 months (P < .001) and at end of treatment (P = .015) were predictors of prolonged OS. Infratentorial location (P = .008) and large (>11.4 cm3) enhancing tumor volume (P = .006) were associated with poor OS and PFS, respectively. Ratio of change in product of largest diameters at early MRI evaluation but not timing of complete response achievement (early vs delayed) was prognostic for OS. Sixty-nine patients relapsed. Relapse in the brain (n = 52) involved an initial enhancing site, a different site, or both in 46%, 40%, and 14% of patients, respectively. At baseline, non-enhancing T2-FLAIR hypersignal lesions distant from the enhancing tumor site were detected in 18 patients. These lesions markedly decreased (>50%) in 16 patients after chemotherapy, supporting their neoplastic nature. Of these patients, 10/18 relapsed, half (n = 5) in the initially non-enhancing T2-FLAIR lesions. Conclusions. Baseline tumor size and infratentorial localization are of prognostic value in PCNSL. Our findings provide evidence that non-enhancing FLAIR abnormalities may add to overall tumor burden, suggesting that response criteria should be refined to incorporate evaluation of T2-weighted/FLAIR sequences. PMID:27994065

  14. Distant Metastasis Risk Stratification for Patients Undergoing Curative Resection Followed by Adjuvant Chemoradiation for Extrahepatic Bile Duct Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Kyubo; Chie, Eui Kyu, E-mail: ekchie93@snu.ac.kr; Jang, Jin-Young

    2012-09-01

    Purpose: To analyze the prognostic factors predicting distant metastasis in patients undergoing adjuvant chemoradiation for extrahepatic bile duct (EHBD) cancer. Methods and Materials: Between January 1995 and August 2006, 166 patients with EHBD cancer underwent resection with curative intent, followed by adjuvant chemoradiation. There were 120 males and 46 females, and median age was 61 years (range, 34-86). Postoperative radiotherapy was delivered to tumor bed and regional lymph nodes (median dose, 40 Gy; range, 34-56 Gy). A total of 157 patients also received fluoropyrimidine chemotherapy as a radiosensitizer, and fluoropyrimidine-based maintenance chemotherapy was administered to 127 patients. Median follow-up durationmore » was 29 months. Results: The treatment failed for 97 patients, and the major pattern of failure was distant metastasis (76 patients, 78.4%). The 5-year distant metastasis-free survival rate was 49.4%. The most common site of distant failure was the liver (n = 36). On multivariate analysis, hilar tumor, tumor size {>=}2 cm, involved lymph node, and poorly differentiated tumor were associated with inferior distant metastasis-free survival (p = 0.0348, 0.0754, 0.0009, and 0.0078, respectively), whereas T stage was not (p = 0.8081). When patients were divided into four groups based on these risk factors, the 5-year distant metastasis-free survival rates for patients with 0, 1, 2, and 3 risk factors were 86.4%, 59.9%, 32.5%, and 0%, respectively (p < 0.0001). Conclusion: Despite maintenance chemotherapy, distant metastasis was the major pattern of failure in patients undergoing adjuvant chemoradiation for EHBD cancer after resection with curative intent. Intensified chemotherapy is warranted to improve the treatment outcome, especially in those with multiple risk factors.« less

  15. Tumoral cavitation in patients with non-small-cell lung cancer treated with antiangiogenic therapy using bevacizumab

    PubMed Central

    Nishino, Mizuki; Cryer, Sarah K.; Okajima, Yuka; Sholl, Lynette M.; Hatabu, Hiroto; Rabin, Michael S.; Jackman, David M.; Johnson, Bruce E.

    2012-01-01

    Abstract Rationale and objectives: To investigate the frequency and radiographic patterns of tumoral cavitation in patients with non-small cell lung cancer (NSCLC) treated with bevacizumab, and correlate the imaging findings with the pathology, clinical characteristics and outcome. Materials and methods: Seventy-two patients with NSCLC treated with bevacizumab therapy were identified retrospectively. Baseline and follow-up chest computed tomography scan were reviewed to identify tumoral cavitation and subsequent filling in of cavitation. Radiographic cavitation patterns were classified into 3 groups. The clinical and outcome data were correlated with cavity formation and patterns. Results: Out of 72 patients, 14 patients developed cavitation after the initiation of bevacizumab therapy (19%; median time to event, 1.5 months; range 1.0–24.8 months). Three radiographic patterns of tumoral cavitation were noted: (1) development of cavity within the dominant lung tumor (n = 8); (2) development of non-dominant cavitary nodules (n = 3); and (3) development of non-dominant cavitary nodules with adjacent interstitial abnormalities (n = 3). Eleven patients (79%) demonstrated subsequent filling in of cavitation (the time from the cavity formation to filling in; median 3.7 months; range 1.9–22.7 months). No significant difference was observed in the clinical characteristics, including smoking history, or in the survival between patients who developed cavitation and those who did not. Smoking history demonstrated a significant difference across 3 radiographic cavitation patterns (P = 0.006). Hemoptysis was noted in 1 patient with cavity formation and 4 patients without, with no significant difference between the 2 groups. Conclusion: Tumoral cavitation occurred in 19% in patients with NSCLC treated with bevacizumab and demonstrated 3 radiographic patterns. Subsequent filling in of cavitation was noted in the majority of cases. PMID:22743083

  16. Expression of p53 and selected proliferative markers (Ki-67, MCM3, PCNA, and topoisomerase IIα) in borderline ovarian tumors: Correlation with clinicopathological features.

    PubMed

    Ciepliński, Klaudiusz; Jóźwik, Maciej; Semczuk-Sikora, Anna; Gogacz, Marek; Lewkowicz, Dorota; Ignatov, Atanas; Semczuk, Andrzej

    2018-02-01

    The expression of p53 has been studied not only in primary human ovarian carcinomas, but also in borderline ovarian tumors, however, the results were discordant. Expression patterns of proteins involved in cell proliferation and apoptosis have been investigated in various human neoplasms, including female genital tract neoplasms. The aim of this investigation was to assess the staining pattern and immunolocalization of p53 and selected proliferative markers (Ki-67, MCM3, PCNA, and topoisomerase IIα) in borderline ovarian tumors (BOTs). The study group consisted of 42 women who underwent pelvic surgery between 2006-2015. The median patients' age was 46 years. The immunoperoxidase technique was employed using antibodies against p53, Ki-67, MCM3, PCNA, and topoisomerase IIα. For p53, nuclear expression was observed in BOTs, however, cytoplasmatic immunoreactivity was also detected. Altogether, 25 (60%) tumors demonstrated positive p53 immunostaining, including overexpression found in 6 (14%). There were no significant differences in p53 expression between subgroups of clinicopathological variables. Immunoexpression of Ki-67, MCM3, PCNA, and topoisomerase IIα was nuclear. Ki-67 expression was positive in 12 (29%) cases and there was a trend towards a relationship between patients' age and Ki-67 staining (P=0.08). Interestingly, a significantly higher Ki-67 expression was found in tumors of ≥10 cm in diameter compared to smaller tumors (P=0.008). MCM3 expression was detected in 38 (90%) tumors, and PCNA expression in 28 (67%), yet none of clinicopathological factors was related to them. Topoisomerase IIα expression was present in 14 (33%) cases and, interestingly, its significantly higher expression was observed in BOTs of ≥10 cm in diameter compared to smaller tumors (P=0.008). Moreover, Spearman's correlation revealed highly significant positive associations between Ki-67 and topoisomerase IIα (R=0.403, P=0.008) and Ki-67 and MCM3 (R=0.469, P=0.001). We report a high positive immunostaining rate for p53, suggesting a role of TP53 alterations in the development of BOTs in humans. The new finding of higher topoisomerase IIα immunostaining positivity in BOTs of ≥10 cm may be clinically relevant and requires further studies on larger patient groups.

  17. Morphogenesis and Complexity of the Tumor Patterns

    NASA Astrophysics Data System (ADS)

    Izquierdo-Kulich, E.; Nieto-Villar, J. M.

    A mechanism to describe the apoptosis process at mesoscopic level through p53 is proposed in this paper. A deterministic model given by three differential equations is deduced from the mesoscopic approach, which exhibits sustained oscillations caused by a supercritical Andronov-Hopf bifurcation. Taking as hypothesis that the p53 sustained oscillation is the fundamental mechanism for apoptosis regulation; the model predicts that it is necessary a strict control of p53 to stimulated it, which is an important consideration to established new therapy strategy to fight cancer. The mathematical modeling of tumor growth allows us to describe the most important regularities of these systems. A stochastic model, based on the most important processes that take place at the level of individual cells, is proposed to predict the dynamical behavior of the expected radius of the tumor and its fractal dimension. It was found that the tumor has a characteristic fractal dimension, which contains the necessary information to predict the tumor growth until it reaches a stationary state. The mathematical modeling of tumor growth is an approach to explain the complex nature of these systems. A model that describes tumor growth was obtained by using a mesoscopic formalism and fractal dimension. This model theoretically predicts the relation between the morphology of the cell pattern and the mitosis/apoptosis quotient that helps to predict tumor growth from tumoral cells fractal dimension. The relation between the tumor macroscopic morphology and the cell pattern morphology is also determined. This could explain why the interface fractal dimension decreases with the increase of the cell pattern fractal dimension and consequently with the increase of the mitosis/apoptosis relation. Indexes to characterize tumoral cell proliferation and invasion capacities are proposed and used to predict the growth of different types of tumors. These indexes also show that the proliferation capacity is directly proportional to the invasion capacity. The proposed model assumes: i) only interface cells proliferate and invade the host, and ii) the fractal dimension of tumoral cell patterns, can reproduce the Gompertzian growth law. A mathematical model was obtained to describe the relation between the tissue morphology of cervix carcinoma and both dynamic processes of mitosis and apoptosis, and an expression to quantify the tumor aggressiveness, which in this context is associated with the tumor growth rate. The proposed model was applied to Stage III cervix carcinoma in vivo studies. In this study we found that the apoptosis rate was significantly smaller in the tumor tissues and both the mitosis rate and aggressiveness index decrease with Stage III patient's age. These quantitative results correspond to observed behavior in clinical and genetics studies. Finally, the entropy production rate was determined for avascular tumor growth. The proposed formula relates the fractal dimension of the tumor contour with the quotient between mitosis and apoptosis rate, which can be used to characterize the degree of proliferation of tumor cells. The entropy production rate was determined for fourteen tumor cell lines as a physical function of cancer robustness. The entropy production rate is a hallmark that allows us the possibility of prognosis of tumor proliferation and invasion capacities, key factors to improve cancer therapy.

  18. THE CHARACTERS OF A THIRD TRANSPLANTABLE CHICKEN TUMOR DUE TO A FILTERABLE CAUSE. A SARCOMA OF INTRACANALICULAR PATTERN

    PubMed Central

    Rous, Peyton; Lange, Linda B.

    1913-01-01

    A spontaneous chicken sarcoma, peculiarly fissured by blood sinuses, and with a tendency to intracanalicular extension into them, has been transplanted and studied in eight successive groups of fowls. Histologically the growth is a characteristic neoplasm, while in its transfer to new hosts a real transplantation is obviously involved. The development of the first few series of transplantation tumors was very slow. They exhibited the histological structure of the original growth and had the same tendency to metastasize to the skeletal muscles. Recently the tumor has grown more rapidly and in a higher percentage of hosts. With this has come a simplification of structure to that of a pure, spindle-celled sarcoma. Fowls of an alien variety (Plymouth Rock) form quite as good hosts for the tumor as those of the sort (brown Leghorn) in which it was originally found. It has not grown in pigeons, rats, or mice. The question of the cause of the tumor is not taken up in the present paper. It has been found to be due to an agent which will pass through Berkefeld filters. The growth is quite distinct in its characters from the other two transplantable neoplasms of the fowl (a spindle-celled sarcoma, an osteochondrosarcoma) which have such a cause. No growth like it has been observed among the forty-three spontaneous tumors of the fowl that have come under our observation. PMID:19867738

  19. Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

    PubMed

    Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

    2011-12-01

    Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

  20. DTI fiber tracking to differentiate demyelinating diseases from diffuse brain stem glioma.

    PubMed

    Giussani, Carlo; Poliakov, Andrew; Ferri, Raymond T; Plawner, Lauren L; Browd, Samuel R; Shaw, Dennis W W; Filardi, Tanya Z; Hoeppner, Corrine; Geyer, J Russell; Olson, James M; Douglas, James G; Villavicencio, Elisabeth H; Ellenbogen, Richard G; Ojemann, Jeffrey G

    2010-08-01

    Intrinsic diffuse brainstem tumors and demyelinating diseases primarily affecting the brainstem can share common clinical and radiological features, sometimes making the diagnosis difficult especially at the time of first clinical presentation. To explore the potential usefulness of new MRI sequences in particular diffusion tensor imaging fiber tracking in differentiating these two pathological entities, we review a series of brainstem tumors and demyelinating diseases treated at our institution. The clinical history including signs and symptoms and MRI findings of three consecutive demyelinating diseases involving the brainstem that presented with diagnostic uncertainty and three diffuse intrinsic brainstem tumors were reviewed, along with a child with a supratentorial tumor for comparison. Fiber tracking of the pyramidal tracts was performed for each patient using a DTI study at the time of presentation. Additionally Fractional Anisotropy values were calculated for each patient in the pons and the medulla oblongata. Routine MR imaging was unhelpful in differentiating between intrinsic tumor and demyelination. In contrast, retrospective DTI fiber tracking clearly differentiated the pathology showing deflection of the pyramidal tracts posteriorly and laterally in the case of intrinsic brainstem tumors and, in the case of demyelinating disease, poorly represented and truncated fibers. Regionalized FA values were variable and of themselves were not predictive either pathology. DTI fiber tracking of the pyramid tracts in patients with suspected intrinsic brainstem tumor or demyelinating disease presents two clearly different patterns that may help in differentiating between these two pathologies when conventional MRI and clinical data are inconclusive. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Distinct anti-oncogenic effect of various microRNAs in different mouse models of liver cancer

    PubMed Central

    Wu, Heng; Liu, Yan; Wang, XinWei; Calvisi, Diego F.; Song, Guisheng; Chen, Xin

    2015-01-01

    Deregulation of microRNAs (miRNAs) is a typical feature of human hepatocellular carcinoma (HCC). However, the in vivo relevance of miRNAs along hepatocarcinogenesis remains largely unknown. Here, we show that liver tumors induced in mice by c-Myc overexpression or AKT/Ras co-expression exhibit distinct miRNA expression profiles. Among the downregulated miRNAs, eight (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802) were selected and their tumor suppressor activity was determined by overexpressing each of them together with c-Myc or AKT/Ras oncogenes in mouse livers via hydrodynamic transfection. The tumor suppressor activity of these microRNAs was extremely heterogeneous in c-Myc and AKT/Ras mice: while miR-378 had no tumor suppressor activity, miR-107, mir-122, miR-29, miR-365 and miR-802 exhibited weak to moderate tumor suppressor potential. Noticeably, miR-375 showed limited antineoplastic activity against c-Myc driven tumorigenesis, whereas it strongly inhibited AKT/Ras induced hepatocarcinogenesis. Furthermore, miR-101 significantly suppressed both c-Myc and AKT/Ras liver tumor development. Altogether, the present data demonstrate that different oncogenes induce distinct miRNA patterns, whose modulation differently affects hepatocarcinogenesis depending on the driving oncogenes. Finally, our findings support a strong tumor suppressor activity of miR-101 in liver cancer models regardless of the driver oncogenes involved, thus representing a promising therapeutic target in human HCC. PMID:25762642

  2. Glioblastoma Recurrence Patterns After Radiation Therapy With Regard to the Subventricular Zone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adeberg, Sebastian, E-mail: Sebastian.adeberg@med.uni-heidelberg; König, Laila; Bostel, Tilman

    Purpose: We evaluated the influence of tumor location and tumor spread in primary glioblastoma (GBM), with respect to the subventricular zone (SVZ), on recurrence behavior, progression-free survival (PFS), and overall survival (OS). Methods and Materials: 607 patients (376 male and 231 female) with a median age of 61.3 years (range, 3.0-87.9 years) and primary GBM treated with radiation therapy (RT) from 2004 to 2012 at a single institution were included in this retrospective study. Preoperative images and follow-up examination results were assessed to evaluate tumor location. Tumors were classified according to the tumor location in relation to the SVZ. Results: The medianmore » PFS of the study population was 5.2 months (range, 1-91 months), and the median OS was 13.8 months (range, 1-102 months). Kaplan-Meier analysis showed that tumor location in close proximity to the SVZ was associated with a significant decline in PFS and OS (4.8 and 12.3 months, respectively; each P<.001). Furthermore, in cases where tumors were involved with the SVZ, distant cerebral progression (43.8%; P=.005) and multifocal progression (39.8%; P=.008) were more common. Interestingly, opening of the ventricle during the previous surgery showed no impact on PFS and OS. Conclusion: GBM in close proximity to the SVZ was associated with decreased survival and had a higher risk of multifocal or distant progression. Ventricle opening during surgery had no effect on survival rates.« less

  3. Improved Endpoints for Cancer Immunotherapy Trials

    PubMed Central

    Eggermont, Alexander M. M.; Janetzki, Sylvia; Hodi, F. Stephen; Ibrahim, Ramy; Anderson, Aparna; Humphrey, Rachel; Blumenstein, Brent; Wolchok, Jedd

    2010-01-01

    Unlike chemotherapy, which acts directly on the tumor, cancer immunotherapies exert their effects on the immune system and demonstrate new kinetics that involve building a cellular immune response, followed by changes in tumor burden or patient survival. Thus, adequate design and evaluation of some immunotherapy clinical trials require a new development paradigm that includes reconsideration of established endpoints. Between 2004 and 2009, several initiatives facilitated by the Cancer Immunotherapy Consortium of the Cancer Research Institute and partner organizations systematically evaluated an immunotherapy-focused clinical development paradigm and created the principles for redefining trial endpoints. On this basis, a body of clinical and laboratory data was generated that supports three novel endpoint recommendations. First, cellular immune response assays generate highly variable results. Assay harmonization in multicenter trials may minimize variability and help to establish cellular immune response as a reproducible biomarker, thus allowing investigation of its relationship with clinical outcomes. Second, immunotherapy may induce novel patterns of antitumor response not captured by Response Evaluation Criteria in Solid Tumors or World Health Organization criteria. New immune-related response criteria were defined to more comprehensively capture all response patterns. Third, delayed separation of Kaplan–Meier curves in randomized immunotherapy trials can affect results. Altered statistical models describing hazard ratios as a function of time and recognizing differences before and after separation of curves may allow improved planning of phase III trials. These recommendations may improve our tools for cancer immunotherapy trials and may offer a more realistic and useful model for clinical investigation. PMID:20826737

  4. [Imaging of odontogenic tumors of the maxilla].

    PubMed

    Martin-Duverneuil, N; Sahli-Amor, M; Chiras, J

    2009-05-01

    Odontogenic tumors of the maxilla are frequent, mainly represented by cysts of the jaw. However, this group of tumors include a large number of potentially intricate pathologies whose evolution is dominated by frequent recurrences justifying long-term follow-up. When such a lesion is discovered, evaluation of imaging features combined with an extensive knowledge of the different patterns of other lesions (particularly their potentially evolutive patterns related to growth) can often suggest the diagnosis. While definitive diagnosis frequently relies on histology, it is not rare that the patterns are so intricate that final diagnosis is based on a correlation between clinical, imaging and histological findings.

  5. miRNA let-7b modulates macrophage polarization and enhances tumor-associated macrophages to promote angiogenesis and mobility in prostate cancer.

    PubMed

    Wang, Zhigang; Xu, Lu; Hu, Yinying; Huang, Yanqin; Zhang, Yujuan; Zheng, Xiufen; Wang, Shanshan; Wang, Yifan; Yu, Yanrong; Zhang, Meng; Yuan, Keng; Min, Weiping

    2016-05-09

    Macrophage polarization is a highly plastic physiological process that responds to a variety of environmental factors by changing macrophage phenotype and function. Tumor-associated macrophages (TAMs) are generally recognized as promoting tumor progression. As universal regulators, microRNAs (miRNAs) are functionally involved in numerous critical cellular processes including macrophage polarization. Let-7b, a miRNA, has differential expression patterns in inflamed tissues compared with healthy controls. However, whether and how miRNA let-7b regulates macrophage phenotype and function is unclear. In this report, we find that up-regulation of let-7b is characteristic of prostatic TAMs, and down-regulation of let-7b in TAMs leads to changes in expression profiles of inflammatory cytokines, such as IL-12, IL-23, IL-10 and TNF-α. As a result, TAMs treated with let-7b inhibitors reduce angiogenesis and prostate carcinoma (PCa) cell mobility. Let-7b may play a vital role in regulating macrophage polarization, thus modulating the prognosis of prostate cancer.

  6. Up-regulation of CHAF1A, a poor prognostic factor, facilitates cell proliferation of colon cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Zehua; Cui, Feifei; Yu, Fudong

    2014-06-27

    Highlights: • We identified that CHAF1A was up-regulated in colon tumor mucosa in TMA. • The expression pattern of CHAF1A was validated with qPCR and western-blot. • CHAF1A overexpression is an independent indicator for poor colon cancer survival. • CHAF1A facilitates cell proliferation of colon cancer both in vitro and in vivo. - Abstract: Deregulation of chromatin assembly factor 1, p150 subunit A (CHAF1A) has recently been reported to be involved in the development of some cancer types. In this study, we identified that the frequency of positive CHAF1A staining in primary tumor mucosa (45.8%, 93 of 203 samples) wasmore » significantly elevated compared to that in paired normal mucosa (18.7%, 38 of 203 samples). The increased expression was strongly associated with cancer stage, tumor invasion, and histological grade. The five-year survival rate of patients with CHAF1A-positive tumors was remarkably lower than that of patients with CHAF1A-negative tumors. Colon cancer cells with CHAF1A knockdown exhibited decreased cell growth index, reduction in colony formation ability, elevated cell apoptosis rate as well as impaired colon tumorigenicity in nude mice. Hence, CHAF1A upregulation functions as a poor prognostic indicator of colon cancer, potentially contributing to its progression by mediating cancer cell proliferation.« less

  7. Transitional cell carcinoma of the endometrium associated with benign ovarian brenner tumor: a case report with immunohistochemistry molecular analysis and a review of the literature.

    PubMed

    Giordano, Giovanna; D'Adda, Tiziana; Gnetti, Letizia; Merisio, Carla; Raboni, Stefano

    2007-07-01

    Transitional cell carcinoma of the endometrium (TCCE) is a subtype of endometrial carcinoma, characterized by a prominent papillary pattern, resembling the papillary carcinoma of the urothelium. This neoplasm is very rare, with only 13 cases reported in the international literature. In this paper, a new case of TCCE associated with benign ovarian Brenner tumor is described. This association is extremely rare, with only 1 other case reported. A review of the literature is performed to delineate the clinico pathologic features of this malignancy. Moreover, immunohistochemical and molecular studies are carried out in the effort to establish the phenotype and etiology of this rare neoplasm. The molecular study, by polymerase chain reaction (PCR) failing to reveal the presence of HPV DNA, demonstrates that neither the TCCE nor the ovarian Brenner tumor is caused by an HPV infection. The association of TCCE with benign ovarian Brenner tumor could be a coincidental event. Conversely, this finding could be the manifestation of a multicentric metaplastic process (neometaplasia), involving both the coelomic epithelium of the ovary and the Mullerian epithelium of the uterus, or the evidence of "field effect" that manifests differently at different anatomical sites. In our view, other cases of TCCE associated with ovarian Brenner tumor should be reported to confirm the last 2 hypotheses.

  8. An integrated genomic approach identifies persistent tumor suppressive effects of transforming growth factor-β in human breast cancer

    PubMed Central

    2014-01-01

    Introduction Transforming growth factor-βs (TGF-βs) play a dual role in breast cancer, with context-dependent tumor-suppressive or pro-oncogenic effects. TGF-β antagonists are showing promise in early-phase clinical oncology trials to neutralize the pro-oncogenic effects. However, there is currently no way to determine whether the tumor-suppressive effects of TGF-β are still active in human breast tumors at the time of surgery and treatment, a situation that could lead to adverse therapeutic responses. Methods Using a breast cancer progression model that exemplifies the dual role of TGF-β, promoter-wide chromatin immunoprecipitation and transcriptomic approaches were applied to identify a core set of TGF-β-regulated genes that specifically reflect only the tumor-suppressor arm of the pathway. The clinical significance of this signature and the underlying biology were investigated using bioinformatic analyses in clinical breast cancer datasets, and knockdown validation approaches in tumor xenografts. Results TGF-β-driven tumor suppression was highly dependent on Smad3, and Smad3 target genes that were specifically enriched for involvement in tumor suppression were identified. Patterns of Smad3 binding reflected the preexisting active chromatin landscape, and target genes were frequently regulated in opposite directions in vitro and in vivo, highlighting the strong contextuality of TGF-β action. An in vivo-weighted TGF-β/Smad3 tumor-suppressor signature was associated with good outcome in estrogen receptor-positive breast cancer cohorts. TGF-β/Smad3 effects on cell proliferation, differentiation and ephrin signaling contributed to the observed tumor suppression. Conclusions Tumor-suppressive effects of TGF-β persist in some breast cancer patients at the time of surgery and affect clinical outcome. Carefully tailored in vitro/in vivo genomic approaches can identify such patients for exclusion from treatment with TGF-β antagonists. PMID:24890385

  9. Radiotherapy planning for glioblastoma based on a tumor growth model: improving target volume delineation.

    PubMed

    Unkelbach, Jan; Menze, Bjoern H; Konukoglu, Ender; Dittmann, Florian; Le, Matthieu; Ayache, Nicholas; Shih, Helen A

    2014-02-07

    Glioblastoma differ from many other tumors in the sense that they grow infiltratively into the brain tissue instead of forming a solid tumor mass with a defined boundary. Only the part of the tumor with high tumor cell density can be localized through imaging directly. In contrast, brain tissue infiltrated by tumor cells at low density appears normal on current imaging modalities. In current clinical practice, a uniform margin, typically two centimeters, is applied to account for microscopic spread of disease that is not directly assessable through imaging. The current treatment planning procedure can potentially be improved by accounting for the anisotropy of tumor growth, which arises from different factors: anatomical barriers such as the falx cerebri represent boundaries for migrating tumor cells. In addition, tumor cells primarily spread in white matter and infiltrate gray matter at lower rate. We investigate the use of a phenomenological tumor growth model for treatment planning. The model is based on the Fisher-Kolmogorov equation, which formalizes these growth characteristics and estimates the spatial distribution of tumor cells in normal appearing regions of the brain. The target volume for radiotherapy planning can be defined as an isoline of the simulated tumor cell density. This paper analyzes the model with respect to implications for target volume definition and identifies its most critical components. A retrospective study involving ten glioblastoma patients treated at our institution has been performed. To illustrate the main findings of the study, a detailed case study is presented for a glioblastoma located close to the falx. In this situation, the falx represents a boundary for migrating tumor cells, whereas the corpus callosum provides a route for the tumor to spread to the contralateral hemisphere. We further discuss the sensitivity of the model with respect to the input parameters. Correct segmentation of the brain appears to be the most crucial model input. We conclude that the tumor growth model provides a method to account for anisotropic growth patterns of glioma, and may therefore provide a tool to make target delineation more objective and automated.

  10. Radiotherapy planning for glioblastoma based on a tumor growth model: improving target volume delineation

    NASA Astrophysics Data System (ADS)

    Unkelbach, Jan; Menze, Bjoern H.; Konukoglu, Ender; Dittmann, Florian; Le, Matthieu; Ayache, Nicholas; Shih, Helen A.

    2014-02-01

    Glioblastoma differ from many other tumors in the sense that they grow infiltratively into the brain tissue instead of forming a solid tumor mass with a defined boundary. Only the part of the tumor with high tumor cell density can be localized through imaging directly. In contrast, brain tissue infiltrated by tumor cells at low density appears normal on current imaging modalities. In current clinical practice, a uniform margin, typically two centimeters, is applied to account for microscopic spread of disease that is not directly assessable through imaging. The current treatment planning procedure can potentially be improved by accounting for the anisotropy of tumor growth, which arises from different factors: anatomical barriers such as the falx cerebri represent boundaries for migrating tumor cells. In addition, tumor cells primarily spread in white matter and infiltrate gray matter at lower rate. We investigate the use of a phenomenological tumor growth model for treatment planning. The model is based on the Fisher-Kolmogorov equation, which formalizes these growth characteristics and estimates the spatial distribution of tumor cells in normal appearing regions of the brain. The target volume for radiotherapy planning can be defined as an isoline of the simulated tumor cell density. This paper analyzes the model with respect to implications for target volume definition and identifies its most critical components. A retrospective study involving ten glioblastoma patients treated at our institution has been performed. To illustrate the main findings of the study, a detailed case study is presented for a glioblastoma located close to the falx. In this situation, the falx represents a boundary for migrating tumor cells, whereas the corpus callosum provides a route for the tumor to spread to the contralateral hemisphere. We further discuss the sensitivity of the model with respect to the input parameters. Correct segmentation of the brain appears to be the most crucial model input. We conclude that the tumor growth model provides a method to account for anisotropic growth patterns of glioma, and may therefore provide a tool to make target delineation more objective and automated.

  11. Meningiomas involving the optic nerve: technical aspects and outcomes for a series of 50 patients.

    PubMed

    Margalit, Nevo S; Lesser, Jonathan B; Moche, Jason; Sen, Chandranath

    2003-09-01

    Surgical strategies and results for 50 patients with meningiomas involving the optic nerves are discussed and evaluated. Factors affecting the degree of resection and patient outcomes are presented. We emphasize our surgical techniques for resection of these tumors and we discuss the advantages of different approaches, depending on the relationship of the tumor to the optic nerves. Data for 50 patients with meningiomas involving the optic nerves who were surgically treated between 1991 and 2002 were reviewed, by using patient files, operative notes, and pre- and postoperative imaging and ophthalmological examination findings. Thirty-one female patients and 19 male patients, with a mean age of 53 years, were treated. Thirty-one patients (62%) underwent complete tumor removal (Simpson Grade 1 or 2), and 19 patients underwent subtotal removal (Grade 4). Factors affecting the grade of resection were tumor size (P = 0.01), location (P = 0.007), and internal carotid artery encasement (P = 0.019). Patients who underwent Grade 1 or 2 resection exhibited a mean tumor size of 3.0 cm, and patients who underwent Grade 4 resection exhibited a mean tumor size of 4.1 cm. Only three patients had residual tumor on the optic nerve; all others had tumor in the cavernous sinus or at the orbital apex or exhibited vascular involvement. Visual outcomes were influenced predominantly by tumor size, preoperative visual function, and optic nerve encasement. Meningiomas that involve the optic nerves require special considerations and surgical techniques. Early decompression of the optic nerve within the bony canal allows identification and separation of the tumor from the nerve, permitting removal of the tumor from this area with minimal manipulation of the optic nerve.

  12. Salivary gland sparing and improved target irradiation by conformal and intensity modulated irradiation of head and neck cancer.

    PubMed

    Eisbruch, Avraham; Ship, Jonathan A; Dawson, Laura A; Kim, Hyungjin M; Bradford, Carol R; Terrell, Jeffrey E; Chepeha, Douglas B; Teknos, Theodore N; Hogikyan, Norman D; Anzai, Yoshimi; Marsh, Lon H; Ten Haken, Randall K; Wolf, Gregory T

    2003-07-01

    The goals of this study were to facilitate sparing of the major salivary glands while adequately treating tumor targets in patients requiring comprehensive bilateral neck irradiation (RT), and to assess the potential for improved xerostomia. Since 1994 techniques of target irradiation and locoregional tumor control with conformal and intensity modulated radiation therapy (IMRT) have been developed. In patients treated with these modalities, the salivary flow rates before and periodically after RT have been measured selectively from each major salivary gland and the residual flows correlated with glands' dose volume histograms (DVHs). In addition, subjective xerostomia questionnaires have been developed and validated. The pattern of locoregional recurrence has been examined from computed tomography (CT) scans at the time of recurrence, transferring the recurrence volumes to the planning CT scans, and regenerating the dose distributions at the recurrence sites. Treatment plans for target coverage and dose homogeneity using static, multisegmental IMRT were found to be significantly better than standard RT plans. In addition, significant parotid gland sparing was achieved in the conformal plans. The relationships among dose, irradiated volume, and the residual saliva flow rates from the parotid glands were characterized by dose and volume thresholds. A mean radiation dose of 26 Gy was found to be the threshold for preserved stimulated saliva flow. Xerostomia questionnaire scores suggested that xerostomia was significantly reduced in patients irradiated with bilateral neck, parotid-sparing RT, compared to patients with similar tumors treated with standard RT. Examination of locoregional tumor recurrence patterns revealed that the large majority of recurrences occurred inside targets, in areas that had been judged to be at high risk and that had received RT doses according to the perceived risk. Tangible gains in salivary gland sparing and target coverage are being achieved, and an improvement in some measures of quality of life is suggested by our findings. Additional reduction of xerostomia may be achieved by further sparing of the salivary glands and the non-involved oral cavity. A mean parotid gland dose of < or = 26 Gy should be a planning objective if significant parotid function preservation is desired. The pattern of recurrence suggests that careful escalation of the dose to areas judged to be at highest risk may improve tumor control.

  13. miRNA-21 is developmentally regulated in mouse brain and is co-expressed with SOX2 in glioma

    PubMed Central

    2012-01-01

    Background MicroRNAs (miRNAs) and their role during tumor development have been studied in great detail during the last decade, albeit their expression pattern and regulation during normal development are however not so well established. Previous studies have shown that miRNAs are differentially expressed in solid human tumors. Platelet-derived growth factor (PDGF) signaling is known to be involved in normal development of the brain as well as in malignant primary brain tumors, gliomas, but the complete mechanism is still lacking. We decided to investigate the expression of the oncogenic miR-21 during normal mouse development and glioma, focusing on PDGF signaling as a potential regulator of miR-21. Methods We generated mouse glioma using the RCAS/tv-a system for driving PDGF-BB expression in a cell-specific manner. Expression of miR-21 in mouse cell cultures and mouse brain were assessed using Northern blot analysis and in situ hybridization. Immunohistochemistry and Western blot analysis were used to investigate SOX2 expression. LNA-modified siRNA was used for irreversible depletion of miR-21. For inhibition of PDGF signaling Gleevec (imatinib mesylate), Rapamycin and U0126, as well as siRNA were used. Statistical significance was calculated using double-sided unpaired Student´s t-test. Results We identified miR-21 to be highly expressed during embryonic and newborn brain development followed by a gradual decrease until undetectable at postnatal day 7 (P7), this pattern correlated with SOX2 expression. Furthermore, miR-21 and SOX2 showed up-regulation and overlapping expression pattern in RCAS/tv-a generated mouse brain tumor specimens. Upon irreversible depletion of miR-21 the expression of SOX2 was strongly diminished in both mouse primary glioma cultures and human glioma cell lines. Interestingly, in normal fibroblasts the expression of miR-21 was induced by PDGF-BB, and inhibition of PDGF signaling in mouse glioma primary cultures resulted in suppression of miR-21 suggesting that miR-21 is indeed regulated by PDGF signaling. Conclusions Our data show that miR-21 and SOX2 are tightly regulated already during embryogenesis and define a distinct population with putative tumor cell of origin characteristics. Furthermore, we believe that miR-21 is a mediator of PDGF-driven brain tumors, which suggests miR-21 as a promising target for treatment of glioma. PMID:22931209

  14. Expanding the molecular signature of ossifying fibromyxoid tumors with two novel gene fusions: CREBBP-BCORL1 and KDM2A-WWTR1.

    PubMed

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R

    2017-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

    PubMed Central

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

    2017-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. PMID:27537276

  16. Clinical usefulness of magnifying endoscopy for non-ampullary duodenal tumors.

    PubMed

    Mizumoto, Takeshi; Sanomura, Yoji; Tanaka, Shinji; Kuroki, Kazutoshi; Kurihara, Mio; Yoshifuku, Yoshikazu; Oka, Shiro; Arihiro, Koji; Shimamoto, Fumio; Chayama, Kazuaki

    2017-04-01

    Study aims  This study aimed to investigate the clinical usefulness of magnifying endoscopy (ME) for non-ampullary duodenal tumors. Patients and methods  We enrolled 103 consecutive patients with non-ampullary duodenal tumors that were observed by ME with narrow-band imaging (ME-NBI) and had pit pattern analysis before endoscopic resection at Hiroshima University Hospital before December 2014. ME-NBI images were classified as Type B or Type C according to the Hiroshima classification, and pit patterns were classified as regular or irregular. We studied the clinicopathological features and diagnoses with ME-NBI and pit pattern analyses according to the Vienna classification (category 3: 73 patients; category 4: 30 patients). Results  Category 4 lesions were significantly larger than category 3 lesions. According to ME-NBI images, category 4 Type C lesions (83 %) were significantly more common than category 4 Type B lesions (17 %). According to pit pattern analyses, category 4 irregular lesions 4 (77 %) were significantly more common than category 4 regular lesions (23 %). The accuracies of using Type C ME-NBI images and irregular pit patterns to diagnose category 4 lesions were 87 % and 84 %, the sensitivities were 83 % and 77 %, and the specificities were 89 % and 88 %, respectively. There was no significant difference between ME-NBI and pit pattern analyses for diagnosing the histologic grade of non-ampullary duodenal tumors. Conclusion  Our study showed that ME-NBI and pit pattern analysis had equivalent abilities to determine the histologic grade of non-ampullary duodenal tumors. ME-NBI may be more useful because it is a simple, less time-consuming procedure.

  17. Spatiotemporal analysis of tumor uptake patterns in dynamic (18)FDG-PET and dynamic contrast enhanced CT.

    PubMed

    Malinen, Eirik; Rødal, Jan; Knudtsen, Ingerid Skjei; Søvik, Åste; Skogmo, Hege Kippenes

    2011-08-01

    Molecular and functional imaging techniques such as dynamic positron emission tomography (DPET) and dynamic contrast enhanced computed tomography (DCECT) may provide improved characterization of tumors compared to conventional anatomic imaging. The purpose of the current work was to compare spatiotemporal uptake patterns in DPET and DCECT images. A PET/CT protocol comprising DCECT with an iodine based contrast agent and DPET with (18)F-fluorodeoxyglucose was set up. The imaging protocol was used for examination of three dogs with spontaneous tumors of the head and neck at sessions prior to and after fractionated radiotherapy. Software tools were developed for downsampling the DCECT image series to the PET image dimensions, for segmentation of tracer uptake pattern in the tumors and for spatiotemporal correlation analysis of DCECT and DPET images. DCECT images evaluated one minute post injection qualitatively resembled the DPET images at most imaging sessions. Segmentation by region growing gave similar tumor extensions in DCECT and DPET images, with a median Dice similarity coefficient of 0.81. A relatively high correlation (median 0.85) was found between temporal tumor uptake patterns from DPET and DCECT. The heterogeneity in tumor uptake was not significantly different in the DPET and DCECT images. The median of the spatial correlation was 0.72. DCECT and DPET gave similar temporal wash-in characteristics, and the images also showed a relatively high spatial correlation. Hence, if the limited spatial resolution of DPET is considered adequate, a single DPET scan only for assessing both tumor perfusion and metabolic activity may be considered. However, further work on a larger number of cases is needed to verify the correlations observed in the present study.

  18. Initial genome sequencing and analysis of multiple myeloma

    PubMed Central

    Chapman, Michael A.; Lawrence, Michael S.; Keats, Jonathan J.; Cibulskis, Kristian; Sougnez, Carrie; Schinzel, Anna C.; Harview, Christina L.; Brunet, Jean-Philippe; Ahmann, Gregory J.; Adli, Mazhar; Anderson, Kenneth C.; Ardlie, Kristin G.; Auclair, Daniel; Baker, Angela; Bergsagel, P. Leif; Bernstein, Bradley E.; Drier, Yotam; Fonseca, Rafael; Gabriel, Stacey B.; Hofmeister, Craig C.; Jagannath, Sundar; Jakubowiak, Andrzej J.; Krishnan, Amrita; Levy, Joan; Liefeld, Ted; Lonial, Sagar; Mahan, Scott; Mfuko, Bunmi; Monti, Stefano; Perkins, Louise M.; Onofrio, Robb; Pugh, Trevor J.; Vincent Rajkumar, S.; Ramos, Alex H.; Siegel, David S.; Sivachenko, Andrey; Trudel, Suzanne; Vij, Ravi; Voet, Douglas; Winckler, Wendy; Zimmerman, Todd; Carpten, John; Trent, Jeff; Hahn, William C.; Garraway, Levi A.; Meyerson, Matthew; Lander, Eric S.; Getz, Gad; Golub, Todd R.

    2013-01-01

    Multiple myeloma is an incurable malignancy of plasma cells, and its pathogenesis is poorly understood. Here we report the massively parallel sequencing of 38 tumor genomes and their comparison to matched normal DNAs. Several new and unexpected oncogenic mechanisms were suggested by the pattern of somatic mutation across the dataset. These include the mutation of genes involved in protein translation (seen in nearly half of the patients), genes involved in histone methylation, and genes involved in blood coagulation. In addition, a broader than anticipated role of NF-κB signaling was suggested by mutations in 11 members of the NF-κB pathway. Of potential immediate clinical relevance, activating mutations of the kinase BRAF were observed in 4% of patients, suggesting the evaluation of BRAF inhibitors in multiple myeloma clinical trials. These results indicate that cancer genome sequencing of large collections of samples will yield new insights into cancer not anticipated by existing knowledge. PMID:21430775

  19. An unusual case of uterine cotyledonoid dissecting leiomyoma with adenomyosis.

    PubMed

    Shimizu, Ai; Tanaka, Hoshihito; Iwasaki, Sari; Wakui, Yukio; Ikeda, Hitoshi; Suzuki, Akira

    2016-08-04

    Cotyledonoid dissecting leiomyoma is a rare variant of uterine smooth muscle tumor with an unusual growth pattern that shows intramural dissection within uterine myometrium and often a placenta-like appearance in its extrauterine components. We present a unique case of cotyledonoid dissecting leiomyoma with adenomyosis. A 40-year-old Japanese female presented with prolonged menorrhagia and severe anemia. She had a pelvic mass followed-up for 6 years with a diagnosis of leiomyoma. However, increase in tumor size and cystic changes with hemorrhage were found by magnetic resonance imaging, and total abdominal hysterectomy with bilateral salpingectomy was performed. Macroscopically, the placenta-like exophytic mass protruding from the posterior uterine wall was composed of multiple nodules containing numerous hemorrhagic cysts. The mass showed continuity as a white multinodular dissecting mass infiltrating the posterolateral myometrium. Microscopically, both extra-and intrauterine portions of the mass were composed of nodules that contained swirled neoplastic smooth muscle cells with marked hyalinized degeneration, as observed in cotyledonoid dissecting leiomyomas of conventional type. In addition, numerous non-neoplastic glands of endometrial type surrounded by abundant endometrium-like stromal cells and non-neoplastic smooth muscle cells were found in the tumor, suggesting that it involved a part of concomitant adenomyosis originating from the nontumoral myometrium. Thus far, over 30 cases of cotyledonoid dissecting leiomyoma have been reported, none of which have described the presence of adenomyosis within the tumor. The present case suggested that cotyledonoid dissecting leiomyoma might have a unique clinical presentation involving concomitant uterine adenomyosis. It is critical for pathologists, gynecologists, and radiologists to be cognizant of cotyledonoid dissecting leiomyoma variants for timely and appropriate diagnosis and treatment.

  20. Differentially Expressed Long Non-Coding RNAs Were Predicted to Be Involved in the Control of Signaling Pathways in Pediatric Astrocytoma.

    PubMed

    Ruiz Esparza-Garrido, Ruth; Rodríguez-Corona, Juan Manuel; López-Aguilar, Javier Enrique; Rodríguez-Florido, Marco Antonio; Velázquez-Wong, Ana Claudia; Viedma-Rodríguez, Rubí; Salamanca-Gómez, Fabio; Velázquez-Flores, Miguel Ángel

    2017-10-01

    Expression changes for long non-coding RNAs (lncRNAs) have been identified in adult glioblastoma multiforme (GBM) and in a mixture of adult and pediatric astrocytoma. Since adult and pediatric astrocytomas are molecularly different, the mixture of both could mask specific features in each. We determined the global expression patterns of lncRNAs and messenger RNA (mRNAs) in pediatric astrocytoma of different histological grades. Transcript expression changes were determined with an HTA 2.0 array. lncRNA interactions with microRNAs and mRNAs were predicted by using an algorithm and the LncTar tool, respectively. Interactomes were constructed with the HIPPIE database and visualized with the Cytoscape platform. The array showed expression changes in 156 and 207 lncRNAs in tumors (versus the control) and in pediatric GBM (versus low-grade astrocytoma), respectively. Predictions identified lncRNAs that have putative microRNA binding sites, which might suggest that they function as sponges in these tumors. Also, lncRNAs were shown to interact with many mRNAs, such as Pleckstrin homology-like domain, family A, member 1 (PHLDA1) and sulfatase 2 (SULF2). For example, qPCR found long intergenic non-coding RNA regulator of reprogramming (linc-RoR) expression levels upregulated in pediatric GBM when they were compared with control tissues or with low-grade tumors. Meanwhile, PHLDA1 and ELAV-like RNA binding protein 1 (ELAV1) showed expression changes in tumors relative to the control. Our data showed many lncRNAs with expression changes in pediatric astrocytoma, which might be involved in the regulation of different signaling pathways.

  1. The tumor microenvironment: An irreplaceable element of tumor budding and epithelial-mesenchymal transition-mediated cancer metastasis

    PubMed Central

    Li, Hui; Xu, Fangying; Li, Si; Zhong, Anjing; Meng, Xianwen; Lai, Maode

    2016-01-01

    ABSTRACT Tumor budding occurs at the invasive front of cancer; the tumor cells involved have metastatic and stemness features, indicating a poor prognosis. Tumor budding is partly responsible for cancer metastasis, and its initiation is based on the epithelial-mesenchymal transition (EMT) process. The EMT process involves the conversion of epithelial cells into migratory and invasive cells, and is a profound event in tumorigenesis. The EMT, associated with the formation of cancer stem cells (CSCs) and resistance to therapy, results from a combination of gene mutation, epigenetic regulation, and microenvironmental control. Tumor budding can be taken to represent the EMT in vivo. The EMT process is under the influence of the tumor microenvironment as well as tumor cells themselves. Here, we demonstrate that the tumor microenvironment dominates EMT development and impacts cancer metastasis, as well as promotes CSC formation and mediates drug resistance. In this review, we mainly discuss components of the microenvironment, such as the extracellular matrix (ECM), inflammatory cytokines, metabolic products, and hypoxia, that are involved in and impact on the acquisition of tumor-cell motility and dissemination, the EMT, metastatic tumor-cell formation, tumor budding and CSCs, and cancer metastasis, including subsequent chemo-resistance. From our point of view, the tumor microenvironment now constitutes a promising target for cancer therapy. PMID:26743180

  2. Confocal Microscopy for the Histological Fluorescence Pattern of a Recurrent Atypical Meningioma: Case Report

    PubMed Central

    Whitson, Wesley J.; Valdes, Pablo A.; Harris, Brent T.; Paulsen, Keith D.; Roberts, David W.

    2013-01-01

    Background and Importance Fluorescence-guided resection with 5-aminolevulinic acid (5-ALA), which has shown promising results in the resection of malignant gliomas, has been used for meningioma resection in an attempt to more clearly delineate the tumor margin. However, no article has investigated the fluorescence pattern of meningiomas on a histological level. Understanding the microscopic pattern of fluorescence could help assess the precision and utility of using 5-ALA for these tumors. We present the case of a recurrent atypical meningioma operated on with 5-ALA fluorescence-guided resection for delineation of tumor tissue from surrounding uninvolved dura. Clinical Presentation A 53-year-old woman presented with recurrent atypical meningioma of the falx. Prior treatment included surgical resection 6 years earlier with subsequent fractionated radiation therapy and radiosurgery for tumor progression. The patient was given 5-ALA 20 mg/kg body weight dissolved in 100 mL water 3 hours before induction of anesthesia. Intraoperative fluorescence was coregistered with preoperative imaging. Neuropathological analysis of the resected falx with confocal microscopy enabled correlation of fluorescence with the extent of tumor on a histological level. Conclusion Fluorescence guidance allowed clear intraoperative delineation of tumor tissue from adjacent, uninvolved dura. On a microscopic level, there was a very close correlation of fluorescence with tumor, but some tumor cells did not fluoresce. PMID:21389893

  3. A case of Werner's syndrome associated with osteosarcoma.

    PubMed

    Murata, K; Hatamochi, A; Shinkai, H; Ishikawa, Y; Kawaguchi, N; Goto, M

    1999-10-01

    We described a case of Werner's syndrome associated with osteosarcoma. A 37-year-old Japanese man was diagnosed as having Werner's syndrome by the presence of juvenile cataracts, skin sclerosis and hyperpigmentation of the feet, high-pitched voice, characteristic bird-like appearance of the face with beak-shaped nose, thinning of the entire skin and hyperkeratoses on soles, hyperlipemia, hyperuricemia, diabetes melitus, and the mutated responsible gene (WRN). He had a 3-month history of a tumor on his left forearm. Histologically, the tumor included four histological patterns; a malignant fibrous histiocytoma-like, a desmoid-like, a dermatofibrosarcoma protuberans-like, and a chondrosarcoma-like pattern. Tumoral osteoid formation was also found in the tumor. Therefore, the tumor was diagnosed as osteosarcoma.

  4. Epithelioid Hemangioendothelioma: A Rare Vascular Tumor

    PubMed Central

    Lakshmi, S Vidya; Prabhavathy, D; Jayakumar, S; Janaki, C; Tharini, G K

    2012-01-01

    Epithelioid hemangioendothelioma is an intermediate-grade vascular tumor arising from the vascular endothelium, which usually arises in soft tissue, and skin involvement is extremely rare. We report a case that presented with primary cutaneous tumor involving the whole limb and was present since birth. PMID:22470212

  5. Tumoral Versus Flat Intraepithelial Neoplasia of Pancreatobiliary Tract, Gallbladder, and Ampulla of Vater.

    PubMed

    Jang, Kee-Taek; Ahn, Sangjeong

    2016-05-01

    -The identification of a precursor lesion is important to understanding the histopathologic and genetic alterations in carcinogenesis. There are a plethora of terminologies that describe precursor lesions of the pancreatobiliary tract, ampulla of Vater, and gallbladder. The current terminologies for precursor lesions may make it difficult to understand the tumor biology. Here, we propose the concept of tumoral and flat intraepithelial neoplasia to improve our understanding of precursor lesions of many epithelial organs, including the pancreatobiliary tract, ampulla of Vater, and gallbladder. -To understand the dichotomous pattern of tumoral and flat intraepithelial neoplasia in carcinogenesis of pancreatobiliary tract, ampulla of Vater, and gallbladder. -Review of relevant literatures indexed in PubMed. -Tumoral intraepithelial neoplasia presents as an intraluminal or intraductal, mass-forming, polypoid lesion or a macroscopic, visible, cystic lesion without intracystic papillae. Microscopically, tumoral intraepithelial neoplasia shows various proportions of papillary and tubular architecture, often with a mixed pattern, such as papillary, tubular, and papillary-tubular. The malignant potential depends on the degree of dysplasia and the cell phenotype of the epithelium. Flat intraepithelial neoplasia presents as a flat or superficial, spreading, mucosal lesion that is frequently accompanied by an invasive carcinoma. Tumoral and flat intraepithelial neoplasias are not homogeneous entities and may exhibit histopathologic spectrum changes and different genetic profiles. Although intraepithelial neoplasia showed a dichotomous pattern in the tumoral versus flat types, they can coexist. Tumoral and flat intraepithelial neoplasia can be interpreted as part of a spectrum of changes in the carcinogenesis pathway of each organ.

  6. Complex pattern of immune evasion in MSI colorectal cancer.

    PubMed

    Ozcan, Mine; Janikovits, Jonas; von Knebel Doeberitz, Magnus; Kloor, Matthias

    2018-01-01

    Mismatch repair (MMR)-deficient cancers accumulate multiple insertion/deletion mutations at coding microsatellites (cMS), which give rise to frameshift peptide neoantigens. The high mutational neoantigen load of MMR-deficient cancers is reflected by pronounced anti-tumoral immune responses of the host and high responsiveness towards immune checkpoint blockade. However, immune evasion mechanisms can interfere with the immune response against MMR-deficient tumors. We here performed a comprehensive analysis of immune evasion in MMR-deficient colorectal cancers, focusing on HLA class I-mediated antigen presentation. 72% of MMR-deficient colorectal cancers of the DFCI database harbored alterations affecting genes involved in HLA class I-mediated antigen presentation, and 54% of these mutations were predicted to abrogate function. Mutations affecting the HLA class I transactivator NLRC5 were observed as a potential new immune evasion mechanism in 26% (6% abrogating) of the analyzed tumors. NLRC5 mutations in MMR-deficient cancers were associated with decreased levels of HLA class I antigen expression. In summary, the majority of MMR-deficient cancers display mutations interfering with HLA class I antigen presentation that reflect active immune surveillance and immunoselection during tumor development. Clinical studies focusing on immune checkpoint blockade in MSI cancer should account for the broad variety of immune evasion mechanisms as potential biomarkers of therapy success.

  7. Endothelial cell membrane vesicles in the study of organ preference of metastasis.

    PubMed

    Johnson, R C; Augustin-Voss, H G; Zhu, D Z; Pauli, B U

    1991-01-01

    Many malignancies exhibit distinct patterns of metastasis that appear to be mediated by receptor/ligand-like interactions between tumor cells and organ-specific vascular endothelium. In order to study endothelial cell surface molecules involved in the binding of metastatic cells, we developed a perfusion method to isolate outside-out membrane vesicles from the lumenal surface of rat lung microvascular endothelium. Lungs were perfused in situ for 4 h at 37 degrees C with a solution of 100 mM formaldehyde, 2 mM dithiothreitol in phosphate-buffered saline to induce endothelial cell vesiculation. Radioiodinated rat lung endothelial cell membrane vesicles bound lung-metastatic tumor cells (B16F10, R323OAC-MET) in significantly higher numbers than their low or nonmetastatic counterparts (B16F0, R323OAC-LR). In contrast, leg endothelial membrane vesicle showed no binding preference for either cell line. Neuraminidase treatment of vesicles abolished specificity of adhesion of lung-derived vesicles to lung metastatic tumor cells. These results demonstrate that in situ perfusion is an appropriate technique to obtain pure endothelial cell membrane vesicles containing functionally active adhesion molecules. The preferential binding of lung-derived endothelial cell membrane vesicles by lung metastatic tumor cells is evidence of the importance of endothelial cell adhesion molecules in the formation of metastases.

  8. Functional involvement of human discs large tumor suppressor in cytokinesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unno, Kenji; Hanada, Toshihiko; Chishti, Athar H.

    2008-10-15

    Cytokinesis is the final step of cell division that completes the separation of two daughter cells. We found that the human discs large (hDlg) tumor suppressor homologue is functionally involved in cytokinesis. The guanylate kinase (GUK) domain of hDlg mediates the localization of hDlg to the midbody during cytokinesis, and over-expression of the GUK domain in U2OS and HeLa cells impaired cytokinesis. Mouse embryonic fibroblasts (MEFs) derived from dlg mutant mice contained an increased number of multinucleated cells and showed reduced proliferation in culture. A kinesin-like motor protein, GAKIN, which binds directly to the GUK domain of hDlg, exhibited amore » similar intracellular distribution pattern with hDlg throughout mitosis and localized to the midbody during cytokinesis. However, the targeting of hDlg and GAKIN to the midbody appeared to be independent of each other. The midbody localization of GAKIN required its functional kinesin-motor domain. Treatment of cells with the siRNA specific for hDlg and GAKIN caused formation of multinucleated cells and delayed cytokinesis. Together, these results suggest that hDlg and GAKIN play functional roles in the maintenance of midbody architecture during cytokinesis.« less

  9. Pattern of metastasis outside tumor-bearing segments in primary lung cancer: rationale for segmentectomy.

    PubMed

    Sakairi, Yuichi; Yoshino, Ichiro; Yoshida, Shigetoshi; Suzuki, Hidemi; Tagawa, Tetsuzo; Iwata, Takekazu; Mizobuchi, Teruaki

    2014-05-01

    Patterns of intrapulmonary metastasis, particularly metastasis outside tumor-bearing segments, were investigated in lung cancer patients to address the rationale for segmentectomy. In a consecutive series of patients who underwent resection of two or more pulmonary segments for primary lung cancer, intrapulmonary spread patterns, such as segmental/intersegmental node metastasis and pulmonary parenchymal metastasis, were pathologically examined. Eligible 244 lesions included 167 adenocarcinomas, 66 squamous cell carcinomas, and 11 large cell carcinomas. Pathologic stages included 0 to IA (n=111), IB (n=56), IIA (n=31), IIB (n=20), IIIA (n=23), and IIIB to IV (n=3); and N1 (n=26) and N2 (n=22). Intrapulmonary spread was observed in 24 cases (9.8%). Of these, metastasis outside tumor-bearing segments was only observed in 4 cases (1.6%), and such cancer spread was more frequently seen in cases with extrapulmonary (hilar to mediastinal) nodal metastasis (7.9%) than in cases without extrapulmonary metastasis (0.5%; p=0.01). Metastasis outside tumor-bearing segments was not observed in 64 tumors with pure or mixed ground glass opacity features on computed tomography. Although tumor location (peripheral or central/intermediate) was not related to the incidence of metastasis outside tumor-bearing segments, intrapulmonary spread was observed in only 1 of 52 peripheral small (≤20 mm) tumors. Metastasis outside tumor-bearing segments is rarely observed in cases with tumors (1) without extrapulmonary nodal metastasis and (2) with ground glass opacity or peripheral small (≤20 mm) features. Copyright © 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  10. Revealing common disease mechanisms shared by tumors of different tissues of origin through semantic representation of genomic alterations and topic modeling.

    PubMed

    Chen, Vicky; Paisley, John; Lu, Xinghua

    2017-03-14

    Cancer is a complex disease driven by somatic genomic alterations (SGAs) that perturb signaling pathways and consequently cellular function. Identifying patterns of pathway perturbations would provide insights into common disease mechanisms shared among tumors, which is important for guiding treatment and predicting outcome. However, identifying perturbed pathways is challenging, because different tumors can have the same perturbed pathways that are perturbed by different SGAs. Here, we designed novel semantic representations that capture the functional similarity of distinct SGAs perturbing a common pathway in different tumors. Combining this representation with topic modeling would allow us to identify patterns in altered signaling pathways. We represented each gene with a vector of words describing its function, and we represented the SGAs of a tumor as a text document by pooling the words representing individual SGAs. We applied the nested hierarchical Dirichlet process (nHDP) model to a collection of tumors of 5 cancer types from TCGA. We identified topics (consisting of co-occurring words) representing the common functional themes of different SGAs. Tumors were clustered based on their topic associations, such that each cluster consists of tumors sharing common functional themes. The resulting clusters contained mixtures of cancer types, which indicates that different cancer types can share disease mechanisms. Survival analysis based on the clusters revealed significant differences in survival among the tumors of the same cancer type that were assigned to different clusters. The results indicate that applying topic modeling to semantic representations of tumors identifies patterns in the combinations of altered functional pathways in cancer.

  11. Downstaging chemotherapy and alteration in the classic computed tomography/magnetic resonance imaging signs of vascular involvement in patients with pancreaticobiliary malignant tumors: influence on patient selection for surgery.

    PubMed

    Donahue, Timothy R; Isacoff, William H; Hines, O Joe; Tomlinson, James S; Farrell, James J; Bhat, Yasser M; Garon, Edward; Clerkin, Barbara; Reber, Howard A

    2011-07-01

    To determine whether computed tomography (CT)/magnetic resonance imaging (MRI) signs of vascular involvement are accurate after downstaging chemotherapy (DCTx) and to highlight factors associated with survival in patients who have undergone resection. Retrospective cohort study; prospective database. University pancreatic disease center. Patients with unresectable pancreaticobiliary cancer who underwent curative intent surgery after completing DCTx. Use of CT/MRI scan, pancreatic resection, and palliative bypass. Resectability after DCTx and disease-specific survival. We operated on 41 patients (1992-2009) with locally advanced periampullary malignant tumors after a median of 8.5 months of DCTx. Before DCTx, most patients (38 [93%]) were unresectable because of evidence of vascular contact on CT/MRI scan or operative exploration. Criteria for exploration after DCTx were CT/MRI evidence of tumor shrinkage and/or change in signs of vascular involvement, cancer antigen 19-9 decrease, and good functional status. None had progressive disease. At operation, we resected tumors in 34 of 41 patients (83%), and 6 had persistent vascular involvement. Surprisingly, CT/MRI scan was only 71% sensitive and 58% specific to detect vascular involvement after DCTx. "Involvement" on imaging was often from tumor fibrosis rather than viable cancer. Radiographic decrease in tumor size also did not predict resectability (P = .10). Patients with tumors that were resected had a median 87% decrease in cancer antigen 19-9 (P = .04) during DCTx. The median follow-up (all survivors) was 31 months, and disease-specific survival was 52 months for patients with resected tumors. In patients with initially unresectable periampullary malignant tumors, original CT/MRI signs of vascular involvement may persist after successful DCTx. Patients should be chosen for surgery on the basis of lack of disease progression, good functional status, and decrease in cancer antigen 19-9.

  12. Adenoid cystic carcinomas of the salivary gland, lacrimal gland, and breast are morphologically and genetically similar but have distinct microRNA expression profiles.

    PubMed

    Andreasen, Simon; Tan, Qihua; Agander, Tina Klitmøller; Steiner, Petr; Bjørndal, Kristine; Høgdall, Estrid; Larsen, Stine Rosenkilde; Erentaite, Daiva; Olsen, Caroline Holkmann; Ulhøi, Benedicte Parm; von Holstein, Sarah Linéa; Wessel, Irene; Heegaard, Steffen; Homøe, Preben

    2018-02-21

    Adenoid cystic carcinoma is among the most frequent malignancies in the salivary and lacrimal glands and has a grave prognosis characterized by frequent local recurrences, distant metastases, and tumor-related mortality. Conversely, adenoid cystic carcinoma of the breast is a rare type of triple-negative (estrogen and progesterone receptor, HER2) and basal-like carcinoma, which in contrast to other triple-negative and basal-like breast carcinomas has a very favorable prognosis. Irrespective of site, adenoid cystic carcinoma is characterized by gene fusions involving MYB, MYBL1, and NFIB, and the reason for the different clinical outcomes is unknown. In order to identify the molecular mechanisms underlying the discrepancy in clinical outcome, we characterized the phenotypic profiles, pattern of gene rearrangements, and global microRNA expression profiles of 64 salivary gland, 9 lacrimal gland, and 11 breast adenoid cystic carcinomas. All breast and lacrimal gland adenoid cystic carcinomas had triple-negative and basal-like phenotypes, while salivary gland tumors were indeterminate in 13% of cases. Aberrations in MYB and/or NFIB were found in the majority of cases in all three locations, whereas MYBL1 involvement was restricted to tumors in the salivary gland. Global microRNA expression profiling separated salivary and lacrimal gland adenoid cystic carcinoma from their respective normal glands but could not distinguish normal breast adenoid cystic carcinoma from normal breast tissue. Hierarchical clustering separated adenoid cystic carcinomas of salivary gland origin from those of the breast and placed lacrimal gland carcinomas in between these. Functional annotation of the microRNAs differentially expressed between salivary gland and breast adenoid cystic carcinoma showed these as regulating genes involved in metabolism, signal transduction, and genes involved in other cancers. In conclusion, microRNA dysregulation is the first class of molecules separating adenoid cystic carcinoma according to the site of origin. This highlights a novel venue for exploring the biology of adenoid cystic carcinoma.

  13. “String of pearls pattern”: report of three cases of non clear-cell acanthoma*

    PubMed Central

    Espinosa, Ana Elena Domínguez; Akay, Bengu Nisa; González-Ramírez, Roger Adrian

    2017-01-01

    The coiled and dotted vessels in a serpiginous arrangement or “string of pearls” is considered a classical vascular pattern associated with clear cell acanthoma. We present three cases of epidermal tumors different from clear cell acanthoma that have the same “string of pearls” vascular pattern. Even though most authors keep considering the “string of pearls” vascular pattern an almost pathognomonic sign of clear-cell acanthoma, the cases presented here suggest that some other epidermal tumors can also show this pattern. PMID:29267474

  14. Computerized morphometry as an aid in distinguishing recurrent versus nonrecurrent meningiomas.

    PubMed

    Noy, Shawna; Vlodavsky, Euvgeni; Klorin, Geula; Drumea, Karen; Ben Izhak, Ofer; Shor, Eli; Sabo, Edmond

    2011-06-01

    To use novel digital and morphometric methods to identify variables able to better predict the recurrence of intracranial meningiomas. Histologic images from 30 previously diagnosed meningioma tumors that recurred over 10 years of follow-up were consecutively selected from the Rambam Pathology Archives. Images were captured and morphometrically analyzed. Novel algorithms of digital pattern recognition using Fourier transformation and fractal and nuclear texture analyses were applied to evaluate the overall growth pattern complexity of the tumors, as well as the chromatin texture of individual tumor nuclei. The extracted parameters were then correlated with patient prognosis. Kaplan-Meier analyses revealed statistically significant associations between tumor morphometric parameters and recurrence times. Tumors with less nuclear orientation, more nuclear density, higher fractal dimension, and less regular chromatin textures tended to recur faster than those with a higher degree of nuclear order, less pattern complexity, lower density, and more homogeneous chromatin nuclear textures (p < 0.01). To our knowledge, these digital morphometric methods were used for the first time to accurately predict tumor recurrence in patients with intracranial meningiomas. The use of these methods may bring additional valuable information to the clinician regarding the optimal management of these patients.

  15. Local sparse bump hunting reveals molecular heterogeneity of colon tumors‡

    PubMed Central

    Dazard, Jean-Eudes; Rao, J. Sunil; Markowitz, Sanford

    2013-01-01

    The question of molecular heterogeneity and of tumoral phenotype in cancer remains unresolved. To understand the underlying molecular basis of this phenomenon, we analyzed genome-wide expression data of colon cancer metastasis samples, as these tumors are the most advanced and hence would be anticipated to be the most likely heterogeneous group of tumors, potentially exhibiting the maximum amount of genetic heterogeneity. Casting a statistical net around such a complex problem proves difficult because of the high dimensionality and multi-collinearity of the gene expression space, combined with the fact that genes act in concert with one another and that not all genes surveyed might be involved. We devise a strategy to identify distinct subgroups of samples and determine the genetic/molecular signature that defines them. This involves use of the local sparse bump hunting algorithm, which provides a much more optimal and biologically faithful transformed space within which to search for bumps. In addition, thanks to the variable selection feature of the algorithm, we derived a novel sparse gene expression signature, which appears to divide all colon cancer patients into two populations: a population whose expression pattern can be molecularly encompassed within the bump and an outlier population that cannot be. Although all patients within any given stage of the disease, including the metastatic group, appear clinically homogeneous, our procedure revealed two subgroups in each stage with distinct genetic/molecular profiles. We also discuss implications of such a finding in terms of early detection, diagnosis and prognosis. PMID:22052459

  16. Core Canonical Pathways Involved in Developing Human Glioblastoma Multiforme (GBM).

    PubMed

    Ghosh, Somiranjan; Dutta, Sisir; Thorne, Gabriel; Boston, Ava; Barfield, Alexis; Banerjee, Narendra; Walker, Rayshawn; Banerjee, Hirendra Nath

    2017-02-01

    Glioblastoma multiforme (GBM) is the most common and aggressive type of the primary brain tumors with pathologic hallmarks of necrosis and vascular proliferation. The diagnosis of GBM is currently mostly based on histological examination of brain tumor tissues, after radiological characterization and surgical biopsy. The ability to characterize tumors comprehensively at the molecular level raises the possibility that diagnosis can be made based on molecular profiling with or without histological examination, rather than solely on histological phenotype. The development of novel genomic and proteomic techniques will foster in the identification of such diagnostic and prognostic molecular markers. We analyzed the global differential gene expression of a GBM cell line HTB15 in comparison to normal human Astrocytes, and established a few canonical pathways that are important in determining the molecular mechanisms of cancer using global gene expression microarray, coupled with the Ingenuity Pathway Analysis ( IPA ®). Overall, we revealed a discrete gene expression profile in the experimental model that resembled progression of GBM cancer. The canonical pathway analysis showed the involvement of genes that differentially expressed in such a disease condition that included Inositol pathway, Polo like kinases, nNOS signaling , and Tetrapyrrole biosynthesis . Our findings established that the gene expression pattern of this dreaded brain cancer will probably help the cancer research community by finding out newer therapeutic strategies to combat this dreaded cancer type that leads to the identification of high-risk population in this category, with almost hundred percent mortality rate.

  17. Molecular pathways involved in synovial cell inflammation and tumoral proliferation in diffuse pigmented villonodular synovitis.

    PubMed

    Fiocco, U; Sfriso, P; Lunardi, F; Pagnin, E; Oliviero, F; Scagliori, E; Cozzi, L; Vezzù, M; Molena, B; Scanu, A; Panziera, C; Nardacchione, R; Rubaltelli, L; Dayer, J M; Calabrese, F; Punzi, L

    2010-09-01

    Diffuse-type tenosynovial giant cell tumors, also known as pigmented villonodular synovitis, are unique mesenchymal lesions that arise from the synovial tissue of the joints. They are predominantly intraarticular, aggressive, infiltrative processes, characterized by both inflammatory or neoplastic properties and local destructive progression. The pattern of synovial gene and protein expressions in pigmented villonodular synovitis, similar to those in activated macrophages in rheumatoid arthritis, and the phenotype of multinucleated giant cells, characteristic of osteoclasts, suggest that there is a common autocrine mechanism in osteoclast differentiation in both diseases and indicate the potential utility of tumor necrosis factor (TNF)-alpha blockade. High synovial colony stimulating factor 1 (CSF1) messenger RNA (m RNA) expression in pigmented villonodular synovitis, unrelated to a chromosomal translocation involving CSF1 locus, may indicate that there is a synergic paracrine loop mediated by TNF-alpha and CSF1, as shown in both inflammatory and neoplastic conditions. The effects of a new therapeutic approach consisting in intraarticular TNF-alpha blockade were studied in four pigmented villonodular synovitis knees. Knee injections produced a rapid reduction in clinical and sonographic indexes and immunohistological alterations, confirmed by arthroscopic synovectomy. A delayed relapse in one of the four knees and unaltered synovial CSF1 expression were other important findings. In the light of these observations, CSF1/CSF1R interaction probably represents a more sensible therapeutic target than TNF-alpha blockade in the diffuse form of pigmented villonodular synovitis. Copyright 2010 Elsevier B.V. All rights reserved.

  18. Chondroblastic osteosarcoma arising in the maxilla mimicking the radiographic and histological characteristics of cemento-osseous lesions: A case report.

    PubMed

    Li, Bin-Bin; Zhang, Jian-Yun; Gao, Yan

    2017-05-01

    Osteosarcomas of the jaw are comparatively rare and represent only 2-10% of all osteosarcomas. We herein present a rare case of an osteosarcoma exhibiting the radiographic and histological characteristics of cemento-osseous lesions in the alveolar ridge of the maxilla. A 53-year-old male patient presented with the complaint of gradual swelling of the left maxilla over 4 years. Radiography revealed an ill-defined radioopaque mass, intimately associated with the apices of the involved teeth, without a periosteal reaction. Microscopically, a cementicle-like structure was identified in the alveolar bone. In addition, the lesion exhibited typical characteristics of chondroblastic osteosarcoma in the body of the maxilla. The tumor contained abundant osteoid and cartilage intimately associated with anaplastic tumor cells. The cartilage displayed malignant-appearing cells in lacunae, and there was crowding at the periphery of the lobule where the spindle cells formed sheets. The differential diagnosis included primary osteosarcoma, concurrent cemento-osseous dysplasia and osteosarcoma, or a secondary osteosarcoma based on a pre-existing cemento-osseous lesion. The presence of the cementicle-like structure in the alveolar bone and the involvement of the periodontal ligament and alveolar bone proper were unique in our case. The general invasive growth pattern and the abundance of the irregular tumor bone helped establish the diagnosis of primary osteosarcoma. This case may represent evidence of the pathogenesis of primary osteosarcoma in the jaw.

  19. Chondroblastic osteosarcoma arising in the maxilla mimicking the radiographic and histological characteristics of cemento-osseous lesions: A case report

    PubMed Central

    Li, Bin-Bin; Zhang, Jian-Yun; Gao, Yan

    2017-01-01

    Osteosarcomas of the jaw are comparatively rare and represent only 2–10% of all osteosarcomas. We herein present a rare case of an osteosarcoma exhibiting the radiographic and histological characteristics of cemento-osseous lesions in the alveolar ridge of the maxilla. A 53-year-old male patient presented with the complaint of gradual swelling of the left maxilla over 4 years. Radiography revealed an ill-defined radioopaque mass, intimately associated with the apices of the involved teeth, without a periosteal reaction. Microscopically, a cementicle-like structure was identified in the alveolar bone. In addition, the lesion exhibited typical characteristics of chondroblastic osteosarcoma in the body of the maxilla. The tumor contained abundant osteoid and cartilage intimately associated with anaplastic tumor cells. The cartilage displayed malignant-appearing cells in lacunae, and there was crowding at the periphery of the lobule where the spindle cells formed sheets. The differential diagnosis included primary osteosarcoma, concurrent cemento-osseous dysplasia and osteosarcoma, or a secondary osteosarcoma based on a pre-existing cemento-osseous lesion. The presence of the cementicle-like structure in the alveolar bone and the involvement of the periodontal ligament and alveolar bone proper were unique in our case. The general invasive growth pattern and the abundance of the irregular tumor bone helped establish the diagnosis of primary osteosarcoma. This case may represent evidence of the pathogenesis of primary osteosarcoma in the jaw. PMID:28529749

  20. Highly differentiated keratinizing squamous cell cancer of the cervix: a rare, locally aggressive tumor not associated with human papillomavirus or squamous intraepithelial lesions.

    PubMed

    Morrison, C; Catania, F; Wakely, P; Nuovo, G J

    2001-10-01

    The purpose of this study is to report an unusual variant of cervical squamous cell carcinoma, not associated with either human papillomavirus infection or antecedent squamous intraepithelial lesions. Five women had a diagnosis of invasive cervical cancer discovered at hysterectomy performed for prolapse (two cases), leiomyoma (one case), or a vaginal fistula (two cases). The women ranged in age from 47 to 78 years (mean 59 years). Four of the five had a history of normal Papanicolaou (Pap) smears; the other had a Pap smear diagnosis of atypical squamous cells of undetermined significance (ASCUS). All had large cervical tumors (two with parametrial involvement and one with vaginal involvement) that showed extensive keratin formation, an inverted pattern of growth, and, except for one case, minimal cytologic atypia. There was extensive hyperkeratosis and parakeratosis adjacent to each tumor; none had evidence of squamous intraepithelial lesion. Human papillomavirus testing by polymerase chain reaction in situ hybridization and reverse-transcribed polymerase chain reaction in situ was negative in each case, compared with a detection rate of 107 of 108 (99%) for squamous intraepithelial lesion-associated cervical squamous cell and adenocarcinomas. Two of the women died of extensive local recurrence; two other women were recently diagnosed. We conclude that highly differentiated keratinizing squamous cell carcinoma of the cervix is a rare entity not associated with human papillomavirus infection or squamous intraepithelial lesion and thus difficult to detect on routine cervical cancer screening.

  1. EMODIN EFFICACY ON THE AKT, MAPK, ERK AND DNMT EXPRESSION PATTERN DURING DMBA-INDUCED ORAL CARCINOMA IN GOLDEN SYRIAN HAMSTERS.

    PubMed

    Manimaran, Asokan; Manoharan, Shanmugam; Neelakandan, Mani

    2016-01-01

    The present study has evaluated the Emodin efficacy on the Akt, MAPK, ERK and DNMT expression pattern during 7,12-dimethylbenz[a]anthracene (DMBA)-induced oral carcinoma in golden Syrian hamsters, in order to explore its antitumor potential. Oral tumors were developed in the buccal pouches of golden Syrian hamsters using the carcinogen, DMBA. While the incidence of tumor formation was 100% in hamsters treated with DMBA alone, the tumor formation was not noticed in DMBA+ Emodin treated hamsters. Also, Emodin reduced the severity of precancerous pathological lesions such as dysplasia, in the hamsters treated with DMBA. Emodin administration corrected the abnormalities in the expression pattern of Akt, MAPK, ERK and DNMT in the buccal mucosa of hamsters treated with DMBA. The present study thus suggests that the tumor preventive potential of Emodin is partly related to its modulating effect on the Akt, MAPK, ERK and DNMT expression pattern, as these molecular markers have a pivotal role in the process of cell proliferation, inflammation, invasion, and apoptosis.

  2. CXCR6: the role of environment in tumor progression. Challenges for therapy.

    PubMed

    La Porta, Caterina A M

    2012-12-01

    The role of chemokines in tumor progression is an essential event that leads to homing and metastasis of tumor cells in a receptor-dependent, organ specific manner. In recent years, the involvement of CXCR6 and its ligand CXCL16 in tumor progression is becoming more evident. Here I review the recent literature on CXCR6/CXCL16. Since CXCR6 was shown recently to be involved in stem cell self renewal and the same cytokine is expressed by a subpopulation of melanoma cells, I discuss new evidences on cancer stem cell theory and the involvement of CXCR6. In particular, in the effort to develop more specific strategies to stop the tumor growth, the present review proposes and discusses the possibility to modulate tumor self renewal affecting asymmetric/symmetric cell division targeting specific factors such as CXCR6.

  3. Round Cell Tumors: Classification and Immunohistochemistry.

    PubMed

    Sharma, Shweta; Kamala, R; Nair, Divya; Ragavendra, T Raju; Mhatre, Swapnil; Sabharwal, Robin; Choudhury, Basanta Kumar; Rana, Vivek

    2017-01-01

    Round cell tumors as the name suggest are comprised round cells with increased nuclear-cytoplasmic ratio. This group of tumor includes entities such as peripheral neuroectodermal tumor, rhabdomyosarcoma, synovial sarcoma, non-Hodgkin's lymphoma, neuroblastoma, hepatoblastoma, Wilms' tumor, and desmoplastic small round cell tumor. These round cells tumors are characterized by typical histological pattern, immunohistochemical, and electron microscopic features that can help in differential diagnosis. The present article describes the classification and explains the histopathology and immunohistochemistry of some important round cell tumors.

  4. Identification of two clinical hepatocellular carcinoma patient phenotypes from results of standard screening parameters

    PubMed Central

    Carr, Brian I.; Giannini, Edoardo G.; Farinati, Fabio; Ciccarese, Francesca; Rapaccini, Gian Ludovico; Marco, Maria Di; Benvegnù, Luisa; Zoli, Marco; Borzio, Franco; Caturelli, Eugenio; Chiaramonte, Maria; Trevisani, Franco

    2014-01-01

    Background Previous work has shown that 2 general processes contribute to hepatocellular cancer (HCC) prognosis. They are: a. liver damage, monitored by indices such as blood bilirubin, prothrombin time and AST; as well as b. tumor biology, monitored by indices such as tumor size, tumor number, presence of PVT and blood AFP levels. These 2 processes may affect one another, with prognostically significant interactions between multiple tumor and host parameters. These interactions form a context that provide personalization of the prognostic meaning of these factors for every patient. Thus, a given level of bilirubin or tumor diameter might have a different significance in different personal contexts. We previously applied Network Phenotyping Strategy (NPS) to characterize interactions between liver function indices of Asian HCC patients and recognized two clinical phenotypes, S and L, differing in tumor size and tumor nodule numbers. Aims To validate the applicability of the NPS-based HCC S/L classification on an independent European HCC cohort, for which survival information was additionally available. Methods Four sets of peripheral blood parameters, including AFP-platelets, derived from routine blood parameter levels and tumor indices from the ITA.LI.CA database, were analyzed using NPS, a graph-theory based approach, which compares personal patterns of complete relationships between clinical data values to reference patterns with significant association to disease outcomes. Results Without reference to the actual tumor sizes, patients were classified by NPS into 2 subgroups with S and L phenotypes. These two phenotypes were recognized using solely the HCC screening test results, consisting of eight common blood parameters, paired by their significant correlations, including an AFP-Platelets relationship. These trends were combined with patient age, gender and self-reported alcoholism into NPS personal patient profiles. We subsequently validated (using actual scan data) that patients in L phenotype group had 1.5x larger mean tumor masses relative to S, p=6×10−16. Importantly, with the new data, liver test pattern-identified S-phenotype patients had typically 1.7 × longer survival compared to L-phenotype. NPS integrated the liver, tumor and basic demographic factors. Cirrhosis associated thrombocytopenia was typical for smaller S-tumors. In L-tumor phenotype, typical platelet levels increased with the tumor mass. Hepatic inflammation and tumor factors contributed to more aggressive L tumors, with parenchymal destruction and shorter survival. Summary NPS provides integrative interpretation for HCC behavior, identifying two tumor and survival phenotypes by clinical parameter patterns. The NPS classifier is provided as an Excel tool. The NPS system shows the importance of considering each tumor marker and parameter in the total context of all the other parameters of an individual patient. PMID:25023357

  5. Need for intraoperative ultrasound and surgical recommendation for partial nephrectomy: correlation with tumor imaging features and urologist practice patterns.

    PubMed

    Sun, Maryellen R M; Wagner, Andrew A; San Francisco, Ignacio F; Brook, Alexander; Kavoussi, Louis; Russo, Paul; Steele, Graeme; Viterbo, Rosalia; Pedrosa, Ivan

    2012-03-01

    This study aimed to evaluate the need for intraoperative ultrasound (IOUS) and recommendation for surgical approach in the resection of renal tumors through a survey of practicing urologists, with correlation to tumor imaging features and urologist practice pattern. An institutional review board-approved retrospective review, compliant with the Health Insurance Portability and Accountability Act, of 44 renal tumors that underwent laparoscopic partial nephrectomy at the study institution was performed. The numeric component of the RENAL nephrometry score (radius [diameter], % exophytic, nearness [to collecting system/renal sinus], location) was calculated for each case using preoperative computed tomography/magnetic resonance imaging. Five anonymized images of each tumor were presented to 4 academic urologists with varying practice patterns. Reviewers independently scored each case for its need for IOUS, for recommendation of a surgical technique, and for the difficulty of the proposed surgery. The RENAL scores were as follows: RENAL 1 (low complexity, score 4-6; n = 19); RENAL 2 (moderate complexity, score 7-9; n = 23); RENAL 3 (high complexity, score 10-12; n = 2). The only RENAL score component significantly influencing need for IOUS was percentage exophytic (P = 0.00002). There was an inverse relationship between normalized and averaged need for IOUS and percentage exophytic (P < 0.0001). The predominant influence for recommendation of surgical method was the reviewer him/herself, with each reviewer's recommendations closely matching his/her practice pattern. Size and percentage exophytic represented the only tumor features significantly (P = 0.03) influencing surgical recommendation. There was a significant difference in the perceived need for IOUS and surgical recommendation when 4 academic urologists reviewed a series of renal masses requiring resection. Percentage exophytic correlated inversely with need for IOUS. Urologist's practice pattern and tumor size and percentage exophytic were most predictive of surgical recommendation.

  6. Differential role of Wnt signaling and base excision repair pathways in gastric adenocarcinoma aggressiveness.

    PubMed

    Korourian, Alireza; Roudi, Raheleh; Shariftabrizi, Ahmad; Kalantari, Elham; Sotoodeh, Kambiz; Madjd, Zahra

    2017-11-01

    Aberrant activation of Wnt and base excision repair (BER) signaling pathways are implicated in tumor progression and chemotherapy resistance in gastric adenocarcinoma. This study was conducted to clarify the role of E2F6 and RhoA, components of the Wnt signaling pathway, and SMUG1, a component of the BER pathway in gastric adenocarcinoma. Expression levels and clinicopathological significance of three biomarkers, namely E2F6, RhoA, and SMUG1, as potential signaling molecules involved in tumorigenesis and aggressive behavior, were examined using tissue microarray. Our analysis showed a relative increase in the expression of E2F6 in gastric adenocarcinoma with no lymph node metastasis (χ 2 , P = 0.04 and OR, P = 0.08), while overexpression of RhoA and SMUG1 was found more often in the diffuse subtype of gastric adenocarcinoma as compared to the intestinal subtype (χ 2 , P = 0.05, OR, P = 0.08 and χ 2 , P = 0.001, OR, P = 0.009, respectively). Higher expression of RhoA was frequently seen in tumors with vascular invasion (χ 2 , P = 0.01 and OR, P = 0.01). In addition, increased expression of SMUG1 was found more often in poorly differentiated tumors (χ 2 , P = 0.01 and OR, P = 0.01). The distinct phenotype of E2F6 Low /SMUG1 High was more common in poorly differentiated tumors (P = 0.04) and with omental involvement (P = 0.01). The RhoA High /SMUG1 High expression pattern was significantly more often found in diffuse subtype compared to the intestinal subtype (P = 0.001) as well as in poorly differentiated tumors (P = 0.004). The E2F6 Low /SMUG1 High and RhoA High /SMUG1 High phenotypes can be considered as aggressive phenotypes of gastric adenocarcinoma. Our findings also demonstrated the synergistic effect of RhoA and SMUG1 in conferring tumor aggressiveness in diffuse subtype of gastric adenocarcinoma.

  7. Tumors Presenting as Multiple Cranial Nerve Palsies

    PubMed Central

    Kumar, Kishore; Ahmed, Rafeeq; Bajantri, Bharat; Singh, Amandeep; Abbas, Hafsa; Dejesus, Eddy; Khan, Rana Raheel; Niazi, Masooma; Chilimuri, Sridhar

    2017-01-01

    Cranial nerve palsy could be one of the presenting features of underlying benign or malignant tumors of the head and neck. The tumor can involve the cranial nerves by local compression, direct infiltration or by paraneoplastic process. Cranial nerve involvement depends on the anatomical course of the cranial nerve and the site of the tumor. Patients may present with single or multiple cranial nerve palsies. Multiple cranial nerve involvement could be sequential or discrete, unilateral or bilateral, painless or painful. The presentation could be acute, subacute or recurrent. Anatomic localization is the first step in the evaluation of these patients. The lesion could be in the brain stem, meninges, base of skull, extracranial or systemic disease itself. We present 3 cases of underlying neoplasms presenting as cranial nerve palsies: a case of glomus tumor presenting as cochlear, glossopharyngeal, vagus and hypoglossal nerve palsies, clivus tumor presenting as abducens nerve palsy, and diffuse large B-cell lymphoma presenting as oculomotor, trochlear, trigeminal and abducens nerve palsies due to paraneoplastic involvement. History and physical examination, imaging, autoantibodies and biopsy if feasible are useful for the diagnosis. Management outcomes depend on the treatment of the underlying tumor. PMID:28553221

  8. Expression of FAP, ADAM12, WISP1, and SOX11 is heterogeneous in aggressive fibromatosis and spatially relates to the histologic features of tumor activity.

    PubMed

    Misemer, Benjamin S; Skubitz, Amy P N; Carlos Manivel, J; Schmechel, Stephen C; Cheng, Edward Y; Henriksen, Jonathan C; Koopmeiners, Joseph S; Corless, Christopher L; Skubitz, Keith M

    2014-02-01

    Aggressive fibromatosis (AF) represents a group of tumors with a variable and unpredictable clinical course, characterized by a monoclonal proliferation of myofibroblastic cells. The optimal treatment for AF remains unclear. Identification and validation of genes whose expression patterns are associated with AF may elucidate biological mechanisms in AF, and aid treatment selection. This study was designed to examine the protein expression by immunohistochemistry (IHC) of four genes, ADAM12, FAP, SOX11, and WISP1, that were found in an earlier study to be uniquely overexpressed in AF compared with normal tissues. Digital image analysis was performed to evaluate inter- and intratumor heterogeneity, and correlate protein expression with histologic features, including a histopathologic assessment of tumor activity, defined by nuclear chromatin density ratio (CDR). AF tumors exhibited marked inter- and intratumor histologic heterogeneity. Pathologic assessment of tumor activity and digital assessment of average nuclear size and CDR were all significantly correlated. IHC revealed protein expression of all four genes. IHC staining for ADAM12, FAP, and WISP1 correlated with CDR and was higher, whereas SOX11 staining was lower in tumors with earlier recurrence following excision. All four proteins were expressed, and the regional variation in tumor activity within and among AF cases was demonstrated. A spatial correlation between protein expression and nuclear morphology was observed. IHC also correlated with the probability of recurrence following excision. These proteins may be involved in AF pathogenesis and the corresponding pathways could serve as potential targets of therapy. © 2013 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  9. MicroRNA genes are frequently located near mouse cancer susceptibility loci

    PubMed Central

    Sevignani, Cinzia; Calin, George A.; Nnadi, Stephanie C.; Shimizu, Masayoshi; Davuluri, Ramana V.; Hyslop, Terry; Demant, Peter; Croce, Carlo M.; Siracusa, Linda D.

    2007-01-01

    MicroRNAs (miRNAs) are short 19- to 24-nt RNA molecules that have been shown to regulate the expression of other genes in a variety of eukaryotic systems. Abnormal expression of miRNAs has been observed in several human cancers, and furthermore, germ-line and somatic mutations in human miRNAs were recently identified in patients with chronic lymphocytic leukemia. Thus, human miRNAs can act as tumor suppressor genes or oncogenes, where mutations, deletions, or amplifications can underlie the development of certain types of leukemia. In addition, previous studies have shown that miRNA expression profiles can distinguish among human solid tumors from different organs. Because a single miRNA can simultaneously influence the expression of two or more protein-coding genes, we hypothesized that miRNAs could be candidate genes for cancer risk. Research in complex trait genetics has demonstrated that genetic background determines cancer susceptibility or resistance in various tissues, such as colon and lung, of different inbred mouse strains. We compared the genome positions of mouse tumor susceptibility loci with those of mouse miRNAs. Here, we report a statistically significant association between the chromosomal location of miRNAs and those of mouse cancer susceptibility loci that influence the development of solid tumors. Furthermore, we identified distinct patterns of flanking DNA sequences for several miRNAs located at or near susceptibility loci in inbred strains with different tumor susceptibilities. These data provide a catalog of miRNA genes in inbred strains that could represent genes involved in the development and penetrance of solid tumors. PMID:17470785

  10. THE PRESENCE OF METASTASES IN REGIONAL LYMPH NODES IS ASSOCIATED WITH TUMOR SIZE AND DEPTH OF INVASION IN SPORADIC GASTRIC ADENOCARCINOMA

    PubMed Central

    CAMBRUZZI, Eduardo; de AZEREDO, Andreza Mariane; KRONHART, Ardala; FOLTZ, Katia Martins; ZETTLER, Cláudio Galeano; PÊGAS, Karla Lais

    2014-01-01

    Background Gastric adenocarcinoma is more often found in men over 50 years in the form of an antral lesion. The tumor has heterogeneous histopathologic features and a poor prognosis (median survival of 15% in five years). Aim To estimate the relationship between the presence of nodal metastasis and other prognostic factors in sporadic gastric adenocarcinoma. Method Were evaluated 164 consecutive cases of gastric adenocarcinoma previously undergone gastrectomy (partial or total), without clinical evidence of distant metastasis, and determined the following variables: topography of the lesion, tumor size, Borrmann macroscopic configuration, histological grade, early or advanced lesions, Lauren histological subtype, presence of signet ring cell, degree of invasion, perigastric lymph node status, angiolymphatic/perineural invasion, and staging. Results Were found 21 early lesions (12.8%) and 143 advanced lesions (87.2%), with a predominance of lesions classified as T3 (n=99/60, 4%) and N1 (n=62/37, 8%). The nodal status was associated with depth of invasion (p<0.001) and tumor size (p<0.001). The staging was related to age (p=0.048), histological grade (p=0.003), and presence of signet ring cells (p = 0.007), angiolymphatic invasion (p = 0.001), and perineural invasion (p=0.003). Conclusion In gastric cancer, lymph node involvement, tumor size and depth of invasion are histopathological data associated with the pattern of growth/tumor spread, suggesting that a wide dissection of perigastric lymph nodes is a fundamental step in the surgical treatment of these patients. PMID:24676292

  11. 1-11C-acetate as a PET radiopharmaceutical for imaging fatty acid synthase expression in prostate cancer.

    PubMed

    Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S

    2008-02-01

    Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.

  12. Characterization of HBV integration patterns and timing in liver cancer and HBV-infected livers.

    PubMed

    Furuta, Mayuko; Tanaka, Hiroko; Shiraishi, Yuichi; Unida, Takuro; Imamura, Michio; Fujimoto, Akihiro; Fujita, Masahi; Sasaki-Oku, Aya; Maejima, Kazuhiro; Nakano, Kaoru; Kawakami, Yoshiiku; Arihiro, Koji; Aikata, Hiroshi; Ueno, Masaki; Hayami, Shinya; Ariizumi, Shun-Ichi; Yamamoto, Masakazu; Gotoh, Kunihito; Ohdan, Hideki; Yamaue, Hiroki; Miyano, Satoru; Chayama, Kazuaki; Nakagawa, Hidewaki

    2018-05-18

    Integration of Hepatitis B virus (HBV) into the human genome can cause genetic instability, leading to selective advantages for HBV-induced liver cancer. Despite the large number of studies for HBV integration into liver cancer, little is known about the mechanism of initial HBV integration events owing to the limitations of materials and detection methods. We conducted an HBV sequence capture, followed by ultra-deep sequencing, to screen for HBV integrations in 111 liver samples from human-hepatocyte chimeric mice with HBV infection and human clinical samples containing 42 paired samples from non-tumorous and tumorous liver tissues. The HBV infection model using chimeric mice verified the efficiency of our HBV-capture analysis and demonstrated that HBV integration could occur 23 to 49 days after HBV infection via microhomology-mediated end joining and predominantly in mitochondrial DNA. Overall HBV integration sites in clinical samples were significantly enriched in regions annotated as exhibiting open chromatin, a high level of gene expression, and early replication timing in liver cells. These data indicate that HBV integration in liver tissue was biased according to chromatin accessibility, with additional selection pressures in the gene promoters of tumor samples. Moreover, an integrative analysis using paired non-tumorous and tumorous samples and HBV-related transcriptional change revealed the involvement of TERT and MLL4 in clonal selection. We also found frequent and non-tumorous liver-specific HBV integrations in FN1 and HBV-FN1 fusion transcript. Extensive survey of HBV integrations facilitates and improves the understanding of the timing and biology of HBV integration during infection and HBV-related hepatocarcinogenesis.

  13. Gene Discovery in Bladder Cancer Progression using cDNA Microarrays

    PubMed Central

    Sanchez-Carbayo, Marta; Socci, Nicholas D.; Lozano, Juan Jose; Li, Wentian; Charytonowicz, Elizabeth; Belbin, Thomas J.; Prystowsky, Michael B.; Ortiz, Angel R.; Childs, Geoffrey; Cordon-Cardo, Carlos

    2003-01-01

    To identify gene expression changes along progression of bladder cancer, we compared the expression profiles of early-stage and advanced bladder tumors using cDNA microarrays containing 17,842 known genes and expressed sequence tags. The application of bootstrapping techniques to hierarchical clustering segregated early-stage and invasive transitional carcinomas into two main clusters. Multidimensional analysis confirmed these clusters and more importantly, it separated carcinoma in situ from papillary superficial lesions and subgroups within early-stage and invasive tumors displaying different overall survival. Additionally, it recognized early-stage tumors showing gene profiles similar to invasive disease. Different techniques including standard t-test, single-gene logistic regression, and support vector machine algorithms were applied to identify relevant genes involved in bladder cancer progression. Cytokeratin 20, neuropilin-2, p21, and p33ING1 were selected among the top ranked molecular targets differentially expressed and validated by immunohistochemistry using tissue microarrays (n = 173). Their expression patterns were significantly associated with pathological stage, tumor grade, and altered retinoblastoma (RB) expression. Moreover, p33ING1 expression levels were significantly associated with overall survival. Analysis of the annotation of the most significant genes revealed the relevance of critical genes and pathways during bladder cancer progression, including the overexpression of oncogenic genes such as DEK in superficial tumors or immune response genes such as Cd86 antigen in invasive disease. Gene profiling successfully classified bladder tumors based on their progression and clinical outcome. The present study has identified molecular biomarkers of potential clinical significance and critical molecular targets associated with bladder cancer progression. PMID:12875971

  14. [Clinical experience in facial nerve tumors: a review of 27 cases].

    PubMed

    Zhang, Fan; Wang, Yucheng; Dai, Chunfu; Chi, Fanglu; Zhou, Liang; Chen, Bing; Li, Huawei

    2010-01-01

    To analyze the clinical manifestations and the diagnosis of the facial nerve tumor according to the clinical information, and evaluate the different surgical approaches depending on tumor location. Twenty-seven cases of facial nerve tumors with general clinical informations available from 1999.9 to 2006.12 in the Shanghai EENT Hospital were reviewed retrospectively. Twenty (74.1%) schwannomas, 4 (14.8%) neurofibromas ,and 3 (11.1%) hemangiomas were identified with histopathology postoperatively. During the course of the disease, 23 patients (85.2%) suffered facial paralysis, both hearing loss and tinnitus affected 11 (40.7%) cases, 5 (18.5%) manifested infra-auricular mass and the others showed some of otalgia or vertigo or ear fullness or facial numbness/twitches. CT or/and MRI results in 24 cases indicated that the tumors originated from the facial nerve. Intra-operative findings showed that 24 (88.9%) cases involved no less than 2 segments of the facial nerve, of these 24 cases 87.5% (21/24) involved the mastoid portion, 70.8% (17/24) involved the tympanic portion, 62.5% (15/24) involved the geniculate ganglion, only 4.2% (1/24) involved the internal acoustic canal (IAC), and 3 cases (11.1%) had only one segments involved. In all of these 27 cases, the tumors were completely excised, of which 13 were resected followed by an immediate facial nerve reconstruction, including 11 sural nerve cable graft, 1 facial nerve end-to-end anastomosis and 1 hypoglossal-facial nerve end-to-end anastomosis. Tumors were removed with preservation of facial nerve continuity in 2 cases. Facial nerve tumor is a rare and benign lesion, and has numerous clinical manifestations. CT and MRI can help surgeons to make a right diagnosis preoperatively. When and how to give the patients an operation depends on the patients individually.

  15. Tissue Damage, Temperature, and pH Induced by Different Electrode Arrays on Potato Pieces (Solanum tuberosum L.).

    PubMed

    González, Maraelys Morales; Aguilar, Claudia Hernández; Pacheco, Flavio Arturo Domínguez; Cabrales, Luis Enrique Bergues; Reyes, Juan Bory; Nava, Juan José Godina; Ambrosio, Paulo Eduardo; Domiguez, Dany Sanchez; Sierra González, Victoriano Gustavo; Pupo, Ana Elisa Bergues; Ciria, Héctor Manuel Camué; Alemán, Elizabeth Issac; García, Francisco Monier; Rivas, Clara Berenguer; Reina, Evelyn Chacón

    2018-01-01

    One of the most challenging problems of electrochemical therapy is the design and selection of suitable electrode array for cancer. The aim is to determine how two-dimensional spatial patterns of tissue damage, temperature, and pH induced in pieces of potato ( Solanum tuberosum L., var. Mondial) depend on electrode array with circular, elliptical, parabolic, and hyperbolic shape. The results show the similarity between the shapes of spatial patterns of tissue damage and electric field intensity, which, like temperature and pH take the same shape of electrode array. The adequate selection of suitable electrodes array requires an integrated analysis that involves, in a unified way, relevant information about the electrochemical process, which is essential to perform more efficiently way the therapeutic planning and the personalized therapy for patients with a cancerous tumor.

  16. Phagocytosis (cannibalism) of apoptotic neutrophils by tumor cells in gastric micropapillary carcinomas.

    PubMed

    Barresi, Valeria; Branca, Giovanni; Ieni, Antonio; Rigoli, Luciana; Tuccari, Giovanni; Caruso, Rosario Alberto

    2015-05-14

    To identify those with a micropapillary pattern, ascertain relative frequency and document clinicopathological characteristics by reviewing gastric carcinomas. One hundred and fifty-one patients diagnosed with gastric cancer who underwent gastrectomy were retrospectively studied and the presence of a regional invasive micropapillary component was evaluated by light microscopy. All available hematoxylin-eosin (HE)-stained slides were histologically reviewed and 5 tumors were selected as putative micropapillary carcinoma when cancer cell clusters without a vascular core within empty lymphatic-like space comprised at least 5% of the tumor. Tumor tissues from these 5 invasive gastric carcinomas were immunostained using an anti-mucin 1 (MUC1) antibody (clone MA695) to detect the characteristic inside-out pattern and with D2-40 antibody to determine the presence of intratumoral lymph vessels. Detection of intraepithelial neutrophil apoptosis was evaluated in consecutive histological tissue sections by three independent methods, namely light microscopy with HE staining, the conventional terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling (TUNEL) method and immunohistochemistry for activated caspase-3 (clone C92-605). Among 151 gastric cancers resected for cure, 5 (3.3%) were adenocarcinomas with a micropapillary component. Four of the patients died of disease from 6 to 23 mo and one patient was alive with metastases at 9 mo. All patients had advanced-stage cancer (≥ pT2) and lymph node metastasis. Positive MUC1 immunostaining on the stroma-facing surface (inside-out pattern) of the carcinomatous cluster cells, together with negative immunostaining for D2-40 in the cells limiting lymphatic-like spaces, confirmed the true micropapillary pattern in these gastric neoplasms. In all five cases, several micropapillae were infiltrated by neutrophils. HE staining, TUNEL assay and immunostaining for caspase-3 demonstrated apoptotic neutrophils within cytoplasmic vacuoles of tumor cells. These data suggest phagocytosis (cannibalism) of apoptotic neutrophils by micropapillary tumor cells. Tumor cell cannibalism is usually found in aggressive tumors with anaplastic morphology. Our data extend these observations to gastric micropapillary carcinoma: a tumor histotype analogously characterized by aggressive behavior and poor prognosis. The results are of interest because they raise the intriguing possibility that neutrophil cannibalism by tumor cells may be one of the mechanisms favoring tumor growth in gastric micropapillary carcinomas. This is the first study showing phagocytosis (cannibalism) of apoptotic neutrophils by tumor cells in gastric micropapillary carcinomas.

  17. Regulation of the Prostate Cancer Tumor Microenvironment

    DTIC Science & Technology

    2015-04-01

    growth can be altered through modulating the composition of TILs through innate immunity . Body Pathogens or cancerous cells alike can produce danger... innate immunity , including Toll-like receptors (TLRs). Thirteen mammalian TLRs have been identified to date with ligands ranging from...damage-associated molecular patterns (DAMPs) released by the tumor stimulate the innate immune pathways through pattern recognition receptors (PRRs

  18. Elevated serum cytokines correlated with altered behavior, serum cortisol rhythm, and dampened 24-hour rest-activity patterns in patients with metastatic colorectal cancer.

    PubMed

    Rich, Tyvin; Innominato, Pasquale F; Boerner, Julie; Mormont, M Christine; Iacobelli, Stefano; Baron, Benoit; Jasmin, Claude; Lévi, Francis

    2005-03-01

    Incapacitating symptom burden in cancer patients contributes to poor quality of life (QOL) and can influence treatment outcomes because of poor tolerance to therapy. In this study, the role of circulating cytokines in the production symptoms in cancer patients is evaluated. Eighty patients with metastatic colorectal cancer with either normal (group I, n = 40) or dampened (group II, n = 40) 24-hour rest/activity patterns measured by actigraphy were identified. Actigraphy patterns were correlated with QOL indices, serum cortisol obtained at 8:00 a.m. and 4:00 p.m. and with serum levels of transforming growth factor-alpha, tumor necrosis factor-alpha, and interleukin 6 (IL-6) obtained at 8:00 a.m. and analyzed in duplicate by ELISA. Cytokine levels and survival were also correlated. Group II patients had significantly higher pre treatment levels of all three cytokines, displayed significantly poorer emotional and social functioning, had higher fatigue, more appetite loss, and poorer performance status compared with group I patients. Transforming growth factor-alpha (TGF-alpha) and IL-6 were significantly increased in the patients with WHO performance status >1 and in those with appetite loss. Fatigue was significantly associated with elevated TGF-alpha only. IL-6 was increased in those patients with extensive liver involvement and multiple organ replacement, and it was significantly correlated with dampened cortisol rhythm. In a multivariate analysis, IL-6 was correlated with poor treatment outcome. Significant correlations were found between serum levels of TGF-alpha and IL-6, circadian patterns in wrist activity and serum cortisol and tumor-related symptoms in patients with metastatic colorectal cancer. These data support the hypothesis that some cancer patient's symptoms of fatigue, poor QOL, and treatment outcome are related to tumor or host generated cytokines and could reflect cytokine effects on the circadian timing system. This interplay between cytokine signaling pathways, the hypothalamic-pituitary-adrenal axis, the autonomic nervous system, and efferent pathways of the suprachiasmatic nucleus that control circadian physiology, opens the way to new rational interventions for symptom management in cancer patients.

  19. B Cell Lymphoma, Unclassifiable, Transformed from Follicular Lymphoma: A Rare Presentation with Review of the Literature

    PubMed Central

    Kanna, Anila; Agrawal, Swati; Jayant, Kumar; Kumar Pala, Varun; Altujjar, Mohammad; Hadid, Tarik; Khurram, Muhammad

    2015-01-01

    B cell lymphoma, unclassifiable, with features of diffuse large B cell lymphoma and classical Hodgkin's lymphoma (BCLu-DLBCL/CHL) is more commonly known as gray zone lymphoma. These cases more often present with mediastinal disease. In this report, we present a very rare case of BCLu-DLBCL/CHL without mediastinal involvement, transformed from follicular lymphoma (FL) to BCLu-DLBCL/CHL. This patient initially presented with a mass in the right neck; biopsy of the lymph node showed predominantly nodular, follicular pattern. Immunohistochemical (IHC) staining of tumor cells expressed positivity for mature B cell markers CD20, CD19, CD10, CD23, CD45, and CD38 but negative for CD5,11c. Hence, diagnosed with FL, he was given rituximab, cyclophosphamide, vincristine, and prednisone (RCVP) regimen, followed by maintenance rituximab. He showed good response. After 2 years, he presented again with a mass in the right side of the neck. Although the needle core biopsy of this mass was suggestive of B cell lymphoma, excisional biopsy showed morphological features of DLBCL as well as foci of histological pattern of CHL. IHC staining expressed positivity for CD20, CD79a, PAX5, and CD15 and CD30 consistent with DLBCL and CHL. He was diagnosed with BCLu-DLBCL/CHL. The patient received “ACVBP” (doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone) followed by radiation. BCLu-DLBCL/CHL is clinically an aggressive tumor with poorer outcomes, but our case showed complete response to ACVBP regimen with tumor regression. PMID:26380128

  20. B Cell Lymphoma, Unclassifiable, Transformed from Follicular Lymphoma: A Rare Presentation with Review of the Literature.

    PubMed

    Kanna, Anila; Agrawal, Swati; Jayant, Kumar; Kumar Pala, Varun; Altujjar, Mohammad; Hadid, Tarik; Khurram, Muhammad

    2015-01-01

    B cell lymphoma, unclassifiable, with features of diffuse large B cell lymphoma and classical Hodgkin's lymphoma (BCLu-DLBCL/CHL) is more commonly known as gray zone lymphoma. These cases more often present with mediastinal disease. In this report, we present a very rare case of BCLu-DLBCL/CHL without mediastinal involvement, transformed from follicular lymphoma (FL) to BCLu-DLBCL/CHL. This patient initially presented with a mass in the right neck; biopsy of the lymph node showed predominantly nodular, follicular pattern. Immunohistochemical (IHC) staining of tumor cells expressed positivity for mature B cell markers CD20, CD19, CD10, CD23, CD45, and CD38 but negative for CD5,11c. Hence, diagnosed with FL, he was given rituximab, cyclophosphamide, vincristine, and prednisone (RCVP) regimen, followed by maintenance rituximab. He showed good response. After 2 years, he presented again with a mass in the right side of the neck. Although the needle core biopsy of this mass was suggestive of B cell lymphoma, excisional biopsy showed morphological features of DLBCL as well as foci of histological pattern of CHL. IHC staining expressed positivity for CD20, CD79a, PAX5, and CD15 and CD30 consistent with DLBCL and CHL. He was diagnosed with BCLu-DLBCL/CHL. The patient received "ACVBP" (doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone) followed by radiation. BCLu-DLBCL/CHL is clinically an aggressive tumor with poorer outcomes, but our case showed complete response to ACVBP regimen with tumor regression.

  1. Identification of the G protein-coupled estrogen receptor (GPER) in human prostate: expression site of the estrogen receptor in the benign and neoplastic gland.

    PubMed

    Rago, V; Romeo, F; Giordano, F; Ferraro, A; Carpino, A

    2016-01-01

    Estrogens are involved in growth, differentiation and pathogenesis of human prostate through the mediation of the classical estrogen receptors ERα and ERβ. The G protein-coupled estrogen receptor (GPER) is a 'novel' mediator of estrogen signaling which has been recently recognized in some human reproductive tissues, but its expression in the prostate gland is still unknown. Here, we investigated GPER in benign (from 5 patients) and neoplastic prostatic tissues (from 50 patients) by immunohistochemical analysis and Western blotting. Normal areas of benign prostates revealed a strong GPER immunoreactivity in the basal epithelial cells while luminal epithelial cells were unreactive and stromal cells were weakly immunostained. GPER was also immunolocalized in adenocarcinoma samples but the immunoreactivity of tumoral areas decreased from Gleason pattern 2 to Gleason pattern 4. Furthermore, a strong GPER immunostaining was also revealed in cells of pre-neoplastic lesions (high-grade prostatic intra-epithelial neoplasia). Western blot analysis of benign and tumor protein extracts showed the presence of a ~42 kDa band, consistent with the GPER molecular weight. An increase in both pAkt and p cAMP-response-binding protein (pCREB) levels was also observed in poorly differentiated PCa samples. Finally, this work identified GPER in the epithelial basal cells of benign human prostate, with a different localization with respect to the classical estrogen receptors. Furthermore, the expression of GPER in prostatic adenocarcinoma cells was also observed but with a modulation of the immunoreactivity according to tumor cell arrangements. © 2015 American Society of Andrology and European Academy of Andrology.

  2. Isolation of Breast Tumor Suppressor Genes from Chromosome 11p.

    DTIC Science & Technology

    1998-09-01

    tumors . Figure 7b shows the SSCA pattern of exon 2 amplified from paired normal/ tumor samples from four different Wilms tumor patients. Sample 1 is...G., Chaussain, J.L., Junien, C. Tumor specific loss of IIp 15.5 alleles in del 1 lp 13 Wilms tumor and in familial adrenocortical carcinoma. Proc...Chilton-MacNeill,S., Campbell, C.E., Weksberg, R., Yeger, H., Reeve, A.E. and Williams, B.R.G. Loss of heterozygosity mapping in Wilms tumor

  3. P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.

    PubMed

    He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M

    2000-09-26

    P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.

  4. A new measure for gene expression biclustering based on non-parametric correlation.

    PubMed

    Flores, Jose L; Inza, Iñaki; Larrañaga, Pedro; Calvo, Borja

    2013-12-01

    One of the emerging techniques for performing the analysis of the DNA microarray data known as biclustering is the search of subsets of genes and conditions which are coherently expressed. These subgroups provide clues about the main biological processes. Until now, different approaches to this problem have been proposed. Most of them use the mean squared residue as quality measure but relevant and interesting patterns can not be detected such as shifting, or scaling patterns. Furthermore, recent papers show that there exist new coherence patterns involved in different kinds of cancer and tumors such as inverse relationships between genes which can not be captured. The proposed measure is called Spearman's biclustering measure (SBM) which performs an estimation of the quality of a bicluster based on the non-linear correlation among genes and conditions simultaneously. The search of biclusters is performed by using a evolutionary technique called estimation of distribution algorithms which uses the SBM measure as fitness function. This approach has been examined from different points of view by using artificial and real microarrays. The assessment process has involved the use of quality indexes, a set of bicluster patterns of reference including new patterns and a set of statistical tests. It has been also examined the performance using real microarrays and comparing to different algorithmic approaches such as Bimax, CC, OPSM, Plaid and xMotifs. SBM shows several advantages such as the ability to recognize more complex coherence patterns such as shifting, scaling and inversion and the capability to selectively marginalize genes and conditions depending on the statistical significance. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. The human keratins: biology and pathology

    PubMed Central

    Divo, Markus; Langbein, Lutz

    2008-01-01

    The keratins are the typical intermediate filament proteins of epithelia, showing an outstanding degree of molecular diversity. Heteropolymeric filaments are formed by pairing of type I and type II molecules. In humans 54 functional keratin genes exist. They are expressed in highly specific patterns related to the epithelial type and stage of cellular differentiation. About half of all keratins—including numerous keratins characterized only recently—are restricted to the various compartments of hair follicles. As part of the epithelial cytoskeleton, keratins are important for the mechanical stability and integrity of epithelial cells and tissues. Moreover, some keratins also have regulatory functions and are involved in intracellular signaling pathways, e.g. protection from stress, wound healing, and apoptosis. Applying the new consensus nomenclature, this article summarizes, for all human keratins, their cell type and tissue distribution and their functional significance in relation to transgenic mouse models and human hereditary keratin diseases. Furthermore, since keratins also exhibit characteristic expression patterns in human tumors, several of them (notably K5, K7, K8/K18, K19, and K20) have great importance in immunohistochemical tumor diagnosis of carcinomas, in particular of unclear metastases and in precise classification and subtyping. Future research might open further fields of clinical application for this remarkable protein family. PMID:18461349

  6. Acquisition of epithelial-mesenchymal transition phenotype in the tamoxifen-resistant breast cancer cell: a new role for G protein-coupled estrogen receptor in mediating tamoxifen resistance through cancer-associated fibroblast-derived fibronectin and β1-integrin signaling pathway in tumor cells.

    PubMed

    Yuan, Jie; Liu, Manran; Yang, Li; Tu, Gang; Zhu, Qing; Chen, Maoshan; Cheng, Hong; Luo, Haojun; Fu, Weijie; Li, Zhenhua; Yang, Guanglun

    2015-05-21

    Acquired tamoxifen resistance remains the major obstacle to breast cancer endocrine therapy. β1-integrin was identified as one of the target genes of G protein-coupled estrogen receptor (GPER), a novel estrogen receptor recognized as an initiator of tamoxifen resistance. Here, we investigated the role of β1-integrin in GPER-mediated tamoxifen resistance in breast cancer. The expression of β1-integrin and biomarkers of epithelial-mesenchymal transition were evaluated immunohistochemically in 53 specimens of metastases and paired primary tumors. The function of β1-integrin was investigated in tamoxifen-resistant (MCF-7R) subclones, derived from parental MCF-7 cells, and MCF-7R β1-integrin-silenced subclones in MTT and Transwell assays. Involved signaling pathways were identified using specific inhibitors and Western blotting analysis. GPER, β1-integrin and mesenchymal biomarkers (vimentin and fibronectin) expression in metastases increased compared to the corresponding primary tumors; a close expression pattern of β1-integrin and GPER were in metastases. Increased β1-integrin expression was also confirmed in MCF-7R cells compared with MCF-7 cells. This upregulation of β1-integrin was induced by agonists of GPER and blocked by both antagonist and knockdown of it in MCF-7R cells. Moreover, the epidermal growth factor receptor/extracellular regulated protein kinase (EGFR/ERK) signaling pathway was involved in this transcriptional regulation since specific inhibitors of these kinases also reduced the GPER-induced upregulation of β1-integrin. Interestingly, silencing of β1-integrin partially rescued the sensitivity of MCF-7R cells to tamoxifen and the α5β1-integrin subunit is probably responsible for this phenomenon. Importantly, the cell migration and epithelial-mesenchymal transition induced by cancer-associated fibroblasts, or the product of cancer-associated fibroblasts, fibronectin, were reduced by knockdown of β1-integrin in MCF-7R cells. In addition, the downstream kinases of β1-integrin including focal adhesion kinase, Src and AKT were activated in MCF-7R cells and may be involved in the interaction between cancer cells and cancer-associated fibroblasts. GPER/EGFR/ERK signaling upregulates β1-integrin expression and activates downstream kinases, which contributes to cancer-associated fibroblast-induced cell migration and epithelial-mesenchymal transition, in MCF-7R cells. GPER probably contributes to tamoxifen resistance via interaction with the tumor microenvironment in a β1-integrin-dependent pattern. Thus, β1-integrin may be a potential target to improve anti-hormone therapy responses in breast cancer patients.

  7. Architectural patterns of p16 immunohistochemical expression associated with cancer immunity and prognosis of head and neck squamous cell carcinoma.

    PubMed

    Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och

    2017-11-01

    We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  8. Computational Trials: Unraveling Motility Phenotypes, Progression Patterns, and Treatment Options for Glioblastoma Multiforme

    PubMed Central

    Raman, Fabio; Scribner, Elizabeth; Saut, Olivier; Wenger, Cornelia; Colin, Thierry; Fathallah-Shaykh, Hassan M.

    2016-01-01

    Glioblastoma multiforme is a malignant brain tumor with poor prognosis and high morbidity due to its invasiveness. Hypoxia-driven motility and concentration-driven motility are two mechanisms of glioblastoma multiforme invasion in the brain. The use of anti-angiogenic drugs has uncovered new progression patterns of glioblastoma multiforme associated with significant differences in overall survival. Here, we apply a mathematical model of glioblastoma multiforme growth and invasion in humans and design computational trials using agents that target angiogenesis, tumor replication rates, or motility. The findings link highly-dispersive, moderately-dispersive, and hypoxia-driven tumors to the patterns observed in glioblastoma multiforme treated by anti-angiogenesis, consisting of progression by Expanding FLAIR, Expanding FLAIR + Necrosis, and Expanding Necrosis, respectively. Furthermore, replication rate-reducing strategies (e.g. Tumor Treating Fields) appear to be effective in highly-dispersive and moderately-dispersive tumors but not in hypoxia-driven tumors. The latter may respond to motility-reducing agents. In a population computational trial, with all three phenotypes, a correlation was observed between the efficacy of the rate-reducing agent and the prolongation of overall survival times. This research highlights the potential applications of computational trials and supports new hypotheses on glioblastoma multiforme phenotypes and treatment options. PMID:26756205

  9. Reduced Dermatopontin Expression Is a Molecular Link Between Uterine Leiomyomas and Keloids

    PubMed Central

    Catherino, William H.; Leppert, Phyllis C.; Stenmark, Matthew H.; Payson, Mark; Potlog-Nahari, Clariss; Nieman, Lynnette K.; Segars, James H.

    2014-01-01

    Uterine leiomyomas are prevalent estrogen-responsive clonal tumors, but the specific genetic alterations that contribute to their development have not been elucidated. To identify genes involved in the formation of leiomyomas, we used global expression profiling to compare clonal tumors with normal myometrium. Contrary to expectation, genes involved in estrogen action were not differentially expressed between leiomyoma and normal myometrium. Genes encoding extracellular-matrix proteins were prominently featured, suggesting their involvement in formation of a myofibroblast phenotype. Analysis of the extracellular matrix in the leiomyomas revealed a disordered collagen fibril orientation. Expression of the collagen-binding protein dermatopontin was found to be consistently decreased in leiomyoma by both reverse transcriptase-polymerase chain reaction (RT-PCR) and real-time RT-PCR (mean underexpression = 9.41-fold) regardless of leiomyoma size, leiomyoma location, patient race, and patient age. This expression pattern was observed in 11 subjects and a total of 23 leiomyoma: myometrium pairs. Decreased expression of dermatopontin was also associated with keloid formation, a fibrotic disease that shares epidemiologic similarities with leiomyoma. Immunohistochemical studies of leiomyomas and keloids demonstrated reduced levels of dermatopontin in both tissues. In addition, ultrastructural analysis revealed that the orientation of the collagen fibrils in the keloid tissues strongly resembled that in the leiomyomas. Reduction in dermatopontin was associated with an increase in transforming growth factor–β3 (TGFB3) mRNA levels in leiomyomas, whereas other genes involved in dermatopontin signaling were not differentially expressed. These findings suggest that leiomyoma development involves a myofibroblast cell phenotype characterized by dysregulation of genes encoding extracellular-matrix proteins. In particular, decreased expression of dermatopontin represents a molecular link between the leiomyoma and keloid phenotypes. PMID:15139000

  10. Juxtaglomerular cell tumor of the kidney: report of two cases with a papillary pattern.

    PubMed

    Têtu, B; Vaillancourt, L; Camilleri, J P; Bruneval, P; Bernier, L; Tourigny, R

    1993-11-01

    We report the clinicopathologic, immunohistochemical, and electron microscopic study of two cases of juxtaglomerular cell tumor of the kidney with a hitherto unreported dominant papillary pattern. Both tumors were associated with high blood pressure that did not respond to medical therapy, but that returned to normal after removal of the kidney. They were well delineated, tan, and had no necrosis. The cores of the papillary structures consisted of polygonal cells found to express renin by immunohistochemistry and to contain renin protogranules by electron microscopy. The papillary fronds were covered by one layer of cuboidal epithelial cells that did not stain for renin and had ultrastructural features reminiscent of the collecting duct epithelium. These tumors must be differentiated from malignant papillary tumors of the kidney, such as papillary clear cell carcinoma, transitional cell carcinoma, and collecting duct carcinoma.

  11. Imaging Tumor Necrosis with Ferumoxytol

    PubMed Central

    Aghighi, Maryam; Golovko, Daniel; Ansari, Celina; Marina, Neyssa M.; Pisani, Laura; Kurlander, Lonnie; Klenk, Christopher; Bhaumik, Srabani; Wendland, Michael; Daldrup-Link, Heike E.

    2015-01-01

    Objective Ultra-small superparamagnetic iron oxide nanoparticles (USPIO) are promising contrast agents for magnetic resonance imaging (MRI). USPIO mediated proton relaxation rate enhancement is strongly dependent on compartmentalization of the agent and can vary depending on their intracellular or extracellular location in the tumor microenvironment. We compared the T1- and T2-enhancement pattern of intracellular and extracellular USPIO in mouse models of cancer and pilot data from patients. A better understanding of these MR signal effects will enable non-invasive characterizations of the composition of the tumor microenvironment. Materials and Methods Six 4T1 and six MMTV-PyMT mammary tumors were grown in mice and imaged with ferumoxytol-enhanced MRI. R1 relaxation rates were calculated for different tumor types and different tumor areas and compared with histology. The transendothelial leakage rate of ferumoxytol was obtained by our measured relaxivity of ferumoxytol and compared between different tumor types, using a t-test. Additionally, 3 patients with malignant sarcomas were imaged with ferumoxytol-enhanced MRI. T1- and T2-enhancement patterns were compared with histopathology in a descriptive manner as a proof of concept for clinical translation of our observations. Results 4T1 tumors showed central areas of high signal on T1 and low signal on T2 weighted MR images, which corresponded to extracellular nanoparticles in a necrotic core on histopathology. MMTV-PyMT tumors showed little change on T1 but decreased signal on T2 weighted images, which correlated to compartmentalized nanoparticles in tumor associated macrophages. Only 4T1 tumors demonstrated significantly increased R1 relaxation rates of the tumor core compared to the tumor periphery (p<0.001). Transendothelial USPIO leakage was significantly higher for 4T1 tumors (3.4±0.9x10-3 mL/min/100cm3) compared to MMTV-PyMT tumors (1.0±0.9x10-3 mL/min/100 cm3). Likewise, ferumoxytol imaging in patients showed similar findings with high T1 signal in areas of tumor necrosis and low signal in areas of intracellularly compartmentalized iron. Conclusion Differential T1- and T2-enhancement patterns of USPIO in tumors enable conclusions about their intracellular and extracellular location. This information can be used to characterize the composition of the tumor microenvironment. PMID:26569397

  12. Collision Tumor between Trichofolliculoma and Melanocytic Nevus.

    PubMed

    Bolte, Christel; Cullen, Roberto; Sazunic, Ivo

    2017-01-01

    Trichofolliculoma (TF) is a hamartomatous hair follicle-related tumor, clinically described as a dome-shaped papule with a central pore crossed by one or more silky white hairs. Histologically, it described as a cystic cavity containing keratinous debris, hair shaft fragments, and numerous hair follicles arising from its linings. Collision or compound tumors are a coexistence of two or more identifiable tumors in the same lesion. We present a case of a 47-year-old man with a lesion on his left cheek clinically characterized as a TF. However, the histopathological study reveals a collision tumor involving a TF and a melanocytic nevus. Collision tumors involving melanocytic nevi and hair follicle-related tumors have been previously reported, such as desmoplastic trichoepithelioma, epidermoid cyst, folliculosebaceous cystic hamartoma, and trichoadenoma.

  13. Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

    PubMed

    Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

    2008-06-01

    Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

  14. The metastasis-associated gene MTA3, a component of the Mi-2/NuRD transcriptional repression complex, predicts prognosis of gastroesophageal junction adenocarcinoma.

    PubMed

    Dong, Hongmei; Guo, Hong; Xie, Liangxi; Wang, Geng; Zhong, Xueyun; Khoury, Thaer; Tan, Dongfeng; Zhang, Hao

    2013-01-01

    Gastroesophageal junction (GEJ) adenocarcinoma carries a poor prognosis that is largely attributable to early and frequent metastasis. The acquisition of metastatic potential in cancer involves epithelial-to-mesenchymal transition (EMT). The metastasis-associated gene MTA3, a novel component of the Mi-2/NuRD transcriptional repression complex, was identified as master regulator of EMT through inhibition of Snail to increase E-cadherin expression in breast cancer. Here, we evaluated the expression pattern of the components of MTA3 pathway and the corresponding prognostic significance in GEJ adenocarcinoma. MTA3 expression was decreased at both protein and mRNA levels in tumor tissues compared to the non-tumorous and lowed MTA3 levels were noted in tumor cell lines with stronger metastatic potential. Immunohistochemical analysis of a cohort of 128 cases exhibited that patients with lower expression of MTA3 had poorer outcomes. Combined misexpression of MTA3, Snail and E-cadherin had stronger correlation with malignant properties. Collectively, results suggest that the MTA3-regulated EMT pathway is altered to favor EMT and, therefore, disease progression and that MTA3 expression was an independent prognostic factor in patients with GEJ adenocarcinoma.

  15. [Head and neck paragangliomas. Embryological origin and anatomical characteristics: topographic distribution and vascularization pattern].

    PubMed

    Carretero González, José; Blanco Pérez, Pedro; Vázquez Osorio, María Teresa; Benito González, Fernando; Sañudo Tejedo, José Ramón

    2009-02-01

    Paragangliomas are tumors that arise in the extraadrenal paraganglia and result from migration of neural crest cells during embryonic development. Based on their anatomical distribution, innervation and microscopic structure, these tumors can be classified into interrelated families: branchiomeric paraganglia (related to the branchial clefts and arches), intravagal, aortic-sympathetic and visceral-autonomic. Head and neck paragangliomas belong mainly to the first two of these families. The present article is divided into two parts. The first part reviews the embryological origin of these tumors. Special emphasis is placed on the process of neurulation or neural tube formation, neurosegmentation (with a summary of the mechanisms involved in the initial segmentation of the neural tube and of the hindbrain and spinal medulla), and the development of the sensory placodes and secondary inductions in the cranial region. Subsequently, the neural crest is analyzed, with special attention paid to the cranial neural crest. The embryonogenesis of paragangliomas is also described. The second part describes the topographical distribution of head and neck paragangliomas according to their localization: jugulotympanic, orbit, intercarotid, subclavian and laryngeal. The embryonogenesis and most important anatomical characteristics are described for each type.

  16. Expression patterns of emmprin and monocarboxylate transporter-1 in ovarian epithelial tumors.

    PubMed

    Fukuoka, Miyoko; Hamasaki, Makoto; Koga, Kaori; Hayashi, Hiroyuki; Aoki, Mikiko; Kawarabayashi, Tatsuhiko; Miyamoto, Shingo; Nabeshima, Kazuki

    2012-10-01

    Emmprin is a transmembrane glycoprotein known as a matrix metalloproteinase inducer and is highly up-regulated in malignant cancer cells. The monocarboxylate transporters (MCTs) are responsible for H(+)-linked transport of monocarboxylates across the cell membrane. It was recently demonstrated that proper plasma membrane localization and activity of MCTs require the presence of emmprin as a chaperone and that MCT-1 also acts as chaperone for emmprin. The objectives of this study were to clarify emmprin and MCT-1 expression patterns in ovarian epithelial tumors and to elucidate the clinicopathological significance of co-localization of the two molecules. Immunohistochemical analysis of 205 epithelial tumors indicated that emmprin is always localized in cell membranes but its distribution differs according to tumor type: in lateral membranes in 89 % of adenomas, in lateral and basal membranes in 76 % of borderline tumors, and in membranes surrounding the entire cell in 98 % of carcinomas. Most carcinomas in situ also showed a lateral and basal expression pattern. In only 21 % of the carcinomas, the cells expressing membranous MCT-1 showed co-localized emmprin expression. Poor co-localization of the two molecules was more frequently found in serous carcinomas. However, the overall survival was not significantly different for the good and poor co-localization carcinoma groups. These findings indicate that the emmprin expression pattern might discriminate between invasive carcinomas and borderline tumors including carcinoma in situ. Moreover, there may be an as yet unidentified regulatory mechanism(s), for localization of MCT-1 and emmprin in cell membranes in vivo.

  17. Genomic characterization of explant tumorgraft models derived from fresh patient tumor tissue

    PubMed Central

    2012-01-01

    Background There is resurgence within drug and biomarker development communities for the use of primary tumorgraft models as improved predictors of patient tumor response to novel therapeutic strategies. Despite perceived advantages over cell line derived xenograft models, there is limited data comparing the genotype and phenotype of tumorgrafts to the donor patient tumor, limiting the determination of molecular relevance of the tumorgraft model. This report directly compares the genomic characteristics of patient tumors and the derived tumorgraft models, including gene expression, and oncogenic mutation status. Methods Fresh tumor tissues from 182 cancer patients were implanted subcutaneously into immune-compromised mice for the development of primary patient tumorgraft models. Histological assessment was performed on both patient tumors and the resulting tumorgraft models. Somatic mutations in key oncogenes and gene expression levels of resulting tumorgrafts were compared to the matched patient tumors using the OncoCarta (Sequenom, San Diego, CA) and human gene microarray (Affymetrix, Santa Clara, CA) platforms respectively. The genomic stability of the established tumorgrafts was assessed across serial in vivo generations in a representative subset of models. The genomes of patient tumors that formed tumorgrafts were compared to those that did not to identify the possible molecular basis to successful engraftment or rejection. Results Fresh tumor tissues from 182 cancer patients were implanted into immune-compromised mice with forty-nine tumorgraft models that have been successfully established, exhibiting strong histological and genomic fidelity to the originating patient tumors. Comparison of the transcriptomes and oncogenic mutations between the tumorgrafts and the matched patient tumors were found to be stable across four tumorgraft generations. Not only did the various tumors retain the differentiation pattern, but supporting stromal elements were preserved. Those genes down-regulated specifically in tumorgrafts were enriched in biological pathways involved in host immune response, consistent with the immune deficiency status of the host. Patient tumors that successfully formed tumorgrafts were enriched for cell signaling, cell cycle, and cytoskeleton pathways and exhibited evidence of reduced immunogenicity. Conclusions The preservation of the patient’s tumor genomic profile and tumor microenvironment supports the view that primary patient tumorgrafts provide a relevant model to support the translation of new therapeutic strategies and personalized medicine approaches in oncology. PMID:22709571

  18. Differential Induction of Immunogenic Cell Death and Interferon Expression in Cancer Cells by Structured ssRNAs.

    PubMed

    Lee, Jaewoo; Lee, Youngju; Xu, Li; White, Rebekah; Sullenger, Bruce A

    2017-06-07

    Activation of the RNA-sensing pattern recognition receptor (PRR) in cancer cells leads to cell death and cytokine expression. This cancer cell death releases tumor antigens and damage-associated molecular patterns (DAMPs) that induce anti-tumor immunity. However, these cytokines and DAMPs also cause adverse inflammatory and thrombotic complications that can limit the overall therapeutic benefits of PRR-targeting anti-cancer therapies. To overcome this problem, we generated and evaluated two novel and distinct ssRNA molecules (immunogenic cell-killing RNA [ICR]2 and ICR4). ICR2 and ICR4 differentially stimulated cell death and PRR signaling pathways and induced different patterns of cytokine expression in cancer and innate immune cells. Interestingly, DAMPs released from ICR2- and ICR4-treated cancer cells had distinct patterns of stimulation of innate immune receptors and coagulation. Finally, ICR2 and ICR4 inhibited in vivo tumor growth as effectively as poly(I:C). ICR2 and ICR4 are potential therapeutic agents that differentially induce cell death, immune stimulation, and coagulation when introduced into tumors. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  19. Intratumoral Heterogeneity of SMAD4 Immunohistochemical Expression and Its Role in Prediction of Recurrence Pattern in Patients with Resectable Pancreatic Cancer.

    PubMed

    Pokataev, Ilya; Kudaibergenova, Asel; Artemyeva, Anna; Popova, Anna; Rumyantsev, Alexey; Podluzhny, Danil; Kudashkin, Nikolay; Fedyanin, Mikhail; Tryakin, Alexey; Tjulandin, Sergey

    2018-04-20

    The aim of our study was to evaluate consistency of SMAD4 expression in different tumor areas and its correlation with recurrence pattern in patients after resection for pancreatic cancer (PC). Records of patients who underwent resection for nonmetastatic PC between 2001 and 2015 were analyzed. Formalin-fixed, paraffin-embedded tissue sections from different areas of primary tumor and lymph node metastases were analyzed immunohistochemically (IHC) for SMAD4 expression using TMA technology. SMAD4 expression was assessed in 356 tissue sections obtained from 91 patients. SMAD4 expression was positive in all assessed tumor slides only in 7 of 26 patients (26.9%). There were 54 recurrences (9 locoregional, 41 distant, and 4 both local and distant) with median follow-up of 21.7 months. There was no correlation between SMAD4 expression and locoregional recurrence pattern (p = 0.30). SMAD4 status influenced neither distant recurrence-free survival (p = 0.99) nor overall survival (p = 0.13). Different areas inside primary tumor and lymph node metastases express SMAD4 heterogeneously. SMAD4 IHC expression is not a biomarker of the recurrence pattern after surgical resection for PC.

  20. Epithelioid inflammatory myofibroblastic sarcoma: An aggressive intra-abdominal variant of inflammatory myofibroblastic tumor with nuclear membrane or perinuclear ALK.

    PubMed

    Mariño-Enríquez, Adrián; Wang, Wei-Lien; Roy, Angshumoy; Lopez-Terrada, Dolores; Lazar, Alexander J F; Fletcher, Christopher D M; Coffin, Cheryl M; Hornick, Jason L

    2011-01-01

    Inflammatory myofibroblastic tumor (IMT) is a mesenchymal neoplasm of intermediate biological potential, which may recur and rarely metastasize. Pathologic features do not correlate well with behavior. Approximately 50% of conventional IMTs harbor ALK gene rearrangement and overexpress ALK, most showing diffuse cytoplasmic staining. Rare IMTs with a distinct nuclear membrane or perinuclear pattern of ALK staining and epithelioid or round cell morphology have been reported. These cases pursued an aggressive clinical course, suggesting that such patterns may predict malignant behavior. We describe 11 cases of IMT with epithelioid morphology and a nuclear membrane or perinuclear pattern of immunostaining for ALK. Ten patients were male and 1 was female, ranging from 7 months to 63 years in age (median, 39 y). All tumors were intra-abdominal; most arose in the mesentery or omentum, measuring 8 to 26 cm (median, 15 cm). Six tumors were multifocal at presentation. The tumors were composed predominantly of sheets of round-to-epithelioid cells with vesicular nuclei, large nucleoli, and amphophilic-to-eosinophilic cytoplasm. In all cases, a minor spindle cell component was present. Nine tumors had abundant myxoid stroma. In 7 cases neutrophils were prominent and in 3 cases lymphocytes were prominent. Plasma cells were often absent. Median mitotic rate was 4/10 HPF; 6 tumors had necrosis. By immunohistochemistry, all tumors were positive for ALK, 9 tumors showing a nuclear membrane staining pattern and 2 tumors showing a cytoplasmic pattern with perinuclear accentuation. Other positive markers were desmin (10 of 11), focal smooth muscle actin (4 of 8), and CD30 (8 of 8). All tumors were negative for MYF4, caldesmon, keratins, EMA, and S-100. Fluorescence in situ hybridization was positive for ALK gene rearrangement in 9 cases, and in 3 cases tested, a RANBP2-ALK fusion was detected by reverse transcription polymerase chain reaction. Ten patients underwent surgical resection; 1 patient was inoperable. Follow-up was available for 8 patients and ranged from 3 to 40 months (median, 13 mo). All patients experienced rapid local recurrences; 4 patients had multiple recurrences. Eight patients were treated with postoperative chemotherapy; 2 patients received additional radiotherapy. Two patients also developed metastases (both patients developed metastases to the liver; 1 patient developed metastases to the lung and lymph nodes as well). Thus far, 5 patients died of disease, 2 patients are alive with disease, and 1 patient, treated with an experimental ALK inhibitor, has no evidence of disease. In summary, the epithelioid variant of IMT with nuclear membrane or perinuclear ALK is a distinctive intra-abdominal sarcoma with a predilection for male patients. Unlike conventional IMT, abundant myxoid stroma and prominent neutrophils are common. These tumors pursue an aggressive course with rapid local recurrences and are frequently fatal. We propose the designation "epithelioid inflammatory myofibroblastic sarcoma" to convey both the malignant behavior of these tumors and their close relationship with IMT.

  1. Expression of Eag1 K+ channel and ErbBs in human pituitary adenomas: cytoskeleton arrangement patterns in cultured cells.

    PubMed

    del Pliego, Margarita González; Aguirre-Benítez, Elsa; Paisano-Cerón, Karina; Valdovinos-Ramírez, Irene; Rangel-Morales, Carlos; Rodríguez-Mata, Verónica; Solano-Agama, Carmen; Martín-Tapia, Dolores; de la Vega, María Teresa; Saldoval-Balanzario, Miguel; Camacho, Javier; Mendoza-Garrido, María Eugenia

    2013-01-01

    Pituitary adenomas can invade surrounded tissue, but the mechanism remains elusive. Ether à go-go-1 (Eag1) potassium channel and epidermal growth factor receptors (ErbB1 and ErbB2) have been associated to invasive phenotypes or poor prognosis in cancer patients. However, cells arrange their cytoskeleton in order to acquire a successful migration pattern. We have studied ErbBs and Eag1 expression, and cytoskeleton arrangements in 11 human pituitary adenomas. Eag1, ErbB1 and ErbB2 expression were studied by immunochemistry in tissue and cultured cells. The cytoskeleton arrangement was analyzed in cultured cells by immunofluorescence. Normal pituitary tissue showed ErbB2 expression and Eag1 only in few cells. However, Eag1 and ErbB2 were expressed in all the tumors analyzed. ErbB1 expression was observed variable and did not show specificity for a tumor characteristic. Cultured cells from micro- and macro-adenomas clinically functional organize their cytoskeleton suggesting a mesenchymal pattern, and a round leucocyte/amoeboid pattern from invasive clinically silent adenoma. Pituitary tumors over-express EGF receptors and the ErbB2 repeated expression suggests is a characteristic of adenomas. Eag 1 was express, in different extent, and could be a therapeutic target. The cytoskeleton arrangements observed suggest that pituitary tumor cells acquire different patterns: mesenchymal, and leucocyte/amoeboid, the last observed in the invasive adenomas. Amoeboid migration pattern has been associated with high invasion capacity.

  2. Decision Trees Predicting Tumor Shrinkage for Head and Neck Cancer: Implications for Adaptive Radiotherapy.

    PubMed

    Surucu, Murat; Shah, Karan K; Mescioglu, Ibrahim; Roeske, John C; Small, William; Choi, Mehee; Emami, Bahman

    2016-02-01

    To develop decision trees predicting for tumor volume reduction in patients with head and neck (H&N) cancer using pretreatment clinical and pathological parameters. Forty-eight patients treated with definitive concurrent chemoradiotherapy for squamous cell carcinoma of the nasopharynx, oropharynx, oral cavity, or hypopharynx were retrospectively analyzed. These patients were rescanned at a median dose of 37.8 Gy and replanned to account for anatomical changes. The percentages of gross tumor volume (GTV) change from initial to rescan computed tomography (CT; %GTVΔ) were calculated. Two decision trees were generated to correlate %GTVΔ in primary and nodal volumes with 14 characteristics including age, gender, Karnofsky performance status (KPS), site, human papilloma virus (HPV) status, tumor grade, primary tumor growth pattern (endophytic/exophytic), tumor/nodal/group stages, chemotherapy regimen, and primary, nodal, and total GTV volumes in the initial CT scan. The C4.5 Decision Tree induction algorithm was implemented. The median %GTVΔ for primary, nodal, and total GTVs was 26.8%, 43.0%, and 31.2%, respectively. Type of chemotherapy, age, primary tumor growth pattern, site, KPS, and HPV status were the most predictive parameters for primary %GTVΔ decision tree, whereas for nodal %GTVΔ, KPS, site, age, primary tumor growth pattern, initial primary GTV, and total GTV volumes were predictive. Both decision trees had an accuracy of 88%. There can be significant changes in primary and nodal tumor volumes during the course of H&N chemoradiotherapy. Considering the proposed decision trees, radiation oncologists can select patients predicted to have high %GTVΔ, who would theoretically gain the most benefit from adaptive radiotherapy, in order to better use limited clinical resources. © The Author(s) 2015.

  3. Cranial nerve involvement in nasopharyngeal carcinoma: response to radiotherapy and its clinical impact.

    PubMed

    Li, Jian-Cheng; Mayr, Nina A; Yuh, William T C; Wang, Jian Z; Jiang, Guo-Liang

    2006-05-01

    To evaluate the cranial nerve (CN) palsy associated with nasopharyngeal carcinoma (NPC), we studied factors that influenced the neurologic outcome of radiotherapy (RT), and the patterns and time course of neurologic recovery of CN palsy. Between July 1987 and July 1989, 93 patients who presented with CN palsy at the time of diagnosis of NPC were studied. All patients underwent external-beam RT with either cobalt-60 or 6-MV photon beams to a dose of 69 to 84 Gy at 2 Gy per fraction. The time course and pattern of neurologic recovery (complete, partial, or none) from CN palsy were evaluated. Age, sex, stage, histology, incidence and distribution of types of CNs involved, duration of CN palsy, and time course of tumor response during RT were correlated with the patterns and the time course of neurologic CN recovery by univariate and multivariate analyses. The cases of CN palsy most commonly involved CN V (38%), CN VI (26%), and CN XII (11%), which accounted for the majority of the cases (75%). The time course of CN recovery was variable and protracted. Most patients showed significant improvement upon completion of RT (51%, 19%, and 30% complete, partial, and no recovery, respectively) and further improvement 6 months after RT (58%, 17%, and 25%, respectively). Cranial nerves V, VI, and XII accounted for 75% of cases with no recovery. Recovery was best for CNs II, IX, and XI and the sympathetic nerve (100%, 87%, 100%, and 100%, respectively) and worst for CNs IV, VII, and XII (67%, 60%, and 40%, respectively, with no recovery). Neurologic CN recovery correlated significantly with the pretherapy duration (<3 months versus > or =3 months) of CN palsy (88% versus 62%; p = .002, multivariate analysis), the time course of clinical tumor regression, and neurologic symptom improvement during RT. Age, sex, T stage, N stage, histology, anterior versus posterior CN palsies, and base of skull involvement were not significant. According to our limited data, most patients with CN palsy respond well to RT. That the time course of neurologic recovery is variable and can be protracted indicates a need for continuous and close neurologic surveillance. The poorer neurologic outcome associated with a longer duration of CN symptoms may be related to a more severe longterm CN compression that results in irreversible damage. Timely diagnosis of NPC and fast institution of therapy are therefore critical to improving the neurologic outcome.

  4. Breast tumor DNA methylation patterns associated with smoking in the Carolina Breast Cancer Study.

    PubMed

    Conway, Kathleen; Edmiston, Sharon N; Parrish, Eloise; Bryant, Christopher; Tse, Chiu-Kit; Swift-Scanlan, Theresa; McCullough, Lauren E; Kuan, Pei Fen

    2017-06-01

    Tobacco smoking is a risk factor in several cancers, yet its roles as a putative etiologic exposure or poor prognostic factor in breast cancer are less clear. Altered DNA methylation contributes to breast cancer development and may provide a mechanistic link between smoking and gene expression changes leading to cancer development or progression. Using a cancer-focused array, we examined methylation at 933 CpGs in 517 invasive breast tumors in the Carolina Breast Cancer Study to determine whether methylation patterns differ by exposure to tobacco smoke. Multivariable generalized linear regression models were used to compare tumor methylation profiles between smokers and never smokers, overall, or stratified on hormone receptor (HR) status. Modest differences in CpG methylation were detected at p < 0.05 in breast tumors from current or ever smokers compared with never smokers. In stratified analyses, HR- tumors from smokers exhibited primarily hypomethylation compared with tumors from never smokers; hypomethylation was similarly detected within the more homogeneous basal-like subtype. Most current smoking-associated CpG loci exhibited methylation levels in former smokers that were intermediate between those in current and never smokers and exhibited progressive changes in methylation with increasing duration of smoking. Among former smokers, restoration of methylation toward baseline (never smoking) levels was observed with increasing time since quitting. Moreover, smoking-related hypermethylation was stronger in HR+ breast tumors from blacks than in whites. Our results suggest that breast tumor methylation patterns differ with tobacco smoke exposure; however, additional studies are needed to confirm these findings.

  5. Carcinosarcoma of the colon: a rare cause of colovesical fistula.

    PubMed

    Patel, Dhaval H; Dang, Shyam; Bentley, Frederick R; Julka, Rahul N; Olden, Kevin W; Aduli, Farshad

    2009-04-01

    Carcinosarcomas are relatively rare tumors composed of both carcinomatous and sarcomatous components. The most common sites involved by this tumor are the head and neck, respiratory tract, uterus, ovaries, and fallopian tubes. Within the gastrointestinal tract this tumor most often occurs in the esophagus, followed by the stomach. Carcinosarcomas are very aggressive tumors associated with a poor prognosis. The first case of carcinosarcoma of the colon was reported in 1986. The case reported here is the only one involving an associated colovesical fistula.

  6. [Clinical and pathologic observation of uveal metastatic carcinoma].

    PubMed

    Cong, C X; Lin, J Y; Wang, L H

    2016-10-11

    Objective: To observe the clinical and pathological features of uveal metastatic carcinoma. Methods: It was a retrospective case series study. The clinical manifestation, growth pattern, tumor types and relative pathological features of 13 patients visiting from January 1980 to December 2014 with uveal metastatic carcinoma in Tianjin Eye Hospital were analyzed retrospectively. Results: There were 13 cases, 6 cases of male and 7 of female. Age was from 37.0 to 66.0 years old. The mean age was 52.1 years old. all cases were monocular. There were 5 cases with right eye and 8 cases with left eye. Among 13 cases, 10 tumors were in posterior choroid, one tumor was in anterior choroid and ciliary body, 2 tumors were in the iris. There were 5 patients with lung cancer, 4 patients with breast cancer, 1 patient with prostate cancer, 1 patient with thyroid cancer and 1 patient with esophageal cancer. The primary tumor wasn't found in 1 patient. The rapid decrease of visual acuity showed in 10 patients with posterior choroidal metastatic carcinoma, 8 of them accompanied with extensive retinal detachment and 6 of them had secondary glaucoma. The multiple gray-white nodule or pink cauliflower mass on the papillary margin of iris were showed respectively in 2 patients with iris metastatic carcinoma. The pathological examination found that posterior choroidal metastatic carcinoma mainly located in temporal or nasal side choroids in 10 cases, among them, local or diffuse flat choroidal masses showed in 6cases, extensive mass involving choroid and ciliary body showed in 1 case, large nodular or globular choroidal mass showed in 2 cases, choroidal mass surrounded the optic disc in 1 case, optic nerve invasion showed in 3 cases and extraocular or orbital invasion showed in 3 cases. The scleral and subconjunctival invasion showed in 1 case of anterior choroid and ciliary body metastatic carcinoma. Conclusions: Uveal metastatic carcinoma manifested various growth pattern, the rapid decrease of visual acuity, flat or nodular choroidal solid mass, secondary retinal detachment and glaucoma were common clinical features. Some cases might invade extraocular or orbital tissue. (Chin J Ophthalmol, 2016, 52: 769-774) .

  7. Glioma cell dispersion is driven by α5 integrin-mediated cell-matrix and cell-cell interactions.

    PubMed

    Blandin, Anne-Florence; Noulet, Fanny; Renner, Guillaume; Mercier, Marie-Cécile; Choulier, Laurence; Vauchelles, Romain; Ronde, Philippe; Carreiras, Franck; Etienne-Selloum, Nelly; Vereb, Gyorgy; Lelong-Rebel, Isabelle; Martin, Sophie; Dontenwill, Monique; Lehmann, Maxime

    2016-07-01

    Glioblastoma multiform (GBM) is the most common and most aggressive primary brain tumor. The fibronectin receptor, α5 integrin is a pertinent novel therapeutic target. Despite numerous data showing that α5 integrin support tumor cell migration and invasion, it has been reported that α5 integrin can also limit cell dispersion by increasing cell-cell interaction. In this study, we showed that α5 integrin was involved in cell-cell interaction and gliomasphere formation. α5-mediated cell-cell cohesion limited cell dispersion from spheroids in fibronectin-poor microenvironment. However, in fibronectin-rich microenvironment, α5 integrin promoted cell dispersion. Ligand-occupied α5 integrin and fibronectin were distributed in fibril-like pattern at cell-cell junction of evading cells, forming cell-cell fibrillar adhesions. Activated focal adhesion kinase was not present in these adhesions but was progressively relocalized with α5 integrin as cell migrates away from the spheroids. α5 integrin function in GBM appears to be more complex than previously suspected. As GBM overexpressed fibronectin, it is most likely that in vivo, α5-mediated dissemination from the tumor mass overrides α5-mediated tumor cell cohesion. In this respect, α5-integrin antagonists may be useful to limit GBM invasion in brain parenchyma. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Application of APTES-Anti-E-cadherin film for early cancer monitoring.

    PubMed

    Ben Ismail, Manel; Carreiras, Franck; Agniel, Rémy; Mili, Donia; Sboui, Dejla; Zanina, Nahla; Othmane, Ali

    2016-10-01

    Cancer staging is a way to classify cancer according to the extent of the disease in the body. The stage is usually determined by several factors such as the location of the primary tumor, the tumor size, the degree of spread in the surrounding tissues, etc. The study of E-cadherin (EC) expression on cancerous cells of patients has revealed variations in the molecular expression patterns of primary tumors and metastatic tumors. The detection of these cells requires a long procedure involving conventional techniques, thus, the requirement for development of new rapid devices that permit direct and highly sensitive detection stimulates the sensing field progress. Here, we explore if E-cadherin could be used as a biomarker to bind and detect epithelial cancer cells. Hence, the sensitive and specific detection of E-cadherin expressed on epithelial cells is approached by immobilizing anti-E-cadherin antibody (AEC) onto aminosilanized indium-tin oxide (ITO) surface. The immunosensing surfaces have been characterized by electrochemical measurements, wettability and confocal microscopy and their performance has been assessed in the presence of cancer cell lines. Under optimal conditions, the resulting immunosensor displayed a selective detection of E-cadherin expressing cells, which could be detected either by fluorescence or electrochemical techniques. The developed immunosensing surface could provide a simple tool that can be applied to cancer staging. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Use of Sodium Fluorescein in Meningioma Surgery Performed Under the YELLOW-560 nm Surgical Microscope Filter: Feasibility and Preliminary Results.

    PubMed

    Akçakaya, Mehmet Osman; Göker, Burcu; Kasımcan, Mustafa Ömür; Hamamcıoğlu, Mustafa Kemal; Kırış, Talat

    2017-11-01

    To evaluate the feasibility of sodium fluorescein (Na-Fl)-guided surgery involving the use of the PENTERO 900 surgical microscope equipped with the YELLOW-560 nm filter and low-dose Na-FL (200 mg/2-4 mg/kg) in meningioma surgery. The study included 30 patients with newly diagnosed or recurrent meningiomas who underwent Na-Fl-guided surgery between April 2015 and December 2016. Clinical features, surgical observations, extent of resection, and tumor histopathology were retrospectively analyzed. The Na-Fl enhancement pattern was assessed as "no enhancement," "diffuse homogenous enhancement," or "low heterogeneous enhancement." There were 30 meningiomas among the 30 patients. In 25 patients, Na-Fl was used for tumor demarcation, whereas in 5 patients, it was used for videoangiography. In this series, 88% of tumors showed diffuse homogeneous Na-Fl enhancement during the operation. The resection rate of the meningiomas was 87%. In 5 patients, in whom Na-Fl was used for videoangiography, the approach was useful to evaluate Na-Fl-stained vessels for patency and to understand their relationship with the tumor. No adverse events were encountered with regard to Na-Fl use. Na-Fl guidance with the use of the YELLOW-560 filter is safe and effective during meningioma surgery. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Expression of Cat Podoplanin in Feline Squamous Cell Carcinomas.

    PubMed

    Itai, Shunsuke; Yamada, Shinji; Kaneko, Mika K; Harada, Hiroyuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2017-12-01

    Oral squamous cell carcinoma is an aggressive tumor in cats; however, molecular-targeted therapies against this tumor, including antibody therapy, have not been developed. Sensitive and specific monoclonal antibodies (mAbs) against highly expressed membrane proteins are needed to develop antibody therapies. Podoplanin, a type I transmembrane glycoprotein, is expressed in many human malignant tumors, including brain tumor, esophageal cancer, lung cancer, mesothelioma, and oral cancer. Podoplanin binds to C-type lectin-like receptor-2 (CLEC-2) and activates platelet aggregation, which is involved in cancer metastasis. Until now, we have established several mAbs against podoplanin in humans, mice, rats, rabbits, dogs, cattle, and cats. We have reported podoplanin expression in canine melanoma and squamous cell carcinomas using an anti-dog podoplanin mAb PMab-38. In this study, we investigated podoplanin expression in 40 feline squamous cell carcinomas (14 cases of mouth floor, 13 of skin, 9 of ear, and 4 of tongue) by immunohistochemical analysis using an anti-cat podoplanin mAb PMab-52, which we recently developed by cell-based immunization and screening (CBIS) method. Of the total 40 cases, 38 (95%) showed positive staining for PMab-52. In particular, 12 cases (30%) showed a strong membrane-staining pattern of squamous cell carcinoma cells. PMab-52 can be useful for antibody therapy against feline podoplanin-expressing squamous cell carcinomas.

  11. Anti-tumor immunity of BAM-SiPc-mediated vascular photodynamic therapy in a BALB/c mouse model.

    PubMed

    Yeung, Hing-Yuen; Lo, Pui-Chi; Ng, Dennis K P; Fong, Wing-Ping

    2017-02-01

    In recent decades, accumulating evidence from both animal and clinical studies has suggested that a sufficiently activated immune system may strongly augment various types of cancer treatment, including photodynamic therapy (PDT). Through the generation of reactive oxygen species, PDT eradicates tumors by triggering localized tumor damage and inducing anti-tumor immunity. As the major component of anti-tumor immunity, the involvement of a cell-mediated immune response in PDT has been well investigated in the past decade, whereas the role of humoral immunity has remained relatively unexplored. In the present investigation, using the photosensitizer BAM-SiPc and the CT26 tumor-bearing BALB/c mouse model, it was demonstrated that both cell-mediated and humoral adaptive immune components could be involved in PDT. With a vascular PDT (VPDT) regimen, BAM-SiPc could eradicate the tumors of ∼70% of tumor-bearing mice and trigger an anti-tumor immune response that could last for more than 1 year. An elevation of Th2 cytokines was detected ex vivo after VPDT, indicating the potential involvement of a humoral response. An analysis of serum from the VPDT-cured mice also revealed elevated levels of tumor-specific antibodies. Moreover, this serum could effectively hinder tumor growth and protect the mice against further re-challenge in a T-cell-dependent manner. Taken together, these results show that the humoral components induced after BAM-SiPc-VPDT could assist the development of anti-tumor immunity.

  12. A case of multicentric low-grade neuroendocrine breast tumor with an unusual histological pattern.

    PubMed

    D'Antonio, Antonio; Addesso, Maria; Memoli, Domenico; Cascone, Annamaria; Cremone, Luigi

    2016-01-01

    Neuroendocrine features are detectable in carcinomas of the breast either as scattered cells, that are recognized by their expression of neuroendocrine cell markers. Instead, pure breast carcinomas with neuroendocrine features (NEBC) are very rare and represent <1% of all breast cancer. Usually NEBC may be well or poorly differentiated and more frequent in older woman. These tumors showed variable histological pattern but a common feature is represented by expression of neuroendocrine markers. Here we report a case of a primary multicentric low-grade neuroendocrine carcinoma of the breast presented because of its rarity and for the unusual tubular and cribriform pattern resembling a well-differentiated conventional breast carcinoma. The tumor was treated with left quadrantectomy with concomitant wide excisional biopsy of other two nodules and lymph node sentinel biopsy. No recurrence was observed during 1-year follow-up. Because of its rarity and variability of morphologic features, there exist diagnostic challenges for pathologists to differentiate primary NEBC to some conventional breast carcinomas and to the breast metastasis from neuroendocrine tumor of the lung or gastrointestinal tract. It is important to be able recognize this tumor in order to avoid potential misdiagnosis and improper management of afflicted patients.

  13. Patterns of Intraosseous Recurrence After Stereotactic Body Radiation Therapy for Coxal Bone Metastasis.

    PubMed

    Ito, Kei; Shimizuguchi, Takuya; Nihei, Keiji; Furuya, Tomohisa; Ogawa, Hiroaki; Tanaka, Hiroshi; Sasai, Keisuke; Karasawa, Katsuyuki

    2018-01-01

    To analyze the detailed pattern of intraosseous failure after stereotactic body radiation therapy (SBRT) for coxal bone metastasis. Patients treated with SBRT to coxal bone metastasis were identified by retrospective chart review. The SBRT doses were 30 Gy or 35 Gy in 5 fractions. A margin of 5 to 10 mm was added to the gross tumor volume to create the clinical target volume. We evaluated the presence or absence of intraosseous recurrence using magnetic resonance imaging. Intraosseous recurrences were assessed as "in-field" or "marginal/out-of-field." In addition, we measured the distance between the center of the recurrent tumor and the nearest edge of the initial bone metastasis in cases of marginal/out-of-field recurrence. Seventeen patients treated for 17 coxal bone metastases were included. Median age was 64 years (range, 48-79 years). Coxal lesions involved the ilium in 14 cases, pubis in 3, and ischium in 4 (3 lesions crossed over multiple regions). Patients most commonly had renal cell carcinoma (29.4%), followed by lung, hepatic cell, and colorectal cancers (23.5%, 11.8%, and 11.8%, respectively). Median follow-up after SBRT was 13 months (range, 2-44 months). Among all 17 cases, 7 cases developed 8 intraosseous recurrences, including in-field recurrence in 1 case and marginal/out-of-field recurrences in 7 cases. Median time to intraosseous recurrence was 10 months (range, 2-35 months). Among 7 cases with marginal/out-of-field recurrence, mean distance to the center of the recurrent tumor from the nearest edge of the initial bone metastasis was 34 mm (range, 15-55 mm). Most recurrences were observed out-of-field in the same coxal bone. These results suggest that defining the optimal clinical target volume in SBRT for coxal bone metastasis to obtain sufficient local tumor control is difficult. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Oncogenic Signaling Pathways in The Cancer Genome Atlas.

    PubMed

    Sanchez-Vega, Francisco; Mina, Marco; Armenia, Joshua; Chatila, Walid K; Luna, Augustin; La, Konnor C; Dimitriadoy, Sofia; Liu, David L; Kantheti, Havish S; Saghafinia, Sadegh; Chakravarty, Debyani; Daian, Foysal; Gao, Qingsong; Bailey, Matthew H; Liang, Wen-Wei; Foltz, Steven M; Shmulevich, Ilya; Ding, Li; Heins, Zachary; Ochoa, Angelica; Gross, Benjamin; Gao, Jianjiong; Zhang, Hongxin; Kundra, Ritika; Kandoth, Cyriac; Bahceci, Istemi; Dervishi, Leonard; Dogrusoz, Ugur; Zhou, Wanding; Shen, Hui; Laird, Peter W; Way, Gregory P; Greene, Casey S; Liang, Han; Xiao, Yonghong; Wang, Chen; Iavarone, Antonio; Berger, Alice H; Bivona, Trever G; Lazar, Alexander J; Hammer, Gary D; Giordano, Thomas; Kwong, Lawrence N; McArthur, Grant; Huang, Chenfei; Tward, Aaron D; Frederick, Mitchell J; McCormick, Frank; Meyerson, Matthew; Van Allen, Eliezer M; Cherniack, Andrew D; Ciriello, Giovanni; Sander, Chris; Schultz, Nikolaus

    2018-04-05

    Genetic alterations in signaling pathways that control cell-cycle progression, apoptosis, and cell growth are common hallmarks of cancer, but the extent, mechanisms, and co-occurrence of alterations in these pathways differ between individual tumors and tumor types. Using mutations, copy-number changes, mRNA expression, gene fusions and DNA methylation in 9,125 tumors profiled by The Cancer Genome Atlas (TCGA), we analyzed the mechanisms and patterns of somatic alterations in ten canonical pathways: cell cycle, Hippo, Myc, Notch, Nrf2, PI-3-Kinase/Akt, RTK-RAS, TGFβ signaling, p53 and β-catenin/Wnt. We charted the detailed landscape of pathway alterations in 33 cancer types, stratified into 64 subtypes, and identified patterns of co-occurrence and mutual exclusivity. Eighty-nine percent of tumors had at least one driver alteration in these pathways, and 57% percent of tumors had at least one alteration potentially targetable by currently available drugs. Thirty percent of tumors had multiple targetable alterations, indicating opportunities for combination therapy. Copyright © 2018. Published by Elsevier Inc.

  15. An interesting case of angiogenesis in cavernous hemangioma.

    PubMed

    Das, Dipankar; Bhattacharjee, Kasturi; Deka, Panna; Bhattacharjee, Harsha; Misra, Diva Kant; Koul, Akanksha; Kapoor, Deepika; Deka, Apurba

    2016-10-01

    Cavernous hemangioma is the most common orbital tumor in adult. There is lot of literatures for clinicopathological features of this tumor. These tumors had been studied for the model of angiogenesis in many of the experimental setups. We present a case of 34-year-old male with this tumor in the left eye with computerized tomography evidence. Postsurgical laboratory findings gave interesting evidence of tumor angiogenesis with tumor endothelial cells and sprouting of the small vessels endothelial cells. Podosome rosette could be conceptualized from the characteristic patterns seen in the tumor.

  16. Methylation alterations are not a major cause of PTTG1 misregulation.

    PubMed

    Hidalgo, Manuel; Galan, Jose Jorge; Sáez, Carmen; Ferrero, Eduardo; Castilla, Carolina; Ramirez-Lorca, Reposo; Pelaez, Pablo; Ruiz, Agustin; Japón, Miguel A; Royo, Jose Luis

    2008-04-21

    On its physiological cellular context, PTTG1 controls sister chromatid segregation during mitosis. Within its crosstalk to the cellular arrest machinery, relies a checkpoint of integrity for which gained the over name of securin. PTTG1 was found to promote malignant transformation in 3T3 fibroblasts, and further found to be overexpressed in different tumor types. More recently, PTTG1 has been also related to different processes such as DNA repair and found to trans-activate different cellular pathways involving c-myc, bax or p53, among others. PTTG1 over-expression has been correlated to a worse prognosis in thyroid, lung, colorectal cancer patients, and it can not be excluded that this effect may also occur in other tumor types. Despite the clinical relevance and the increasing molecular characterization of PTTG1, the reason for its up-regulation remains unclear. We analysed PTTG1 differential expression in PC-3, DU-145 and LNCaP tumor cell lines, cultured in the presence of the methyl-transferase inhibitor 5-Aza-2'-deoxycytidine. We also tested whether the CpG island mapping PTTG1 proximal promoter evidenced a differential methylation pattern in differentiated thyroid cancer biopsies concordant to their PTTG1 immunohistochemistry status. Finally, we performed whole-genome LOH studies using Affymetix 50 K microarray technology and FRET analysis to search for allelic imbalances comprising the PTTG1 locus. Our data suggest that neither methylation alterations nor LOH are involved in PTTG1 over-expression. These data, together with those previously reported, point towards a post-transcriptional level of misregulation associated to PTTG1 over-expression.

  17. Revising the embryonic origin of thyroid C cells in mice and humans

    PubMed Central

    Johansson, Ellen; Andersson, Louise; Örnros, Jessica; Carlsson, Therese; Ingeson-Carlsson, Camilla; Liang, Shawn; Dahlberg, Jakob; Jansson, Svante; Parrillo, Luca; Zoppoli, Pietro; Barila, Guillermo O.; Altschuler, Daniel L.; Padula, Daniela; Lickert, Heiko; Fagman, Henrik; Nilsson, Mikael

    2015-01-01

    Current understanding infers a neural crest origin of thyroid C cells, the major source of calcitonin in mammals and ancestors to neuroendocrine thyroid tumors. The concept is primarily based on investigations in quail–chick chimeras involving fate mapping of neural crest cells to the ultimobranchial glands that regulate Ca2+ homeostasis in birds, reptiles, amphibians and fishes, but whether mammalian C cell development involves a homologous ontogenetic trajectory has not been experimentally verified. With lineage tracing, we now provide direct evidence that Sox17+ anterior endoderm is the only source of differentiated C cells and their progenitors in mice. Like many gut endoderm derivatives, embryonic C cells were found to coexpress pioneer factors forkhead box (Fox) a1 and Foxa2 before neuroendocrine differentiation takes place. In the ultimobranchial body epithelium emerging from pharyngeal pouch endoderm in early organogenesis, differential Foxa1/Foxa2 expression distinguished two spatially separated pools of C cell precursors with different growth properties. A similar expression pattern was recapitulated in medullary thyroid carcinoma cells in vivo, consistent with a growth-promoting role of Foxa1. In contrast to embryonic precursor cells, C cell-derived tumor cells invading the stromal compartment downregulated Foxa2, foregoing epithelial-to-mesenchymal transition designated by loss of E-cadherin; both Foxa2 and E-cadherin were re-expressed at metastatic sites. These findings revise mammalian C cell ontogeny, expand the neuroendocrine repertoire of endoderm and redefine the boundaries of neural crest diversification. The data further underpin distinct functions of Foxa1 and Foxa2 in both embryonic and tumor development. PMID:26395490

  18. Two-Dimensional Raman Correlation Analysis of Diseased Esophagus in a Rat

    NASA Astrophysics Data System (ADS)

    Takanezawa, Sota; Morita, Shin-ichi; Maruyama, Atsushi; Murakami, Takurou N.; Kawashima, Norimichi; Endo, Hiroyuki; Iijima, Katsunori; Asakura, Tohru; Shimosegawa, Tooru; Sato, Hidetoshi

    2010-07-01

    Generalized two-dimensional (2D) Raman correlation analysis effectively distinguished a benign tumor from normal tissue. Line profiling Raman spectra of a rat esophagus, including a benign tumor, were measured and the generalized 2D synchronous and asynchronous spectra were calculated. In the autocorrelation area of the amide I band of proteins in the asynchronous map, a cross-like pattern was observed. A simulation study indicated that the pattern was caused by a sharp band component in the amide I band region. We considered that the benign tumor corresponded to the sharp component.

  19. MECHANISMS INVOLVED IN TRICHLOROETHYLENE INDUCED LIVER CANCER: IMPORTANCE TO ENVIRONMENTAL CLEANUP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bull, Richard J.; Thrall, Brain D.

    2001-12-31

    Trichloroethylene (TCE) is a common contaminant of groundwater as a result of poor disposal practices of the past. As a consequence, this solvent is the focus of many clean-up operations of uncontrolled hazardous waste sites. TCE is carcinogenic in both mice and rats, but at different sites, the liver and kidney, respectively (NCI 1976; NTP 1988; NTP 1990). Liver tumor induction in mice has been the tumor most critical from the standpoint of environmental regulation (Bull 2000). Under the proposed cancer risk guidelines of the Environmental Protection Agency (EPA 1996), identifying the dose-response behavior of key events involved in carcinogenicmore » responses can be used for developing alternative risk assessments. A major difficulty in developing alternative approaches for TCE is the fact that three of its metabolites are capable of inducing liver cancer in mice (Bull et al. 1990; Daniel et al. 1992; DeAngelo et al. 1999; Pereria 1996). Two of these metabolites have distinct modes of action, dichloroacetate (DCA) and trichloroacetate (TCA). The third metabolite, chloral hydrate, is probably active as a result of its conversion to one or both of these two metabolites. Ordinarily, the first approach to assigning causality to a metabolite in tumorigenesis would be an attempt to measure its concentration in the body and associate that with tumorigenic concentrations observed when the compound is itself administered. This can be done with relative ease with TCA. However, it has been more difficult with DCA since blood levels of this metabolite after exposure to carcinogenic doses of DCA fall rapidly below detection limits (Kato-Weinstein et al. 1998; Merdink et al. 1998). Mutations in the ras protooncogene have been used to determine if distinct patterns of DNAsequence alterations can provide indications of the type of DNA damage that might be produced by carcinogens. The presence of ras mutations in chemically-induced tumors was suggested as a means o f determining whether a chemical was genotoxic (Wiseman et al. 1986). However, the 7 discovery that spontaneous tumors also contain this oncogene indicated that this assumption may not be correct (Fox and Watanabe 1985). Several non-genotoxic carcinogens have been shown to produce tumors with a H-ras mutation frequency considerably below those that result spontaneously (Maronpot et al. 1995). Among these chemicals are a class called peroxisome proliferators, of which TCA and TCE are members. DCA and TCE were found to induce tumors with similar H-ras mutation spectra (Anna et al. 1994), whereas only limited data have been available on TCA (Fereira-Gonzalez et al. 1995). Thus, a major focus of this research was to evaluate whether the pattern and frequency of H-ras mutations in TCE-induced tumors could be explained by the same parameters in tumors induced by the metabolites TCA or DCA. The present project was organized around three interrelated objectives: The first objective addressed the pharmacokinetic questions regarding the formation and elimination of DCA and TCA in mice administered TCE and whether levels of these metabolites may account for the tumors induced by TCE. The second objective was to investigate potential molecular mechanisms by which TCA and DCA may, in the absence of directly causing mutations, promote the clonal growth and expansion of precancerous cell populations within mouse liver. The third objective was to investigate whether the genotype of tumors induced by TCA and DCA can be used to establish the relative roles of these metabolites in TCE-induced cancer. In particular, the focus of the latter studies was to compare the incidence and spectra of mutations in the H-ras gene (codon 61) to determine if the reported similarities in the genotype of DCA- and TCE-induced tumors have a causal relationship.« less

  20. Altered levels of acid, basic, and neutral peptidase activity and expression in human clear cell renal cell carcinoma.

    PubMed

    Varona, Adolfo; Blanco, Lorena; López, José I; Gil, Javier; Agirregoitia, Ekaitz; Irazusta, Jon; Larrinaga, Gorka

    2007-02-01

    Peptides play important roles in cell regulation and signaling in many tissues and are regulated by peptidases, most of which are highly expressed in the kidney. Several peptide convertases have a function in different tumor stages, and some have been clearly characterized as diagnostic and prognostic markers for solid tumors, including renal cancer; however, little is known about their in vivo role in kidney tumors. The present study compares the activity of a range of peptidases in human tumor samples and nontumor tissue obtained from clear cell renal cell carcinoma (CCRCC) patients. To cover the complete spectrum and subcellular distribution of peptide-converting activity, acid, neutral, basic, and omega activities were selected. CCRCC displays a selective and restricted pattern of peptidase activities. Puromycin-sensitive aminopeptidase activity in the tumor increases [tumor (t) = 10,775 vs. nontumor (n) = 7,635 units of peptidase (UP)/mg protein; P < 0.05], whereas aminopeptidase N decreases (t = 6,664 vs. n = 33,381 UP/mg protein; P < 0.001). Aminopeptidase B activity of the particulate fraction in tumors decreases (t = 2,399 vs. n = 13,536 UP/mg protein; P < 0.001) compared with nontumor tissues, and aspartyl-aminopeptidase activity decreases significantly in CCRCC (t = 137 vs. n = 223 UP/mg protein; P < 0.05). Soluble and particulate pyroglutamyl peptidase I activities, aminopeptidase A activity, and soluble aminopeptidase B activity do not vary in renal cancer. The relative expression for the aforementioned peptidases, assayed using quantitative RT-PCR, increases in CCRCC for aminopeptidases B (1.5-fold) and A (19-fold), aspartyl-aminopeptidase (3.9-fold), puromycin-sensitive aminopeptidase (2.5-fold), and pyroglutamyl peptidase I (7.6-fold). Only aminopeptidase N expression decreases in tumors (1.3-fold). This peptidase activity profile in the neoplastic kidney suggests a specific role for the studied convertases and the possible involvement of an intracrine renin-angiotensin system in the pathogenesis of CCRCC.

  1. Genomic analysis and selected molecular pathways in rare cancers

    NASA Astrophysics Data System (ADS)

    Liu, Stephen V.; Lenkiewicz, Elizabeth; Evers, Lisa; Holley, Tara; Kiefer, Jeffrey; Ruiz, Christian; Glatz, Katharina; Bubendorf, Lukas; Demeure, Michael J.; Eng, Cathy; Ramanathan, Ramesh K.; Von Hoff, Daniel D.; Barrett, Michael T.

    2012-12-01

    It is widely accepted that many cancers arise as a result of an acquired genomic instability and the subsequent evolution of tumor cells with variable patterns of selected and background aberrations. The presence and behaviors of distinct neoplastic cell populations within a patient's tumor may underlie multiple clinical phenotypes in cancers. A goal of many current cancer genome studies is the identification of recurring selected driver events that can be advanced for the development of personalized therapies. Unfortunately, in the majority of rare tumors, this type of analysis can be particularly challenging. Large series of specimens for analysis are simply not available, allowing recurring patterns to remain hidden. In this paper, we highlight the use of DNA content-based flow sorting to identify and isolate DNA-diploid and DNA-aneuploid populations from tumor biopsies as a strategy to comprehensively study the genomic composition and behaviors of individual cancers in a series of rare solid tumors: intrahepatic cholangiocarcinoma, anal carcinoma, adrenal leiomyosarcoma, and pancreatic neuroendocrine tumors. We propose that the identification of highly selected genomic events in distinct tumor populations within each tumor can identify candidate driver events that can facilitate the development of novel, personalized treatment strategies for patients with cancer.

  2. Genomic analysis and selected molecular pathways in rare cancers.

    PubMed

    Liu, Stephen V; Lenkiewicz, Elizabeth; Evers, Lisa; Holley, Tara; Kiefer, Jeffrey; Ruiz, Christian; Glatz, Katharina; Bubendorf, Lukas; Demeure, Michael J; Eng, Cathy; Ramanathan, Ramesh K; Von Hoff, Daniel D; Barrett, Michael T

    2012-12-01

    It is widely accepted that many cancers arise as a result of an acquired genomic instability and the subsequent evolution of tumor cells with variable patterns of selected and background aberrations. The presence and behaviors of distinct neoplastic cell populations within a patient's tumor may underlie multiple clinical phenotypes in cancers. A goal of many current cancer genome studies is the identification of recurring selected driver events that can be advanced for the development of personalized therapies. Unfortunately, in the majority of rare tumors, this type of analysis can be particularly challenging. Large series of specimens for analysis are simply not available, allowing recurring patterns to remain hidden. In this paper, we highlight the use of DNA content-based flow sorting to identify and isolate DNA-diploid and DNA-aneuploid populations from tumor biopsies as a strategy to comprehensively study the genomic composition and behaviors of individual cancers in a series of rare solid tumors: intrahepatic cholangiocarcinoma, anal carcinoma, adrenal leiomyosarcoma, and pancreatic neuroendocrine tumors. We propose that the identification of highly selected genomic events in distinct tumor populations within each tumor can identify candidate driver events that can facilitate the development of novel, personalized treatment strategies for patients with cancer.

  3. Lipoteichoic acid (LTA) and lipopolysaccharides (LPS) from periodontal pathogenic bacteria facilitate oncogenic herpesvirus infection within primary oral cells.

    PubMed

    Dai, Lu; DeFee, Michael R; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C; Qin, Zhiqiang

    2014-01-01

    Kaposi's sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria-lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients.

  4. Lipoteichoic Acid (LTA) and Lipopolysaccharides (LPS) from Periodontal Pathogenic Bacteria Facilitate Oncogenic Herpesvirus Infection within Primary Oral Cells

    PubMed Central

    Dai, Lu; DeFee, Michael R.; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C.; Qin, Zhiqiang

    2014-01-01

    Kaposi’s sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria–lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients. PMID:24971655

  5. Immunoglobulin class switching to IgG4 in Warthin tumor and analysis of serum IgG4 levels and IgG4-positive plasma cells in the tumor.

    PubMed

    Aga, Mitsuharu; Kondo, Satoru; Yamada, Kazunori; Wakisaka, Naohiro; Yagi-Nakanishi, Sayaka; Tsuji, Akira; Endo, Kazuhira; Murono, Shigeyuki; Ito, Makoto; Muramatsu, Masamichi; Kawano, Mitsuhiro; Yoshizaki, Tomokazu

    2014-04-01

    We previously reported a case of immunoglobulin (Ig)G4-related immune inflammation in Warthin tumor. Increased serum IgG4 levels and tissue infiltration of IgG4-positive plasma cells are characteristics of IgG4-related disease (IgG4-RD), a newly emerging clinicopathological entity. However, the relationship between IgG4-RD and Warthin tumor remains to be elucidated. We aimed to investigate the involvement of systemic and local IgG4 production and class-switch recombination in Warthin tumor. We examined serum IgG4 levels and also analyzed the involvement of IgG4-positive plasma cells in Warthin tumors (18 cases) compared with those of pleomorphic adenomas (19 cases) as controls. Furthermore, in specimens of Warthin tumors (3 cases), pleomorphic adenomas (2 cases), and IgG4-RDs (2 cases), we examined messenger RNA expression of activation-induced cytidine deaminase, IgG4 germline transcripts and productive IgG4 by reverse transcription polymerase chain reaction. Serum IgG4 levels were increased in 5 of 18 Warthin tumors and not in any of the 19 pleomorphic adenomas. Infiltration of IgG4-positive plasma cells was detected in 4 Warthin tumors and none in the pleomorphic adenomas. Moreover, activation-induced cytidine deaminase, IgG4 germline transcripts, and productive IgG4 messenger RNA were found to be expressed in 2 of 3 Warthin tumors as well as IgG4-RDs by reverse transcription polymerase chain reaction, but not in pleomorphic adenomas. In conclusion, immunoglobulin class switching to IgG4 may be involved in the pathogenesis of Warthin tumor, and it is possible that certain inflammatory background with an immune reaction is involved in the pathogenesis of Warthin tumor. © 2013.

  6. The involvement of heparan sulfate proteoglycans in stem cell differentiation and in malignant glioma

    NASA Astrophysics Data System (ADS)

    Kundu, Soumi; Xiong, Anqi; Forsberg-Nilsson, Karin

    2016-04-01

    Heparan sulfate (HS) proteoglycans (HSPG) are major components of the extracellular matrix. They interact with a plethora of macromolecules that are of physiological importance. The pattern of sulfation of the HS chain determines the specificity of these interactions. The enzymes that synthesize and degrade HS are thus key regulators of processes ranging from embryonic development to tissue homeostasis and tumor development. Formation of the nervous system is also critically dependent on appropriate HSPGs as shown by several studies on the role of HS in neural induction from embryonic stem cells. High-grade glioma is the most common primary malignant brain tumor among adults, and the prognosis is poor. Neural and glioma stem cells share several traits, including sustained proliferation and highly efficient migration in the brain. There are also similarities between the neurogenic niche where adult neural stem cells reside and the tumorigenic niche, including their interactions with components of the extracellular matrix (ECM). The levels of many of these components, for example HSPGs and enzymes involved in the biosynthesis and modification of HS are attenuated in gliomas. In this paper, HS regulation of pathways involved in neural differentiation and how these may be of importance for brain development are discussed. The literature suggesting that modifications of HS could regulate glioma growth and invasion is reviewed. Targeting the invasiveness of glioma cells by modulating HS may improve upon present therapeutic options, which only marginally enhance the survival of glioma patients.

  7. Cytoreduction of diaphragmatic metastasis from ovarian cancer with involvement of the liver using a ventral liver mobilization technique.

    PubMed

    Kato, Kazuyoshi; Katsuda, Takahiro; Takeshima, Nobuhiro

    2016-03-01

    Upper abdominal spreading of advanced-stage ovarian cancer often involves the diaphragm. In addition, bulky diaphragmatic tumors occasionally infiltrate the liver. Here, we describe our early experiences with a ventral liver mobilization technique to remove diaphragmatic tumors with liver involvement. Two patients with primary ovarian cancer and 1 patient with recurrent ovarian cancer underwent en bloc resections of a diaphragmatic tumor together with the full-thickness diaphragm and the liver tissue using a ventral liver mobilization technique. The surgical technique involved a full-thickness division of the diaphragm at the central tendon and a ventral mobilization of the right lobe of the liver, with entry into the pleural cavity. During the parenchymal transection of the liver, the posterior area of the right lobe of the liver was pressed using the surgeon's hand to reduce bleeding from the resection surface. After the completion of the en bloc resection, the diaphragmatic opening was closed using running sutures. All the diaphragmatic tumors were completely removed without severe bleeding in the current series. No intraoperative or postoperative complications occurred. Diaphragmatic tumors with involvement of the liver can be safely and effectively removed using a ventral liver mobilization technique. This surgical procedure may be suitable for the management of bulky diaphragmatic tumors in select patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Alterations in gene expression of proprotein convertases in human lung cancer have a limited number of scenarios.

    PubMed

    Demidyuk, Ilya V; Shubin, Andrey V; Gasanov, Eugene V; Kurinov, Alexander M; Demkin, Vladimir V; Vinogradova, Tatyana V; Zinovyeva, Marina V; Sass, Alexander V; Zborovskaya, Irina B; Kostrov, Sergey V

    2013-01-01

    Proprotein convertases (PCs) is a protein family which includes nine highly specific subtilisin-like serine endopeptidases in mammals. The system of PCs is involved in carcinogenesis and levels of PC mRNAs alter in cancer, which suggests expression status of PCs as a possible marker for cancer typing and prognosis. The goal of this work was to assess the information value of expression profiling of PC genes. Quantitative polymerase chain reaction was used for the first time to analyze mRNA levels of all PC genes as well as matrix metalloproteinase genes MMP2 and MMP14, which are substrates of PCs, in 30 matched pairs of samples of human lung cancer tumor and adjacent tissues without pathology. Significant changes in the expression of PCs have been revealed in tumor tissues: increased FURIN mRNA level (p<0.00005) and decreased mRNA levels of PCSK2 (p<0.007), PCSK5 (p<0.0002), PCSK7 (p<0.002), PCSK9 (p<0.00008), and MBTPS1 (p<0.00004) as well as a tendency to increase in the level of PCSK1 mRNA. Four distinct groups of samples have been identified by cluster analysis of the expression patterns of PC genes in tumor vs. normal tissue. Three of these groups covering 80% of samples feature a strong elevation in the expression of a single gene in cancer: FURIN, PCSK1, or PCSK6. Thus, the changes in the expression of PC genes have a limited number of scenarios, which may reflect different pathways of tumor development and cryptic features of tumors. This finding allows to consider the mRNAs of PC genes as potentially important tumor markers.

  9. Visualization of tumor blockage and rerouting of lymphatic drainage in penile cancer patients by use of SPECT/CT.

    PubMed

    Leijte, Joost A P; van der Ploeg, Iris M C; Valdés Olmos, Renato A; Nieweg, Omgo E; Horenblas, Simon

    2009-03-01

    The reliability of sentinel node biopsy is dependent on the accurate visualization and identification of the sentinel node(s). It has been suggested that extensive metastatic involvement of a sentinel node can lead to blocked inflow and rerouting of lymph fluid to a "neo-sentinel node" that may not yet contain tumor cells, causing a false-negative result. However, there is little evidence to support this hypothesis. Recently introduced hybrid SPECT/CT scanners provide both tomographic lymphoscintigraphy and anatomic detail. Such a scanner enabled the present study of the concept of tumor blockage and rerouting of lymphatic drainage in patients with palpable groin metastases. Seventeen patients with unilateral palpable and cytologically proven metastases in the groin underwent bilateral conventional lymphoscintigraphy and SPECT/CT before sentinel node biopsy of the contralateral groin. The pattern of lymphatic drainage in the 17 palpable groin metastases was evaluated for signs of tumor blockage or rerouting. On the CT images, the palpable node metastases could be identified in all 17 groins. Four of the 17 palpable node metastases (24%) showed uptake of radioactivity on the SPECT/CT images. In 10 groins, rerouting of lymphatic drainage to a neo-sentinel node was seen; one neo-sentinel node was located in the contralateral groin. A complete absence of lymphatic drainage was seen in the remaining 3 groins. The concept of tumor blockage and rerouting was visualized in 76% of the groins with palpable metastases. Precise physical examination and preoperative ultrasound with fine-needle aspiration cytology may identify nodes with considerable tumor invasion at an earlier stage and thereby reduce the incidence of false-negative results.

  10. Numerical Modeling of Interstitial Fluid Flow Coupled with Blood Flow through a Remodeled Solid Tumor Microvascular Network

    PubMed Central

    Soltani, M.; Chen, P.

    2013-01-01

    Modeling of interstitial fluid flow involves processes such as fluid diffusion, convective transport in extracellular matrix, and extravasation from blood vessels. To date, majority of microvascular flow modeling has been done at different levels and scales mostly on simple tumor shapes with their capillaries. However, with our proposed numerical model, more complex and realistic tumor shapes and capillary networks can be studied. Both blood flow through a capillary network, which is induced by a solid tumor, and fluid flow in tumor’s surrounding tissue are formulated. First, governing equations of angiogenesis are implemented to specify the different domains for the network and interstitium. Then, governing equations for flow modeling are introduced for different domains. The conservation laws for mass and momentum (including continuity equation, Darcy’s law for tissue, and simplified Navier–Stokes equation for blood flow through capillaries) are used for simulating interstitial and intravascular flows and Starling’s law is used for closing this system of equations and coupling the intravascular and extravascular flows. This is the first study of flow modeling in solid tumors to naturalistically couple intravascular and extravascular flow through a network. This network is generated by sprouting angiogenesis and consisting of one parent vessel connected to the network while taking into account the non-continuous behavior of blood, adaptability of capillary diameter to hemodynamics and metabolic stimuli, non-Newtonian blood flow, and phase separation of blood flow in capillary bifurcation. The incorporation of the outlined components beyond the previous models provides a more realistic prediction of interstitial fluid flow pattern in solid tumors and surrounding tissues. Results predict higher interstitial pressure, almost two times, for realistic model compared to the simplified model. PMID:23840579

  11. Induction of apoptosis by [6]-gingerol associated with the modulation of p53 and involvement of mitochondrial signaling pathway in B[a]P-induced mouse skin tumorigenesis.

    PubMed

    Nigam, Nidhi; George, Jasmine; Srivastava, Smita; Roy, Preeti; Bhui, Kulpreet; Singh, Madhulika; Shukla, Yogeshwer

    2010-03-01

    To unravel the molecular mechanisms underlying the chemopreventive potential of [6]-gingerol, a pungent ingredient of ginger rhizome (Zingiber officinale Roscoe, Zingiberaceae), against benzo[a]pyrene (B[a]P)-induced mouse skin tumorigenesis. Topical treatment of [6]-gingerol (2.5 muM/animal) was given to the animals 30 min prior and post to B[a]P (5 mug/animal) for 32 weeks. At the end of the study period, the skin tumors/tissues were dissected out and examined histopathologically. Flow cytometry was employed for cell cycle analysis. Further immunohistochemical localization of p53 and regulation of related apoptogenic proteins were determined by Western blotting. Chemopreventive properties of [6]-gingerol were reflected by delay in onset of tumorigenesis, reduced cumulative number of tumors, and reduction in tumor volume. Cell cycle analysis revealed that the appearance of sub-G1 peak was significantly elevated in [6]-gingerol treated animals with post treatment showing higher efficacy in preventing tumorigenesis induced by B[a]P. Moreover, elevated apoptotic propensity was observed in tumor tissues than the corresponding non-tumor tissues. Western blot analysis also showed the same pattern of chemoprevention with [6]-gingerol treatment increasing the B[a]P suppressed p53 levels, also evident by immunohistochemistry, and Bax while decreasing the expression of Bcl-2 and Survivin. Further, [6]-gingerol treatment resulted in release of Cytochrome c, Caspases activation, increase in apoptotic protease-activating factor-1 (Apaf-1) as mechanism of apoptosis induction. On the basis of the results we conclude that [6]-gingerol possesses apoptotic potential in mouse skin tumors as mechanism of chemoprevention hence deserves further investigation.

  12. Tissue Damage, Temperature, and pH Induced by Different Electrode Arrays on Potato Pieces (Solanum tuberosum L.)

    PubMed Central

    González, Maraelys Morales; Aguilar, Claudia Hernández; Pacheco, Flavio Arturo Domínguez; Cabrales, Luis Enrique Bergues; Reyes, Juan Bory; Nava, Juan José Godina; Ambrosio, Paulo Eduardo; Domiguez, Dany Sanchez; Sierra González, Victoriano Gustavo; Pupo, Ana Elisa Bergues; Ciria, Héctor Manuel Camué; Alemán, Elizabeth Issac; García, Francisco Monier; Rivas, Clara Berenguer; Reina, Evelyn Chacón

    2018-01-01

    One of the most challenging problems of electrochemical therapy is the design and selection of suitable electrode array for cancer. The aim is to determine how two-dimensional spatial patterns of tissue damage, temperature, and pH induced in pieces of potato (Solanum tuberosum L., var. Mondial) depend on electrode array with circular, elliptical, parabolic, and hyperbolic shape. The results show the similarity between the shapes of spatial patterns of tissue damage and electric field intensity, which, like temperature and pH take the same shape of electrode array. The adequate selection of suitable electrodes array requires an integrated analysis that involves, in a unified way, relevant information about the electrochemical process, which is essential to perform more efficiently way the therapeutic planning and the personalized therapy for patients with a cancerous tumor. PMID:29725584

  13. Remote intracranial recurrence of IDH mutant gliomas is associated with TP53 mutations and an 8q gain

    PubMed Central

    Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi

    2017-01-01

    Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679

  14. Craniopharyngioma: a roadmap for scientific translation.

    PubMed

    Gupta, Saksham; Bi, Wenya Linda; Giantini Larsen, Alexandra; Al-Abdulmohsen, Sally; Abedalthagafi, Malak; Dunn, Ian F

    2018-06-01

    OBJECTIVE Craniopharyngiomas are among the most challenging of intracranial tumors to manage because of their pattern of growth, associated morbidities, and high recurrence rate. Complete resection on initial encounter can be curative, but it may be impeded by the risks posed by the involved neurovascular structures. Recurrent craniopharyngiomas, in turn, are frequently refractory to additional surgery and adjuvant radiation or chemotherapy. METHODS The authors conducted a review of primary literature. RESULTS Recent advances in the understanding of craniopharyngioma biology have illuminated potential oncogenic targets for pharmacotherapy. Specifically, distinct molecular profiles define two histological subtypes of craniopharyngioma: adamantinomatous and papillary. The discovery of overactive B-Raf signaling in the adult papillary subtype has led to reports of targeted inhibitors, with a growing acceptance for refractory cases. An expanding knowledge of the biological underpinnings of craniopharyngioma will continue to drive development of targeted therapies and immunotherapies that are personalized to the molecular signature of each individual tumor. CONCLUSIONS The rapid translation of genomic findings to medical therapies for recurrent craniopharyngiomas serves as a roadmap for other challenging neurooncological diseases.

  15. Long non-coding RNA gastric carcinoma highly expressed transcript 1 promotes cell proliferation and invasion in human head and neck cancer.

    PubMed

    Liu, Hui; Wu, Yu

    2018-05-01

    Recent evidence indicates that the long non-coding RNA gastric carcinoma highly expressed transcript 1 (GHET1) is involved in the development and carcinogenesis of several tumor types; however, the exact roles of GHET1 and its underlying mechanisms in head and neck cancer (HNC) remain largely unknown. In the present study, the expression patterns of GHET1 in HNC were determined and its clinical significance was assessed. The expression level of GHET1 was significantly increased in HNC tissues, compared with paired adjacent normal tissues. High GHET1 expression was significantly associated with advanced Tumor-Node-Metastasis stages and poor prognosis. Furthermore, inhibition of GHET1 suppressed cell proliferation, induced cell apoptosis and caused cell cycle arrest in vitro . In addition, GHET1 silencing inhibited cell migration and invasion. Taken together, the results of the present study indicated that GHET1 acts as an oncogene in HNC and may represent a novel therapeutic target.

  16. Clonal evolution through loss of chromosomes and subsequent polyploidization in chondrosarcoma.

    PubMed

    Olsson, Linda; Paulsson, Kajsa; Bovée, Judith V M G; Nord, Karolin H

    2011-01-01

    Near-haploid chromosome numbers have been found in less than 1% of cytogenetically reported tumors, but seem to be more common in certain neoplasms including the malignant cartilage-producing tumor chondrosarcoma. By a literature survey of published karyotypes from chondrosarcomas we could confirm that loss of chromosomes resulting in hyperhaploid-hypodiploid cells is common and that these cells may polyploidize. Sixteen chondrosarcomas were investigated by single nucleotide polymorphism (SNP) array and the majority displayed SNP patterns indicative of a hyperhaploid-hypodiploid origin, with or without subsequent polyploidization. Except for chromosomes 5, 7, 19, 20 and 21, autosomal loss of heterozygosity was commonly found, resulting from chromosome loss and subsequent duplication of monosomic chromosomes giving rise to uniparental disomy. Additional gains, losses and rearrangements of genetic material, and even repeated rounds of polyploidization, may affect chondrosarcoma cells resulting in highly complex karyotypes. Loss of chromosomes and subsequent polyploidization was not restricted to a particular chondrosarcoma subtype and, although commonly found in chondrosarcoma, binucleated cells did not seem to be involved in these events.

  17. Dissecting dysfunctional crosstalk pathways regulated by miRNAs during glioma progression

    PubMed Central

    Li, Feng; Li, Xiang; Feng, Li; Shi, Xinrui; Wang, Lihua; Li, Xia

    2016-01-01

    Glioma is a malignant nervous system tumor with a high fatality rate and poor prognosis. MicroRNAs (miRNAs) are important post-transcriptional modulators of glioma initiation and progression. Tumor progression often results from dysfunctional co-operation between pathways regulated by miRNAs. We therefore constructed a glioma progression-related miRNA-pathway crosstalk network that not only revealed some key miRNA-pathway patterns, but also helped characterize the functional roles of miRNAs during glioma progression. Our data indicate that crosstalk between cell cycle and p53 pathways is associated with grade II to grade III progression, while cell communications-related pathways involving regulation of actin cytoskeleton and adherens junctions are associated with grade IV glioblastoma progression. Furthermore, miRNAs and their crosstalk pathways may be useful for stratifying glioma and glioblastoma patients into groups with short or long survival times. Our data indicate that a combination of miRNA and pathway crosstalk information can be used for survival prediction. PMID:27013589

  18. Brucella melitensis infection within warthin tumor of the parotid gland.

    PubMed

    Horasan, Elif Sahin; Vaysoğlu, Yusuf; Unal, Murat; Uğuz, Mustafa; Kaya, Ali

    2011-09-01

    Brucellosis is a zoonotic systemic infectious disease, and multiorgan involvement is commonly seen, but involvement of the neck is a rare presentation of brucellosis. Granulomatous infections of the parotid gland are extremely rare. Warthin tumor is a well-known benign neoplasm of the salivary glands. In this report, we describe a Warthin tumor associated with Brucella melitensis in the same parotid gland.

  19. Metformin reduces the Walker-256 tumor development in obese-MSG rats via AMPK and FOXO3a.

    PubMed

    de Queiroz, Eveline A I F; Akamine, Eliana H; de Carvalho, Maria Helena C; Sampaio, Sandra C; Fortes, Zuleica B

    2015-01-15

    Studies have associated obesity with a wide variety of cancers. Metformin, an anti-diabetic drug, has recently received attention as a potentially useful therapeutic agent for treating cancer. Therefore, the objective of this study was to analyze the mechanisms involved in the increase in tumor development and the reduction of it by metformin in obesity using an experimental breast tumor model. Newborn male Wistar rats were subcutaneously injected with 400mg/kg monosodium glutamate (MSG) (obese) or saline (control) at 2, 3, 4, 5 and 6 days of age. After 16 weeks, 1 × 10(7) Walker-256 tumor cells were subcutaneously injected in the right flank of the rats and concomitantly the treatment with metformin 300 mg/kg/15 days, via gavage, started. The rats were divided into 4 groups: control tumor (CT), control tumor metformin (CTM), obese-MSG tumor (OT) and obese-MSG tumor metformin (OTM). On the 18th week the tumor development and metformin effect were analyzed. Tumor development was higher in OT rats compared with CT rats. Activation of insulin-IR-ERK1/2 pathway and an anti-apoptotic effect might be the mechanisms involved in the higher development of tumor in obesity. The effect of metformin reducing the tumor development in obese rats might involve increased mRNA expression of pRb and p27, increased activity of AMPK and FOXO3a and decreased expression of p-ERK1/2 (Thr202/Tyr204) in Walker-256 tumor. Our data allow us to suggest that metformin, reducing the stimulatory effect of obesity on tumor development, has a potential role in the management of cancers. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Engineered three-dimensional microfluidic device for interrogating cell-cell interactions in the tumor microenvironment.

    PubMed

    Hockemeyer, K; Janetopoulos, C; Terekhov, A; Hofmeister, W; Vilgelm, A; Costa, Lino; Wikswo, J P; Richmond, A

    2014-07-01

    Stromal cells in the tumor microenvironment play a key role in the metastatic properties of a tumor. It is recognized that cancer-associated fibroblasts (CAFs) and endothelial cells secrete factors capable of influencing tumor cell migration into the blood or lymphatic vessels. We developed a microfluidic device that can be used to image the interactions between stromal cells and tumor cell spheroids in a three dimensional (3D) microenvironment while enabling external control of interstitial flow at an interface, which supports endothelial cells. The apparatus couples a 200-μm channel with a semicircular well to mimic the interface of a blood vessel with the stroma, and the design allows for visualization of the interactions of interstitial flow, endothelial cells, leukocytes, and fibroblasts with the tumor cells. We observed that normal tissue-associated fibroblasts (NAFs) contribute to the "single file" pattern of migration of tumor cells from the spheroid in the 3D microenvironment. In contrast, CAFs induce a rapid dispersion of tumor cells out of the spheroid with migration into the 3D matrix. Moreover, treatment of tumor spheroid cultures with the chemokine CXCL12 mimics the effect of the CAFs, resulting in similar patterns of dispersal of the tumor cells from the spheroid. Conversely, addition of CXCL12 to co-cultures of NAFs with tumor spheroids did not mimic the effects observed with CAF co-cultures, suggesting that NAFs produce factors that stabilize the tumor spheroids to reduce their migration in response to CXCL12.

  1. Expression of most matrix metalloproteinase family members in breast cancer represents a tumor-induced host response.

    PubMed Central

    Heppner, K. J.; Matrisian, L. M.; Jensen, R. A.; Rodgers, W. H.

    1996-01-01

    Matrix metalloproteinase (MMP) family members have been associated with advanced-stage cancer and contribute to tumor progression, invasion, and metastasis as determined by inhibitor studies. In situ hybridization was performed to analyze the expression and localization of all known MMPs in a series of human breast cancer biopsy specimens. Most MMPs were localized to tumor stroma, and all MMPs had very distinct expression patterns. Matrilysin was expressed by morphologically normal epithelial ducts within tumors and in tissue from reduction mammoplasties, and by epithelial-derived tumor cells. Many family members, including stromelysin-3, gelatinase A, MT-MMP, interstitial collagenase, and stromelysin-1 were localized to fibroblasts of tumor stroma of invasive cancers but in quite distinct, and generally widespread, patterns. Gelatinase B, collagenase-3, and metalloelastase expression were more focal; gelatinase B was primarily localized to endothelial cells, collagenase-3 to isolated tumor cells, and metalloelastase to cytokeratin-negative, macrophage-like cells. The MMP inhibitor, TIMP-1, was expressed in both stromal and tumor components in most tumors, and neither stromelysin-2 nor neutrophil collagenase were detected in any of the tumors. These results indicate that there is very tight and complex regulation in the expression of MMP family members in breast cancer that generally represents a host response to the tumor and emphasize the need to further evaluate differential functions for MMP family members in breast tumor progression. Images Figure 1 Figure 2 Figure 3 PMID:8686751

  2. Molecular Genetic Evidence for a Common Clonal Origin of Urinary Bladder Small Cell Carcinoma and Coexisting Urothelial Carcinoma

    PubMed Central

    Cheng, Liang; Jones, Timothy D.; McCarthy, Ryan P.; Eble, John N.; Wang, Mingsheng; MacLennan, Gregory T.; Lopez-Beltran, Antonio; Yang, Ximing J.; Koch, Michael O.; Zhang, Shaobo; Pan, Chong-Xian; Baldridge, Lee Ann

    2005-01-01

    In most cases, small-cell carcinoma of the urinary bladder is admixed with other histological types of bladder carcinoma. To understand the pathogenetic relationship between the two tumor types, we analyzed histologically distinct tumor cell populations from the same patient for loss of heterozygosity (LOH) and X chromosome inactivation (in female patients). We examined five polymorphic microsatellite markers located on chromosome 3p25-26 (D3S3050), chromosome 9p21 (IFNA and D9S171), chromosome 9q32-33 (D9S177), and chromosome 17p13 (TP53) in 20 patients with small-cell carcinoma of the urinary bladder and concurrent urothelial carcinoma. DNA samples were prepared from formalin-fixed, paraffin-embedded tissue sections using laser-assisted microdissection. A nearly identical pattern of allelic loss was observed in the two tumor types in all cases, with an overall frequency of allelic loss of 90% (18 of 20 cases). Three patients showed different allelic loss patterns in the two tumor types at a single locus; however, the LOH patterns at the remaining loci were identical. Similarly, the same pattern of nonrandom X chromosome inactivation was present in both carcinoma components in the four cases analyzed. Concordant genetic alterations and X chromosome inactivation between small-cell carcinoma and coexisting urothelial carcinoma suggest that both tumor components originate from the same cells in the urothelium. PMID:15855652

  3. [Eye involvement in neurofibromatosis].

    PubMed

    Baier, M; Pitz, S

    2016-05-01

    Neurofibromatosis 1 (NF1) and neurofibromatosis 2 (NF2) are characterized by an autosomal dominant pattern of inheritance with irregular penetrance and a broad spectrum of different clinical phenotypes. There are large variations in the age of onset, progression and prognosis. Symptoms are often manifested early in childhood. Characteristics which the two main forms NF1 and NF2 have in common are a positive family history, characteristic skin alterations, such as café au lait macules, axillary or inguinal freckling and neural tumors such as neurofibroma and optic glioma (NF1) as well as (bilateral) vestibular schwannomas (NF2). An interdisciplinary cooperation is necessary for the diagnostics and therapy.

  4. The transition from HLA-I positive to HLA-I negative primary tumors: the road to escape from T-cell responses.

    PubMed

    Aptsiauri, Natalia; Ruiz-Cabello, Francisco; Garrido, Federico

    2018-04-01

    MHC/HLA class I loss in cancer is one of the main mechanisms of tumor immune escape from T-cell recognition and destruction. Tumor infiltration by T lymphocytes (TILs) and by other immune cells was first described many years ago, but has never been directly and clearly linked to the destruction of HLA-I positive and selection of HLA-I negative tumor cells. The degree and the pattern of lymphocyte infiltration in a tumor nest may depend on antigenicity and the developmental stages of the tumors. In addition, it is becoming evident that HLA-I expression and tumor infiltration have a direct correlation with tumor tissue reorganization. We observed that at early stages (permissive Phase I) tumors are heterogeneous, with both HLA-I positive and HLA-negative cancer cells, and are infiltrated by TILs and M1 macrophages as a part of an active anti-tumor Th1 response. At later stages (encapsulated Phase II), tumor nests are mostly HLA-I negative with immune cells residing in the peri-tumoral stroma, which forms a granuloma-like encapsulated tissue structure. All these tumor characteristics, including tumor HLA-I expression pattern, have an important clinical prognostic value and should be closely and routinely investigated in different types of cancer by immunologists and by pathologists. In this review we summarize our current viewpoint about the alterations in HLA-I expression in cancer and discuss how, when and why tumor HLA-I losses occur. We also provide evidence for the negative impact of tumor HLA-I loss in current cancer immunotherapies, with the focus on reversible ('soft') and irreversible ('hard') HLA-I defects. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. TH-AB-202-01: Daily Lung Tumor Motion Characterization On EPIDs Using a Markerless Tiling Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rozario, T; University of Texas at Dallas, Richardson, TX; Chiu, T

    Purpose: Tracking lung tumor motion in real time allows for target dose escalation while simultaneously reducing dose to sensitive structures, thus increasing local control without increasing toxicity. We present a novel intra-fractional markerless lung tumor tracking algorithm using MV treatment beam images acquired during treatment delivery. Strong signals superimposed on the tumor significantly reduced the soft tissue resolution; while different imaging modalities involved introduce global imaging discrepancies. This reduced the comparison accuracies. A simple yet elegant Tiling algorithm is reported to overcome the aforementioned issues. Methods: MV treatment beam images were acquired continuously in beam’s eye view (BEV) by anmore » electronic portal imaging device (EPID) during treatment and analyzed to obtain tumor positions on every frame. Every frame of the MV image was simulated by a composite of two components with separate digitally reconstructed radiographs (DRRs): all non-moving structures and the tumor. This Titling algorithm divides the global composite DRR and the corresponding MV projection into sub-images called tiles. Rigid registration is performed independently on tile-pairs in order to improve local soft tissue resolution. This enables the composite DRR to be transformed accurately to match the MV projection and attain a high correlation value through a pixel-based linear transformation. The highest cumulative correlation for all tile-pairs achieved over a user-defined search range indicates the 2-D coordinates of the tumor location on the MV projection. Results: This algorithm was successfully applied to cine-mode BEV images acquired during two SBRT plans delivered five times with different motion patterns to each of two phantoms. Approximately 15000 beam’s eye view images were analyzed and tumor locations were successfully identified on every projection with a maximum/average error of 1.8 mm / 1.0 mm. Conclusion: Despite the presence of strong anatomical signal overlapping with tumor images, this markerless detection algorithm accurately tracks intrafractional lung tumor motions. This project is partially supported by an Elekta research grant.« less

  6. High-grade endometrial stromal sarcomas: a clinicopathologic study of a group of tumors with heterogenous morphologic and genetic features.

    PubMed

    Sciallis, Andrew P; Bedroske, Patrick P; Schoolmeester, John K; Sukov, William R; Keeney, Gary L; Hodge, Jennelle C; Bell, Debra A

    2014-09-01

    The existence of a "high-grade endometrial stromal sarcoma" category of tumors has been a controversial subject owing to, among other things, the difficulty in establishing consistent diagnostic criteria. Currently, the recommended classification for such tumors is undifferentiated uterine/endometrial sarcoma. Interest in this subject has recently increased markedly with the identification of recurrent molecular genetic abnormalities. At Mayo Clinic, a group of neoplasms has been observed that morphologically resemble, either cytologically or architecturally, classic "low-grade" endometrial stromal sarcoma but feature obvious deviations, specifically, 17 tumors with unequivocally high-grade morphology. These high-grade tumors displayed 3 morphologic themes: (1) tumors with a component that is identical to low-grade ESS that transitions abruptly into an obviously higher-grade component; (2) tumors composed exclusively of high-grade cells with uniform nuclear features but with a permeative pattern of infiltration; (3) tumors similar to the second group but with a different, yet characteristic, cytomorphology featuring enlarged round to ovoid cells (larger than those found in low-grade ESS) with smooth nuclear membranes and distinct chromatin clearing but lacking prominent nucleoli. We collected clinicopathologic data, applied immunohistochemical studies, and also tested tumors by fluorescence in situ hybridization for abnormalities in JAZF1, PHF1, YWHAE, and CCND1. Tumors from these 3 groups were found to be immunohistochemically and genetically distinct from one another. Most notable was the fact that category 3 contained all the cases that tested positive for YWHAE rearrangement, did not show any classic translocations for JAZF1, PHF1, or CCND1, often presented at a high stage, and behaved aggressively. This study demonstrates the morphologic, immunophenotypic, and molecular genetic heterogeneity that exists within "undifferentiated endometrial sarcomas" as currently defined and lends credence to the effort of subclassifying some tumors as truly "high-grade endometrial stromal sarcomas." Our study also shows that, in the context of undifferentiated endometrial sarcomas, recognition of cytomorphologic features on routine hematoxylin and eosin-stained sections may be used to select tumors with specific molecular genetic changes-that is, translocations involving YWHAE. Our conclusions will help further efforts towards proper sub-classification of these tumors which will aid in diagnosis and potentially affect clinical management.

  7. The effect of CT26 tumor-derived TGF-β on the balance of tumor growth and immunity.

    PubMed

    Owyang, Stephanie Y; Zhang, Min; Walkup, Grace A; Chen, Grace E; Grasberger, Helmut; El-Zaatari, Mohamad; Kao, John Y

    2017-11-01

    TGF-β is an important target for many cancer therapies under development. In addition to suppressing anti-tumor immunity, it has pleiotropic direct pro- and anti- tumor effects. The actions of increased endogenous TGF-β production remain unclear, and may affect the outcomes of anti-TGF-β cancer therapy. We hypothesize that tumor-derived TGF-β (td-TGF-β) plays an important role in maintaining tumor remission by controlling tumor proliferation in vivo, and that decreasing td-TGF-β in the tumor microenvironment will result in tumor progression. The aim of this study was to examine the effect of TGF-β in the tumor microenvironment on the balance between its anti-proliferative and immunosuppressive effects. A murine BALB/c spontaneous colon adenocarcinoma cell line (CT26) was genetically engineered to produce increased active TGF-β (CT26-TGF-β), a dominant-negative soluble TGF-β receptor (CT26-TGF-β-R), or the empty neomycin cassette as control (CT26-neo). In vitro proliferation rates were measured. For in vivo studies, the three cell lines were injected into syngeneic BALB/c mice, and tumor growth was measured over time. Immunodeficient BALB/c nude mice were used to investigate the role of T and B cells. In vitro, CT26-TGF-β-R and CT26-TGF-β cells showed increased and suppressed proliferation, respectively, compared to control (CT26-neo), confirming TGF-β has direct anti-tumor effects. In vivo, we found that CT26-TGF-β-R cells displayed slower growth compared to control, likely secondary to reduced suppression of anti-tumor immunity, as this effect was ablated in immunodeficient BALB/c nude mice. However, CT26-TGF-β cells (excess TGF-β) exhibited rapid early growth compared to control, but later failed to progress. The same pattern was shown in immunodeficient BALB/c nude mice, suggesting the effect on tumor growth is direct, with minimal immune system involvement. There was minimal effect on systemic antitumor immunity as determined by peripheral antigen-specific splenocyte type 1 cytokine production and tumor growth rate of CT26-neo on the contralateral flank of the same mice. Although TGF-β has opposing effects on tumor growth, this study showed that excessive td-TGF-β in the tumor microenvironment renders the tumor non-proliferative. Depleting excess td-TGF-β may release this endogenous tumor suppressive mechanism, thus triggering the progression of the tumor. Therefore, our findings support cautions against using anti-TGF-β strategies in treating cancer, as this may tip the balance of anti-immunity vs. anti-tumor effects of TGF-β, leading to tumor progression instead of remission. Copyright © 2017 European Federation of Immunological Societies. All rights reserved.

  8. Epigenetic changes in localized gastric cancer: the role of RUNX3 in tumor progression and the immune microenvironment

    PubMed Central

    Ibarrola-Villava, Maider; Peña-Chilet, María; Mongort, Cristina; Martinez-Ciarpaglini, Carolina; Navarro, Lara; Gambardella, Valentina; Castillo, Josefa; Roselló, Susana; Navarro, Samuel; Ribas, Gloria; Cervantes, Andrés

    2016-01-01

    Gastric cancer (GC) pathogenesis involves genetic, epigenetic and environmental factors. Epigenetic alterations, such as DNA methylation are considered pivotal in the inactivation of tumor-related genes. We assessed a methylation panel of 5 genes to study their association to GC progression and microsatellite instability (MSI), and studied the role of RUNX3 in GC pathogenesis and the tumor immune microenvironment. The methylation status of 47 promoter-CpG islands was studied through MALDI-TOF mass spectrometry analysis in 35 Microsatellite stable (MSS) GC, 26 MSI, and 18 cancer-free samples (CFS), and 6 MSS GC and 4 MSI GC cell lines. We also studied RUNX3 expression by immunohistochemistry (IHC) in 40 samples, and validated differences in methylation levels between tumor, normal, and immune tissue in 14 additional samples. Unsupervised hierarchical clustering of methylation levels revealed no distinct subgroups between MSI and MSS samples or cell lines. CFSs clustered together showing higher levels of RUNX3 methylation compared to GC samples. RUNX3 showed protein silencing in cancer and normal mucosa, compared to inflammatory peritumoural infiltrate in almost all cases, showing a non-lymphocytic predominant pattern and being correlated with epigenetic silencing. Our results show aberrant promoter's methylation in APC, CDH1, CDKN2A, MLH1 and RUNX3 associated with GC, as well as a non-lymphocytic predominant infiltrate with high expression of RUNX3. Deep study of RUNX3 inflammation signaling could help in understanding inflammation and immune activation in the tumor microenvironment. PMID:27566570

  9. Cell expression patterns of CD147 in N-diethylnitrosamine/phenobarbital-induced mouse hepatocellular carcinoma.

    PubMed

    Lu, Meng; Wu, Jiao; He, Feng; Wang, Xi-Long; Li, Can; Chen, Zhi-Nan; Bian, Huijie

    2015-02-01

    Overexpression of CD147/basigin in hepatic cells promotes the progression of hepatocellular carcinoma (HCC). Whether CD147 also expressed in liver non-parenchymal cells and associated with HCC development was unknown. The aim of the study was to explore time-dependent cell expression patterns of CD147 in a widely accepted N-diethylnitrosamine/phenobarbital (DEN/PB)-induced HCC mouse model. Liver samples collected at month 1-12 of post-DEN/PB administration were assessed the localization of CD147 in hepatocytes, endothelial cells, hepatic stellate cells, and macrophages. Immunohistochemistry analysis showed that CD147 was upregulated in liver tumors during month 1-8 of DEN/PB induction. Expression of CD147 was positively correlated with cytokeratin 18, a hepatocyte marker (r = 0.7857, P = 0.0279), CD31 (r = 0.9048, P = 0.0046), an endothelial cell marker, and CD68, a macrophage marker (r = 0.7619, P = 0.0368). A significant correlation was also observed between CD147 and alpha-smooth muscle actin (r = 0.8857, P = 0.0333) at DEN/PB initiation and early stage of tumor formation. Immunofluorescence and fluorescence in situ hybridization showed that CD147 co-expressed with cytokeratin 18, CD31, alpha-smooth muscle actin, and CD68. Moreover, there existed positive correlations between CD147 and microvessel density (r = 0.7857, P = 0.0279), CD147 and Ki-67 (r = 0.9341, P = 0.0022) in the development of DEN/PB-induced HCC. In conclusion, our results demonstrated that CD147 was upregulated in the liver parenchymal and mesenchymal cells and involved in angiogenesis and tumor cell proliferation in the development of DEN/PB-induced HCC.

  10. Global DNA methylation analysis reveals miR-214-3p contributes to cisplatin resistance in pediatric intracranial nongerminomatous malignant germ cell tumors.

    PubMed

    Hsieh, Tsung-Han; Liu, Yun-Ru; Chang, Ting-Yu; Liang, Muh-Lii; Chen, Hsin-Hung; Wang, Hsei-Wei; Yen, Yun; Wong, Tai-Tong

    2018-03-27

    Pediatric central nervous system germ cell tumors (CNSGCTs) are rare and heterogeneous neoplasms, which can be divided into germinomas and nongerminomatous germ cell tumors (NGGCTs). NGGCTs are further subdivided into mature teratomas and nongerminomatous malignant GCTs (NGMGCTs). Clinical outcomes suggest that NGMGCTs have poor prognosis and survival and that they require more extensive radiotherapy and adjuvant chemotherapy. However, the mechanisms underlying this difference are still unclear. DNA methylation alteration is generally acknowledged to cause therapeutic resistance in cancers. We hypothesized that the pediatric NGMGCTs exhibit a different genome-wide DNA methylation pattern, which is involved in the mechanism of its therapeutic resistance. We performed methylation and hydroxymethylation DNA immunoprecipitation sequencing, mRNA expression microarray, and small RNA sequencing (smRNA-seq) to determine methylation-regulated genes, including microRNAs (miRNAs). The expression levels of 97 genes and 8 miRNAs were correlated with promoter DNA methylation and hydroxymethylation status, such as the miR-199/-214 cluster, and treatment with DNA demethylating agent 5-aza-2'-deoxycytidine elevated its expression level. Furthermore, smRNA-seq analysis showed 27 novel miRNA candidates with differential expression between germinomas and NGMGCTs. Overexpresssion of miR-214-3p in NCCIT cells leads to reduced expression of the pro-apoptotic protein BCL2-like 11 and induces cisplatin resistance. We interrogated the differential DNA methylation patterns between germinomas and NGMGCTs and proposed a mechanism for chemoresistance in NGMGCTs. In addition, our sequencing data provide a roadmap for further pediatric CNSGCT research and potential targets for the development of new therapeutic strategies.

  11. Clinicopathological significance and prognostic value of myoinvasive patterns in endometrial endometrioid carcinoma.

    PubMed

    Amălinei, Cornelia; Aignătoaei, Anda Maria; Balan, Raluca Anca; Giuşcă, Simona Eliza; Lozneanu, Ludmila; Avădănei, Elena Roxana; Căruntu, Irina Draga

    2018-01-01

    Endometrioid endometrial carcinoma has an overall good prognosis. However, variable five-year survival rates (92%-42%) have been reported in FIGO stage I, suggesting the involvement of other factors related to tumor biological behavior. These may be related to the role played by epithelial-mesenchymal transition (EMT) and cancer stem cells in endometrial carcinogenesis. In this context, our review highlights the prognostic significance of several types of myoinvasion in low grade, low stage endometrioid endometrial carcinoma, as a reflection of these molecular changes at the invasive front. According to recently introduced myoinvasive patterns, the diffusely infiltrating and microcystic, elongated, and fragmented (MELF) patterns show loss of hormone receptors, along with EMT and high expression of cancer stem cell markers, being associated with a poor prognosis. Additionally, MELF pattern exhibits a high incidence of lymphovascular invasion and lymph node metastases. Conversely, the broad front pattern has a good prognosis and a low expression of EMT and stem cells markers. Similarly, the adenomyosis (AM)-like and adenoma malignum patterns of invasion are associated to a favorable prognosis, but nevertheless, they raise diagnostic challenges. AM-like pattern must be differentiated from carcinoma invasion of AM foci, while adenoma malignum pattern creates difficulties in appreciating the depth of myoinvasion and requires differential diagnosis with other conditions. Another pattern expecting its validation and prognostic significance value is the nodular fasciitis-like stroma and large cystic growth pattern. In practice, the knowledge of these patterns of myoinvasion may be valuable for the correct assessment of stage, may improve prognosis evaluation and may help identify molecules for future targeted therapies.

  12. Two-Phase Helical Computed Tomography Study of Salivary Gland Warthin Tumors: A Radiologic Findings and Surgical Applications

    PubMed Central

    Joo, Yeon Hee; Kim, Jin Pyeong; Park, Jung Je

    2014-01-01

    Objectives The goal of this study was to define the radiologic characteristics of two-phase computed tomography (CT) of salivary gland Warthin tumors and to compare them to pleomorphic adenomas. We also aimed to provide a foundation for selecting a surgical method on the basis of radiologic findings. Methods We prospectively enrolled 116 patients with parotid gland tumors, who underwent two-phase CT preoperatively. Early and delayed phase scans were obtained, with scanning delays of 30 and 120 seconds, respectively. The attenuation changes and enhancement patterns were analyzed. In cases when the attenuation changes were decreased, we presumed Warthin tumor preoperatively and performed extracapsular dissection. When the attenuation changes were increased, superficial parotidectomy was performed on the parotid gland tumors. We analyzed the operation times, incision sizes, complications, and recurrence rates. Results Attenuation of Warthin tumors was decreased from early to delayed scans. The ratio of CT numbers in Warthin tumors was also significantly different from other tumors. Warthin tumors were diagnosed with a sensitivity of 96.1% and specificity of 97% using two-phase CT. The mean operation time was 38 minutes and the mean incision size was 36.2 mm for Warthin tumors. However, for the other parotid tumors, the average operation time was 122 minutes and the average incision size was 91.8 mm (P<0.05). Conclusion Salivary Warthin tumor has a distinct pattern of contrast enhancement on two-phase CT, which can guide treatment decisions. The preoperative diagnosis of Warthin tumor made extracapsular dissection possible instead of superficial parotidectomy. PMID:25177439

  13. Two-phase helical computed tomography study of salivary gland warthin tumors: a radiologic findings and surgical applications.

    PubMed

    Joo, Yeon Hee; Kim, Jin Pyeong; Park, Jung Je; Woo, Seung Hoon

    2014-09-01

    The goal of this study was to define the radiologic characteristics of two-phase computed tomography (CT) of salivary gland Warthin tumors and to compare them to pleomorphic adenomas. We also aimed to provide a foundation for selecting a surgical method on the basis of radiologic findings. We prospectively enrolled 116 patients with parotid gland tumors, who underwent two-phase CT preoperatively. Early and delayed phase scans were obtained, with scanning delays of 30 and 120 seconds, respectively. The attenuation changes and enhancement patterns were analyzed. In cases when the attenuation changes were decreased, we presumed Warthin tumor preoperatively and performed extracapsular dissection. When the attenuation changes were increased, superficial parotidectomy was performed on the parotid gland tumors. We analyzed the operation times, incision sizes, complications, and recurrence rates. Attenuation of Warthin tumors was decreased from early to delayed scans. The ratio of CT numbers in Warthin tumors was also significantly different from other tumors. Warthin tumors were diagnosed with a sensitivity of 96.1% and specificity of 97% using two-phase CT. The mean operation time was 38 minutes and the mean incision size was 36.2 mm for Warthin tumors. However, for the other parotid tumors, the average operation time was 122 minutes and the average incision size was 91.8 mm (P<0.05). Salivary Warthin tumor has a distinct pattern of contrast enhancement on two-phase CT, which can guide treatment decisions. The preoperative diagnosis of Warthin tumor made extracapsular dissection possible instead of superficial parotidectomy.

  14. Alpha Particles Induce Autophagy in Multiple Myeloma Cells.

    PubMed

    Gorin, Jean-Baptiste; Gouard, Sébastien; Ménager, Jérémie; Morgenstern, Alfred; Bruchertseifer, Frank; Faivre-Chauvet, Alain; Guilloux, Yannick; Chérel, Michel; Davodeau, François; Gaschet, Joëlle

    2015-01-01

    Radiation emitted by the radionuclides in radioimmunotherapy (RIT) approaches induce direct killing of the targeted cells as well as indirect killing through the bystander effect. Our research group is dedicated to the development of α-RIT, i.e., RIT using α-particles especially for the treatment of multiple myeloma (MM). γ-irradiation and β-irradiation have been shown to trigger apoptosis in tumor cells. Cell death mode induced by (213)Bi α-irradiation appears more controversial. We therefore decided to investigate the effects of (213)Bi on MM cell radiobiology, notably cell death mechanisms as well as tumor cell immunogenicity after irradiation. Murine 5T33 and human LP-1 MM cell lines were used to study the effects of such α-particles. We first examined the effects of (213)Bi on proliferation rate, double-strand DNA breaks, cell cycle, and cell death. Then, we investigated autophagy after (213)Bi irradiation. Finally, a coculture of dendritic cells (DCs) with irradiated tumor cells or their culture media was performed to test whether it would induce DC activation. We showed that (213)Bi induces DNA double-strand breaks, cell cycle arrest, and autophagy in both cell lines, but we detected only slight levels of early apoptosis within the 120 h following irradiation in 5T33 and LP-1. Inhibition of autophagy prevented (213)Bi-induced inhibition of proliferation in LP-1 suggesting that this mechanism is involved in cell death after irradiation. We then assessed the immunogenicity of irradiated cells and found that irradiated LP-1 can activate DC through the secretion of soluble factor(s); however, no increase in membrane or extracellular expression of danger-associated molecular patterns was observed after irradiation. This study demonstrates that (213)Bi induces mainly necrosis in MM cells, low levels of apoptosis, and autophagy that might be involved in tumor cell death.

  15. Cervical node metastasis in T1 squamous cell carcinoma of oral tongue- pattern and the predictive factors.

    PubMed

    S, Vishak; Rohan, Vinayak

    2014-06-01

    The squamous cell carcinoma (SCC) of the oral tongue is a common cancer in India. Elective lymphadenectomy is generally performed in all patients with T2-T4 tumors. In this study we have tried to analyze the pattern and risk factors associated with lymph node metastasis in T1 tongue cancers. A retrospective review of the records of 57 patients undergoing surgery for treatment of T1 sqamous cell carcinoma of oral tongue was carried out. The clinicopatological features of the tumor, pattern of nodal metastasis and the risk factors associated with lymph node metastasis were studied. Totally 57 patients with T1 tumor underwent excision of the primary and modified neck dissection (MND). Lymph node metastasis was found in 36.8 % of the patients. Level I to Level II was the commonest site of metastasis. Skip metastasis at level III and IV was found in 8.5 % of the patients and isolated skip metastasis at level IV in 1.5 % of the patients. The risk factors associated with the lymph node metastasis on univariete analysis were; higher grade, tumor size >1 cm and tumor thickness >3 mm. On multivariate analysis only the tumor thickness was found to be a risk factor for the lymph node metastasis (hazard ratio of 21.59). T1 sqamous cell carcinoma of tongue is associated with a high incidence of lymph node metastasis. Elective neck dissection should be considered in all patients with tumors more than 3 mm in thickness.

  16. Grade classification of neuroepithelial tumors using high-resolution magic-angle spinning proton nuclear magnetic resonance spectroscopy and pattern recognition.

    PubMed

    Chen, WenXue; Lou, HaiYan; Zhang, HongPing; Nie, Xiu; Lan, WenXian; Yang, YongXia; Xiang, Yun; Qi, JianPin; Lei, Hao; Tang, HuiRu; Chen, FenEr; Deng, Feng

    2011-07-01

    Clinical data have shown that survival rates vary considerably among brain tumor patients, according to the type and grade of the tumor. Metabolite profiles of intact tumor tissues measured with high-resolution magic-angle spinning proton nuclear magnetic resonance spectroscopy (HRMAS (1)H NMRS) can provide important information on tumor biology and metabolism. These metabolic fingerprints can then be used for tumor classification and grading, with great potential value for tumor diagnosis. We studied the metabolic characteristics of 30 neuroepithelial tumor biopsies, including two astrocytomas (grade I), 12 astrocytomas (grade II), eight anaplastic astrocytomas (grade III), three glioblastomas (grade IV) and five medulloblastomas (grade IV) from 30 patients using HRMAS (1)H NMRS. The results were correlated with pathological features using multivariate data analysis, including principal component analysis (PCA). There were significant differences in the levels of N-acetyl-aspartate (NAA), creatine, myo-inositol, glycine and lactate between tumors of different grades (P<0.05). There were also significant differences in the ratios of NAA/creatine, lactate/creatine, myo-inositol/creatine, glycine/creatine, scyllo-inositol/creatine and alanine/creatine (P<0.05). A soft independent modeling of class analogy model produced a predictive accuracy of 87% for high-grade (grade III-IV) brain tumors with a sensitivity of 87% and a specificity of 93%. HRMAS (1)H NMR spectroscopy in conjunction with pattern recognition thus provides a potentially useful tool for the rapid and accurate classification of human brain tumor grades.

  17. The use of intraoperative near-infrared indocyanine green videoangiography in the microscopic resection of hemangioblastomas.

    PubMed

    Tamura, Yoji; Hirota, Yuki; Miyata, Shiro; Yamada, Yoshitaka; Tucker, Adam; Kuroiwa, Toshihiko

    2012-08-01

    The authors assessed the usefulness of intraoperative near-infrared indocyanine green videoangiography (ICG-VA) in the microscopic resection of hemangioblastomas. From January 2009 to February 2012, nine consecutive patients (seven men, two women) who underwent surgery for hemangioblastomas using intraoperative ICG-VA were included in this study. Surgery was performed on four cystic cerebellar lesions with mural nodules, two solid tumors (one in the cerebellar hemisphere and one in the medulla oblongata), one spinal tumor and multiple tumors in two patients with von Hippel-Lindau disease. Of the nine patients, three were treated for recurrent tumor. The ICG-induced fluorescence images of hemangioblastomas with variable presentation were evaluated. All tumors could be completely removed en bloc. Blood flow in the tumor and tumor-related vessels at the brain surface were clearly detected by ICG-VA in all cases, except one recurrent tumor where postoperative adhesive scar tissue obstructed ICG-induced fluorescence resulting in poor delineation of the blood flow patterns and tumor margins. ICG-VA was also helpful for detecting the multiple small mural nodules within the cyst or the tumors buried under thin gliotic neural tissue despite reduced fluorescence. Intraoperative ICG-VA is a safe and easy modality for confirming the vascular flow patterns in hemangioblastomas. In addition, ICG-VA provided useful information for intracystic small lesions or lesions concealed under thin brain tissue in order to accomplish total resection of these tumors.

  18. Recurrent keratocystic odontogenic tumor of right maxillary sinus involving the right infraorbital rim.

    PubMed

    Maruthamuthu, Karthikeyan; Vasupradha, G; Dineshshankar, Janardhanam; Balaji, Abishek Rajaram

    2017-01-01

    Keratocystic odontogenic tumor (KCOT) is a benign odontogenic tumor with an aggressive behavior and high recurrence rate. The most common site of predilection is the posterior mandible. In contrast, KCOTs occurring in the maxillary region are relatively rare. However, the maxillary involvement poses a greater and increased threat, due to proximity to vital structures such as maxillary sinus, orbital floor, and infratemporal fossa. This report presents such a case of KCOT involving the maxillary sinus eroding the floor of the orbit and provides an account of the factors that need to be considered during management.

  19. Epithelial-to-endothelial transition and cancer stem cells: two cornerstones of vasculogenic mimicry in malignant tumors.

    PubMed

    Sun, Baocun; Zhang, Danfang; Zhao, Nan; Zhao, Xiulan

    2017-05-02

    Vasculogenic mimicry (VM) is a functional microcirculation pattern in malignant tumors accompanied by endothelium-dependent vessels and mosaic vessels. VM has been identified in more than 15 solid tumor types and is associated with poor differentiation, late clinical stage and poor prognosis. Classic anti-angiogenic agents do not target endothelium-dependent vessels and are not efficacious against tumors exhibiting VM. Further insight into the molecular signaling that triggers and promotes VM formation could improve anti-angiogenic therapeutics. Recent studies have shown that cancer stem cells (CSCs) and epithelium-to-endothelium transition (EET), a subtype of epithelial-to-mesenchymal transition (EMT), accelerate VM formation by stimulating tumor cell plasticity, remodeling the extracellular matrix (ECM) and connecting VM channels with host blood vessels. VM channel-lining cells originate from CSCs due to expression of EMT inducers such as Twist1, which promote EET and ECM remodeling. Hypoxia and high interstitial fluid pressure in the tumor microenvironment induce a specific type of cell death, linearly patterned programmed cell necrosis (LPPCN), which spatially guides VM and endothelium-dependent vessel networks. This review focuses on the roles of CSCs and EET in VM, and on possible novel anti-angiogenic strategies against alternative tumor vascularization.

  20. Salivary Glands

    MedlinePlus

    ... salivary gland tumors usually show up as painless enlargements of these glands. Tumors rarely involve more than ... otolaryngologist-head and neck surgeon should check these enlargements. Malignant tumors of the major salivary glands can ...

  1. T Lymphocyte Inhibition by Tumor-Infiltrating Dendritic Cells Involves Ectonucleotidase CD39 but Not Arginase-1.

    PubMed

    Trad, Malika; Gautheron, Alexandrine; Fraszczak, Jennifer; Alizadeh, Darya; Larmonier, Claire; LaCasse, Collin J; Centuori, Sara; Audia, Sylvain; Samson, Maxime; Ciudad, Marion; Bonnefoy, Francis; Lemaire-Ewing, Stéphanie; Katsanis, Emmanuel; Perruche, Sylvain; Saas, Philippe; Bonnotte, Bernard

    2015-01-01

    T lymphocytes activated by dendritic cells (DC) which present tumor antigens play a key role in the antitumor immune response. However, in patients suffering from active cancer, DC are not efficient at initiating and supporting immune responses as they participate to T lymphocyte inhibition. DC in the tumor environment are functionally defective and exhibit a characteristic of immature phenotype, different to that of DC present in nonpathological conditions. The mechanistic bases underlying DC dysfunction in cancer responsible for the modulation of T-cell responses and tumor immune escape are still being investigated. Using two different mouse tumor models, we showed that tumor-infiltrating DC (TIDC) are constitutively immunosuppressive, exhibit a semimature phenotype, and impair responder T lymphocyte proliferation and activation by a mechanism involving CD39 ectoenzyme.

  2. Usefulness of a Novel Ultrasonographic Classification Based on Anechoic Area Patterns for Differentiating Warthin Tumors from Pleomorphic Adenomas of the Parotid Gland

    PubMed Central

    Matsuda, Eriko; Fukuhara, Takahiro; Donishi, Ryohei; Kawamoto, Katsuyuki; Hirooka, Yasuaki; Takeuchi, Hiromi

    2018-01-01

    Background Ultrasonographic homogeneity is an important differential finding between Warthin tumor and pleomorphic adenoma, two types of benign parotid gland tumors, with the former likely to be heterogeneous and the latter homogeneous. However, differences in the performance of ultrasound machines or the homogeneity cut-off level affect the judgment of ultrasonographic homogeneity. Therefore, in this study, we adopted a novel system for classifying the composition of tumors via ultrasonography, using anechoic area as a substitute for differences in homogeneity to differentiate between Warthin tumors and pleomorphic adenomas. Methods We evaluated 68 tumors that were histopathologically diagnosed as Warthin tumor or pleomorphic adenoma between July 2009 and November 2015. Ultrasonographic images of the tumors were evaluated on the basis of key differentiating features, including features on B-mode imaging and color Doppler imaging. Additionally, the tumors were classified into four groups based on anechoic area, and findings were compared between Warthin tumors and pleomorphic adenomas. Results While 38 of the tumors were pleomorphic adenomas, 30 were Warthin tumors. The sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy for detection of Warthin tumors using our novel classification system were 73.3%, 76.3%, 71.0%, 78.4% and 75.0%, respectively. Compared to pleomorphic adenomas, Warthin tumors showed large or sponge-like anechoic areas, rich vascularization and an oval shape even at large tumor sizes, and the difference was significant. On defining Warthin tumor as a tumor demonstrating two or more of the findings noted above, the sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy for its detection were 73.3%, 84.2%, 78.6%, 80.0% and 79.4%, respectively. Conclusion Our novel classification system based on anechoic area patterns demonstrated by the tumors had high sensitivity, specificity and diagnostic accuracy for differentiating Warthin tumors from pleomorphic adenomas. PMID:29434491

  3. Usefulness of a Novel Ultrasonographic Classification Based on Anechoic Area Patterns for Differentiating Warthin Tumors from Pleomorphic Adenomas of the Parotid Gland.

    PubMed

    Matsuda, Eriko; Fukuhara, Takahiro; Donishi, Ryohei; Kawamoto, Katsuyuki; Hirooka, Yasuaki; Takeuchi, Hiromi

    2017-12-01

    Ultrasonographic homogeneity is an important differential finding between Warthin tumor and pleomorphic adenoma, two types of benign parotid gland tumors, with the former likely to be heterogeneous and the latter homogeneous. However, differences in the performance of ultrasound machines or the homogeneity cut-off level affect the judgment of ultrasonographic homogeneity. Therefore, in this study, we adopted a novel system for classifying the composition of tumors via ultrasonography, using anechoic area as a substitute for differences in homogeneity to differentiate between Warthin tumors and pleomorphic adenomas. We evaluated 68 tumors that were histopathologically diagnosed as Warthin tumor or pleomorphic adenoma between July 2009 and November 2015. Ultrasonographic images of the tumors were evaluated on the basis of key differentiating features, including features on B-mode imaging and color Doppler imaging. Additionally, the tumors were classified into four groups based on anechoic area, and findings were compared between Warthin tumors and pleomorphic adenomas. While 38 of the tumors were pleomorphic adenomas, 30 were Warthin tumors. The sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy for detection of Warthin tumors using our novel classification system were 73.3%, 76.3%, 71.0%, 78.4% and 75.0%, respectively. Compared to pleomorphic adenomas, Warthin tumors showed large or sponge-like anechoic areas, rich vascularization and an oval shape even at large tumor sizes, and the difference was significant. On defining Warthin tumor as a tumor demonstrating two or more of the findings noted above, the sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy for its detection were 73.3%, 84.2%, 78.6%, 80.0% and 79.4%, respectively. Our novel classification system based on anechoic area patterns demonstrated by the tumors had high sensitivity, specificity and diagnostic accuracy for differentiating Warthin tumors from pleomorphic adenomas.

  4. Heme oxygenase-1 system and gastrointestinal tumors

    PubMed Central

    Zhu, Xiao; Fan, Wen-Guo; Li, Dong-Pei; Lin, Marie CM; Kung, Hsiangfu

    2010-01-01

    Heme oxygenase-1 (HO-1) system catabolizes heme into three products: carbon monoxide, biliverdin/bilirubin and free iron. It is involved in many physiological and pathophysiological processes. A great deal of data has demonstrated the roles of HO-1 in the formation, growth and metastasis of tumors. The interest in this system by investigators involved in gastrointestinal tumors is fairly recent, and few papers on HO-1 have touched upon this subject. This review focuses on the current understanding of the physiological significance of HO-1 induction and its possible roles in the gastrointestinal tumors studied to date. The implications for possible therapeutic manipulation of HO-1 in gastrointestinal tumors are also discussed. PMID:20518085

  5. [Neck lymphatic metastasis, surgical methods and prognosis in early tongue squamous cell carcinoma].

    PubMed

    Wang, L S; Zhou, F T; Han, C B; He, X P; Zhang, Z X

    2018-02-09

    Objective: To investigate the different pattern of neck lymph node metastasis, the choice of surgical methods and prognosis in early tongue squamous cell carcinoma. Methods: A total of 157 patients with early oral tongue squamous cell carcinoma were included in this study. Statistical analysis was performed to identify the pattern of lymph node metastasis, to determine the best surgical procedure and to analyze the prognosis. Results: The occurrence of cervical lymph node metastasis rate was 31%(48/157). Neck lymphatic metastasis was significantly related to tumor size ( P= 0.026) and histology differentiation type ( P= 0.022). The rate of metastasis was highest in level Ⅱ [33% (16/48)]. In level Ⅳ, the incidence of lymph node metastasis was 5%(7/157), and there was no skip metastases. The possibility of level Ⅳ metastasis was higher, when level Ⅱ ( P= 0.000) or Ⅲ ( P= 0.000) involved. The differentiation tumor recurrence, neck lymphatic metastasis and adjuvant radiotherapy were prognostic factors ( P< 0.05). Multivariate analyses revealed histology differentiation type, neck lymphatic metastases and adjuvant radiotherapy were the independent prognostic factors. Conclusions: Neck lymphatic metastasis rate is high in early tongue squamous cell carcinoma, simultaneous glossectomy and neck dissection should be performed. Level Ⅳ metastasis rate is extremely low, so supraomohyoid neck dissection is sufficient for most of the time. The histology differentiation type, neck lymphatic metastasis and adjuvant radiotherapy are independent prognostic factors.

  6. Identifying DNA Methylation Features that Underlie Prostate Cancer Disparities

    DTIC Science & Technology

    2016-10-01

    Report We will continue to recruit African American patients and bank their prostate tissue . We will continue dissecting tumor samples into tumor...in prostate tumors and adjacent normal tissue derived from both AA and EA individuals. We will determine if DNA methylation patterns in prostate... tissue (both cancerous and normal tissue ) differ between AA and EA individuals. We will also identify methylation features that differ between tumor

  7. White matter tracts of speech and language.

    PubMed

    Smits, Marion; Jiskoot, Lize C; Papma, Janne M

    2014-10-01

    Diffusion tensor imaging (DTI) has been used to investigate the white matter (WM) tracts underlying the perisylvian cortical regions known to be associated with language function. The arcuate fasciculus is composed of 3 segments (1 long and 2 short) whose separate functions correlate with traditional models of conductive and transcortical motor or sensory aphasia, respectively. DTI mapping of language fibers is useful in presurgical planning for patients with dominant hemisphere tumors, particularly when combined with functional magnetic resonance imaging. DTI has found damage to language networks in stroke patients and has the potential to influence poststroke rehabilitation and treatment. Assessment of the WM tracts involved in the default mode network has been found to correlate with mild cognitive impairment, potentially explaining language deficits in patients with apparently mild small vessel ischemic disease. Different patterns of involvement of language-related WM structures appear to correlate with different clinical subtypes of primary progressive aphasias. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Brain Tumor Statistics

    MedlinePlus

    ... Scientific Advisory Council & Reviewers The International Low Grade Glioma Registry Get Involved Advocacy Breakthrough for Brain Tumors ... an estimated 29,320 new cases in 2018. Gliomas , a broad term which includes all tumors arising ...

  9. Mdm2 overexpression and p14(ARF) inactivation are two mutually exclusive events in primary human lung tumors.

    PubMed

    Eymin, Béatrice; Gazzeri, Sylvie; Brambilla, Christian; Brambilla, Elisabeth

    2002-04-18

    Pathways involving p53 and pRb tumor suppressor genes are frequently deregulated during lung carcinogenesis. Through its location at the interface of these pathways, Mdm2 can modulate the function of both p53 and pRb genes. We have examined here the pattern of expression of Mdm2 in a series of 192 human lung carcinomas of all histological types using both immunohistochemical and Western blot analyses and four distinct antibodies mapping different epitopes onto the Mdm2 protein. Using Immunohistochemistry (IHC), Mdm2 was overexpressed as compared to normal lung in 31% (60 out of 192) of all tumors analysed, whatever their histological types. Western blotting was performed on 28 out of the 192 tumoral samples. Overexpression of p85/90, p74/76 and p57 Mdm2 isoforms was detected in 18% (5 out of 28), 25% (7 out of 28) and 39% (11 out of 28) of the cases respectively. Overall, overexpression of at least one isoform was observed in 14 out of 28 (50%) lung tumors and concomittant overexpression of at least two isoforms in 7 out of 28 (25%) cases. A good concordance (82%) was observed between immunohistochemical and Western blot data. Interestingly, a highly significant inverse relationship was detected between p14(ARF) loss and Mdm2 overexpression either in NSCLC (P=0.0089) or in NE lung tumors (P<0.0001). Furthermore, a Mdm2/p14(ARF) >1 ratio was correlated with a high grade phenotype among NE tumors overexpressing Mdm2 (P=0.0021). Taken together, these data strongly suggest that p14(ARF)and Mdm2 act on common pathway(s) to regulate p53 and/or pRb-dependent or independent functions and that the Mdm2 : p14(ARF) ratio might act as a rheostat in modulating the activity of both proteins.

  10. Multifocality of transitional cell carcinoma results from genetic instability of entire transitional epithelium.

    PubMed

    Pycha, A; Mian, C; Hofbauer, J; Brössner, C; Haitel, A; Wiener, H; Marberger, M

    1999-01-01

    Multifocality of transitional cell carcinoma (TCC) has been attributed to seeding of exfoliated tumor cells or to a general sensitivity of the entire urothelium to carcinogenic stimuli. By contrast, TCC has been shown to evolve as a consequence of genetic defects and chromosomal instability. We analyzed chromosomal patterns, total DNA content, and p53 and Ki67 expression in malignant and normal transitional cells to evaluate their relationship to the development of multifocal TCC. Included in the study were 47 patients, 16 women and 31 men, with a mean age of 70.04 years (range 37 to 83). Of 47 patients, 45 had TCC of the urinary bladder and 7 of those had synchronous ureteral involvement. Two patients had ureteral TCC and a history of TCC of the bladder. Using fluorescence in situ hybridization, numerical aberrations of chromosomes 7, 9, and 17 were detected in imprint specimens of histologically verified tumor and "normal" urothelium and were compared with static ploidy and p53 and Ki67 expression. Chromosome 7 was altered in 93.6%, chromosome 9 in 63.8% (including monosomy), and chromosome 17 in 87.2% of the 47 analyzed tumor and normal imprints. Differences between tumor and normal epithelium were observed in aberrational frequencies (number of cells showing chromosomal aberrations calculated on 200 cells counted, given in percentages). DNA content was aneuploid in all tumor specimens, but diploid in 20 (42.5%) of 47 normal specimens, according to lower aberration frequencies in these patients. p53 detection was positive in 82.9% of the tumor specimens and 76.6% of the normal specimens. Ki67 was positive in 87.2% of the tumor imprints and in 72.3% of the normal specimens. These data suggest a general genetic instability as a reason for multifocality in the entire transitional epithelium.

  11. Adenovirus-mediated gene transfer of pathogen-associated molecular patterns for cancer immunotherapy.

    PubMed

    Tosch, C; Geist, M; Ledoux, C; Ziller-Remi, C; Paul, S; Erbs, P; Corvaia, N; Von Hoegen, P; Balloul, J-M; Haegel, H

    2009-04-01

    The delivery of stimulatory signals to dendritic cells (DCs) in the tumor microenvironment could be an effective means to break tumor-induced tolerance. The work presented here evaluates the immunostimulatory properties of pathogen-associated molecular patterns (PAMPs), microbial molecules which bind Toll-like receptors and deliver activating signals to immune cells, when expressed in tumor cells using adenoviral (Ad) vectors. In vitro, transduction of A549 tumor cells with Ad vectors expressing either flagellin from Listeria monocytogenes or P40 protein from Klebsiella pneumoniae induced the maturation of human monocyte-derived DCs in co-cultures. In mixed lymphocyte reactions (MLRs), Ad-flagellin and Ad-P40 transduction of tumor cells stimulated lymphocyte proliferation and the secretion of IFN-gamma. In vivo, these vectors were used either as stand-alone immunoadjuvants injected intratumorally or as vaccine adjuvants combined with a tumor antigen-expressing vector. When Ad-PAMPs were administered intratumorally to mice bearing subcutaneous syngeneic B16F0-CAR (cocksackie-adenovirus receptor) melanomas, tumor progression was transiently inhibited by Ad-P40. In a therapeutic vaccine setting, the combination of Ad-MUC1 and Ad-PAMP vectors injected subcutaneously delayed the growth of implanted RenCa-MUC1 tumors and improved tumor rejection when compared with vaccination with Ad-MUC1 alone. These results suggest that Ad-PAMPs could be effective immunoadjuvants for cancer immunotherapy.

  12. Increased growth rate of vestibular schwannoma after resection of contralateral tumor in neurofibromatosis type 2

    PubMed Central

    Peyre, Matthieu; Goutagny, Stephane; Imbeaud, Sandrine; Bozorg-Grayeli, Alexis; Felce, Michele; Sterkers, Olivier; Kalamarides, Michel

    2011-01-01

    Surgical management of bilateral vestibular schwannomas (VS) in neurofibromatosis type 2 (NF2) is often difficult, especially when both tumors threaten the brainstem. When the largest tumor has been removed, the management of the contralateral VS may become puzzling. To give new insights into the growth pattern of these tumors and to determine the best time point for treatment (surgery or medical treatment), we studied radiological growth in 11 VS (11 patients with NF2) over a long period (mean duration, 7.6 years), before and after removal of the contralateral tumor while both were threatening the brainstem. We used a quantitative approach of the radiological velocity of diametric expansion (VDE) on consecutive magnetic resonance images. Before first surgery, growth patterns of both tumors were similar in 9 of 11 cases. After the first surgery, VDE of the remaining VS was significantly elevated, compared with the preoperative period (2.5 ± 2.2 vs 4.4 ± 3.4 mm/year; P = .01, by Wilcoxon test). Decrease in hearing function was associated with increased postoperative growth in 3 cases. Growth pattern of coexisting intracranial meningiomas was not modified by VS surgery on the first side. In conclusion, removal of a large VS in a patient with NF2 might induce an increase in the growth rate of the contralateral medium or large VS. This possibility should be integrated in NF2 patient management to adequately treat the second VS. PMID:21798887

  13. Pancreatic neuroendocrine tumors containing areas of iso- or hypoattenuation in dynamic contrast-enhanced computed tomography: Spectrum of imaging findings and pathological grading.

    PubMed

    Hyodo, Ryota; Suzuki, Kojiro; Ogawa, Hiroshi; Komada, Tomohiro; Naganawa, Shinji

    2015-11-01

    To evaluate dynamic contrast-enhanced computed tomography (CT) features of pancreatic neuroendocrine tumors (PNETs) containing areas of iso- or hypoattenuation and the relationship with pathological grading. Between June 2006 and March 2014, 61 PNETs in 58 consecutive patients (29 male, 29 female; median-age 55 years), which were surgically diagnosed, underwent preoperative dynamic contrast-enhanced CT. PNETs were classified based on contrast enhancement patterns in the pancreatic phase: iso/hypo-PNETs were defined as tumors containing areas of iso- or hypoattenuation except for cystic components, and hyper-PNETs were tumors showing hyperattenuation over the whole area. CT findings and contrast-enhancement patterns of the tumors were evaluated retrospectively by two radiologists and compared with the pathological grading. Iso/hypo-PNETs comprised 26 tumors, and hyper-PNETs comprised 35 tumors. Not only hyper-PNETs but also most iso/hypo-PNETs showed peak enhancement in the pancreatic phase and a washout from the portal venous phase to the delayed phase. Iso/hypo-PNETs showed larger tumor size than the hyper-PNETs (mean, 3.7 cm vs. 1.6 cm; P<0.001), and were significantly correlated with unclear tumor margins (n=4 vs. n=0; P=0.029), the existence of cystic components (n=10 vs. n=3; P=0.006), intratumoral blood vessels in the early arterial phase (n=13 vs. n=3; P<0.001), and a smooth rim enhancement in the delayed phase (n=12 vs. n=6; P=0.019). Iso/hypo-PNETs also showed significantly higher pathological grading (WHO 2010 classification; iso/hypo, G1=14, G2=11, G3=1; hyper, G1=34, G2=1; P<0.001). PNETs containing iso/hypo-areas showed a rapid enhancement pattern as well as hyper-PNETs, various radiological features and higher malignant potential. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Assessment of Parametrial Response by Growth Pattern in Patients With International Federation of Gynecology and Obstetrics Stage IIB and IIIB Cervical Cancer: Analysis of Patients From a Prospective, Multicenter Trial (EMBRACE)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshida, Kenji; Kobe University Graduate School of Medicine, Kobe; Jastaniyah, Noha

    Purpose: To assess disease response along the parametrial space according to tumor morphology in patients with International Federation of Gynecology and Obstetrics (FIGO) stage IIB and IIIB cervical cancer at the time of image-guided adaptive brachytherapy. Methods and Materials: Patients with FIGO stage IIB and IIIB cervical cancer registered as of November 2013 in the EMBRACE study were evaluated. Tumors were stratified according to morphologic subtype on magnetic resonance imaging (expansive and infiltrative), and the characteristics of those subtypes were analyzed. Parametrial involvement at diagnosis and at brachytherapy was evaluated, and the response to chemo-radiotherapy was classified as good, moderate,more » or poor. The response grade was compared between the 2 groups and analyzed with regard to tumor volumes, and dosimetric parameters. Results: A total of 452 patients were evaluated, of whom 186 had expansive growth type and 266 had infiltrative morphology. Patients with infiltrative tumors had more extensive disease, as indicated by a higher rate of FIGO stage IIIB disease, as well as radiologic evidence of extension into the distal parametrial space and to the pelvic side wall on magnetic resonance imaging. Cervical necrosis was more common in the infiltrative group. Good response was more common in the expansive group (34% vs 24%; P=.02), and poor response was more common in the infiltrative group (11% and 19%; P=.02). Mean gross tumor volume at diagnosis was equal in both groups (51.7 cm{sup 3}). The high-risk clinical target volume was larger in infiltrative tumors (37.9 cm{sup 3} vs 33.3 cm{sup 3}, P=.005). The mean high-risk clinical target volume D{sub 90} was slightly higher in expansive tumors (92.7 Gy and 89.4 Gy, P<.001). Conclusion: Infiltrative tumors are more advanced at presentation and respond less favorably to chemo-radiotherapy when compared with expansive tumors that are more or less equivalent in size. The use of image-guided adaptive brachytherapy allows achieving reasonably high doses in both groups.« less

  15. Acinic Cell Carcinoma of the Parotid Gland with Four Morphological Features

    PubMed Central

    Rosero, David S; Alvarez, Ramiro; Gambó, Paula; Alastuey, María; Valero, Alberto; Torrecilla, Nerea; Roche, A. Belén; Simón, Sara

    2016-01-01

    Acinic cell carcinoma arising in salivary glands is a rare tumor, accounting for 2% to 5% of the primary neoplasms of the parotid gland. When these tumors are well-differentiated, the neoplasia has innocuous aspect, due to the similarity to normal parotid tissue. This makes the diagnosis difficult. Initially the malignancy of this tumor was uncertain; however, recent studies have declared it as malignant. The female / male ratio is 3:2. The nodule usually presents as solitary and well defined shape. Several authors have used different terms to describe histomorphological patterns of these tumors. Four descriptive categories (solid, microcystic, papillary-cystic and follicular) are useful for pathologists. Here we report a case of a 49 yr old man with a left parotid nodule of 5 cm. Parotidectomy was performed at the Hospital Universitario Miguel Servet, in Zaragoza (Spain). The microscopy showed a tumor with acinic semblance, having the four morphologic patterns previously described. The morphological and immunohistochemical study was consistent with the diagnosis of acinic cell carcinoma. PMID:27499783

  16. Acinic Cell Carcinoma of the Parotid Gland with Four Morphological Features.

    PubMed

    Rosero, David S; Alvarez, Ramiro; Gambó, Paula; Alastuey, María; Valero, Alberto; Torrecilla, Nerea; Roche, A Belén; Simón, Sara

    2016-01-01

    Acinic cell carcinoma arising in salivary glands is a rare tumor, accounting for 2% to 5% of the primary neoplasms of the parotid gland. When these tumors are well-differentiated, the neoplasia has innocuous aspect, due to the similarity to normal parotid tissue. This makes the diagnosis difficult. Initially the malignancy of this tumor was uncertain; however, recent studies have declared it as malignant. The female / male ratio is 3:2. The nodule usually presents as solitary and well defined shape. Several authors have used different terms to describe histomorphological patterns of these tumors. Four descriptive categories (solid, microcystic, papillary-cystic and follicular) are useful for pathologists. Here we report a case of a 49 yr old man with a left parotid nodule of 5 cm. Parotidectomy was performed at the Hospital Universitario Miguel Servet, in Zaragoza (Spain). The microscopy showed a tumor with acinic semblance, having the four morphologic patterns previously described. The morphological and immunohistochemical study was consistent with the diagnosis of acinic cell carcinoma.

  17. Neuroendocrine differentiation in basal cell carcinoma.

    PubMed

    Houcine, Yoldez; Chelly, Ines; Zehani, Alia; Belhaj Kacem, Linda; Azzouz, Haifa; Rekik, Wafa; C, Hend; Haouet, Slim; Kchir, Nidhameddine

    2017-01-01

    Basal cell carcinoma (BCC) is the prototypical basaloid tumor of the skin. It may show various patterns simulating other cutaneous tumors due to its pleomorphism. It may have an unusal pattern of differentiation such as squamous, sebaceous, apocrine, eccrine, pilar, and endocrine differentiation. In order to establish the relative frequency of neuroendocrine differentiation in BCC, we performed a retrospective study of 33 consecutive BCCs using conventional immunohistochemistry with two neuroendocrine antibodies: Chromogranine A and synaptophysine. The age of the patients ranged from 17-83 years with mean of 65 years. The male to female ratio was 16:17. In immunohistochimestry, Chromogranine A was seen in 72.2% (24/33) while Synaptophysine was positive in 9.09% (3/33). Their expression was cytoplasmic and membranous and was seen in the periphery of these tumors in the overlying cells. Positive staining of chromogranine A was high (75-100% of tumors cells) in 9%, intermediate (25-75% of tumors cells) in 33% of cases and relatively low (<25%) in 30.3% of cases.

  18. Pre-clinical analysis of changes in intra-cellular biochemistry of glioblastoma multiforme (GBM) cells due to c-Myc silencing.

    PubMed

    Rajagopalan, Vishal; Vaidyanathan, Muthukumar; Janardhanam, Vanisree Arambakkam; Bradner, James E

    2014-10-01

    Glioblastoma Multiforme (GBM) is an aggressive form of brain Tumor that has few cures. In this study, we analyze the anti-proliferative effects of a new molecule JQ1 against GBMs induced in Wistar Rats. JQ1 is essentially a Myc inhibitor. c-Myc is also known for altering the biochemistry of a tumor cell. Therefore, the study is intended to analyze certain other oncogenes associated with c-Myc and also the change in cellular biochemistry upon c-Myc inhibition. The quantitative analysis of gene expression gave a co-expressive pattern for all the three genes involved namely; c-Myc, Bcl-2, and Akt. The cellular biochemistry analysis by transmission electron microscopy revealed high glycogen and lipid aggregation in Myc inhibited cells and excessive autophagy. The study demonstrates the role of c-Myc as a central metabolic regulator and Bcl-2 and Akt assisting in extending c-Myc half-life as well as in regulation of autophagy, so as to regulate cell survival on the whole. The study also demonstrates that transient treatment by JQ1 leads to aggressive development of tumor and therefore, accelerating death, emphasizing the importance of dosage fixation, and duration for clinical use in future.

  19. A Catalogue of Putative cis-Regulatory Interactions Between Long Non-coding RNAs and Proximal Coding Genes Based on Correlative Analysis Across Diverse Human Tumors.

    PubMed

    Basu, Swaraj; Larsson, Erik

    2018-05-31

    Antisense transcripts and other long non-coding RNAs are pervasive in mammalian cells, and some of these molecules have been proposed to regulate proximal protein-coding genes in cis For example, non-coding transcription can contribute to inactivation of tumor suppressor genes in cancer, and antisense transcripts have been implicated in the epigenetic inactivation of imprinted genes. However, our knowledge is still limited and more such regulatory interactions likely await discovery. Here, we make use of available gene expression data from a large compendium of human tumors to generate hypotheses regarding non-coding-to-coding cis -regulatory relationships with emphasis on negative associations, as these are less likely to arise for reasons other than cis -regulation. We document a large number of possible regulatory interactions, including 193 coding/non-coding pairs that show expression patterns compatible with negative cis -regulation. Importantly, by this approach we capture several known cases, and many of the involved coding genes have known roles in cancer. Our study provides a large catalog of putative non-coding/coding cis -regulatory pairs that may serve as a basis for further experimental validation and characterization. Copyright © 2018 Basu and Larsson.

  20. Reconstruction of the Midfoot Using a Free Vascularized Fibular Graft After En Bloc Excision for Giant Cell Tumor of the Tarsal Bones: A Case Report.

    PubMed

    Hara, Hitomi; Kawamoto, Teruya; Onishi, Yasuo; Fujioka, Hiroyuki; Nishida, Kotaro; Kuroda, Ryosuke; Kurosaka, Masahiro; Akisue, Toshihiro

    2016-01-01

    We report the case of a 32-year-old Japanese female with a giant cell tumor of bone involving multiple midfoot bones. Giant cell tumors of bone account for approximately 5% of all primary bone tumors and most often arise at the ends of long bones. The small bones, such as those of the hands and feet, are rare sites for giant cell tumors. Giant cell tumors of the small bones tend to exhibit more aggressive clinical behavior than those of the long bones. The present patient underwent en bloc tumor excision involving multiple tarsals and metatarsals. We reconstructed the longitudinal arch of the foot with a free vascularized fibular graft. At the 2-year follow-up visit, bony union had been achieved, with no tumor recurrence. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  1. Dietary Patterns and Risk of Colorectal Cancer: Analysis by Tumor Location and Molecular Subtypes.

    PubMed

    Mehta, Raaj S; Song, Mingyang; Nishihara, Reiko; Drew, David A; Wu, Kana; Qian, Zhi Rong; Fung, Teresa T; Hamada, Tsuyoshi; Masugi, Yohei; da Silva, Annacarolina; Shi, Yan; Li, Wanwan; Gu, Mancang; Willett, Walter C; Fuchs, Charles S; Giovannucci, Edward L; Ogino, Shuji; Chan, Andrew T

    2017-06-01

    Western and prudent dietary patterns have been associated with higher and lower risks of colorectal cancer (CRC), respectively. However, little is known about the associations between dietary patterns and specific anatomic subsites or molecular subtypes of CRC. We used multivariable Cox proportional hazards models to examine the associations between Western and prudent dietary patterns and CRC risk in the Health Professionals Follow-up Study and Nurses' Health Study. After up to 32 years of follow-up of 137,217 men and women, we documented 3260 cases of CRC. Among individuals from whom subsite data were available, we observed 1264 proximal colon, 866 distal colon, and 670 rectal tumors. Western diet was associated with an increased incidence of CRC (P trend < .0001), with a relative risk (RR) of 1.31 (95% CI, 1.15-1.48, comparing the highest to lowest quartile). The association of Western diet with CRC was evident for tumors of the distal colon (RR, 1.55; 95% CI, 1.22-1.96; P trend  = .0004) and rectum (RR, 1.35; 95% CI, 1.03-1.77; P trend  = .01) but not proximal colon (RR, 1.11; 95% CI, 0.91-1.35; P trend  = .51) when we comparing extreme quartiles. In contrast, for the prudent pattern, we observed a RR of 0.86 for overall CRC (95% CI, 0.77-0.95; P trend  = .01), with similar trends at anatomic subsites. However, the trend appeared stronger among men than women. Among 1285 cases (39%) with tissue available for molecular profiling, Western diet appeared to be more strongly associated with some CRC molecular subtypes (no mutations in KRAS [KRAS wildtype] or BRAF [BRAF wildtype], no or a low CpG island methylator phenotype, and microsatellite stability), although formal tests for heterogeneity did not produce statistically significant results. Western dietary patterns are associated with an increased risk of CRC, particularly distal colon and rectal tumors. Western dietary patterns also appear more strongly associated with tumors that are KRAS wildtype, BRAF wildtype, have no or a low CpG island methylator phenotype, and microsatellite stability. In contrast, prudent dietary patterns are associated with a lower risk of CRC that does not vary according to anatomic subsite or molecular subtype. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  2. Organ Preference of Cancer Metastasis and Metastasis-Related Cell Adhesion Molecules Including Carbohydrates.

    PubMed

    Kawaguchi, Takanori

    2016-01-01

    This review starts on one of our special interests, the organ preference of metastasis. We examined data on 1,117 autopsy cases and found that the organ distribution of metastasis of cancers of the lung, pancreas, stomach, colon, rectum, uterine cervix, liver, bile duct, and esophagus involved the lung, liver, adrenal gland, bone/bone marrow, lymph node, and pleura/peritoneum. Cancers of the kidney, thyroid, ovary, choriocarcinoma, and breast, however, manifested different metastatic patterns. The distribution of leukemia and lymphoma metastases was quite different from that of epithelial cancers. On the basis of experimental studies, we believe that the anatomical-mechanical hypothesis should be replaced by the microinjury hypothesis, which suggests that tissue microinjury induced by temporal tumor cell embolization is crucial for successful metastasis. This hypothesis may actually reflect the so-called inflammatory oncotaxis concept. To clarify the mechanisms underlying metastasis, we developed an experimental model system of a rat hepatoma AH7974 that embraced substrate adhesiveness. This model did not prove a relationship between substrate-adhesion potential and metastatic lung-colonizing potential of tumor cells, but metastatic potential was correlated with the expression of the laminin carbohydrate that was recognized by Griffonia (Bandeiraea) simplicifolia isolectin G4. Therefore, we investigated the relationship between carbohydrate expression profiles and metastasis and prognosis. We indeed found an intimate relationship between the carbohydrate expression of cancer cells and the progression of malignant tumors, organ preference of metastasis, metastatic potential of tumor cells, and prognosis of patients.

  3. The nuclear bile acid receptor FXR controls the liver derived tumor suppressor histidine-rich glycoprotein.

    PubMed

    Deuschle, Ulrich; Birkel, Manfred; Hambruch, Eva; Hornberger, Martin; Kinzel, Olaf; Perović-Ottstadt, Sanja; Schulz, Andreas; Hahn, Ulrike; Burnet, Michael; Kremoser, Claus

    2015-06-01

    The nuclear bile acid receptor Farnesoid X receptor (FXR) is strongly expressed in liver and intestine, controls bile acid and lipid homeostasis and exerts tumor-protective functions in liver and intestine. Histidine-rich glycoprotein (HRG) is an abundant plasma protein produced by the liver with the proposed function as a pattern recognition molecule involved in the clearance of immune complexes, necrotic cells and pathogens, the modulation of angiogenesis, the normalization of deranged endothelial vessel structure in tumors and tumor suppression. FXR recognition sequences were identified within a human HRG promoter fragment that mediated FXR/FXR-agonist dependent reporter gene activity in vitro. We show that HRG is a novel transcriptional target gene of FXR in human hepatoma cells, human upcyte® primary hepatocytes and 3D human liver microtissues in vitro and in mouse liver in vivo. Prolonged administration of the potent nonsteroidal FXR agonist PX20606 increases HRG levels in mouse plasma. Finally, daily oral administration of this FXR agonist for seven days resulted in a significant increase of HRG levels in the plasma of healthy human male volunteers during a clinical Phase I safety study. HRG might serve as a surrogate marker indicative of liver-specific FXR activation in future human clinical studies. Furthermore, potent FXR agonists might be beneficial in serious health conditions where HRG is reduced, for example, in hepatocellular carcinoma but also other solid cancers, liver failure, sepsis and pre-eclampsia. © 2014 UICC.

  4. Warthin tumor of the upper lip: an unusual location of a benign salivary gland tumor.

    PubMed

    dos Santos Almeida, Aroldo; Costa Hanemann, João Adolfo; Tostes Oliveira, Denise

    2011-06-01

    Warthin tumor (papillary cystadenoma lymphomatosum) is a benign salivary gland tumor involving almost exclusively the parotid gland. The lip is a very unusual location for this type of tumor, which develops only rarely in minor salivary glands. The case of 42-year-old woman with Warthin tumor arising in minor salivary glands of the upper lip is reported.

  5. Vasculogenic Mimicry and Tumor Angiogenesis

    PubMed Central

    Folberg, Robert; Hendrix, Mary J. C.; Maniotis, Andrew J.

    2000-01-01

    Tumors require a blood supply for growth and hematogenous dissemination. Much attention has been focused on the role of angiogenesis—the recruitment of new vessels into a tumor from pre-existing vessels. However, angiogenesis may not be the only mechanism by which tumors acquire a microcirculation. Highly aggressive and metastatic melanoma cells are capable of forming highly patterned vascular channels in vitro that are composed of a basement membrane that stains positive with the periodic acid-Schiff (PAS) reagent in the absence of endothelial cells and fibroblasts. These channels formed in vitro are identical morphologically to PAS-positive channels in histological preparations from highly aggressive primary uveal melanomas, in the vertical growth phase of cutaneous melanomas, and in metastatic uveal and cutaneous melanoma. The generation of microvascular channels by genetically deregulated, aggressive tumor cells was termed “vasculogenic mimicry” to emphasize their de novo generation without participation by endothelial cells and independent of angiogenesis. Techniques designed to identify the tumor microcirculation by the staining of endothelial cells may not be applicable to tumors that express vasculogenic mimicry. Although it is not known if therapeutic strategies targeting endothelial cells will be effective in tumors whose blood supply is formed by tumor cells in the absence of angiogenesis, the biomechanical and molecular events that regulate vasculogenic mimicry provide opportunities for the development of novel forms of tumor-targeted treatments. The unique patterning characteristic of vasculogenic mimicry provides an opportunity to design noninvasive imaging techniques to detect highly aggressive neoplasms and their metastases. PMID:10666364

  6. A giant mesentery malignant solitary fibrous tumor recurring as dedifferentiated liposarcoma- a report of a very rare case and literature review.

    PubMed

    Liu, Yang; Ishibashi, Haruaki; Sako, Shozou; Takeshita, Kazuyoshi; Li, Yan; Elnemr, Ayman; Yonemura, Yutaka

    2013-11-01

    We report a case of a 59-year-old woman with a very rare giant mesentery malignant solitary fibrous tumor that recurred as dedifferentiated liposarcoma. The woman was admitted to the hospital because of low abdominal pain. Radiological and biopsy findings revealed a multi-lobulated giant malignant solitary fibrous tumor that had invaded the inferior vena cava, abdominal aorta, and superior mesentery vessels. The tumor was completely removed during the first cytoreductive surgery. Histopathologically, tumor had a heterogeneous cell population, composed of spindle cells with fibrous collagen proliferation. The spindle cells were not arranged in a specific pattern. Immunohistochemistry revealed that the tumor cells were positive for CD34, CD99, Bcl-2, and smooth muscle actin( SMA) and negative for CD117, epithelial membrane antigen (EMA), CAM5.7, S100, desmin, and caldesmon. The tumor recurred 9 months after surgery, and another cytoreductive surgery was then performed. The postoperative histopathological appearance of the invaded area indicated a well-differentiated liposarcoma. Formation of tumorous bone was also noted in the same area, in addition to atypical mesenchymal cells and multi-vacuolated lipoblasts in the area of the well-differentiated liposarcoma. Proliferated spindle cells arranged in a storiform pattern were found in the area adjacent to the tumor. Immunohistochemical analysis revealed that the tumors cells were positive for SMA, HHF-35, and caldesmon and negative for CD117, CD34, and S100. A diagnosis of dedifferentiated liposarcoma was made.

  7. Immunohistochemical features of the gastrointestinal tract tumors

    PubMed Central

    Wong, Hannah H.

    2012-01-01

    Gastrointestinal tract tumors include a wide variety of vastly different tumors and on a whole are one of the most common malignancies in western countries. These tumors often present at late stages as distant metastases which are then biopsied and may be difficult to differentiate without the aid of immunohistochemical stains. With the exception of pancreatic and biliary tumors where there are no distinct immunohistochemical patterns, most gastrointestinal tumors can be differentiated by their unique immunohistochemical profile. As the size of biopsies decrease, the role of immunohistochemical stains will become even more important in determining the origin and differentiation of gastrointestinal tract tumors. PMID:22943017

  8. Quantitative characterization of metastatic disease in the spine. Part I. Semiautomated segmentation using atlas-based deformable registration and the level set method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hardisty, M.; Gordon, L.; Agarwal, P.

    2007-08-15

    Quantitative assessment of metastatic disease in bone is often considered immeasurable and, as such, patients with skeletal metastases are often excluded from clinical trials. In order to effectively quantify the impact of metastatic tumor involvement in the spine, accurate segmentation of the vertebra is required. Manual segmentation can be accurate but involves extensive and time-consuming user interaction. Potential solutions to automating segmentation of metastatically involved vertebrae are demons deformable image registration and level set methods. The purpose of this study was to develop a semiautomated method to accurately segment tumor-bearing vertebrae using the aforementioned techniques. By maintaining morphology of anmore » atlas, the demons-level set composite algorithm was able to accurately differentiate between trans-cortical tumors and surrounding soft tissue of identical intensity. The algorithm successfully segmented both the vertebral body and trabecular centrum of tumor-involved and healthy vertebrae. This work validates our approach as equivalent in accuracy to an experienced user.« less

  9. Methylation alterations are not a major cause of PTTG1 missregulation

    PubMed Central

    Hidalgo, Manuel; Galan, Jose Jorge; Sáez, Carmen; Ferrero, Eduardo; Castilla, Carolina; Ramirez-Lorca, Reposo; Pelaez, Pablo; Ruiz, Agustin; Japón, Miguel A; Royo, Jose Luis

    2008-01-01

    Background On its physiological cellular context, PTTG1 controls sister chromatid segregation during mitosis. Within its crosstalk to the cellular arrest machinery, relies a checkpoint of integrity for which gained the over name of securin. PTTG1 was found to promote malignant transformation in 3T3 fibroblasts, and further found to be overexpressed in different tumor types. More recently, PTTG1 has been also related to different processes such as DNA repair and found to trans-activate different cellular pathways involving c-myc, bax or p53, among others. PTTG1 over-expression has been correlated to a worse prognosis in thyroid, lung, colorectal cancer patients, and it can not be excluded that this effect may also occur in other tumor types. Despite the clinical relevance and the increasing molecular characterization of PTTG1, the reason for its up-regulation remains unclear. Method We analysed PTTG1 differential expression in PC-3, DU-145 and LNCaP tumor cell lines, cultured in the presence of the methyl-transferase inhibitor 5-Aza-2'-deoxycytidine. We also tested whether the CpG island mapping PTTG1 proximal promoter evidenced a differential methylation pattern in differentiated thyroid cancer biopsies concordant to their PTTG1 immunohistochemistry status. Finally, we performed whole-genome LOH studies using Affymetix 50 K microarray technology and FRET analysis to search for allelic imbalances comprising the PTTG1 locus. Conclusion Our data suggest that neither methylation alterations nor LOH are involved in PTTG1 over-expression. These data, together with those previously reported, point towards a post-transcriptional level of missregulation associated to PTTG1 over-expression. PMID:18426563

  10. Epidemiology, Risk Factors and Tumor Profiles of Breast Cancer in Bangladeshi underprivileged women.

    PubMed

    Rahman, M; Ahsan, A; Begum, F; Rahman, K

    2015-01-01

    Similar to cancer statistics in developed countries, breast cancer is also the leading cause of cancer-related death in the women population of Bangladesh particularly the poor and underprivileged. The objective of this study was to study the socio-demography, tumor patterns and risk factors that affect these women from Dhaka and Bangladesh in general. This cross-sectional study involved 250 patients who presented to NICRH, Dhaka for treatment. These patients were interviewed, physically examined and vital information were gathered using approved questionnaires. Various personal, social, reproductive and tumor related factors were recorded and analyzed. The mean age of the study group was 44.7 years, standard deviation (SD) was 9.82 (range: 21-67), 87% have children, 57.2% were postmenopausal, 92% were housewives, 51.4% were illiterate, 62% attended 6 months after initiation of symptoms, 72% of the patients' yearly family income were less than US$1000/year. Almost 100% of the patients gave history of cooking from wooden fire source in the rural areas. In our study group, 79.7 percent women were within the group of BMI 20 kg/m2or more. Locally advanced breast cancer patients (T3 and T4) were 52.6%, axillary lymph node involvement was present in 80% of cases, 61.6 % patient received neoadjuvant chemotherapy. In the elderly group (above 40 years) Estrogen receptor was positive in 53.2% cases, 26.6% were Triple negative breast cancer patients. Women with poor socio-economic status and have none or low educational level are often victims of late presentation and tend to have a higher stage at diagnosis. Poverty, literacy and assorted risk factors have influenced the outcome of breast cancer cases among Bangladeshi women.

  11. Release of Membrane-Bound Vesicles and Inhibition of Tumor Cell Adhesion by the Peptide Neopetrosiamide A

    PubMed Central

    Austin, Pamela; Heller, Markus; Williams, David E.; McIntosh, Lawrence P.; Vogl, A. Wayne; Foster, Leonard J.; Andersen, Raymond J.; Roberge, Michel; Roskelley, Calvin D.

    2010-01-01

    Background Neopetrosiamide A (NeoA) is a 28-amino acid tricyclic peptide originally isolated from a marine sponge as a tumor cell invasion inhibitor whose mechanism of action is unknown. Methodology/Principal Findings We show that NeoA reversibly inhibits tumor cell adhesion, disassembles focal adhesions in pre-attached cells, and decreases the level of β1 integrin subunits on the cell surface. NeoA also induces the formation of dynamic, membrane-bound protrusions on the surface of treated cells and the release of membrane-bound vesicles into the culture medium. Proteomic analysis indicates that the vesicles contain EGF and transferrin receptors as well as a number of proteins involved in adhesion and migration including: β1 integrin and numerous α integrin subunits; actin and actin-binding proteins such as cofilin, moesin and myosin 1C; and membrane modulating eps15 homology domain (EHD) proteins. Surface labeling, trafficking inhibition, and real-time imaging experiments all suggest that β1 integrin-containing vesicles are released directly from NeoA-induced cell surface protrusions rather than from vesicles generated intracellularly. The biological activity of NeoA is dependent on its disulfide bond pattern and NMR spectroscopy indicates that the peptide is globular with a continuous ridge of hydrophobic groups flanked by charged amino acid residues that could facilitate a simultaneous interaction with lipids and proteins in the membrane. Conclusions/Significance NeoA is an anti-adhesive peptide that decreases cell surface integrin levels through a novel, yet to be elucidated, mechanism that involves the release of adhesion molecule-containing vesicles from the cell surface. PMID:20520768

  12. Identification of micro-RNA expression profile related to recurrence in women with ESMO low-risk endometrial cancer.

    PubMed

    de Foucher, Tiphaine; Sbeih, Maria; Uzan, Jenifer; Bendifallah, Sofiane; Lefevre, Marine; Chabbert-Buffet, Nathalie; Aractingi, Selim; Uzan, Catherine; Abd Alsalam, Issam; Mitri, Rana; Fontaine, Romain H; Daraï, Emile; Haddad, Bassam; Méhats, Céline; Ballester, Marcos; Canlorbe, Geoffroy; Touboul, Cyril

    2018-05-21

    Actual European pathological classification of early-stage endometrial cancer (EC) may show insufficient accuracy to precisely stratify recurrence risk, leading to potential over or under treatment. Micro-RNAs are post-transcriptional regulators involved in carcinogenic mechanisms, with some micro-RNA patterns of expression associated with EC characteristics and prognosis. We previously demonstrated that downregulation of micro-RNA-184 was associated with lymph node involvement in low-risk EC (LREC). The aim of this study was to evaluate whether micro-RNA signature in tumor tissues from LREC women can be correlated with the occurrence of recurrences. MicroRNA expression was assessed by chip analysis and qRT-PCR in 7 formalin-fixed paraffin-embedded (FFPE) LREC primary tumors from women whose follow up showed recurrences (R+) and in 14 FFPE LREC primary tumors from women whose follow up did not show any recurrence (R-), matched for grade and age. Various statistical analyses, including enrichment analysis and a minimum p-value approach, were performed. The expression levels of micro-RNAs-184, -497-5p, and -196b-3p were significantly lower in R+ compared to R- women. Women with a micro-RNA-184 fold change < 0.083 were more likely to show recurrence (n = 6; 66%) compared to those with a micro-RNA-184 fold change > 0.083 (n = 1; 8%), p = 0.016. Women with a micro-RNA-196 fold change < 0.56 were more likely to show recurrence (n = 5; 100%) compared to those with a micro-RNA-196 fold change > 0.56 (n = 2; 13%), p = 0.001. These findings confirm the great interest of micro-RNA-184 as a prognostic tool to improve the management of LREC women.

  13. Color-coded Imaging Enables Fluorescence-guided Surgery to Resect the Tumor Along with the Tumor Microenvironment in a Syngeneic Mouse Model of EL-4 Lymphoma.

    PubMed

    Hasegawa, Kosuke; Suetsugu, Atsushi; Nakamura, Miki; Matsumoto, Takuro; Kunisada, Takahiro; Shimizu, Masahito; Saji, Shigetoyo; Moriwaki, Hisataka; Bouvet, Michael; Hoffman, Robert M

    2016-09-01

    Fluorescence-guided surgery (FGS) of cancer is an emerging technology. We have previously shown the importance of resecting both the tumor and the tumor microenvironment (TME) for curative FGS. We also previously developed a syngeneic model using the mouse lymphoma cell line EL-4, expressing red fluorescent protein (EL-4-RFP), growing in green fluorescent protein (GFP) transgenic mice, which we have used in the present report to develop FGS of the tumor microenvironment. EL-4-RFP lymphoma cells were injected subcutaneously in C57/BL6 GFP transgenic mice. EL-4-RFP cells subsequently formed tumors by 35 days after cell transplantation. Using the portable hand-held Dino-Lite digital imaging system, subcutaneous tumors were resected by FGS. Resected tumor tissues were visualized with the Olympus FV1000 confocal microscope. Using the Dino-Lite, subcutaneous tumors and the tumor microenvironment were clearly visualized and resected. In the resected tumor, host stromal cells, including adipocyte-like cells and blood vessels with lymphocytes, were observed by confocal microscopy in addition to cancer cells by color-coded confocal imaging. The cancer cells and stromal cells in the TME were deeply intermingled in a highly-complex pattern. Color-coded FGS is an effective method to completely resect cancer cells along with the stromal cells in the TME which interact in a highly-complex pattern. Microscopically, cancer cells invade the TME and vice versa. To prevent tumor recurrence, it is necessary to resect the TME along with the tumor. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  14. Pattern of Retained Contrast on Immediate Postprocedure Computed tomography (CT) After Particle Embolization of Liver Tumors Predicts Subsequent Treatment Response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Xiaodong, E-mail: wangxde@gmail.com; Erinjeri, Joseph P., E-mail: erinjerj@mskcc.org; Jia Xiaoyu, E-mail: jiax@mskcc.org

    2013-08-01

    PurposeTo determine if the pattern of retained contrast on immediate postprocedure computed tomography (CT) after particle embolization of hepatic tumors predicts modified Response Evaluation Criteria in Solid Tumors (mRECIST) response.Materials and MethodsThis study was approved by the Institutional Review Board with a waiver of authorization. One hundred four liver tumors were embolized with spherical embolic agents (Embospheres, Bead Block, LC Bead) and polyvinyl alcohol. Noncontrast CT was performed immediately after embolization to assess contrast retention in the targeted tumors, and treatment response was assessed by mRECIST criteria on follow-up CT (average time 9.0 {+-} 7.7 weeks after embolization). Tumor contrastmore » retention (TCR) was determined based on change in Hounsfield units (HUs) of the index tumors between the preprocedure and immediate postprocedure scans; vascular contrast retention (VCR) was rated; and defects in contrast retention (DCR) were also documented. The morphology of residual enhancing tumor on follow-up CT was described as partial, circumferential, or total. Association between TCR variables and tumor response were assessed using multivariate logistic regression.ResultsOf 104 hepatic tumors, 51 (49 %) tumors had complete response (CR) by mRECIST criteria; 23 (22.1 %) had partial response (PR); 21 (20.2 %) had stable disease (SD); and 9 (8.7 %) had progressive disease (PD). By multivariate analysis, TCR, VCR, and tumor size are independent predictors of CR (p = 0.02, 0.05, and 0.005 respectively). In 75 tumors, DCR was found to be an independent predictor of failure to achieve complete response (p < 0.0001) by imaging criteria.ConclusionTCR, VCR, and DCR on immediate posttreatment CT are independent predictors of CR by mRECIST criteria.« less

  15. T Lymphocyte Inhibition by Tumor-Infiltrating Dendritic Cells Involves Ectonucleotidase CD39 but Not Arginase-1

    PubMed Central

    Trad, Malika; Gautheron, Alexandrine; Fraszczak, Jennifer; Larmonier, Claire; LaCasse, Collin J.; Centuori, Sara; Audia, Sylvain; Samson, Maxime; Ciudad, Marion; Bonnefoy, Francis; Lemaire-Ewing, Stéphanie; Katsanis, Emmanuel; Perruche, Sylvain; Saas, Philippe; Bonnotte, Bernard

    2015-01-01

    T lymphocytes activated by dendritic cells (DC) which present tumor antigens play a key role in the antitumor immune response. However, in patients suffering from active cancer, DC are not efficient at initiating and supporting immune responses as they participate to T lymphocyte inhibition. DC in the tumor environment are functionally defective and exhibit a characteristic of immature phenotype, different to that of DC present in nonpathological conditions. The mechanistic bases underlying DC dysfunction in cancer responsible for the modulation of T-cell responses and tumor immune escape are still being investigated. Using two different mouse tumor models, we showed that tumor-infiltrating DC (TIDC) are constitutively immunosuppressive, exhibit a semimature phenotype, and impair responder T lymphocyte proliferation and activation by a mechanism involving CD39 ectoenzyme. PMID:26491691

  16. Epigenetic modifiers in immunotherapy: a focus on checkpoint inhibitors.

    PubMed

    Terranova-Barberio, Manuela; Thomas, Scott; Munster, Pamela N

    2016-06-01

    Immune surveillance should be directed to suppress tumor development and progression, involving a balance of coinhibitory and costimulatory signals that amplify immune response without overwhelming the host. Immunotherapy confers durable clinical benefit in 'immunogenic tumors', whereas in other tumors the responses are modest. Thus, immune checkpoint inhibitors may need to be combined with strategies to boost immune response or increase the tumor immune profile. Epigenetic aberrations contribute significantly to carcinogenesis. Recent findings suggest that epigenetic drugs prime the immune response by increasing expression of tumor-associated antigens and immune-related genes, as well as modulating chemokines and cytokines involved in immune system activation. This review describes our current understanding regarding epigenetic and immunotherapy combination, focusing on immune response priming to checkpoint blockade.

  17. An integrative approach to assess X-chromosome inactivation using allele-specific expression with applications to epithelial ovarian cancer.

    PubMed

    Larson, Nicholas B; Fogarty, Zachary C; Larson, Melissa C; Kalli, Kimberly R; Lawrenson, Kate; Gayther, Simon; Fridley, Brooke L; Goode, Ellen L; Winham, Stacey J

    2017-12-01

    X-chromosome inactivation (XCI) epigenetically silences transcription of an X chromosome in females; patterns of XCI are thought to be aberrant in women's cancers, but are understudied due to statistical challenges. We develop a two-stage statistical framework to assess skewed XCI and evaluate gene-level patterns of XCI for an individual sample by integration of RNA sequence, copy number alteration, and genotype data. Our method relies on allele-specific expression (ASE) to directly measure XCI and does not rely on male samples or paired normal tissue for comparison. We model ASE using a two-component mixture of beta distributions, allowing estimation for a given sample of the degree of skewness (based on a composite likelihood ratio test) and the posterior probability that a given gene escapes XCI (using a Bayesian beta-binomial mixture model). To illustrate the utility of our approach, we applied these methods to data from tumors of ovarian cancer patients. Among 99 patients, 45 tumors were informative for analysis and showed evidence of XCI skewed toward a particular parental chromosome. For 397 X-linked genes, we observed tumor XCI patterns largely consistent with previously identified consensus states based on multiple normal tissue types. However, 37 genes differed in XCI state between ovarian tumors and the consensus state; 17 genes aberrantly escaped XCI in ovarian tumors (including many oncogenes), whereas 20 genes were unexpectedly inactivated in ovarian tumors (including many tumor suppressor genes). These results provide evidence of the importance of XCI in ovarian cancer and demonstrate the utility of our two-stage analysis. © 2017 WILEY PERIODICALS, INC.

  18. Disorganized Steroidogenesis in Adrenocortical Carcinoma, a Case Study.

    PubMed

    Uchida, Toyoyoshi; Nishimoto, Koshiro; Fukumura, Yuki; Asahina, Miki; Goto, Hiromasa; Kawano, Yui; Shimizu, Fumitaka; Tsujimura, Akira; Seki, Tsugio; Mukai, Kuniaki; Kabe, Yasuaki; Suematsu, Makoto; Gomez-Sanchez, Celso E; Yao, Takashi; Horie, Shigeo; Watada, Hirotaka

    2017-03-01

    Most adrenocortical carcinomas (ACCs) produce excessive amounts of steroid hormones including aldosterone, cortisol, and steroid precursors. However, aldosterone- and cortisol-producing cells in ACCs have not yet been immunohistochemically described. We present a case of ACC causing mild primary aldosteronism and subclinical Cushing's syndrome. Removal of the tumor cured both conditions. In order to examine the expression patterns of the steroidogenic enzymes responsible for adrenocortical hormone production, 10 tumor portions were immunohistochemically analyzed for aldosterone synthase (CYP11B2), 11β-hydroxylase (CYP11B1, cortisol-synthesizing enzyme), 3β-hydroxysteroid dehydrogenase (3βHSD, upstream enzyme for both CYP11B2 and CYP11B1), and 17α-hydroxylase/C17-20 lyase (CYP17, upstream enzyme for CYP11B1, but not for CYP11B1). CYP11B2, CYP11B1, and 3βHSD were expressed sporadically, and their expression patterns varied significantly among the different tumor portions examined. The expression of these enzymes was random and not associated with each other. CYP17 was expressed throughout the tumor, even in CYP11B2-positive cells. Small tumor cell populations were aldosterone- or cortisol-producing cells, as judged by 3βHSD coinciding with either CYP11B2 or CYP11B1, respectively. These results suggest that the tumor produced limited amounts of aldosterone and cortisol due to the lack of the coordinated expression of steroidogenic enzymes, which led to mild clinical expression in this case. We delineated the expression patterns of steroidogenic enzymes in ACC. The coordinated expression of steroidogenic enzymes in normal and adenoma cells was disturbed in ACC cells, resulting in the inefficient production of steroid hormones in relation to the large tumor volume.

  19. A reappraisal of hemangiopericytoma of bone; analysis of cases reclassified as synovial sarcoma and solitary fibrous tumor of bone.

    PubMed

    Verbeke, Sofie L J; Fletcher, Christopher D M; Alberghini, Marco; Daugaard, Søren; Flanagan, Adrienne M; Parratt, Tim; Kroon, Herman M; Hogendoorn, Pancras C W; Bovée, Judith V M G

    2010-06-01

    Hemangiopericytoma (HPC) was first described as a neoplasm with distinct morphologic features, presumably composed of pericytes. In soft tissue, it is accepted that most such lesions are solitary fibrous tumors (SFTs), monophasic synovial sarcomas (SSs), or myofibromatoses. It is unclear whether HPC of bone exists. We reviewed 9 primary "HPC" of bone from 4 institutions diagnosed between 1952 and 2002. Immunohistochemistry was performed for CD31, CD34, von Willebrand factor, smooth muscle actin, keratin AE1/AE3, and epithelial membrane antigen. There were 4 male and 5 female patients between 21 and 73 years. All tumors were located within bone, either sited within spine or extremities. All tumors showed thin-walled branching vessels surrounded by undifferentiated spindle or round cells. These cells showed variation in their morphologic pattern: 6 tumors showed a pattern-less architecture and varying cellularity, consistent with SFT; 3 of 5 cases examined were CD34-positive. Three tumors showed more densely packed sheets and fascicles of poorly differentiated cells, resembling SS, of which 2 showed focal staining for keratin AE1/AE3 or epithelial membrane antigen. Fluorescent in-situ hybridization confirmed the presence of SS18 rearrangement in 1 of 2 tumors examined. In conclusion, similar to their soft-tissue counterpart, HPC-like features in bone are a nonspecific growth pattern rather than a true diagnosis. We confirm the existence of 2 entities: SFT and SS of bone. Both are characterized by distinct morphology and immunohistochemical profile. SFT of bone is located within spine and has a better prognosis, whereas SS of bone is located within long bones having a poor prognosis.

  20. Concordance of anaplastic lymphoma kinase (ALK) gene rearrangements between circulating tumor cells and tumor in non-small cell lung cancer

    PubMed Central

    Lim, Tony KH; Tan, Daniel Shao-Weng; Chua, Yong Wei; Ang, Mei Kim; Pang, Brendan; Lim, Chwee Teck; Takano, Angela; Lim, Alvin Soon-Tiong; Leong, Man Chun; Lim, Wan-Teck

    2016-01-01

    Anaplastic lymphoma kinase (ALK) gene rearrangement in non-small cell lung cancer (NSCLC) is routinely evaluated by fluorescent in-situ hybridization (FISH) testing on biopsy tissues. Testing can be challenging however, when suitable tissue samples are unavailable. We examined the relevance of circulating tumor cells (CTC) as a surrogate for biopsy-based FISH testing. We assessed paired tumor and CTC samples from patients with ALK rearranged lung cancer (n = 14), ALK-negative lung cancer (n = 12), and healthy controls (n = 5) to derive discriminant CTC counts, and to compare ALK rearrangement patterns. Blood samples were enriched for CTCs to be used for ALK FISH testing. ALK-positive CTCs counts were higher in ALK-positive NSCLC patients (3–15 cells/1.88 mL of blood) compared with ALK-negative NSCLC patients and healthy donors (0–2 cells/1.88 mL of blood). The latter range was validated as the ‘false positive’ cutoff for ALK FISH testing of CTCs. ALK FISH signal patterns observed on tumor biopsies were recapitulated in CTCs in all cases. Sequential CTC counts in an index case of lung cancer with no evaluable tumor tissue treated with crizotinib showed six, three and eleven ALK-positive CTCs per 1.88 mL blood at baseline, partial response and post-progression time points, respectively. Furthermore, ALK FISH rearrangement suggestive of gene copy number increase was observed in CTCs following progression. Recapitulation of ALK rearrangement patterns in the tumor on CTCs, suggested that CTCs might be used to complement tissue-based ALK testing in NSCLC to guide ALK-targeted therapy when suitable tissue biopsy samples are unavailable for testing. PMID:26993609

  1. Concordance of anaplastic lymphoma kinase (ALK) gene rearrangements between circulating tumor cells and tumor in non-small cell lung cancer.

    PubMed

    Tan, Chye Ling; Lim, Tse Hui; Lim, Tony Kh; Tan, Daniel Shao-Weng; Chua, Yong Wei; Ang, Mei Kim; Pang, Brendan; Lim, Chwee Teck; Takano, Angela; Lim, Alvin Soon-Tiong; Leong, Man Chun; Lim, Wan-Teck

    2016-04-26

    Anaplastic lymphoma kinase (ALK) gene rearrangement in non-small cell lung cancer (NSCLC) is routinely evaluated by fluorescent in-situ hybridization (FISH) testing on biopsy tissues. Testing can be challenging however, when suitable tissue samples are unavailable. We examined the relevance of circulating tumor cells (CTC) as a surrogate for biopsy-based FISH testing. We assessed paired tumor and CTC samples from patients with ALK rearranged lung cancer (n = 14), ALK-negative lung cancer (n = 12), and healthy controls (n = 5) to derive discriminant CTC counts, and to compare ALK rearrangement patterns. Blood samples were enriched for CTCs to be used for ALK FISH testing. ALK-positive CTCs counts were higher in ALK-positive NSCLC patients (3-15 cells/1.88 mL of blood) compared with ALK-negative NSCLC patients and healthy donors (0-2 cells/1.88 mL of blood). The latter range was validated as the 'false positive' cutoff for ALK FISH testing of CTCs. ALK FISH signal patterns observed on tumor biopsies were recapitulated in CTCs in all cases. Sequential CTC counts in an index case of lung cancer with no evaluable tumor tissue treated with crizotinib showed six, three and eleven ALK-positive CTCs per 1.88 mL blood at baseline, partial response and post-progression time points, respectively. Furthermore, ALK FISH rearrangement suggestive of gene copy number increase was observed in CTCs following progression. Recapitulation of ALK rearrangement patterns in the tumor on CTCs, suggested that CTCs might be used to complement tissue-based ALK testing in NSCLC to guide ALK-targeted therapy when suitable tissue biopsy samples are unavailable for testing.

  2. Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

    PubMed Central

    Groner, B; Hynes, N E

    1980-01-01

    The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

  3. Intensity and Pattern of Enhancement on CESM: Prognostic Significance and its Relation to Expression of Podoplanin in Tumor Stroma - A Preliminary Report.

    PubMed

    Luczynska, Elzbieta; Niemiec, Joanna; Heinze, Sylwia; Adamczyk, Agnieszka; Ambicka, Aleksandra; Marcyniuk, Paulina; Rudnicki, Wojciech; Mitus, Jerzy W; Dyczek, Sonia; Rys, Janusz; Sas-Korczynska, Beata

    2018-02-01

    It is possible that the degree of enhancement on contrast-enhanced spectral mammography (CESM), a new diagnostic method, might provide prognostic information for breast cancer patients. Therefore, in a group of 82 breast cancer patients, we analyzed the prognostic significance of degree and pattern of enhancement on CESM as well as its relation to: (a) breast cancer immunophenotype (based on ER/PR/HER2 status) (b) podoplanin expression in cancer stroma (lymphatic vessel density plus podoplanin-positivity of cancer-associated fibroblasts), and (c) other histological parameters. For each tumor the intensity of enhancement on CESM was qualitatively assessed as strong or weak/medium, while the pattern - as homogenous and heterogenous. Herein we report, for the first time, that strong and heterogenous enhancement on CESM was related to unfavorable disease-free survival of breast cancer patients (p=0.005). Moreover, the strong enhancement was more frequent in large and node-positive tumors (pT>1, pN>0) (p=0.002), as well as in carcinomas with podoplanin-sparse stroma (p=0.008). Intensity and pattern of enhancement on CESM might provide (together with the results of other diagnostic imaging methods) not only the confirmation of presence or absence of tumor, but also prognostic information. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  4. Communicating Hydrocephalus Associated with Intracranial Schwannoma Treated by Gamma Knife Radiosurgery.

    PubMed

    Park, Chang Kyu; Lee, Sung Ho; Choi, Man Kyu; Choi, Seok Keun; Park, Bong Jin; Lim, Young Jin

    2016-05-01

    Gamma knife radiosurgery (GKRS) has been established as an effective and safe treatment for intracranial schwannoma. However, serious complications can occur after GKRS, including hydrocephalus. The pathophysiology and risk factors of this disorder are not yet fully understood. The objective of the study was to assess potential risk factors for hydrocephalus after GKRS. We retrospectively reviewed the medical radiosurgical records of 244 patients who underwent GKRS to treat intracranial schwannoma. The following parameters were analyzed as potential risk factors for hydrocephalus after GKRS: age, sex, target volume, irradiation dose, prior tumor resection, treatment technique, and tumor enhancement pattern. The tumor enhancement pattern was divided into 2 groups: group A (homogeneous enhancement) and group B (heterogeneous or rim enhancement). Of the 244 patients, 14 of them (5.7%) developed communicating hydrocephalus. Communicating hydrocephalus occurred within 2 years after GKRS in most patients (92.8%). No significant association was observed between any of the parameters investigated and the development of hydrocephalus, with the exception of tumor enhancement pattern. Group B exhibited a statistically significant difference by univariate analysis (P = 0.002); this difference was also significant by multivariate analysis (P = 0.006). Because hydrocephalus is curable, patients should be closely monitored for the development of this disorder after GKRS. In particular, patients with intracranial schwannomas with irregular enhancement patterns or cysts should be meticulously observed. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Relationships of nuclear, architectural and International Federation of Gynecology and Obstetrics grading systems in endometrial cancer.

    PubMed

    Toptaş, Tayfun; Peştereli, Elif; Bozkurt, Selen; Erdoğan, Gülgün; Şimşek, Tayup

    2018-03-01

    To examine correlations among nuclear, architectural, and International Federation of Gynecology and Obstetrics (FIGO) grading systems, and their relationships with lymph node (LN) involvement in endometrioid endometrial cancer. Histopathology slides of 135 consecutive patients were reviewed with respect to tumor grade and LN metastasis. Notable nuclear atypia was defined as grade 3 nuclei. FIGO grade was established by raising the architectural grade (AG) by one grade when the tumor was composed of cells with nuclear grade (NG) 3. Correlations between the grading systems were analyzed using Spearman's rank correlation coefficients, and relationships of grading systems with LN involvement were assessed using logistic regression analysis. Correlation analysis revealed a significant and strongly positive relationship between FIGO and architectural grading systems (r=0.885, p=0.001); however, correlations of nuclear grading with the architectural (r=0.535, p=0.165) and FIGO grading systems (r=0.589, p=0.082) were moderate and statistically non-significant. Twenty-five (18.5%) patients had LN metastasis. LN involvement rates differed significantly between tumors with AG 1 and those with AG 2, and tumors with FIGO grade 1 and those with FIGO grade 2. In contrast, although the difference in LN involvement rates failed to reach statistical significance between tumors with NG 1 and those with NG 2, it was significant between NG 2 and NG 3 (p=0.042). Although all three grading systems were associated with LN involvement in univariate analyses, an independent relationship could not be established after adjustment for other confounders in multivariate analysis. Nuclear grading is significantly correlated with neither architectural nor FIGO grading systems. The differences in LN involvement rates in the nuclear grading system reach significance only in the setting of tumor cells with NG 3; however, none of the grading systems was an independent predictor of LN involvement.

  6. Recurrent DGCR8, DROSHA, and SIX homeodomain mutations in favorable histology Wilms tumors | Office of Cancer Genomics

    Cancer.gov

    We report the most common single-nucleotide substitution/deletion mutations in favorable histology Wilms tumors (FHWTs) to occur within SIX1/2 (7% of 534 tumors) and microRNA processing genes (miRNAPGs) DGCR8 and DROSHA (15% of 534 tumors). Comprehensive analysis of 77 FHWTs indicates that tumors with SIX1/2 and/or miRNAPG mutations show a pre-induction metanephric mesenchyme gene expression pattern and are significantly associated with both perilobar nephrogenic rests and 11p15 imprinting aberrations.

  7. Patterns of breast cancer relapse in accordance to biological subtype.

    PubMed

    Ignatov, Atanas; Eggemann, Holm; Burger, Elke; Ignatov, Tanja

    2018-04-19

    To evaluate the pattern of recurrence of breast cancer according to its biological subtype in a large cohort of patients treated with therapy representative of current practice. Patients treated between 2000 and 2016 with known biological subtype were eligible. Data were prospectively collected. Primary endpoint was the subtype-dependent pattern and time of recurrence. Loco-regional and distant site and time of recurrence were assessed. Median follow-up time was 80.8 months. For 12,053 (82.5%) of 14,595 patients with primary non-metastatic invasive breast cancer a subtype classification was possible. The luminal A subtype had the highest 10-year survival followed by luminal B and luminal/HER2. The worst survival demonstrated HER2 enriched and TNBC. HER2 and TNBC had the highest rate of recurrence in the first 5 years, whereas the rate of recurrence for luminal A and luminal B tumors was initially low, but remained continuously even after 10 years of follow-up. Luminal A tumors demonstrated the lowest rate of distant metastases predominantly in bone. So did luminal B tumors. HER2 enriched subtype was characterized with increased rate of loco-regional recurrence and distant metastases in bone, liver and brain. Luminal/HER2 had pattern of relapse similar to HER2 enriched tumors, with exception of loco-regional relapse and brain metastases. TNBC had higher rate of lung, bone and brain metastases as well as loco-regional relapse. Breast cancer subtypes are associated with different time and pattern of recurrence and it should be considered during treatment decision.

  8. Sonography for diagnosis of benign and malignant tumors of the nose and paranasal sinuses.

    PubMed

    Liu, Jun-jie; Gao, Yong; Wu, Ya-Fei; Zhu, Shang-Yong

    2014-09-01

    The purpose of this study was to demonstrate the reliability of sonography for diagnosis of nose and paranasal sinus tumors. Ninety-six consecutive patients with tumors underwent sonography and computed tomography (CT) before surgical treatment. Tumor detectability and imaging findings were evaluated independently and then compared with pathologic findings. Of 96 tumors, 75 were detected by sonography, for a detectability rate of 78.1%; 93 tumors were detected by CT, for a detectability rate of 96.9%. By comparison, sonography showed a trend toward higher detectability of nasal vestibular tumors than CT (87.5% for sonography versus 50.0% for CT) and small lumps on the wing of the nose (78.8% for sonography versus 33.3% for CT). Among the sonographic features, boundary, shape, internal echo, calcification, bone invasion, vascular pattern, and cervical lymph node metastasis all had significantly positive correlations with malignancy (P < .05), but size did not (P = .324). In addition, the vascular resistive index for malignant tumors was significantly higher (mean ± SD, 0.66 ± 0.20) than the index for benign lesions (0.24 ± 0.30; P < .001). Moreover, the detection rate for grade 1-3 (small-large) blood flow in benign lesions was only 43.8%, whereas the rate for malignant tumors was 97.7% (P < .001). The vascular pattern may be a promising predictive indicator for distinguishing benign and malignant tumors of the nose and paranasal sinuses. Consequently, sonography has high value for diagnosis of benign and malignant tumors of the nose and paranasal sinuses, especially for nasal vestibular tumors and small lumps on the wing of the nose. © 2014 by the American Institute of Ultrasound in Medicine.

  9. Colorectal cancer cell lines are representative models of the main molecular subtypes of primary cancer.

    PubMed

    Mouradov, Dmitri; Sloggett, Clare; Jorissen, Robert N; Love, Christopher G; Li, Shan; Burgess, Antony W; Arango, Diego; Strausberg, Robert L; Buchanan, Daniel; Wormald, Samuel; O'Connor, Liam; Wilding, Jennifer L; Bicknell, David; Tomlinson, Ian P M; Bodmer, Walter F; Mariadason, John M; Sieber, Oliver M

    2014-06-15

    Human colorectal cancer cell lines are used widely to investigate tumor biology, experimental therapy, and biomarkers. However, to what extent these established cell lines represent and maintain the genetic diversity of primary cancers is uncertain. In this study, we profiled 70 colorectal cancer cell lines for mutations and DNA copy number by whole-exome sequencing and SNP microarray analyses, respectively. Gene expression was defined using RNA-Seq. Cell line data were compared with those published for primary colorectal cancers in The Cancer Genome Atlas. Notably, we found that exome mutation and DNA copy-number spectra in colorectal cancer cell lines closely resembled those seen in primary colorectal tumors. Similarities included the presence of two hypermutation phenotypes, as defined by signatures for defective DNA mismatch repair and DNA polymerase ε proofreading deficiency, along with concordant mutation profiles in the broadly altered WNT, MAPK, PI3K, TGFβ, and p53 pathways. Furthermore, we documented mutations enriched in genes involved in chromatin remodeling (ARID1A, CHD6, and SRCAP) and histone methylation or acetylation (ASH1L, EP300, EP400, MLL2, MLL3, PRDM2, and TRRAP). Chromosomal instability was prevalent in nonhypermutated cases, with similar patterns of chromosomal gains and losses. Although paired cell lines derived from the same tumor exhibited considerable mutation and DNA copy-number differences, in silico simulations suggest that these differences mainly reflected a preexisting heterogeneity in the tumor cells. In conclusion, our results establish that human colorectal cancer lines are representative of the main subtypes of primary tumors at the genomic level, further validating their utility as tools to investigate colorectal cancer biology and drug responses. ©2014 American Association for Cancer Research.

  10. Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

    PubMed

    van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

    2005-06-10

    To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

  11. Renal cell carcinoma, unclassified with medullary phenotype: poorly differentiated adenocarcinomas overlapping with renal medullary carcinoma.

    PubMed

    Sirohi, Deepika; Smith, Steven C; Ohe, Chisato; Colombo, Piergiuseppe; Divatia, Mukul; Dragoescu, Ema; Rao, Priya; Hirsch, Michelle S; Chen, Ying-Bei; Mehra, Rohit; Amin, Mahul B

    2017-09-01

    Renal medullary carcinoma (RMC) is a highly aggressive renal cell carcinoma arising in the collecting system and requiring careful correlation with status of sickle cell trait. A panel of international experts has recently proposed provisional diagnostic terminology, renal cell carcinoma, unclassified, with medullary phenotype, based on encountering an extraordinarily rare tumor with RMC morphology and immunophenotype in an individual proven not to have a hemoglobinopathy. Herein, we extend this observation to a cohort of 5 such tumors, morphologically similar to RMC, lacking SMARCB1 expression by immunohistochemistry, but each without evidence of a hemoglobinopathy. The tumors arose in 4 men and 1 woman with a mean age of 44 years, occurring in 3 left and 2 right kidneys. Clinically, aggression was apparent with involvement of perinephric adipose tissue in all 5 cases, nodal metastasis in 4 of 5 cases, and death of disease in 4 of 5 cases within 3-27 months. Histologic sections showed poorly differentiated adenocarcinoma, often with solid and nested growth patterns, as well as infiltrative glandular, tubulopapillary, cribriform, or reticular growth. Rhabdoid and sarcomatoid cytomorphology was seen in a subset. All tumors showed PAX8 nuclear positivity and SMARCB1 loss, with OCT3/4 expression in 4 of 5 cases. In summary, this first series of renal cell carcinoma, unclassified, with medullary phenotype documents tumors with morphologic, immunophenotypic, and prognostic features of RMC occurring in individuals without sickle cell trait. Although greater biologic and molecular understanding is needed, the available evidence points to these cases representing a sporadic counterpart to sickle cell trait-associated RMC. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Diet- and Genetically-Induced Obesity Differentially Affect the Fecal Microbiome and Metabolome in Apc1638N Mice

    PubMed Central

    Parnell, Laurence D.; Iyer, Lakshmanan K.; Liu, Zhenhua; Kane, Anne V.; Chen, C-Y. Oliver; Tai, Albert K.; Bowman, Thomas A.; Obin, Martin S.; Mason, Joel B.; Greenberg, Andrew S.; Choi, Sang-Woon; Selhub, Jacob; Paul, Ligi; Crott, Jimmy W.

    2015-01-01

    Obesity is a risk factor for colorectal cancer (CRC), and alterations in the colonic microbiome and metabolome may be mechanistically involved in this relationship. The relative contribution of diet and obesity per se are unclear. We compared the effect of diet- and genetically-induced obesity on the intestinal microbiome and metabolome in a mouse model of CRC. Apc1638N mice were made obese by either high fat (HF) feeding or the presence of the Leprdb/db (DbDb) mutation. Intestinal tumors were quantified and stool microbiome and metabolome were profiled. Genetic obesity, and to a lesser extent HF feeding, promoted intestinal tumorigenesis. Each induced distinct microbial patterns: taxa enriched in HF were mostly Firmicutes (6 of 8) while those enriched in DbDb were split between Firmicutes (7 of 12) and Proteobacteria (5 of 12). Parabecteroides distasonis was lower in tumor-bearing mice and its abundance was inversely associated with colonic Il1b production (p<0.05). HF and genetic obesity altered the abundance of 49 and 40 fecal metabolites respectively, with 5 in common. Of these 5, adenosine was also lower in obese and in tumor-bearing mice (p<0.05) and its concentration was inversely associated with colonic Il1b and Tnf production (p<0.05). HF and genetic obesity differentially alter the intestinal microbiome and metabolome. A depletion of adenosine and P.distasonis in tumor-bearing mice could play a mechanistic role in tumor formation. Adenosine and P. distasonis have previously been shown to be anti-inflammatory in the colon and we postulate their reduction could promote tumorigenesis by de-repressing inflammation. PMID:26284788

  13. Diet- and Genetically-Induced Obesity Differentially Affect the Fecal Microbiome and Metabolome in Apc1638N Mice.

    PubMed

    Pfalzer, Anna C; Nesbeth, Paula-Dene C; Parnell, Laurence D; Iyer, Lakshmanan K; Liu, Zhenhua; Kane, Anne V; Chen, C-Y Oliver; Tai, Albert K; Bowman, Thomas A; Obin, Martin S; Mason, Joel B; Greenberg, Andrew S; Choi, Sang-Woon; Selhub, Jacob; Paul, Ligi; Crott, Jimmy W

    2015-01-01

    Obesity is a risk factor for colorectal cancer (CRC), and alterations in the colonic microbiome and metabolome may be mechanistically involved in this relationship. The relative contribution of diet and obesity per se are unclear. We compared the effect of diet- and genetically-induced obesity on the intestinal microbiome and metabolome in a mouse model of CRC. Apc1638N mice were made obese by either high fat (HF) feeding or the presence of the Leprdb/db (DbDb) mutation. Intestinal tumors were quantified and stool microbiome and metabolome were profiled. Genetic obesity, and to a lesser extent HF feeding, promoted intestinal tumorigenesis. Each induced distinct microbial patterns: taxa enriched in HF were mostly Firmicutes (6 of 8) while those enriched in DbDb were split between Firmicutes (7 of 12) and Proteobacteria (5 of 12). Parabecteroides distasonis was lower in tumor-bearing mice and its abundance was inversely associated with colonic Il1b production (p<0.05). HF and genetic obesity altered the abundance of 49 and 40 fecal metabolites respectively, with 5 in common. Of these 5, adenosine was also lower in obese and in tumor-bearing mice (p<0.05) and its concentration was inversely associated with colonic Il1b and Tnf production (p<0.05). HF and genetic obesity differentially alter the intestinal microbiome and metabolome. A depletion of adenosine and P.distasonis in tumor-bearing mice could play a mechanistic role in tumor formation. Adenosine and P. distasonis have previously been shown to be anti-inflammatory in the colon and we postulate their reduction could promote tumorigenesis by de-repressing inflammation.

  14. Hypoxia-mediated alterations and their role in the HER-2/neuregulated CREB status and localization

    PubMed Central

    Steven, André; Leisz, Sandra; Sychra, Katharina; Hiebl, Bernhard; Wickenhauser, Claudia; Mougiakakos, Dimitrios; Kiessling, Rolf; Denkert, Carsten; Seliger, Barbara

    2016-01-01

    The cAMP-responsive element-binding protein (CREB) is involved in the tumorigenicity of HER-2/neu-overexpressing murine and human tumor cells, but a link between the HER-2/neu-mediated CREB activation, its posttranslational modification and localization and changes in the cellular metabolism, due to an altered (tumor) microenvironment remains to be established. The present study demonstrated that shRNA-mediated silencing of CREB in HER-2/neu-transformed cells resulted in decreased tumor formation, which was associated with reduced angiogenesis, but increased necrotic and hypoxic areas in the tumor. Hypoxia induced pCREBSer133, but not pCREBSer121 expression in HER-2/neu-transformed cells. This was accompanied by upregulation of the hypoxia-inducible genes GLUT1 and VEGF, increased cell migration and matrix metalloproteinase-mediated invasion. Treatment of HER-2/neu+ cells with signal transduction inhibitors targeting in particular HER-2/neu was able to revert hypoxia-controlled CREB activation. In addition to changes in the phosphorylation, hypoxic response of HER-2/neu+ cells caused a transient ubiquitination and SUMOylation as well as a co-localization of nuclear CREB to the mitochondrial matrix. A mitochondrial localization of CREB was also demonstrated in hypoxic areas of HER-2/neu+ mammary carcinoma lesions. This was accompanied by an altered gene expression pattern, activity and metabolism of mitochondria leading to an increased respiratory rate, oxidative phosphorylation and mitochondrial membrane potential and consequently to an enhanced apoptosis and reduced cell viability. These data suggest that the HER-2/neu-mediated CREB activation caused by a hypoxic tumor microenvironment contributes to the neoplastic phenotype of HER-2/neu+ cells at various levels. PMID:27409833

  15. Role of intercellular communications in breast cancer multicellular tumor spheroids after chemotherapy.

    PubMed

    Oktem, G; Bilir, A; Ayla, S; Yavasoglu, A; Goksel, G; Saydam, G; Uysal, A

    2006-01-01

    Tumor heterogeneity is an important feature that is especially involved in tumor aggressiveness. Multicellular tumor spheroids (MTS) may provide some benefits in different steps for investigation of the aggregation, organization, differentiation, and network formation of tumor cells in 3D space. This model offers a unique opportunity for improvements in the capability of a current strategy to detect the effect of an appropriate anticancer agent. The aim of this study was to investigate the cellular interactions and morphological changes following chemotherapy in a 3D breast cancer spheroid model. Distribution of the gap junction protein "connexin-43" and the tight junction protein "occludin" was investigated by immunohistochemistry. Cellular interactions were examined by using transmission and scanning electron microscopies as well as light microscopy with Giemsa staining after treating cells with doxorubicin, docetaxel, and doxorubicin/docetaxel combination. Statistical analyses showed significant changes and various alterations that were observed in all groups; however, the most prominent effect was detected in the doxorubicin/docetaxel combination group. Distinct composition as a vessel-like structure and a pseudoglandular pattern of control spheroids were detected in drug-administered groups. Immunohistochemical results were consistent with the ultrastructural changes. In conclusion, doxorubicin/docetaxel combination may be more effective than the single drug usage as shown in a 3D model. The MTS model has been found to be an appropriate and reliable method for the detection of the changes in the expression of cellular junction proteins as well as other cellular proteins occurring after chemotherapy. The MTS model can be used to validate the effects of various combinations or new chemotherapeutic agents as well as documentation of possible mechanisms of new drugs.

  16. Endometrial vs. cervical cancer: development and pilot testing of a magnetic resonance imaging (MRI) scoring system for predicting tumor origin of uterine carcinomas of indeterminate histology.

    PubMed

    Bourgioti, Charis; Chatoupis, Konstantinos; Panourgias, Evangelia; Tzavara, Chara; Sarris, Kyrillos; Rodolakis, Alexandros; Moulopoulos, Lia Angela

    2015-10-01

    To report discriminant MRI features between cervical and endometrial carcinomas and to design an MRI- scoring system, with the potential to predict the origin of uterine cancer (cervix or endometrium) in histologically indeterminate cases. Dedicated pelvic MRIs of 77 patients with uterine tumors involving both cervix and corpus were retrospectively analyzed by two experts in female imaging. Seven MRI tumor characteristics were statistically tested for their discriminant ability for tumor origin compared to final histology: tumor location, perfusion pattern, rim enhancement, depth of myometrial invasion, cervical stromal integrity, intracavitary mass, and retained endometrial secretions. Kappa values were estimated to assess the levels of inter-rater reliability. On the basis of positive likelihood ratio values, an MRI-score was assigned. K value was excellent for most of the imaging criteria. Using ROC curve analysis, the estimated optimal cut-off for the MRI-scoring system was 4 with 96.6% sensitivity and 100% specificity. Using a ≥4 cut-off for cervical cancers and <4 for endometrial cancers, 97.4% of the patients were correctly classified. 2/58 patients with cervical cancer had MRI score <4 and none of the patients with endometrial cancer had MRI score >4. The area under curve of the MRI-scoring system was 0.99 (95% CI 0.98-1.00). When the MRI-score was applied to 20/77 patients with indeterminate initial biopsy and to 5/26 surgically treated patients with erroneous pre-op histology, all cases were correctly classified. The produced MRI-scoring system may be a reliable problem-solving tool for the differential diagnosis of cervical vs. endometrial cancer in cases of equivocal histology.

  17. Stromal differences in odontogenic cysts of a common histopathogenesis but with different biological behavior: a study with picrosirius red and polarizing microscopy.

    PubMed

    Aggarwal, P; Saxena, S

    2011-01-01

    The present study was undertaken to detect and compare the pattern of collagen fibers in odontogenic cysts and also to find out if this methodology could be used to predict the aggressive nature of odontogenic cysts by comparing with the odontogenic tumors. The collagen in the wall of 11 odontogenic keratocysts, 14 dentigerous cysts and 14 radicular cysts was studied histochemically by staining sections with picrosirius red and examining under polarizing microscope. This was compared to 10 cases of odontogenic tumors using Z test of proportion at 1% and 5%. In dentigerous cysts, odontogenic keratocysts and odontogenic tumors, the predominant color of collagen fibers birefringence was found to be orangish red, whereas in radicular cysts the collagen fiber was of green color. Similar birefringence pattern of collagen fibers between dentigerous cysts, odontogenic keratocysts and odontogenic tumors may indicate that these lesions have a common histogenesis with a broad spectrum of biological behavior and belong to the same group, i.e., are developmental in origin. Different patterns of radicular cysts suggest different biological behavior and a positive role of inflammation on polarization color of collagen fibers.

  18. Analysis of Lung Tumor Motion in a Large Sample: Patterns and Factors Influencing Precise Delineation of Internal Target Volume

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Knybel, Lukas; VŠB-Technical University of Ostrava, Ostrava; Cvek, Jakub, E-mail: Jakub.cvek@fno.cz

    Purpose/Objective: To evaluate lung tumor motion during respiration and to describe factors affecting the range and variability of motion in patients treated with stereotactic ablative radiation therapy. Methods and Materials: Log file analysis from online respiratory tumor tracking was performed in 145 patients. Geometric tumor location in the lungs, tumor volume and origin (primary or metastatic), sex, and tumor motion amplitudes in the superior-inferior (SI), latero-lateral (LL), and anterior-posterior (AP) directions were recorded. Tumor motion variability during treatment was described using intrafraction/interfraction amplitude variability and tumor motion baseline changes. Tumor movement dependent on the tumor volume, position and origin, andmore » sex were evaluated using statistical regression and correlation analysis. Results: After analysis of >500 hours of data, the highest rates of motion amplitudes, intrafraction/interfraction variation, and tumor baseline changes were in the SI direction (6.0 ± 2.2 mm, 2.2 ± 1.8 mm, 1.1 ± 0.9 mm, and −0.1 ± 2.6 mm). The mean motion amplitudes in the lower/upper geometric halves of the lungs were significantly different (P<.001). Motion amplitudes >15 mm were observed only in the lower geometric quarter of the lungs. Higher tumor motion amplitudes generated higher intrafraction variations (R=.86, P<.001). Interfraction variations and baseline changes >3 mm indicated tumors contacting mediastinal structures or parietal pleura. On univariate analysis, neither sex nor tumor origin (primary vs metastatic) was an independent predictive factor of different movement patterns. Metastatic lesions in women, but not men, showed significantly higher mean amplitudes (P=.03) and variability (primary, 2.7 mm; metastatic, 4.9 mm; P=.002) than primary tumors. Conclusion: Online tracking showed significant irregularities in lung tumor movement during respiration. Motion amplitude was significantly lower in upper lobe tumors; higher interfraction amplitude variability indicated tumors in contact with mediastinal structures, although adhesion to parietal pleura did not necessarily reduce tumor motion amplitudes. The most variable lung tumors were metastatic lesions in women.« less

  19. Identifying the association between contrast enhancement pattern, surgical resection, and prognosis in anaplastic glioma patients.

    PubMed

    Wang, Yinyan; Wang, Kai; Wang, Jiangfei; Li, Shaowu; Ma, Jun; Dai, Jianping; Jiang, Tao

    2016-04-01

    Contrast enhancement observable on magnetic resonance (MR) images reflects the destructive features of malignant gliomas. This study aimed to investigate the relationship between radiologic patterns of tumor enhancement, extent of resection, and prognosis in patients with anaplastic gliomas (AGs). Clinical data from 268 patients with histologically confirmed AGs were retrospectively analyzed. Contrast enhancement patterns were classified based on preoperative T1-contrast MR images. Univariate and multivariate analyses were performed to evaluate the prognostic value of MR enhancement patterns on progression-free survival (PFS) and overall survival (OS). The pattern of tumor contrast enhancement was associated with the extent of surgical resection in AGs. A gross total resection was more likely to be achieved for AGs with focal enhancement than those with diffuse (p = 0.001) or ring-like (p = 0.024) enhancement. Additionally, patients with focal-enhanced AGs had a significantly longer PFS and OS than those with diffuse (log-rank, p = 0.025 and p = 0.031, respectively) or ring-like (log-rank, p = 0.008 and p = 0.011, respectively) enhanced AGs. Furthermore, multivariate analysis identified the pattern of tumor enhancement as a significant predictor of PFS (p = 0.016, hazard ratio [HR] = 1.485) and OS (p = 0.030, HR = 1.446). Our results suggested that the contrast enhancement pattern on preoperative MR images was associated with the extent of resection and predictive of survival outcomes in AG patients.

  20. Adenomatoid odontogenic tumor with peripheral cemento-osseous reactive proliferation: report of 2 cases and review of the literature.

    PubMed

    Naidu, Aparna; Slater, Lee J; Hamao-Sakamoto, Aya; Waters, Patrick; Kessler, Harvey P; Wright, John M

    2016-09-01

    Two cases of a rare variant of adenomatoid odontogenic tumor encompassed by a prominent reactive cemento-osseous proliferation are reported. This unique variant of adenomatoid odontogenic tumor has only been seen twice in the authors' collective experience. Literature documenting the histopathologic patterns of adenomatoid odontogenic tumor and the occurrence of other combined lesions other is reviewed and discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Vascular Gene Expression in Nonneoplastic and Malignant Brain

    PubMed Central

    Madden, Stephen L.; Cook, Brian P.; Nacht, Mariana; Weber, William D.; Callahan, Michelle R.; Jiang, Yide; Dufault, Michael R.; Zhang, Xiaoming; Zhang, Wen; Walter-Yohrling, Jennifer; Rouleau, Cecile; Akmaev, Viatcheslav R.; Wang, Clarence J.; Cao, Xiaohong; St. Martin, Thia B.; Roberts, Bruce L.; Teicher, Beverly A.; Klinger, Katherine W.; Stan, Radu-Virgil; Lucey, Brenden; Carson-Walter, Eleanor B.; Laterra, John; Walter, Kevin A.

    2004-01-01

    Malignant gliomas are uniformly lethal tumors whose morbidity is mediated in large part by the angiogenic response of the brain to the invading tumor. This profound angiogenic response leads to aggressive tumor invasion and destruction of surrounding brain tissue as well as blood-brain barrier breakdown and life-threatening cerebral edema. To investigate the molecular mechanisms governing the proliferation of abnormal microvasculature in malignant brain tumor patients, we have undertaken a cell-specific transcriptome analysis from surgically harvested nonneoplastic and tumor-associated endothelial cells. SAGE-derived endothelial cell gene expression patterns from glioma and nonneoplastic brain tissue reveal distinct gene expression patterns and consistent up-regulation of certain glioma endothelial marker genes across patient samples. We define the G-protein-coupled receptor RDC1 as a tumor endothelial marker whose expression is distinctly induced in tumor endothelial cells of both brain and peripheral vasculature. Further, we demonstrate that the glioma-induced gene, PV1, shows expression both restricted to endothelial cells and coincident with endothelial cell tube formation. As PV1 provides a framework for endothelial cell caveolar diaphragms, this protein may serve to enhance glioma-induced disruption of the blood-brain barrier and transendothelial exchange. Additional characterization of this extensive brain endothelial cell gene expression database will provide unique molecular insights into vascular gene expression. PMID:15277233

  2. Epithelial borderline ovarian tumor: Diagnosis and treatment strategy.

    PubMed

    Ushijima, Kimio; Kawano, Kouichiro; Tsuda, Naotake; Nishio, Shin; Terada, Atsumu; Kato, Hiroyuki; Tasaki, Kazuto; Matsukuma, Ken

    2015-05-01

    Epithelial borderline ovarian tumors (BOT) are distinctive from benign tumors and carcinoma. They occur in younger women more often than carcinoma, and there is some difficulty making correct diagnosis of BOT. Two subtypes of BOT, serous and mucinous borderline tumor have different characteristics and very different clinical behavior. Serous borderline tumor (SBT) with micropapillary pattern shows more incidence of extra ovarian disease and often coexists with invasive implant. SBT with micropapillary pattern in advanced stage has showed a worse prognosis than typical SBT. Huge mucinous borderline tumors have histologic heterogeneity, and the accuracy of frozen section diagnosis is relatively low. Extensive sampling is required to reach a correct pathological diagnosis. Mucinous adenoma (intestinal type) also runs the risk of recurrence after cystectomy, or intraoperative rupture of cyst. Laparoscopic procedure for BOT has not increased the risk of recurrence. Fertility preserving procedures are generally accepted, except in advanced stage SBT with invasive implants. Only cystectomy shows a significant risk of recurrence. Re-staging surgery and full staging surgery is not necessary for all BOT. We should not attempt to treat them uniformly, by the single diagnosis of "borderline tumor". It depends on histologic type. Close communication with the pathologist is necessary to gain more detail and ask more pathological samples in order to make the optimal treatment strategy for each individual patients.

  3. Immunohistochemical Analysis Supports a Role for INI1/SMARCB1 in Hereditary Forms of Schwannomas, But Not in Solitary, Sporadic Schwannomas

    PubMed Central

    Patil, Sushama; Perry, Arie; MacCollin, Mia; Dong, Shumin; Betensky, Rebecca A.; Yeh, Tu-Hsueh; Gutmann, David H.; Stemmer-Rachamimov, Anat O.

    2009-01-01

    The INI1/SMARCB1 protein product (INI1), a component of a transcription complex, was recently implicated in the pathogenesis of schwannomas in two members of a single family with familial schwannomatosis1. Tumors were found to have both constitutional and somatic mutations of the SMARCB1 gene and showed a mosaic pattern of loss of INI1 expression by immunohistochemistry, suggesting a tumor composition of mixed null and haploinsufficient cells. To determine if this finding could be extended to all tumors arising in familial schwannomatosis, and how it compares to other multiple schwannoma syndromes (sporadic schwannomatosis and neurofibromatosis 2) as well as to sporadic, solitary schwannomas, we performed an immunohistochemistry analysis on 45 schwannomas from patients with multiple schwannoma syndromes and on 38 solitary, sporadic schwannomas from non-syndromic patients. A mosaic pattern of INI1 expression was seen in 93% of tumors from familial schwannomatosis patients, 55% of tumors from sporadic schwannomatosis, 83% of NF2-associated tumors and only 5% of solitary, sporadic schwannomas. These results confirm a role for INI1/SMARCB1 in multiple schwannoma syndromes and suggest that a different pathway of tumorigenesis occurs in solitary, sporadic tumors. PMID:18422762

  4. A case of coexisting Warthin tumor and langerhans cell histiocytosis associated with necrosis, eosinophilic abscesses and a granulomatous reaction in intraparotid lymph nodes.

    PubMed

    Tan, Char Loo; Raju, Gangaraju Changal; Petersson, Fredrik

    2011-04-04

    We present a patient (50-year-old male) with coexisting Warthin tumor and involvement of two intraparotid lymph nodes by Langerhans cell histiocytosis associated with necrosis, eosinophilic abscesses and a granulomatous reaction. This is the second documented case of this unusual combination of histological changes in nodal Langerhans cell histiocytosis and the first case involving intraparotid lymph nodes occurring together with an ipsilateral Warthin tumor.

  5. A case of coexisting Warthin tumor and langerhans cell histiocytosis associated with necrosis, eosinophilic abscesses and a granulomatous reaction in intraparotid lymph nodes

    PubMed Central

    Tan, Char Loo; Raju, Gangaraju Changal; Petersson, Fredrik

    2011-01-01

    We present a patient (50-year-old male) with coexisting Warthin tumor and involvement of two intraparotid lymph nodes by Langerhans cell histiocytosis associated with necrosis, eosinophilic abscesses and a granulomatous reaction. This is the second documented case of this unusual combination of histological changes in nodal Langerhans cell histiocytosis and the first case involving intraparotid lymph nodes occurring together with an ipsilateral Warthin tumor. PMID:21769315

  6. Morphological, immunohistochemical, and chromosomal analysis of multicystic chromophobe renal cell carcinoma, an architecturally unusual challenging variant.

    PubMed

    Foix, Maria Pané; Dunatov, Ana; Martinek, Petr; Mundó, Enric Condom; Suster, Saul; Sperga, Maris; Lopez, Jose I; Ulamec, Monika; Bulimbasic, Stela; Montiel, Delia Perez; Alaghehbandan, Reza; Peckova, Kvetoslava; Pivovarcikova, Krystina; Ondrej, Daum; Rotterova, Pavla; Skenderi, Faruk; Prochazkova, Kristyna; Dusek, Martin; Hora, Milan; Michal, Michal; Hes, Ondrej

    2016-12-01

    Chromophobe renal cell carcinoma (ChRCC) is typically composed of large leaf-like cells and smaller eosinophilic cells arranged in a solid-alveolar pattern. Eosinophilic, adenomatoid/pigmented, or neuroendocrine variants have also been described. We collected 10 cases of ChRCC with a distinct multicystic pattern out of 733 ChRCCs from our registry, and subsequently analyzed these by morphology, immunohistochemistry, and array comparative genomic hybridization. Of the 10 patients, 6 were males with an age range of 50-89 years (mean 68, median 69). Tumor size ranged between 1.2 and 20 cm (mean 5.32, median 3). Clinical follow-up was available for seven patients, ranging 1-19 years (mean 7.2, median 2.5). No aggressive behavior was documented. We observed two growth patterns, which were similar in all tumors: (1) variable-sized cysts, resembling multilocular cystic neoplasm of low malignant potential and (2) compressed cystic and tubular pattern with slit-like spaces. Raisinoid nuclei were consistently present while necrosis was absent in all cases. Half of the cases showed eosinophilic/oncocytic cytology, deposits of pigment (lipochrome) and microcalcifications. The other half was composed of pale or mixed cell populations. Immunostains for epithelial membrane antigen (EMA), CK7, OSCAR, CD117, parvalbumin, MIA, and Pax 8 were positive in all tumors while negative for vimentin, TFE3, CANH 9, HMB45, cathepsin K, and AMACR. Ki67 immunostain was positive in up to 1 % of neoplastic cells. Molecular genetic examination revealed multiple chromosomal losses in two fifths analyzable tumors, while three cases showed no chromosomal numerical aberrations. ChRCC are rarely arranged in a prominent multicystic pattern, which is probably an extreme form of the microcystic adenomatoid pigmented variant of ChRCC. The spectrum of tumors entering the differential diagnosis of ChRCC is quite different from that of conventional ChRCC. The immunophenotype of ChRCC is identical with that of conventional ChRCC. Chromosomal numerical aberration pattern was variable; no chromosomal numerical aberrations were found in three cases. All the cases in this series have shown an indolent and non-aggressive behavior.

  7. Study of the Histopathologic Characteristics and Surface Morphologies of Glottic Carcinomas With Anterior Vocal Commissure Involvement.

    PubMed

    Wu, Jianhui; Zhao, Jing; Wang, Zhangfeng; Li, Zenghong; Luo, Jie; Liao, Bing; Yang, Zhiyun; Liu, Qihong; Wang, Bin; Wen, Weiping; Lei, Wenbin

    2015-07-01

    This article explores the features and the role of the anterior vocal commissure (AVC) structure and the surface morphologies of glottic carcinomas with AVC involvement to provide a reference for the selection of transoral carbon dioxide (CO2) laser surgery. A total of 31 cases of glottic carcinomas with AVC involvement from May 2012 to January 2014 were included. All patients underwent electronic laryngoscopic examinations and computed tomography scans to determine the surface morphology. After surgery, the tumor specimens were resected integrally, and axial serial sections parallel to the plane of vocal cords were taken to explore the features and possible invasion paths of the glottic carcinomas with AVC involvement. The rates of involvement of the supraglottis and subglottis were 71.4% and 14.8%, respectively, via the AVC. The involvement of the superficial layer of the unilateral or bilateral vocal cords without involvement of the vocal muscle in the AVC region (IVM) or the cartilage was present in 15 cases (48.4%). The involvement of the superficial layer of the unilateral and bilateral vocal cords occurred in 16 cases (51.6%) with the IVM in 13 cases and the involvement of the intermediate lamina of the thyroid cartilage (ITC) in 8 cases. The involvement of the ITC was associated with the involvement of the vocal muscle of the AVC region (P < 0.05). Among the pushing carcinomas, 15 of 21 (71.4%) presented with well-defined tumor mass, and 8 of 10 (80.0%) infiltrating carcinomas presented with multiple tumor nests that were often surrounded by fibrosis (P < 0.05). The AVC is an important path of invasion of subglottic in glottic carcinomas but less so for suparglottic. The Broyles' ligaments acted as a barrier against the spread of the tumors to the thyroid cartilage, but this role was obviously weaken by the involvement of the vocal muscle of the AVC region. The infiltrating carcinomas presented with multiple tumor nests in fibrous tissue. When CO2 laser microsurgery is considered as a treatment option, these facts should be kept in mind.

  8. Study of the Histopathologic Characteristics and Surface Morphologies of Glottic Carcinomas With Anterior Vocal Commissure Involvement

    PubMed Central

    Wu, Jianhui; Zhao, Jing; Wang, Zhangfeng; Li, Zenghong; Luo, Jie; Liao, Bing; Yang, Zhiyun; Liu, Qihong; Wang, Bin; Wen, Weiping; Lei, Wenbin

    2015-01-01

    Abstract This article explores the features and the role of the anterior vocal commissure (AVC) structure and the surface morphologies of glottic carcinomas with AVC involvement to provide a reference for the selection of transoral carbon dioxide (CO2) laser surgery. A total of 31 cases of glottic carcinomas with AVC involvement from May 2012 to January 2014 were included. All patients underwent electronic laryngoscopic examinations and computed tomography scans to determine the surface morphology. After surgery, the tumor specimens were resected integrally, and axial serial sections parallel to the plane of vocal cords were taken to explore the features and possible invasion paths of the glottic carcinomas with AVC involvement. The rates of involvement of the supraglottis and subglottis were 71.4% and 14.8%, respectively, via the AVC. The involvement of the superficial layer of the unilateral or bilateral vocal cords without involvement of the vocal muscle in the AVC region (IVM) or the cartilage was present in 15 cases (48.4%). The involvement of the superficial layer of the unilateral and bilateral vocal cords occurred in 16 cases (51.6%) with the IVM in 13 cases and the involvement of the intermediate lamina of the thyroid cartilage (ITC) in 8 cases. The involvement of the ITC was associated with the involvement of the vocal muscle of the AVC region (P < 0.05). Among the pushing carcinomas, 15 of 21 (71.4%) presented with well-defined tumor mass, and 8 of 10 (80.0%) infiltrating carcinomas presented with multiple tumor nests that were often surrounded by fibrosis (P < 0.05). The AVC is an important path of invasion of subglottic in glottic carcinomas but less so for suparglottic. The Broyles’ ligaments acted as a barrier against the spread of the tumors to the thyroid cartilage, but this role was obviously weaken by the involvement of the vocal muscle of the AVC region. The infiltrating carcinomas presented with multiple tumor nests in fibrous tissue. When CO2 laser microsurgery is considered as a treatment option, these facts should be kept in mind. PMID:26200618

  9. Quantification and clinical relevance of gene amplification at chromosome 17q12-q21 in human epidermal growth factor receptor 2-amplified breast cancers

    PubMed Central

    2011-01-01

    Introduction Human epidermal growth factor receptor 2 (HER2)-amplified breast cancers represent a tumor subtype with chromosome 17q rearrangements that lead to frequent gene amplifications. The aim of this study was to quantify the amplification of genes located on chromosome 17q and to analyze the relations between the pattern of gene amplifications and the patients' characteristics and survival. Methods Patients with HER2-positive breast tumors (HER2 score of 3+ by immunohistochemistry or positive for HER2 amplification by fluorescence in situ hybridization (FISH)) (n = 86) and with HER2-negative breast tumors (n = 40) (negative controls) were included in this study. Using a quantitative polymerase chain reaction method and DNA extracted from frozen tumor specimens, 11 genes (MED1, STARD3, HER2, GRB7, THRA, RARA, TOP2A, IGFBP4, CCR7, KRT20, KRT19 and GAS), which are localized within Chr17q12-q21 and have a putative role in breast cancer development, were quantified. Relapse-free and overall survival rates were estimated from the date of surgery to the date of the event of interest (recurrence or death) using the Kaplan-Meier method. Results Gene amplification was observed only in HER2-positive tumors, and the frequency of amplification decreased with the distance of the gene from HER2. HER2 presented the highest level of amplification. TOP2A was not included in the smallest region of amplification involving HER2. Amplification of RARA, KRT20 and KRT19 was significantly associated with node-positive breast cancer (P = 0.030, P = 0.002 and P = 0.033, respectively). During a median follow-up period of 55 months (range, 6 to 81 months), the subgroup of patients with hormone receptor-negative cancer and without TOP2A amplification showed the worst survival (relapse-free survival: hazard ratio (HR) = 0.29, 95% confidence interval (95% CI), 0.13 to 0.65, P = 0.001; and overall survival: HR = 0.28, 95% CI, 0.10 to 0.76, P = 0.008). Conclusions HER2 amplification seems to drive genomic instability along chromosome 17q, leading to different patterns of gene amplification. This study confirms the clinical importance of identifying, among patients with HER2-positive breast tumors, the subgroup of patients with hormone receptor-negative and nonamplified TOP2A cancers as they have the worst prognosis. PMID:21288332

  10. A cellular automata model for avascular solid tumor growth under the effect of therapy

    NASA Astrophysics Data System (ADS)

    Reis, E. A.; Santos, L. B. L.; Pinho, S. T. R.

    2009-04-01

    Tumor growth has long been a target of investigation within the context of mathematical and computer modeling. The objective of this study is to propose and analyze a two-dimensional stochastic cellular automata model to describe avascular solid tumor growth, taking into account both the competition between cancer cells and normal cells for nutrients and/or space and a time-dependent proliferation of cancer cells. Gompertzian growth, characteristic of some tumors, is described and some of the features of the time-spatial pattern of solid tumors, such as compact morphology with irregular borders, are captured. The parameter space is studied in order to analyze the occurrence of necrosis and the response to therapy. Our findings suggest that transitions exist between necrotic and non-necrotic phases (no-therapy cases), and between the states of cure and non-cure (therapy cases). To analyze cure, the control and order parameters are, respectively, the highest probability of cancer cell proliferation and the probability of the therapeutic effect on cancer cells. With respect to patterns, it is possible to observe the inner necrotic core and the effect of the therapy destroying the tumor from its outer borders inwards.

  11. Molecular biology of testicular germ cell tumors.

    PubMed

    Gonzalez-Exposito, R; Merino, M; Aguayo, C

    2016-06-01

    Testicular germ cell tumors (TGCTs) are the most common solid tumors in young adult men. They constitute a unique pathology because of their embryonic and germ origin and their special behavior. Genetic predisposition, environmental factors involved in their development and genetic aberrations have been under study in many works throughout the last years trying to explain the susceptibility and the transformation mechanism of TGCTs. Despite the high rate of cure in this type of tumors because its particular sensitivity to cisplatin, there are tumors resistant to chemotherapy for which it is needed to find new therapies. In the present work, it has been carried out a literature review on the most important molecular aspects involved in the onset and development of such tumors, as well as a review of the major developments regarding prognostic factors, new prognostic biomarkers and the possibility of new targeted therapies.

  12. CT diagnosis and differentiation of benign and malignant varieties of solitary fibrous tumor of the pleura

    PubMed Central

    You, Xiaofang; Sun, Xiwen; Yang, Chunyan; Fang, Yong

    2017-01-01

    Abstract To investigate computed tomography (CT) characteristics of benign and malignant solitary fibrous tumors of the pleura (SFTPs). Preoperative CTs for 60 SFTP cases (49 benign and 11 malignant) with subsequently confirmed diagnoses were retrospectively analyzed. Tumor morphologies included mounded or mushroom umbrella-shape (19 cases, 31.7%), quasi-circular or oval-shape (30 cases, 50%), and growth resembling a casting mould (12 cases, 20%). Maximum tumor diameters were 1.1 to 18.9 cm (average: 6.4 ± 4.8 cm). Fifty-seven cases had clear boundaries, and 3 had partially coarse boundaries. Twenty-seven cases showed homogeneous density; 33, “geographic”-patterned inhomogeneous density; 6, calcifications; 12, intratumor blood vessels; and 3, thick nourishing peritumoral blood vessels. Pleural thickening (regular and irregular) was found adjacent to tumors in 4, compression of adjacent ribs with absorption and cortical sclerosis in 2, and location adjacent to ribs with bony destruction in 1. Four cases had a small amount of lung tissue enfolded along the boundary, 2 had multiple peritumoral pulmonary bullae, and 9 had small ipsilateral pleural effusions. Compared with benign and malignant SFTPs were larger (P < .001), had inhomogeneous density, and were more commonly associated with intratumor blood vessels and pleural effusions (P < .01). CT revealed characteristic patterns in SFTPs, including casting mould-like growth, rich blood supply, and “geographic”-patterned enhancement. In addition, larger tumor size, inhomogeneous intensities, abundant intratumor blood vessels, and pleural effusions were more common with malignancy. Lastly, multislice CT angiography can reveal feeding arteries and help guide surgical management. PMID:29245313

  13. CT diagnosis and differentiation of benign and malignant varieties of solitary fibrous tumor of the pleura.

    PubMed

    You, Xiaofang; Sun, Xiwen; Yang, Chunyan; Fang, Yong

    2017-12-01

    To investigate computed tomography (CT) characteristics of benign and malignant solitary fibrous tumors of the pleura (SFTPs).Preoperative CTs for 60 SFTP cases (49 benign and 11 malignant) with subsequently confirmed diagnoses were retrospectively analyzed.Tumor morphologies included mounded or mushroom umbrella-shape (19 cases, 31.7%), quasi-circular or oval-shape (30 cases, 50%), and growth resembling a casting mould (12 cases, 20%). Maximum tumor diameters were 1.1 to 18.9 cm (average: 6.4 ± 4.8 cm). Fifty-seven cases had clear boundaries, and 3 had partially coarse boundaries. Twenty-seven cases showed homogeneous density; 33, "geographic"-patterned inhomogeneous density; 6, calcifications; 12, intratumor blood vessels; and 3, thick nourishing peritumoral blood vessels. Pleural thickening (regular and irregular) was found adjacent to tumors in 4, compression of adjacent ribs with absorption and cortical sclerosis in 2, and location adjacent to ribs with bony destruction in 1. Four cases had a small amount of lung tissue enfolded along the boundary, 2 had multiple peritumoral pulmonary bullae, and 9 had small ipsilateral pleural effusions. Compared with benign and malignant SFTPs were larger (P < .001), had inhomogeneous density, and were more commonly associated with intratumor blood vessels and pleural effusions (P < .01).CT revealed characteristic patterns in SFTPs, including casting mould-like growth, rich blood supply, and "geographic"-patterned enhancement. In addition, larger tumor size, inhomogeneous intensities, abundant intratumor blood vessels, and pleural effusions were more common with malignancy. Lastly, multislice CT angiography can reveal feeding arteries and help guide surgical management.

  14. DNA methylation analysis reveals distinct methylation signatures in pediatric germ cell tumors.

    PubMed

    Amatruda, James F; Ross, Julie A; Christensen, Brock; Fustino, Nicholas J; Chen, Kenneth S; Hooten, Anthony J; Nelson, Heather; Kuriger, Jacquelyn K; Rakheja, Dinesh; Frazier, A Lindsay; Poynter, Jenny N

    2013-06-27

    Aberrant DNA methylation is a prominent feature of many cancers, and may be especially relevant in germ cell tumors (GCTs) due to the extensive epigenetic reprogramming that occurs in the germ line during normal development. We used the Illumina GoldenGate Cancer Methylation Panel to compare DNA methylation in the three main histologic subtypes of pediatric GCTs (germinoma, teratoma and yolk sac tumor (YST); N = 51) and used recursively partitioned mixture models (RPMM) to test associations between methylation pattern and tumor and demographic characteristics. We identified genes and pathways that were differentially methylated using generalized linear models and Ingenuity Pathway Analysis. We also measured global DNA methylation at LINE1 elements and evaluated methylation at selected imprinted loci using pyrosequencing. Methylation patterns differed by tumor histology, with 18/19 YSTs forming a distinct methylation class. Four pathways showed significant enrichment for YSTs, including a human embryonic stem cell pluripotency pathway. We identified 190 CpG loci with significant methylation differences in mature and immature teratomas (q < 0.05), including a number of CpGs in stem cell and pluripotency-related pathways. Both YST and germinoma showed significantly lower methylation at LINE1 elements compared with normal adjacent tissue while there was no difference between teratoma (mature and immature) and normal tissue. DNA methylation at imprinted loci differed significantly by tumor histology and location. Understanding methylation patterns may identify the developmental stage at which the GCT arose and the at-risk period when environmental exposures could be most harmful. Further, identification of relevant genetic pathways could lead to the development of new targets for therapy.

  15. Recurrent intracranial solitary fibrous tumor initially diagnosed as hemangiopericytoma.

    PubMed

    Hori, Emiko; Kurimoto, Masanori; Fukuda, Osamu; Takahashi, Chiaki; Nagai, Shoichi; Oya, Takeshi; Endo, Shunro

    2007-01-01

    We describe a case of an intracranial solitary fibrous tumor that recurred three times consecutively in an 11-year period. A 72-year-old man presented with a headache and gait disturbance. Magnetic resonance imaging (MRI) revealed a dumbbell tumor at the left tentorium. The tumor was removed but recurred. The first diagnosis was hemangiopericytoma, but all specimens showed a "patternless pattern" and few reticulin fibers, which features were not compatible with hemangiopericytoma. All tumors showed immunoreactivity for CD34 and bcl-2. These results point to a solitary fibrous tumor (SFT) and not to hemangiopericytoma. We present here a hypercellular spindle-cell tumor that was very similar to hemangiopericytoma but is better diagnosed as SFT.

  16. Prediction of lymph node involvement in patients with breast tumors measuring 3-5 cm in a middle-income setting: the role of CancerMath.

    PubMed

    Pijnappel, E N; Bhoo-Pathy, N; Suniza, J; See, M H; Tan, G H; Yip, C H; Hartman, M; Taib, N A; Verkooijen, H M

    2014-12-01

    In settings with limited resources, sentinel lymph node biopsy (SNB) is only offered to breast cancer patients with small tumors and a low a priori risk of axillary metastases. We investigated whether CancerMath, a free online prediction tool for axillary lymph node involvement, is able to identify women at low risk of axillary lymph node metastases in Malaysian women with 3-5 cm tumors, with the aim to offer SNB in a targeted, cost-effective way. Women with non-metastatic breast cancers, measuring 3-5 cm were identified within the University Malaya Medical Centre (UMMC) breast cancer registry. We compared CancerMath-predicted probabilities of lymph node involvement between women with versus without lymph node metastases. The discriminative performance of CancerMath was tested using receiver operating characteristic (ROC) analysis. Out of 1,017 patients, 520 (51 %) had axillary involvement. Tumors of women with axillary involvement were more often estrogen-receptor positive, progesterone-receptor positive, and human epidermal growth factor receptor (HER)-2 positive. The mean CancerMath score was higher in women with axillary involvement than in those without (53.5 vs. 51.3, p = 0.001). In terms of discrimination, CancerMath performed poorly, with an area under the ROC curve of 0.553 (95 % confidence interval CI 0.518-0.588). Attempts to optimize the CancerMath model by adding ethnicity and HER2 to the model did not improve discriminatory performance. For Malaysian women with tumors measuring 3-5 cm, CancerMath is unable to accurately predict lymph node involvement and is therefore not helpful in the identification of women at low risk of node-positive disease who could benefit from SNB.

  17. Detection of circulating tumor cells harboring a unique ALK rearrangement in ALK-positive non-small-cell lung cancer.

    PubMed

    Pailler, Emma; Adam, Julien; Barthélémy, Amélie; Oulhen, Marianne; Auger, Nathalie; Valent, Alexander; Borget, Isabelle; Planchard, David; Taylor, Melissa; André, Fabrice; Soria, Jean Charles; Vielh, Philippe; Besse, Benjamin; Farace, Françoise

    2013-06-20

    The diagnostic test for ALK rearrangement in non-small-cell lung cancer (NSCLC) for crizotinib treatment is currently done on tumor biopsies or fine-needle aspirations. We evaluated whether ALK rearrangement diagnosis could be performed by using circulating tumor cells (CTCs). The presence of an ALK rearrangement was examined in CTCs of 18 ALK-positive and 14 ALK-negative patients by using a filtration enrichment technique and filter-adapted fluorescent in situ hybridization (FA-FISH), a FISH method optimized for filters. ALK-rearrangement patterns were determined in CTCs and compared with those present in tumor biopsies. ALK-rearranged CTCs and tumor specimens were characterized for epithelial (cytokeratins, E-cadherin) and mesenchymal (vimentin, N-cadherin) marker expression. ALK-rearranged CTCs were monitored in five patients treated with crizotinib. All ALK-positive patients had four or more ALK-rearranged CTCs per 1 mL of blood (median, nine CTCs per 1 mL; range, four to 34 CTCs per 1 mL). No or only one ALK-rearranged CTC (median, one per 1 mL; range, zero to one per 1 mL) was detected in ALK-negative patients. ALK-rearranged CTCs harbored a unique (3'5') split pattern, and heterogeneous patterns (3'5', only 3') of splits were present in tumors. ALK-rearranged CTCs expressed a mesenchymal phenotype contrasting with heterogeneous epithelial and mesenchymal marker expressions in tumors. Variations in ALK-rearranged CTC levels were detected in patients being treated with crizotinib. ALK rearrangement can be detected in CTCs of patients with ALK-positive NSCLC by using a filtration technique and FA-FISH, enabling both diagnostic testing and monitoring of crizotinib treatment. Our results suggest that CTCs harboring a unique ALK rearrangement and mesenchymal phenotype may arise from clonal selection of tumor cells that have acquired the potential to drive metastatic progression of ALK-positive NSCLC.

  18. Invasive growth patterns of juvenile nasopharyngeal angiofibroma: radiological imaging and clinical implications.

    PubMed

    Szymańska, Anna; Szymański, Marcin; Czekajska-Chehab, Elżbieta; Szczerbo-Trojanowska, Małgorzata

    2014-07-01

    Juvenile nasopharyngeal angiofibroma is a benign lesion with locally aggressive nature. Knowledge of its typical growth patterns is crucial for precise preoperative staging and adequate preoperative patient counseling. This pictorial essay focuses on characteristic radiological features and paths of invasive growth of this rare tumor. Also, the impact of accurate preoperative evaluation of tumor extensions on surgical planning and results of treatment are discussed. © The Foundation Acta Radiologica 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  19. Histopathologic patterns as markers of prognosis in patients undergoing hepatectomy for colorectal cancer liver metastases - Pushing growth as an independent risk factor for decreased survival.

    PubMed

    Falcão, Daniela; Alexandrino, Henrique; Caetano Oliveira, Rui; Martins, João; Ferreira, Luís; Martins, Ricardo; Serôdio, Marco; Martins, Mónica; Tralhão, José Guilherme; Cipriano, Maria Augusta; Castro E Sousa, Francisco

    2018-04-11

    Liver resection combined with neoadjuvant chemotherapy (NAC) has reported notable results in patients with colorectal liver metastases (CRLM). Tumoral response to NAC is associated with specific histopathologic patterns with prognostic implications. The main objective of this study was to evaluate the influence of pathological findings on overall survival (OS), disease-free survival (DFS) and liver recurrence-free survival (LRFS). Analysis of clinical and outcome data from 110 patients who underwent first CRLM resection between January 2010 and July 2013. Blinded pathological review of histological material of several parameters: resection margin, tumor regression grade (TRG), tumor thickness at the tumor-normal interface (TTNI) and the growth pattern (GP). The median survival following hepatic resection was 52 months and 3- and 5- year Kaplan-Meier estimates were 69 and 48%, respectively. Seventy-four patients developed recurrent disease. Oxaliplatin-based chemotherapy was significantly associated with a pushing GP. A positive resection margin was an independent predictor of decreased DFS (p = 0.018) but not of decreased OS. LRFS was strongly reduced by the absence of histologic tumor response (p = 0.018). The pushing pattern had an adverse impact on both OS (p = 0.007) and DFS (p = 0.004) on multivariate analysis. The prognostic value of histopathological features in patients who underwent CRLM's resection is undeniable. The pushing GP was related with worse prognosis. Further studies are required to clarify the biological mechanisms underlying these findings in order to enhance a more personalized and efficient treatment of these patients. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

  20. Imaging Surrogates of Infiltration Obtained Via Multiparametric Imaging Pattern Analysis Predict Subsequent Location of Recurrence of Glioblastoma

    PubMed Central

    Akbari, Hamed; Macyszyn, Luke; Da, Xiao; Bilello, Michel; Wolf, Ronald L.; Martinez-Lage, Maria; Biros, George; Alonso-Basanta, Michelle; O’Rourke, Donald M.; Davatzikos, Christos

    2016-01-01

    Background Glioblastoma is an aggressive and highly infiltrative brain cancer. Standard surgical resection is guided by enhancement on postcontrast T1-weighted (T1) magnetic resonance imaging (MRI), which is insufficient for delineating surrounding infiltrating tumor. Objective To develop imaging biomarkers that delineate areas of tumor infiltration and predict early recurrence in peritumoral tissue. Such markers would enable intensive, yet targeted, surgery and radiotherapy, thereby potentially delaying recurrence and prolonging survival. Methods Preoperative multiparametric MRIs (T1, T1-Gad, T2-weighted [T2], T2-fluid-attenuated inversion recovery [FLAIR], diffusion tensor imaging (DTI), and dynamic susceptibility contrast-enhanced [DSC]-MRI) from 31 patients were combined using machine learning methods, thereby creating predictive spatial maps of infiltrated peritumoral tissue. Cross validation was used in the retrospective cohort to achieve generalizable biomarkers. Subsequently, the imaging signatures learned from the retrospective study were used in a replication cohort of 34 new patients. Spatial maps representing likelihood of tumor infiltration and future early recurrence were compared to regions of recurrence on postresection follow-up studies with pathology confirmation. Results This technique produced predictions of early recurrence with a mean area under the curve (AUC) of 0.84, sensitivity of 91%, specificity of 93%, and odds ratio estimates of 9.29 (99% CI, 8.95–9.65) for tissue predicted to be heavily infiltrated in the replication study. Regions of tumor recurrence were found to have subtle, yet fairly distinctive multiparametric imaging signatures when analyzed quantitatively by pattern analysis and machine learning. Conclusion Visually imperceptible imaging patterns discovered via multiparametric pattern analysis methods were found to estimate the extent of infiltration and location of future tumor recurrence, paving the way for improved targeted treatment. PMID:26813856

  1. Augmentation of Breast Cancer Growth and Metastasis by Chronic Stressor Exposure

    DTIC Science & Technology

    2012-07-01

    good model for examining NE effects on the tumor stromal cells in the absence of direct involvement of β-AR-expressing tumor cells . In that report...SHG+ fiber content also directly inhibit tumor metastasis, perhaps through direct effects on tumor cell motility, and that this inhibition is induced... effects in different cell types within a tumor that contribute to tumor progression. Nevertheless, the overall result is a protumorigenic signal that

  2. Regression Patterns of Iris Melanoma after Palladium-103 (103Pd) Plaque Brachytherapy.

    PubMed

    Chaugule, Sonal S; Finger, Paul T

    2017-07-01

    To evaluate the patterns of regression of iris melanoma after treatment with palladium-103 ( 103 Pd) plaque brachytherapy. Retrospective, nonrandomized, interventional case series. Fifty patients with primary malignant melanoma of the iris. Palladium-103 plaque brachytherapy. Changes in tumor size, pigmentation, and vascularity; incidence of iris neovascularization; and radiation-related complications. The mean age in the case series was 61.2±14.9 years. The mean tumor thickness was 1.4±0.6 mm. According to the American Joint Committee on Cancer, eighth edition, staging criteria for iris melanoma, 21 tumors (42%) were T1a, 5 tumors (10%) were T1b, and 24 tumors (48%) were T2a. The tumor was melanotic in 37 cases (74%) and amelanotic in 13 cases (26%); of these, 13 tumors (26%) showed variable pigmentation. After brachytherapy, mean tumor thickness decreased to 0.9±0.2 mm. Pigmentation increased in 32 tumors (64%), decreased in 11 tumors (22%), and was unchanged in 6 tumors (12%). For intrinsic vascularity (n = 19), 12 tumors (63%) showed decrease and 7 tumors (37%) showed complete resolution. Appearance of ectropion uveae showed diminution in 15 tumors (43%); newly present corectopia was observed in 6 patients (12%). On high-frequency ultrasound imaging, of the 42 tumors (84%) with low to moderate internal reflectivity, 30 tumors (60%) showed an increase in internal reflectivity on regression. Iris stromal atrophy was noted in 26 patients (52%), progression or new-onset cataract was noted in 22 patients (44%), neovascular glaucoma was noted in 1 patient (2%), and there were no cases of corneal opacity. There was no clinical evidence (0%) of radiation-induced retinopathy, maculopathy, or optic neuropathy. Mean follow-up in this series was 5.2 years (range, 0.5-17 years). The most common findings related to iris melanoma regression after 103 Pd plaque brachytherapy included decreased intrinsic tumor vascularity, increased tumor pigmentation, and decreased tumor thickness with synchronous increase in internal ultrasonographic reflectivity. No irreversible sight-limiting complications were noted. Copyright © 2017 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  3. Epithelioid hemangioendothelioma of the spine. Report of two cases.

    PubMed

    Aquilina, Kristian; Lim, Christopher; Kamel, Mahmoud Hamdy; Marks, Charles J; O'Sullivan, Michael G; Keohane, Catherine

    2005-11-01

    Epithelioid hemangioendothelioma (EH) is a rare tumor of vascular origin. The authors describe two cases of spinal EH, one involving the T-10 vertebra and the second involving the upper cervical spine. In the first case the patient underwent resection of the tumor; this case represents the longest reported follow-up period for spinal EH. In the second case, extensive involvement of C-2, C-3, and C-4 as well as encasement of both vertebral arteries precluded safe tumor resection, and posterior occipitocervical stabilization was performed. The patient subsequently died of metastatic disease. The findings in these two cases underscore the difficulty in predicting the clinical behavior of spinal EH based solely on histological and clinical features as well as the uncertainty of the roles of surgery, chemotherapy, and radiotherapy in the oncological management of a spinal tumor for which clinical data are very limited.

  4. Gene expression profiling identifies inflammation and angiogenesis as distinguishing features of canine hemangiosarcoma.

    PubMed

    Tamburini, Beth A; Phang, Tzu L; Fosmire, Susan P; Scott, Milcah C; Trapp, Susan C; Duckett, Megan M; Robinson, Sally R; Slansky, Jill E; Sharkey, Leslie C; Cutter, Gary R; Wojcieszyn, John W; Bellgrau, Donald; Gemmill, Robert M; Hunter, Lawrence E; Modiano, Jaime F

    2010-11-09

    The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA). Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma). The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic plasticity creates this phenotype, although they suggest that cells which give rise to hemangiosarcoma modulate their microenvironment to promote tumor growth and survival. We propose that the frequent occurrence of canine hemangiosarcoma in defined dog breeds, as well as its similarity to homologous tumors in humans, offers unique models to solve the dilemma of stem cell plasticity and whether angiogenic endothelial cells and hematopoietic cells originate from a single cell or from distinct progenitor cells.

  5. Gene expression profiling identifies inflammation and angiogenesis as distinguishing features of canine hemangiosarcoma

    PubMed Central

    2010-01-01

    Background The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. Methods We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA). Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Results Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma). Conclusions The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic plasticity creates this phenotype, although they suggest that cells which give rise to hemangiosarcoma modulate their microenvironment to promote tumor growth and survival. We propose that the frequent occurrence of canine hemangiosarcoma in defined dog breeds, as well as its similarity to homologous tumors in humans, offers unique models to solve the dilemma of stem cell plasticity and whether angiogenic endothelial cells and hematopoietic cells originate from a single cell or from distinct progenitor cells. PMID:21062482

  6. Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

    PubMed

    Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

    2015-01-01

    The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered classic methods previously used to define CIMP. The results that we provide can be used to refine existing molecular subtypes of cancer into more homogeneously behaving subgroups, potentially leading to more uniform responses in clinical trials.

  7. Changes in the microarchitecture of the pancreatic cancer stroma are linked to neutrophil-dependent reprogramming of stellate cells and reflected by diffusion-weighted magnetic resonance imaging

    PubMed Central

    Mayer, Philipp; Dinkic, Christine; Jesenofsky, Ralf; Klauss, Miriam; Schirmacher, Peter; Dapunt, Ulrike; Hackert, Thilo; Uhle, Florian; Hänsch, G. Maria; Gaida, Matthias M.

    2018-01-01

    In pancreatic cancer (PDAC) intratumor infiltration of polymorphonuclear neutrophils (PMN) is associated with histologically apparent alterations of the tumor growth pattern. The aim of this study was to examine possible associations between PMN infiltration, tumor microarchitecture, and water diffusivity in diffusion-weighted magnetic resonance imaging (DW-MRI), and to further asses the underlying mechanisms. Methods: DW-MRI was performed in 33 PDAC patients prior to surgery. In parallel, tissue specimen were examined histologically for growth pattern, azurocidin-positive PMN infiltrates, and the presence of alpha-smooth muscle actin (α-SMA) and metalloproteinase 9 (MMP9)-positive myofibroblastic cells. For confirmation of the histological findings, a tissue microarray of a second cohort of patients (n=109) was prepared and examined similarly. For in vitro studies, the pancreatic stellate cell line RLT was co-cultivated either with isolated PMN, PMN-lysates, or recombinant azurocidin and characterized by Western blot, flow cytometry, and proteome profiler arrays. Results: Tumors with high PMN density showed restricted water diffusion in DW-MRI and histologic apparent alterations of the tumor microarchitecture (microglandular, micropapillary, or overall poorly differentiated growth pattern) as opposed to tumors with scattered PMN. Areas with altered growth pattern lacked α-SMA-positive myofibroblastic cells. Tissue microarrays confirmed a close association of high PMN density with alterations of the tumor microarchitecture and revealed a significant association of high PMN density with poor histologic grade of differentiation (G3). In vitro experiments provided evidence for direct effects of PMN on stellate cells, where a change to a spindle shaped cell morphology in response to PMN and to PMN-derived azurocidin was seen. Azurocidin incorporated into stellate cells, where it associated with F-actin. Down-regulation of α-SMA was seen within hours, as was activation of the p38-cofilin axis, up-regulation of MMP9, and acquisition of intracellular lipid droplets, which together indicate a phenotype switch of the stellate cells. Conclusion: In PDAC, PMN infiltrates are associated with alterations of the tumor microarchitecture. As a causal relationship, we propose a reprogramming of stellate cells by PMN-derived azurocidin towards a phenotype, which affects the microarchitecture of the tumor. PMID:29290790

  8. Treatment of solid tumors by interstitial release of recoiling short-lived alpha emitters

    NASA Astrophysics Data System (ADS)

    Arazi, L.; Cooks, T.; Schmidt, M.; Keisari, Y.; Kelson, I.

    2007-08-01

    A new method utilizing alpha particles to treat solid tumors is presented. Tumors are treated with interstitial radioactive sources which continually release short-lived alpha emitting atoms from their surface. The atoms disperse inside the tumor, delivering a high dose through their alpha decays. We implement this scheme using thin wire sources impregnated with 224Ra, which release by recoil 220Rn, 216Po and 212Pb atoms. This work aims to demonstrate the feasibility of our method by measuring the activity patterns of the released radionuclides in experimental tumors. Sources carrying 224Ra activities in the range 10-130 kBq were used in experiments on murine squamous cell carcinoma tumors. These included gamma spectroscopy of the dissected tumors and major organs, Fuji-plate autoradiography of histological tumor sections and tissue damage detection by Hematoxylin-Eosin staining. The measurements focused on 212Pb and 212Bi. The 220Rn/216Po distribution was treated theoretically using a simple diffusion model. A simplified scheme was used to convert measured 212Pb activities to absorbed dose estimates. Both physical and histological measurements confirmed the formation of a 5-7 mm diameter necrotic region receiving a therapeutic alpha-particle dose around the source. The necrotic regions shape closely corresponded to the measured activity patterns. 212Pb was found to leave the tumor through the blood at a rate which decreased with tumor mass. Our results suggest that the proposed method, termed DART (diffusing alpha-emitters radiation therapy), may potentially be useful for the treatment of human patients.

  9. Shrink pattern of breast cancer after neoadjuvant chemotherapy and its correlation with clinical pathological factors.

    PubMed

    Wang, Shushu; Zhang, Yi; Yang, Xinhua; Fan, Linjun; Qi, Xiaowei; Chen, Qingqiu; Jiang, Jun

    2013-07-24

    Breast conservation therapy (BCS) after neoadjuvant chemotherapy (NCT) can improve patients' quality of life. Currently used intraoperative examination for negative margins may not be sufficient to detect microresidual foci, which are a risk factor for local recurrence. This study was conducted to investigate the shrinking pattern of breast cancer and residual tumors as a risk factor for BCS after NCT. Ninety women with stage II or III invasive ductal carcinoma who achieved partial response after NCT with paclitaxel and epirubicin were enrolled. All patients had undergone modified radical mastectomy. One-half of the surgical specimens were subjected to subserial sectioning. Pathological changes of tumor bed and pericancerous tissues were examined with an optical microscope. The levels of estrogen receptors, progesterone receptors and HER2 were analyzed by immnohistochemical staining. The residual tumors were classified into three types according to their microscopic morphology: solitary lesion, multifocal and patchlike lesions, and main residual tumor with satellite lesions. Type I residual tumors were found in 55 patients (61%), type II in 30 patients (33%) and type III in 5 patients (6%). Types II and III were often associated with larger primary tumors. The types of residual tumors were not correlated with the status of hormone receptors or HER2. Three types of residual tumors were observed after NCT. The solitary residual tumor is most common, but main residual tumors with satellite lesions are most likely to cause local recurrence after BCS. Subserial sectioning would improve the identification of microfoci and patient survival after BCS.

  10. Brown tumors of the anterior skull base as the initial manifestation of true normocalcemic primary hyperparathyroidism: report of three cases and review of the literature.

    PubMed

    Khalatbari, Mahmoud Reza; Hamidi, Mehrdokht; Moharamzad, Yashar; Setayesh, Ali; Amirjamshidi, Abbas

    2013-01-01

    Brown tumor is a bone lesion secondary to hyperparathyroidism of various etiologies. Skeletal involvement in primary hyperparathyroidism secondary to parathyroid adenoma is very uncommon and brown tumor has become extremely a rare clinical entity. Hyperparathyroidism is usually associated with high levels of serum calcium. Brown tumor as the only and initial symptom of normocalcemic primary hyperparathyroidism is extremely rare. Moreover, involvement of the skull base and the orbit is exceedingly rare. The authors would report three cases of brown tumor of the anterior skull base that were associated with true normocalcemic primary hyperparathyroidism. Clinical manifestations, neuroimaging findings, pathological findings, diagnosis and treatment of the patients are discussed and the relevant literature is reviewed.

  11. Cell Transformation by PTP1B Truncated Mutants Found in Human Colon and Thyroid Tumors.

    PubMed

    Mei, Wenhan; Wang, Kemin; Huang, Jian; Zheng, Xinmin

    2016-01-01

    Expression of wild-type protein tyrosine phosphatase (PTP) 1B may act either as a tumor suppressor by dysregulation of protein tyrosine kinases or a tumor promoter through Src dephosphorylation at Y527 in human breast cancer cells. To explore whether mutated PTP1B is involved in human carcinogenesis, we have sequenced PTP1B cDNAs from human tumors and found splice mutations in ~20% of colon and thyroid tumors. The PTP1BΔE6 mutant expressed in these two tumor types and another PTP1BΔE5 mutant expressed in colon tumor were studied in more detail. Although PTP1BΔE6 revealed no phosphatase activity compared with wild-type PTP1B and the PTP1BΔE5 mutant, its expression induced oncogenic transformation of rat fibroblasts without Src activation, indicating that it involved signaling pathways independent of Src. The transformed cells were tumourigenic in nude mice, suggesting that the PTP1BΔE6 affected other molecule(s) in the human tumors. These observations may provide a novel therapeutic target for colon and thyroid cancer.

  12. Hypothalamic tumor

    MedlinePlus

    ... occur at any age. They are often more aggressive in adults than in children. In adults, tumors ... The treatment depends on how aggressive the tumor is, and whether it is a glioma or another type of cancer. Treatment may involve combinations of surgery, radiation , ...

  13. Differences in MYB expression and gene abnormalities further confirm that salivary cribriform basal cell tumors and adenoid cystic carcinoma are two distinct tumor entities.

    PubMed

    Tian, Zhen; Li, Lei; Zhang, Chun-Ye; Gu, Ting; Li, Jiang

    2016-10-01

    In practices, some cases of salivary basal cell tumors that consist mainly of cribriform growth pattern are difficult to differentiate from adenoid cystic carcinoma (AdCC). Identification of reliable molecular biomarkers for the differential diagnosis between them is required. Twenty-two cases of cribriform salivary basal cell tumors (at least 10% cribriform pattern present in each tumor) comprising 18 cases of basal cell adenoma (BCA) and four cases of basal cell adenocarcinoma (BcAC) were collected between 1985 and 2008. Twenty cases of cribriform AdCC were retrieved from our archives. MYB protein expression and gene abnormalities were detected in all cases by immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH) analyses, respectively. Neither MYB protein nor split genes were detected in any of the cases of cribriform basal cell tumors, while 55% (11/20) of cases of cribriform AdCC had MYB protein expression. High MYB expression was detected in 81.8% (9/11) cases, while low expression was found in the remaining cases. FISH analysis indicated that nine AdCC tumors with high MYB protein expression were split gene-positive, while MYB gene splitting was not detected in the 11 cases with low or absent MYB protein expression. The molecular changes in AdCC differ from those associated with cribriform basal cell tumors, which further confirms that cribriform basal cell tumors and AdCC are two distinct tumor entities. Simultaneous detection of MYB protein expression and the associated molecular changes could be beneficial in differentiating salivary cribriform basal cell tumors from AdCC. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Diagnostic Value of Multidetector CT and Its Multiplanar Reformation, Volume Rendering and Virtual Bronchoscopy Postprocessing Techniques for Primary Trachea and Main Bronchus Tumors.

    PubMed

    Luo, Mingyue; Duan, Chaijie; Qiu, Jianping; Li, Wenru; Zhu, Dongyun; Cai, Wenli

    2015-01-01

    To evaluate the diagnostic value of multidetector CT (MDCT) and its multiplanar reformation (MPR), volume rendering (VR) and virtual bronchoscopy (VB) postprocessing techniques for primary trachea and main bronchus tumors. Detection results of 31 primary trachea and main bronchus tumors with MDCT and its MPR, VR and VB postprocessing techniques, were analyzed retrospectively with regard to tumor locations, tumor morphologies, extramural invasions of tumors, longitudinal involvements of tumors, morphologies and extents of luminal stenoses, distances between main bronchus tumors and trachea carinae, and internal features of tumors. The detection results were compared with that of surgery and pathology. Detection results with MDCT and its MPR, VR and VB were consistent with that of surgery and pathology, included tumor locations (tracheae, n = 19; right main bronchi, n = 6; left main bronchi, n = 6), tumor morphologies (endoluminal nodes with narrow bases, n = 2; endoluminal nodes with wide bases, n = 13; both intraluminal and extraluminal masses, n = 16), extramural invasions of tumors (brokethrough only serous membrane, n = 1; 4.0 mm-56.0 mm, n = 14; no clear border with right atelectasis, n = 1), longitudinal involvements of tumors (3.0 mm, n = 1; 5.0 mm-68.0 mm, n = 29; whole right main bronchus wall and trachea carina, n = 1), morphologies of luminal stenoses (irregular, n = 26; circular, n = 3; eccentric, n = 1; conical, n = 1) and extents (mild, n = 5; moderate, n = 7; severe, n = 19), distances between main bronchus tumors and trachea carinae (16.0 mm, n = 1; invaded trachea carina, n = 1; >20.0 mm, n = 10), and internal features of tumors (fairly homogeneous densities with rather obvious enhancements, n = 26; homogeneous density with obvious enhancement, n = 1; homogeneous density without obvious enhancement, n = 1; not enough homogeneous density with obvious enhancement, n = 1; punctate calcification with obvious enhancement, n = 1; low density without obvious enhancement, n = 1). MDCT and its MPR, VR and VB images have respective advantages and disadvantages. Their combination could complement to each other to accurately detect locations, natures (benignancy, malignancy or low malignancy), and quantities (extramural invasions, longitudinal involvements, extents of luminal stenoses, distances between main bronchus tumors and trachea carinae) of primary trachea and main bronchus tumors with crucial information for surgical treatment, are highly useful diagnostic methods for primary trachea and main bronchus tumors.

  15. Clonal Evolution through Loss of Chromosomes and Subsequent Polyploidization in Chondrosarcoma

    PubMed Central

    Olsson, Linda; Paulsson, Kajsa; Bovée, Judith V. M. G.; Nord, Karolin H.

    2011-01-01

    Near-haploid chromosome numbers have been found in less than 1% of cytogenetically reported tumors, but seem to be more common in certain neoplasms including the malignant cartilage-producing tumor chondrosarcoma. By a literature survey of published karyotypes from chondrosarcomas we could confirm that loss of chromosomes resulting in hyperhaploid-hypodiploid cells is common and that these cells may polyploidize. Sixteen chondrosarcomas were investigated by single nucleotide polymorphism (SNP) array and the majority displayed SNP patterns indicative of a hyperhaploid-hypodiploid origin, with or without subsequent polyploidization. Except for chromosomes 5, 7, 19, 20 and 21, autosomal loss of heterozygosity was commonly found, resulting from chromosome loss and subsequent duplication of monosomic chromosomes giving rise to uniparental disomy. Additional gains, losses and rearrangements of genetic material, and even repeated rounds of polyploidization, may affect chondrosarcoma cells resulting in highly complex karyotypes. Loss of chromosomes and subsequent polyploidization was not restricted to a particular chondrosarcoma subtype and, although commonly found in chondrosarcoma, binucleated cells did not seem to be involved in these events. PMID:21949816

  16. Expression of cancer-testis antigens MAGE-A4 and MAGE-C1 in oral squamous cell carcinoma.

    PubMed

    Montoro, José Raphael de Moura Campos; Mamede, Rui Celso Martins; Neder Serafini, Luciano; Saggioro, Fabiano Pinto; Figueiredo, David Livingstone Alves; Silva, Wilson Araújo da; Jungbluth, Achim A; Spagnoli, Giulio Cesare; Zago, Marco Antônio

    2012-08-01

    Tumor markers are genes or their products expressed exclusively or preferentially in tumor cells and cancer-testis antigens (CTAs) form a group of genes with a typical expression pattern expressed in a variety of malignant neoplasms. CTAs are considered potential targets for cancer vaccines. It is possible that the CTA MAGE-A4 (melanoma antigen) and MAGE-C1 are expressed in carcinoma of the oral cavity and are related with survival. This study involved immunohistochemical analysis of 23 patients with oral squamous cell carcinoma (SCC) and was carried out using antibodies for MAGE-A4 and MAGE-C1. Fisher's exact test and log-rank test were used to evaluate the results. The expression of the MAGE-A4 and MAGE-C1 were 56.5% and 47.8% without statistical difference in studied variables and survival. The expression of at least 1 CTA was present in 78.3% of the patients, however, without correlation with clinicopathologic variables and survival. Copyright © 2011 Wiley Periodicals, Inc.

  17. [Clinical value of MRI united-sequences examination in diagnosis and differentiation of morphological sub-type of hilar and extrahepatic big bile duct cholangiocarcinoma].

    PubMed

    Yin, Long-Lin; Song, Bin; Guan, Ying; Li, Ying-Chun; Chen, Guang-Wen; Zhao, Li-Ming; Lai, Li

    2014-09-01

    To investigate MRI features and associated histological and pathological changes of hilar and extrahepatic big bile duct cholangiocarcinoma with different morphological sub-types, and its value in differentiating between nodular cholangiocarcinoma (NCC) and intraductal growing cholangiocarcinoma (IDCC). Imaging data of 152 patients with pathologically confirmed hilar and extrahepatic big bile duct cholangiocarcinoma were reviewed, which included 86 periductal infiltrating cholangiocarcinoma (PDCC), 55 NCC, and 11 IDCC. Imaging features of the three morphological sub-types were compared. Each of the subtypes demonstrated its unique imaging features. Significant differences (P < 0.05) were found between NCC and IDCC in tumor shape, dynamic enhanced pattern, enhancement degree during equilibrium phase, multiplicity or singleness of tumor, changes in wall and lumen of bile duct at the tumor-bearing segment, dilatation of tumor upstream or downstream bile duct, and invasion of adjacent organs. Imaging features reveal tumor growth patterns of hilar and extrahepatic big bile duct cholangiocarcinoma. MRI united-sequences examination can accurately describe those imaging features for differentiation diagnosis.

  18. Two-phase computed tomography study of warthin tumor of parotid gland: differentiation from other parotid gland tumors and its pathologic explanation.

    PubMed

    Woo, Seung Hoon; Choi, Dae-Seob; Kim, Jin-pyeong; Park, Jung Je; Joo, Yeon Hee; Chung, Phil-Sang; Kim, Bo-Young; Ko, Young-Hyeh; Jeong, Han-Sin; Kim, Hyung-Jin

    2013-01-01

    The objective of this study was to define the radiological characteristics of 2-phase computed tomography (CT) of parotid gland Warthin tumors (WTs) with a pathologic basis for these findings. We prospectively enrolled 116 patients with parotid gland tumor who underwent preoperative 2-phase CT scans(scanning delays of 30 and 120 seconds). The attenuation changes and enhancement patterns were analyzed according to pathology. We also evaluated size-matched samples of WTs and pleomorphic adenoma by staining CD31, vascular endothelial growth factor-receptor 2, collagen IV, and smooth muscle actin. Computed tomography numbers in WTs were significantly higher than those in other tumors in early-phase scans and lower in delayed scans. Pathologically, CD31(+) blood vessel area was significantly higher in WTs than in pleomorphic adenomas. In addition, WTs had an extensive capillary network and many leaky blood vessels. The enhancement pattern of early fill-in and early washout is the typical finding of WTs on 2-phase CT scans, which may be attributed pathologically to abundant blood vessel and extensive capillary network.

  19. Epithelial-myoepithelial carcinoma with myoepithelial anaplasia: report of a case with cytologic findings of a rare variant.

    PubMed

    Suzuki, Takashi; Murata, Shin-ichi; Yamaguchi, Hiroshi; Shimizu, Yoshihiko; Shimizu, Michio

    2010-01-01

    Epithelial-myoepithelial carcinoma (EMC) is usually a low grade malignancy with rare mortality. Rare aggressive variants of EMC, dedifferentiated EMC and EMC with myoepithelial anaplasia have been reported. An 81-year-old man presented with EMC of the parotid gland showing the classical type at the time of initial presentation and a high grade type with myoepithelial anaplasia at recurrence after 10 years. We compared the histologic and cytologic findings of the initial and recurrent tumors. Aspiration cytology of the initial tumor was typical of classical EMC, represented by a biphasic pattern composed of sheetlike and tubular clusters. In contrast, cytologic specimens of the recurrent tumor, which had a focally biphasic pattern similar to that of the initial tumor, also had many isolated or discohesive piled-up clusters of spindle and polygonal cells with nuclear atypia. The cytologic findings of the recurrent tumor were consistent with a rare variant of EMC with myoepithelial anaplasia. To the best of our knowledge, this is the first report of the cytologic finding of an EMC with myoepithelial anaplasia.

  20. Multinodular and Vacuolating Neuronal Tumor of the Cerebrum: A New "Leave Me Alone" Lesion with a Characteristic Imaging Pattern.

    PubMed

    Nunes, R H; Hsu, C C; da Rocha, A J; do Amaral, L L F; Godoy, L F S; Watkins, T W; Marussi, V H; Warmuth-Metz, M; Alves, H C; Goncalves, F G; Kleinschmidt-DeMasters, B K; Osborn, A G

    2017-10-01

    Multinodular and vacuolating neuronal tumor of the cerebrum is a recently reported benign, mixed glial neuronal lesion that is included in the 2016 updated World Health Organization classification of brain neoplasms as a unique cytoarchitectural pattern of gangliocytoma. We report 33 cases of presumed multinodular and vacuolating neuronal tumor of the cerebrum that exhibit a remarkably similar pattern of imaging findings consisting of a subcortical cluster of nodular lesions located on the inner surface of an otherwise normal-appearing cortex, principally within the deep cortical ribbon and superficial subcortical white matter, which is hyperintense on FLAIR. Only 4 of our cases are biopsy-proven because most were asymptomatic and incidentally discovered. The remaining were followed for a minimum of 24 months (mean, 3 years) without interval change. We demonstrate that these are benign, nonaggressive lesions that do not require biopsy in asymptomatic patients and behave more like a malformative process than a true neoplasm. © 2017 by American Journal of Neuroradiology.

  1. Are all pelvic (nonuterine) serous carcinomas of tubal origin?

    PubMed

    Przybycin, Christopher G; Kurman, Robert J; Ronnett, Brigitte M; Shih, Ie-Ming; Vang, Russell

    2010-10-01

    It has been proposed that the presence of tubal intraepithelial carcinoma (TIC), in association with one-third to nearly half of pelvic serous carcinomas, is evidence of fallopian tube origin for high-grade serous carcinomas that would have been otherwise classified as primary ovarian or peritoneal. To address this hypothesis, we evaluated a series of 114 consecutive pelvic (nonuterine) gynecologic carcinomas at our institution (2006 to 2008) to determine the frequency of TIC in 52 cases in which all the resected fallopian tube tissue was examined microscopically. These 52 cases were classified as ovarian (n=37), peritoneal (n=8), or fallopian tube (n=7) in origin as per conventional criteria based on disease distribution. The presence of TIC and its location and relationship to invasive carcinoma in the fallopian tubes and ovaries were assessed. Among the 45 cases of ovarian/peritoneal origin, carcinoma subtypes included 41 high-grade serous, 1 endometrioid, 1 mucinous, 1 high-grade, not otherwise specified, and 1 malignant mesodermal mixed tumor. TIC was identified in 24 cases (59%) of high-grade serous carcinoma but not among any of the other subtypes; therefore, the term serous TIC (STIC) is a more specific appellation. STICs were located in the fimbriated end of the tube in 22 cases (92%) and in the ampulla in 2 (8%); they were unilateral in 21 (88%) and bilateral in 3 (13%). STICs in the absence of an associated invasive carcinoma in the same tube were detected in 7 cases (30%) and with invasive carcinoma in the same tube in 17 (71%). Unilateral STICs were associated with bilateral ovarian involvement in 15 cases and unilateral (ipsilateral) ovarian involvement in 5 (the remaining case with a unilateral STIC had a primary peritoneal tumor with no ovarian involvement); the bilateral STICs were all associated with bilateral ovarian involvement. Six of the 7 primary tubal tumors were high-grade serous carcinomas, and 4 of these 6 (67%) had STICs. Based on conventional criteria, 70%, 17%, and 13% of high-grade serous carcinomas qualified for classification as ovarian, peritoneal, and tubal in origin, respectively; however, using STIC as a supplemental criterion to define a case as tubal in origin, the distribution was modified to 28%, 8%, and 64%, respectively. Features of tumors in the ovary that generally suggest metastatic disease (bilaterality, small size, nodular growth pattern, and surface plaques) were identified with similar frequency in cases with and without STIC and were, therefore, not predictive of tubal origin. The findings, showing that nearly 60% of high-grade pelvic (nonuterine) serous carcinomas are associated with STICs, are consistent with the proposal that the fallopian tube is the source of a majority of these tumors. If these findings can be validated by molecular studies that definitively establish that STIC is the earliest form of carcinoma rather than intraepithelial spread from adjacent invasive serous carcinoma of ovarian or peritoneal origin, they will have important clinical implications for screening, treatment, and prevention.

  2. The secreted factors responsible for pre-metastatic niche formation: old sayings and new thoughts.

    PubMed

    Peinado, Héctor; Lavotshkin, Simon; Lyden, David

    2011-04-01

    Metastasis is a multistep process that requires acquisition of malignant cell phenotypes which allow tumor cells to escape from the primary tumor site. Each of the steps during metastatic progression involves co-evolution of the tumor and its microenvironment. Although tumor cells are the driving force of metastasis, new findings suggest that the host cells within the tumor microenvironment play a key role in influencing metastatic behavior. Many of these contributing cells are derived from the bone marrow; in particular, recruited bone marrow progenitor cells generate the "pre-metastatic niche" to which the tumor cells metastasize. Analysis of the molecular mechanisms involved in pre-metastatic niche formation has revealed that secreted soluble factors are key players in bone marrow cell mobilization during metastasis. In addition, membrane vesicles derived from both tumor and host cells have recently been recognized as new candidates with important roles in the promotion of tumor growth and metastasis. This review describes old ideas and presents new insights into the role of tumor and bone marrow-derived microvesicles and exosomes in pre-metastatic niche formation and metastasis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Proteolysis during Tumor Cell Extravasation In Vitro: Metalloproteinase Involvement across Tumor Cell Types

    PubMed Central

    Voura, Evelyn B.; English, Jane L.; Yu, Hoi-Ying E.; Ho, Andrew T.; Subarsky, Patrick; Hill, Richard P.; Hojilla, Carlo V.; Khokha, Rama

    2013-01-01

    To test if proteolysis is involved in tumor cell extravasation, we developed an in vitro model where tumor cells cross an endothelial monolayer cultured on a basement membrane. Using this model we classified the ability of the cells to transmigrate through the endothelial cell barrier onto the underlying matrix, and scored this invasion according to the stage of passage through the endothelium. Metalloproteinase inhibitors reduced tumor cell extravasation by at least 35%. Visualization of protease and cell adhesion molecules by confocal microscopy demonstrated the cell surface localization of MMP-2, MMP-9, MT1-MMP, furin, CD44 and αvβ3, during the process of transendothelial migration. By the addition of inhibitors and bio-modulators we assessed the functional requirement of the aforementioned molecules for efficient migration. Proteolytic digestion occurred at the cell-matrix interface and was most evident during the migratory stage. All of the inhibitors and biomodulators affected the transition of the tumor cells into the migratory stage, highlighting the most prevalent use of proteolysis at this particular step of tumor cell extravasation. These data suggest that a proteolytic interface operates at the tumor cell surface within the tumor-endothelial cell microenvironment. PMID:24194929

  4. Bronchoalveolar lavage in malignancy.

    PubMed

    Poletti, Venerino; Poletti, Giovanni; Murer, Bruno; Saragoni, Luca; Chilosi, Marco

    2007-10-01

    Bronchoalveolar lavage is a useful diagnostic tool in diffuse or disseminated lung malignancies that do not involve the bronchial structures visible by endoscopy. The neoplastic histotype and the intraparenchymal neoplastic growth pattern are good predictors for diagnostic yield; adenocarcinoma, and tumors with lymphangitic or lepidic growth patterns are more easily diagnosed by bronchoalveolar lavage; in these cases the diagnostic yield reported is higher than 80%. In hematologic malignancies the diagnostic yield is quite good in secondary diffuse indolent B cell lymphomas and in primary B cell lymphomas of mucosa-associated lymphoid tissue (MALT) type but low in Hodgkin disease. Morphological analysis may be implemented by immunocytochemical or molecular tests to identify the cell lineage and the presence of monoclonality. Disorders in which bronchioloalveolar cell hyperplasia/dysplasia is a significant morphological component may have cytological features in bronchoalveolar lavage fluid that mimic lung neoplasms: acute respiratory distress syndrome (ARDS), acute interstitial pneumonitis (AIP), and acute exacerbation of idiopathic pulmonary fibrosis are the most important clinical entities in this group.

  5. The role of TLRs in cervical cancer with HPV infection: a review

    PubMed Central

    Yang, Xiao; Cheng, Yanxiang; Li, Chunsheng

    2017-01-01

    The main cause of cervical cancer is persistent infection with high-risk human papilloma virus (HR-HPV), but not all human papilloma virus (HPV) infections lead to cervical cancer. The key factors that determine the outcome of HPV infection remain poorly understood, and how the host immune system protects against HPV infection is unclear. Toll-like receptors (TLRs) are a group of pattern recognition receptors present in the cytoplasm and cell membrane, and can specifically recognize pathogen-associated molecular patterns. As the key molecules of innate and acquired immunity, TLRs not only play important roles in the immune defense against infectious diseases, but also are involved in the occurrence and development of a variety of malignant tumors. In cervical cancer caused by HR-HPV infection, TLRs have been found to regulate the local immune microenvironment. The role of TLRs in HR-HPV infection and HPV-induced cervical cancer and its relationship with HPV vaccine are reviewed in this article. PMID:29263932

  6. T lymphocyte-derived TNF and IFN-γ repress HFE expression in cancer cells.

    PubMed

    Reuben, Alexandre; Godin-Ethier, Jessica; Santos, Manuela M; Lapointe, Réjean

    2015-06-01

    The immune system and tumors are closely intertwined initially upon tumor development. During this period, tumors evolve to promote self-survival through immune escape, including by targeting crucial components involved in the presentation of antigens to the immune system in order to avoid recognition. Accordingly, components involved in MHC I presentation of tumor antigens are often mutated and down-regulated targets in tumors. On the other hand, the immune system has been shown to influence tumors through production of immunosuppressive cytokines, recruitment and polarization of cells favoring or impeding tumor escape or through production of anti-tumor cytokines promoting tumor rejection. We previously discovered that the hemochromatosis protein HFE, a negative regulator of iron absorption, dampens classical MHC I antigen presentation. In this study, we evaluated the impact of activated T lymphocytes purified from peripheral blood mononuclear cells (PBMC) on HFE expression in tumor cell lines. We co-cultured tumor cell lines from melanoma, lung, and kidney cancers with anti-CD3-activated PBMC and established that HFE expression is increased in tumor cell lines compared to healthy tissues, whilst being down-regulated significantly upon exposure to activated PBMC. HFE down-regulation was mediated by both CD4 and CD8 T lymphocytes, through production of soluble mediators, namely TNF and IFN-γ. These results suggest that the immune system may modulate tumor HFE expression in inflammatory conditions in order to regulate MHC I antigen presentation and promote tumor clearance. Copyright © 2015. Published by Elsevier Ltd.

  7. Complete resection of locally advanced ovarian carcinoma fixed to the pelvic sidewall and involving external and internal iliac vessels.

    PubMed

    Nishikimi, Kyoko; Tate, Shinichi; Matsuoka, Ayumu; Shozu, Makio

    2017-08-01

    Locally advanced ovarian carcinomas may be fixed to the pelvic sidewall, and although these often involve the internal iliac vessels, they rarely involve the external iliac vessels. Such tumors are mostly considered inoperable. We present a surgical technique for complete resection of locally advanced ovarian carcinoma fixed to the pelvic sidewall and involving external and internal iliac vessels. A 69-year-old woman presented with ovarian carcinoma fixed to the right pelvic sidewall, which involved the right external and internal iliac arteries and veins and the right lower ureter, rectum, and vagina. We cut the external iliac artery and vein at the bifurcation and at the inguinal ligament to resect the external artery and vein. Then, we reconstructed the arterial and venous supplies of the right external artery and vein with grafts. After creating a wide space immediately inside of the sacral plexus to allow the tumor fixed to pelvic sidewall with the internal iliac vessels to move medially, we performed total internal iliac vessel resection. We achieved complete en bloc tumor resection with the right external and internal artery and vein, right ureter, vagina, and rectum adhering to the tumor. There were no intra- or postoperative complications, such as bleeding, graft occlusion, infection, or limb edema. Exfoliation from the sacral plexus and total resection with external and internal iliac vessels enables complete resection of the tumor fixed to the pelvic sidewall. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Solitary Fibrous Tumor of Retromolar Pad; a Rare Challenging Case

    PubMed Central

    Lotfi, Ali; Mokhtari, Sepideh; Moshref, Mohammad; Shahla, Maryam; Atarbashi Moghadam, Saede

    2017-01-01

    Solitary fibrous tumor has a wide spectrum of histopathologic features and many tumors show similar microscopic features. This similarity poses diagnostic challenges to the pathologists and immunohistochemical analysis is required in many cases. Moreover, it is a rare entity in orofacial region which consequently would make its diagnosis more challenging in oral cavity. The knowledge of various microscopic patterns of this tumor contributes to a proper diagnosis and prevents unnecessary treatment. This study reports a case of solitary fibrous tumor in the retromolar pad area and discusses its various histological features and differential diagnoses. PMID:28620640

  9. The impact of rectal cancer tumor height on recurrence rates and metastatic location: A competing risk analysis of a national database.

    PubMed

    Augestad, Knut M; Keller, Deborah S; Bakaki, Paul M; Rose, Johnie; Koroukian, Siran M; Øresland, Tom; Delaney, Conor P

    2018-04-01

    The impact of rectal cancer tumor height on local recurrence and metastatic spread is unknown. The objective was to evaluate the impact of rectal cancer tumor height from the anal verge on metastatic spread and local recurrence patterns. The Norwegian nationwide surgical quality registry was reviewed for curative rectal cancer resections from 1/1/1996-12/15/2006. Cancers were stratified into five height groups: 0-3 cm, >3-5 cm, >5-9 cm, >9-12 cm, 12 cm-HI. Competing risk and proportional hazards models assessed the relationship between tumor height and patterns of metastasis and survival. 6859 patients were analyzed. After median follow-up of 52 months (IQR 20-96), 26.7% (n = 1835) experienced recurrence. With tumors >12 cm, the risk of liver metastases increased (crude HR 1.49, p = 0.03), while lung metastases decreased (crude HR 0.66, p = 0.03), and risk of death decreased (crude HR 0.81, p = 0.001) The cumulative incidence of pelvic recurrence were highest for the low tumors (p = 0.01). Median time to liver metastases was 14months (IQR 7-24), lung metastases 25months (IQR 13-39), pelvic recurrence 19months (IQR10-32), (p < 0.0001). Time to metastases in liver and lungs were significantly associated with tumor height (p < 0.001) CONCLUSION: There are distinct differences in metastatic recurrence patterns and time to recurrence from different anatomic areas of the rectum. In crude analyses, tumor height impacted metastatic spread to the liver and lungs. However, when adjusting for treatment variables, the hazard of metastatic spread to the liver and lungs are limited. Nevertheless, time to metastases in liver and lungs is significantly impacted by tumor height. Venous drainage of the rectal cancer may be a significant contributor of rectal cancer metastatic spread, but further research is warranted. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Childhood Vascular Tumors Treatment (PDQ®)—Patient Version

    Cancer.gov

    Childhood vascular tumor treatment depends on the specific type and location, can involve surgery, and may be followed by chemotherapy or radiation. Targeted therapy, immunotherapy, and other medications may be used. Learn more about vascular tumors in this expert-reviewed summary.

  11. Metastatic pattern and DNA ploidy in stage IV breast cancer at initial diagnosis. Relation to response and survival.

    PubMed

    De Lena, M; Romero, A; Rabinovich, M; Leone, B; Vallejo, C; Machiavelli, M; Cuevas, M; Rodriguez, R; Lacava, J; Perez, J

    1993-06-01

    Sixty-nine patients with metastatic breast cancer (MBC) at initial diagnosis were analyzed to verify if metastatic pattern and clinical outcome are related to DNA ploidy determined by flow cytometry (FCM). Characteristics of 55 fully evaluable patients were as follows: median age: 61 years; postmenopausal: 75%; bone-only metastases (BM): 60%; extraosseous-only metastases (EM): 40%. Overall response rates (CR + PR) obtained with different chemotherapies and/or hormonal therapies were 58% and 68% for patients with BM and EM, respectively. Sixty percent of specimens resulted aneuploid, and the mean coefficient of variation of the complete series was 5.1%. In the whole group of patients DNA ploidy of primary tumor did not predict the metastatic pattern and had no influence upon response to treatment, duration of response, time to progression, and overall survival. When analyses were carried out according to metastatic pattern, those patients with BM showed similar results. However, within the group with EM, those with diploid tumors presented a significantly better survival (median 18 vs 13 months, p = .04). FCM-DNA analysis seems to identify a subgroup of patients with poor prognosis constituted by those who had aneuploid primary tumors and metastases to extraosseous sites.

  12. Lymphomas or leukemia presenting as ovarian tumors. An analysis of 42 cases.

    PubMed

    Osborne, B M; Robboy, S J

    1983-11-15

    Forty cases of ovarian lymphoma and two of extramedullary leukemia were examined with emphasis on histologic types correlated with age, modes of presentation, operative findings, including frequency of bilaterality and omental spread, clinical course following therapy, and problems in differential diagnosis. Although most cases were referred with diagnoses other than lymphoma (granulosa cell tumor or dysgerminoma, occasionally anaplastic tumor, Krukenberg tumor, or metastatic breast carcinoma), utilization of sections cut at 4 mu and stained with hematoxylin and eosin, or sections stained by the methyl green pyronine (MGP), naphthol-ASD esterase (NASD) or periodic acid-Schiff (PAS) methods helped bring out the lymphoid or hematopoietic nature of the cells. Sixteen patients were under 20 years of age. They had small noncleaved cell lymphoma (undifferentiated Burkitt's and non-Burkitt's, 10 cases), diffuse immunoblastic large cell lymphoma (4 cases), or acute granulocytic leukemia (2 cases). Twenty-six patients were 29 to 74 years of age and had diffuse large cell lymphoma (10 cases), diffuse immunoblastic large cell lymphoma (9 cases), follicular (nodular) lymphoma (6 cases) or small noncleaved cell lymphoma (1 case). Pain with an abdominal or pelvic mass was the most common presentation. Nine tumors were discovered during investigation of other gynecologic complaints. At laparotomy, the tumors in 55% of cases involved both ovaries, and in 64% also involved extragonadal sites (usually omentum, fallopian tubes, or lymph nodes). Seventeen patients had tumor affecting one ovary, seven of these without any evidence of extragonadal spread. Forty-two percent (15) of 37 patients with follow-up were alive after 2 years. Only nine patients survived more than 5 years; two subsequently died of lymphoma. Favorable prognostic features included: (1) FIGO stage IA; (2) unilateral ovarian involvement; (3) focal involvement of one ovary; and (4) follicular (nodular) lymphoma.

  13. Analysis of the methylation patterns of the p16 INK4A, p15 INK4B, and APC genes in gastric adenocarcinoma patients from a Brazilian population.

    PubMed

    do Nascimento Borges, Bárbara; Burbano, Rommel Mario Rodriguez; Harada, Maria Lúcia

    2013-08-01

    Gastric cancer is a major public health problem in Pará state, where studies suggest complex genetic and epigenetic profiles of the population, indicating the need for the identification of molecular markers for this tumor type. In the present study, the methylation patterns of three genes [p16 (INK4A), p15 (INK4B), and adenomatous polyposis coli (APC)] were assessed in patients with gastric adenocarcinoma from Pará state in order to identify possible molecular markers of gastric carcinogenesis. DNA samples from tumoral and non-tumoral gastric tissues were modified with sodium bisulfite. A fragment of the promoter region of each gene was amplified and sequenced, and samples with more than 20 % of methylated CpG sites were considered hypermethylated. The correlation between the methylation pattern of the selected genes and the MTHFR C677T polymorphism, as well as the relationship between APC and CDH1 methylation, were evaluated. The results suggest that APC hypermethylation is an age-specific marker of gastric carcinogenesis, and the concordance of this event with CDH1 hypermethylation suggests that the Wnt pathway has an important role in gastric carcinogenesis. While the hypermethylation pattern of p15 (INK4B) seems to be an earlier event in this type of tumor, the hypomethylated status of this gene seems to be correlated to the C677T MTHFR TT genotype. On the other hand, the observed pattern of p16 (INK4A) hypermethylation suggests that this event is a good marker for the gastric cancer pathway in the Pará state population.

  14. White matter reorganization after surgical resection of brain tumors and vascular malformations.

    PubMed

    Lazar, M; Alexander, A L; Thottakara, P J; Badie, B; Field, A S

    2006-01-01

    Diffusion tensor imaging (DTI) and white matter tractography (WMT) are promising techniques for estimating the course, extent, and connectivity patterns of the white matter (WM) structures in the human brain. In this study, DTI and WMT were used to evaluate WM tract reorganization after the surgical resection of brain tumors and vascular malformations. Pre- and postoperative DTI data were obtained in 6 patients undergoing surgical resection of brain lesions. WMT using a tensor deflection algorithm was used to reconstruct WM tracts adjacent to the lesions. Reconstructed tracts included corticospinal tracts, the corona radiata, superior longitudinal and inferior fronto-occipital fasciculi, cingulum bundles, and the corpus callosum. WMT revealed a series of tract alteration patterns including deviation, deformation, infiltration, and apparent tract interruption. In general, the organization of WM tracts appeared more similar to normal anatomy after resection, with either disappearance or reduction of the deviation, deformation, or infiltration present preoperatively. In patients whose lesions were associated with corticospinal tract involvement, the WMT reconstructions showed that the tract was preserved during surgery and improved in position and appearance, and this finding correlated with improvement or preservation of motor function as determined by clinical assessment. WMT is useful for appreciating the complex relationships between specific WM structures and the anatomic distortions created by brain lesions. Further studies with intraoperative correlation are necessary to confirm these initial findings and to determine WMT utility for presurgical planning and evaluation of surgical treatments.

  15. Results of a pancreatectomy with a limited venous resection for pancreatic cancer.

    PubMed

    Illuminati, Giulio; Carboni, Fabio; Lorusso, Riccardo; D'Urso, Antonio; Ceccanei, Gianluca; Papaspyropoulos, Vassilios; Pacile, Maria Antonietta; Santoro, Eugenio

    2008-01-01

    The indications for a pancreatectomy with a partial resection of the portal or superior mesenteric vein for pancreatic cancer, when the vein is involved by the tumor, remain controversial. It can be assumed that when such involvement is not extensive, resection of the tumor and the involved venous segment, followed by venous reconstruction will extend the potential benefits of this resection to a larger number of patients. The further hypothesis of this study is that whenever involvement of the vein by the tumor does not exceed 2 cm in length, this involvement is more likely due to the location of the tumor being close to the vein rather than because of its aggressive biological behavior. Consequently, in these instances a pancreatectomy with a resection of the involved segment of portal or superior mesenteric vein for pancreatic cancer is indicated, as it will yield results that are superposable to those of a pancreatectomy for cancer without vascular involvement. Twenty-nine patients with carcinoma of the pancreas involving the portal or superior mesenteric vein over a length of 2 cm or less underwent a macroscopically curative resection of the pancreas en bloc with the involved segment of the vein. The venous reconstruction procedures included a tangential resection/lateral suture in 15 cases, a resection/end-to-end anastomosis in 11, and a resection/patch closure in 3. Postoperative mortality was 3.4%; morbidity was 21%. Local recurrence was 14%. Cumulative (standard error) survival rate was 17% (9%) at 3 years. A pancreatectomy combined with a resection of the portal or superior mesenteric vein for cancer with venous involvement not exceeding 2 cm is indicated in order to extend the potential benefits of a curative resection.

  16. Insights into the regulation of tumor dormancy by angiogenesis in experimental tumors.

    PubMed

    Indraccolo, Stefano

    2013-01-01

    While it is well established that an angiogenic switch marks escape from tumor dormancy in xenograft models, the molecular pathways involved in the control of tumor cell proliferation or survival by angiogenesis remain substantially uncharted. We recently demonstrated that signals stemming from angiogenic endothelial cells (EC) regulate the behavior of dormant cancer cells. Specifically, we observed that the Notch ligand Dll4, induced by angiogenic factors in EC, triggers Notch3 activation in neighboring tumor cells and promotes a tumorigenic phenotype. Evidence that Notch signaling is involved in tumor dormancy was further strengthened by the observation that MKP-1 levels-a broadly expressed phosphatase-are controlled by Notch3 by regulation of protein ubiquitination and stability. Notch3 and MKP-1 levels are consistently low in dormant tumors, and this is accompanied by relatively high levels of phosphorylated p38, a canonical MKP-1 target previously associated with maintenance of tumor dormancy. These results elucidate a novel angiogenesis-driven mechanism involving the Notch and MAPK pathways that controls tumor dormancy. More in general, angiogenic EC could form part of the vascular niche, a specialized microenvironment which appears to regulate metastatic outgrowth and future studies are needed to clarify the contribution of EC in the regulation of cancer stem cell behavior in the niche.The notion that EC could communicate signals to tumor cells raises questions about the possibility of achieving tumor dormancy by counteracting angiogenesis. In experimental tumors, anti-VEGF drugs typically prune the newly formed vasculature, thus reducing microvessel density, blood flow, and perfusion. These drugs eventually increase hypoxia and cause tumor necrosis but dormancy is rarely observed. Our group recently reported that anti-VEGF therapy causes a dramatic depletion of glucose and an exhaustion of ATP levels in tumors. Moreover, we found that the central metabolic checkpoint LKB1/AMPK-a cellular sensor of ATP levels that supports cell viability in response to energy stress-is activated by anti-VEGF therapy in experimental tumors and it has a key role in induction of sustained tumor regression. These functional links between activation of the LKB1/AMPK by anti-angiogenic therapy and tumor dormancy suggest a role for metabolism in the regulation of this phenomenon.

  17. An automatic brain tumor segmentation tool.

    PubMed

    Diaz, Idanis; Boulanger, Pierre; Greiner, Russell; Hoehn, Bret; Rowe, Lindsay; Murtha, Albert

    2013-01-01

    This paper introduces an automatic brain tumor segmentation method (ABTS) for segmenting multiple components of brain tumor using four magnetic resonance image modalities. ABTS's four stages involve automatic histogram multi-thresholding and morphological operations including geodesic dilation. Our empirical results, on 16 real tumors, show that ABTS works very effectively, achieving a Dice accuracy compared to expert segmentation of 81% in segmenting edema and 85% in segmenting gross tumor volume (GTV).

  18. Analysis of molecular markers as predictive factors of lymph node involvement in breast carcinoma.

    PubMed

    Paula, Luciana Marques; De Moraes, Luis Henrique Ferreira; Do Canto, Abaeté Leite; Dos Santos, Laurita; Martin, Airton Abrahão; Rogatto, Silvia Regina; De Azevedo Canevari, Renata

    2017-01-01

    Nodal status is the most significant independent prognostic factor in breast cancer. Identification of molecular markers would allow stratification of patients who require surgical assessment of lymph nodes from the large numbers of patients for whom this surgical procedure is unnecessary, thus leading to a more accurate prognosis. However, up to now, the reported studies are preliminary and controversial, and although hundreds of markers have been assessed, few of them have been used in clinical practice for treatment or prognosis in breast cancer. The purpose of the present study was to determine whether protein phosphatase Mg2+/Mn2+ dependent 1D, β-1,3-N-acetylglucosaminyltransferase, neural precursor cell expressed, developmentally down-regulated 9, prohibitin, phosphoinositide-3-kinase regulatory subunit 5 (PIK3R5), phosphatidylinositol-5-phosphate 4-kinase type IIα, TRF1-interacting ankyrin-related ADP-ribose polymerase 2, BCL2 associated agonist of cell death, G2 and S-phase expressed 1 and PAX interacting protein 1 genes, described as prognostic markers in breast cancer in a previous microarray study, are also predictors of lymph node involvement in breast carcinoma Reverse transcription-quantitative polymerase chain reaction analysis was performed on primary breast tumor tissues from women with negative lymph node involvement (n=27) compared with primary tumor tissues from women with positive lymph node involvement (n=23), and was also performed on primary tumors and paired lymph node metastases (n=11). For all genes analyzed, only the PIK3R5 gene exhibited differential expression in samples of primary tumors with positive lymph node involvement compared with primary tumors with negative lymph node involvement (P=0.0347). These results demonstrate that the PIK3R5 gene may be considered predictive of lymph node involvement in breast carcinoma. Although the other genes evaluated in the present study have been previously characterized to be involved with the development of distant metastases, they did not have predictive potential.

  19. Intranasal pericytic tumors (glomus tumor and sinonasal hemangiopericytoma-like tumor): report of two cases with review of the literature.

    PubMed

    Li, Xiao-Qiu; Hisaoka, Masanori; Morio, Takashi; Hashimoto, Hiroshi

    2003-05-01

    An intranasal glomus tumor and a sinonasal hemangiopericytoma-like tumor are reported. Both patients were elderly women suffering from nasal bleeding, and presented with a polypoid mass arising in the nasal septum. Microscopically, the glomus tumor displayed a proliferation of uniform rounded or cuboidal epithelioid cells arranged in sheets and interrupted by a rich vasculature with a characteristic configuration mimicking the normal glomus bodies, while the sinonasal hemangiopericytoma-like tumor featured a perivascular proliferation of spindle- to oval-shaped cells that were arranged in short fascicles. Both tumors shared immunohistochemical features supporting their myoid differentiation by the expression of vimentin, alpha-smooth muscle actin and muscle-specific actin, albeit with no immunoreaction to desmin. Both the intranasal glomus tumor and sinonasal hemangiopericytoma-like tumor are characterized by a perivascular growth pattern and myoid differentiation, having a close relation to the 'perivascular myomas', which was recently designated.

  20. Paraganglioma: report of a rare case with ovarian involvement.

    PubMed

    Bacha, D; Mrad, K; Dhouib, R; Driss, M; Abbes, I; Sassi, S; Ben Romdhane, K

    2007-04-01

    We report a well-documented case of paraganglioma involving right ovary, which was initially misdiagnosed as a Sertoli-Leydig cell tumor and recurred one year later. The right ovarian tumor measured 105x90x60 mm and was associated to a subdiaphragmatic tumor measuring 80x60x35 mm, a peritoneal and a preureteral nodules measuring 10 mm either. Microscopically, tumor cells were arranged in trabeculae and cords separated by a delicate stroma. Their cytoplasm was abundant granular and eosinophilic. Their nuclei were enlarged and regular in size with coarse chromatine and a large nucleolus. The tumor expressed neuroendocrine markers (chromogranin, synaptophysin) epithelial membrane antigen and focally cytokeratin 7 and E-cadherin. Pathological ovarian paraganglioma diagnosis could be difficult but one should be aware of its bona fide existence. The clinical course is favourable in most of the cases.

  1. Metastatic Breast Cancer in Uterine Cervix: A Rare Presentation.

    PubMed

    Proença, Sara; Reis, Maria Inês; Cominho, Joana; Conde, Pedro Casado; Santos E Pereira, Helena; Ribeiro, Filipa Castro

    2016-01-01

    Uterine cervix involvement by a distant primary tumor is a rare event. We report the following 2 cases of breast tumor metastasis to the uterine cervix with different presentations: case 1 is an isolated cervix metastasis and case 2 is a disseminated metastatic disease with cervix involvement. In both, clinical examination raised the suspicion of cervical tumor, which was confirmed to be a metastatic adenocarcinoma.The poor outcome and lack of symptoms suggest that although its rareness, all patients with breast cancer should undergo a careful routine gynecologic examination.

  2. Distinctive expression patterns of glycoprotein non-metastatic B and folliculin in renal tumors in patients with Birt–Hogg–Dubé syndrome

    PubMed Central

    Furuya, Mitsuko; Hong, Seung-Beom; Tanaka, Reiko; Kuroda, Naoto; Nagashima, Yoji; Nagahama, Kiyotaka; Suyama, Takahito; Yao, Masahiro; Nakatani, Yukio

    2015-01-01

    Birt–Hogg–Dubé syndrome (BHD) is an inherited disorder associated with a germline mutation of the folliculin gene (FLCN). The affected families have a high risk for developing multiple renal cell carcinomas (RCC). Diagnostic markers that distinguish between FLCN-related RCC and sporadic RCC have not been investigated, and many patients with undiagnosed BHD fail to receive proper medical care. We investigated the histopathology of 27 RCCs obtained from 18 BHD patients who were diagnosed by genetic testing. Possible somatic mutations of RCC lesions were investigated by DNA sequencing. Western blotting and immunohistochemical staining were used to compare the expression levels of FLCN and glycoprotein non-metastatic B (GPNMB) between FLCN-related RCCs and sporadic renal tumors (n = 62). The expression of GPNMB was also evaluated by quantitative RT-PCR. Histopathological analysis revealed that the most frequent histological type was chromophobe RCC (n = 12), followed by hybrid oncocytic/chromophobe tumor (n = 6). Somatic mutation analysis revealed small intragenic mutations in six cases and loss of heterozygosity in two cases. Western blot and immunostaining analyses revealed that FLCN-related RCCs showed overexpression of GPNMB and underexpression of FLCN, whereas sporadic tumors showed inverted patterns. GPNMB mRNA in FLCN-related RCCs was 23-fold more abundant than in sporadic tumors. The distinctive expression patterns of GPNMB and FLCN might identify patients with RCCs who need further work-up for BHD. PMID:25594584

  3. Early versus late GD-DTPA MRI enhancement in experimental glioblastomas.

    PubMed

    Farace, Paolo; Tambalo, Stefano; Fiorini, Silvia; Merigo, Flavia; Daducci, Alessandro; Nicolato, Elena; Conti, Giamaica; Degrassi, Anna; Sbarbati, Andrea; Marzola, Pasquina

    2011-03-01

    To compare early versus late enhancement in two glioblastoma models characterized by different infiltrative/edematous patterns. Three weeks after inoculation into nude mice of U87MG and U251 cells, T1-weighted images were acquired early (10.5 min), intermediate (21 min) and late (30.5 min) after a bolus injection of Gd-DTPA at 300 μ mol/kg dosage. EARLY(TH) and LATE(TH) were the corresponding volumes with an enhancement higher than a threshold TH, defined by the mean (μ) and standard deviation (σ) on a contralateral healthy area. ADD(TH) was the enhancing volume found in LATE(TH) but not in EARLY(TH). T2 imaging of both tumors was performed, and T2 mapping of U251. In all tumors, LATE(TH) was significantly higher than EARLY(TH) for TH ranging from μ+σ to μ+5σ. The ADD(TH) /EARLY(TH) ratio was not significantly different when U251 and U87MG tumors were compared. In the U87MG tumors, some enhancement was observed outside the regularly demarcated T2-hyperintense area. In the U251 tumors, irregularly T2 demarcated, a large portion of ADD(μ+3σ) had normal T2 values. At histology, U251 showed a higher infiltrative pattern than U87MG. In these models, the increase over time in the enhancing volume did not depend on the different infiltrative/edematous patterns and was not closely related with edema. Copyright © 2011 Wiley-Liss, Inc.

  4. Involvements of Estrogen Receptor, Proliferating Cell Nuclear Antigen and p53 in Endometrial Adenocarcinoma Development in Donryu Rats

    PubMed Central

    Yoshida, Midori; Katsuda, Shin-ichi; Maekawa, Akihiko

    2012-01-01

    Involvements of estrogen receptor (ER)α, proliferating cell nuclear antigen (PCNA) and p53 in the uterine carcinogenesis process in Donryu rats, a high yield strain of the uterine cancer were investigated immunohistochemically. ERα was expressed in atypical endometrial hyperplasia, accepted as a precancerous lesion of the uterine tumors, as well as well- and in moderately-differentiated endometrial adenocarcinomas, and the intensities of expression were similar to those in the luminal epithelial cells of the atrophic uterus at 15 months of age. The expression, however, was negative in the tumor cells of poorly differentiated type. Good growth of implanted grafts of the poorly-differentiated adenocarcinomas in both sexes with or without gonadectomy supported the estrogen independency of tumor progression to malignancy. PCNA labeling indices were increased with tumor development from atypical hyperplasia to adenocarcinoma. The tumor cells in poorly-differentiated adenocarcinomas were positive for p53 positive but negative for p21 expression, suggesting accumulation of mutated p53. These results indicate that the consistent ERα expression is involved in initiation and promotion steps of uterine carcinogenesis, but not progression. In addition, PCNA is related to tumor development and the expression of mutated p53 might be a late event during endometrial carcinogenesis. PMID:23345926

  5. Increased Expression of ALDH1A1 in Prostate Cancer is Correlated With Tumor Aggressiveness: A Tissue Microarray Study of Iranian Patients.

    PubMed

    Kalantari, Elham; Saadi, Faezeh H; Asgari, Mojgan; Shariftabrizi, Ahmad; Roudi, Raheleh; Madjd, Zahra

    2017-09-01

    Subpopulations of prostate cancer (PCa) cells expressing putative stem cell markers possess the ability to promote tumor growth, maintenance, and progression. This study aimed to evaluate the expression patterns and clinical significance of putative stem cell marker aldehyde dehydrogenase 1 A1 (ALDH1A1) in prostate tumor tissues. ALDH1A1 expression was examined in a well-defined series of prostate tissues, including 105 (68%) samples of PCa, 21 (13%) samples of high-grade prostatic intraepithelial neoplasia, and 31 (19%) samples of benign prostate hyperplasia, which were embedded in tissue microarray blocks. The correlation of ALDH1A1 expression with clinicopathologic parameters was also assessed. There was a significant difference between the expression level of ALDH1A1 in PCa compared with the high-grade prostatic intraepithelial neoplasia and benign prostate hyperplasia samples (P<0.001). PCa cells expressing ALDH1A1 were more often seen in samples with advanced Gleason score (P=0.05) and high serum prostate specific antigen level (P=0.02). In addition, a positive correlation was found between ALDH1A1 expression and primary tumor stage and regional lymph node involvement (P=0.04 and 0.03, respectively). The significant association between ALDH1A1 expressions with Gleason score indicates the potential role of this protein in PCa tumorigenesis and aggressive behavior; therefore, this cancer stem cell marker can be used as a promising candidate for targeted therapy of PCa, especially those with high Gleason score.

  6. Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

    PubMed Central

    McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C.; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

    2015-01-01

    Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal “actionable” mutations, including BRAF(V600E), IDH1(R132H), PIK3CA(E545K), EGFR(L858R), and KRAS(G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K(phosphatidylinositol 3-kinase)–AKT–mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS–MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTORsignaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. PMID:25877892

  7. Bronchoalveolar carcinoma: clinical, radiologic, and pathologic factors and survival.

    PubMed

    Okubo, K; Mark, E J; Flieder, D; Wain, J C; Wright, C D; Moncure, A C; Grillo, H C; Mathisen, D J

    1999-10-01

    The principal feature of bronchoalveolar carcinoma is that it spreads along airways or aerogenously with multifocality, but many issues are unresolved. We studied 119 patients with pathologically confirmed bronchoalveolar carcinoma. Symptoms, smoking status, radiologic findings, the size of tumor, operative procedures, and complications were reviewed. We studied the pathologic features: presence or absence of aerogenous spread, patterns of growth, cell type, nuclear grade, mitosis, rate of bronchoalveolar carcinoma in adenocarcinoma, and lymphocyte infiltration. The correlation among clinical, radiologic, and pathologic findings was examined, and the factors affecting survival were analyzed. Symptomatic patients had more infiltrative radiographic features, and asymptomatic patients tended to have more mass-like features (P <.0001). Tumors with radiographically infiltrating lesions tended to have mucinous histologic features (P =.006). Tumors with mass lesions by radiograph tended to have nonmucinous and sclerosing histologic features (P =.003). Aerogenous spread was seen in 94% of specimens. The presence of a variety of cell types suggested multiple clonal origin. The overall survival in those patients undergoing resection was 69.1% at 5 years and 56.5% at 10 years. The significant factors affecting survival were radiologic presence of a mass or infiltrate, pathologic findings of the presence of sclerosis, association with a scar, the rate of bronchoalveolar carcinoma in adenocarcinoma, lymphocyte infiltration grade, nodal involvement, and status of complete resection. Mitosis or nuclear grade of tumor cells did not correlate with survival. Bronchoalveolar carcinoma showed good overall survival with appropriate surgical procedures. Certain radiologic or pathologic findings correlated with survival. These findings may enhance the ability to predict long-term survival.

  8. Identification of a novel set of genes reflecting different in vivo invasive patterns of human GBM cells.

    PubMed

    Monticone, Massimiliano; Daga, Antonio; Candiani, Simona; Romeo, Francesco; Mirisola, Valentina; Viaggi, Silvia; Melloni, Ilaria; Pedemonte, Simona; Zona, Gianluigi; Giaretti, Walter; Pfeffer, Ulrich; Castagnola, Patrizio

    2012-08-17

    Most patients affected by Glioblastoma multiforme (GBM, grade IV glioma) experience a recurrence of the disease because of the spreading of tumor cells beyond surgical boundaries. Unveiling mechanisms causing this process is a logic goal to impair the killing capacity of GBM cells by molecular targeting.We noticed that our long-term GBM cultures, established from different patients, may display two categories/types of growth behavior in an orthotopic xenograft model: expansion of the tumor mass and formation of tumor branches/nodules (nodular like, NL-type) or highly diffuse single tumor cell infiltration (HD-type). We determined by DNA microarrays the gene expression profiles of three NL-type and three HD-type long-term GBM cultures. Subsequently, individual genes with different expression levels between the two groups were identified using Significance Analysis of Microarrays (SAM). Real time RT-PCR, immunofluorescence and immunoblot analyses, were performed for a selected subgroup of regulated gene products to confirm the results obtained by the expression analysis. Here, we report the identification of a set of 34 differentially expressed genes in the two types of GBM cultures. Twenty-three of these genes encode for proteins localized to the plasma membrane and 9 of these for proteins are involved in the process of cell adhesion. This study suggests the participation in the diffuse infiltrative/invasive process of GBM cells within the CNS of a novel set of genes coding for membrane-associated proteins, which should be thus susceptible to an inhibition strategy by specific targeting.Massimiliano Monticone and Antonio Daga contributed equally to this work.

  9. Expression and role of anion exchanger 1 in esophageal squamous cell carcinoma.

    PubMed

    Shiozaki, Atsushi; Kudou, Michihiro; Ichikawa, Daisuke; Shimizu, Hiroki; Arita, Tomohiro; Kosuga, Toshiyuki; Konishi, Hirotaka; Komatsu, Shuhei; Fujiwara, Hitoshi; Okamoto, Kazuma; Kishimoto, Mitsuo; Marunaka, Yoshinori; Otsuji, Eigo

    2017-03-14

    Recent studies have described important roles for the anion exchanger (AE) in epithelial carcinogenesis and tumor behavior. The objectives of the present study were to investigate the role of AE1 in the regulation of genes involved in tumor progression and the clinicopathological significance of its expression in esophageal squamous cell carcinoma (ESCC). An immunohistochemical analysis was performed on 61 primary tumor samples obtained from ESCC patients who underwent esophagectomy. AE1 was primarily located in the cell membranes or cytoplasm of carcinoma cells, and its distribution pattern was related to the histological degree of the differentiation of SCC or the pT category. Among patients with pT2-3 ESCC, the 5-year survival rate of patients with diffuse AE1 expression (40.2%) was significantly lower than that of patients with focal expression (74.0%). AE1 was strongly expressed in KYSE150 and TE8 human ESCC cells. The depletion of AE1 using siRNA inhibited cell proliferation, migration, and invasion and induced apoptosis. The results of the microarray analysis revealed that MAPK and Hedgehog signaling pathway-related genes, such as DHH, and GLI1, were down-regulated in AE1-depleted KYSE150 cells. In conclusions, the results of the present study suggest that the diffuse expression of AE1 is related to a worse prognosis in patients with advanced ESCC, and that it regulates tumor progression by affecting MAPK and Hedgehog signaling pathways. These results provide an insight into the role of AE1 as a mediator of and/or a biomarker for ESCC.

  10. Upgrading the definition of early gastric cancer: better staging means more appropriate treatment.

    PubMed

    Saragoni, Luca

    2015-12-01

    Since Murakami defined early gastric cancer (EGC) as a "carcinoma limited to the gastric mucosa and/or submucosa regardless of the lymph node status", several authors have focused on the most influential histopathological parameters for predicting the development of lymph node metastases by considering the lymph node status as an important prognostic factor. A few authors have also considered the depth of invasion as one of the keys to explaining the existence of subgroups of patients affected by EGC with poor prognoses. In any case, EGC is still considered an initial phase of tumor progression with good prognosis. The introduction of modern endoscopic devices has allowed a precise diagnosis of early lesions, which can lead to improved definitions of tumors that can be radically treated with endoscopic mucosal resection or endoscopic submucosal dissection (ESD). Given the widespread use of these techniques, the Japanese Gastric Cancer Association (JGCA) identified in 2011 the standard criteria that should exclude the presence of lymph node metastases. At that time, EGCs with nodal involvement should have been asserted as no longer fitting the definition of an early tumor. Some authors have also demonstrated that the morphological growth pattern of a tumor, according to Kodama's classification, is one of the most important prognostic factors, thereby suggesting the need to report it in histopathological drafts. Notwithstanding the acquired knowledge regarding the clinical behavior of EGC, Murakami's definition is still being used. This definition needs to be upgraded according to the modern staging of the disease so that the appropriate treatment would be selected.

  11. 18F-FDG PET for staging breast cancer in patients with inner-quadrant versus outer-quadrant tumors: comparison with long-term clinical outcome.

    PubMed

    Tran, Amy; Pio, Betty S; Khatibi, Bahareh; Czernin, Johannes; Phelps, Michael E; Silverman, Daniel H S

    2005-09-01

    Extraaxillary metastases (i.e., in the absence of axillary involvement) are more likely to develop in patients with inner-quadrant (IQ) breast cancer than in patients with outer-quadrant (OQ) primary tumors. The relative difficulty of identifying extraaxillary metastases may lead to understaging of cancer in these patients. This study examined whether (18)F-FDG PET findings were differentially associated with the location of primary tumors, and with long-term prognosis, in IQ and OQ patients. Follow-up data were obtained for 141 patients whose breast cancer was staged by PET and who were documented to have IQ (n = 42) or OQ (n = 99) primaries. Results were stratified according to PET findings consistent with different metastatic patterns. Data were further analyzed with respect to disease outcome after a mean 3-y follow-up period. Among IQ patients, progressive disease was identified in 26.1%, compared with 13.1% of OQ patients, for a relative risk (RR) of 2.0. Of patients with PET findings of isolated extraaxillary metastases, 36.1% had progressive disease, compared with 10.7% of other patients (RR = 3.4), and 61.9% of IQ patients had isolated extraaxillary metastases identified on PET, compared with 10.1% of OQ patients (RR = 6.1). IQ patients demonstrated a 6-fold greater frequency of PET findings of isolated extraaxillary metastasis, and such findings were associated with triple the risk for disease progression. Patients with IQ tumors could be vulnerable to understaging with conventional staging approaches and may particularly benefit from PET during the staging process.

  12. Comparison of 30-2 Standard and Fast programs of Swedish Interactive Threshold Algorithm of Humphrey Field Analyzer for perimetry in patients with intracranial tumors.

    PubMed

    Singh, Manav Deep; Jain, Kanika

    2017-11-01

    To find out whether 30-2 Swedish Interactive Threshold Algorithm (SITA) Fast is comparable to 30-2 SITA Standard as a tool for perimetry among the patients with intracranial tumors. This was a prospective cross-sectional study involving 80 patients aged ≥18 years with imaging proven intracranial tumors and visual acuity better than 20/60. The patients underwent multiple visual field examinations using the two algorithms till consistent and repeatable results were obtained. A total of 140 eyes of 80 patients were analyzed. Almost 60% of patients undergoing perimetry with SITA Standard required two or more sessions to obtain consistent results, whereas the same could be obtained in 81.42% with SITA Fast in the first session itself. Of 140 eyes, 70 eyes had recordable field defects and the rest had no defects as detected by either of the two algorithms. Mean deviation (MD) (P = 0.56), pattern standard deviation (PSD) (P = 0.22), visual field index (P = 0.83) and number of depressed points at P < 5%, 2%, 1%, and 0.5% on MD and PSD probability plots showed no statistically significant difference between two algorithms. Bland-Altman test showed that considerable variability existed between two algorithms. Perimetry performed by SITA Standard and SITA Fast algorithm of Humphrey Field Analyzer gives comparable results among the patients of intracranial tumors. Being more time efficient and with a shorter learning curve, SITA Fast my be recommended as a standard test for the purpose of perimetry among these patients.

  13. Identification of constrained cancer driver genes based on mutation timing.

    PubMed

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver-passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression.

  14. Identification of Constrained Cancer Driver Genes Based on Mutation Timing

    PubMed Central

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148

  15. Investigating Associations Between Proliferation Indices, C-kit, and Lymph Node Stage in Canine Mast Cell Tumors.

    PubMed

    Krick, Erika Lauren; Kiupel, Matti; Durham, Amy C; Thaiwong, Tuddow; Brown, Dorothy C; Sorenmo, Karin U

    Previous studies have evaluated cellular proliferation indices, KIT expression, and c-kit mutations to predict the clinical behavior of canine mast cell tumors (MCTs). The study purpose was to retrospectively compare mitotic index, argyrophilic nucleolar organizer regions (AgNORs)/nucleus, Ki-67 index, KIT labeling pattern, and internal tandem duplication mutations in c-KIT between stage I and stage II grade II MCTs. Medical records and tumor biopsy samples from dogs with Grade II MCTs with cytological or histopathological regional lymph node evaluation were included. Signalment, tumor location and stage, and presence of a recurrent versus de novo tumor were recorded. Mitotic index, AgNORs/nucleus, Ki-67, KIT staining pattern, and internal tandem duplication mutations in exon 11 of c-KIT were evaluated. Sixty-six tumors (51 stage I; 15 stage II) were included. Only AgNORs/nucleus and recurrent tumors were significantly associated with stage (odds ratio 2.8, 95% confidence interval [CI] 1.0-8.0, P = .049; odds ratio 8.8, 95% CI 1.1-69.5; P = .039). Receiver-operator characteristic analysis showed that the sensitivity and specificity of AgNORs/cell ≥ 1.87 were 93.3% and 27.4%, respectively, (area under the curve: 0.65) for predicting stage. Recurrent tumors and higher AgNORs/nucleus are associated with stage II grade II MCTs; however, an AgNOR cutoff value that reliably predicts lymph node metastasis was not determined.

  16. Genome-wide methylation patterns provide insight into differences in breast tumor biology between American women of African and European ancestry

    PubMed Central

    Ambrosone, Christine B.; Young, Allyson C.; Sucheston, Lara E.; Wang, Dan; Li, Yan; Liu, Song; Tang, Li; Hu, Quang; Freudenheim, Jo L.; Shields, Peter G.; Morrison, Carl D.; Demissie, Kitaw; Higgins, Michael J.

    2014-01-01

    American women of African ancestry (AA) are more likely than European-Americans (EA) to be diagnosed with aggressive, estrogen receptor (ER) negative breast tumors; mechanisms underlying these disparities are poorly understood. We conducted a genome wide (450K loci) methylation analysis to determine if there were differences in DNA methylation patterns between tumors from AA and EA women and if these differences were similar for both ER positive and ER negative breast cancer. Methylation levels at CpG loci within CpG islands (CGI)s and CGI-shores were significantly higher in tumors (n=138) than in reduction mammoplasty samples (n=124). In hierarchical cluster analysis, there was separation between tumor and normal samples, and in tumors, there was delineation by ER status, but not by ancestry. However, differential methylation analysis identified 157 CpG loci with a mean β value difference of at least 0.17 between races, with almost twice as many differences in ER-negative tumors compared to ER-positive cancers. This first genome-wide methylation study to address disparities indicates that there are likely differing etiologic pathways for the development of ER negative breast cancer between AA and EA women. Further investigation of the genes most differentially methylated by race in ER negative tumors can guide new approaches for cancer prevention and targeted therapies, and elucidate the biologic basis of breast cancer disparities. PMID:24368439

  17. Assessment of Environmental and Hereditary Influence on Development of Pituitary Tumors Using Dermatoglyphic Traits and Their Potential as Screening Markers.

    PubMed

    Gradiser, Marina; Matovinovic Osvatic, Martina; Dilber, Dario; Bilic-Curcic, Ines

    2016-03-17

    The aim of this study was to assess environmental and hereditary influence on development of pituitary tumors using dermatoglyphic traits. The study was performed on 126 patients of both genders with pituitary tumors (60 non-functional and 66 functional pituitary tumor patients) in comparison to the control group of 400 phenotypically healthy individuals. Statistical analysis of quantitative and qualitative traits of digito-palmar dermatoglyphics was performed, and hormonal status was determined according to the standard protocols. Although we did not find markers that could specifically distinguish functional from non-functional tumors, we have found markers predisposing to the development of tumors in general (a small number of ridges between triradius of both hands, a smaller number of ridges between the triradius of c-d rc R), those for endocrine dysfunction (increased number of arches and reduced number of whorls, difference of pattern distribution in the I3 and I4 interdigital space), and some that could potentially be attributed to patients suffering from pituitary tumors (small number of ridges for variables FRR 5, smaller number of ridges in the FRL 4 of both hands and difference of pattern distribution at thenar of I1 and I2 interdigital space). The usage of dermatoglyphic traits as markers of predisposition of pituitary tumor development could facilitate the earlier detection of patients in addition to standard methods, and possibly earlier treatment and higher survival rate. Finally, our results are consistent with the hypothesis about multifactorial nature of pituitary tumor etiology comprised of both gene instability and environmental factors.

  18. Assessment of Environmental and Hereditary Influence on Development of Pituitary Tumors Using Dermatoglyphic Traits and Their Potential as Screening Markers

    PubMed Central

    Gradiser, Marina; Matovinovic Osvatic, Martina; Dilber, Dario; Bilic-Curcic, Ines

    2016-01-01

    The aim of this study was to assess environmental and hereditary influence on development of pituitary tumors using dermatoglyphic traits. The study was performed on 126 patients of both genders with pituitary tumors (60 non-functional and 66 functional pituitary tumor patients) in comparison to the control group of 400 phenotypically healthy individuals. Statistical analysis of quantitative and qualitative traits of digito-palmar dermatoglyphics was performed, and hormonal status was determined according to the standard protocols. Although we did not find markers that could specifically distinguish functional from non-functional tumors, we have found markers predisposing to the development of tumors in general (a small number of ridges between triradius of both hands, a smaller number of ridges between the triradius of c–d rc R), those for endocrine dysfunction (increased number of arches and reduced number of whorls, difference of pattern distribution in the I3 and I4 interdigital space), and some that could potentially be attributed to patients suffering from pituitary tumors (small number of ridges for variables FRR 5, smaller number of ridges in the FRL 4 of both hands and difference of pattern distribution at thenar of I1 and I2 interdigital space). The usage of dermatoglyphic traits as markers of predisposition of pituitary tumor development could facilitate the earlier detection of patients in addition to standard methods, and possibly earlier treatment and higher survival rate. Finally, our results are consistent with the hypothesis about multifactorial nature of pituitary tumor etiology comprised of both gene instability and environmental factors. PMID:26999178

  19. Evaluation of neovascularization patterns in an orthotopic rat glioma model with dynamic contrast-enhanced MRI.

    PubMed

    Xuesong, Du; Wei, Xue; Heng, Liu; Xiao, Chen; Shunan, Wang; Yu, Guo; Weiguo, Zhang

    2017-09-01

    Background Dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) has been proved useful in evaluating glioma angiogenesis, but the utility in evaluating neovascularization patterns has not been reported. Purpose To evaluate in vivo real-time glioma neovascularization patterns by measuring glioma perfusion quantitatively using DCE-MRI. Material and Methods Thirty Sprague-Dawley rats were used to establish C6 orthotopic glioma model and underwent MRI and pathology detections. As MRI and pathology were performed at six time points (i.e. 4, 8, 12, 16, 20, and 24 days) post transplantation, neovascularization patterns were evaluated via DCE-MRI. Results Four neovascularization patterns were observed in glioma tissues. Sprout angiogenesis and intussusceptive microvascular growth located inside tumor, while vascular co-option and vascular mimicry were found in the tumor margin and necrotic area, respectively. Sprout angiogenesis and intussusceptive microvascular growth increased with K trans , K ep , and V p inside tumor tissue. In addition, K ep and V p were positively correlated with sprout angiogenesis and intussusceptive microvascular growth. Vascular co-option was decreased at 12 and 16 days post transplantation and correlated negatively with K trans and K ep detected in the glioma margin, respectively. Changes of vascular mimicry showed no significant statistical difference at the six time points. Conclusion Our results indicate that DCE-MRI can evaluate neovascularization patterns in a glioma model. Furthermore, DCE-MRI could be an imaging biomarker for guidance of antiangiogenic treatments in humans in the future.

  20. miRNA Involved in Six1-Induced Breast Cancer

    DTIC Science & Technology

    2013-05-01

    populations7. Interestingly, we have also demonstrated that Six1 is capable of switching TGFβ from a tumor suppressor to a tumor promoter9, however the...may be the mechanism by which Six1 switches TGFβ signaling from a tumor suppressor to a tumor promoter. In addition we also sought to determine if...signaling from a tumor suppressor to a tumor promoter, this is known as the TGFβ paradox. Previous research has described the miR106b-25 cluster as

  1. Pinhole Micro-SPECT/CT for Noninvasive Monitoring and Quantitation of Oncolytic Virus Dispersion and Percent Infection in Solid Tumors

    PubMed Central

    Penheiter, Alan R.; Griesmann, Guy E.; Federspiel, Mark J.; Dingli, David; Russell, Stephen J.; Carlson, Stephanie K.

    2011-01-01

    The purpose of our study was to validate the ability of pinhole micro-single-photon emission computed tomography/computed tomography (SPECT/CT) to 1) accurately resolve the intratumoral dispersion pattern and 2) quantify the infection percentage in solid tumors of an oncolytic measles virus encoding the human sodium iodide symporter (MV-NIS). NIS RNA level and dispersion pattern were determined in control and MV-NIS infected BxPC-3 pancreatic tumor cells and mouse xenografts using quantitative, real-time, reverse transcriptase, polymerase chain reaction, autoradiography, and immunohistochemistry (IHC). Mice with BxPC-3 xenografts were imaged with 123I or 99TcO4 micro-SPECT/CT. Tumor dimensions and radionuclide localization were determined with imaging software. Linear regression and correlation analyses were performed to determine the relationship between tumor infection percentage and radionuclide uptake (% injected dose per gram) above background and a highly significant correlation was observed (r2 = 0.947). A detection threshold of 1.5-fold above the control tumor uptake (background) yielded a sensitivity of 2.7% MV-NIS infected tumor cells. We reliably resolved multiple distinct intratumoral zones of infection from noninfected regions. Pinhole micro-SPECT/CT imaging using the NIS reporter demonstrated precise localization and quantitation of oncolytic MV-NIS infection and can replace more time-consuming and expensive analyses (eg, autoradiography and IHC) that require animal sacrifice. PMID:21753796

  2. Molecular Analyses Reveal Inflammatory Mediators in the Solid Component and Cyst Fluid of Human Adamantinomatous Craniopharyngioma.

    PubMed

    Donson, Andrew M; Apps, John; Griesinger, Andrea M; Amani, Vladimir; Witt, Davis A; Anderson, Richard C E; Niazi, Toba N; Grant, Gerald; Souweidane, Mark; Johnston, James M; Jackson, Eric M; Kleinschmidt-DeMasters, Bette K; Handler, Michael H; Tan, Aik-Choon; Gore, Lia; Virasami, Alex; Gonzalez-Meljem, Jose Mario; Jacques, Thomas S; Martinez-Barbera, Juan Pedro; Foreman, Nicholas K; Hankinson, Todd C

    2017-09-01

    Pediatric adamantinomatous craniopharyngioma (ACP) is a highly solid and cystic tumor, often causing substantial damage to critical neuroendocrine structures such as the hypothalamus, pituitary gland, and optic apparatus. Paracrine signaling mechanisms driving tumor behavior have been hypothesized, with IL-6R overexpression identified as a potential therapeutic target. To identify potential novel therapies, we characterized inflammatory and immunomodulatory factors in ACP cyst fluid and solid tumor components. Cytometric bead analysis revealed a highly pro-inflammatory cytokine pattern in fluid from ACP compared to fluids from another cystic pediatric brain tumor, pilocytic astrocytoma. Cytokines and chemokines with particularly elevated concentrations in ACPs were IL-6, CXCL1 (GRO), CXCL8 (IL-8) and the immunosuppressive cytokine IL-10. These data were concordant with solid tumor compartment transcriptomic data from a larger cohort of ACPs, other pediatric brain tumors and normal brain. The majority of receptors for these cytokines and chemokines were also over-expressed in ACPs. In addition to IL-10, the established immunosuppressive factor IDO-1 was overexpressed by ACPs at the mRNA and protein levels. These data indicate that ACP cyst fluids and solid tumor components are characterized by an inflammatory cytokine and chemokine expression pattern. Further study regarding selective cytokine blockade may inform novel therapeutic interventions. © 2017 American Association of Neuropathologists, Inc. All rights reserved.

  3. Molecular profiling of tumor progression in head and neck cancer.

    PubMed

    Belbin, Thomas J; Singh, Bhuvanesh; Smith, Richard V; Socci, Nicholas D; Wreesmann, Volkert B; Sanchez-Carbayo, Marta; Masterson, Jessica; Patel, Snehal; Cordon-Cardo, Carlos; Prystowsky, Michael B; Childs, Geoffrey

    2005-01-01

    To assess gene expression changes associated with tumor progression in patients with squamous cell carcinoma of the oral cavity. A microarray containing 17 840 complementary DNA clones was used to measure gene expression changes associated with tumor progression in 9 patients with squamous cell carcinoma of the oral cavity. Samples were taken for analysis from the primary tumor, nodal metastasis, and "normal" mucosa from the patients' oral cavity. Tertiary care facility. Patients Nine patients with stage III or stage IV untreated oral cavity squamous cell carcinoma. Our analysis to categorize genes based on their expression patterns has identified 140 genes that consistently increased in expression during progression from normal tissue to invasive tumor and subsequently to metastatic node (in at least 4 of the 9 cases studied). A similar list of 94 genes has been identified that decreased in expression during tumor progression and metastasis. We validated this gene discovery approach by selecting moesin (a member of the ezrin/radixin/moesin [ERM] family of cytoskeletal proteins) and one of the genes that consistently increased in expression during tumor progression for subsequent immunohistochemical analysis using a head and neck squamous cell carcinoma tissue array. A distinct pattern of gene expression, with progressive up- or down-regulation of expression, is found during the progression from histologically normal tissue to primary carcinoma and to nodal metastasis.

  4. KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.

    PubMed

    Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad

    2012-01-01

    Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.

  5. Drosophila TIEG Is a Modulator of Different Signalling Pathways Involved in Wing Patterning and Cell Proliferation

    PubMed Central

    Rodriguez, Isabel

    2011-01-01

    Acquisition of a final shape and size during organ development requires a regulated program of growth and patterning controlled by a complex genetic network of signalling molecules that must be coordinated to provide positional information to each cell within the corresponding organ or tissue. The mechanism by which all these signals are coordinated to yield a final response is not well understood. Here, I have characterized the Drosophila ortholog of the human TGF-β Inducible Early Gene 1 (dTIEG). TIEG are zinc-finger proteins that belong to the Krüppel-like factor (KLF) family and were initially identified in human osteoblasts and pancreatic tumor cells for the ability to enhance TGF-β response. Using the developing wing of Drosophila as “in vivo” model, the dTIEG function has been studied in the control of cell proliferation and patterning. These results show that dTIEG can modulate Dpp signalling. Furthermore, dTIEG also regulates the activity of JAK/STAT pathway suggesting a conserved role of TIEG proteins as positive regulators of TGF-β signalling and as mediators of the crosstalk between signalling pathways acting in a same cellular context. PMID:21494610

  6. Diffuse Staining for Activated NOTCH1 Correlates With NOTCH1 Mutation Status and Is Associated With Worse Outcome in Adenoid Cystic Carcinoma.

    PubMed

    Sajed, Dipti P; Faquin, William C; Carey, Chris; Severson, Eric A; H Afrogheh, Amir; A Johnson, Carl; Blacklow, Stephen C; Chau, Nicole G; Lin, Derrick T; Krane, Jeffrey F; Jo, Vickie Y; Garcia, Joaquín J; Sholl, Lynette M; Aster, Jon C

    2017-11-01

    NOTCH1 is frequently mutated in adenoid cystic carcinoma (ACC). To test the idea that immunohistochemical (IHC) staining can identify ACCs with NOTCH1 mutations, we performed IHC for activated NOTCH1 (NICD1) in 197 cases diagnosed as ACC from 173 patients. NICD1 staining was positive in 194 cases (98%) in 2 major patterns: subset positivity, which correlated with tubular/cribriform histology; and diffuse positivity, which correlated with a solid histology. To determine the relationship between NICD1 staining and NOTCH1 mutational status, targeted exome sequencing data were obtained on 14 diffusely NICD1-positive ACC specimens from 11 patients and 15 subset NICD1-positive ACC specimens from 15 patients. This revealed NOTCH1 gain-of-function mutations in 11 of 14 diffusely NICD1-positive ACC specimens, whereas all subset-positive tumors had wild-type NOTCH1 alleles. Notably, tumors with diffuse NICD1 positivity were associated with significantly worse outcomes (P=0.003). To determine whether NOTCH1 activation is unique among tumors included in the differential diagnosis with ACC, we performed NICD1 IHC on a cohort of diverse salivary gland and head and neck tumors. High fractions of each of these tumor types were positive for NICD1 in a subset of cells, particularly in basaloid squamous cell carcinomas; however, sequencing of basaloid squamous cell carcinomas failed to identify NOTCH1 mutations. These findings indicate that diffuse NICD1 positivity in ACC correlates with solid growth pattern, the presence of NOTCH1 gain-of-function mutations, and unfavorable outcome, and suggest that staining for NICD1 can be helpful in distinguishing ACC with solid growth patterns from other salivary gland and head and neck tumors.

  7. A case report of CIC-rearranged undifferentiated small round cell sarcoma in the cerebrum.

    PubMed

    Ito, Mayumi; Ishikawa, Misawo; Kitajima, Masateru; Narita, Jun; Hattori, Shinya; Endo, Otone; Goto, Keisuke

    2016-10-01

    CIC-rearranged undifferentiated small round cell sarcoma (CIC-rearranged USRCS) is a recently established type of Ewing-like small round cell sarcomas, characterized by CIC gene rearrangement, most commonly CIC-DUX4 fusion. This report presents the second case of CIC-rearranged USRCS arising primarily in the cerebrum. A 64-year-old otherwise healthy woman presented with a 1 × 1 cm sized hemorrhagic subcortical tumor in the left temporo-parietal lobe. The tumor repeatedly recurred, and the patient underwent three surgeries, chemotherapy with doxorubicin and ifosfamide, and radiotherapy, as well as gamma knife surgery. Systemic examination revealed no other extracranial masses. Imprint cytology revealed small to moderate-sized round-to-ovoid tumor cells with mild pleomorphism and variations in size and shape. The nuclei contained finely granular chromatin, and some had easily-recognizable nucleoli. The tumor exhibited a mainly cytoplasmic pattern of CD99 immunostaining, rather than a diffuse membranous pattern. The tumor also exhibited diffuse positivity for calretinin and p16, as well as partial positivity for WT1 (nuclear and cytoplasmic staining pattern) and D2-40. FISH assessment showed CIC split signals. In conclusion, CIC-rearranged USRCSs can occur primarily in the cerebrum. It would be impossible to diagnose them through cytology alone, but cytology would be useful to rule out other small round cell brain tumors including gliomas, lymphomas, carcinomas, and germinoma. Immunohistochemical analysis including tests for CD99, calretinin, and WT1 would help to suggest CIC-rearranged USRCSs and distinguish them from Ewing sarcomas. Additionally, immunohistochemistry for p16 might be useful in the diagnosis. Diagn. Cytopathol. 2016;44:828-832. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Inter-rater reliability of surgical reviews for AREN03B2: a COG renal tumor committee study.

    PubMed

    Hamilton, Thomas E; Barnhart, Douglas; Gow, Kenneth; Ferrer, Fernando; Kandel, Jessica; Glick, Richard; Dasgupta, Roshni; Naranjo, Arlene; He, Ying; Gratias, Eric; Geller, James; Mullen, Elizabeth; Ehrlich, Peter

    2014-01-01

    The Children's Oncology Group (COG) renal tumor study (AREN03B2) requires real-time central review of radiology, pathology, and the surgical procedure to determine appropriate risk-based therapy. The purpose of this study was to determine the inter-rater reliability of the surgical reviews. Of the first 3200 enrolled AREN03B2 patients, a sample of 100 enriched for blood vessel involvement, spill, rupture, and lymph node involvement was selected for analysis. The surgical assessment was then performed independently by two blinded surgical reviewers and compared to the original assessment, which had been completed by another of the committee surgeons. Variables assessed included surgeon-determined local tumor stage, overall disease stage, type of renal procedure performed, presence of tumor rupture, occurrence of intraoperative tumor spill, blood vessel involvement, presence of peritoneal implants, and interpretation of residual disease. Inter-rater reliability was measured using the Fleiss' Kappa statistic two-sided hypothesis tests (Kappa, p-value). Local tumor stage correlated in all 3 reviews except in one case (Kappa=0.9775, p<0.001). Similarly, overall disease stage had excellent correlation (0.9422, p<0.001). There was strong correlation for type of renal procedure (0.8357, p<0.001), presence of tumor rupture (0.6858, p<0.001), intraoperative tumor spill (0.6493, p<0.001), and blood vessel involvement (0.6470, p<0.001). Variables that had lower correlation were determination of the presence of peritoneal implants (0.2753, p<0.001) and interpretation of residual disease status (0.5310, p<0.001). The inter-rater reliability of the surgical review is high based on the great consistency in the 3 independent review results. This analysis provides validation and establishes precedent for real-time central surgical review to determine treatment assignment in a risk-based stratagem for multimodal cancer therapy. © 2014.

  9. Composite Resection of Tumors of the Rostral Maxilla and Dorsolateral Muzzle Utilizing an Upper Lip-Sparing, Combined Approach in Dogs.

    PubMed

    Thomson, Amy E; Soukup, Jason W

    2018-01-01

    Tumors of the rostral maxilla that involve both the oral mucosa and the dermis or subdermis of the dorsolateral muzzle provide unique challenges for the oromaxillofacial surgeon. Traditionally described approaches to such lesions may involve an intraoral incision that extends and involves the upper lip to envelope the involved dermis of the dorsolateral muzzle. However, such an approach unnecessarily resects upper lip tissue resulting in a large defect that likely requires advanced skin flaps or grafts for reconstruction. Such flaps are technically challenging and introduce potential for significance postoperative complications. In this article, we provide a detailed description a combined intra- and extraoral approach that allows for composite resection of tumors of the rostral maxilla that also involve the dorsolateral muzzle. The described technique allows for excellent intraoperative visualization and provides a superior cosmetic outcome that minimizes postoperative complications. In addition, we describe our experience utilizing the technique in three clinical cases.

  10. Composite Resection of Tumors of the Rostral Maxilla and Dorsolateral Muzzle Utilizing an Upper Lip-Sparing, Combined Approach in Dogs

    PubMed Central

    Thomson, Amy E.; Soukup, Jason W.

    2018-01-01

    Tumors of the rostral maxilla that involve both the oral mucosa and the dermis or subdermis of the dorsolateral muzzle provide unique challenges for the oromaxillofacial surgeon. Traditionally described approaches to such lesions may involve an intraoral incision that extends and involves the upper lip to envelope the involved dermis of the dorsolateral muzzle. However, such an approach unnecessarily resects upper lip tissue resulting in a large defect that likely requires advanced skin flaps or grafts for reconstruction. Such flaps are technically challenging and introduce potential for significance postoperative complications. In this article, we provide a detailed description a combined intra- and extraoral approach that allows for composite resection of tumors of the rostral maxilla that also involve the dorsolateral muzzle. The described technique allows for excellent intraoperative visualization and provides a superior cosmetic outcome that minimizes postoperative complications. In addition, we describe our experience utilizing the technique in three clinical cases. PMID:29616231

  11. Preoperative mapping of the supplementary motor area in patients harboring tumors in the medial frontal lobe.

    PubMed

    Nelson, Lindsey; Lapsiwala, Samir; Haughton, Victor M; Noyes, Jane; Sadrzadeh, Amir H; Moritz, Chad H; Meyerand, M Elizabeth; Badie, Behnam

    2002-11-01

    Injury to the supplementary motor area (SMA) is thought to be responsible for transient motor and speech deficits following resection of tumors involving the medial frontal lobe. Because direct intraoperative localization of SMA is difficult, the authors hypothesized that functional magnetic resonance (fMR) imaging might be useful in predicting the risk of postoperative deficits in patients who undergo resection of tumors in this region. Twelve patients who had undergone fMR imaging mapping while performing speech and motor tasks prior to excision of their tumor, that is, based on anatomical landmarks involving the SMA, were included in this study. The distance between the edge of the tumor and the center of SMA activation was measured and was correlated with the risk of incurring postoperative neurological deficits. In every patient, SMA activation was noted in the superior frontal gyrus on preoperative fMR imaging. Two speech and two motor deficits typical of SMA injury were observed in three of the 12 patients. The two speech deficits occurred in patients with tumors involving the dominant hemisphere, whereas one of the motor deficits occurred in a patient with a tumor in the nondominant hemisphere. The risk of developing a postoperative speech or motor deficit was 100% when the distance between the SMA and the tumor was 5 mm or less. When the distance between SMA activation and the lesion was greater than 5 mm, the risk of developing a motor or a speech deficit was 0% (p = 0.0007). Early data from this study indicated that fMR imaging might be useful in localizing the SMA and in determining the risk of postoperative deficits in patients who undergo resection of tumors located in the medial frontal lobe.

  12. Miscellaneous rare paratesticular tumors.

    PubMed

    Henley, J D; Ferry, J; Ulbright, T M

    2000-11-01

    A few uncommon but distinctive tumors may preferentially involve the paratestis. The 3 unusual tumors that represent the focus of this discussion are the ovarian-type epithelial tumors (OTET), the desmoplastic small round cell tumor (DSRCT), and the melanotic neuroectodermal tumor of infancy (MNTI). The OTETs are testicular homologues of their more common namesake counterparts that arise in the ovary. Most frequent of these are serous tumors of borderline malignancy, with fewer cases of serous carcinomas or other forms of mullerian differentiation. DSRCT is an increasingly recognized, aggressive, "small blue cell" neoplasm with distinctive clinical and pathologic features. These polyphenotypic tumors characteristically, but not invariably, arise in intimate association with the serosal membrane of the peritoneal cavity and harbor a signature translocation-t(11;22)(p13,q12). In the paratestis they often involve the surface of the epididymis. The MNTI is an enigmatic, histologically distinctive, low-grade neoplasm occasionally encountered in the epididymis. Recognition of its features is essential to avoid misdiagnosis as a more aggressive "small blue cell" neoplasm and consequent therapeutic mismanagement. Primary hematopoietic tumors of the paratesticular structures are rare. There appears to be a tendency for young men to have low-grade lymphomas with an indolent course and older patients to develop higher-grade tumors. Plasmacytoma and granulocytic sarcoma of the paratestis are even more rare and are often susceptible to misinterpretation. Finally, metastatic tumors and a variety of other very rare neoplasms are discussed.

  13. Integrative genome-wide analysis of the determinants of RNA splicing in kidney renal clear cell carcinoma.

    PubMed

    Lehmann, Kjong-Van; Kahles, André; Kandoth, Cyriac; Lee, William; Schultz, Nikolaus; Stegle, Oliver; Rätsch, Gunnar

    2015-01-01

    We present a genome-wide analysis of splicing patterns of 282 kidney renal clear cell carcinoma patients in which we integrate data from whole-exome sequencing of tumor and normal samples, RNA-seq and copy number variation. We proposed a scoring mechanism to compare splicing patterns in tumor samples to normal samples in order to rank and detect tumor-specific isoforms that have a potential for new biomarkers. We identified a subset of genes that show introns only observable in tumor but not in normal samples, ENCODE and GEUVADIS samples. In order to improve our understanding of the underlying genetic mechanisms of splicing variation we performed a large-scale association analysis to find links between somatic or germline variants with alternative splicing events. We identified 915 cis- and trans-splicing quantitative trait loci (sQTL) associated with changes in splicing patterns. Some of these sQTL have previously been associated with being susceptibility loci for cancer and other diseases. Our analysis also allowed us to identify the function of several COSMIC variants showing significant association with changes in alternative splicing. This demonstrates the potential significance of variants affecting alternative splicing events and yields insights into the mechanisms related to an array of disease phenotypes.

  14. Time-Adjusted Internal Target Volume: A Novel Approach Focusing on Heterogeneity of Tumor Motion Based on 4-Dimensional Computed Tomography Imaging for Radiation Therapy Planning of Lung Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishibuchi, Ikuno; Department of Radiation Oncology, Hiroshima Prefectural Hospital, Hiroshima; Kimura, Tomoki, E-mail: tkkimura@hiroshima-u.ac.jp

    2014-08-01

    Purpose: To consider nonuniform tumor motion within the internal target volume (ITV) by defining time-adjusted ITV (TTV), a volume designed to include heterogeneity of tumor existence on the basis of 4-dimensional computed tomography (4D-CT). Methods and Materials: We evaluated 30 lung cancer patients. Breath-hold CT (BH-CT) and free-breathing 4D-CT scans were acquired for each patient. The tumors were manually delineated using a lung CT window setting (window, 1600 HU; level, −300 HU). Tumor in BH-CT images was defined as gross tumor volume (GTV), and the sum of tumors in 4D-CT images was defined as ITV-4D. The TTV images were generatedmore » from the 4D-CT datasets, and the tumor existence probability within ITV-4D was calculated. We calculated the TTV{sub 80} value, which is the percentage of the volume with a tumor existence probability that exceeded 80% on ITV-4D. Several factors that affected the TTV{sub 80} value, such as the ITV-4D/GTV ratio or tumor centroid deviation, were evaluated. Results: Time-adjusted ITV images were acquired for all patients, and tumor respiratory motion heterogeneity was visualized. The median (range) ITV-4D/GTV ratio and median tumor centroid deviation were 1.6 (1.0-4.1) and 6.3 mm (0.1-30.3 mm), respectively. The median TTV{sub 80} value was 43.3% (2.9-98.7%). Strong correlations were observed between the TTV{sub 80} value and the ITV-4D/GTV ratio (R=−0.71) and tumor centroid deviation (R=−0.72). The TTV images revealed the tumor motion pattern features within ITV. Conclusions: The TTV images reflected nonuniform tumor motion, and they revealed the tumor motion pattern features, suggesting that the TTV concept may facilitate various aspects of radiation therapy planning of lung cancer while incorporating respiratory motion in the future.« less

  15. Atypical Findings on Cervicovaginal Smears Correlate with Cervical Involvement by Malignant Mixed Müllerian Tumors of the Uterus.

    PubMed

    Hanley, Krisztina Z; Oprea-Ilies, Gabriela; Ormenisan, Claudia; Seydafkan, Shabnam; Mosunjac, Marina B

    2015-01-01

    A malignant mixed müllerian tumor (MMMT) is a high-grade neoplasm commonly arising from the uterus. Patients present with bleeding and a mass protruding from the cervix. This study was designed to correlate Papanicolaou (Pap) smear findings with histological findings in women diagnosed with MMMT. Women diagnosed with MMMT were identified. Preoperative Pap tests were correlated with histological findings. Statistical analysis was performed to assess associations between abnormal Pap tests and histological findings. Forty patients with MMMT were included in the study. Age ranged from 37-85 years and tumor size ranged from 1.2 to 21 cm. In presurgical Pap tests (4 conventional and 36 liquid based), 11 smears (27.5%) were diagnosed as negative, 5 (12.5%) as atypical squamous cells of undetermined significance, 6 (15%) as atypical glandular cells, 16 (40%) as malignant and 2 (5%) as high-grade squamous intraepithelial lesion. Malignant cells detected on Pap smears showed a strong correlation with endocervical involvement by MMMT (p = 0.002). Larger tumors were more likely to involve the cervix (p = 0.0115). The Pap test can predict cervical involvement by MMMT. On Pap smears, MMMT cells showed no correlation with other adverse histological features (lymphovascular invasion, myoinvasion or adnexal involvement). © 2015 S. Karger AG, Basel.

  16. Epigenetic regulation of cancer biology and anti-tumor immunity by EZH2.

    PubMed

    Christofides, Anthos; Karantanos, Theodoros; Bardhan, Kankana; Boussiotis, Vassiliki A

    2016-12-20

    Polycomb group proteins regulate chromatin structure and have an important regulatory role on gene expression in various cell types. Two polycomb group complexes (Polycomb repressive complex 1 (PRC1) and 2 (PRC2)) have been identified in mammalian cells. Both PRC1 and PRC2 compact chromatin, and also catalyze histone modifications. PRC1 mediates monoubiquitination of histone H2A, whereas PRC2 catalyzes methylation of histone H3 on lysine 27. These alterations of histones can lead to altered gene expression patterns by regulating chromatin structure. Numerous studies have highlighted the role of the PRC2 catalytic component enhancer of zeste homolog 2 (EZH2) in neoplastic development and progression, and EZH2 mutations have been identified in various malignancies. Through modulating the expression of critical genes, EZH2 is actively involved in fundamental cellular processes such as cell cycle progression, cell proliferation, differentiation and apoptosis. In addition to cancer cells, EZH2 also has a decisive role in the differentiation and function of T effector and T regulatory cells. In this review we summarize the recent progress regarding the role of EZH2 in human malignancies, highlight the molecular mechanisms by which EZH2 aberrations promote the pathogenesis of cancer, and discuss the anti-tumor effects of EZH2 targeting via activating direct anti-cancer mechanisms and anti-tumor immunity.

  17. Epigenetic regulation of cancer biology and anti-tumor immunity by EZH2

    PubMed Central

    Bardhan, Kankana; Boussiotis, Vassiliki A.

    2016-01-01

    Polycomb group proteins regulate chromatin structure and have an important regulatory role on gene expression in various cell types. Two polycomb group complexes (Polycomb repressive complex 1 (PRC1) and 2 (PRC2)) have been identified in mammalian cells. Both PRC1 and PRC2 compact chromatin, and also catalyze histone modifications. PRC1 mediates monoubiquitination of histone H2A, whereas PRC2 catalyzes methylation of histone H3 on lysine 27. These alterations of histones can lead to altered gene expression patterns by regulating chromatin structure. Numerous studies have highlighted the role of the PRC2 catalytic component enhancer of zeste homolog 2 (EZH2) in neoplastic development and progression, and EZH2 mutations have been identified in various malignancies. Through modulating the expression of critical genes, EZH2 is actively involved in fundamental cellular processes such as cell cycle progression, cell proliferation, differentiation and apoptosis. In addition to cancer cells, EZH2 also has a decisive role in the differentiation and function of T effector and T regulatory cells. In this review we summarize the recent progress regarding the role of EZH2 in human malignancies, highlight the molecular mechanisms by which EZH2 aberrations promote the pathogenesis of cancer, and discuss the anti-tumor effects of EZH2 targeting via activating direct anti-cancer mechanisms and anti-tumor immunity. PMID:27793053

  18. Epigenome Aberrations: Emerging Driving Factors of the Clear Cell Renal Cell Carcinoma

    PubMed Central

    Mehdi, Ali; Riazalhosseini, Yasser

    2017-01-01

    Clear cell renal cell carcinoma (ccRCC), the most common form of Kidney cancer, is characterized by frequent mutations of the von Hippel-Lindau (VHL) tumor suppressor gene in ~85% of sporadic cases. Loss of pVHL function affects multiple cellular processes, among which the activation of hypoxia inducible factor (HIF) pathway is the best-known function. Constitutive activation of HIF signaling in turn activates hundreds of genes involved in numerous oncogenic pathways, which contribute to the development or progression of ccRCC. Although VHL mutations are considered as drivers of ccRCC, they are not sufficient to cause the disease. Recent genome-wide sequencing studies of ccRCC have revealed that mutations of genes coding for epigenome modifiers and chromatin remodelers, including PBRM1, SETD2 and BAP1, are the most common somatic genetic abnormalities after VHL mutations in these tumors. Moreover, recent research has shed light on the extent of abnormal epigenome alterations in ccRCC tumors, including aberrant DNA methylation patterns, abnormal histone modifications and deregulated expression of non-coding RNAs. In this review, we discuss the epigenetic modifiers that are commonly mutated in ccRCC, and our growing knowledge of the cellular processes that are impacted by them. Furthermore, we explore new avenues for developing therapeutic approaches based on our knowledge of epigenome aberrations of ccRCC. PMID:28812986

  19. Epigenome Aberrations: Emerging Driving Factors of the Clear Cell Renal Cell Carcinoma.

    PubMed

    Mehdi, Ali; Riazalhosseini, Yasser

    2017-08-16

    Clear cell renal cell carcinoma (ccRCC), the most common form of Kidney cancer, is characterized by frequent mutations of the von Hippel-Lindau ( VHL ) tumor suppressor gene in ~85% of sporadic cases. Loss of pVHL function affects multiple cellular processes, among which the activation of hypoxia inducible factor (HIF) pathway is the best-known function. Constitutive activation of HIF signaling in turn activates hundreds of genes involved in numerous oncogenic pathways, which contribute to the development or progression of ccRCC. Although VHL mutations are considered as drivers of ccRCC, they are not sufficient to cause the disease. Recent genome-wide sequencing studies of ccRCC have revealed that mutations of genes coding for epigenome modifiers and chromatin remodelers, including PBRM1 , SETD2 and BAP1 , are the most common somatic genetic abnormalities after VHL mutations in these tumors. Moreover, recent research has shed light on the extent of abnormal epigenome alterations in ccRCC tumors, including aberrant DNA methylation patterns, abnormal histone modifications and deregulated expression of non-coding RNAs. In this review, we discuss the epigenetic modifiers that are commonly mutated in ccRCC, and our growing knowledge of the cellular processes that are impacted by them. Furthermore, we explore new avenues for developing therapeutic approaches based on our knowledge of epigenome aberrations of ccRCC.

  20. Carcinoma of the floor of the mouth: a 20-year experience.

    PubMed

    Aygun, C; Salazar, O M; Sewchand, W; Amornmarn, R; Prempree, T

    1984-05-01

    From 1955 to 1975, 116 patients with squamous cell carcinoma of the floor of the mouth were primarily treated by irradiation in the Department of Radiation Oncology, University of Maryland at Baltimore. Of these, 93 evaluable patients yielded loco-regional control rates of 83, 85, 42 and 21% for Stages I-IV, respectively. A palisading technique of radium needle implants was used, either alone or combined with external beam therapy, for early tumors (Stages I-II). Similar control rates were achieved by these two techniques: 13/14 for interstitial irradiation alone and 16/24 for combined interstitial and external irradiation. In selected early cases (Stages I-II), errors in staging were minimized by the systematic use of a needle biopsy of the submaxillary triangle for suspicious submaxillary swellings. Patients with early lesions and truly negative nodes (N0) only received irradiation to the primary tumor bed. No subsequent nodal neck failures have occurred in 13 of such patients. The overall complication rate for the entire series was 17% with only 8 patients requiring surgery. No differences in complication rates were found among the treatment modalities employed. The distribution of lymph nodal involvement by anatomical level, correlation of histological differentiation or tumor aggressiveness at presentation, the dosimetric analysis of the palisading interstitial technique, the spread and failure patterns and other observations are discussed.

Top